#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARMC5	79798	hgsc.bcm.edu	37	16	31471168	31471169	+	Frame_Shift_Ins	INS	-	-	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr16:31471168_31471169insC	ENST00000563544.1	+	2	869_870	c.323_324insC	c.(322-327)ggccccfs	p.GP108fs	ARMC5_ENST00000538189.1_Frame_Shift_Ins_p.GP140fs|ARMC5_ENST00000408912.3_Frame_Shift_Ins_p.GP203fs|ARMC5_ENST00000268314.4_Frame_Shift_Ins_p.GP108fs|ARMC5_ENST00000412665.2_5'Flank|ARMC5_ENST00000457010.2_Frame_Shift_Ins_p.GP108fs|RP11-452L6.5_ENST00000564629.1_RNA			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	108										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						cccgcgtcgggccccgcccccT	0.748																																					p.G108fs		.											.	.	.	0			c.323_324insC						.																																			SO:0001589	frameshift_variant	79798	exon1			CGTCGGGCCCCGC	AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.327dupC	16.37:g.31471172_31471172dupC	ENSP00000456877:p.Gly108fs	43	0		36	10	NM_024742	Q86WM9|Q9H7P8|Q9H925	Frame_Shift_Ins	INS	ENST00000563544.1	37	CCDS45472.1																																																																																			.		0.748	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432847.1	NM_024742	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	9068625	9068625	+	Frame_Shift_Del	DEL	C	C	-	rs200874005		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr19:9068625delC	ENST00000397910.4	-	3	19024	c.18821delG	c.(18820-18822)cgtfs	p.R6274fs		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6276	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.R6274L(2)|p.R1907L(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTGAGGTGAACGAGTCACAGG	0.483																																					p.R6274fs		.											.	.	.	3	Substitution - Missense(3)	lung(3)	c.18822delT						.						170.0	163.0	166.0					19																	9068625		2030	4172	6202	SO:0001589	frameshift_variant	94025	exon3			GGTGAACGAGTCA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.18821delG	19.37:g.9068625delC	ENSP00000381008:p.Arg6274fs	48	0		43	16	NM_024690	Q6ZQW5|Q96RK2	Frame_Shift_Del	DEL	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
C3	718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	6678260	6678260	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr19:6678260T>C	ENST00000245907.6	-	40	4845	c.4753A>G	c.(4753-4755)Atc>Gtc	p.I1585V	C3_ENST00000599668.1_5'UTR	NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1585	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	ATGGGGCTGATGAACGTGCGC	0.592																																					p.I1585V		.											.	.	.	0			c.A4753G						.						88.0	68.0	75.0					19																	6678260		2203	4300	6503	SO:0001583	missense	718	exon40			GGCTGATGAACGT	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4753A>G	19.37:g.6678260T>C	ENSP00000245907:p.Ile1585Val	36	0		18	8	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	T	12.30	1.897148	0.33535	.	.	ENSG00000125730	ENST00000245907	T	0.19669	2.13	5.24	5.24	0.73138	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	1.336540	0.05531	U	0.563937	T	0.34424	0.0897	L	0.59436	1.845	0.32119	N	0.588317	B;P	0.36412	0.352;0.552	P;B	0.45474	0.482;0.388	T	0.16217	-1.0410	10	0.20519	T	0.43	.	13.112	0.59278	0.0:0.0:0.0:1.0	.	1585;1020	P01024;B4E216	CO3_HUMAN;.	V	1585	ENSP00000245907:I1585V	ENSP00000245907:I1585V	I	-	1	0	C3	6629260	1.000000	0.71417	1.000000	0.80357	0.003000	0.03518	2.438000	0.44837	1.993000	0.58246	0.373000	0.22412	ATC	.		0.592	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
OR52E8	390079	hgsc.bcm.edu	37	11	5878458	5878458	+	Silent	SNP	G	G	A	rs549924845	byFrequency	TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:5878458G>A	ENST00000537935.1	-	1	506	c.475C>T	c.(475-477)Ctg>Ttg	p.L159L	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCATGTACAGGCTCCTCAGG	0.507													G|||	10	0.00199681	0.0068	0.0	5008	,	,		18808	0.0		0.0	False		,,,				2504	0.001				p.L159L		.											OR52E8,NS,carcinoma,0,1	OR52E8	0	0			c.C475T						.						135.0	147.0	143.0					11																	5878458		2154	4296	6450	SO:0001819	synonymous_variant	390079	exon1			TGTACAGGCTCCT	BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.475C>T	11.37:g.5878458G>A		44	0		17	2	NM_001005168	B9EH38	Silent	SNP	ENST00000537935.1	37	CCDS31400.1																																																																																			.		0.507	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401145.1	NM_001005168	
TLN2	83660	hgsc.bcm.edu	37	15	62939540	62939540	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr15:62939540C>T	ENST00000561311.1	+	3	261	c.31C>T	c.(31-33)Cgc>Tgc	p.R11C	TLN2_ENST00000306829.6_Missense_Mutation_p.R11C|RP11-625H11.1_ENST00000558940.1_5'Flank|RP11-625H11.1_ENST00000560347.1_5'Flank			Q9Y4G6	TLN2_HUMAN	talin 2	11					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GATTTGTGTGCGCCACTGCAA	0.488																																					p.R11C		.											TLN2,bladder,carcinoma,0,1	TLN2	0	0			c.C31T						.						169.0	145.0	153.0					15																	62939540		2203	4300	6503	SO:0001583	missense	83660	exon1			TGTGTGCGCCACT	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.31C>T	15.37:g.62939540C>T	ENSP00000453508:p.Arg11Cys	47	0		27	3	NM_015059	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	37	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618480	0.87359	.	.	ENSG00000171914	ENST00000306829	T	0.68331	-0.32	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.64416	0.2596	N	0.08118	0	0.80722	D	1	D	0.71674	0.998	P	0.58266	0.836	T	0.71368	-0.4614	10	0.56958	D	0.05	-13.1671	18.7456	0.91791	0.0:1.0:0.0:0.0	.	11	Q9Y4G6	TLN2_HUMAN	C	11	ENSP00000303476:R11C	ENSP00000303476:R11C	R	+	1	0	TLN2	60726832	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.606000	0.67641	2.748000	0.94277	0.655000	0.94253	CGC	.		0.488	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
LMAN2L	81562	hgsc.bcm.edu	37	2	97370411	97370411	+	IGR	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:97370411T>C	ENST00000264963.4	-	0	2397				FER1L5_ENST00000457909.1_RNA	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like						ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						TCCCAGAACTTCCAGCCCCAG	0.507																																					p.L2088L		.											FER1L5,colon,carcinoma,0,1	FER1L5	0	0			c.T6264C						.						62.0	62.0	62.0					2																	97370411		1868	4093	5961	SO:0001628	intergenic_variant	90342	exon52			AGAACTTCCAGCC	AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453		2.37:g.97370411T>C		37	0		36	2	NM_001113382	B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Silent	SNP	ENST00000264963.4	37	CCDS2023.1																																																																																			.		0.507	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252844.1	NM_030805	
CADM1	23705	hgsc.bcm.edu	37	11	115049489	115049489	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:115049489C>A	ENST00000452722.3	-	9	1105	c.1085G>T	c.(1084-1086)cGa>cTa	p.R362L	CADM1_ENST00000536727.1_Missense_Mutation_p.R363L|CADM1_ENST00000331581.6_Missense_Mutation_p.R391L|CADM1_ENST00000542447.2_Missense_Mutation_p.R334L|CADM1_ENST00000537058.1_Missense_Mutation_p.R373L|CADM1_ENST00000537140.1_5'UTR	NM_014333.3	NP_055148.3			cell adhesion molecule 1									p.R362Q(1)		cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		TTCACCTGCTCGGGAATCTGT	0.552																																					p.R362L		.											CADM1,NS,carcinoma,0,1	CADM1	0	1	Substitution - Missense(1)	lung(1)	c.G1085T						.						83.0	75.0	78.0					11																	115049489		2201	4296	6497	SO:0001583	missense	23705	exon9			CCTGCTCGGGAAT	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1085G>T	11.37:g.115049489C>A	ENSP00000395359:p.Arg362Leu	47	0		25	2	NM_014333		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121613	0.37436	.	.	ENSG00000182985	ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000541325	T;T;T;T;T	0.72394	-0.65;-0.05;0.2;-0.09;-0.08	5.0	5.0	0.66597	.	0.201138	0.32593	N	0.005891	T	0.72170	0.3427	N	0.21097	0.63	0.52099	D	0.999945	D;D;P;P	0.59357	0.985;0.967;0.838;0.918	P;P;B;B	0.60236	0.871;0.549;0.416;0.353	T	0.69213	-0.5204	10	0.26408	T	0.33	.	18.4828	0.90818	0.0:1.0:0.0:0.0	.	373;335;362;334	F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.;.;CADM1_HUMAN;.	L	334;362;373;363;293;391;47	ENSP00000439176:R334L;ENSP00000395359:R362L;ENSP00000439817:R373L;ENSP00000440322:R363L;ENSP00000329797:R391L	ENSP00000329797:R391L	R	-	2	0	CADM1	114554699	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	4.500000	0.60387	2.617000	0.88574	0.655000	0.94253	CGA	.		0.552	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
SEC1P	653677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	49183517	49183517	+	RNA	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr19:49183517C>T	ENST00000430145.2	+	0	604					NR_004401.2				secretory blood group 1, pseudogene																		CCACGCTGTACGCCCTGGCCA	0.667																																					.		.											.	.	.	0			.						.																																					653677	.			GCTGTACGCCCTG			19q13.33	2012-07-04			ENSG00000232871	ENSG00000232871			44149	pseudogene	pseudogene							Standard	NR_004401		Approved		uc010xzv.2		OTTHUMG00000154617		19.37:g.49183517C>T		75	0		43	19	.		RNA	SNP	ENST00000430145.2	37																																																																																				.		0.667	SEC1P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000336334.1	NR_004401	
VPS8	23355	hgsc.bcm.edu	37	3	184682319	184682319	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:184682319C>A	ENST00000437079.3	+	38	3418	c.3247C>A	c.(3247-3249)Cat>Aat	p.H1083N	VPS8_ENST00000446204.2_Missense_Mutation_p.H991N|VPS8_ENST00000436792.2_Missense_Mutation_p.H1081N|VPS8_ENST00000287546.4_Missense_Mutation_p.H1083N	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1083							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AGGAGATATTCATGGTGCCTT	0.294																																					p.H1083N		.											VPS8,colon,carcinoma,0,1	VPS8	0	0			c.C3247A						.						87.0	87.0	87.0					3																	184682319		1702	3709	5411	SO:0001583	missense	23355	exon37			GATATTCATGGTG	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3247C>A	3.37:g.184682319C>A	ENSP00000397879:p.His1083Asn	77	0		44	2	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789391	0.70337	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	5.8	5.8	0.92144	Quinonprotein alcohol dehydrogenase-like (1);	0.277928	0.44902	D	0.000408	T	0.24736	0.0600	L	0.54323	1.7	0.36589	D	0.873981	B;P;B	0.42337	0.255;0.776;0.372	B;P;B	0.46362	0.045;0.514;0.15	T	0.05835	-1.0861	10	0.19590	T	0.45	-16.1268	16.9805	0.86326	0.0:1.0:0.0:0.0	.	1083;991;1081	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	N	1083;1083;1081;991	ENSP00000287546:H1083N;ENSP00000397879:H1083N;ENSP00000404704:H1081N;ENSP00000405483:H991N	ENSP00000287546:H1083N	H	+	1	0	VPS8	186165013	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	5.343000	0.65976	2.751000	0.94390	0.650000	0.86243	CAT	.		0.294	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
LINC00710	254312	hgsc.bcm.edu	37	10	10988052	10988052	+	RNA	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr10:10988052G>A	ENST00000428520.2	-	0	363					NR_015413.1				long intergenic non-protein coding RNA 710																		GGTGGGGATGGCATTCCTGAA	0.522																																					.		.											.	.	.	0			.						.																																					254312	.			GGGATGGCATTCC			10p14	2012-12-05			ENSG00000229240	ENSG00000229240		"""Long non-coding RNAs"""	27386	non-coding RNA	RNA, long non-coding							Standard	NR_015413		Approved		uc009xiu.3		OTTHUMG00000017661		10.37:g.10988052G>A		90	0		79	4	.		RNA	SNP	ENST00000428520.2	37																																																																																				.		0.522	LINC00710-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000046746.3	NR_015413	
HLA-DRA	3122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32410347	32410347	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:32410347C>T	ENST00000374982.5	+	2	278	c.205C>T	c.(205-207)Cgg>Tgg	p.R69W	HLA-DRA_ENST00000395388.2_Missense_Mutation_p.R69W			P01903	DRA_HUMAN	major histocompatibility complex, class II, DR alpha	69	Alpha-1.			R -> L (in Ref. 12; AA sequence). {ECO:0000305}.	antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002504)|cognition (GO:0050890)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|polysaccharide assembly with MHC class II protein complex (GO:0002506)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19						GACGGTCTGGCGGCTTGAAGA	0.468									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Kaposi Sarcoma, Familial Clustering of																												p.R69W		.											HLA-DRA,colon,carcinoma,0,1	HLA-DRA	0	0			c.C205T						.						151.0	153.0	152.0					6																	32410347		1511	2708	4219	SO:0001583	missense	3122	exon2	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;	GTCTGGCGGCTTG		CCDS4750.1	6p21.3	2013-01-11			ENSG00000204287	ENSG00000204287		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4947	protein-coding gene	gene with protein product		142860		HLA-DRA1			Standard	NM_019111		Approved		uc003obh.3	P01903	OTTHUMG00000031269	ENST00000374982.5:c.205C>T	6.37:g.32410347C>T	ENSP00000364121:p.Arg69Trp	72	0		62	20	NM_019111	A2BET4|Q30160|Q6IAZ1|Q861I2|Q9TP70	Missense_Mutation	SNP	ENST00000374982.5	37		.	.	.	.	.	.	.	.	.	.	.	15.24	2.774506	0.49786	.	.	ENSG00000204287	ENST00000395388;ENST00000374982	T;T	0.00940	5.52;5.52	5.38	-4.41	0.03590	MHC class II, alpha/beta chain, N-terminal (1);MHC classes I/II-like antigen recognition protein (1);MHC class II, alpha chain, N-terminal (2);	0.517370	0.19798	N	0.105812	T	0.00875	0.0029	M	0.80508	2.5	0.29473	N	0.856929	P;D	0.55605	0.552;0.972	B;P	0.49708	0.274;0.62	T	0.21621	-1.0240	10	0.72032	D	0.01	.	8.2935	0.31971	0.6731:0.1757:0.0:0.1512	.	69;69	Q30118;P01903	.;DRA_HUMAN	W	69	ENSP00000378786:R69W;ENSP00000364121:R69W	ENSP00000364121:R69W	R	+	1	2	HLA-DRA	32518325	0.716000	0.27956	0.796000	0.32109	0.791000	0.44710	-0.644000	0.05415	-0.604000	0.05760	0.638000	0.83543	CGG	.		0.468	HLA-DRA-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000076587.3	NM_019111	
SOGA1	140710	hgsc.bcm.edu	37	20	35445812	35445812	+	Nonsense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr20:35445812G>A	ENST00000357779.3	-	4	744	c.418C>T	c.(418-420)Cag>Tag	p.Q140*	SOGA1_ENST00000456801.2_5'Flank|SOGA1_ENST00000279034.6_Nonsense_Mutation_p.Q140*|SOGA1_ENST00000237536.4_Nonsense_Mutation_p.Q378*			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	140					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						GGAATTACCTGCACCAAAGTC	0.478																																					p.Q378X		.											.	.	.	0			c.C1132T						.						41.0	41.0	41.0					20																	35445812		1819	4071	5890	SO:0001587	stop_gained	140710	exon4			TTACCTGCACCAA	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.418C>T	20.37:g.35445812G>A	ENSP00000350424:p.Gln140*	67	0		54	4	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Nonsense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	G	37	6.207262	0.97376	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000357779	.	.	.	5.14	5.14	0.70334	.	0.117096	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-44.6348	15.9874	0.80168	0.0:0.0:1.0:0.0	.	.	.	.	X	378;140;140	.	ENSP00000237536:Q378X	Q	-	1	0	KIAA0889	34879226	1.000000	0.71417	0.971000	0.41717	0.050000	0.14768	7.779000	0.85648	2.837000	0.97791	0.655000	0.94253	CAG	.		0.478	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
SYTL3	94120	hgsc.bcm.edu	37	6	159104022	159104022	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:159104022G>T	ENST00000297239.9	+	5	588		c.e5+1		SYTL3_ENST00000360448.3_Splice_Site|SYTL3_ENST00000367081.3_Splice_Site			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		CCAACTGGAGGTAAATGCTCT	0.328																																					.		.											SYTL3,NS,carcinoma,0,1	SYTL3	0	0			c.394+1G>T						.						53.0	54.0	53.0					6																	159104022		2203	4300	6503	SO:0001630	splice_region_variant	94120	exon7			CTGGAGGTAAATG	AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.394+1G>T	6.37:g.159104022G>T		102	0		58	3	NM_001009991	Q496J4|Q496J6|Q5U3B9	Splice_Site	SNP	ENST00000297239.9	37	CCDS56458.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.303372	0.60195	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239;ENST00000367081	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9047	0.70709	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYTL3	159024010	1.000000	0.71417	0.999000	0.59377	0.774000	0.43823	4.895000	0.63214	2.656000	0.90262	0.603000	0.83216	.	.		0.328	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042876.1		Intron
SLC7A3	84889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	70149683	70149683	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chrX:70149683G>T	ENST00000374299.3	-	2	309	c.165C>A	c.(163-165)ggC>ggA	p.G55G	SLC7A3_ENST00000298085.4_Silent_p.G55G			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	55					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	TGGCCACCTCGCCAGCTAGGA	0.572																																					p.G55G		.											.	.	.	0			c.C165A						.						118.0	75.0	90.0					X																	70149683		2203	4300	6503	SO:0001819	synonymous_variant	84889	exon2			CACCTCGCCAGCT	AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.165C>A	X.37:g.70149683G>T		36	0		13	13	NM_032803	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Silent	SNP	ENST00000374299.3	37	CCDS14404.1																																																																																			.		0.572	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	NM_032803	
HEPHL1	341208	hgsc.bcm.edu	37	11	93806546	93806546	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:93806546G>T	ENST00000315765.9	+	8	1453	c.1445G>T	c.(1444-1446)aGc>aTc	p.S482I		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	482	Plastocyanin-like 3.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				AAGGTCTATAGCATTTTACCC	0.493																																					p.S482I		.											HEPHL1,NS,carcinoma,0,1	HEPHL1	0	0			c.G1445T						.						66.0	62.0	64.0					11																	93806546		1922	4123	6045	SO:0001583	missense	341208	exon8			TCTATAGCATTTT	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.1445G>T	11.37:g.93806546G>T	ENSP00000313699:p.Ser482Ile	74	0		34	2	NM_001098672	Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.648574	0.87958	.	.	ENSG00000181333	ENST00000315765	D	0.99311	-5.73	5.51	5.51	0.81932	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.039076	0.85682	D	0.000000	D	0.99619	0.9861	H	0.94620	3.56	0.51012	D	0.999906	D	0.89917	1.0	D	0.85130	0.997	D	0.97917	1.0312	10	0.87932	D	0	.	19.4292	0.94758	0.0:0.0:1.0:0.0	.	482	Q6MZM0	HPHL1_HUMAN	I	482	ENSP00000313699:S482I	ENSP00000313699:S482I	S	+	2	0	HEPHL1	93446194	1.000000	0.71417	0.996000	0.52242	0.788000	0.44548	9.027000	0.93706	2.581000	0.87130	0.650000	0.86243	AGC	.		0.493	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	
ABCA8	10351	hgsc.bcm.edu	37	17	66877304	66877304	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr17:66877304G>T	ENST00000269080.2	-	30	4012	c.3875C>A	c.(3874-3876)tCc>tAc	p.S1292Y	ABCA8_ENST00000430352.2_Missense_Mutation_p.S1332Y|ABCA8_ENST00000586539.1_Missense_Mutation_p.S1332Y	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1292	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					CACCTTAATGGATGTGCTTTT	0.313																																					p.S1292Y		.											ABCA8,NS,carcinoma,0,1	ABCA8	0	0			c.C3875A						.						135.0	121.0	126.0					17																	66877304		2203	4299	6502	SO:0001583	missense	10351	exon30			TTAATGGATGTGC	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3875C>A	17.37:g.66877304G>T	ENSP00000269080:p.Ser1292Tyr	61	0		48	2	NM_007168	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632559	0.47049	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.93763	-3.28;-3.28	4.3	1.13	0.20643	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.169906	0.29424	N	0.012182	D	0.92694	0.7678	L	0.36672	1.1	0.09310	N	1	D;D;D	0.63880	0.993;0.982;0.993	D;P;D	0.70016	0.956;0.891;0.967	D	0.84871	0.0825	10	0.87932	D	0	.	6.1702	0.20412	0.2439:0.1369:0.6192:0.0	.	1332;1332;1292	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	Y	1292;1332	ENSP00000269080:S1292Y;ENSP00000402814:S1332Y	ENSP00000269080:S1292Y	S	-	2	0	ABCA8	64388899	0.000000	0.05858	0.505000	0.27651	0.995000	0.86356	0.782000	0.26788	0.188000	0.20168	0.655000	0.94253	TCC	.		0.313	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33589742	33589742	+	Missense_Mutation	SNP	G	G	T	rs376568090		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:33589742G>T	ENST00000321505.4	+	8	3488	c.3308G>T	c.(3307-3309)cGg>cTg	p.R1103L	KIAA1549L_ENST00000265654.5_Missense_Mutation_p.R1109L|KIAA1549L_ENST00000389726.3_Missense_Mutation_p.R1109L			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1103						integral component of membrane (GO:0016021)											CGGTTTAAACGGGCCACCACC	0.587																																					p.R1103L		.											C11orf41_ENST00000321505,right_upper_lobe,carcinoma,0,2	C11orf41_ENST00000321505	0	0			c.G3308T						.						33.0	34.0	34.0					11																	33589742		1948	4132	6080	SO:0001583	missense	25758	exon8			TTAAACGGGCCAC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.3308G>T	11.37:g.33589742G>T	ENSP00000315295:p.Arg1103Leu	80	0		41	2	NM_012194	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	37	CCDS44565.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.348955|5.348955	0.95807|0.95807	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000526400|ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568	.|.	.|.	.|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83552|0.83552	0.5279|0.5279	M|M	0.82056|0.82056	2.57|2.57	0.42116|0.42116	D|D	0.991403|0.991403	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.85786|0.85786	0.1364|0.1364	5|9	.|0.87932	.|D	.|0	-22.5335|-22.5335	19.2636|19.2636	0.93977|0.93977	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1109;1109	.|E9PAT2;Q6ZVL6-2	.|.;.	W|L	501|1103;1109;1109;942	.|.	.|ENSP00000265654:R1109L	G|R	+|+	1|2	0|0	C11orf41|C11orf41	33546318|33546318	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.435000|9.435000	0.97529|0.97529	2.539000|2.539000	0.85634|0.85634	0.555000|0.555000	0.69702|0.69702	GGG|CGG	.		0.587	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
ANKRD44	91526	hgsc.bcm.edu	37	2	198051784	198051784	+	Missense_Mutation	SNP	C	C	A	rs149690877		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:198051784C>A	ENST00000409153.1	-	2	256	c.74G>T	c.(73-75)cGg>cTg	p.R25L	ANKRD44_ENST00000409919.1_Missense_Mutation_p.R25L|ANKRD44_ENST00000450567.1_5'UTR|ANKRD44_ENST00000539527.1_5'UTR|ANKRD44_ENST00000328737.2_5'UTR|ANKRD44_ENST00000282272.8_Missense_Mutation_p.R17L			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	25										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GATGAGCATCCGGATCTCCTC	0.438																																					p.R25L		.											ANKRD44_ENST00000409919,NS,carcinoma,0,2	ANKRD44_ENST00000409919	0	0			c.G74T						.						187.0	186.0	186.0					2																	198051784		2203	4300	6503	SO:0001583	missense	91526	exon2			AGCATCCGGATCT	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000409153.1:c.74G>T	2.37:g.198051784C>A	ENSP00000387141:p.Arg25Leu	68	0		41	2	NM_153697	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000409153.1	37		.	.	.	.	.	.	.	.	.	.	C	17.08	3.298442	0.60195	.	.	ENSG00000065413	ENST00000282272;ENST00000409153;ENST00000409919	T;T;T	0.66815	-0.23;-0.23;-0.23	5.22	5.22	0.72569	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.73830	0.3637	L	0.33668	1.02	0.80722	D	1	B;D	0.63046	0.098;0.992	B;D	0.70487	0.167;0.969	T	0.76055	-0.3099	9	0.72032	D	0.01	.	16.3396	0.83078	0.0:1.0:0.0:0.0	.	25;25	Q8N8A2;Q8N8A2-3	ANR44_HUMAN;.	L	17;25;25	ENSP00000282272:R17L;ENSP00000387141:R25L;ENSP00000387233:R25L	ENSP00000282272:R17L	R	-	2	0	ANKRD44	197760029	1.000000	0.71417	0.994000	0.49952	0.721000	0.41392	4.290000	0.59019	2.708000	0.92522	0.650000	0.86243	CGG	.		0.438	ANKRD44-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000335114.3	NM_153697	
MOXD1	26002	hgsc.bcm.edu	37	6	132618355	132618355	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:132618355G>C	ENST00000367963.3	-	12	1897	c.1779C>G	c.(1777-1779)ttC>ttG	p.F593L	MOXD1_ENST00000336749.3_Missense_Mutation_p.F525L	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	593						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)	p.F525L(1)|p.F593L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		AGTTGATGGAGAAATCTCTGT	0.438																																					p.F593L		.											MOXD1_ENST00000336749,rectum,carcinoma,0,2	MOXD1_ENST00000336749	0	2	Substitution - Missense(2)	large_intestine(2)	c.C1779G						.						150.0	134.0	139.0					6																	132618355		2203	4300	6503	SO:0001583	missense	26002	exon12			GATGGAGAAATCT	AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.1779C>G	6.37:g.132618355G>C	ENSP00000356940:p.Phe593Leu	68	0		37	2	NM_015529	Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Missense_Mutation	SNP	ENST00000367963.3	37	CCDS5152.2	.	.	.	.	.	.	.	.	.	.	G	5.904	0.350842	0.11182	.	.	ENSG00000079931	ENST00000367963;ENST00000336749	T;T	0.43294	0.97;0.95	5.7	1.33	0.21861	.	1.363200	0.04540	N	0.388044	T	0.06371	0.0164	N	0.11560	0.145	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18903	-1.0322	10	0.11485	T	0.65	0.728	2.7927	0.05392	0.1622:0.2427:0.4563:0.1388	.	593;525	Q6UVY6;Q6UVY6-2	MOXD1_HUMAN;.	L	593;525	ENSP00000356940:F593L;ENSP00000336998:F525L	ENSP00000336998:F525L	F	-	3	2	MOXD1	132660048	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.685000	0.25378	0.329000	0.23460	0.591000	0.81541	TTC	.		0.438	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000125837.1	NM_015529	
SEMA4C	54910	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	97530504	97530504	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:97530504C>T	ENST00000305476.5	-	9	1032	c.900G>A	c.(898-900)atG>atA	p.M300I		NM_017789.4	NP_060259.4	Q9C0C4	SEM4C_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C	300	Dominant negative effect on myogenic differentiation. {ECO:0000250}.|Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell migration in hindbrain (GO:0021535)|cerebellum development (GO:0021549)|muscle cell differentiation (GO:0042692)|neural tube closure (GO:0001843)|positive regulation of stress-activated MAPK cascade (GO:0032874)|semaphorin-plexin signaling pathway (GO:0071526)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle membrane (GO:0030672)	receptor activity (GO:0004872)			NS(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	17						GCAGGGTGTGCATCGCCTGCA	0.617																																					p.M300I		.											.	.	.	0			c.G900A						.						74.0	77.0	76.0					2																	97530504		2203	4300	6503	SO:0001583	missense	54910	exon9			GGTGTGCATCGCC	AB051526	CCDS2029.1	2q11.2	2013-01-11			ENSG00000168758	ENSG00000168758		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10731	protein-coding gene	gene with protein product	"""M-Sema F"""	604462		SEMAI		7656991	Standard	NM_017789		Approved	Semacl1, Semaf	uc002sxh.4	Q9C0C4	OTTHUMG00000130535	ENST00000305476.5:c.900G>A	2.37:g.97530504C>T	ENSP00000306844:p.Met300Ile	65	0		27	4	NM_017789	Q32MJ3|Q7Z5X0	Missense_Mutation	SNP	ENST00000305476.5	37	CCDS2029.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.245742	0.39697	.	.	ENSG00000168758	ENST00000305476	T	0.26518	1.73	5.97	3.16	0.36331	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.568416	0.18388	N	0.142745	T	0.11239	0.0274	N	0.04805	-0.155	0.19945	N	0.999941	B;B	0.02656	0.0;0.0	B;B	0.14023	0.01;0.005	T	0.22382	-1.0218	10	0.39692	T	0.17	.	5.4828	0.16733	0.0:0.5067:0.2716:0.2217	.	300;10	Q9C0C4;Q6P5A5	SEM4C_HUMAN;.	I	300	ENSP00000306844:M300I	ENSP00000306844:M300I	M	-	3	0	SEMA4C	96894231	0.001000	0.12720	0.750000	0.31169	0.910000	0.53928	-0.771000	0.04699	0.398000	0.25338	0.655000	0.94253	ATG	.		0.617	SEMA4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252957.1	NM_017789	
MMP8	4317	hgsc.bcm.edu	37	11	102593358	102593358	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:102593358G>T	ENST00000236826.3	-	2	247	c.149C>A	c.(148-150)tCt>tAt	p.S50Y		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	50					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.S50F(1)		autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	CTTCCTTGTAGACTGATACTG	0.438																																					p.S50Y		.											MMP8,shoulder,malignant_melanoma,0,1	MMP8	0	1	Substitution - Missense(1)	skin(1)	c.C149A						.						134.0	130.0	131.0					11																	102593358		2203	4299	6502	SO:0001583	missense	4317	exon2			CTTGTAGACTGAT	J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.149C>A	11.37:g.102593358G>T	ENSP00000236826:p.Ser50Tyr	67	0		37	2	NM_002424	Q45F99	Missense_Mutation	SNP	ENST00000236826.3	37	CCDS8320.1	.	.	.	.	.	.	.	.	.	.	G	1.620	-0.521776	0.04171	.	.	ENSG00000118113	ENST00000236826;ENST00000544383	T	0.37235	1.21	5.92	1.47	0.22746	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	3.305230	0.00748	N	0.001054	T	0.31263	0.0791	L	0.42245	1.32	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.15870	0.014;0.008	T	0.25433	-1.0132	10	0.07175	T	0.84	.	9.7368	0.40392	0.3474:0.0:0.6526:0.0	.	50;50	A8K9E4;P22894	.;MMP8_HUMAN	Y	50;27	ENSP00000236826:S50Y	ENSP00000236826:S50Y	S	-	2	0	MMP8	102098568	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	-2.687000	0.00833	0.399000	0.25367	0.655000	0.94253	TCT	.		0.438	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1	NM_002424	
TGFBR2	7048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	30686282	30686282	+	Silent	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:30686282G>A	ENST00000295754.5	+	2	520	c.138G>A	c.(136-138)aaG>aaA	p.K46K	TGFBR2_ENST00000359013.4_Silent_p.K71K	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	46					activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						GTGCAGTCAAGTTTCCACAAC	0.428																																					p.K71K		.											.	.	.	0			c.G213A						.						103.0	95.0	97.0					3																	30686282		2203	4300	6503	SO:0001819	synonymous_variant	7048	exon3			AGTCAAGTTTCCA		CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.138G>A	3.37:g.30686282G>A		52	0		32	11	NM_001024847	B4DTV5|Q15580|Q6DKT6|Q99474	Silent	SNP	ENST00000295754.5	37	CCDS2648.1																																																																																			.		0.428	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2		
CDH9	1007	hgsc.bcm.edu	37	5	26885775	26885775	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr5:26885775G>T	ENST00000231021.4	-	11	2002	c.1830C>A	c.(1828-1830)ggC>ggA	p.G610G		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	610					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CCGTGCTCAGGCCGGCTGAAA	0.502																																					p.G610G	Melanoma(8;187 585 15745 40864 52829)	.											CDH9,NS,carcinoma,0,1	CDH9	0	0			c.C1830A						.						80.0	67.0	72.0					5																	26885775		2203	4300	6503	SO:0001819	synonymous_variant	1007	exon11			GCTCAGGCCGGCT	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1830C>A	5.37:g.26885775G>T		64	0		28	2	NM_016279	Q3B7I5	Silent	SNP	ENST00000231021.4	37	CCDS3893.1																																																																																			.		0.502	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
TTN	7273	hgsc.bcm.edu	37	2	179447086	179447086	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:179447086C>A	ENST00000591111.1	-	264	61398	c.61174G>T	c.(61174-61176)Gaa>Taa	p.E20392*	TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.E13093*|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.E22033*|RP11-171I2.2_ENST00000603521.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.E13160*|TTN_ENST00000342992.6_Nonsense_Mutation_p.E19465*|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.E12968*|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20392	Fibronectin type-III 47. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E13093*(1)|p.E13160*(1)|p.E19465*(1)|p.E12968*(1)|p.E19463*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTTATTTTCAGCACAAATA	0.448																																					p.E22033X		.											TTN_ENST00000359218,NS,carcinoma,0,5	TTN_ENST00000359218	0	5	Substitution - Nonsense(5)	lung(5)	c.G66097T						.						51.0	48.0	49.0					2																	179447086		1883	4108	5991	SO:0001587	stop_gained	7273	exon314			TATTTTCAGCACA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.61174G>T	2.37:g.179447086C>A	ENSP00000465570:p.Glu20392*	84	0		49	2	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	61	61.142966	0.99990	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.09310	A	1e-37	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.1723	0.98160	0.0:1.0:0.0:0.0	.	.	.	.	X	19465;12968;13160;13093;12966	.	ENSP00000340554:E13160X	E	-	1	0	TTN	179155332	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.770000	0.85390	2.768000	0.95171	0.655000	0.94253	GAA	.		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
C16orf86	388284	hgsc.bcm.edu;bcgsc.ca	37	16	67702300	67702300	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr16:67702300C>T	ENST00000403458.4	+	4	906	c.751C>T	c.(751-753)Ccc>Tcc	p.P251S	ENKD1_ENST00000602409.1_5'Flank|ENKD1_ENST00000243878.4_5'Flank|ENKD1_ENST00000602644.1_5'Flank	NM_001012984.2	NP_001013002.2	Q6ZW13	CP086_HUMAN	chromosome 16 open reading frame 86	251										endometrium(2)|lung(4)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		CCTCGCTTTGCCCTGTCCCAG	0.687											OREG0023886	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P251S		.											.	.	.	0			c.C751T						.						21.0	27.0	25.0					16																	67702300		2085	4200	6285	SO:0001583	missense	388284	exon4			GCTTTGCCCTGTC		CCDS32468.2	16q22.1	2008-10-30			ENSG00000159761	ENSG00000159761			33755	protein-coding gene	gene with protein product							Standard	NM_001012984		Approved	FLJ41802	uc002ety.3	Q6ZW13	OTTHUMG00000150527	ENST00000403458.4:c.751C>T	16.37:g.67702300C>T	ENSP00000384117:p.Pro251Ser	59	0	1101	52	4	NM_001012984	B5MCW6	Missense_Mutation	SNP	ENST00000403458.4	37	CCDS32468.2	.	.	.	.	.	.	.	.	.	.	C	15.25	2.776472	0.49786	.	.	ENSG00000159761	ENST00000403458	.	.	.	4.94	3.98	0.46160	.	.	.	.	.	T	0.37839	0.1018	L	0.32530	0.975	0.28437	N	0.917008	D	0.60160	0.987	P	0.53518	0.728	T	0.16070	-1.0415	8	0.87932	D	0	-11.3603	8.5067	0.33193	0.0:0.898:0.0:0.102	.	251	Q6ZW13	CP086_HUMAN	S	251	.	ENSP00000384117:P251S	P	+	1	0	C16orf86	66259801	0.028000	0.19301	0.965000	0.40720	0.249000	0.25844	0.219000	0.17641	2.724000	0.93272	0.563000	0.77884	CCC	.		0.687	C16orf86-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318767.2	NM_001012984	
DST	667	hgsc.bcm.edu	37	6	56401599	56401599	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:56401599C>A	ENST00000361203.3	-	58	16122	c.16115G>T	c.(16114-16116)cGg>cTg	p.R5372L	DST_ENST00000244364.6_Missense_Mutation_p.R2960L|DST_ENST00000446842.2_Missense_Mutation_p.R5048L|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Missense_Mutation_p.R3286L|DST_ENST00000370769.4_Missense_Mutation_p.R5374L|DST_ENST00000370754.5_Missense_Mutation_p.R5552L|DST_ENST00000421834.2_Missense_Mutation_p.R3286L|DST_ENST00000340834.4_5'UTR			Q03001	DYST_HUMAN	dystonin	5372					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGTCTTCCACCGTGCATTGAC	0.428																																					p.R2960L		.											DST_ENST00000370769,NS,haematopoietic_neoplasm,0,2	DST_ENST00000370769	0	0			c.G8879T						.						154.0	153.0	153.0					6																	56401599		2035	4203	6238	SO:0001583	missense	667	exon43			TTCCACCGTGCAT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.16115G>T	6.37:g.56401599C>A	ENSP00000354508:p.Arg5372Leu	76	0		49	2	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	16.60	3.169478	0.57584	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62;0.62	5.7	5.7	0.88788	.	0.000000	0.47455	D	0.000237	T	0.64271	0.2583	M	0.83012	2.62	0.30256	N	0.793582	D;D;D;P;P	0.71674	0.972;0.998;0.995;0.82;0.928	P;D;D;B;P	0.74674	0.812;0.984;0.94;0.298;0.82	T	0.69412	-0.5152	9	0.59425	D	0.04	.	14.0397	0.64667	0.0:0.928:0.0:0.072	.	3286;5374;5552;5372;2960	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	L	2960;5552;5374;3286;5048;3286;5372	ENSP00000244364:R2960L;ENSP00000359790:R5552L;ENSP00000359805:R5374L;ENSP00000400883:R3286L;ENSP00000393645:R5048L;ENSP00000359824:R3286L;ENSP00000354508:R5372L	ENSP00000244364:R2960L	R	-	2	0	DST	56509558	0.998000	0.40836	0.637000	0.29366	0.945000	0.59286	4.693000	0.61753	2.697000	0.92050	0.585000	0.79938	CGG	.		0.428	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
SPAG9	9043	hgsc.bcm.edu	37	17	49059961	49059961	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr17:49059961G>T	ENST00000262013.7	-	25	3369	c.3161C>A	c.(3160-3162)aCt>aAt	p.T1054N	SPAG9_ENST00000510283.1_Missense_Mutation_p.T897N|SPAG9_ENST00000505279.1_Missense_Mutation_p.T1044N|SPAG9_ENST00000357122.4_Missense_Mutation_p.T1040N	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	1054					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			ATGTACCACAGTCATGCAACG	0.403																																					p.T1054N		.											SPAG9_ENST00000262013,NS,carcinoma,0,2	SPAG9_ENST00000262013	0	0			c.C3161A						.						153.0	143.0	147.0					17																	49059961		2203	4300	6503	SO:0001583	missense	9043	exon25			ACCACAGTCATGC	AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.3161C>A	17.37:g.49059961G>T	ENSP00000262013:p.Thr1054Asn	75	1		51	3	NM_001130528	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	ENST00000262013.7	37	CCDS45740.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464244	0.84425	.	.	ENSG00000008294	ENST00000262013;ENST00000376407;ENST00000357804;ENST00000357791;ENST00000510283;ENST00000505279;ENST00000357122;ENST00000535445	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.83	5.83	0.93111	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.046039	0.85682	D	0.000000	T	0.53012	0.1770	M	0.69823	2.125	0.52099	D	0.999942	P;P;D;P	0.54207	0.758;0.864;0.965;0.948	B;P;P;P	0.54270	0.438;0.598;0.747;0.676	T	0.54622	-0.8266	10	0.66056	D	0.02	-15.7558	15.5855	0.76479	0.0:0.137:0.863:0.0	.	1044;1054;1040;897	O60271-2;O60271;O60271-4;E7ENU2	.;JIP4_HUMAN;.;.	N	1054;811;801;591;897;1044;1040;652	ENSP00000262013:T1054N;ENSP00000423165:T897N;ENSP00000426900:T1044N;ENSP00000349636:T1040N	ENSP00000262013:T1054N	T	-	2	0	SPAG9	46414960	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.773000	0.98989	2.763000	0.94921	0.561000	0.74099	ACT	.		0.403	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971	
ZNF638	27332	hgsc.bcm.edu	37	2	71661914	71661914	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:71661914G>T	ENST00000409544.1	+	28	6544	c.5914G>T	c.(5914-5916)Gct>Tct	p.A1972S	ZNF638_ENST00000355812.3_3'UTR|ZNF638_ENST00000409407.1_Missense_Mutation_p.A912S|ZNF638_ENST00000264447.4_Missense_Mutation_p.A1972S	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1972					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						GCAGAATGAGGCTGAAGAAAG	0.333																																					p.A1972S		.											.	.	.	0			c.G5914T						.						74.0	87.0	83.0					2																	71661914		2203	4300	6503	SO:0001583	missense	27332	exon28			AATGAGGCTGAAG	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.5914G>T	2.37:g.71661914G>T	ENSP00000386433:p.Ala1972Ser	140	0		92	4	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.725012	0.48833	.	.	ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407	T;T;T	0.34667	1.35;1.35;1.73	5.97	0.996	0.19844	.	0.594972	0.16106	N	0.229314	T	0.21307	0.0513	L	0.36672	1.1	0.80722	D	1	B;B	0.27068	0.167;0.104	B;B	0.31101	0.124;0.036	T	0.08973	-1.0696	10	0.14252	T	0.57	-0.0056	1.6978	0.02866	0.2399:0.14:0.4756:0.1444	.	1951;1972	Q14966-3;Q14966	.;ZN638_HUMAN	S	1972;1972;912	ENSP00000264447:A1972S;ENSP00000386433:A1972S;ENSP00000386813:A912S	ENSP00000264447:A1972S	A	+	1	0	ZNF638	71515422	0.995000	0.38212	0.994000	0.49952	0.996000	0.88848	0.812000	0.27211	-0.094000	0.12374	0.591000	0.81541	GCT	.		0.333	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
ERICH3	127254	hgsc.bcm.edu	37	1	75038477	75038477	+	Missense_Mutation	SNP	C	C	T	rs200414564		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:75038477C>T	ENST00000326665.5	-	14	3135	c.2917G>A	c.(2917-2919)Gca>Aca	p.A973T	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		973	Glu-rich.							p.A973S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CCAAGAATTGCCTCTTCAGAA	0.517																																					p.A973T		.											C1orf173,NS,carcinoma,0,1	C1orf173	0	1	Substitution - Missense(1)	lung(1)	c.G2917A						.						136.0	125.0	128.0					1																	75038477		2203	4300	6503	SO:0001583	missense	127254	exon14			GAATTGCCTCTTC																												ENST00000326665.5:c.2917G>A	1.37:g.75038477C>T	ENSP00000322609:p.Ala973Thr	40	0		19	2	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.958576	0.74016	.	.	ENSG00000178965	ENST00000326665	T	0.16457	2.34	4.87	2.95	0.34219	.	.	.	.	.	T	0.06234	0.0161	L	0.40543	1.245	0.32010	N	0.602267	P	0.45126	0.851	B	0.43301	0.415	T	0.29792	-1.0000	9	0.21014	T	0.42	-1.3337	10.5312	0.44977	0.0:0.8342:0.0:0.1658	.	973	Q5RHP9	CA173_HUMAN	T	973	ENSP00000322609:A973T	ENSP00000322609:A973T	A	-	1	0	C1orf173	74811065	0.000000	0.05858	0.003000	0.11579	0.456000	0.32438	0.988000	0.29616	0.450000	0.26774	0.462000	0.41574	GCA	.		0.517	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
BRD1	23774	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	50197977	50197977	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr22:50197977G>T	ENST00000216267.8	-	2	1885	c.1399C>A	c.(1399-1401)Cag>Aag	p.Q467K	BRD1_ENST00000404760.1_Missense_Mutation_p.Q467K|BRD1_ENST00000457780.2_Missense_Mutation_p.Q467K|BRD1_ENST00000342989.5_Missense_Mutation_p.Q62K|BRD1_ENST00000404034.1_Missense_Mutation_p.Q467K|BRD1_ENST00000542442.1_Missense_Mutation_p.Q160K	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	467					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TTCTTCCGCTGAATGGCCACC	0.507																																					p.Q467K		.											.	.	.	0			c.C1399A						.						82.0	85.0	84.0					22																	50197977		2203	4300	6503	SO:0001583	missense	23774	exon2			TCCGCTGAATGGC	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.1399C>A	22.37:g.50197977G>T	ENSP00000216267:p.Gln467Lys	54	0		37	4	NM_014577	A6ZJA4	Missense_Mutation	SNP	ENST00000216267.8	37	CCDS14080.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.833782	0.91036	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000457780;ENST00000542442;ENST00000342989	T;T;T;T;T;T	0.40756	2.59;2.59;2.52;2.35;1.02;1.02	5.05	5.05	0.67936	.	0.113551	0.64402	D	0.000008	T	0.52725	0.1752	M	0.64997	1.995	0.80722	D	1	P;P;P;D	0.55385	0.952;0.745;0.917;0.971	B;B;B;P	0.50109	0.427;0.445;0.207;0.631	T	0.56745	-0.7928	10	0.52906	T	0.07	.	18.3901	0.90479	0.0:0.0:1.0:0.0	.	467;62;467;467	Q86X06;B7Z926;O95696;O95696-2	.;.;BRD1_HUMAN;.	K	467;467;467;467;160;62	ENSP00000216267:Q467K;ENSP00000384076:Q467K;ENSP00000385858:Q467K;ENSP00000410042:Q467K;ENSP00000437514:Q160K;ENSP00000345886:Q62K	ENSP00000216267:Q467K	Q	-	1	0	BRD1	48583981	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.574000	0.98184	2.366000	0.80165	0.655000	0.94253	CAG	.		0.507	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1	NM_014577	
ZMYM1	79830	hgsc.bcm.edu	37	1	35579573	35579573	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:35579573G>T	ENST00000373330.1	+	11	2316	c.2142G>T	c.(2140-2142)caG>caT	p.Q714H	ZMYM1_ENST00000373329.1_3'UTR|ZMYM1_ENST00000359858.4_Missense_Mutation_p.Q714H			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	714						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TACATGGCCAGGCCTATGATA	0.353																																					p.Q714H		.											ZMYM1,colon,carcinoma,0,1	ZMYM1	0	0			c.G2142T						.						66.0	63.0	64.0					1																	35579573		1830	4088	5918	SO:0001583	missense	79830	exon10			TGGCCAGGCCTAT	AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.2142G>T	1.37:g.35579573G>T	ENSP00000362427:p.Gln714His	73	0		33	2	NM_024772	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	G	7.742	0.701502	0.15172	.	.	ENSG00000197056	ENST00000359858;ENST00000373329;ENST00000373330	T;T;T	0.21543	2.0;2.0;2.0	4.24	0.241	0.15494	Ribonuclease H-like (1);	0.175681	0.28312	N	0.015815	T	0.45196	0.1330	M	0.89095	3.005	0.26237	N	0.978929	D;D	0.71674	0.996;0.998	D;D	0.81914	0.995;0.951	T	0.27502	-1.0072	9	.	.	.	-6.3792	7.1161	0.25416	0.5284:0.0:0.4716:0.0	.	695;714	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	H	714;639;714	ENSP00000352920:Q714H;ENSP00000362426:Q639H;ENSP00000362427:Q714H	.	Q	+	3	2	ZMYM1	35352160	1.000000	0.71417	0.984000	0.44739	0.016000	0.09150	0.572000	0.23684	0.053000	0.16036	-0.262000	0.10625	CAG	.		0.353	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1	NM_024772	
IQCB1	9657	hgsc.bcm.edu	37	3	121508986	121508986	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:121508986G>T	ENST00000310864.6	-	11	1277	c.1063C>A	c.(1063-1065)Caa>Aaa	p.Q355K	IQCB1_ENST00000349820.6_Missense_Mutation_p.Q222K	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	355					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)	p.Q355*(1)		NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		CTCTGTCTTTGAAGTTGCAAT	0.398																																					p.Q355K		.											IQCB1,NS,carcinoma,0,1	IQCB1	0	1	Substitution - Nonsense(1)	lung(1)	c.C1063A						.						246.0	229.0	235.0					3																	121508986		2203	4300	6503	SO:0001583	missense	9657	exon11			GTCTTTGAAGTTG	D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.1063C>A	3.37:g.121508986G>T	ENSP00000311505:p.Gln355Lys	75	0		41	2	NM_001023570	Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Missense_Mutation	SNP	ENST00000310864.6	37	CCDS33837.1	.	.	.	.	.	.	.	.	.	.	G	9.738	1.164086	0.21538	.	.	ENSG00000173226	ENST00000310864;ENST00000349820	T;T	0.37058	1.22;1.33	4.92	3.04	0.35103	.	0.217108	0.48767	D	0.000177	T	0.25644	0.0624	L	0.41236	1.265	0.32373	N	0.555606	B;P	0.41450	0.104;0.75	B;B	0.36808	0.024;0.233	T	0.25467	-1.0131	10	0.13108	T	0.6	-3.8352	13.0898	0.59160	0.0:0.3092:0.6908:0.0	.	355;222	Q15051;Q15051-2	IQCB1_HUMAN;.	K	355;222	ENSP00000311505:Q355K;ENSP00000323756:Q222K	ENSP00000311505:Q355K	Q	-	1	0	IQCB1	122991676	1.000000	0.71417	0.997000	0.53966	0.737000	0.42083	3.935000	0.56560	0.710000	0.31997	0.650000	0.86243	CAA	.		0.398	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	NM_014642	
SLC35F1	222553	hgsc.bcm.edu	37	6	118598679	118598679	+	Silent	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:118598679C>T	ENST00000360388.4	+	6	1018	c.817C>T	c.(817-819)Ctg>Ttg	p.L273L		NM_001029858.3	NP_001025029.2	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	273					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.L273V(1)		breast(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(226;0.217)		GCATAAGGAACTGTTGAAGGT	0.413																																					p.L273L		.											SLC35F1,NS,carcinoma,0,1	SLC35F1	0	1	Substitution - Missense(1)	breast(1)	c.C817T						.						182.0	172.0	175.0					6																	118598679		2203	4300	6503	SO:0001819	synonymous_variant	222553	exon6			AAGGAACTGTTGA	BC028615	CCDS34524.1	6q22.31	2013-05-22			ENSG00000196376	ENSG00000196376		"""Solute carriers"""	21483	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 169"""	C6orf169			Standard	NM_001029858		Approved	dJ230I3.1	uc003pxx.4	Q5T1Q4	OTTHUMG00000015460	ENST00000360388.4:c.817C>T	6.37:g.118598679C>T		54	0		39	2	NM_001029858	E1P564|Q1RMG1|Q4G0U9|Q4G167|Q6N007	Silent	SNP	ENST00000360388.4	37	CCDS34524.1																																																																																			.		0.413	SLC35F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041991.2	XM_167044	
ZNF729	100287226	hgsc.bcm.edu	37	19	22498722	22498722	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr19:22498722C>T	ENST00000601693.1	+	4	2621	c.2503C>T	c.(2503-2505)Cat>Tat	p.H835Y	ZNF729_ENST00000357491.6_Missense_Mutation_p.H835Y			A6NN14	ZN729_HUMAN	zinc finger protein 729	835					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H835Y(1)		breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						AGCTTTTAAGCATTTCTCAGC	0.383																																					p.H835Y		.											ZNF729,NS,carcinoma,0,1	ZNF729	0	1	Substitution - Missense(1)	breast(1)	c.C2503T						.																																			SO:0001583	missense	100287226	exon4			TTTAAGCATTTCT		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.2503C>T	19.37:g.22498722C>T	ENSP00000469582:p.His835Tyr	103	0		59	4	NM_001242680	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	37	CCDS59368.1	.	.	.	.	.	.	.	.	.	.	.	0.038	-1.298743	0.01364	.	.	ENSG00000196350	ENST00000357491	T	0.06528	3.29	0.832	-1.66	0.08265	.	.	.	.	.	T	0.02571	0.0078	N	0.20685	0.6	.	.	.	.	.	.	.	.	.	T	0.47182	-0.9137	6	0.02654	T	1	.	1.7862	0.03042	0.2754:0.3296:0.0:0.395	.	.	.	.	Y	835	ENSP00000350085:H835Y	ENSP00000350085:H835Y	H	+	1	0	ZNF729	22290562	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-3.209000	0.00557	-1.435000	0.01972	-1.476000	0.00998	CAT	.		0.383	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301	
TECPR2	9895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	102891358	102891358	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr14:102891358G>T	ENST00000359520.7	+	6	907	c.681G>T	c.(679-681)aaG>aaT	p.K227N	TECPR2_ENST00000561228.1_3'UTR|TECPR2_ENST00000558678.1_Missense_Mutation_p.K227N	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	227					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GACTCTGTAAGCAAAGTGATC	0.413																																					p.K227N		.											.	.	.	0			c.G681T						.						107.0	115.0	112.0					14																	102891358		2203	4300	6503	SO:0001583	missense	9895	exon6			CTGTAAGCAAAGT	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.681G>T	14.37:g.102891358G>T	ENSP00000352510:p.Lys227Asn	89	0		41	18	NM_001172631	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	37	CCDS32162.1	.	.	.	.	.	.	.	.	.	.	g	18.45	3.626126	0.66901	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	T	0.24908	1.83	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.42562	0.1208	L	0.55481	1.735	0.39849	D	0.973217	D;D	0.89917	0.983;1.0	P;D	0.87578	0.81;0.998	T	0.17837	-1.0356	10	0.24483	T	0.36	.	11.7176	0.51663	0.1291:0.0:0.8709:0.0	.	227;227	A5PKY3;O15040	.;TCPR2_HUMAN	N	227	ENSP00000352510:K227N	ENSP00000352510:K227N	K	+	3	2	TECPR2	101961111	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.566000	0.36396	2.419000	0.82065	0.552000	0.68991	AAG	.		0.413	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
PDE1C	5137	hgsc.bcm.edu	37	7	31855651	31855651	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr7:31855651T>C	ENST00000396191.1	-	15	2155	c.1700A>G	c.(1699-1701)aAg>aGg	p.K567R	PDE1C_ENST00000396184.3_Missense_Mutation_p.K567R|PDE1C_ENST00000321453.7_Missense_Mutation_p.K567R|PDE1C_ENST00000479980.1_5'UTR|PDE1C_ENST00000396182.2_Missense_Mutation_p.K567R|PDE1C_ENST00000396193.1_Missense_Mutation_p.K627R	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	567					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	TCCAGACGTCTTTTTCTCAGC	0.498																																					p.K627R		.											PDE1C_ENST00000396193,NS,malignant_melanoma,0,3	PDE1C_ENST00000396193	0	0			c.A1880G						.						243.0	242.0	242.0					7																	31855651		2203	4300	6503	SO:0001583	missense	5137	exon16			GACGTCTTTTTCT	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1700A>G	7.37:g.31855651T>C	ENSP00000379494:p.Lys567Arg	68	0		37	2	NM_001191058	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	37	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	T	10.39	1.336073	0.24253	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.73681	-0.76;-0.77;-0.77;-0.72;-0.72	5.34	5.34	0.76211	.	0.437409	0.19729	N	0.107413	T	0.58206	0.2106	N	0.24115	0.695	0.32563	N	0.530843	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.61431	-0.7064	10	0.49607	T	0.09	.	6.4892	0.22105	0.0:0.1633:0.0:0.8367	.	567;627;567	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	R	627;567;567;567;567	ENSP00000379496:K627R;ENSP00000379494:K567R;ENSP00000318105:K567R;ENSP00000379487:K567R;ENSP00000379485:K567R	ENSP00000318105:K567R	K	-	2	0	PDE1C	31822176	0.964000	0.33143	0.840000	0.33206	0.007000	0.05969	3.863000	0.56016	2.242000	0.73789	0.533000	0.62120	AAG	.		0.498	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
REXO2	25996	hgsc.bcm.edu	37	11	114310340	114310340	+	Silent	SNP	C	C	T	rs371745776		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:114310340C>T	ENST00000265881.5	+	1	233	c.90C>T	c.(88-90)ggC>ggT	p.G30G	RP11-212D19.4_ENST00000544347.1_Intron|REXO2_ENST00000539275.1_Silent_p.G30G|REXO2_ENST00000544196.1_Silent_p.G30G|REXO2_ENST00000539754.1_Silent_p.G30G	NM_015523.3	NP_056338.2	Q9Y3B8	ORN_HUMAN	RNA exonuclease 2	30					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide metabolic process (GO:0009117)	focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(1)|lung(1)	4		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.65e-06)|Epithelial(105;6.09e-05)|all cancers(92;0.000494)		GCGAAGGTGGCGCAGCCATGG	0.697											OREG0021351	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G30G		.											.	.	.	0			c.C90T						.	C		1,4391		0,1,2195	26.0	27.0	27.0		90	0.8	1.0	11		27	0,8590		0,0,4295	no	coding-synonymous	REXO2	NM_015523.3		0,1,6490	TT,TC,CC		0.0,0.0228,0.0077		30/238	114310340	1,12981	2196	4295	6491	SO:0001819	synonymous_variant	25996	exon1			AGGTGGCGCAGCC	AF151872	CCDS8371.1	11q23.2	2013-06-10	2013-06-10		ENSG00000076043	ENSG00000076043			17851	protein-coding gene	gene with protein product		607149	"""REX2, RNA exonuclease 2 homolog (S. cerevisiae)"""			10851236, 10810093, 23741365	Standard	NM_015523		Approved	DKFZP566E144, SFN, CGI-114	uc001poy.3	Q9Y3B8	OTTHUMG00000168271	ENST00000265881.5:c.90C>T	11.37:g.114310340C>T		177	0	1457	92	3	NM_015523	B2R532|Q32Q18|Q53FT1|Q6FIC6|Q9UFY7	Silent	SNP	ENST00000265881.5	37	CCDS8371.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.003793	0.35320	2.28E-4	0.0	ENSG00000076043	ENST00000539119	.	.	.	5.27	0.783	0.18572	.	.	.	.	.	T	0.50854	0.1640	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37126	-0.9719	4	.	.	.	0.0174	4.9608	0.14065	0.1617:0.5724:0.0:0.266	.	.	.	.	C	13	.	.	R	+	1	0	REXO2	113815550	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.311000	0.33562	0.235000	0.21160	0.650000	0.86243	CGC	.		0.697	REXO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399087.1	NM_015523	
DDOST	1650	hgsc.bcm.edu	37	1	20979149	20979149	+	Silent	SNP	G	G	T	rs138561924		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:20979149G>T	ENST00000375048.3	-	10	1291	c.1186C>A	c.(1186-1188)Cgg>Agg	p.R396R	DDOST_ENST00000602624.2_Silent_p.R379R|DDOST_ENST00000415136.2_Silent_p.R359R|PINK1-AS_ENST00000451424.1_RNA	NM_005216.4	NP_005207	P39656	OST48_HUMAN	dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)	396					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|innate immune response (GO:0045087)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|response to cytokine (GO:0034097)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell activation (GO:0042110)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|protein complex (GO:0043234)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|skin(1)	13		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TAGCCTAGCCGGTTGTAATCC	0.507																																					p.R396R		.											DDOST,colon,carcinoma,0,1	DDOST	0	0			c.C1186A						.						124.0	112.0	116.0					1																	20979149		2203	4300	6503	SO:0001819	synonymous_variant	1650	exon10			CTAGCCGGTTGTA	D29643	CCDS212.1	1p36.1	2013-03-06	2013-03-06		ENSG00000244038	ENSG00000244038	2.4.1.119		2728	protein-coding gene	gene with protein product	"""oligosaccharyltransferase subunit 48"""	602202	"""dolichyl-diphosphooligosaccharide-protein glycosyltransferase"", ""dolichyl-diphosphooligosaccharide--protein glycosyltransferase"""			9367678	Standard	NM_005216		Approved	OST, KIAA0115, OST48, WBP1	uc001bdo.1	P39656	OTTHUMG00000002844	ENST00000375048.3:c.1186C>A	1.37:g.20979149G>T		101	0		22	2	NM_005216	B2RDQ4|B4DJE3|B4DLI2|O43244|Q5VWA5|Q8NI93|Q9BUI2	Silent	SNP	ENST00000375048.3	37	CCDS212.1																																																																																			.		0.507	DDOST-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007961.2	NM_005216	
NEDD4	4734	hgsc.bcm.edu	37	15	56258687	56258687	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr15:56258687C>T	ENST00000435532.3	-	2	293	c.103G>A	c.(103-105)Gat>Aat	p.D35N		NM_006154.2	NP_006145.2	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	0					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		CCCAATATATCCTTCTTGGCA	0.279																																					p.D35N		.											.	.	.	0			c.G103A						.						30.0	28.0	29.0					15																	56258687		1774	3988	5762	SO:0001583	missense	4734	exon2			ATATATCCTTCTT	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000435532.3:c.103G>A	15.37:g.56258687C>T	ENSP00000410613:p.Asp35Asn	121	0		78	2	NM_006154	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	ENST00000435532.3	37	CCDS45265.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314921	0.81358	.	.	ENSG00000069869	ENST00000435532	T	0.74526	-0.85	5.36	5.36	0.76844	.	.	.	.	.	D	0.85570	0.5727	.	.	.	0.80722	D	1	D	0.67145	0.996	D	0.73708	0.981	D	0.87098	0.2177	8	0.72032	D	0.01	.	14.5886	0.68347	0.0:1.0:0.0:0.0	.	35	P46934-4	.	N	35	ENSP00000410613:D35N	ENSP00000410613:D35N	D	-	1	0	NEDD4	54045979	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.173000	0.65010	2.513000	0.84729	0.467000	0.42956	GAT	.		0.279	NEDD4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359821.2	NM_198400	
ZNF141	7700	hgsc.bcm.edu	37	4	367218	367218	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr4:367218G>T	ENST00000240499.7	+	4	1141	c.992G>T	c.(991-993)aGa>aTa	p.R331I	ZNF141_ENST00000512994.1_Intron|ZNF141_ENST00000505939.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	331					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						AAACATAAGAGAATTCATACT	0.383																																					p.R331I		.											ZNF141,NS,carcinoma,0,1	ZNF141	0	0			c.G992T						.						50.0	55.0	54.0					4																	367218		2201	4294	6495	SO:0001583	missense	7700	exon4			ATAAGAGAATTCA	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.992G>T	4.37:g.367218G>T	ENSP00000240499:p.Arg331Ile	61	0		30	2	NM_003441	Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422398	0.43020	.	.	ENSG00000131127	ENST00000240499	T	0.02446	4.29	1.24	-0.242	0.13039	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03915	0.0110	M	0.77616	2.38	0.39205	D	0.963211	P	0.35542	0.508	B	0.32149	0.141	T	0.42430	-0.9452	8	.	.	.	.	5.765	0.18221	0.0:0.0:0.6941:0.3059	.	331	Q15928	ZN141_HUMAN	I	331	ENSP00000240499:R331I	.	R	+	2	0	ZNF141	357218	0.000000	0.05858	0.838000	0.33150	0.981000	0.71138	0.254000	0.18314	0.591000	0.29711	0.313000	0.20887	AGA	.		0.383	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
PRR9	574414	hgsc.bcm.edu;bcgsc.ca	37	1	153190821	153190821	+	Silent	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:153190821G>A	ENST00000368744.3	+	2	257	c.201G>A	c.(199-201)caG>caA	p.Q67Q		NM_001195571.1	NP_001182500.1	Q5T870	PRR9_HUMAN	proline rich 9	67	Cys-rich.									prostate(1)	1						AATGCCCACAGCAAGGCCAAG	0.527																																					p.Q67Q		.											.	.	.	0			c.G201A						.																																			SO:0001819	synonymous_variant	574414	exon2			CCCACAGCAAGGC	AL161636	CCDS55639.1	1q21.3	2008-07-02			ENSG00000203783	ENSG00000203783			32057	protein-coding gene	gene with protein product							Standard	NM_001195571		Approved		uc021ozw.1	Q5T870	OTTHUMG00000013936	ENST00000368744.3:c.201G>A	1.37:g.153190821G>A		48	0		77	67	NM_001195571		Silent	SNP	ENST00000368744.3	37	CCDS55639.1																																																																																			.		0.527	PRR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039105.1		
MFN1	55669	hgsc.bcm.edu	37	3	179082161	179082161	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:179082161G>T	ENST00000471841.1	+	6	739	c.613G>T	c.(613-615)Gtc>Ttc	p.V205F	MFN1_ENST00000280653.7_Missense_Mutation_p.V205F|MFN1_ENST00000263969.5_Missense_Mutation_p.V205F	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	205	Dynamin-type G.				mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			CTTTGTTTTGGTCGCAAACTC	0.353																																					p.V205F		.											.	.	.	0			c.G613T						.						135.0	126.0	129.0					3																	179082161		2203	4300	6503	SO:0001583	missense	55669	exon6			GTTTTGGTCGCAA	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.613G>T	3.37:g.179082161G>T	ENSP00000420617:p.Val205Phe	86	0		44	4	NM_033540	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	ENST00000471841.1	37	CCDS3228.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168992	0.78339	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000263969;ENST00000489329;ENST00000474903	D;D;D;D;D	0.98280	-4.6;-4.6;-4.6;-4.84;-4.84	5.24	5.24	0.73138	Dynamin, GTPase domain (1);	0.000000	0.85682	D	0.000000	D	0.99171	0.9713	M	0.93062	3.375	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.993	D;D;D	0.66602	0.93;0.945;0.914	D	0.99349	1.0914	10	0.87932	D	0	-9.7232	19.1856	0.93642	0.0:0.0:1.0:0.0	.	205;233;205	Q8IWA4-3;Q4AEJ4;Q8IWA4	.;.;MFN1_HUMAN	F	205;205;205;205;58;68	ENSP00000420617:V205F;ENSP00000280653:V205F;ENSP00000263969:V205F;ENSP00000420148:V58F;ENSP00000419926:V68F	ENSP00000263969:V205F	V	+	1	0	MFN1	180564855	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.414000	0.97362	2.611000	0.88343	0.650000	0.86243	GTC	.		0.353	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	
ABHD12B	145447	hgsc.bcm.edu	37	14	51370833	51370833	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr14:51370833G>T	ENST00000337334.2	+	12	999	c.984G>T	c.(982-984)agG>agT	p.R328S	PYGL_ENST00000532462.1_Intron|ABHD12B_ENST00000395752.1_Missense_Mutation_p.R221S|ABHD12B_ENST00000353130.1_Missense_Mutation_p.R251S	NM_001206673.1	NP_001193602.1	Q7Z5M8	AB12B_HUMAN	abhydrolase domain containing 12B	328							hydrolase activity (GO:0016787)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)	10	all_epithelial(31;0.00481)|Breast(41;0.148)					ACAAAGAGAGGGTCAAGATGG	0.428																																					p.R328S		.											ABHD12B_ENST00000337334,NS,haematopoietic_neoplasm,0,2	ABHD12B_ENST00000337334	0	0			c.G984T						.						196.0	191.0	193.0					14																	51370833		2203	4300	6503	SO:0001583	missense	145447	exon12			AGAGAGGGTCAAG	BG698443	CCDS9702.1, CCDS55916.1	14q21.3	2009-10-09	2007-04-03	2007-04-03	ENSG00000131969	ENSG00000131969		"""Abhydrolase domain containing"""	19837	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 29"""	C14orf29			Standard	NM_181814		Approved	BEM46L3	uc001wys.3	Q7Z5M8	OTTHUMG00000140286	ENST00000337334.2:c.984G>T	14.37:g.51370833G>T	ENSP00000336693:p.Arg328Ser	55	0		27	2	NM_001206673	Q3KNR9|Q3KNS0|Q7Z5M6|Q7Z5M7|Q8N4D2	Missense_Mutation	SNP	ENST00000337334.2	37	CCDS55916.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473991	0.84640	.	.	ENSG00000131969	ENST00000353130;ENST00000337334;ENST00000395752	T;T;T	0.42131	2.27;0.98;2.27	4.94	4.94	0.65067	.	0.162995	0.53938	D	0.000041	T	0.43100	0.1232	L	0.59436	1.845	0.47037	D	0.999296	B;B	0.32968	0.392;0.34	B;B	0.37989	0.262;0.113	T	0.20840	-1.0263	10	0.18710	T	0.47	-19.8804	15.7423	0.77910	0.0:0.0:1.0:0.0	.	328;251	Q7Z5M8;Q7Z5M8-2	AB12B_HUMAN;.	S	251;328;221	ENSP00000343951:R251S;ENSP00000336693:R328S;ENSP00000379101:R221S	ENSP00000336693:R328S	R	+	3	2	ABHD12B	50440583	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.861000	0.48380	2.675000	0.91044	0.655000	0.94253	AGG	.		0.428	ABHD12B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411030.1		
RNF213	57674	hgsc.bcm.edu	37	17	78302195	78302195	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr17:78302195G>T	ENST00000582970.1	+	20	3578	c.3435G>T	c.(3433-3435)gaG>gaT	p.E1145D	RNF213_ENST00000456466.1_Missense_Mutation_p.E1145D|RNF213_ENST00000508628.2_Missense_Mutation_p.E1194D	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1145					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GGAGAAGGGAGGAACTGTTAC	0.418																																					p.E1145D		.											RNF213_ENST00000456466,NS,carcinoma,0,2	RNF213_ENST00000456466	0	0			c.G3435T						.						194.0	178.0	182.0					17																	78302195		692	1591	2283	SO:0001583	missense	57674	exon20			AAGGGAGGAACTG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.3435G>T	17.37:g.78302195G>T	ENSP00000464087:p.Glu1145Asp	84	0		49	2	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	1.214	-0.628833	0.03610	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466	.	.	.	4.79	-9.58	0.00559	.	.	.	.	.	T	0.11580	0.0282	N	0.05199	-0.095	0.19300	N	0.999974	B	0.12013	0.005	B	0.12156	0.007	T	0.33879	-0.9851	8	0.11485	T	0.65	0.0112	4.2994	0.10916	0.3278:0.1272:0.4159:0.129	.	1145	Q9HCF4	ALO17_HUMAN	D	1145;1194;1145	.	ENSP00000396478:E1194D	E	+	3	2	RNF213	75916790	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-4.722000	0.00194	-6.687000	0.00003	-1.069000	0.02264	GAG	.		0.418	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
SIGLEC10	89790	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	51918278	51918278	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr19:51918278G>C	ENST00000339313.5	-	8	1531	c.1415C>G	c.(1414-1416)cCc>cGc	p.P472R	SIGLEC10_ENST00000525998.1_Intron|SIGLEC10_ENST00000353836.5_Intron|SIGLEC10_ENST00000441969.3_Intron|SIGLEC10_ENST00000442846.3_Intron|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.P472R|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000439889.2_Missense_Mutation_p.P414R|CTD-2616J11.2_ENST00000532688.1_RNA|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000432469.2_Intron|SIGLEC10_ENST00000436984.2_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	472					cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GCGCAGAGAGGGGGCCGGGCT	0.706																																					p.P472R		.											.	.	.	0			c.C1415G						.						10.0	12.0	12.0					19																	51918278		2177	4257	6434	SO:0001583	missense	89790	exon8			AGAGAGGGGGCCG	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.1415C>G	19.37:g.51918278G>C	ENSP00000345243:p.Pro472Arg	64	0		39	17	NM_033130	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	ENST00000339313.5	37	CCDS12832.1	.	.	.	.	.	.	.	.	.	.	.	12.55	1.972289	0.34754	.	.	ENSG00000142512	ENST00000356298;ENST00000439889;ENST00000339313	D;D;D	0.87809	-2.3;-2.3;-2.3	4.83	4.83	0.62350	.	0.229124	0.31519	N	0.007513	D	0.94374	0.8191	M	0.91300	3.195	0.22081	N	0.999371	D;D	0.89917	1.0;1.0	D;D	0.91635	0.988;0.999	D	0.88564	0.3125	10	0.87932	D	0	.	13.417	0.60974	0.0:0.0:1.0:0.0	.	414;472	Q96LC7-3;Q96LC7	.;SIG10_HUMAN	R	472;414;472	ENSP00000348646:P472R;ENSP00000389132:P414R;ENSP00000345243:P472R	ENSP00000345243:P472R	P	-	2	0	SIGLEC10	56610090	0.878000	0.30173	0.849000	0.33467	0.004000	0.04260	4.523000	0.60545	2.235000	0.73313	0.561000	0.74099	CCC	.		0.706	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
FAM111A	63901	hgsc.bcm.edu	37	11	58920814	58920814	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:58920814C>A	ENST00000528737.1	+	5	4491	c.1673C>A	c.(1672-1674)gCt>gAt	p.A558D	FAM111A_ENST00000361723.3_Missense_Mutation_p.A558D|FAM111A_ENST00000533703.1_Missense_Mutation_p.A558D|FAM111A_ENST00000531147.1_Missense_Mutation_p.A558D|FAM111A_ENST00000420244.1_Missense_Mutation_p.A558D			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	558	Interaction with SV40 large T antigen.				defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				ATGCATGCTGCTGGCTTTGCT	0.428																																					p.A558D		.											FAM111A,NS,carcinoma,0,1	FAM111A	0	0			c.C1673A						.						137.0	134.0	135.0					11																	58920814		2201	4295	6496	SO:0001583	missense	63901	exon5			ATGCTGCTGGCTT	AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1673C>A	11.37:g.58920814C>A	ENSP00000434435:p.Ala558Asp	100	0		49	2	NM_001142520	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	ENST00000528737.1	37	CCDS7973.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044054	0.55110	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	5.57	5.57	0.84162	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.067305	0.64402	D	0.000014	T	0.67581	0.2908	M	0.68593	2.085	0.41061	D	0.985373	D	0.89917	1.0	D	0.76575	0.988	T	0.69105	-0.5233	10	0.66056	D	0.02	-13.918	16.8262	0.85931	0.0:1.0:0.0:0.0	.	558	Q96PZ2	F111A_HUMAN	D	558	ENSP00000434435:A558D;ENSP00000406683:A558D;ENSP00000355264:A558D;ENSP00000433154:A558D;ENSP00000431631:A558D	ENSP00000355264:A558D	A	+	2	0	FAM111A	58677390	0.157000	0.22836	0.783000	0.31826	0.302000	0.27658	0.225000	0.17757	2.791000	0.96007	0.655000	0.94253	GCT	.		0.428	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393975.1	NM_022074	
GLB1L3	112937	hgsc.bcm.edu	37	11	134188524	134188524	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:134188524G>T	ENST00000431683.2	+	19	1779		c.e19-1			NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3						carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		ATTCCTTTCAGAACTGGAATT	0.423																																					.		.											GLB1L3_ENST00000431683,colon,carcinoma,0,2	GLB1L3_ENST00000431683	0	0			c.1780-1G>T						.						103.0	91.0	95.0					11																	134188524		1887	4119	6006	SO:0001630	splice_region_variant	112937	exon19			CTTTCAGAACTGG		CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.1780-1G>T	11.37:g.134188524G>T		77	0		41	2	NM_001080407	A6NEM0|A6NN15|Q6P3S3|Q96FF8	Splice_Site	SNP	ENST00000431683.2	37	CCDS44780.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.401075	0.42613	.	.	ENSG00000166105	ENST00000431683	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.75	0.77976	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GLB1L3	133693734	1.000000	0.71417	0.483000	0.27378	0.028000	0.11728	6.933000	0.75874	2.776000	0.95493	0.558000	0.71614	.	.		0.423	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393625.1	NM_138416	Intron
RMND1	55005	hgsc.bcm.edu;bcgsc.ca	37	6	151738443	151738443	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:151738443G>T	ENST00000367303.4	-	10	1293	c.1171C>A	c.(1171-1173)Caa>Aaa	p.Q391K	RMND1_ENST00000336451.3_Missense_Mutation_p.Q180K	NM_017909.2	NP_060379.2	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog (S. cerevisiae)	391					translation (GO:0006412)	mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		CTAAGGAATTGACACGTTTTA	0.383																																					p.Q391K		.											.	.	.	0			c.C1171A						.						122.0	115.0	118.0					6																	151738443		2203	4300	6503	SO:0001583	missense	55005	exon10			GGAATTGACACGT	AK000634	CCDS5232.1, CCDS75539.1	6q25.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000155906	ENSG00000155906			21176	protein-coding gene	gene with protein product		614917	"""chromosome 6 open reading frame 96"""	C6orf96			Standard	NM_001271937		Approved	bA351K16.3, FLJ20627, RMD1	uc003qoi.3	Q9NWS8	OTTHUMG00000015837	ENST00000367303.4:c.1171C>A	6.37:g.151738443G>T	ENSP00000356272:p.Gln391Lys	100	0		63	4	NM_017909	A8K8H4|Q0VDG6|Q5SZ48|Q5SZ83|Q6NSC5|Q96EN7	Missense_Mutation	SNP	ENST00000367303.4	37	CCDS5232.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255601	0.22965	.	.	ENSG00000155906	ENST00000336451;ENST00000367303;ENST00000367299	T;T	0.74737	-0.87;1.06	5.93	5.93	0.95920	.	0.107189	0.64402	D	0.000003	T	0.44829	0.1312	N	0.16066	0.365	0.58432	D	0.999999	B	0.16603	0.018	B	0.15052	0.012	T	0.44112	-0.9349	10	0.15066	T	0.55	-7.7738	18.1126	0.89540	0.0:0.0:1.0:0.0	.	391	Q9NWS8	RMND1_HUMAN	K	180;391;82	ENSP00000336683:Q180K;ENSP00000356272:Q391K	ENSP00000336683:Q180K	Q	-	1	0	RMND1	151780136	1.000000	0.71417	0.928000	0.36995	0.265000	0.26407	6.869000	0.75521	2.812000	0.96745	0.555000	0.69702	CAA	.		0.383	RMND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042718.2	NM_017909	
ANK1	286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	41550703	41550703	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr8:41550703G>T	ENST00000347528.4	-	30	3632	c.3549C>A	c.(3547-3549)gcC>gcA	p.A1183A	ANK1_ENST00000379758.2_Silent_p.A1183A|ANK1_ENST00000396945.1_Silent_p.A1183A|ANK1_ENST00000265709.8_Silent_p.A1224A|ANK1_ENST00000289734.7_Silent_p.A1183A|ANK1_ENST00000396942.1_Silent_p.A1183A|ANK1_ENST00000352337.4_Silent_p.A1183A	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1183	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTTCCCACTGGGCTTGGTCTG	0.537																																					p.A1224A		.											.	.	.	0			c.C3672A						.						267.0	212.0	231.0					8																	41550703		2203	4300	6503	SO:0001819	synonymous_variant	286	exon31			CCACTGGGCTTGG	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3549C>A	8.37:g.41550703G>T		59	0		22	11	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Silent	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	G	5.899	0.350001	0.11182	.	.	ENSG00000029534	ENST00000520299	.	.	.	4.54	1.71	0.24356	.	.	.	.	.	T	0.45296	0.1335	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22417	-1.0217	4	.	.	.	.	3.0865	0.06279	0.2922:0.1422:0.4659:0.0998	.	.	.	.	T	505	.	.	P	-	1	0	ANK1	41669860	0.109000	0.22037	0.998000	0.56505	0.684000	0.39900	-0.426000	0.07008	-0.003000	0.14444	-1.595000	0.00837	CCA	.		0.537	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
SVEP1	79987	hgsc.bcm.edu	37	9	113166798	113166798	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr9:113166798C>T	ENST00000401783.2	-	39	9811	c.9475G>A	c.(9475-9477)Gat>Aat	p.D3159N	SVEP1_ENST00000297826.5_Missense_Mutation_p.D1085N|SVEP1_ENST00000374469.1_Missense_Mutation_p.D3136N	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3159	Sushi 29. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GTGAATGTATCTGTATCTGTA	0.398																																					p.D3159N		.											SVEP1,NS,carcinoma,0,1	SVEP1	0	0			c.G9475A						.						248.0	237.0	240.0					9																	113166798		1885	4116	6001	SO:0001583	missense	79987	exon39			ATGTATCTGTATC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.9475G>A	9.37:g.113166798C>T	ENSP00000384917:p.Asp3159Asn	62	0		22	2	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635532	0.67130	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.63580	-0.05;-0.05;-0.05	5.76	5.76	0.90799	Complement control module (2);Sushi/SCR/CCP (3);	0.281376	0.38326	N	0.001728	T	0.61739	0.2371	L	0.35793	1.09	0.80722	D	1	D	0.53619	0.961	P	0.53450	0.726	T	0.53989	-0.8360	10	0.13470	T	0.59	.	14.7584	0.69588	0.1445:0.8555:0.0:0.0	.	3159	Q4LDE5	SVEP1_HUMAN	N	3159;3136;1085	ENSP00000384917:D3159N;ENSP00000363593:D3136N;ENSP00000297826:D1085N	ENSP00000297826:D1085N	D	-	1	0	SVEP1	112206619	0.995000	0.38212	0.865000	0.33974	0.351000	0.29236	3.647000	0.54403	2.725000	0.93324	0.591000	0.81541	GAT	.		0.398	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
HMCN1	83872	hgsc.bcm.edu	37	1	185902703	185902703	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:185902703G>T	ENST00000271588.4	+	11	1804	c.1575G>T	c.(1573-1575)gtG>gtT	p.V525V	HMCN1_ENST00000367492.2_Silent_p.V525V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	525	Ig-like C2-type 2.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCATCCAAGTGCCTAACAATG	0.423																																					p.V525V		.											.	.	.	0			c.G1575T						.						80.0	78.0	79.0					1																	185902703		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon11			CCAAGTGCCTAAC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1575G>T	1.37:g.185902703G>T		54	0		54	4	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																			.		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
DLG2	1740	hgsc.bcm.edu;bcgsc.ca	37	11	84996326	84996326	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:84996326G>T	ENST00000376104.2	-	4	435	c.124C>A	c.(124-126)Cag>Aag	p.Q42K	DLG2_ENST00000543673.1_Missense_Mutation_p.Q42K	NM_001142699.1	NP_001136171.1	Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TCCCATTTCTGTAAAACTTGA	0.348																																					p.Q42K		.											.	.	.	0			c.C124A						.						222.0	198.0	205.0					11																	84996326		1568	3581	5149	SO:0001583	missense	1740	exon4			ATTTCTGTAAAAC	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000376104.2:c.124C>A	11.37:g.84996326G>T	ENSP00000365272:p.Gln42Lys	87	0		44	4	NM_001142699	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000376104.2	37	CCDS44690.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471252	0.43942	.	.	ENSG00000150672	ENST00000376104;ENST00000543673;ENST00000546021	T;T	0.11930	2.73;2.73	5.88	3.93	0.45458	.	0.241793	0.26780	N	0.022539	T	0.05364	0.0142	N	0.03608	-0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34104	-0.9842	9	.	.	.	.	9.0218	0.36204	0.0:0.3681:0.5138:0.1181	.	42	Q15700-2	.	K	42	ENSP00000365272:Q42K;ENSP00000441994:Q42K	.	Q	-	1	0	DLG2	84673974	0.997000	0.39634	0.995000	0.50966	0.990000	0.78478	1.957000	0.40392	1.444000	0.47605	0.650000	0.86243	CAG	.		0.348	DLG2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259245.3	NM_001364	
KIAA1377	57562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	101857706	101857706	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:101857706T>C	ENST00000263468.8	+	9	3448	c.3178T>C	c.(3178-3180)Tgc>Cgc	p.C1060R	KIAA1377_ENST00000537689.1_Missense_Mutation_p.C861R	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	1060										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		ATTCAACATCTGCACACTGTC	0.368																																					p.C1060R		.											.	.	.	0			c.T3178C						.						98.0	98.0	98.0					11																	101857706		2203	4299	6502	SO:0001583	missense	57562	exon9			AACATCTGCACAC	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.3178T>C	11.37:g.101857706T>C	ENSP00000263468:p.Cys1060Arg	60	0		42	19	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.994551	0.35226	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.08896	3.04;3.04	5.49	3.1	0.35709	.	0.296463	0.29087	N	0.013186	T	0.18130	0.0435	M	0.68317	2.08	0.41808	D	0.989951	D	0.63880	0.993	P	0.60682	0.878	T	0.00498	-1.1704	10	0.41790	T	0.15	-6.0453	6.5984	0.22687	0.2086:0.0:0.1296:0.6618	.	1060	Q9P2H0	K1377_HUMAN	R	1060;861	ENSP00000263468:C1060R;ENSP00000443184:C861R	ENSP00000263468:C1060R	C	+	1	0	KIAA1377	101362916	0.999000	0.42202	0.933000	0.37362	0.389000	0.30415	2.546000	0.45778	2.212000	0.71576	0.533000	0.62120	TGC	.		0.368	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
CNGA1	1259	hgsc.bcm.edu	37	4	47939627	47939627	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr4:47939627G>T	ENST00000514170.1	-	11	1203	c.884C>A	c.(883-885)cCa>cAa	p.P295Q	CNGA1_ENST00000544810.1_Missense_Mutation_p.P295Q|CNGA1_ENST00000420489.2_Missense_Mutation_p.P295Q|CNGA1_ENST00000402813.3_Missense_Mutation_p.P364Q|CNGA1_ENST00000358519.4_Missense_Mutation_p.P295Q			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	295					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						GAAGATGTTTGGATAGTTTGT	0.368																																					p.P364Q		.											CNGA1,colon,carcinoma,0,1	CNGA1	0	0			c.C1091A						.						157.0	154.0	155.0					4																	47939627		1867	4097	5964	SO:0001583	missense	1259	exon10			ATGTTTGGATAGT	M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.884C>A	4.37:g.47939627G>T	ENSP00000426862:p.Pro295Gln	76	0		57	3	NM_001142564	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Missense_Mutation	SNP	ENST00000514170.1	37	CCDS43226.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108042	0.77096	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489	D;D;D;D;D	0.99789	-6.75;-6.75;-6.75;-6.75;-6.75	5.09	5.09	0.68999	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72625	0.978;0.978	D	0.96723	0.9534	10	0.87932	D	0	.	18.5276	0.90978	0.0:0.0:1.0:0.0	.	295;295	Q4W5E3;P29973	.;CNGA1_HUMAN	Q	364;295;295;295;295	ENSP00000384264:P364Q;ENSP00000426862:P295Q;ENSP00000443401:P295Q;ENSP00000351320:P295Q;ENSP00000389881:P295Q	ENSP00000351320:P295Q	P	-	2	0	CNGA1	47634384	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.416000	0.97383	2.372000	0.80975	0.655000	0.94253	CCA	.		0.368	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372070.2	NM_000087	
UBQLNL	143630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	5537616	5537616	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:5537616C>T	ENST00000380184.1	-	1	319	c.56G>A	c.(55-57)gGt>gAt	p.G19D	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	19										endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		TGCCAGCAGACCTGATGGACA	0.522																																					p.G19D		.											.	.	.	0			c.G56A						.						91.0	89.0	90.0					11																	5537616		2201	4297	6498	SO:0001583	missense	143630	exon1			AGCAGACCTGATG	AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.56G>A	11.37:g.5537616C>T	ENSP00000369531:p.Gly19Asp	28	0		15	9	NM_145053	Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	ENST00000380184.1	37	CCDS31385.1	.	.	.	.	.	.	.	.	.	.	C	1.297	-0.605904	0.03717	.	.	ENSG00000175518	ENST00000380184;ENST00000538889	T	0.40225	1.04	4.94	0.52	0.17040	.	1.043860	0.07557	N	0.916494	T	0.28333	0.0700	L	0.31926	0.97	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.25537	-1.0129	10	0.32370	T	0.25	.	3.2598	0.06845	0.1803:0.477:0.0:0.3427	.	19	Q8IYU4	UBQLN_HUMAN	D	19	ENSP00000369531:G19D	ENSP00000369531:G19D	G	-	2	0	UBQLNL	5494192	0.004000	0.15560	0.000000	0.03702	0.043000	0.13939	0.578000	0.23773	-0.065000	0.13021	0.650000	0.86243	GGT	.		0.522	UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143386.1	NM_145053	
CRTAM	56253	hgsc.bcm.edu	37	11	122726478	122726478	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:122726478G>A	ENST00000227348.4	+	5	613	c.566G>A	c.(565-567)gGc>gAc	p.G189D		NM_019604.2	NP_062550.2			cytotoxic and regulatory T cell molecule									p.G189V(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|prostate(1)	19		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		CACACTTATGGCAAAAATTCA	0.418																																					p.G189D		.											CRTAM,caecum,carcinoma,0,2	CRTAM	0	1	Substitution - Missense(1)	ovary(1)	c.G566A						.						109.0	105.0	106.0					11																	122726478		2202	4299	6501	SO:0001583	missense	56253	exon5			CTTATGGCAAAAA	AF001622	CCDS8437.1	11q24.1	2013-01-11			ENSG00000109943	ENSG00000109943		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24313	protein-coding gene	gene with protein product	"""class I MHC restricted T cell associated molecule"""	612597				10811014, 16300832	Standard	NM_019604		Approved	CD355	uc001pyj.3	O95727	OTTHUMG00000166026	ENST00000227348.4:c.566G>A	11.37:g.122726478G>A	ENSP00000227348:p.Gly189Asp	97	0		43	2	NM_019604		Missense_Mutation	SNP	ENST00000227348.4	37	CCDS8437.1	.	.	.	.	.	.	.	.	.	.	G	9.275	1.046704	0.19748	.	.	ENSG00000109943	ENST00000227348	T	0.09350	2.99	4.86	3.83	0.44106	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);	0.495810	0.22537	N	0.058774	T	0.11922	0.0290	M	0.69823	2.125	0.09310	N	1	B	0.25206	0.12	B	0.26202	0.067	T	0.24512	-1.0158	10	0.24483	T	0.36	.	5.4314	0.16456	0.1964:0.1619:0.6417:0.0	.	189	O95727	CRTAM_HUMAN	D	189	ENSP00000227348:G189D	ENSP00000227348:G189D	G	+	2	0	CRTAM	122231688	0.000000	0.05858	0.006000	0.13384	0.048000	0.14542	0.467000	0.22035	1.016000	0.39470	0.462000	0.41574	GGC	.		0.418	CRTAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387507.1	NM_019604	
BTBD16	118663	hgsc.bcm.edu	37	10	124036305	124036305	+	Splice_Site	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr10:124036305G>A	ENST00000260723.4	+	3	269		c.e3-1		BTBD16_ENST00000368994.2_Silent_p.Q7Q	NM_144587.2	NP_653188.2	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16											breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(3)|skin(2)|stomach(1)|urinary_tract(1)	15		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				TTACCAAGCAGCACAAAGCTC	0.448																																					.		.											BTBD16,bladder,carcinoma,0,1	BTBD16	0	0			c.19-1G>A						.						84.0	87.0	86.0					10																	124036305		2203	4300	6503	SO:0001630	splice_region_variant	118663	exon3			CAAGCAGCACAAA	AK058088	CCDS31301.1	10q26.13	2013-01-24	2006-07-04	2006-07-04	ENSG00000138152	ENSG00000138152		"""BTB/POZ domain containing"""	26340	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 87"""	C10orf87			Standard	NM_144587		Approved	FLJ25359, Em:AC061711.1	uc001lgc.1	Q32M84	OTTHUMG00000019182	ENST00000260723.4:c.19-1G>A	10.37:g.124036305G>A		66	0		60	3	NM_144587	A6NM63|Q4VXL1|Q96LN0	Splice_Site	SNP	ENST00000260723.4	37	CCDS31301.1	.	.	.	.	.	.	.	.	.	.	G	9.384	1.073731	0.20147	.	.	ENSG00000138152	ENST00000260723	.	.	.	4.66	3.76	0.43208	.	.	.	.	.	.	.	.	.	.	.	0.27163	N	0.961122	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8669	0.35291	0.1013:0.0:0.8987:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BTBD16	124026295	0.605000	0.26941	0.007000	0.13788	0.006000	0.05464	2.406000	0.44557	1.332000	0.45431	0.650000	0.86243	.	.		0.448	BTBD16-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050780.3	NM_144587	Intron
RUNX3	864	hgsc.bcm.edu	37	1	25229099	25229099	+	Silent	SNP	C	C	T	rs377188925		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:25229099C>T	ENST00000308873.6	-	5	770	c.762G>A	c.(760-762)acG>acA	p.T254T	RUNX3_ENST00000399916.1_Silent_p.T268T|RUNX3_ENST00000540420.1_Silent_p.T161T|RUNX3_ENST00000496967.1_5'UTR|RUNX3_ENST00000338888.3_Silent_p.T268T	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	254	Pro/Ser/Thr-rich.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T254T(1)|p.T268T(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		GGGTTGGCAGCGTGGGGAAGG	0.642																																					p.T268T		.											RUNX3_ENST00000399916,NS,carcinoma,0,2	RUNX3_ENST00000399916	0	2	Substitution - coding silent(2)	lung(2)	c.G804A						.	C	,	1,4385		0,1,2192	77.0	76.0	77.0		804,762	1.9	0.6	1		77	0,8572		0,0,4286	no	coding-synonymous,coding-synonymous	RUNX3	NM_001031680.2,NM_004350.2	,	0,1,6478	TT,TC,CC		0.0,0.0228,0.0077	,	268/430,254/416	25229099	1,12957	2193	4286	6479	SO:0001819	synonymous_variant	864	exon6			TGGCAGCGTGGGG	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.762G>A	1.37:g.25229099C>T		136	0		44	2	NM_001031680	B1AJV5|Q12969|Q13760	Silent	SNP	ENST00000308873.6	37	CCDS257.1																																																																																			.		0.642	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009284.1	NM_004350	
BIRC7	79444	hgsc.bcm.edu	37	20	61870741	61870741	+	Silent	SNP	G	G	T	rs373757098		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr20:61870741G>T	ENST00000217169.3	+	6	895	c.681G>T	c.(679-681)gcG>gcT	p.A227A	MIR3196_ENST00000579556.1_RNA|BIRC7_ENST00000342412.6_Intron|NKAIN4_ENST00000466885.1_5'Flank|BIRC7_ENST00000395306.1_Intron	NM_139317.1	NP_647478.1	Q96CA5	BIRC7_HUMAN	baculoviral IAP repeat containing 7	227					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of natural killer cell apoptotic process (GO:0070247)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(9)|ovary(1)	12	all_cancers(38;2.72e-09)					CCCAGAGGGCGTGGTGGGTTC	0.687																																					p.A227A		.											BIRC7,right_upper_lobe,carcinoma,0,1	BIRC7	0	0			c.G681T						.						49.0	55.0	53.0					20																	61870741		2203	4299	6502	SO:0001819	synonymous_variant	79444	exon6			GAGGGCGTGGTGG	AF301009	CCDS13512.1, CCDS13513.1	20q13.3	2011-01-25	2011-01-25		ENSG00000101197	ENSG00000101197		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	13702	protein-coding gene	gene with protein product	"""melanoma inhibitor of apoptosis protein"", ""kidney inhibitor of apoptosis protein"", ""livin inhibitor-of-apoptosis"", ""livin"""	605737	"""baculoviral IAP repeat-containing 7"""			11024045, 11162435	Standard	NM_139317		Approved	mliap, ML-IAP, KIAP, RNF50	uc002yej.3	Q96CA5	OTTHUMG00000032957	ENST00000217169.3:c.681G>T	20.37:g.61870741G>T		80	0		58	3	NM_139317	Q9BQV0|Q9H2A8|Q9HAP7	Silent	SNP	ENST00000217169.3	37	CCDS13513.1																																																																																			.		0.687	BIRC7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080114.2	NM_139317	
LAMA3	3909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	21437935	21437935	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr18:21437935G>C	ENST00000313654.9	+	33	4505	c.4264G>C	c.(4264-4266)Ggg>Cgg	p.G1422R	LAMA3_ENST00000399516.3_Missense_Mutation_p.G1422R	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1422	Domain III B.|Laminin EGF-like 12. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CCCAGGGACCGGGGCTTGCCT	0.527																																					p.G1422R		.											LAMA3,NS,carcinoma,0,3	LAMA3	0	0			c.G4264C						.						97.0	97.0	97.0					18																	21437935		2033	4180	6213	SO:0001583	missense	3909	exon33			GGGACCGGGGCTT	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.4264G>C	18.37:g.21437935G>C	ENSP00000324532:p.Gly1422Arg	61	0		22	8	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.562706	0.86335	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.75821	-0.97;-0.97	5.43	5.43	0.79202	EGF-like, laminin (3);	.	.	.	.	D	0.90906	0.7142	H	0.95151	3.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	D	0.93103	0.6510	9	0.87932	D	0	.	19.6064	0.95583	0.0:0.0:1.0:0.0	.	1422;1422	Q6VU67;Q16787	.;LAMA3_HUMAN	R	1422;1422;1420	ENSP00000324532:G1422R;ENSP00000382432:G1422R	ENSP00000324532:G1422R	G	+	1	0	LAMA3	19691933	1.000000	0.71417	0.529000	0.27951	0.839000	0.47603	7.352000	0.79404	2.710000	0.92621	0.561000	0.74099	GGG	.		0.527	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
SERINC2	347735	hgsc.bcm.edu	37	1	31905889	31905889	+	Silent	SNP	A	A	G	rs3050461|rs5773362	byFrequency	TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:31905889A>G	ENST00000373709.3	+	9	1239	c.1089A>G	c.(1087-1089)acA>acG	p.T363T	SERINC2_ENST00000536859.1_Silent_p.T367T|SERINC2_ENST00000536384.1_Silent_p.T367T|SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000373710.1_Silent_p.T372T	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	363					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		TAGACGCCACACAGCAGCAGC	0.637																																					p.T372T		.											.,6	.	44	0			c.A1116G						.						57.0	49.0	52.0					1																	31905889		2202	4300	6502	SO:0001819	synonymous_variant	347735	exon10			CGCCACACAGCAG	AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.1089A>G	1.37:g.31905889A>G		48	0		12	1	NM_001199038	A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Silent	SNP	ENST00000373709.3	37	CCDS30662.1																																																																																			.		0.637	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010680.1	NM_018565	
SMARCA2	6595	hgsc.bcm.edu	37	9	2115849	2115849	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr9:2115849C>T	ENST00000382203.1	+	25	3693	c.3484C>T	c.(3484-3486)Cgc>Tgc	p.R1162C	SMARCA2_ENST00000349721.2_Missense_Mutation_p.R1162C|SMARCA2_ENST00000382194.1_Missense_Mutation_p.R1162C|SMARCA2_ENST00000357248.2_Missense_Mutation_p.R1162C			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1162	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.		R -> H (in NCBRS; dbSNP:rs281875186). {ECO:0000269|PubMed:22366787}.		aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.R1158C(1)|p.R1162C(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CCGAGCTCACCGCATCGGGCA	0.582																																					p.R1162C		.											SMARCA2_ENST00000349721,NS,carcinoma,0,2	SMARCA2_ENST00000349721	0	2	Substitution - Missense(2)	ovary(2)	c.C3484T						.						31.0	30.0	31.0					9																	2115849		2203	4300	6503	SO:0001583	missense	6595	exon25			GCTCACCGCATCG	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3484C>T	9.37:g.2115849C>T	ENSP00000371638:p.Arg1162Cys	29	0		29	2	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	C	17.64	3.439262	0.63067	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	D;D;D;D	0.97888	-4.59;-4.59;-4.59;-4.59	5.67	4.76	0.60689	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99381	0.9782	H	0.99884	4.89	0.80722	D	1	D;D;D	0.89917	1.0;0.993;0.995	D;P;P	0.97110	1.0;0.707;0.807	D	0.97735	1.0205	10	0.87932	D	0	-12.13	11.557	0.50755	0.1408:0.7239:0.1353:0.0	.	763;1162;1162	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	C	1162	ENSP00000265773:R1162C;ENSP00000349788:R1162C;ENSP00000371638:R1162C;ENSP00000371629:R1162C	ENSP00000265773:R1162C	R	+	1	0	SMARCA2	2105849	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.824000	0.62701	1.385000	0.46445	-0.302000	0.09304	CGC	.		0.582	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
TP53BP1	7158	hgsc.bcm.edu	37	15	43708493	43708493	+	Silent	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr15:43708493C>A	ENST00000263801.3	-	22	5040	c.4788G>T	c.(4786-4788)ctG>ctT	p.L1596L	TP53BP1_ENST00000382044.4_Silent_p.L1601L|TP53BP1_ENST00000450115.2_Silent_p.L1601L|TP53BP1_ENST00000382039.3_Silent_p.L1551L	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1596	Tudor-like.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)	p.L1596L(1)		breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		ACTGCTCTCTCAGTCTGTTTC	0.468								Other conserved DNA damage response genes																													p.L1601L		.											TP53BP1,NS,carcinoma,0,1	TP53BP1	0	1	Substitution - coding silent(1)	endometrium(1)	c.G4803T						.						183.0	154.0	164.0					15																	43708493		2201	4298	6499	SO:0001819	synonymous_variant	7158	exon22			CTCTCTCAGTCTG	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.4788G>T	15.37:g.43708493C>A		49	0		32	3	NM_001141980	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Silent	SNP	ENST00000263801.3	37	CCDS10096.1																																																																																			.		0.468	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
ELAVL4	1996	hgsc.bcm.edu	37	1	50610818	50610818	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:50610818G>A	ENST00000371823.4	+	2	423	c.199G>A	c.(199-201)Ggg>Agg	p.G67R	ELAVL4_ENST00000371819.1_Missense_Mutation_p.G72R|ELAVL4_ENST00000371824.1_Missense_Mutation_p.G67R|ELAVL4_ENST00000492299.1_3'UTR|ELAVL4_ENST00000448907.2_Missense_Mutation_p.G70R|ELAVL4_ENST00000371827.1_Missense_Mutation_p.G67R|ELAVL4_ENST00000371821.1_Missense_Mutation_p.G72R|ELAVL4_ENST00000357083.4_Missense_Mutation_p.G84R	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4	67	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G67R(1)|p.G84R(1)		NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						GAGTCTCTTCGGGAGCATTGG	0.428																																					p.G84R		.											ELAVL4_ENST00000357083,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,2	ELAVL4_ENST00000357083	0	2	Substitution - Missense(2)	central_nervous_system(2)	c.G250A						.						92.0	90.0	91.0					1																	50610818		2203	4300	6503	SO:0001583	missense	1996	exon2			CTCTTCGGGAGCA	AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.199G>A	1.37:g.50610818G>A	ENSP00000360888:p.Gly67Arg	77	0		49	2	NM_001144775	B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Missense_Mutation	SNP	ENST00000371823.4	37	CCDS553.1	.	.	.	.	.	.	.	.	.	.	G	32	5.169884	0.94768	.	.	ENSG00000162374	ENST00000448907;ENST00000371827;ENST00000357083;ENST00000371824;ENST00000371823;ENST00000371821;ENST00000371819	T;T;T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36;2.36;2.36	6.17	6.17	0.99709	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.34019	0.0883	L	0.38175	1.15	0.80722	D	1	D;D;P;D;D;D;D	0.89917	1.0;0.962;0.937;1.0;0.999;0.999;1.0	D;B;B;D;P;P;D	0.63877	0.919;0.321;0.16;0.919;0.812;0.711;0.919	T	0.00377	-1.1778	10	0.54805	T	0.06	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	72;72;67;67;84;67;70	B1APY9;B1APY8;P26378-2;P26378;P26378-3;P26378-4;B7Z4G7	.;.;.;ELAV4_HUMAN;.;.;.	R	70;67;84;67;67;72;72	ENSP00000399939:G70R;ENSP00000360892:G67R;ENSP00000349594:G84R;ENSP00000360889:G67R;ENSP00000360888:G67R;ENSP00000360886:G72R;ENSP00000360884:G72R	ENSP00000349594:G84R	G	+	1	0	ELAVL4	50383405	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GGG	.		0.428	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000021712.1	NM_021952	
NR1I3	9970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161206261	161206261	+	Missense_Mutation	SNP	T	T	G			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:161206261T>G	ENST00000367982.4	-	2	250	c.95A>C	c.(94-96)aAg>aCg	p.K32T	NR1I3_ENST00000502985.1_Missense_Mutation_p.K32T|NR1I3_ENST00000437437.2_Intron|NR1I3_ENST00000428574.2_Missense_Mutation_p.K32T|NR1I3_ENST00000511748.1_Intron|NR1I3_ENST00000508740.1_Intron|NR1I3_ENST00000367980.2_Missense_Mutation_p.K32T|NR1I3_ENST00000412844.2_Intron|NR1I3_ENST00000515452.1_Missense_Mutation_p.K32T|NR1I3_ENST00000504010.1_Intron|NR1I3_ENST00000367985.3_Missense_Mutation_p.K32T|NR1I3_ENST00000515621.1_Intron|NR1I3_ENST00000506209.1_Intron|NR1I3_ENST00000367984.4_Missense_Mutation_p.K32T|NR1I3_ENST00000511944.1_Missense_Mutation_p.K32T|NR1I3_ENST00000367983.4_Missense_Mutation_p.K32T|NR1I3_ENST00000512372.1_Intron|NR1I3_ENST00000367979.2_Missense_Mutation_p.K32T|NR1I3_ENST00000442691.2_Missense_Mutation_p.K32T|NR1I3_ENST00000505005.1_Missense_Mutation_p.K32T|NR1I3_ENST00000508387.1_Intron|NR1I3_ENST00000367981.3_Intron|NR1I3_ENST00000511676.1_Intron			Q14994	NR1I3_HUMAN	nuclear receptor subfamily 1, group I, member 3	32					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	15	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			GAAGAAACCCTTGCAGCCCTC	0.537																																					p.K32T		.											.	.	.	0			c.A95C						.						170.0	155.0	160.0					1																	161206261		2203	4300	6503	SO:0001583	missense	9970	exon2			AAACCCTTGCAGC	Z30425	CCDS1228.1, CCDS41427.1, CCDS41428.1, CCDS41429.1, CCDS41430.1, CCDS44260.1, CCDS44261.1, CCDS44262.1, CCDS53405.1, CCDS53406.1, CCDS53407.1, CCDS53408.1, CCDS53409.1, CCDS53410.1, CCDS53411.1	1q23.3	2013-01-16			ENSG00000143257	ENSG00000143257		"""Nuclear hormone receptors"""	7969	protein-coding gene	gene with protein product	"""constitutive androstane receptor"""	603881				8114692	Standard	NM_001077480		Approved	MB67, CAR1, CAR	uc001fzp.3	Q14994	OTTHUMG00000034347	ENST00000367982.4:c.95A>C	1.37:g.161206261T>G	ENSP00000356961:p.Lys32Thr	59	0		115	11	NM_005122	E9PB75|E9PC13|E9PDU3|E9PGH6|E9PH10|E9PHC8|E9PHN4|F1D8Q0|F1D8Q1|Q0VAC9|Q4U0F0|Q5VTW5|Q5VTW6|Q6GZ68|Q6GZ76|Q6GZ77|Q6GZ78|Q6GZ79|Q6GZ82|Q6GZ83|Q6GZ84|Q6GZ85|Q6GZ87|Q6GZ89	Missense_Mutation	SNP	ENST00000367982.4	37	CCDS41430.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.500010	0.85176	.	.	ENSG00000143257	ENST00000367983;ENST00000367980;ENST00000442691;ENST00000428574;ENST00000505005;ENST00000367982;ENST00000502985;ENST00000511944;ENST00000367984;ENST00000367985;ENST00000367979;ENST00000515452	D;D;D;D;D;D;D;D;D;D;D;D	0.98264	-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83;-4.83	5.44	5.44	0.79542	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.145674	0.64402	D	0.000014	D	0.99039	0.9671	M	0.90977	3.165	0.42742	D	0.993746	D;D;D;D;D;D;D;D;D;D	0.76494	0.999;0.997;0.999;0.997;0.997;0.997;0.989;0.999;0.997;0.989	D;D;D;D;D;D;P;D;D;P	0.85130	0.997;0.994;0.957;0.994;0.986;0.986;0.893;0.982;0.986;0.893	D	0.99690	1.1001	9	0.87932	D	0	.	13.502	0.61462	0.0:0.0:0.0:1.0	.	32;32;32;32;32;32;32;32;32;32	B7Z8R7;Q6GZ85;E9PHC8;Q0VAC9;F1D8Q1;Q14994;E9PC13;Q6GZ72;Q4U0F0;E9PB75	.;.;.;.;.;NR1I3_HUMAN;.;.;.;.	T	32	ENSP00000356962:K32T;ENSP00000356959:K32T;ENSP00000406493:K32T;ENSP00000412672:K32T;ENSP00000424934:K32T;ENSP00000356961:K32T;ENSP00000421374:K32T;ENSP00000426292:K32T;ENSP00000356963:K32T;ENSP00000356965:K32T;ENSP00000356958:K32T;ENSP00000427034:K32T	ENSP00000356958:K32T	K	-	2	0	NR1I3	159472885	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.030000	0.76484	2.288000	0.76882	0.533000	0.62120	AAG	.		0.537	NR1I3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083048.2		
AHCTF1	25909	hgsc.bcm.edu	37	1	247025439	247025439	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:247025439G>A	ENST00000391829.2	-	28	3680	c.3557C>T	c.(3556-3558)gCc>gTc	p.A1186V	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000366508.1_Missense_Mutation_p.A1221V|AHCTF1_ENST00000326225.3_Missense_Mutation_p.A1195V			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1186	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AACTGACATGGCCAAACTTTT	0.458																																					p.A1195V	Colon(145;197 1800 4745 15099 26333)	.											.	.	.	0			c.C3584T						.						57.0	57.0	57.0					1																	247025439		2203	4300	6503	SO:0001583	missense	25909	exon28			GACATGGCCAAAC		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3557C>T	1.37:g.247025439G>A	ENSP00000375705:p.Ala1186Val	57	0		68	4	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37		.	.	.	.	.	.	.	.	.	.	G	12.28	1.889347	0.33348	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.35421	1.31;1.31;1.32	5.64	4.72	0.59763	.	0.344807	0.29868	N	0.010983	T	0.31979	0.0814	L	0.47190	1.495	0.32505	N	0.538309	P;P;B	0.47545	0.897;0.565;0.429	B;B;B	0.43809	0.432;0.107;0.029	T	0.37291	-0.9712	10	0.30078	T	0.28	-5.6762	9.6856	0.40096	0.1511:0.0:0.8489:0.0	.	47;1221;1186	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	V	1221;1195;1186	ENSP00000355464:A1221V;ENSP00000355465:A1195V;ENSP00000375705:A1186V	ENSP00000355465:A1195V	A	-	2	0	AHCTF1	245092062	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.161000	0.50747	2.667000	0.90743	0.650000	0.86243	GCC	.		0.458	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
TTN	7273	hgsc.bcm.edu	37	2	179511839	179511839	+	Intron	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:179511839C>A	ENST00000591111.1	-	167	35599				TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Nonsense_Mutation_p.E13392*|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000460472.2_Intron|RP11-171I2.3_ENST00000605021.1_lincRNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGCTTTTTCTTCATATATT	0.274																																					p.E13392X		.											.	.	.	0			c.G40174T						.																																			SO:0001627	intron_variant	7273	exon215			CTTTTTCTTCATA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35375-1082G>T	2.37:g.179511839C>A		122	0		94	4	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	23.4	4.413509	0.83449	.	.	ENSG00000155657	ENST00000429997;ENST00000446966	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	13.2835	0.60230	0.0:0.8887:0.0:0.1113	.	.	.	.	X	231	.	ENSP00000400616:E231X	E	-	1	0	TTN	179220084	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.912000	0.39946	2.882000	0.98803	0.655000	0.94253	GAA	.		0.274	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FZD8	8325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	35929045	35929045	+	Missense_Mutation	SNP	G	G	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr10:35929045G>C	ENST00000374694.1	-	1	1317	c.1313C>G	c.(1312-1314)tCg>tGg	p.S438W	MIR4683_ENST00000579659.1_RNA	NM_031866.2	NP_114072.1	Q9H461	FZD8_HUMAN	frizzled class receptor 8	438					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	11						GAAGTACTGCGAGTAGCCGGC	0.652																																					p.S438W		.											.	.	.	0			c.C1313G						.						40.0	39.0	39.0					10																	35929045		2202	4300	6502	SO:0001583	missense	8325	exon1			TACTGCGAGTAGC	AB043703	CCDS7192.1	10p11.2	2014-01-29	2014-01-29		ENSG00000177283	ENSG00000177283		"""GPCR / Class F : Frizzled receptors"""	4046	protein-coding gene	gene with protein product		606146	"""frizzled (Drosophila) homolog 8"", ""frizzled homolog 8 (Drosophila)"", ""frizzled 8, seven transmembrane spanning receptor"", ""frizzled family receptor 8"""			11295046	Standard	NM_031866		Approved		uc001iyz.1	Q9H461	OTTHUMG00000017956	ENST00000374694.1:c.1313C>G	10.37:g.35929045G>C	ENSP00000363826:p.Ser438Trp	37	0		17	8	NM_031866		Missense_Mutation	SNP	ENST00000374694.1	37	CCDS7192.1	.	.	.	.	.	.	.	.	.	.	G	14.45	2.539806	0.45176	.	.	ENSG00000177283	ENST00000374694	D	0.84516	-1.86	3.74	3.74	0.42951	GPCR, family 2-like (1);	0.188754	0.35555	U	0.003122	D	0.93782	0.8012	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95447	0.8531	10	0.87932	D	0	.	15.6696	0.77262	0.0:0.0:1.0:0.0	.	438	Q9H461	FZD8_HUMAN	W	438	ENSP00000363826:S438W	ENSP00000363826:S438W	S	-	2	0	FZD8	35969051	1.000000	0.71417	1.000000	0.80357	0.146000	0.21551	9.013000	0.93629	2.067000	0.61834	0.289000	0.19496	TCG	.		0.652	FZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047575.2	NM_031866	
C6orf163	206412	hgsc.bcm.edu;ucsc.edu	37	6	88058571	88058571	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:88058571G>T	ENST00000388923.4	+	2	441	c.190G>T	c.(190-192)Gaa>Taa	p.E64*	RP1-102H19.8_ENST00000448282.2_Intron|C6orf163_ENST00000608326.1_5'UTR	NM_001010868.2	NP_001010868.2	Q5TEZ5	CF163_HUMAN	chromosome 6 open reading frame 163	64										central_nervous_system(1)|kidney(1)	2						GCAGTTTCAAGAAGATATACT	0.403																																					p.E64X		.											.	.	.	0			c.G190T						.						115.0	105.0	108.0					6																	88058571		692	1591	2283	SO:0001587	stop_gained	206412	exon2			TTTCAAGAAGATA	AK092941	CCDS55042.1	6q15	2012-02-07			ENSG00000203872	ENSG00000203872			21403	protein-coding gene	gene with protein product							Standard	NM_001010868		Approved		uc021zcl.1	Q5TEZ5	OTTHUMG00000015169	ENST00000388923.4:c.190G>T	6.37:g.88058571G>T	ENSP00000373575:p.Glu64*	54	0		31	4	NM_001010868		Nonsense_Mutation	SNP	ENST00000388923.4	37	CCDS55042.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496401	0.64186	.	.	ENSG00000203872	ENST00000388923	.	.	.	5.2	4.25	0.50352	.	0.487515	0.18767	N	0.131709	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-15.1084	12.9671	0.58490	0.0:0.1634:0.8366:0.0	.	.	.	.	X	64	.	ENSP00000373575:E64X	E	+	1	0	C6orf163	88115290	0.973000	0.33851	0.757000	0.31301	0.041000	0.13682	1.555000	0.36277	2.809000	0.96659	0.655000	0.94253	GAA	.		0.403	C6orf163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041436.2	NM_001010868	
NEK5	341676	hgsc.bcm.edu	37	13	52684525	52684525	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr13:52684525C>A	ENST00000355568.4	-	7	557	c.418G>T	c.(418-420)Gga>Tga	p.G140*		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	140	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		GCCACCATTCCGTTCTTGCTA	0.353																																					p.G140X		.											NEK5_ENST00000355568,NS,carcinoma,+1,2	NEK5_ENST00000355568	+1	0			c.G418T						.						141.0	137.0	139.0					13																	52684525		2203	4300	6503	SO:0001587	stop_gained	341676	exon7			CCATTCCGTTCTT	BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.418G>T	13.37:g.52684525C>A	ENSP00000347767:p.Gly140*	131	0		89	4	NM_199289	Q5TAP5	Nonsense_Mutation	SNP	ENST00000355568.4	37	CCDS31979.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.858173	0.91433	.	.	ENSG00000197168	ENST00000355568	.	.	.	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	18.4315	0.90627	0.0:1.0:0.0:0.0	.	.	.	.	X	140	.	ENSP00000347767:G140X	G	-	1	0	NEK5	51582526	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	7.383000	0.79741	2.365000	0.80145	0.467000	0.42956	GGA	.		0.353	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045045.3	NM_199289	
PSME4	23198	hgsc.bcm.edu	37	2	54101581	54101581	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:54101581G>T	ENST00000404125.1	-	43	5050	c.4995C>A	c.(4993-4995)ctC>ctA	p.L1665L	PSME4_ENST00000476586.1_Intron|PSME4_ENST00000421748.2_Silent_p.L809L	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1665	Bromodomain-like (BRDL).				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CCATGGTCTGGAGGTAGGTCA	0.378																																					p.L1665L		.											PSME4,NS,carcinoma,0,1	PSME4	0	0			c.C4995A						.						88.0	85.0	86.0					2																	54101581		2203	4300	6503	SO:0001819	synonymous_variant	23198	exon43			GGTCTGGAGGTAG	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.4995C>A	2.37:g.54101581G>T		59	0		36	2	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Silent	SNP	ENST00000404125.1	37	CCDS33197.2																																																																																			.		0.378	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
MT-ND4	4538	hgsc.bcm.edu;broad.mit.edu	37	M	11880	11880	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chrM:11880A>G	ENST00000361381.2	+	1	1121	c.1121A>G	c.(1120-1122)aAc>aGc	p.N374S	MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	374					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						CCCCACTATTAACCTACTGGG	0.448																																					p.N374S		.											.	.	.	0			c.A1121G						.																																			SO:0001583	missense	0	exon1			CTATTAACCTACT			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.1121A>G	M.37:g.11880A>G	ENSP00000354961:p.Asn374Ser	11	0		6	6	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	37																																																																																				.		0.448	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
RPH3A	22895	hgsc.bcm.edu	37	12	113266158	113266158	+	Missense_Mutation	SNP	G	G	A	rs139903605		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr12:113266158G>A	ENST00000389385.4	+	3	532	c.35G>A	c.(34-36)cGt>cAt	p.R12H	RPH3A_ENST00000447659.2_Missense_Mutation_p.R12H|RPH3A_ENST00000551052.1_Missense_Mutation_p.R12H|RPH3A_ENST00000415485.3_Missense_Mutation_p.R12H|RPH3A_ENST00000548866.1_Missense_Mutation_p.R12H|RPH3A_ENST00000420983.2_Missense_Mutation_p.R12H|RPH3A_ENST00000543106.2_Missense_Mutation_p.R12H	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	12					intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		AGTTCTAACCGTTGGATGTAC	0.473																																					p.R12H		.											RPH3A,rectum,carcinoma,0,1	RPH3A	0	0			c.G35A						.	G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	185.0	159.0	168.0		35,35	5.7	0.7	12	dbSNP_134	168	0,8600		0,0,4300	no	missense,missense	RPH3A	NM_001143854.1,NM_014954.3	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	12/695,12/691	113266158	1,13005	2203	4300	6503	SO:0001583	missense	22895	exon3			CTAACCGTTGGAT	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.35G>A	12.37:g.113266158G>A	ENSP00000374036:p.Arg12His	61	0		43	2	NM_001143854	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943641	0.73672	2.27E-4	0.0	ENSG00000089169	ENST00000549736;ENST00000548197;ENST00000547686;ENST00000543106;ENST00000551593;ENST00000546426;ENST00000551748;ENST00000546703;ENST00000547840;ENST00000547728;ENST00000549769;ENST00000552667;ENST00000389385;ENST00000447659;ENST00000551198;ENST00000551052;ENST00000415485;ENST00000553114;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T	0.77750	-0.2;-0.2;-1.12;-0.15;-0.2;-0.58;-0.2	5.7	5.7	0.88788	Rabphilin-3A effector, zinc-binding (1);	0.248756	0.28606	N	0.014742	D	0.86222	0.5881	M	0.63843	1.955	0.51233	D	0.999911	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.85130	0.994;0.997;0.997;0.994	D	0.86144	0.1583	10	0.54805	T	0.06	.	15.3248	0.74150	0.0:0.0:1.0:0.0	.	12;12;12;12	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	H	12	ENSP00000440384:R12H;ENSP00000374036:R12H;ENSP00000413254:R12H;ENSP00000448297:R12H;ENSP00000405357:R12H;ENSP00000450347:R12H;ENSP00000408889:R12H	ENSP00000374036:R12H	R	+	2	0	RPH3A	111750541	0.998000	0.40836	0.690000	0.30148	0.403000	0.30841	4.419000	0.59835	2.696000	0.92011	0.655000	0.94253	CGT	0.000		0.473	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
CSNK1A1L	122011	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	37679178	37679178	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr13:37679178G>T	ENST00000379800.3	-	1	625	c.216C>A	c.(214-216)ggC>ggA	p.G72G		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	72	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TGTGGGGGATGCCAACCCCAC	0.502																																					p.G72G		.											.	.	.	0			c.C216A						.						143.0	124.0	130.0					13																	37679178		2203	4300	6503	SO:0001819	synonymous_variant	122011	exon1			GGGGATGCCAACC	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.216C>A	13.37:g.37679178G>T		77	0		46	4	NM_145203	Q5T2N2	Silent	SNP	ENST00000379800.3	37	CCDS9363.1																																																																																			.		0.502	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203	
ASPM	259266	hgsc.bcm.edu;bcgsc.ca	37	1	197071223	197071223	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:197071223G>T	ENST00000367409.4	-	18	7414	c.7158C>A	c.(7156-7158)caC>caA	p.H2386Q	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2386	IQ 24. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TCACAGCAGAGTGTCTTTGTC	0.438																																					p.H2386Q		.											.	.	.	0			c.C7158A						.						178.0	176.0	177.0					1																	197071223		2203	4299	6502	SO:0001583	missense	259266	exon18			AGCAGAGTGTCTT	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.7158C>A	1.37:g.197071223G>T	ENSP00000356379:p.His2386Gln	41	0		53	4	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	g	5.888	0.347940	0.11126	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	T	0.24908	1.83	4.25	-8.5	0.00927	.	0.593695	0.15277	N	0.270906	T	0.13586	0.0329	L	0.35288	1.05	0.09310	N	0.999995	P;B	0.38729	0.644;0.115	B;B	0.43301	0.415;0.173	T	0.12528	-1.0544	10	0.12430	T	0.62	.	5.4381	0.16492	0.1177:0.2439:0.469:0.1694	.	372;2386	E7EQ84;Q8IZT6	.;ASPM_HUMAN	Q	2386;372	ENSP00000356379:H2386Q	ENSP00000356376:H372Q	H	-	3	2	ASPM	195337846	0.000000	0.05858	0.000000	0.03702	0.643000	0.38383	-4.351000	0.00248	-1.994000	0.00972	-1.290000	0.01357	CAC	.		0.438	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
TMTC2	160335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	83289597	83289597	+	Splice_Site	SNP	A	A	G			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr12:83289597A>G	ENST00000321196.3	+	3	1362	c.655A>G	c.(655-657)Agg>Ggg	p.R219G	TMTC2_ENST00000548305.1_Splice_Site_p.R219G|TMTC2_ENST00000549919.1_Splice_Site_p.R213G	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	219					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						TTGGTTTCAGAGGAAGAACTT	0.378																																					p.R219G		.											.	.	.	0			c.A655G						.						91.0	90.0	90.0					12																	83289597		2203	4300	6503	SO:0001630	splice_region_variant	160335	exon3			TTTCAGAGGAAGA	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.655-1A>G	12.37:g.83289597A>G		68	0		33	15	NM_152588	B2RCU7|Q8N2K8	Missense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	A	11.18	1.562974	0.27915	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919	T;T;T	0.62105	0.71;0.05;0.6	5.84	0.5	0.16919	.	0.129288	0.64402	N	0.000001	T	0.41604	0.1166	N	0.21373	0.66	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.10660	-1.0620	9	.	.	.	-2.345	9.8383	0.40982	0.7249:0.0:0.2751:0.0	.	219;219	Q8N394;F8VSH2	TMTC2_HUMAN;.	G	219;219;213	ENSP00000322300:R219G;ENSP00000448292:R219G;ENSP00000447609:R213G	.	R	+	1	2	TMTC2	81813728	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	2.269000	0.43346	-0.141000	0.11374	0.533000	0.62120	AGG	.		0.378	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	Missense_Mutation
DNMBP	23268	hgsc.bcm.edu	37	10	101716493	101716493	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr10:101716493G>T	ENST00000324109.4	-	4	829	c.738C>A	c.(736-738)acC>acA	p.T246T	DNMBP-AS1_ENST00000434409.1_RNA|DNMBP_ENST00000342239.3_Silent_p.T246T	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	246	SH3 4. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T246T(1)		central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CGACCCCATAGGTCCCTGGCT	0.512																																					p.T246T		.											DNMBP,caecum,carcinoma,0,2	DNMBP	0	1	Substitution - coding silent(1)	ovary(1)	c.C738A						.						78.0	84.0	82.0					10																	101716493		2203	4300	6503	SO:0001819	synonymous_variant	23268	exon4			CCCATAGGTCCCT	AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.738C>A	10.37:g.101716493G>T		58	0		43	2	NM_015221	Q8IVY3|Q9Y2L3	Silent	SNP	ENST00000324109.4	37	CCDS7485.1																																																																																			.		0.512	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
OR4K2	390431	hgsc.bcm.edu	37	14	20344676	20344676	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr14:20344676G>T	ENST00000298642.2	+	1	286	c.250G>T	c.(250-252)Gat>Tat	p.D84Y		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GATGATTACAGATTACCTAAC	0.423																																					p.D84Y		.											OR4K2,NS,carcinoma,0,1	OR4K2	0	0			c.G250T						.						253.0	250.0	251.0					14																	20344676		2203	4300	6503	SO:0001583	missense	390431	exon1			ATTACAGATTACC		CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.250G>T	14.37:g.20344676G>T	ENSP00000298642:p.Asp84Tyr	91	0		43	2	NM_001005501	B2RNK8|Q6IFA5	Missense_Mutation	SNP	ENST00000298642.2	37	CCDS32023.1	.	.	.	.	.	.	.	.	.	.	.	15.37	2.812155	0.50527	.	.	ENSG00000165762	ENST00000298642	T	0.00420	7.47	5.27	5.27	0.74061	GPCR, rhodopsin-like superfamily (1);	0.119911	0.36972	N	0.002311	T	0.01489	0.0048	M	0.87328	2.875	0.34943	D	0.750485	D	0.76494	0.999	D	0.70016	0.967	T	0.49466	-0.8937	10	0.87932	D	0	.	16.4283	0.83832	0.0:0.0:1.0:0.0	.	84	Q8NGD2	OR4K2_HUMAN	Y	84	ENSP00000298642:D84Y	ENSP00000298642:D84Y	D	+	1	0	OR4K2	19414516	0.000000	0.05858	1.000000	0.80357	0.847000	0.48162	0.608000	0.24223	2.740000	0.93945	0.563000	0.77884	GAT	.		0.423	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409864.1		
CLASP2	23122	hgsc.bcm.edu	37	3	33592749	33592749	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:33592749G>T	ENST00000468888.2	-	30	3218	c.3172C>A	c.(3172-3174)Cgg>Agg	p.R1058R	CLASP2_ENST00000461133.3_Silent_p.R817R|CLASP2_ENST00000399362.4_Silent_p.R1057R|CLASP2_ENST00000480013.1_Silent_p.R837R|CLASP2_ENST00000539981.1_Silent_p.R827R|CLASP2_ENST00000307312.7_Silent_p.R539R|CLASP2_ENST00000359576.5_Silent_p.R1049R			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	838	Interaction with RSN and localization to the Golgi and kinetochores.|Required for cortical localization.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						TATACCTTCCGAACATCAGAA	0.388																																					p.R1059R		.											CLASP2,NS,carcinoma,0,1	CLASP2	0	0			c.C3175A						.						89.0	86.0	87.0					3																	33592749		1812	4073	5885	SO:0001819	synonymous_variant	23122	exon30			CCTTCCGAACATC	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.3172C>A	3.37:g.33592749G>T		95	0		48	2	NM_015097	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Silent	SNP	ENST00000468888.2	37		.	.	.	.	.	.	.	.	.	.	G	9.306	1.054334	0.19907	.	.	ENSG00000163539	ENST00000480385	.	.	.	5.27	3.28	0.37604	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.359	11.3481	0.49573	0.0:0.0:0.5241:0.4758	.	.	.	.	X	113	.	.	S	-	2	0	CLASP2	33567753	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.820000	0.55693	1.275000	0.44379	0.591000	0.81541	TCG	.		0.388	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
WDR61	80349	hgsc.bcm.edu	37	15	78580718	78580718	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr15:78580718G>T	ENST00000267973.2	-	8	840	c.569C>A	c.(568-570)gCc>gAc	p.A190D	WDR61_ENST00000559332.1_5'Flank|WDR61_ENST00000558311.1_Missense_Mutation_p.A190D|WDR61_ENST00000558459.1_Missense_Mutation_p.A97D			Q9GZS3	WDR61_HUMAN	WD repeat domain 61	190					histone H3-K4 trimethylation (GO:0080182)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9						AATGGGCATGGCATGGCCTGA	0.478																																					p.A190D		.											WDR61,colon,carcinoma,0,1	WDR61	0	0			c.C569A						.						157.0	120.0	133.0					15																	78580718		2196	4293	6489	SO:0001583	missense	80349	exon8			GGCATGGCATGGC		CCDS10300.1	15q25.1	2013-01-09			ENSG00000140395	ENSG00000140395		"""WD repeat domain containing"""	30300	protein-coding gene	gene with protein product		609540				12477932	Standard	NM_025234		Approved	REC14	uc002bdn.3	Q9GZS3	OTTHUMG00000143735	ENST00000267973.2:c.569C>A	15.37:g.78580718G>T	ENSP00000267973:p.Ala190Asp	47	0		27	2	NM_025234	D3DW84|Q6IA22|Q7Z4X4	Missense_Mutation	SNP	ENST00000267973.2	37	CCDS10300.1	.	.	.	.	.	.	.	.	.	.	G	34	5.376655	0.95945	.	.	ENSG00000140395	ENST00000267973	T	0.59638	0.25	5.88	5.88	0.94601	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047802	0.85682	D	0.000000	T	0.55768	0.1941	N	0.20881	0.62	0.80722	D	1	D	0.56746	0.977	P	0.50590	0.645	T	0.52480	-0.8570	10	0.34782	T	0.22	-2.7593	19.2252	0.93815	0.0:0.0:1.0:0.0	.	190	Q9GZS3	WDR61_HUMAN	D	190	ENSP00000267973:A190D	ENSP00000267973:A190D	A	-	2	0	WDR61	76367773	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	9.382000	0.97209	2.788000	0.95919	0.555000	0.69702	GCC	.		0.478	WDR61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289803.3	NM_025234	
GLG1	2734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	74505136	74505136	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr16:74505136T>A	ENST00000422840.2	-	15	2163	c.2164A>T	c.(2164-2166)Ata>Tta	p.I722L	GLG1_ENST00000447066.2_Missense_Mutation_p.I711L|GLG1_ENST00000205061.5_Missense_Mutation_p.I722L	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	722					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TTGTTCTGTATCAGACACTCC	0.468																																					p.I722L		.											.	.	.	0			c.A2164T						.						347.0	292.0	311.0					16																	74505136		2198	4300	6498	SO:0001583	missense	2734	exon15			TCTGTATCAGACA		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2164A>T	16.37:g.74505136T>A	ENSP00000405984:p.Ile722Leu	49	0		23	11	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.038565	0.93630	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	6.17	6.17	0.99709	.	0.051523	0.85682	D	0.000000	T	0.52773	0.1755	N	0.20574	0.59	0.80722	D	1	B;P;P	0.44309	0.223;0.798;0.832	B;B;P	0.47346	0.17;0.409;0.544	T	0.55503	-0.8131	9	0.49607	T	0.09	-5.198	16.8222	0.85835	0.0:0.0:0.0:1.0	.	722;722;711	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	L	722;711;722	.	ENSP00000205061:I722L	I	-	1	0	GLG1	73062637	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.904000	0.63279	2.371000	0.80710	0.533000	0.62120	ATA	.		0.468	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
ZNF317	57693	hgsc.bcm.edu	37	19	9271878	9271878	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr19:9271878G>T	ENST00000247956.6	+	7	1862	c.1557G>T	c.(1555-1557)acG>acT	p.T519T	ZNF317_ENST00000360385.3_Silent_p.T487T	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	519					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T519T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						CGCTGAAGACGCACATGCGAA	0.547																																					p.T519T		.											ZNF317,colon,carcinoma,0,1	ZNF317	0	1	Substitution - coding silent(1)	large_intestine(1)	c.G1557T						.						88.0	73.0	78.0					19																	9271878		2203	4300	6503	SO:0001819	synonymous_variant	57693	exon7			GAAGACGCACATG	AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.1557G>T	19.37:g.9271878G>T		35	0		21	2	NM_020933	Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Silent	SNP	ENST00000247956.6	37	CCDS12210.1																																																																																			.		0.547	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448995.1	NM_020933	
TRIP11	9321	hgsc.bcm.edu;bcgsc.ca	37	14	92474186	92474186	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr14:92474186T>C	ENST00000267622.4	-	10	1698	c.1325A>G	c.(1324-1326)cAg>cGg	p.Q442R		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	442					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		AAGTGACATCTGAAGTTCTTC	0.294			T	PDGFRB	AML																																p.Q442R	Ovarian(84;609 1888 9852 42686)	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	.	.	0			c.A1325G						.						51.0	47.0	48.0					14																	92474186		2200	4295	6495	SO:0001583	missense	9321	exon10			GACATCTGAAGTT	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.1325A>G	14.37:g.92474186T>C	ENSP00000267622:p.Gln442Arg	60	0		62	4	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	.	.	.	.	.	.	.	.	.	.	T	10.80	1.452068	0.26074	.	.	ENSG00000100815	ENST00000267622;ENST00000542257	T	0.56611	0.45	5.85	5.85	0.93711	.	0.276460	0.34291	N	0.004096	T	0.60196	0.2250	M	0.69823	2.125	0.29721	N	0.838633	B;P	0.52463	0.029;0.953	B;P	0.48982	0.018;0.597	T	0.61272	-0.7096	10	0.21014	T	0.42	.	16.2483	0.82460	0.0:0.0:0.0:1.0	.	178;442	F5H1Z0;Q15643	.;TRIPB_HUMAN	R	442;178	ENSP00000267622:Q442R	ENSP00000267622:Q442R	Q	-	2	0	TRIP11	91543939	1.000000	0.71417	0.634000	0.29324	0.104000	0.19210	4.873000	0.63057	2.237000	0.73441	0.459000	0.35465	CAG	.		0.294	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
KDR	3791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	55956163	55956163	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr4:55956163C>T	ENST00000263923.4	-	23	3447	c.3152G>A	c.(3151-3153)cGg>cAg	p.R1051Q	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	1051	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.R1051Q(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATAAATATCCCGGGCCAAGCC	0.408			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.R1051Q		.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	KDR,NS,carcinoma,0,1	KDR	0	1	Substitution - Missense(1)	kidney(1)	c.G3152A						.						80.0	82.0	81.0					4																	55956163		2203	4300	6503	SO:0001583	missense	3791	exon23			ATATCCCGGGCCA	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.3152G>A	4.37:g.55956163C>T	ENSP00000263923:p.Arg1051Gln	68	0		30	8	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	C	36	5.710324	0.96821	.	.	ENSG00000128052	ENST00000263923	D	0.84873	-1.91	5.65	5.65	0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92097	0.7495	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92118	0.5701	10	0.87932	D	0	.	20.0835	0.97793	0.0:1.0:0.0:0.0	.	1051	P35968	VGFR2_HUMAN	Q	1051	ENSP00000263923:R1051Q	ENSP00000263923:R1051Q	R	-	2	0	KDR	55650920	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.822000	0.97130	0.563000	0.77884	CGG	.		0.408	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
MEGF6	1953	hgsc.bcm.edu	37	1	3440803	3440803	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:3440803G>T	ENST00000356575.4	-	5	715	c.489C>A	c.(487-489)gaC>gaA	p.D163E	MEGF6_ENST00000294599.4_Missense_Mutation_p.D58E	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	163	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.D163E(1)		cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		TTCGGCATTCGTCCACATCTG	0.652																																					p.D163E	Ovarian(73;978 3658)	.											MEGF6,NS,carcinoma,0,1	MEGF6	0	1	Substitution - Missense(1)	lung(1)	c.C489A						.						54.0	65.0	62.0					1																	3440803		2053	4203	6256	SO:0001583	missense	1953	exon5			GCATTCGTCCACA	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.489C>A	1.37:g.3440803G>T	ENSP00000348982:p.Asp163Glu	84	0		13	2	NM_001409	Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	37	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.198997	0.38806	.	.	ENSG00000162591	ENST00000294599;ENST00000356575	D;D	0.91945	-2.55;-2.94	4.47	-5.38	0.02673	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.054278	0.64402	D	0.000001	D	0.96081	0.8723	H	0.95224	3.64	0.30553	N	0.765319	D;D	0.89917	0.994;1.0	D;D	0.80764	0.972;0.994	D	0.93343	0.6711	10	0.49607	T	0.09	-26.9228	13.1827	0.59663	0.6231:0.0:0.3769:0.0	.	163;58	O75095;O75095-2	MEGF6_HUMAN;.	E	58;163	ENSP00000294599:D58E;ENSP00000348982:D163E	ENSP00000294599:D58E	D	-	3	2	MEGF6	3430663	0.004000	0.15560	0.952000	0.39060	0.202000	0.24057	-1.337000	0.02657	-0.983000	0.03511	-0.320000	0.08662	GAC	.		0.652	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	
ANK3	288	hgsc.bcm.edu	37	10	61994461	61994461	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr10:61994461G>T	ENST00000280772.2	-	8	1073	c.882C>A	c.(880-882)atC>atA	p.I294I	ANK3_ENST00000503366.1_Silent_p.I277I|ANK3_ENST00000373827.2_Silent_p.I288I	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	294					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTTTGGCATCGATTTTAGCTC	0.388																																					p.I294I		.											ANK3,NS,carcinoma,0,1	ANK3	0	0			c.C882A						.						191.0	150.0	163.0					10																	61994461		2203	4300	6503	SO:0001819	synonymous_variant	288	exon8			GGCATCGATTTTA	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.882C>A	10.37:g.61994461G>T		78	0		74	3	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	37	CCDS7258.1																																																																																			.		0.388	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
PSMA5	5686	hgsc.bcm.edu	37	1	109944658	109944658	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:109944658C>A	ENST00000271308.4	-	9	723	c.703G>T	c.(703-705)Gaa>Taa	p.E235*	PSMA5_ENST00000538610.1_Nonsense_Mutation_p.E177*|PSMA5_ENST00000490870.1_5'UTR	NM_002790.3	NP_002781.2	P28066	PSA5_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 5	235					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)	5		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.045)|Colorectal(144;0.116)|Epithelial(280;0.187)|all cancers(265;0.196)|LUSC - Lung squamous cell carcinoma(189;0.235)		ATAACCTCTTCAAGTTCTTCC	0.418																																					p.E235X		.											.	.	.	0			c.G703T						.						150.0	148.0	149.0					1																	109944658		2203	4300	6503	SO:0001587	stop_gained	5686	exon9			CCTCTTCAAGTTC	X61970	CCDS799.1, CCDS55619.1	1p13	2008-02-05			ENSG00000143106	ENSG00000143106		"""Proteasome (prosome, macropain) subunits"""	9534	protein-coding gene	gene with protein product		176844				1888762	Standard	NM_002790		Approved	ZETA	uc001dxn.3	P28066	OTTHUMG00000012001	ENST00000271308.4:c.703G>T	1.37:g.109944658C>A	ENSP00000271308:p.Glu235*	89	0		59	4	NM_002790	B2R8F6|B4E2V4|Q3T1C1|Q6IBF7	Nonsense_Mutation	SNP	ENST00000271308.4	37	CCDS799.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.263402	0.80358	.	.	ENSG00000143106	ENST00000538610;ENST00000271308	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-27.3866	18.396	0.90499	0.0:1.0:0.0:0.0	.	.	.	.	X	177;235	.	ENSP00000271308:E235X	E	-	1	0	PSMA5	109746181	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.612000	0.82975	2.882000	0.98803	0.655000	0.94253	GAA	.		0.418	PSMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033192.2	NM_002790	
SNORA51	677831	hgsc.bcm.edu	37	1	228785861	228785861	+	RNA	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:228785861C>T	ENST00000384151.1	+	0	0				RNA5SP18_ENST00000390935.1_RNA					small nucleolar RNA, H/ACA box 51																		ctcttgaatacagatttctaa	0.423																																					.		.											.	.	.	0			.						.																																					574029	.			TGAATACAGATTT	AJ609477		20p13	2013-09-05			ENSG00000207427	ENSG00000271798		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32644	non-coding RNA	RNA, small nucleolar						15199136, 16381836	Standard	NR_002981		Approved	ACA51	uc002wgk.1				1.37:g.228785861C>T		39	0		73	4	.		RNA	SNP	ENST00000384151.1	37																																																																																				.		0.423	SNORA51.6-201	NOVEL	basic	snoRNA	snoRNA		NR_002981	
FAM135A	57579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	71195946	71195946	+	Intron	SNP	A	A	G			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:71195946A>G	ENST00000418814.2	+	10	1437				FAM135A_ENST00000361499.3_Intron|FAM135A_ENST00000370479.3_Splice_Site_p.L257L|FAM135A_ENST00000505769.1_Intron|FAM135A_ENST00000457062.2_Splice_Site_p.L257L|FAM135A_ENST00000505868.1_Intron	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A											breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						ACAACCATCTAGGTACGTTTA	0.338																																					p.L257L		.											.	.	.	0			c.A771G						.						87.0	78.0	81.0					6																	71195946		2203	4300	6503	SO:0001627	intron_variant	57579	exon9			CCATCTAGGTACG	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.823+4089A>G	6.37:g.71195946A>G		85	0		58	17	NM_020819	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Silent	SNP	ENST00000418814.2	37	CCDS55028.1																																																																																			.		0.338	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	NM_020819	
ZC3H7A	29066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	11859523	11859523	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr16:11859523T>C	ENST00000396516.2	-	13	1738	c.1541A>G	c.(1540-1542)gAa>gGa	p.E514G	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.E514G			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	514						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						ATATCTACATTCCTCCTCAGC	0.502																																					p.E514G		.											.	.	.	0			c.A1541G						.						94.0	81.0	85.0					16																	11859523		2197	4300	6497	SO:0001583	missense	29066	exon14			CTACATTCCTCCT	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1541A>G	16.37:g.11859523T>C	ENSP00000379773:p.Glu514Gly	51	0		33	9	NM_014153	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	37	CCDS10550.1	.	.	.	.	.	.	.	.	.	.	T	16.82	3.228561	0.58777	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.09163	3.01;3.01	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.14960	0.0361	L	0.51422	1.61	0.80722	D	1	B;B	0.27013	0.166;0.103	B;B	0.33750	0.169;0.082	T	0.03739	-1.1008	10	0.33940	T	0.23	.	15.3479	0.74355	0.0:0.0:0.0:1.0	.	235;514	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	G	514	ENSP00000347999:E514G;ENSP00000379773:E514G	ENSP00000347999:E514G	E	-	2	0	ZC3H7A	11767024	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.210000	0.71456	0.533000	0.62120	GAA	.		0.502	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153	
ARMC9	80210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	232070973	232070973	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:232070973G>A	ENST00000349938.4	+	2	216	c.22G>A	c.(22-24)Gaa>Aaa	p.E8K	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	8	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.					extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		TCTGGCTCATGAATCTGAATT	0.348																																					p.E8K		.											.	.	.	0			c.G22A						.						116.0	114.0	115.0					2																	232070973		2203	4300	6503	SO:0001583	missense	80210	exon2			GCTCATGAATCTG	BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.22G>A	2.37:g.232070973G>A	ENSP00000258417:p.Glu8Lys	64	0		47	8	NM_025139	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	ENST00000349938.4	37	CCDS2484.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525625	0.85600	.	.	ENSG00000135931	ENST00000349938;ENST00000359743;ENST00000440107	T;T	0.58060	2.07;0.36	5.2	5.2	0.72013	LisH dimerisation motif (2);	0.000000	0.85682	D	0.000000	T	0.67795	0.2931	L	0.50333	1.59	0.53005	D	0.999968	D	0.89917	1.0	D	0.87578	0.998	T	0.66352	-0.5945	10	0.41790	T	0.15	-20.9748	17.5249	0.87796	0.0:0.0:1.0:0.0	.	8	Q7Z3E5	ARMC9_HUMAN	K	8	ENSP00000258417:E8K;ENSP00000387391:E8K	ENSP00000258417:E8K	E	+	1	0	ARMC9	231779217	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	7.662000	0.83803	2.437000	0.82529	0.655000	0.94253	GAA	.		0.348	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139	
RDH12	145226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	68195982	68195982	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr14:68195982T>A	ENST00000551171.1	+	8	1057	c.733T>A	c.(733-735)Tgc>Agc	p.C245S	RDH12_ENST00000267502.3_Missense_Mutation_p.C245S|RDH12_ENST00000539142.1_Missense_Mutation_p.C245S	NM_152443.2	NP_689656.2	Q96NR8	RDH12_HUMAN	retinol dehydrogenase 12 (all-trans/9-cis/11-cis)	245					photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	intracellular (GO:0005622)|photoreceptor inner segment membrane (GO:0060342)	retinol dehydrogenase activity (GO:0004745)			large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(4)	12				all cancers(60;0.000704)|OV - Ovarian serous cystadenocarcinoma(108;0.00161)|BRCA - Breast invasive adenocarcinoma(234;0.00953)	Vitamin A(DB00162)	CTCCCTGCTCTGCCTGCTCTG	0.672																																					p.C245S		.											.	.	.	0			c.T733A						.						75.0	74.0	74.0					14																	68195982		2203	4300	6503	SO:0001583	missense	145226	exon8			CTGCTCTGCCTGC	AK054835	CCDS9787.1	14q24.1	2013-02-14	2006-05-09		ENSG00000139988	ENSG00000139988	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19977	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 2"""	608830	"""retinol dehydrogenase 12 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_152443		Approved	FLJ30273, SDR7C2, LCA13, RP53	uc001xjz.4	Q96NR8		ENST00000551171.1:c.733T>A	14.37:g.68195982T>A	ENSP00000449079:p.Cys245Ser	46	0		14	5	NM_152443	B2RDA2|Q8TAW6	Missense_Mutation	SNP	ENST00000551171.1	37	CCDS9787.1	.	.	.	.	.	.	.	.	.	.	T	13.65	2.301121	0.40694	.	.	ENSG00000139988	ENST00000551171;ENST00000267502;ENST00000539142	D;D;D	0.84070	-1.8;-1.8;-1.8	5.89	4.73	0.59995	NAD(P)-binding domain (1);	0.147737	0.42420	D	0.000702	T	0.56615	0.1997	N	0.01219	-0.95	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.49854	-0.8895	10	0.17369	T	0.5	.	9.4186	0.38536	0.3497:0.0:0.0:0.6503	.	245	Q96NR8	RDH12_HUMAN	S	245	ENSP00000449079:C245S;ENSP00000267502:C245S;ENSP00000438715:C245S	ENSP00000267502:C245S	C	+	1	0	RDH12	67265735	1.000000	0.71417	0.444000	0.26895	0.662000	0.39071	1.415000	0.34748	1.021000	0.39600	0.533000	0.62120	TGC	.		0.672	RDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406918.1		
LDLR	3949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11230846	11230846	+	Silent	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr19:11230846T>C	ENST00000558518.1	+	13	2111	c.1924T>C	c.(1924-1926)Ttg>Ctg	p.L642L	LDLR_ENST00000545707.1_Silent_p.L515L|LDLR_ENST00000557933.1_Silent_p.L642L|LDLR_ENST00000455727.2_Silent_p.L474L|LDLR_ENST00000558013.1_Silent_p.L642L|LDLR_ENST00000535915.1_Silent_p.L601L	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	642					cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	TGTCAACTTGTTGGCTGAAAA	0.502																																					p.L642L	GBM(18;201 575 7820 21545)	.											.	.	.	1	Unknown(1)	lung(1)	c.T1924C						.						129.0	102.0	111.0					19																	11230846		2203	4300	6503	SO:0001819	synonymous_variant	3949	exon13			AACTTGTTGGCTG	AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.1924T>C	19.37:g.11230846T>C		68	0		44	23	NM_001195798	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Silent	SNP	ENST00000558518.1	37	CCDS12254.1																																																																																			.		0.502	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415973.2		
LRP1B	53353	hgsc.bcm.edu	37	2	141128375	141128375	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:141128375G>T	ENST00000389484.3	-	71	11883	c.10912C>A	c.(10912-10914)Cgg>Agg	p.R3638R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3638	LDL-receptor class A 29. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.R3638W(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTTTGCACCGAAACTGATCT	0.383										TSP Lung(27;0.18)																											p.R3638R	Colon(99;50 2074 2507 20106)	.											LRP1B,bladder,carcinoma,0,1	LRP1B	0	1	Substitution - Missense(1)	urinary_tract(1)	c.C10912A						.						177.0	164.0	168.0					2																	141128375		2203	4300	6503	SO:0001819	synonymous_variant	53353	exon71			TGCACCGAAACTG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10912C>A	2.37:g.141128375G>T		43	0		47	2	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																			.		0.383	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
MICAL1	64780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	109769503	109769503	+	Silent	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:109769503C>T	ENST00000358807.3	-	13	2069	c.1758G>A	c.(1756-1758)gtG>gtA	p.V586V	MICAL1_ENST00000358577.3_Silent_p.V500V|MICAL1_ENST00000368952.4_Silent_p.V605V	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	586	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		CCTGTGCAGACACCACCGGTG	0.617																																					p.V586V		.											.	.	.	0			c.G1758A						.						172.0	159.0	163.0					6																	109769503		2203	4300	6503	SO:0001819	synonymous_variant	64780	exon13			TGCAGACACCACC	AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.1758G>A	6.37:g.109769503C>T		24	0		19	9	NM_022765	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Silent	SNP	ENST00000358807.3	37	CCDS5076.1	.	.	.	.	.	.	.	.	.	.	C	8.394	0.840367	0.16891	.	.	ENSG00000135596	ENST00000433205	T	0.57107	0.42	5.38	2.38	0.29361	.	0.257251	0.35067	N	0.003471	T	0.40570	0.1122	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27971	-1.0058	7	0.38643	T	0.18	.	9.0192	0.36188	0.0:0.7021:0.1345:0.1633	.	.	.	.	I	148	ENSP00000408924:V148I	ENSP00000408924:V148I	V	-	1	0	MICAL1	109876196	1.000000	0.71417	0.921000	0.36526	0.835000	0.47333	1.799000	0.38824	0.635000	0.30488	-0.291000	0.09656	GTC	.		0.617	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
RABGAP1L	9910	hgsc.bcm.edu	37	1	174957825	174957825	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:174957825G>T	ENST00000367688.3	+	6	638	c.459G>T	c.(457-459)gaG>gaT	p.E153D	RABGAP1L_ENST00000367687.1_Missense_Mutation_p.E277D|RABGAP1L_ENST00000489615.1_Missense_Mutation_p.E270D|RABGAP1L_ENST00000347255.2_Missense_Mutation_p.E278D|RABGAP1L_ENST00000392064.2_Missense_Mutation_p.E208D|RABGAP1L_ENST00000367686.3_3'UTR|RABGAP1L_ENST00000325589.5_Missense_Mutation_p.E258D	NM_001243764.1	NP_001230693.1	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	153										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						TCAGCAAGGAGGGTGCTTTGA	0.438																																					p.E270D		.											.	.	.	0			c.G810T						.																																			SO:0001583	missense	9910	exon8			CAAGGAGGGTGCT	AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000367688.3:c.459G>T	1.37:g.174957825G>T	ENSP00000356661:p.Glu153Asp	69	0		98	4	NM_001243765	B7ZAA4	Missense_Mutation	SNP	ENST00000367688.3	37	CCDS55662.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.602079	0.46423	.	.	ENSG00000152061	ENST00000325589;ENST00000367687;ENST00000347255;ENST00000489615;ENST00000392064;ENST00000367688	T;T;T	0.14266	2.52;2.74;2.74	5.94	-1.08	0.09936	.	.	.	.	.	T	0.08179	0.0204	N	0.20766	0.605	0.38246	D	0.941468	B;B;B;B;B;B	0.09022	0.001;0.002;0.001;0.0;0.0;0.001	B;B;B;B;B;B	0.09377	0.003;0.004;0.003;0.001;0.003;0.003	T	0.32587	-0.9901	9	0.19147	T	0.46	.	12.7421	0.57259	0.349:0.0:0.651:0.0	.	153;208;270;277;278;156	B7ZAP0;F5H8L0;Q5R372-8;Q5R372-6;Q5R372-5;Q9Y6Y7	.;.;.;.;.;.	D	258;277;278;270;208;153	ENSP00000318603:E258D;ENSP00000356660:E277D;ENSP00000281844:E278D	ENSP00000318603:E258D	E	+	3	2	RABGAP1L	173224448	0.952000	0.32445	0.980000	0.43619	0.921000	0.55340	0.005000	0.13129	-0.080000	0.12685	0.561000	0.74099	GAG	.		0.438	RABGAP1L-015	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000084573.2	NM_001243765	
BRCA2	675	hgsc.bcm.edu	37	13	32971139	32971139	+	Silent	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr13:32971139G>A	ENST00000380152.3	+	26	9839	c.9606G>A	c.(9604-9606)ccG>ccA	p.P3202P	BRCA2_ENST00000544455.1_Silent_p.P3202P			P51587	BRCA2_HUMAN	breast cancer 2, early onset	3202					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CTTCAGGGCCGTACACTGCTC	0.393			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.P3202P	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	BRCA2_ENST00000544455,colon,carcinoma,0,2	BRCA2_ENST00000544455	0	0			c.G9606A						.						247.0	240.0	242.0					13																	32971139		2203	4300	6503	SO:0001819	synonymous_variant	675	exon26	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	AGGGCCGTACACT	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.9606G>A	13.37:g.32971139G>A		87	0		47	2	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Silent	SNP	ENST00000380152.3	37	CCDS9344.1																																																																																			.		0.393	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
PFKP	5214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	3124594	3124594	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr10:3124594G>A	ENST00000381125.4	+	2	203	c.127G>A	c.(127-129)Gtc>Atc	p.V43I	PFKP_ENST00000421751.1_3'UTR|PFKP_ENST00000381075.2_Missense_Mutation_p.R8H	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	43	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		GAACGCTGCCGTCCGTGCCGT	0.587																																					p.V43I		.											.	.	.	0			c.G127A						.						119.0	95.0	103.0					10																	3124594		2203	4300	6503	SO:0001583	missense	5214	exon2			GCTGCCGTCCGTG	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.127G>A	10.37:g.3124594G>A	ENSP00000370517:p.Val43Ile	33	0		22	8	NM_002627	B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	ENST00000381125.4	37	CCDS7059.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.17|15.17	2.754488|2.754488	0.49362|0.49362	.|.	.|.	ENSG00000067057|ENSG00000067057	ENST00000397834;ENST00000381075|ENST00000381125;ENST00000421751;ENST00000407806	T|T;T;T	0.80738|0.75477	-1.41|-0.94;-0.94;-0.94	4.31|4.31	4.31|4.31	0.51392|0.51392	.|Phosphofructokinase domain (2);	.|0.404483	.|0.26903	.|N	.|0.021905	T|T	0.75265|0.75265	0.3826|0.3826	L|L	0.31578|0.31578	0.945|0.945	0.80722|0.80722	D|D	1|1	P|D	0.44006|0.67145	0.824|0.996	B|P	0.31337|0.60173	0.128|0.87	T|T	0.77851|0.77851	-0.2434|-0.2434	9|10	0.62326|0.72032	D|D	0.03|0.01	.|.	12.5582|12.5582	0.56265|0.56265	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	8|43	Q5VSR7|Q01813	.|K6PP_HUMAN	H|I	5;8|43;5;5	ENSP00000370465:R8H|ENSP00000370517:V43I;ENSP00000410590:V5I;ENSP00000385880:V5I	ENSP00000370465:R8H|ENSP00000370517:V43I	R|V	+|+	2|1	0|0	PFKP|PFKP	3114594|3114594	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.022000|0.022000	0.10575|0.10575	7.242000|7.242000	0.78210|0.78210	2.416000|2.416000	0.81992|0.81992	0.545000|0.545000	0.68477|0.68477	CGT|GTC	.		0.587	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1	NM_002627	
LRRC6	23639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	133627332	133627332	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr8:133627332G>A	ENST00000519595.1	-	8	1024	c.926C>T	c.(925-927)tCt>tTt	p.S309F	LRRC6_ENST00000250173.1_Missense_Mutation_p.S309F|LRRC6_ENST00000518642.1_Missense_Mutation_p.S309F			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	309	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			ATCTTTCAAAGAGAAGTCAAT	0.323																																					p.S309F		.											.	.	.	0			c.C926T						.						74.0	77.0	76.0					8																	133627332		2202	4293	6495	SO:0001583	missense	23639	exon8			TTCAAAGAGAAGT	U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.926C>T	8.37:g.133627332G>A	ENSP00000429791:p.Ser309Phe	52	0		40	15	NM_012472	Q13648|Q4G183	Missense_Mutation	SNP	ENST00000519595.1	37		.	.	.	.	.	.	.	.	.	.	G	10.36	1.329851	0.24167	.	.	ENSG00000129295	ENST00000519595;ENST00000518642;ENST00000250173;ENST00000395414	T;T;T	0.55413	0.68;0.52;0.68	5.2	4.31	0.51392	CS-like domain (1);	0.332224	0.32190	N	0.006458	T	0.55847	0.1946	M	0.79805	2.47	0.51233	D	0.999915	B	0.14805	0.011	B	0.16722	0.016	T	0.59289	-0.7482	10	0.87932	D	0	-9.4353	12.4619	0.55736	0.0:0.0:0.8321:0.1679	.	309	Q86X45	LRRC6_HUMAN	F	309	ENSP00000429791:S309F;ENSP00000428610:S309F;ENSP00000250173:S309F	ENSP00000250173:S309F	S	-	2	0	LRRC6	133696514	1.000000	0.71417	1.000000	0.80357	0.391000	0.30476	1.815000	0.38981	1.296000	0.44742	0.563000	0.77884	TCT	.		0.323	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379578.1	NM_012472	
RCCD1	91433	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	91504867	91504867	+	Silent	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr15:91504867C>T	ENST00000394258.2	+	8	1201	c.999C>T	c.(997-999)ggC>ggT	p.G333G	RCCD1_ENST00000555155.1_Silent_p.G331G|RCCD1_ENST00000556618.1_Silent_p.G333G	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	333						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			GACAGCTGGGCCACGAGGACA	0.547																																					p.G333G		.											.	.	.	0			c.C999T						.						115.0	99.0	104.0					15																	91504867		2198	4298	6496	SO:0001819	synonymous_variant	91433	exon8			GCTGGGCCACGAG		CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.999C>T	15.37:g.91504867C>T		52	0		27	4	NM_001017919	B2RTP9|Q29RX6	Silent	SNP	ENST00000394258.2	37	CCDS32333.1																																																																																			.		0.547	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414748.1	NM_033544	
KIF21A	55605	hgsc.bcm.edu;bcgsc.ca	37	12	39701493	39701493	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr12:39701493G>T	ENST00000361418.5	-	34	4331	c.4316C>A	c.(4315-4317)gCa>gAa	p.A1439E	KIF21A_ENST00000547745.1_5'Flank|KIF21A_ENST00000395670.3_Missense_Mutation_p.A1440E|KIF21A_ENST00000541463.2_Missense_Mutation_p.A1386E|KIF21A_ENST00000544797.2_Missense_Mutation_p.A1402E|KIF21A_ENST00000361961.3_Missense_Mutation_p.A1426E			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1439					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				ACTGGTACTTGCAGAACAAGC	0.428																																					p.A1439E		.											.	.	.	0			c.C4316A						.						125.0	104.0	111.0					12																	39701493		2203	4300	6503	SO:0001583	missense	55605	exon34			GTACTTGCAGAAC	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.4316C>A	12.37:g.39701493G>T	ENSP00000354878:p.Ala1439Glu	82	0		54	4	NM_001173464	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	37	CCDS53776.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.03|16.03	3.007680|3.007680	0.54361|0.54361	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000545778;ENST00000551264;ENST00000544797;ENST00000361418;ENST00000541463|ENST00000552961	T;T;T;T;T;T|.	0.71461|.	-0.57;-0.53;0.29;-0.55;-0.48;-0.54|.	5.72|5.72	4.83|4.83	0.62350|0.62350	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.259372|.	0.26927|.	N|.	0.021785|.	T|T	0.39009|0.39009	0.1062|0.1062	L|L	0.39245|0.39245	1.2|1.2	0.25749|0.25749	N|N	0.985076|0.985076	B;B;B;B;B;B|.	0.33266|.	0.277;0.302;0.262;0.277;0.404;0.374|.	B;B;B;B;B;B|.	0.35688|.	0.109;0.167;0.131;0.109;0.208;0.208|.	T|T	0.25606|0.25606	-1.0127|-1.0127	10|5	0.72032|.	D|.	0.01|.	.|.	9.3277|9.3277	0.38003|0.38003	0.0806:0.2594:0.66:0.0|0.0806:0.2594:0.66:0.0	.|.	1402;1386;1439;1426;1392;426|.	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3;F5H0V8|.	.;.;KI21A_HUMAN;.;.;.|.	E|K	1426;1440;1392;426;420;1402;1439;1386|740	ENSP00000354851:A1426E;ENSP00000379029:A1440E;ENSP00000448792:A420E;ENSP00000445606:A1402E;ENSP00000354878:A1439E;ENSP00000438075:A1386E|.	ENSP00000344501:A1392E|.	A|Q	-|-	2|1	0|0	KIF21A|KIF21A	37987760|37987760	0.998000|0.998000	0.40836|0.40836	0.994000|0.994000	0.49952|0.49952	0.998000|0.998000	0.95712|0.95712	4.577000|4.577000	0.60922|0.60922	1.430000|1.430000	0.47334|0.47334	0.650000|0.650000	0.86243|0.86243	GCA|CAA	.		0.428	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641	
NBR2	10230	hgsc.bcm.edu;broad.mit.edu	37	17	41290728	41290728	+	RNA	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr17:41290728C>A	ENST00000460115.1	+	0	279					NR_003108.1		O15453	NBR2_HUMAN	neighbor of BRCA1 gene 2 (non-protein coding)																		agggtgctgccaataaaaggt	0.542																																					.		.											.	.	.	0			.						.						48.0	42.0	43.0					17																	41290728		1568	3582	5150			10230	.			TGCTGCCAATAAA	U88573		17q21	2012-10-16	2009-08-21		ENSG00000198496	ENSG00000198496		"""Long non-coding RNAs"""	20691	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 192"""		"""neighbor of BRCA1 gene 2"""			9215675, 15777733	Standard	NR_003108		Approved	NCRNA00192	uc002idf.3	O15453	OTTHUMG00000140395		17.37:g.41290728C>A		136	0		75	5	.	Q3LRJ7	RNA	SNP	ENST00000460115.1	37																																																																																				.		0.542	NBR2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000277175.1	NR_003108	
NXF4	55999	hgsc.bcm.edu	37	X	101818123	101818123	+	RNA	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chrX:101818123C>A	ENST00000360035.2	+	0	724					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						CTCTCTTCATCTGTCTCTGCA	0.517																																					.		.											.	.	.	0			.						.																																					55999	.			CTTCATCTGTCTC	AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101818123C>A		46	0		9	7	.		RNA	SNP	ENST00000360035.2	37																																																																																				.		0.517	NXF4-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000095720.1		
CDH10	1008	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	24488016	24488016	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr5:24488016G>A	ENST00000264463.4	-	12	2630	c.2123C>T	c.(2122-2124)aCg>aTg	p.T708M	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	708					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		CCGGACGTCCGTGTTATCTGG	0.473										HNSCC(23;0.051)																											p.T708M		.											CDH10,NS,carcinoma,0,1	CDH10	0	0			c.C2123T						.						80.0	86.0	84.0					5																	24488016		2203	4300	6503	SO:0001583	missense	1008	exon12			ACGTCCGTGTTAT	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2123C>T	5.37:g.24488016G>A	ENSP00000264463:p.Thr708Met	57	0		20	4	NM_006727	Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.653090	0.67472	.	.	ENSG00000040731	ENST00000264463	T	0.77358	-1.09	5.41	5.41	0.78517	Cadherin, cytoplasmic domain (1);	0.385638	0.31312	N	0.007880	D	0.85695	0.5756	M	0.82056	2.57	0.41503	D	0.988298	D	0.61080	0.989	P	0.54372	0.75	D	0.86626	0.1882	10	0.46703	T	0.11	.	18.1996	0.89833	0.0:0.0:1.0:0.0	.	708	Q9Y6N8	CAD10_HUMAN	M	708	ENSP00000264463:T708M	ENSP00000264463:T708M	T	-	2	0	CDH10	24523773	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.495000	0.73665	2.544000	0.85801	0.655000	0.94253	ACG	.		0.473	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
NF2	4771	hgsc.bcm.edu	37	22	30054254	30054254	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr22:30054254G>T	ENST00000338641.4	+	7	1116		c.e7+1		NF2_ENST00000347330.5_Intron|NF2_ENST00000403435.1_Splice_Site|NF2_ENST00000397789.3_Splice_Site|NF2_ENST00000361166.4_Splice_Site|NF2_ENST00000353887.4_Splice_Site|NF2_ENST00000361452.4_Splice_Site|NF2_ENST00000403999.3_Splice_Site|NF2_ENST00000361676.4_Splice_Site|NF2_ENST00000334961.7_Splice_Site|NF2_ENST00000413209.2_Intron	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)						actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(18)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						TGCAATCCGGGTGTGTTGAAA	0.478			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												.		.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	NF2_ENST00000403999,colon,carcinoma,0,13	NF2_ENST00000403999	0	18	Unknown(18)	meninges(10)|soft_tissue(4)|central_nervous_system(2)|large_intestine(1)|stomach(1)	c.675+1G>T	GRCh37	CS951488	NF2	S		.						183.0	143.0	157.0					22																	30054254		2203	4300	6503	SO:0001630	splice_region_variant	4771	exon7	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	ATCCGGGTGTGTT	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.675+1G>T	22.37:g.30054254G>T		78	0		45	2	NM_016418	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Splice_Site	SNP	ENST00000338641.4	37	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162683	0.57368	.	.	ENSG00000186575	ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	.	.	.	5.75	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7764	0.85551	0.0:0.1291:0.8709:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF2	28384254	1.000000	0.71417	1.000000	0.80357	0.482000	0.33219	9.771000	0.98977	1.403000	0.46800	-0.302000	0.09304	.	.		0.478	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	Intron
UGT3A1	133688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	35965666	35965666	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr5:35965666T>C	ENST00000274278.3	-	4	1022	c.665A>G	c.(664-666)gAc>gGc	p.D222G	UGT3A1_ENST00000507113.1_Missense_Mutation_p.D188G|UGT3A1_ENST00000503189.1_Missense_Mutation_p.D222G|UGT3A1_ENST00000333811.4_Missense_Mutation_p.D168G|UGT3A1_ENST00000513233.1_Intron	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	222						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GATGGTGTTGTCAAATGTAGA	0.443																																					p.D222G		.											.	.	.	0			c.A665G						.						120.0	123.0	122.0					5																	35965666		2203	4300	6503	SO:0001583	missense	133688	exon4			GTGTTGTCAAATG		CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.665A>G	5.37:g.35965666T>C	ENSP00000274278:p.Asp222Gly	115	0		54	26	NM_152404	G5E961|Q8IYS9|Q8NAW4|Q96DM6	Missense_Mutation	SNP	ENST00000274278.3	37	CCDS3913.1	.	.	.	.	.	.	.	.	.	.	T	11.69	1.712882	0.30413	.	.	ENSG00000145626	ENST00000274278;ENST00000503189;ENST00000507113;ENST00000333811	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	3.05	3.05	0.35203	.	0.482842	0.19329	N	0.116946	T	0.63486	0.2515	M	0.64260	1.97	0.49299	D	0.99977	P;B;B;B	0.40250	0.709;0.234;0.331;0.067	P;B;B;B	0.45099	0.469;0.25;0.264;0.169	T	0.66988	-0.5784	10	0.62326	D	0.03	.	10.867	0.46862	0.0:0.0:0.0:1.0	.	188;222;168;222	E9PD17;B7Z8Q8;G5E961;Q6NUS8	.;.;.;UD3A1_HUMAN	G	222;222;188;168	ENSP00000274278:D222G;ENSP00000427079:D222G;ENSP00000426100:D188G;ENSP00000328033:D168G	ENSP00000274278:D222G	D	-	2	0	UGT3A1	36001423	0.994000	0.37717	0.850000	0.33497	0.666000	0.39218	4.321000	0.59209	1.333000	0.45449	0.260000	0.18958	GAC	.		0.443	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253770.2	NM_152404	
OPRL1	4987	hgsc.bcm.edu	37	20	62724277	62724277	+	Silent	SNP	G	G	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr20:62724277G>C	ENST00000349451.3	+	4	616	c.204G>C	c.(202-204)ggG>ggC	p.G68G	OPRL1_ENST00000336866.2_Silent_p.G68G|OPRL1_ENST00000355631.4_Silent_p.G68G	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	68					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)	p.G68G(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					GGCTCCTGGGGAACTGCCTTG	0.637																																					p.G68G		.											OPRL1,colon,carcinoma,0,1	OPRL1	0	1	Substitution - coding silent(1)	large_intestine(1)	c.G204C						.						80.0	70.0	73.0					20																	62724277		2199	4291	6490	SO:0001819	synonymous_variant	4987	exon2			CCTGGGGAACTGC		CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.204G>C	20.37:g.62724277G>C		74	0		45	2	NM_000913	Q8TD34|Q8WYH9|Q9H4K4	Silent	SNP	ENST00000349451.3	37	CCDS13556.1																																																																																			.		0.637	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080295.1	NM_182647	
LRIT3	345193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	110788888	110788888	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr4:110788888T>A	ENST00000594814.1	+	3	681	c.681T>A	c.(679-681)gaT>gaA	p.D227E	LRIT3_ENST00000409621.2_Missense_Mutation_p.D44E|LRIT3_ENST00000379920.3_Missense_Mutation_p.D182E|LRIT3_ENST00000327908.3_Missense_Mutation_p.D44E	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	227	LRRCT.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		TGCTTCTGGATCCACTGATGA	0.458																																					p.D227E		.											.	.	.	0			c.T681A						.						146.0	123.0	131.0					4																	110788888		2203	4300	6503	SO:0001583	missense	345193	exon3			TCTGGATCCACTG	AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.681T>A	4.37:g.110788888T>A	ENSP00000469759:p.Asp227Glu	53	0		29	13	NM_198506	C9J1C2|Q6ZTG1	Missense_Mutation	SNP	ENST00000594814.1	37	CCDS3688.3	.	.	.	.	.	.	.	.	.	.	T	21.4	4.146293	0.77888	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	T;T;T	0.55930	0.49;0.71;0.49	5.88	-7.27	0.01461	.	0.000000	0.85682	D	0.000000	T	0.64271	0.2583	L	0.54323	1.7	0.43149	D	0.994916	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.70985	-0.4723	10	0.49607	T	0.09	.	21.8843	0.99962	0.0:0.7225:0.0:0.2775	.	182;44	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	E	44;182;44	ENSP00000328222:D44E;ENSP00000369252:D182E;ENSP00000386734:D44E	ENSP00000328222:D44E	D	+	3	2	LRIT3	111008337	0.004000	0.15560	0.683000	0.30040	0.804000	0.45430	-1.113000	0.03296	-1.294000	0.02360	0.533000	0.62120	GAT	.		0.458	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335270.2	NM_198506	
PKD1	5310	hgsc.bcm.edu;bcgsc.ca	37	16	2162835	2162835	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr16:2162835G>T	ENST00000262304.4	-	13	3323	c.3115C>A	c.(3115-3117)Ctg>Atg	p.L1039M	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.L1039M	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1039	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCCGCCGTCAGTGCTAGCGTG	0.662																																					p.L1039M		.											.	.	.	0			c.C3115A						.						84.0	80.0	82.0					16																	2162835		2197	4299	6496	SO:0001583	missense	5310	exon13			CCGTCAGTGCTAG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.3115C>A	16.37:g.2162835G>T	ENSP00000262304:p.Leu1039Met	86	0		79	5	NM_000296	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	g	13.19	2.162423	0.38217	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.63744	-0.06;-0.06	4.99	4.02	0.46733	PKD/Chitinase domain (1);Polycystin cation channel (1);PKD domain (2);	0.077113	0.51477	D	0.000093	T	0.73567	0.3603	M	0.72894	2.215	0.36834	D	0.887039	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.76892	-0.2791	10	0.59425	D	0.04	.	6.377	0.21513	0.1617:0.1615:0.6768:0.0	.	1039;1039	P98161-3;P98161	.;PKD1_HUMAN	M	1039;1039;754	ENSP00000262304:L1039M;ENSP00000399501:L1039M	ENSP00000262304:L1039M	L	-	1	2	PKD1	2102836	0.895000	0.30542	0.036000	0.18154	0.003000	0.03518	1.647000	0.37260	1.080000	0.41073	0.645000	0.84053	CTG	.		0.662	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
RICTOR	253260	hgsc.bcm.edu	37	5	38946582	38946582	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr5:38946582G>T	ENST00000357387.3	-	33	4417	c.4387C>A	c.(4387-4389)Cat>Aat	p.H1463N	RICTOR_ENST00000296782.5_Missense_Mutation_p.H1487N	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					CCTGCATCATGGGCAAATGCT	0.343																																					p.H1463N		.											.	.	.	0			c.C4387A						.						187.0	174.0	179.0					5																	38946582		2203	4300	6503	SO:0001583	missense	253260	exon33			CATCATGGGCAAA		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4387C>A	5.37:g.38946582G>T	ENSP00000349959:p.His1463Asn	97	0		76	4	NM_152756		Missense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.365157	0.24684	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.41758	0.99;1.01	5.18	5.18	0.71444	.	0.264107	0.43747	D	0.000535	T	0.19208	0.0461	N	0.01168	-0.975	0.26732	N	0.970575	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.24083	-1.0170	10	0.87932	D	0	-10.737	14.3211	0.66487	0.0739:0.0:0.9261:0.0	.	1463;1487	Q6R327;Q6R327-3	RICTR_HUMAN;.	N	1463;1487	ENSP00000349959:H1463N;ENSP00000296782:H1487N	ENSP00000296782:H1487N	H	-	1	0	RICTOR	38982339	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.892000	0.39748	2.566000	0.86566	0.460000	0.39030	CAT	.		0.343	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
TMEM161B-AS1	100505894	hgsc.bcm.edu	37	5	87678454	87678454	+	RNA	SNP	A	A	G			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr5:87678454A>G	ENST00000501715.2	+	0	577				TMEM161B-AS1_ENST00000501869.2_RNA|TMEM161B-AS1_ENST00000504922.1_RNA|TMEM161B-AS1_ENST00000510087.1_RNA|SNORA70_ENST00000384231.1_RNA					TMEM161B antisense RNA 1																		TTTCATGATGAAGTTAGTTGT	0.363																																					.		.											.	.	.	0			.						.																																					100505894	.			ATGATGAAGTTAG			5q14.3	2014-02-12	2012-08-15		ENSG00000247828	ENSG00000247828		"""Long non-coding RNAs"", ""-"""	43839	non-coding RNA	RNA, long non-coding			"""TMEM161B antisense RNA 1 (non-protein coding)"""			21890647	Standard	NR_039993		Approved	linc-POLR3G-8	uc003kje.3		OTTHUMG00000162704		5.37:g.87678454A>G		13	0		6	4	.		RNA	SNP	ENST00000501715.2	37																																																																																				.		0.363	TMEM161B-AS1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000369984.1	NR_039993	
SFXN1	94081	hgsc.bcm.edu;bcgsc.ca	37	5	174949392	174949392	+	Missense_Mutation	SNP	C	C	T	rs543601264		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr5:174949392C>T	ENST00000321442.5	+	10	1093	c.839C>T	c.(838-840)aCa>aTa	p.T280I		NM_022754.5	NP_073591.2	Q9H9B4	SFXN1_HUMAN	sideroflexin 1	280					erythrocyte differentiation (GO:0030218)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(3)	15	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GTGTTTGCTACACCCCTGTGT	0.313																																					p.T280I		.											.	.	.	0			c.C839T						.						174.0	177.0	176.0					5																	174949392		2203	4300	6503	SO:0001583	missense	94081	exon10			TTGCTACACCCCT	AF327346	CCDS4394.1	5q35.3	2008-02-05			ENSG00000164466	ENSG00000164466		"""Sideroflexins"""	16085	protein-coding gene	gene with protein product		615569					Standard	NM_022754		Approved	FLJ12876	uc003mda.2	Q9H9B4	OTTHUMG00000130555	ENST00000321442.5:c.839C>T	5.37:g.174949392C>T	ENSP00000316905:p.Thr280Ile	101	0		54	4	NM_022754	B3KPW3|D3DQN2|Q9HA53	Missense_Mutation	SNP	ENST00000321442.5	37	CCDS4394.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385577	0.61956	.	.	ENSG00000164466	ENST00000321442	T	0.31247	1.5	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.40398	0.1115	M	0.62266	1.93	0.80722	D	1	B	0.19445	0.036	B	0.34418	0.182	T	0.25813	-1.0121	10	0.52906	T	0.07	-18.4917	17.1047	0.86659	0.0:1.0:0.0:0.0	.	280	Q9H9B4	SFXN1_HUMAN	I	280	ENSP00000316905:T280I	ENSP00000316905:T280I	T	+	2	0	SFXN1	174881998	1.000000	0.71417	0.279000	0.24732	0.900000	0.52787	7.344000	0.79328	2.702000	0.92279	0.655000	0.94253	ACA	.		0.313	SFXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252980.2	NM_022754	
PLIN4	729359	hgsc.bcm.edu	37	19	4511680	4511680	+	Silent	SNP	A	A	G			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr19:4511680A>G	ENST00000301286.3	-	3	2249	c.2250T>C	c.(2248-2250)gaT>gaC	p.D750D		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	750	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TGGACACAGCATCTTTAGTGC	0.577																																					p.D750D		.											PLIN4_ENST00000301286,right_lower_lobe,carcinoma,0,2	PLIN4_ENST00000301286	0	0			c.T2250C						.						120.0	88.0	98.0					19																	4511680		2000	4144	6144	SO:0001819	synonymous_variant	729359	exon3			CACAGCATCTTTA	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2250T>C	19.37:g.4511680A>G		35	0		16	8	NM_001080400	A6NEI2	Silent	SNP	ENST00000301286.3	37	CCDS45927.1																																																																																			.		0.577	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
TGIF2	60436	hgsc.bcm.edu	37	20	35219439	35219439	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr20:35219439C>A	ENST00000373874.2	+	3	518	c.319C>A	c.(319-321)Cgt>Agt	p.R107S	TGIF2_ENST00000373872.4_Missense_Mutation_p.R107S|TGIF2-C20orf24_ENST00000558530.1_Intron|RP5-977B1.11_ENST00000561134.1_RNA	NM_001199514.1|NM_001199515.1	NP_001186443.1|NP_001186444.1	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	107	Repressive function.				gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway (GO:0038092)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				GGCCCTCCCCCGTGGCAGCAG	0.632																																					p.R107S		.											.	.	.	0			c.C319A						.						75.0	86.0	82.0					20																	35219439		2203	4300	6503	SO:0001583	missense	60436	exon3			CTCCCCCGTGGCA	AB042646	CCDS13278.1	20q11.23	2012-12-12	2007-02-07		ENSG00000118707	ENSG00000118707		"""Homeoboxes / TALE class"""	15764	protein-coding gene	gene with protein product		607294	"""TGFB-induced factor 2 (TALE family homeobox)"""			11006116	Standard	NM_021809		Approved		uc021wcv.1	Q9GZN2	OTTHUMG00000172332	ENST00000373874.2:c.319C>A	20.37:g.35219439C>A	ENSP00000362981:p.Arg107Ser	126	0		69	4	NM_021809	B2R9U3|E1P5T9|H0YNI0	Missense_Mutation	SNP	ENST00000373874.2	37	CCDS13278.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.346796	0.41599	.	.	ENSG00000118707	ENST00000373874;ENST00000373872	T;T	0.64803	-0.12;-0.12	5.71	4.74	0.60224	.	1.045190	0.07463	N	0.900930	T	0.57110	0.2031	L	0.46157	1.445	0.80722	D	1	B	0.23591	0.088	B	0.18561	0.022	T	0.33343	-0.9872	10	0.12430	T	0.62	-17.1341	14.7398	0.69445	0.15:0.85:0.0:0.0	.	107	Q9GZN2	TGIF2_HUMAN	S	107	ENSP00000362981:R107S;ENSP00000362979:R107S	ENSP00000362979:R107S	R	+	1	0	TGIF2	34652853	0.690000	0.27699	0.999000	0.59377	0.996000	0.88848	2.636000	0.46545	1.350000	0.45770	0.561000	0.74099	CGT	.		0.632	TGIF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079004.2	NM_021809	
FAR2	55711	hgsc.bcm.edu	37	12	29469923	29469923	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr12:29469923C>T	ENST00000536681.3	+	9	1351	c.1105C>T	c.(1105-1107)Cgg>Tgg	p.R369W	FAR2_ENST00000547116.1_Missense_Mutation_p.R272W|RP11-996F15.2_ENST00000553105.1_RNA|FAR2_ENST00000182377.4_Missense_Mutation_p.R369W	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	369					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)	p.R369W(1)		central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						CTGCTATCTGCGGCTCACTGG	0.507																																					p.R369W		.											FAR2,colon,carcinoma,0,1	FAR2	0	1	Substitution - Missense(1)	large_intestine(1)	c.C1105T						.						124.0	125.0	125.0					12																	29469923		2203	4300	6503	SO:0001583	missense	55711	exon9			TATCTGCGGCTCA	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.1105C>T	12.37:g.29469923C>T	ENSP00000443291:p.Arg369Trp	38	0		25	2	NM_018099	F8VV73|Q9H0D5|Q9NVW8	Missense_Mutation	SNP	ENST00000536681.3	37	CCDS8717.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.434912	0.25813	.	.	ENSG00000064763	ENST00000536681;ENST00000182377;ENST00000547116	T;T;T	0.33438	1.82;1.82;1.41	4.44	-2.56	0.06268	.	0.069786	0.53938	N	0.000043	T	0.26268	0.0641	M	0.79475	2.455	0.22446	N	0.999095	B	0.31054	0.306	B	0.30179	0.112	T	0.14643	-1.0465	10	0.35671	T	0.21	-19.8622	5.299	0.15768	0.604:0.2031:0.1138:0.0791	.	369	Q96K12	FACR2_HUMAN	W	369;369;272	ENSP00000443291:R369W;ENSP00000182377:R369W;ENSP00000449349:R272W	ENSP00000182377:R369W	R	+	1	2	FAR2	29361190	0.260000	0.24053	0.010000	0.14722	0.762000	0.43233	0.043000	0.13971	-0.844000	0.04184	0.467000	0.42956	CGG	.		0.507	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099	
TRPM6	140803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	77470478	77470478	+	Nonsense_Mutation	SNP	A	A	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr9:77470478A>T	ENST00000360774.1	-	3	354	c.117T>A	c.(115-117)tgT>tgA	p.C39*	TRPM6_ENST00000451710.3_Nonsense_Mutation_p.C39*|TRPM6_ENST00000361255.3_Nonsense_Mutation_p.C34*|TRPM6_ENST00000449912.2_Nonsense_Mutation_p.C34*|TRPM6_ENST00000376871.3_Nonsense_Mutation_p.C39*|TRPM6_ENST00000376864.4_Nonsense_Mutation_p.C39*|TRPM6_ENST00000359047.2_Nonsense_Mutation_p.C39*|TRPM6_ENST00000376872.3_Nonsense_Mutation_p.C39*|RNU6-445P_ENST00000516949.1_RNA	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	39					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ATACTGGAGTACATCTAAATT	0.318																																					p.C39X		.											.	.	.	0			c.T117A						.						110.0	114.0	112.0					9																	77470478		2203	4300	6503	SO:0001587	stop_gained	140803	exon3			TGGAGTACATCTA	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.117T>A	9.37:g.77470478A>T	ENSP00000354006:p.Cys39*	83	0		57	28	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Nonsense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	A	15.08	2.728554	0.48833	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870;ENST00000376864;ENST00000359047	.	.	.	5.57	0.171	0.15026	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.0943	0.36629	0.6391:0.0:0.3609:0.0	.	.	.	.	X	39;39;39;39;34;34;38;39;39	.	ENSP00000351942:C39X	C	-	3	2	TRPM6	76660298	1.000000	0.71417	0.986000	0.45419	0.079000	0.17450	0.947000	0.29082	0.100000	0.17581	0.533000	0.62120	TGT	.		0.318	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
COL22A1	169044	hgsc.bcm.edu;broad.mit.edu	37	8	139705902	139705902	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr8:139705902G>T	ENST00000303045.6	-	35	3187	c.2741C>A	c.(2740-2742)gCa>gAa	p.A914E	COL22A1_ENST00000435777.1_Missense_Mutation_p.A914E|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	914	Collagen-like 7.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTTTCCAGCTGCTCCAGGAGC	0.632										HNSCC(7;0.00092)																											p.A914E		.											.	.	.	0			c.C2741A						.						44.0	38.0	40.0					8																	139705902		2202	4297	6499	SO:0001583	missense	169044	exon35			CCAGCTGCTCCAG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2741C>A	8.37:g.139705902G>T	ENSP00000303153:p.Ala914Glu	93	0		45	4	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.279349	0.40294	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.93426	-3.22;-3.22	3.88	2.99	0.34606	.	0.642642	0.13324	U	0.396464	T	0.79834	0.4514	N	0.03071	-0.42	0.26457	N	0.975506	B;B	0.23442	0.069;0.085	B;B	0.25759	0.037;0.063	T	0.68569	-0.5374	10	0.07175	T	0.84	.	7.4006	0.26962	0.1184:0.0:0.8816:0.0	.	914;914	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	E	914;914;627	ENSP00000303153:A914E;ENSP00000387655:A914E	ENSP00000303153:A914E	A	-	2	0	COL22A1	139775084	0.975000	0.34042	0.999000	0.59377	0.902000	0.53008	1.228000	0.32588	1.202000	0.43218	0.637000	0.83480	GCA	.		0.632	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
PRICKLE2	166336	hgsc.bcm.edu	37	3	64082612	64082612	+	3'UTR	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:64082612G>T	ENST00000295902.6	-	0	5235				PRICKLE2-AS1_ENST00000476308.1_RNA|RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)						establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		CATCAATCAAGGAACTTAAAA	0.378																																					.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	100652759	.			AATCAAGGAACTT	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.*2115C>A	3.37:g.64082612G>T		99	0		48	4	.	Q0VF44	RNA	SNP	ENST00000295902.6	37	CCDS2902.1																																																																																			.		0.378	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	142168326	142168326	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:142168326G>A	ENST00000350721.4	-	47	8001	c.7880C>T	c.(7879-7881)gCt>gTt	p.A2627V	XRN1_ENST00000392981.2_5'Flank|XRN1_ENST00000264951.4_5'Flank|XRN1_ENST00000544157.1_5'Flank|XRN1_ENST00000463916.1_5'Flank|XRN1_ENST00000465074.1_5'Flank|ATR_ENST00000383101.3_Missense_Mutation_p.A2563V	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	2627	FATC. {ECO:0000255|PROSITE- ProRule:PRU00534, ECO:0000255|PROSITE- ProRule:PRU00535}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TTCATCAGTAGCTTCCTGTAT	0.358								Other conserved DNA damage response genes																													p.A2627V		.											.	.	.	0			c.C7880T						.						123.0	118.0	120.0					3																	142168326		2203	4300	6503	SO:0001583	missense	545	exon47			TCAGTAGCTTCCT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.7880C>T	3.37:g.142168326G>A	ENSP00000343741:p.Ala2627Val	83	0		33	17	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	G	36	5.674465	0.96764	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	D;D	0.97430	-4.38;-4.38	5.46	5.46	0.80206	PIK-related kinase, FATC (2);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.99245	0.9737	H	0.98833	4.345	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98660	1.0683	10	0.87932	D	0	-14.8997	19.3783	0.94521	0.0:0.0:1.0:0.0	.	2627	Q13535	ATR_HUMAN	V	2627;2563	ENSP00000343741:A2627V;ENSP00000372581:A2563V	ENSP00000343741:A2627V	A	-	2	0	ATR	143651016	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.792000	0.99085	2.591000	0.87537	0.650000	0.86243	GCT	.		0.358	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
ATG16L1	55054	hgsc.bcm.edu	37	2	234189793	234189793	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:234189793G>T	ENST00000392017.4	+	11	1360	c.1103G>T	c.(1102-1104)gGa>gTa	p.G368V	ATG16L1_ENST00000392018.1_Missense_Mutation_p.G385V|ATG16L1_ENST00000347464.5_Missense_Mutation_p.G205V|ATG16L1_ENST00000498620.1_3'UTR|ATG16L1_ENST00000392020.4_Missense_Mutation_p.G349V|ATG16L1_ENST00000373525.5_Splice_Site_p.G189V	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)	368					autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		AGTAATGCAGGAATTACAAGC	0.279																																					p.G368V		.											.	.	.	0			c.G1103T						.						96.0	102.0	100.0					2																	234189793		2203	4300	6503	SO:0001583	missense	55054	exon11			ATGCAGGAATTAC	AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.1103G>T	2.37:g.234189793G>T	ENSP00000375872:p.Gly368Val	88	0		77	4	NM_030803	A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Missense_Mutation	SNP	ENST00000392017.4	37	CCDS2503.2	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720295	0.89205	.	.	ENSG00000085978	ENST00000392017;ENST00000347464;ENST00000373525;ENST00000392020;ENST00000392018;ENST00000334050	T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.16	5.42	5.42	0.78866	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.78710	0.4326	M	0.87456	2.885	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.97110	0.997;1.0;0.998;1.0;0.998	T	0.75841	-0.3175	10	0.16420	T	0.52	.	19.2521	0.93929	0.0:0.0:1.0:0.0	.	322;349;189;368;205	B7ZLM5;Q676U5-2;Q676U5-4;Q676U5;A3EXL0	.;.;.;A16L1_HUMAN;.	V	368;205;189;349;385;27	ENSP00000375872:G368V;ENSP00000318259:G205V;ENSP00000362625:G189V;ENSP00000375875:G349V;ENSP00000375873:G385V	ENSP00000334016:G27V	G	+	2	0	ATG16L1	233854532	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	8.937000	0.92936	2.542000	0.85734	0.655000	0.94253	GGA	.		0.279	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257069.2	NM_017974	
PPP6C	5537	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	127915867	127915867	+	Nonsense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr9:127915867C>T	ENST00000373547.4	-	6	713	c.614G>A	c.(613-615)tGg>tAg	p.W205*	PPP6C_ENST00000415905.1_Nonsense_Mutation_p.W183*|PPP6C_ENST00000373546.3_Nonsense_Mutation_p.W58*|PPP6C_ENST00000451402.1_Nonsense_Mutation_p.W242*	NM_002721.4	NP_002712.1	O00743	PPP6_HUMAN	protein phosphatase 6, catalytic subunit	205					G1/S transition of mitotic cell cycle (GO:0000082)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(3)	14						ACTGATAGCCCAGGTATCCAC	0.433																																					p.W242X		.											.	.	.	0			c.G725A						.						80.0	75.0	77.0					9																	127915867		2203	4300	6503	SO:0001587	stop_gained	5537	exon7			ATAGCCCAGGTAT	AF035158	CCDS6861.1, CCDS48018.1, CCDS48019.1	9q33.3	2010-03-17			ENSG00000119414	ENSG00000119414		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9323	protein-coding gene	gene with protein product		612725				9143513	Standard	NM_002721		Approved	PP6	uc004bpg.4	O00743	OTTHUMG00000020671	ENST00000373547.4:c.614G>A	9.37:g.127915867C>T	ENSP00000362648:p.Trp205*	82	0		41	19	NM_001123355	B2R5V6|B7Z2W9|B7Z5K9|Q5U0A2|Q9UIC9	Nonsense_Mutation	SNP	ENST00000373547.4	37	CCDS6861.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927061	0.92389	.	.	ENSG00000119414	ENST00000373547;ENST00000451402;ENST00000415905;ENST00000373546	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.3142	18.9632	0.92684	0.0:1.0:0.0:0.0	.	.	.	.	X	205;242;183;58	.	ENSP00000362647:W58X	W	-	2	0	PPP6C	126955688	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.445000	0.80570	2.724000	0.93272	0.585000	0.79938	TGG	.		0.433	PPP6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054060.1	NM_016294	
GATA3	2625	hgsc.bcm.edu	37	10	8100385	8100385	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr10:8100385C>T	ENST00000346208.3	+	3	814	c.359C>T	c.(358-360)aCg>aTg	p.T120M	GATA3_ENST00000379328.3_Missense_Mutation_p.T120M|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	120					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TTCTCCAAGACGTCCATCCAC	0.697			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																														p.T120M		.		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	.	.	.	0			c.C359T						.						69.0	84.0	79.0					10																	8100385		2203	4299	6502	SO:0001583	missense	2625	exon3			CCAAGACGTCCAT	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.359C>T	10.37:g.8100385C>T	ENSP00000341619:p.Thr120Met	134	0		93	4	NM_002051	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	37	CCDS7083.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932972	0.73442	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.96587	-4.06;-4.02	5.4	4.49	0.54785	.	0.099723	0.64402	D	0.000002	D	0.96321	0.8800	L	0.50333	1.59	0.45567	D	0.998514	D;D	0.67145	0.982;0.996	B;P	0.54664	0.374;0.758	D	0.96378	0.9279	10	0.72032	D	0.01	-13.9673	15.563	0.76266	0.139:0.861:0.0:0.0	.	120;120	P23771;P23771-2	GATA3_HUMAN;.	M	120	ENSP00000368632:T120M;ENSP00000341619:T120M	ENSP00000341619:T120M	T	+	2	0	GATA3	8140391	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.872000	0.63050	1.257000	0.44085	0.561000	0.74099	ACG	.		0.697	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295	
MIPOL1	145282	hgsc.bcm.edu	37	14	37736219	37736219	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr14:37736219G>T	ENST00000327441.7	+	5	562	c.96G>T	c.(94-96)atG>atT	p.M32I	MIPOL1_ENST00000537471.1_Missense_Mutation_p.M32I|MIPOL1_ENST00000556451.1_Start_Codon_SNP_p.M1I|MIPOL1_ENST00000539062.2_Start_Codon_SNP_p.M1I|MIPOL1_ENST00000536774.1_Intron|MIPOL1_ENST00000545536.1_Start_Codon_SNP_p.M1I|MIPOL1_ENST00000396294.2_Missense_Mutation_p.M32I	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	32						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		AACTGACTATGAATTCTGAGA	0.363																																					p.M32I		.											MIPOL1,NS,carcinoma,0,1	MIPOL1	0	0			c.G96T						.						104.0	100.0	102.0					14																	37736219		2203	4300	6503	SO:0001583	missense	145282	exon6			GACTATGAATTCT	AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.96G>T	14.37:g.37736219G>T	ENSP00000333539:p.Met32Ile	68	0		38	2	NM_001195296	D3DSA4|Q7Z3J0|Q8IV14	Missense_Mutation	SNP	ENST00000327441.7	37	CCDS9664.1	.	.	.	.	.	.	.	.	.	.	G	8.668	0.902236	0.17760	.	.	ENSG00000151338	ENST00000556615;ENST00000327441;ENST00000539062;ENST00000556451;ENST00000556753;ENST00000396294;ENST00000537471;ENST00000545536	T;T;T;T;T;T	0.48201	1.0;0.88;0.82;1.0;1.0;0.82	5.19	3.3	0.37823	.	0.662135	0.14760	N	0.300051	T	0.31544	0.0800	L	0.29908	0.895	0.25104	N	0.990766	B;B	0.10296	0.003;0.001	B;B	0.13407	0.009;0.003	T	0.12811	-1.0533	10	0.25106	T	0.35	-0.0789	6.4739	0.22024	0.0986:0.1979:0.7036:0.0	.	32;1	Q8TD10;Q49AL5	MIPO1_HUMAN;.	I	32;32;1;1;32;32;32;1	ENSP00000333539:M32I;ENSP00000438319:M1I;ENSP00000450479:M1I;ENSP00000379589:M32I;ENSP00000444254:M32I;ENSP00000442529:M1I	ENSP00000333539:M32I	M	+	3	0	MIPOL1	36805970	0.903000	0.30736	0.415000	0.26534	0.066000	0.16364	1.758000	0.38410	1.425000	0.47237	0.655000	0.94253	ATG	.		0.363	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276734.1	NM_138731	
MGRN1	23295	hgsc.bcm.edu	37	16	4733264	4733264	+	Nonsense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr16:4733264C>T	ENST00000399577.5	+	15	1615	c.1522C>T	c.(1522-1524)Cag>Tag	p.Q508*	MGRN1_ENST00000262370.7_Nonsense_Mutation_p.Q508*|MGRN1_ENST00000588994.1_Nonsense_Mutation_p.Q486*|MGRN1_ENST00000586183.1_Nonsense_Mutation_p.Q486*|MGRN1_ENST00000415496.1_Nonsense_Mutation_p.Q487*	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase	508					endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						GTCGTCACCACAGCAAGGTGA	0.592																																					p.Q508X		.											.	.	.	0			c.C1522T						.						55.0	60.0	59.0					16																	4733264		2087	4236	6323	SO:0001587	stop_gained	23295	exon15			TCACCACAGCAAG	AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.1522C>T	16.37:g.4733264C>T	ENSP00000382487:p.Gln508*	74	0		61	4	NM_015246	A4URL3|A4URL4|Q86W76	Nonsense_Mutation	SNP	ENST00000399577.5	37	CCDS45402.1	.	.	.	.	.	.	.	.	.	.	A	32	5.124551	0.94429	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496	.	.	.	4.34	3.23	0.37069	.	0.905606	0.09298	U	0.821351	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-8.8417	10.1291	0.42667	0.4741:0.5259:0.0:0.0	.	.	.	.	X	508;508;487	.	ENSP00000262370:Q508X	Q	+	1	0	MGRN1	4673265	0.997000	0.39634	0.360000	0.25837	0.001000	0.01503	2.421000	0.44688	0.210000	0.20664	-1.489000	0.00976	CAG	.		0.592	MGRN1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432060.2		
ACSL3	2181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	223793606	223793606	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:223793606G>A	ENST00000357430.3	+	13	2023	c.1492G>A	c.(1492-1494)Gga>Aga	p.G498R	ACSL3_ENST00000392066.3_Missense_Mutation_p.G498R	NM_004457.3	NP_004448.2	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	498					brain development (GO:0007420)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty acid import (GO:0044539)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)|positive regulation of phosphatidylcholine biosynthetic process (GO:2001247)|positive regulation of secretion (GO:0051047)|response to nutrient (GO:0007584)|response to organic cyclic compound (GO:0014070)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)|skin(2)	22		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	TGGCAGAGTGGGAGCACCATT	0.313			T	ETV1	prostate																																p.G498R		.		Dom	yes		2	2q36	2181	acyl-CoA synthetase long-chain family member 3		E	.	.	.	0			c.G1492A						.						99.0	103.0	101.0					2																	223793606		2203	4300	6503	SO:0001583	missense	2181	exon12			AGAGTGGGAGCAC	D89053	CCDS2455.1	2q34-q35	2008-02-05	2004-02-19	2004-02-20	ENSG00000123983	ENSG00000123983		"""Acyl-CoA synthetase family"""	3570	protein-coding gene	gene with protein product		602371	"""fatty-acid-Coenzyme A ligase, long-chain 3"""	FACL3			Standard	NM_004457		Approved	ACS3, PRO2194	uc002vnj.3	O95573	OTTHUMG00000133160	ENST00000357430.3:c.1492G>A	2.37:g.223793606G>A	ENSP00000350012:p.Gly498Arg	92	0		61	6	NM_203372	Q60I92|Q8IUM9	Missense_Mutation	SNP	ENST00000357430.3	37	CCDS2455.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643690	0.87859	.	.	ENSG00000123983	ENST00000357430;ENST00000392066	T;T	0.65178	-0.14;-0.14	5.56	4.66	0.58398	AMP-dependent synthetase/ligase (1);	0.101591	0.64402	D	0.000002	D	0.88340	0.6410	H	0.99444	4.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93395	0.6755	10	0.87932	D	0	-16.2221	15.5574	0.76208	0.0:0.0:0.8609:0.1391	.	498	O95573	ACSL3_HUMAN	R	498	ENSP00000350012:G498R;ENSP00000375918:G498R	ENSP00000350012:G498R	G	+	1	0	ACSL3	223501850	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	1.313000	0.45069	0.561000	0.74099	GGA	.		0.313	ACSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256862.2	NM_004457	
PER2	8864	hgsc.bcm.edu	37	2	239164502	239164502	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:239164502C>A	ENST00000254657.3	-	18	2395	c.2116G>T	c.(2116-2118)Ggc>Tgc	p.G706C	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	706	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)	p.G706C(2)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		AGGGCAGGGCCCGCCAGGCAG	0.587																																					p.G706C		.											PER2,NS,carcinoma,0,1	PER2	0	2	Substitution - Missense(2)	lung(2)	c.G2116T						.						77.0	86.0	83.0					2																	239164502		2203	4300	6503	SO:0001583	missense	8864	exon18			CAGGGCCCGCCAG	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2116G>T	2.37:g.239164502C>A	ENSP00000254657:p.Gly706Cys	53	0		26	2	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	37	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.064878	0.36470	.	.	ENSG00000132326	ENST00000254657	T	0.11277	2.79	3.65	3.65	0.41850	.	0.722697	0.13874	N	0.356800	T	0.28134	0.0694	L	0.53249	1.67	0.19775	N	0.99996	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.922	T	0.03335	-1.1047	10	0.66056	D	0.02	-27.3625	13.1967	0.59743	0.0:1.0:0.0:0.0	.	706;706	B4DH14;O15055	.;PER2_HUMAN	C	706	ENSP00000254657:G706C	ENSP00000254657:G706C	G	-	1	0	PER2	238829241	0.075000	0.21258	0.222000	0.23844	0.036000	0.12997	1.619000	0.36965	1.735000	0.51646	0.555000	0.69702	GGC	.		0.587	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
ARNTL2	56938	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	27573423	27573423	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr12:27573423G>T	ENST00000266503.5	+	17	1887	c.1869G>T	c.(1867-1869)ctG>ctT	p.L623L	ARNTL2_ENST00000395901.2_Silent_p.L586L|ARNTL2_ENST00000542388.1_Silent_p.L538L|ARNTL2_ENST00000261178.5_Silent_p.L575L|ARNTL2_ENST00000546179.1_3'UTR|ARNTL2_ENST00000311001.5_Silent_p.L609L|ARNTL2_ENST00000544915.1_Silent_p.L589L|RP11-165P7.1_ENST00000500498.2_RNA			Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear translocator-like 2	623					circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	21	Colorectal(261;0.0847)|Lung SC(9;0.184)					AGGGGGGCCTGGGAGACCCTG	0.433																																					p.L623L		.											.	.	.	0			c.G1869T						.						79.0	83.0	81.0					12																	27573423		2203	4300	6503	SO:0001819	synonymous_variant	56938	exon17			GGGCCTGGGAGAC	AF246961	CCDS8712.1, CCDS58219.1, CCDS58220.1, CCDS58221.1, CCDS58222.1	12p12.2-p11.2	2013-05-21			ENSG00000029153	ENSG00000029153		"""Basic helix-loop-helix proteins"""	18984	protein-coding gene	gene with protein product		614517				10864977, 10964693	Standard	NM_020183		Approved	BMAL2, MOP9, CLIF, PASD9, bHLHe6	uc001rht.2	Q8WYA1	OTTHUMG00000169257	ENST00000266503.5:c.1869G>T	12.37:g.27573423G>T		75	0		43	4	NM_020183	B7Z429|F5H402|Q8WYA2|Q8WYA3|Q8WYA4|Q96J63|Q9H2M4|Q9NS70|Q9NYQ4|Q9NYQ5	Silent	SNP	ENST00000266503.5	37	CCDS8712.1	.	.	.	.	.	.	.	.	.	.	.	6.032	0.374247	0.11409	.	.	ENSG00000029153	ENST00000457040	.	.	.	3.63	-0.603	0.11630	.	.	.	.	.	T	0.43233	0.1238	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23190	-1.0195	4	.	.	.	.	3.3556	0.07168	0.0812:0.2682:0.3753:0.2753	.	.	.	.	L	575	.	.	W	+	2	0	ARNTL2	27464690	0.997000	0.39634	0.966000	0.40874	0.927000	0.56198	0.075000	0.14686	-0.250000	0.09555	-2.236000	0.00289	TGG	.		0.433	ARNTL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403162.1	NM_020183	
CKAP5	9793	hgsc.bcm.edu;bcgsc.ca	37	11	46780475	46780475	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:46780475G>T	ENST00000529230.1	-	35	4733	c.4687C>A	c.(4687-4689)Cag>Aag	p.Q1563K	CKAP5_ENST00000354558.3_Missense_Mutation_p.Q1563K|CKAP5_ENST00000415402.1_Missense_Mutation_p.Q1563K|CKAP5_ENST00000312055.5_Missense_Mutation_p.Q1563K|SNORD67_ENST00000516618.1_RNA			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1563					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						CCCATTACCTGTGTCAGAGCT	0.453																																					p.Q1563K	Ovarian(4;85 273 2202 4844 13323)	.											.	.	.	0			c.C4687A						.						263.0	213.0	230.0					11																	46780475		2201	4299	6500	SO:0001583	missense	9793	exon35			TTACCTGTGTCAG		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.4687C>A	11.37:g.46780475G>T	ENSP00000432768:p.Gln1563Lys	75	0		49	4	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	CCDS31477.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.125932|4.125932	0.77436|0.77436	.|.	.|.	ENSG00000175216|ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558;ENST00000526876|ENST00000527333	T;T;T;T|.	0.44482|.	0.92;0.93;0.92;0.92|.	5.52|5.52	5.52|5.52	0.82312|0.82312	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.65133|0.65133	0.2662|0.2662	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	D;P;P|.	0.56035|.	0.974;0.954;0.924|.	P;D;P|.	0.67900|.	0.717;0.954;0.9|.	T|T	0.58994|0.58994	-0.7537|-0.7537	10|5	0.16420|.	T|.	0.52|.	0.1853|0.1853	19.7999|19.7999	0.96502|0.96502	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1563;1563;1563|.	Q14008-3;Q14008-2;Q14008|.	.;.;CKAP5_HUMAN|.	K|K	1563;1563;1563;1563;294|119	ENSP00000432768:Q1563K;ENSP00000395302:Q1563K;ENSP00000310227:Q1563K;ENSP00000346566:Q1563K|.	ENSP00000310227:Q1563K|.	Q|T	-|-	1|2	0|0	CKAP5|CKAP5	46737051|46737051	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	9.813000|9.813000	0.99286|0.99286	2.751000|2.751000	0.94390|0.94390	0.650000|0.650000	0.86243|0.86243	CAG|ACA	.		0.453	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
HMGCL	3155	broad.mit.edu	37	1	24147070	24147070	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:24147070G>A	ENST00000374490.3	-	2	117	c.74C>T	c.(73-75)tCt>tTt	p.S25F	HMGCL_ENST00000509389.1_5'UTR|HMGCL_ENST00000436439.2_Missense_Mutation_p.S25F|HMGCL_ENST00000374483.4_5'UTR	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase	25					acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		AGTGCCCATAGATGAGGTGCT	0.403																																					p.S25F													.	HMGCL	22	0			c.C74T						.						133.0	119.0	124.0					1																	24147070		2203	4300	6503	SO:0001583	missense	3155	exon2			CCCATAGATGAGG	BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963	ENST00000374490.3:c.74C>T	1.37:g.24147070G>A	ENSP00000363614:p.Ser25Phe	95	0		24	3	NM_000191	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Missense_Mutation	SNP	ENST00000374490.3	37	CCDS243.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.747688	0.30955	.	.	ENSG00000117305	ENST00000374490;ENST00000436439	D;D	0.97924	-4.61;-4.39	5.27	4.32	0.51571	.	0.767739	0.12876	N	0.431849	D	0.92051	0.7481	N	0.08118	0	0.21627	N	0.999611	P;B;B	0.44309	0.832;0.077;0.077	B;B;B	0.31390	0.129;0.027;0.027	D	0.86591	0.1860	10	0.49607	T	0.09	-0.7447	16.1316	0.81445	0.0:0.1452:0.8548:0.0	.	25;25;25	B4DUP4;Q6IBC0;P35914	.;.;HMGCL_HUMAN	F	25	ENSP00000363614:S25F;ENSP00000389281:S25F	ENSP00000363614:S25F	S	-	2	0	HMGCL	24019657	0.517000	0.26226	0.106000	0.21319	0.887000	0.51463	3.273000	0.51623	2.759000	0.94783	0.558000	0.71614	TCT	.		0.403	HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008253.2	NM_000191	
BCL9	607	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	147096004	147096004	+	Silent	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:147096004C>T	ENST00000234739.3	+	10	4265	c.3525C>T	c.(3523-3525)ggC>ggT	p.G1175G		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	1175	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CAGGAGAAGGCCCCCTTGGCC	0.642			T	"""IGH@, IGL@"""	B-ALL																																p.G1175G				Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	BCL9	150	0			c.C3525T						.						35.0	40.0	38.0					1																	147096004		2203	4300	6503	SO:0001819	synonymous_variant	607	exon10			AGAAGGCCCCCTT	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.3525C>T	1.37:g.147096004C>T		54	1		76	37	NM_004326	Q5T489	Silent	SNP	ENST00000234739.3	37	CCDS30833.1																																																																																			.		0.642	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
KIF28P	100130097	broad.mit.edu;ucsc.edu	37	1	246939562	246939562	+	RNA	SNP	T	T	G			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:246939562T>G	ENST00000451123.1	-	0	1239				RP11-439E19.10_ENST00000567832.1_RNA|RP11-439E19.3_ENST00000421003.1_RNA|RP11-439E19.3_ENST00000509202.1_RNA|RP11-439E19.3_ENST00000505748.1_RNA																							GGGGCTGAGGTGGAAAAAGGT	0.488																																					.													.	.	.	0			.						.																																					0	.			CTGAGGTGGAAAA																													1.37:g.246939562T>G		59	0		79	40	.		RNA	SNP	ENST00000451123.1	37																																																																																				.		0.488	RP11-439E19.8-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000331247.2		
SEMA4G	57715	broad.mit.edu	37	10	102743836	102743836	+	Frame_Shift_Del	DEL	A	A	-			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr10:102743836delA	ENST00000370250.4	+	14	2838	c.2465delA	c.(2464-2466)gaafs	p.E822fs	RP11-108L7.4_ENST00000447344.1_RNA|MRPL43_ENST00000342071.1_Intron|SEMA4G_ENST00000210633.3_Frame_Shift_Del_p.E827fs|MRPL43_ENST00000299179.5_Intron|MRPL43_ENST00000318325.2_Intron|MRPL43_ENST00000370242.4_Intron|SEMA4G_ENST00000517724.1_Intron|MRPL43_ENST00000370241.3_Intron|MRPL43_ENST00000493646.1_5'Flank	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	822					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		CGCATCCTGGAAAAAAGGAAG	0.562																																					p.E827fs													.	SEMA4G	55	0			c.2480delA						.						73.0	73.0	73.0					10																	102743836		2203	4300	6503	SO:0001589	frameshift_variant	57715	exon14			TCCTGGAAAAAAG	AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.2465delA	10.37:g.102743836delA	ENSP00000359270:p.Glu822fs	6	0		6	2	NM_017893	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Frame_Shift_Del	DEL	ENST00000370250.4	37																																																																																				.		0.562	SEMA4G-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049920.2		
ZEB1	6935	broad.mit.edu	37	10	31791305	31791305	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr10:31791305G>A	ENST00000320985.10	+	4	459	c.349G>A	c.(349-351)Gaa>Aaa	p.E117K	ZEB1_ENST00000560721.2_Missense_Mutation_p.E97K|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000542815.3_Missense_Mutation_p.E50K|ZEB1_ENST00000446923.2_Missense_Mutation_p.E101K|ZEB1_ENST00000361642.5_Missense_Mutation_p.E118K			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	117					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				GTCAGATGCAGAAAATGAGCA	0.373																																					p.E118K	Ovarian(40;423 959 14296 36701 49589)												.	ZEB1	173	0			c.G352A						.						114.0	104.0	108.0					10																	31791305		2203	4300	6503	SO:0001583	missense	6935	exon4			GATGCAGAAAATG	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.349G>A	10.37:g.31791305G>A	ENSP00000319248:p.Glu117Lys	54	0		54	3	NM_001174096	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	G	36	5.856495	0.97030	.	.	ENSG00000148516	ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000424869;ENST00000446923	T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46	5.92	5.92	0.95590	.	0.092076	0.47093	D	0.000243	D	0.89076	0.6612	M	0.66939	2.045	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.998;0.998;0.985;0.998;0.998	D;D;D;P;D;D	0.80764	0.994;0.989;0.989;0.808;0.99;0.989	D	0.86428	0.1759	10	0.35671	T	0.21	-23.2597	20.3129	0.98645	0.0:0.0:1.0:0.0	.	50;101;117;97;118;117	F5H4I8;E9PCM7;B2RBI8;Q5VZ84;Q2KJ05;P37275	.;.;.;.;.;ZEB1_HUMAN	K	117;118;117;50;117;97;118;101	ENSP00000354487:E118K;ENSP00000444891:E50K;ENSP00000319248:E117K;ENSP00000415961:E118K;ENSP00000391612:E101K	ENSP00000319248:E117K	E	+	1	0	ZEB1	31831311	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.230000	0.95299	2.800000	0.96347	0.650000	0.86243	GAA	.		0.373	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
ZNF503	84858	broad.mit.edu	37	10	77161113	77161115	+	In_Frame_Del	DEL	CCG	CCG	-			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr10:77161113_77161115delCCG	ENST00000372524.4	-	1	549_551	c.63_65delCGG	c.(61-66)ggcgga>gga	p.21_22GG>G	ZNF503-AS2_ENST00000466942.2_RNA|ZNF503_ENST00000535216.1_In_Frame_Del_p.21_22GG>G|RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503-AS2_ENST00000486015.1_RNA|ZNF503-AS2_ENST00000425916.3_RNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	21	Gly-rich.				G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					gcctccgcctccgccgccgccgc	0.734																																					p.21_22del													.	ZNF503	25	0			c.63_65del						.			76,614		30,16,299						1.1	1.0		dbSNP_130	2	28,2504		8,12,1246	no	coding	ZNF503	NM_032772.4		38,28,1545	A1A1,A1R,RR		1.1058,11.0145,3.2278				104,3118				SO:0001651	inframe_deletion	84858	exon1			CCGCCTCCGCCGC	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.63_65delCGG	10.37:g.77161122_77161124delCCG	ENSP00000361602:p.Gly27del	12	0		6	2	NM_032772	Q8NAC5|Q96E25|Q96IJ0	In_Frame_Del	DEL	ENST00000372524.4	37	CCDS7350.1																																																																																			.		0.734	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
ELMOD1	55531	broad.mit.edu;ucsc.edu	37	11	107462568	107462568	+	Intron	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:107462568T>C	ENST00000265840.7	+	1	180				AP000889.3_ENST00000600612.1_Missense_Mutation_p.S29P|ELMOD1_ENST00000529675.1_3'UTR|ELMOD1_ENST00000443271.2_Intron|ELMOD1_ENST00000531234.1_Intron	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1						phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		GGCTTCGGTCTCCAGGGAGGA	0.716																																					.													.	.	.	0			.						.						12.0	15.0	14.0					11																	107462568		1840	3984	5824	SO:0001627	intron_variant	0	.			TCGGTCTCCAGGG	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.-86+433T>C	11.37:g.107462568T>C		86	0		44	21	.	B4E167|G5E9S5|Q9NPW3	Missense_Mutation	SNP	ENST00000265840.7	37	CCDS44723.1																																																																																			.		0.716	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389406.1	NM_018712	
NELL2	4753	broad.mit.edu;bcgsc.ca	37	12	44926453	44926453	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr12:44926453C>T	ENST00000429094.2	-	16	2219	c.1715G>A	c.(1714-1716)tGc>tAc	p.C572Y	NELL2_ENST00000551601.1_Intron|NELL2_ENST00000452445.2_Missense_Mutation_p.C572Y|NELL2_ENST00000333837.4_Missense_Mutation_p.C595Y|NELL2_ENST00000395487.2_Missense_Mutation_p.C571Y|NELL2_ENST00000549027.1_Missense_Mutation_p.C571Y|NELL2_ENST00000437801.2_Missense_Mutation_p.C622Y	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	572	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		CAGGTTAATGCAATTAGCACG	0.398																																					p.C622Y													.	NELL2	286	0			c.G1865A						.						165.0	139.0	148.0					12																	44926453		2203	4300	6503	SO:0001583	missense	4753	exon17			TTAATGCAATTAG	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1715G>A	12.37:g.44926453C>T	ENSP00000390680:p.Cys572Tyr	43	0		17	6	NM_001145107	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	37	CCDS8746.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690285	0.88735	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684	D;D;D;D;D;D	0.99955	-2.48;-2.48;-2.48;-2.48;-8.88;-2.48	5.71	5.71	0.89125	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99967	0.9988	H	0.97265	3.97	0.80722	D	1	D;D;D;D	0.89917	0.995;1.0;0.999;1.0	D;D;D;D	0.97110	0.986;0.999;0.996;1.0	D	0.96691	0.9511	10	0.87932	D	0	-12.6398	19.8594	0.96778	0.0:1.0:0.0:0.0	.	595;622;572;571	B7Z2U7;B7Z9U3;Q99435;Q96JS2	.;.;NELL2_HUMAN;.	Y	571;572;572;571;595;622;571	ENSP00000378866:C571Y;ENSP00000390680:C572Y;ENSP00000394612:C572Y;ENSP00000447927:C571Y;ENSP00000327988:C595Y;ENSP00000416341:C622Y	ENSP00000327988:C595Y	C	-	2	0	NELL2	43212720	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	7.386000	0.79775	2.691000	0.91804	0.650000	0.86243	TGC	.		0.398	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159	
ANGEL1	23357	broad.mit.edu;bcgsc.ca	37	14	77275681	77275681	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr14:77275681C>A	ENST00000251089.2	-	2	482	c.370G>T	c.(370-372)Gat>Tat	p.D124Y	ANGEL1_ENST00000554941.1_5'UTR	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	124										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		AAAGGCTCATCCAGGTTCTCT	0.597																																					p.D124Y													.	ANGEL1	63	0			c.G370T						.						42.0	45.0	44.0					14																	77275681		2203	4300	6503	SO:0001583	missense	23357	exon2			GCTCATCCAGGTT	AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.370G>T	14.37:g.77275681C>A	ENSP00000251089:p.Asp124Tyr	19	0		6	3	NM_015305	B4DWL7|O94859|Q8NCS9	Missense_Mutation	SNP	ENST00000251089.2	37	CCDS9852.1	.	.	.	.	.	.	.	.	.	.	C	6.394	0.440820	0.12104	.	.	ENSG00000013523	ENST00000251089	T	0.24908	1.83	5.36	3.51	0.40186	.	0.759067	0.12267	N	0.484161	T	0.15522	0.0374	N	0.19112	0.55	0.23889	N	0.996559	P;B	0.45827	0.867;0.327	B;B	0.41813	0.367;0.087	T	0.12967	-1.0527	10	0.59425	D	0.04	-0.0376	2.9867	0.05970	0.1351:0.5559:0.1479:0.1611	.	124;124	B4DVG4;Q9UNK9	.;ANGE1_HUMAN	Y	124	ENSP00000251089:D124Y	ENSP00000251089:D124Y	D	-	1	0	ANGEL1	76345434	0.517000	0.26226	0.761000	0.31378	0.052000	0.14988	0.184000	0.16939	0.634000	0.30469	0.655000	0.94253	GAT	.		0.597	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413712.2	NM_015305	
MYBBP1A	10514	broad.mit.edu	37	17	4458229	4458229	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr17:4458229A>T	ENST00000254718.4	-	2	527	c.221T>A	c.(220-222)cTg>cAg	p.L74Q	MYBBP1A_ENST00000381556.2_Missense_Mutation_p.L74Q			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	74	Interaction with MYB. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						TAGACGCTTCAGGGCATATTT	0.632																																					p.L74Q													.	MYBBP1A	69	0			c.T221A						.						48.0	50.0	49.0					17																	4458229		2203	4300	6503	SO:0001583	missense	10514	exon2			CGCTTCAGGGCAT	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.221T>A	17.37:g.4458229A>T	ENSP00000254718:p.Leu74Gln	97	0		52	3	NM_014520	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	ENST00000254718.4	37	CCDS11046.1	.	.	.	.	.	.	.	.	.	.	A	18.41	3.617314	0.66672	.	.	ENSG00000132382	ENST00000381556;ENST00000254718;ENST00000426435	T;T	0.67171	-0.25;-0.25	4.73	3.63	0.41609	Armadillo-type fold (1);	0.163970	0.41938	D	0.000785	T	0.65344	0.2682	M	0.64997	1.995	0.33338	D	0.569494	P;P	0.42908	0.793;0.754	B;B	0.43658	0.426;0.3	T	0.75808	-0.3187	10	0.87932	D	0	-21.219	9.9819	0.41819	0.8481:0.0:0.0:0.1519	.	74;74	Q9BQG0;Q9BQG0-2	MBB1A_HUMAN;.	Q	74	ENSP00000370968:L74Q;ENSP00000254718:L74Q	ENSP00000254718:L74Q	L	-	2	0	MYBBP1A	4404978	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	4.614000	0.61183	0.910000	0.36722	0.533000	0.62120	CTG	.		0.632	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
TMEM11	8834	broad.mit.edu;bcgsc.ca	37	17	21101947	21101947	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr17:21101947G>A	ENST00000317635.5	-	2	740	c.269C>T	c.(268-270)aCc>aTc	p.T90I	TMEM11_ENST00000584432.1_5'UTR	NM_003876.2	NP_003867.1	P17152	TMM11_HUMAN	transmembrane protein 11	90					mitochondrion organization (GO:0007005)	integral component of mitochondrial inner membrane (GO:0031305)|integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						GAGGCAGGCGGTGCCCGCCAG	0.617																																					p.T90I													.	TMEM11	15	0			c.C269T						.						36.0	31.0	33.0					17																	21101947		2202	4295	6497	SO:0001583	missense	8834	exon2			CAGGCGGTGCCCG	BC002819	CCDS11216.1	17p11.1	2011-08-12	2005-09-08	2005-09-08		ENSG00000178307			16823	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 35"""	C17orf35		2110658, 21274005	Standard	NM_003876		Approved	PMI, PM1	uc002gyp.2	P17152		ENST00000317635.5:c.269C>T	17.37:g.21101947G>A	ENSP00000319992:p.Thr90Ile	29	0		14	7	NM_003876	Q53YB2	Missense_Mutation	SNP	ENST00000317635.5	37	CCDS11216.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.761861	0.31228	.	.	ENSG00000178307	ENST00000317635	.	.	.	5.79	4.76	0.60689	.	0.187541	0.56097	D	0.000022	T	0.38878	0.1057	N	0.11064	0.09	0.53688	D	0.99997	B	0.09022	0.002	B	0.06405	0.002	T	0.20571	-1.0271	9	0.13853	T	0.58	-29.5582	18.4904	0.90844	0.0:0.1273:0.8727:0.0	.	90	P17152	TMM11_HUMAN	I	90	.	ENSP00000319992:T90I	T	-	2	0	TMEM11	21042539	1.000000	0.71417	0.982000	0.44146	0.998000	0.95712	6.148000	0.71788	2.735000	0.93741	0.655000	0.94253	ACC	.		0.617	TMEM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444150.2	NM_003876	
AC079305.8	0	broad.mit.edu	37	2	178042509	178042509	+	RNA	DEL	A	A	-			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:178042509delA	ENST00000455416.1	-	0	166																											AGCATCGAGGAAGGGCGCATC	0.542																																					.													.	.	.	0			.						.																																					0	.			TCGAGGAAGGGCG																													2.37:g.178042509delA		10	0		6	2	.		RNA	DEL	ENST00000455416.1	37																																																																																				.		0.542	AC079305.8-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000333896.1		
CCNT2	905	broad.mit.edu	37	2	135711353	135711353	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:135711353G>T	ENST00000264157.5	+	9	1358	c.1328G>T	c.(1327-1329)cGt>cTt	p.R443L	CCNT2_ENST00000295238.6_Missense_Mutation_p.R443L|CCNT2_ENST00000537343.1_Missense_Mutation_p.R268L	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	443					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		AGAGAAAAGCGTAAACTAGAA	0.423																																					p.R443L													.	CCNT2	98	0			c.G1328T						.						51.0	53.0	53.0					2																	135711353		2203	4300	6503	SO:0001583	missense	905	exon9			AAAAGCGTAAACT	AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.1328G>T	2.37:g.135711353G>T	ENSP00000264157:p.Arg443Leu	30	0		46	3	NM_058241	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	ENST00000264157.5	37	CCDS2174.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.332450	0.60853	.	.	ENSG00000082258	ENST00000537343;ENST00000295238;ENST00000264157	T;T	0.34667	1.35;1.35	5.71	5.71	0.89125	.	0.045307	0.85682	D	0.000000	T	0.59783	0.2219	M	0.69823	2.125	0.80722	D	1	D;D;D	0.67145	0.988;0.994;0.996	P;P;P	0.61874	0.895;0.762;0.88	T	0.60944	-0.7162	10	0.66056	D	0.02	.	19.8769	0.96880	0.0:0.0:1.0:0.0	.	268;443;443	B4DH21;O60583;O60583-2	.;CCNT2_HUMAN;.	L	268;443;443	ENSP00000295238:R443L;ENSP00000264157:R443L	ENSP00000264157:R443L	R	+	2	0	CCNT2	135427823	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.778000	0.68940	2.712000	0.92718	0.650000	0.86243	CGT	.		0.423	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254629.1	NM_058241	
ZFP64	55734	broad.mit.edu	37	20	50701719	50701719	+	Frame_Shift_Del	DEL	C	C	-			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr20:50701719delC	ENST00000361387.2	-	9	1375	c.1315delG	c.(1315-1317)gagfs	p.E439fs	ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371523.4_Frame_Shift_Del_p.E220fs	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	396					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						AAAGGCTTCTCCCCCGAGTGC	0.537																																					p.E439fs													.	ZFP64	240	0			c.1315delG						.						59.0	52.0	54.0					20																	50701719		2203	4300	6503	SO:0001589	frameshift_variant	55734	exon9			GCTTCTCCCCCGA	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1315delG	20.37:g.50701719delC	ENSP00000355179:p.Glu439fs	14	0		6	2	NM_199427	Q9NTS7|Q9NVH4	Frame_Shift_Del	DEL	ENST00000361387.2	37	CCDS13439.1																																																																																			.		0.537	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079743.2	NM_018197	
MYLIP	29116	broad.mit.edu;bcgsc.ca	37	6	16148551	16148554	+	IGR	DEL	AGTT	AGTT	-			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:16148551_16148554delAGTT	ENST00000356840.3	+	0	1666				U3_ENST00000515984.1_RNA	NM_013262.3	NP_037394.2	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting protein						cellular component movement (GO:0006928)|cholesterol homeostasis (GO:0042632)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|nervous system development (GO:0007399)|positive regulation of protein catabolic process (GO:0045732)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	cytoskeletal protein binding (GO:0008092)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			GTAACATCACAGTTAGTATCTACT	0.299																																					.													.	MYLIP	44	0			.						.																																			SO:0001628	intergenic_variant	0	.			CATCACAGTTAGT	AF187016	CCDS4536.1	6p23-p22.3	2011-11-17			ENSG00000007944	ENSG00000007944			21155	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase-inducible degrader of the low density lipoprotein receptor"""	610082				10593918, 11162443, 19688294	Standard	NM_013262		Approved	MIR, IDOL	uc003nbq.3	Q8WY64	OTTHUMG00000016405		6.37:g.16148551_16148554delAGTT		24	0		28	18	.	Q5TIA4|Q9BU73|Q9NRL9|Q9UHE7	RNA	DEL	ENST00000356840.3	37	CCDS4536.1																																																																																			.		0.299	MYLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043864.1	NM_013262	
UBR2	23304	broad.mit.edu	37	6	42600594	42600594	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:42600594G>T	ENST00000372899.1	+	13	1755	c.1497G>T	c.(1495-1497)aaG>aaT	p.K499N	UBR2_ENST00000372901.1_Missense_Mutation_p.K499N|UBR2_ENST00000372883.3_5'UTR	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	499					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TGAGGCAGAAGTTCCTAGAAG	0.333																																					p.K499N													.	UBR2	134	0			c.G1497T						.						87.0	86.0	86.0					6																	42600594		2203	4300	6503	SO:0001583	missense	23304	exon13			GCAGAAGTTCCTA	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1497G>T	6.37:g.42600594G>T	ENSP00000361990:p.Lys499Asn	46	0		42	3	NM_015255	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274668	0.59649	.	.	ENSG00000024048	ENST00000372899;ENST00000372901	T;T	0.47177	0.85;0.85	5.09	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.44891	0.1315	L	0.41356	1.27	0.80722	D	1	D;B	0.89917	1.0;0.23	D;B	0.87578	0.998;0.05	T	0.26883	-1.0090	10	0.30854	T	0.27	-14.2471	9.3816	0.38318	0.2158:0.0:0.7842:0.0	.	499;499	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	N	499	ENSP00000361990:K499N;ENSP00000361992:K499N	ENSP00000361990:K499N	K	+	3	2	UBR2	42708572	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.612000	0.46343	2.496000	0.84212	0.655000	0.94253	AAG	.		0.333	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
PDGFRL	5157	broad.mit.edu;bcgsc.ca	37	8	17447006	17447006	+	Missense_Mutation	SNP	C	C	T	rs373035421		TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr8:17447006C>T	ENST00000541323.1	+	3	530	c.85C>T	c.(85-87)Cgt>Tgt	p.R29C	PDGFRL_ENST00000398074.3_Missense_Mutation_p.R29C|PDGFRL_ENST00000251630.6_Missense_Mutation_p.R29C	NM_006207.2	NP_006198.1	Q15198	PGFRL_HUMAN	platelet-derived growth factor receptor-like	29					G-protein coupled receptor signaling pathway (GO:0007186)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)	extracellular region (GO:0005576)	platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	9				Colorectal(111;0.0752)		CAAGAACAAGCGTCCAAAAGA	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		19667	0.0		0.001	False		,,,				2504	0.0				p.R29C													.	PDGFRL	27	0			c.C85T						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	145.0	149.0	148.0		85	3.6	1.0	8		148	0,8600		0,0,4300	no	missense	PDGFRL	NM_006207.2	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	29/376	17447006	1,13005	2203	4300	6503	SO:0001583	missense	5157	exon3			AACAAGCGTCCAA	D37965	CCDS6003.1	8p22-p21.3	2013-01-29			ENSG00000104213	ENSG00000104213		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8805	protein-coding gene	gene with protein product		604584					Standard	NM_006207		Approved	PRLTS	uc003wxr.3	Q15198	OTTHUMG00000130818	ENST00000541323.1:c.85C>T	8.37:g.17447006C>T	ENSP00000444211:p.Arg29Cys	139	0		72	5	NM_006207	A8K085|Q6FH04	Missense_Mutation	SNP	ENST00000541323.1	37	CCDS6003.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798799	0.70567	2.27E-4	0.0	ENSG00000104213	ENST00000251630;ENST00000541323;ENST00000398074	T;T;T	0.37752	1.18;1.18;1.18	4.52	3.57	0.40892	.	0.222920	0.45126	D	0.000382	T	0.44498	0.1296	M	0.64997	1.995	0.80722	D	1	D	0.65815	0.995	P	0.49387	0.609	T	0.53450	-0.8437	10	0.87932	D	0	-12.4939	14.6299	0.68647	0.1457:0.8543:0.0:0.0	.	29	Q15198	PGFRL_HUMAN	C	29	ENSP00000251630:R29C;ENSP00000444211:R29C;ENSP00000381149:R29C	ENSP00000251630:R29C	R	+	1	0	PDGFRL	17491266	0.998000	0.40836	0.995000	0.50966	0.915000	0.54546	3.324000	0.52022	2.503000	0.84419	0.591000	0.81541	CGT	.		0.423	PDGFRL-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253366.3	NM_006207	
MT-ND2	4536	broad.mit.edu	37	M	2530	2530	+	5'Flank	SNP	A	A	G			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chrM:2530A>G	ENST00000361453.3	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						AGCATCACCAGTATTAGAGGC	0.468																																					.													.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			ACCAGTATTAGAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2530A>G	Exception_encountered	431	0		826	8	.	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																				.		0.468	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
ZSWIM5	57643	ucsc.edu	37	1	45500112	45500112	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:45500112G>T	ENST00000359600.5	-	11	2526	c.2321C>A	c.(2320-2322)gCa>gAa	p.A774E	AL359473.1_ENST00000583502.1_RNA	NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	774						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TGTGTCGCCTGCAGAAGCTGA	0.537																																					p.A774E													.	ZSWIM5	72	0			c.C2321A						.						96.0	96.0	96.0					1																	45500112		1994	4166	6160	SO:0001583	missense	57643	exon11			TCGCCTGCAGAAG	AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.2321C>A	1.37:g.45500112G>T	ENSP00000352614:p.Ala774Glu	69	0		35	4	NM_020883	Q5SXQ9	Missense_Mutation	SNP	ENST00000359600.5	37	CCDS41319.1	.	.	.	.	.	.	.	.	.	.	g	27.8	4.860388	0.91433	.	.	ENSG00000162415	ENST00000359600	T	0.43688	0.94	4.56	4.56	0.56223	.	0.290277	0.39475	N	0.001347	T	0.44953	0.1318	L	0.29908	0.895	0.41513	D	0.988351	P	0.51791	0.948	P	0.51657	0.676	T	0.44283	-0.9338	10	0.48119	T	0.1	-0.0762	18.2179	0.89893	0.0:0.0:1.0:0.0	.	774	Q9P217	ZSWM5_HUMAN	E	774	ENSP00000352614:A774E	ENSP00000352614:A774E	A	-	2	0	ZSWIM5	45272699	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	6.473000	0.73572	2.479000	0.83701	0.563000	0.77884	GCA	.		0.537	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024823.2	XM_046581	
TRANK1	9881	ucsc.edu;bcgsc.ca	37	3	36896814	36896814	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:36896814C>A	ENST00000429976.2	-	12	4514	c.4267G>T	c.(4267-4269)Gcc>Tcc	p.A1423S	TRANK1_ENST00000428977.2_Missense_Mutation_p.A873S|TRANK1_ENST00000301807.6_Missense_Mutation_p.A873S	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	1423							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						ATGCTCTGGGCCGTGTCCCCC	0.547																																					p.A1423S													.	TRANK1	398	0			c.G4267T						.						128.0	125.0	126.0					3																	36896814		2070	4213	6283	SO:0001583	missense	9881	exon12			TCTGGGCCGTGTC	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.4267G>T	3.37:g.36896814C>A	ENSP00000416168:p.Ala1423Ser	46	0		15	4	NM_014831	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	23.1	4.381027	0.82792	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	D;D;D	0.82711	-1.64;-1.64;-1.64	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000013	D	0.92407	0.7590	M	0.85777	2.775	0.53005	D	0.999962	D	0.89917	1.0	D	0.91635	0.999	D	0.92683	0.6160	10	0.66056	D	0.02	.	19.8624	0.96787	0.0:1.0:0.0:0.0	.	1423	O15050	TRNK1_HUMAN	S	873;1423;873	ENSP00000416826:A873S;ENSP00000416168:A1423S;ENSP00000301807:A873S	ENSP00000301807:A873S	A	-	1	0	TRANK1	36871818	1.000000	0.71417	0.915000	0.36163	0.956000	0.61745	6.025000	0.70864	2.780000	0.95670	0.561000	0.74099	GCC	.		0.547	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
CCR1	1230	ucsc.edu	37	3	46245105	46245105	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:46245105T>C	ENST00000296140.3	-	2	825	c.700A>G	c.(700-702)Aaa>Gaa	p.K234E	CCR3_ENST00000357422.2_Intron	NM_001295.2	NP_001286.1	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	234					calcium ion transport (GO:0006816)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of osteoclast differentiation (GO:0045672)|response to wounding (GO:0009611)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine (C-C motif) ligand 7 binding (GO:0035717)|chemokine receptor activity (GO:0004950)|phosphatidylinositol phospholipase C activity (GO:0004435)			autonomic_ganglia(1)|large_intestine(6)|lung(6)|pancreas(1)|skin(3)	17				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GCTTTGGATTTCTTCTCATTT	0.378																																					p.K234E													.	CCR1	36	0			c.A700G						.						62.0	61.0	61.0					3																	46245105		2203	4300	6503	SO:0001583	missense	1230	exon2			TGGATTTCTTCTC		CCDS2737.1	3p21	2012-08-08			ENSG00000163823	ENSG00000163823		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1602	protein-coding gene	gene with protein product		601159		SCYAR1, CMKBR1		7679328	Standard	NM_001295		Approved	CKR-1, MIP1aR, CD191	uc003cph.1	P32246	OTTHUMG00000133451	ENST00000296140.3:c.700A>G	3.37:g.46245105T>C	ENSP00000296140:p.Lys234Glu	62	0		34	4	NM_001295	Q86VA9	Missense_Mutation	SNP	ENST00000296140.3	37	CCDS2737.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.280429	0.80692	.	.	ENSG00000163823	ENST00000296140	T	0.69306	-0.39	5.31	5.31	0.75309	GPCR, rhodopsin-like superfamily (1);	0.069902	0.64402	D	0.000018	D	0.84392	0.5462	M	0.88310	2.945	0.48696	D	0.99969	D	0.89917	1.0	D	0.97110	1.0	D	0.87702	0.2561	10	0.87932	D	0	.	15.5574	0.76208	0.0:0.0:0.0:1.0	.	234	P32246	CCR1_HUMAN	E	234	ENSP00000296140:K234E	ENSP00000296140:K234E	K	-	1	0	CCR1	46220109	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	7.981000	0.88123	2.138000	0.66242	0.523000	0.50628	AAA	.		0.378	CCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257325.2	NM_001295	
NCKIPSD	51517	ucsc.edu;bcgsc.ca	37	3	48712059	48712059	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:48712059G>T	ENST00000294129.2	-	13	2206	c.2087C>A	c.(2086-2088)aCc>aAc	p.T696N	RP11-572O6.1_ENST00000607025.1_lincRNA|NCKIPSD_ENST00000416649.2_Missense_Mutation_p.T689N|NCKIPSD_ENST00000341520.4_Intron	NM_016453.2	NP_057537.1	Q9NZQ3	SPN90_HUMAN	NCK interacting protein with SH3 domain	696					cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|NLS-bearing protein import into nucleus (GO:0006607)|signal transduction (GO:0007165)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	cytoskeletal protein binding (GO:0008092)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTGGGGTGAGGTCTCCTCCTC	0.607																																					p.T696N													.	NCKIPSD	52	0			c.C2087A						.						127.0	105.0	112.0					3																	48712059		2203	4300	6503	SO:0001583	missense	51517	exon13			GGTGAGGTCTCCT	AF178432	CCDS2776.1, CCDS46827.1	3p21	2008-07-18			ENSG00000213672	ENSG00000213672			15486	protein-coding gene	gene with protein product	"""dia interacting protein"", ""diaphanous protein interacting protein"", ""SH3 protein interacting with Nck, 90 kDa"""	606671				10648423, 10619843	Standard	NM_016453		Approved	AF3P21, SPIN90, ORF1, WISH, WASLBP, DIP1	uc003cun.3	Q9NZQ3	OTTHUMG00000133542	ENST00000294129.2:c.2087C>A	3.37:g.48712059G>T	ENSP00000294129:p.Thr696Asn	23	0		17	4	NM_016453	B4DFL5|Q6GU34|Q6SPF3|Q8TC10|Q9UGM8	Missense_Mutation	SNP	ENST00000294129.2	37	CCDS2776.1	.	.	.	.	.	.	.	.	.	.	g	9.867	1.197772	0.22037	.	.	ENSG00000213672	ENST00000416649;ENST00000294129	T;T	0.30448	1.53;1.53	5.42	1.14	0.20703	.	.	.	.	.	T	0.14570	0.0352	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.18166	0.015;0.026	B;B	0.17722	0.008;0.019	T	0.30707	-0.9969	9	0.18710	T	0.47	.	4.68	0.12731	0.0803:0.1043:0.4641:0.3513	.	696;689	Q9NZQ3;Q9NZQ3-3	SPN90_HUMAN;.	N	689;696	ENSP00000389059:T689N;ENSP00000294129:T696N	ENSP00000294129:T696N	T	-	2	0	NCKIPSD	48687063	0.422000	0.25473	0.085000	0.20634	0.679000	0.39708	2.938000	0.48987	0.594000	0.29761	0.543000	0.68304	ACC	.		0.607	NCKIPSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257520.1	NM_016453	
INTS12	57117	ucsc.edu	37	4	106604263	106604263	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr4:106604263G>T	ENST00000451321.2	-	7	1495	c.1016C>A	c.(1015-1017)tCa>tAa	p.S339*	INTS12_ENST00000394735.1_Nonsense_Mutation_p.S339*|INTS12_ENST00000340139.5_Nonsense_Mutation_p.S339*	NM_001142471.1	NP_001135943.1	Q96CB8	INT12_HUMAN	integrator complex subunit 12	339	Ser-rich.				snRNA processing (GO:0016180)	integrator complex (GO:0032039)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		ACCTTTGGATGATGTTGCCAG	0.443																																					p.S339X													.	INTS12	35	0			c.C1016A						.						223.0	201.0	208.0					4																	106604263		2203	4300	6503	SO:0001587	stop_gained	57117	exon8			TTGGATGATGTTG		CCDS3671.1	4q24	2013-01-28	2006-03-15	2006-03-15	ENSG00000138785	ENSG00000138785		"""Zinc fingers, PHD-type"""	25067	protein-coding gene	gene with protein product	"""hypothetical nuclear factor SBBI22"""	611355	"""PHD finger protein 22"""	PHF22		16239144	Standard	NM_020395		Approved	SBBI22, INT12	uc010ilr.3	Q96CB8	OTTHUMG00000131215	ENST00000451321.2:c.1016C>A	4.37:g.106604263G>T	ENSP00000415433:p.Ser339*	66	0		19	4	NM_020395	B2RC48|Q3B6Z3|Q9HD71	Nonsense_Mutation	SNP	ENST00000451321.2	37	CCDS3671.1	.	.	.	.	.	.	.	.	.	.	G	40	8.049945	0.98629	.	.	ENSG00000138785	ENST00000394735;ENST00000340139;ENST00000451321	.	.	.	5.17	5.17	0.71159	.	0.277018	0.35291	N	0.003313	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-9.5387	18.6889	0.91576	0.0:0.0:1.0:0.0	.	.	.	.	X	339	.	ENSP00000340737:S339X	S	-	2	0	INTS12	106823712	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.633000	0.74286	2.406000	0.81754	0.591000	0.81541	TCA	.		0.443	INTS12-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318624.1	NM_020395	
THBS2	7058	ucsc.edu;bcgsc.ca	37	6	169632768	169632768	+	Silent	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:169632768C>T	ENST00000366787.3	-	13	2172	c.1923G>A	c.(1921-1923)acG>acA	p.T641T	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	641					cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CTTGCTTTTCCGTCTTGGCTG	0.602																																					p.T641T	Esophageal Squamous(91;219 1934 18562 44706)												.	THBS2	230	0			c.G1923A						.						80.0	86.0	84.0					6																	169632768		2203	4300	6503	SO:0001819	synonymous_variant	7058	exon13			CTTTTCCGTCTTG		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1923G>A	6.37:g.169632768C>T		29	0		22	4	NM_003247	A6H8N1|A7E232|Q5RI52	Silent	SNP	ENST00000366787.3	37	CCDS34574.1																																																																																			.		0.602	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
PTPRR	5801	ucsc.edu;bcgsc.ca	37	12	71139661	71139661	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr12:71139661G>A	ENST00000283228.2	-	6	1396	c.944C>T	c.(943-945)gCt>gTt	p.A315V	PTPRR_ENST00000440835.2_Missense_Mutation_p.A70V|PTPRR_ENST00000342084.4_Missense_Mutation_p.A203V|PTPRR_ENST00000549308.1_Missense_Mutation_p.A70V|PTPRR_ENST00000378778.1_Missense_Mutation_p.A109V	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	315					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		AGCGGTGGTAGCTTTGATCTC	0.512																																					p.A315V													.	PTPRR	109	0			c.C944T						.						152.0	113.0	126.0					12																	71139661		2203	4300	6503	SO:0001583	missense	5801	exon6			GTGGTAGCTTTGA	D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.944C>T	12.37:g.71139661G>A	ENSP00000283228:p.Ala315Val	70	0		30	4	NM_002849	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	ENST00000283228.2	37	CCDS8998.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.115248	0.37339	.	.	ENSG00000153233	ENST00000440835;ENST00000283228;ENST00000378778;ENST00000342084;ENST00000549308;ENST00000550661	T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28	5.53	3.64	0.41730	.	0.550425	0.16238	N	0.223296	T	0.20861	0.0502	N	0.14661	0.345	0.22034	N	0.999404	B;B;B;B	0.30763	0.294;0.078;0.023;0.02	B;B;B;B	0.21708	0.026;0.036;0.022;0.016	T	0.08868	-1.0701	10	0.33940	T	0.23	-3.0837	12.2386	0.54530	0.0:0.1259:0.7354:0.1388	.	164;203;109;315	B7Z998;F5GXR7;Q15256-4;Q15256	.;.;.;PTPRR_HUMAN	V	70;315;109;203;70;70	ENSP00000391750:A70V;ENSP00000283228:A315V;ENSP00000368054:A109V;ENSP00000339605:A203V;ENSP00000446943:A70V;ENSP00000449616:A70V	ENSP00000283228:A315V	A	-	2	0	PTPRR	69425928	1.000000	0.71417	0.543000	0.28128	0.904000	0.53231	3.957000	0.56730	0.645000	0.30675	0.655000	0.94253	GCT	.		0.512	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404485.1	NM_002849	
PLBD2	196463	ucsc.edu;bcgsc.ca	37	12	113812331	113812331	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr12:113812331G>A	ENST00000280800.3	+	4	627	c.596G>A	c.(595-597)cGt>cAt	p.R199H	PLBD2_ENST00000545182.2_Missense_Mutation_p.R199H	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	199					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						TACGAAGGCCGTGTGAGCTTC	0.632																																					p.R199H													.	PLBD2	33	0			c.G596A						.						31.0	31.0	31.0					12																	113812331		2203	4299	6502	SO:0001583	missense	196463	exon4			AAGGCCGTGTGAG	BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.596G>A	12.37:g.113812331G>A	ENSP00000280800:p.Arg199His	65	0		27	4	NM_173542	F5H5E2	Missense_Mutation	SNP	ENST00000280800.3	37	CCDS9168.1	.	.	.	.	.	.	.	.	.	.	G	13.92	2.379919	0.42207	.	.	ENSG00000151176	ENST00000545182;ENST00000280800	T;T	0.24908	1.83;1.83	4.39	2.56	0.30785	.	0.235919	0.41823	N	0.000820	T	0.23289	0.0563	L	0.53561	1.675	0.26495	N	0.974874	B;B	0.16603	0.018;0.009	B;B	0.12156	0.002;0.007	T	0.16305	-1.0407	10	0.45353	T	0.12	-4.9438	9.8778	0.41213	0.1649:0.0:0.8351:0.0	.	199;199	F5H5E2;Q8NHP8	.;PLBL2_HUMAN	H	199	ENSP00000443463:R199H;ENSP00000280800:R199H	ENSP00000280800:R199H	R	+	2	0	PLBD2	112296714	0.927000	0.31430	0.532000	0.27989	0.972000	0.66771	1.453000	0.35167	0.493000	0.27837	0.407000	0.27541	CGT	.		0.632	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404835.1	NM_173542	
SNAI3	333929	ucsc.edu;bcgsc.ca	37	16	88747696	88747696	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr16:88747696G>A	ENST00000332281.5	-	2	589	c.503C>T	c.(502-504)gCc>gTc	p.A168V	SNAI3-AS1_ENST00000563261.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3	168					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		CCGGTGCCTGGCCAGCCCGGC	0.652																																					p.A168V	Colon(27;366 710 19748 23199 27567)												.	SNAI3	23	0			c.C503T						.						47.0	51.0	50.0					16																	88747696		2198	4299	6497	SO:0001583	missense	333929	exon2			TGCCTGGCCAGCC	BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1		ENST00000332281.5:c.503C>T	16.37:g.88747696G>A	ENSP00000327968:p.Ala168Val	40	0		33	4	NM_178310	Q86SU5	Missense_Mutation	SNP	ENST00000332281.5	37	CCDS32505.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.970413	0.74246	.	.	ENSG00000185669	ENST00000332281	T	0.05996	3.36	4.37	3.38	0.38709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.268725	0.34676	N	0.003768	T	0.06462	0.0166	L	0.37897	1.145	0.40559	D	0.981195	B	0.34181	0.44	B	0.38378	0.272	T	0.43180	-0.9407	10	0.16896	T	0.51	-12.0956	10.95	0.47323	0.0:0.0:0.8116:0.1884	.	168	Q3KNW1	SNAI3_HUMAN	V	168	ENSP00000327968:A168V	ENSP00000327968:A168V	A	-	2	0	SNAI3	87275197	1.000000	0.71417	0.997000	0.53966	0.686000	0.39977	3.889000	0.56212	0.922000	0.37019	0.491000	0.48974	GCC	.		0.652	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422582.1		
YPEL1	29799	ucsc.edu;bcgsc.ca	37	22	22064926	22064926	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr22:22064926G>T	ENST00000339468.3	-	2	491	c.108C>A	c.(106-108)ctC>ctA	p.L36L	YPEL1_ENST00000403503.1_Silent_p.L36L	NM_013313.3	NP_037445.1	O60688	YPEL1_HUMAN	yippee-like 1 (Drosophila)	36						nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(1)	3	Colorectal(54;0.105)					CCTTGGAGATGAGCTCGTCAT	0.438																																					p.L36L													YPEL1,rectum,carcinoma,-1,1	YPEL1	6	0			c.C108A						.						309.0	262.0	278.0					22																	22064926		2203	4300	6503	SO:0001819	synonymous_variant	29799	exon2			GGAGATGAGCTCG	AF060862	CCDS13794.1	22q11.2	2008-02-04	2001-11-28		ENSG00000100027	ENSG00000100027			12845	protein-coding gene	gene with protein product		608082	"""yippee (Drosophila) homolog-like 1"""			11473580	Standard	NM_013313		Approved		uc002zvl.3	O60688	OTTHUMG00000150830	ENST00000339468.3:c.108C>A	22.37:g.22064926G>T		76	0		42	4	NM_013313	Q65ZA1|Q6GLI6	Silent	SNP	ENST00000339468.3	37	CCDS13794.1																																																																																			.		0.438	YPEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320245.1	NM_013313	
TRAF3IP2	10758	bcgsc.ca	37	6	111912799	111912799	+	Frame_Shift_Del	DEL	G	G	-			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:111912799delG	ENST00000340026.6	-	3	1112	c.518delC	c.(517-519)cctfs	p.P173fs	TRAF3IP2_ENST00000359831.4_Frame_Shift_Del_p.P164fs|TRAF3IP2-AS1_ENST00000532353.1_RNA|TRAF3IP2_ENST00000368761.5_Frame_Shift_Del_p.P164fs|TRAF3IP2_ENST00000392556.4_5'UTR			O43734	CIKS_HUMAN	TRAF3 interacting protein 2	173	Mediates interaction with TRAF6.				B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)					central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		TGAGGCATTAGGTAAACTTTG	0.517																																					p.P164fs													TRAF3IP2,colon,carcinoma,0,1	TRAF3IP2	35	0			c.491delC						.						59.0	56.0	57.0					6																	111912799		2203	4300	6503	SO:0001589	frameshift_variant	10758	exon2			GCATTAGGTAAAC	AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.518delC	6.37:g.111912799delG	ENSP00000345984:p.Pro173fs	62	0		20	4	NM_147686	B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	Frame_Shift_Del	DEL	ENST00000340026.6	37																																																																																				.		0.517	TRAF3IP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000041841.2		
WASF2	10163	bcgsc.ca	37	1	27742558	27742558	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:27742558G>A	ENST00000430629.2	-	5	673	c.458C>T	c.(457-459)cCt>cTt	p.P153L	WASF2_ENST00000536657.1_Missense_Mutation_p.P153L	NM_001201404.1|NM_006990.3	NP_001188333.1|NP_008921.1	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	153					actin cytoskeleton organization (GO:0030036)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of lamellipodium assembly (GO:0010592)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	actin binding (GO:0003779)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	18		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		GAAGTATGAAGGGTCTGTGTA	0.458																																					p.P153L													.	WASF2	41	0			c.C458T						.						202.0	177.0	185.0					1																	27742558		2203	4300	6503	SO:0001583	missense	10163	exon5			TATGAAGGGTCTG	AB026542	CCDS304.1, CCDS55582.1	1p36.11	2011-05-10			ENSG00000158195	ENSG00000158195			12733	protein-coding gene	gene with protein product		605875				10381382	Standard	NM_006990		Approved	WAVE2, SCAR2	uc001bof.2	Q9Y6W5	OTTHUMG00000003393	ENST00000430629.2:c.458C>T	1.37:g.27742558G>A	ENSP00000396211:p.Pro153Leu	88	0		28	3	NM_006990	B4DZN0|O60794|Q9UDY7	Missense_Mutation	SNP	ENST00000430629.2	37	CCDS304.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086807	0.76642	.	.	ENSG00000158195	ENST00000430629;ENST00000536657	T;T	0.67523	-0.27;-0.27	5.64	5.64	0.86602	.	0.052035	0.85682	D	0.000000	D	0.85852	0.5793	M	0.91717	3.235	0.80722	D	1	D;D	0.76494	0.999;0.993	D;P	0.68765	0.96;0.508	D	0.88566	0.3126	10	0.87932	D	0	-8.2979	19.3173	0.94220	0.0:0.0:1.0:0.0	.	153;153	B4DZN0;Q9Y6W5	.;WASF2_HUMAN	L	153	ENSP00000396211:P153L;ENSP00000439883:P153L	ENSP00000396211:P153L	P	-	2	0	WASF2	27615145	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.429000	0.97481	2.654000	0.90174	0.563000	0.77884	CCT	.		0.458	WASF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009516.1	NM_006990	
TIE1	7075	bcgsc.ca	37	1	43783044	43783044	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:43783044G>T	ENST00000372476.3	+	15	2663	c.2584G>T	c.(2584-2586)Ggg>Tgg	p.G862W	TIE1_ENST00000433781.2_Missense_Mutation_p.G507W|TIE1_ENST00000473014.1_3'UTR	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	862	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CAAGAAGGACGGGCTGAAGAT	0.597																																					p.G862W													.	TIE1	132	0			c.G2584T						.						79.0	76.0	77.0					1																	43783044		2203	4300	6503	SO:0001583	missense	7075	exon15			AAGGACGGGCTGA	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2584G>T	1.37:g.43783044G>T	ENSP00000361554:p.Gly862Trp	41	0		19	3	NM_005424	B5A949|B5A950	Missense_Mutation	SNP	ENST00000372476.3	37	CCDS482.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268079	0.80469	.	.	ENSG00000066056	ENST00000372476;ENST00000372475;ENST00000536913;ENST00000433781	T;T	0.73469	-0.75;-0.75	5.15	5.15	0.70609	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.38837	N	0.001547	D	0.89774	0.6812	M	0.93016	3.37	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.92279	0.5832	10	0.87932	D	0	.	18.6195	0.91316	0.0:0.0:1.0:0.0	.	817;507;862	B4DTW8;B4DKW0;P35590	.;.;TIE1_HUMAN	W	862;265;145;507	ENSP00000361554:G862W;ENSP00000411728:G507W	ENSP00000361553:G265W	G	+	1	0	TIE1	43555631	1.000000	0.71417	0.886000	0.34754	0.927000	0.56198	9.433000	0.97501	2.396000	0.81511	0.555000	0.69702	GGG	.		0.597	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424	
LOC101927209	101927209	bcgsc.ca	37	1	142620859	142620859	+	lincRNA	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:142620859T>C	ENST00000610091.1	-	0	6624				RP11-417J8.3_ENST00000426408.1_lincRNA																							CGTGAAGGACTCTTCTCCCAT	0.418																																					.													.	.	.	0			.						.																																					0	.			AAGGACTCTTCTC																													1.37:g.142620859T>C		158	2		83	5	.		RNA	SNP	ENST00000610091.1	37																																																																																				.		0.418	RP11-417J8.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000037265.2		
PKLR	5313	bcgsc.ca	37	1	155271109	155271109	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:155271109G>T	ENST00000342741.4	-	1	116	c.78C>A	c.(76-78)tcC>tcA	p.S26S	PKLR_ENST00000392414.3_5'Flank	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	26					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	CAATCAGGATGGACTTTGCTA	0.522																																					p.S26S													.	PKLR	70	0			c.C78A						.						117.0	108.0	111.0					1																	155271109		2203	4300	6503	SO:0001819	synonymous_variant	5313	exon1			CAGGATGGACTTT	BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.78C>A	1.37:g.155271109G>T		40	0		72	4	NM_000298	O75758|P11973	Silent	SNP	ENST00000342741.4	37	CCDS1109.1																																																																																			.		0.522	PKLR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087407.2	NM_000298	
RHBG	57127	bcgsc.ca	37	1	156337543	156337543	+	5'Flank	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:156337543G>A	ENST00000368249.1	+	0	0				RHBG_ENST00000400992.2_5'Flank|RHBG_ENST00000368246.2_5'Flank|RHBG_ENST00000255013.3_5'Flank|RHBG_ENST00000451864.2_5'Flank|RHBG_ENST00000537040.1_5'Flank	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)						ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					acactgccaggctcggtctat	0.522																																					.													.	.	.	0			.						.						173.0	166.0	168.0					1																	156337543		876	1991	2867	SO:0001631	upstream_gene_variant	7203	.			TGCCAGGCTCGGT	AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057		1.37:g.156337543G>A	Exception_encountered	71	0		79	4	.	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Missense_Mutation	SNP	ENST00000368249.1	37		.	.	.	.	.	.	.	.	.	.	G	2.062	-0.415134	0.04766	.	.	ENSG00000163468	ENST00000413555;ENST00000446905	T;T	0.78364	-1.17;0.55	2.76	0.758	0.18432	.	.	.	.	.	T	0.34337	0.0894	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.21930	-1.0231	6	0.16896	T	0.51	.	3.0156	0.06058	0.1523:0.0:0.5789:0.2688	.	.	.	.	V	32	ENSP00000413308:A32V;ENSP00000388799:A32V	ENSP00000413308:A32V	A	-	2	0	CCT3	154604167	0.000000	0.05858	0.062000	0.19696	0.196000	0.23810	-0.020000	0.12525	0.206000	0.20587	0.591000	0.81541	GCC	.		0.522	RHBG-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000060589.2	NM_001256395	
MAPKAPK2	9261	bcgsc.ca	37	1	206904533	206904533	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr1:206904533C>A	ENST00000367103.3	+	7	1011	c.818C>A	c.(817-819)cCg>cAg	p.P273Q	MAPKAPK2_ENST00000294981.4_Missense_Mutation_p.P273Q	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	273	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GCCATCTCTCCGGGCATGAAG	0.527																																					p.P273Q													.	MAPKAPK2	45	0			c.C818A						.						121.0	112.0	115.0					1																	206904533		2203	4300	6503	SO:0001583	missense	9261	exon7			TCTCTCCGGGCAT	U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.818C>A	1.37:g.206904533C>A	ENSP00000356070:p.Pro273Gln	30	0		48	4	NM_004759	Q5SY30|Q5SY41|Q8IYD6	Missense_Mutation	SNP	ENST00000367103.3	37	CCDS31001.1	.	.	.	.	.	.	.	.	.	.	C	33	5.213372	0.95069	.	.	ENSG00000162889	ENST00000294981;ENST00000367103	T;T	0.63744	-0.06;-0.06	5.62	5.62	0.85841	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.68137	0.2968	N	0.20807	0.61	0.80722	D	1	P;D	0.89917	0.929;1.0	P;D	0.79108	0.812;0.992	T	0.69217	-0.5203	9	0.44086	T	0.13	-23.5545	18.2248	0.89914	0.0:1.0:0.0:0.0	.	273;273	P49137;P49137-2	MAPK2_HUMAN;.	Q	273	ENSP00000294981:P273Q;ENSP00000356070:P273Q	ENSP00000294981:P273Q	P	+	2	0	MAPKAPK2	204971156	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.796000	0.85898	2.659000	0.90383	0.655000	0.94253	CCG	.		0.527	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088465.1	NM_004759	
XPO1	7514	bcgsc.ca	37	2	61711107	61711107	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:61711107G>T	ENST00000401558.2	-	21	3369	c.2642C>A	c.(2641-2643)gCt>gAt	p.A881D	RP11-355B11.2_ENST00000603028.1_RNA|RP11-355B11.2_ENST00000578974.2_RNA|RP11-355B11.2_ENST00000603652.1_RNA|XPO1_ENST00000404992.2_Missense_Mutation_p.A881D|XPO1_ENST00000406957.1_Missense_Mutation_p.A881D|RP11-355B11.2_ENST00000605437.1_RNA	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	881					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			ATGTTTGAAAGCCCAAATGAT	0.343			Mis		CLL																																p.A881D			-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	.	XPO1	108	0			c.C2642A						.						104.0	102.0	102.0					2																	61711107		2203	4300	6503	SO:0001583	missense	7514	exon21			TTGAAAGCCCAAA	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.2642C>A	2.37:g.61711107G>T	ENSP00000384863:p.Ala881Asp	126	0		72	4	NM_003400	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	37	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	G	34	5.330731	0.95733	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.68624	-0.34;-0.34;-0.34	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (2);Exportin 1, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.87629	0.6225	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	D	0.90237	0.4283	10	0.87932	D	0	-14.6569	20.0358	0.97557	0.0:0.0:1.0:0.0	.	528;881	B3KWD0;O14980	.;XPO1_HUMAN	D	881	ENSP00000384863:A881D;ENSP00000385942:A881D;ENSP00000385559:A881D	ENSP00000384863:A881D	A	-	2	0	XPO1	61564611	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.813000	0.99286	2.805000	0.96524	0.655000	0.94253	GCT	.		0.343	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
TTN	7273	bcgsc.ca	37	2	179655547	179655547	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:179655547G>T	ENST00000591111.1	-	11	1912	c.1688C>A	c.(1687-1689)gCt>gAt	p.A563D	TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.A563D|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.A563D|TTN_ENST00000360870.5_Missense_Mutation_p.A563D|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATGGATGCAGCAGTTATCTC	0.398																																					p.A563D													.	TTN	18412	0			c.C1688A						.						195.0	175.0	181.0					2																	179655547		2203	4300	6503	SO:0001583	missense	7273	exon11			GATGCAGCAGTTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1688C>A	2.37:g.179655547G>T	ENSP00000465570:p.Ala563Asp	114	0		63	4	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	12.86	2.064040	0.36373	.	.	ENSG00000155657	ENST00000342992;ENST00000360870	T;T	0.63417	-0.04;-0.04	5.07	4.19	0.49359	Titin Z (1);Ribonuclease H-like (1);	.	.	.	.	T	0.53012	0.1770	N	0.24115	0.695	0.80722	D	1	B;D	0.53462	0.157;0.96	B;P	0.46110	0.091;0.504	T	0.60177	-0.7314	9	0.87932	D	0	.	13.641	0.62251	0.0742:0.0:0.9258:0.0	.	563;563	Q8WZ42;Q8WZ42-6	TITIN_HUMAN;.	D	563	ENSP00000343764:A563D;ENSP00000354117:A563D	ENSP00000343764:A563D	A	-	2	0	TTN	179363792	0.905000	0.30787	0.939000	0.37840	0.972000	0.66771	6.072000	0.71238	1.370000	0.46153	0.655000	0.94253	GCT	.		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SLC23A3	151295	bcgsc.ca	37	2	220029918	220029918	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr2:220029918G>T	ENST00000409878.3	-	8	1172	c.1140C>A	c.(1138-1140)ccC>ccA	p.P380P	SLC23A3_ENST00000455516.2_Silent_p.P388P|SLC23A3_ENST00000295738.7_Intron|SLC23A3_ENST00000396775.3_Intron	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	380					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGCCCACGTTGGGGAAGCTGG	0.622																																					p.P388P													.	SLC23A3	60	0			c.C1164A						.						13.0	19.0	17.0					2																	220029918		691	1589	2280	SO:0001819	synonymous_variant	151295	exon8			CACGTTGGGGAAG	BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.1140C>A	2.37:g.220029918G>T		40	0		41	4	NM_001144890	B7Z512|Q2PYN6|Q96NA6	Silent	SNP	ENST00000409878.3	37	CCDS46518.1																																																																																			.		0.622	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336331.2	NM_144712	
CACNA2D2	9254	bcgsc.ca	37	3	50403587	50403587	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:50403587C>T	ENST00000479441.1	-	33	2737	c.2738G>A	c.(2737-2739)aGg>aAg	p.R913K	XXcos-LUCA11.4_ENST00000607121.1_RNA|XXcos-LUCA11.4_ENST00000606665.1_RNA|XXcos-LUCA11.4_ENST00000606259.1_RNA|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.R914K|CACNA2D2_ENST00000395083.1_Missense_Mutation_p.R906K|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.R913K|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.R907K|XXcos-LUCA11.5_ENST00000606589.1_Intron|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.R837K|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.R906K|XXcos-LUCA11.4_ENST00000607088.1_RNA|XXcos-LUCA11.4_ENST00000607362.1_RNA|CACNA2D2_ENST00000424201.2_Missense_Mutation_p.R906K|XXcos-LUCA11.4_ENST00000607583.1_RNA			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	913					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	ACTGAAGAACCTGCCCACCTG	0.537																																					p.R913K													.	CACNA2D2	82	0			c.G2738A						.						161.0	151.0	155.0					3																	50403587		2203	4300	6503	SO:0001583	missense	9254	exon33			AAGAACCTGCCCA	AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.2738G>A	3.37:g.50403587C>T	ENSP00000418081:p.Arg913Lys	33	0		25	4	NM_001174051	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	ENST00000479441.1	37	CCDS54588.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.227928	0.39399	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	T;T;T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	4.97	3.96	0.45880	.	0.466449	0.22899	N	0.054300	T	0.44871	0.1314	N	0.03154	-0.405	0.27354	N	0.956169	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.14868	-1.0457	10	0.25751	T	0.34	-18.066	3.8104	0.08795	0.0:0.7171:0.0:0.2829	.	913;906	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	K	914;907;906;837;913;906;906;913	ENSP00000407393:R914K;ENSP00000404631:R907K;ENSP00000266039:R906K;ENSP00000354228:R837K;ENSP00000390526:R913K;ENSP00000378519:R906K;ENSP00000390329:R906K;ENSP00000418081:R913K	ENSP00000266039:R906K	R	-	2	0	CACNA2D2	50378591	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.804000	0.38873	2.298000	0.77334	0.561000	0.74099	AGG	.		0.537	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030	
AC108696.1	0	bcgsc.ca	37	3	84339395	84339395	+	RNA	SNP	T	T	C			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr3:84339395T>C	ENST00000408453.1	-	0	9																											caagtttatctggctgtctgg	0.368																																					.													.	.	.	0			.						.																																					0	.			TTTATCTGGCTGT																													3.37:g.84339395T>C		126	0		70	29	.		RNA	SNP	ENST00000408453.1	37																																																																																				.		0.368	AC108696.1-201	NOVEL	basic	miRNA	miRNA			
CORIN	10699	bcgsc.ca	37	4	47647102	47647102	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr4:47647102G>T	ENST00000273857.4	-	14	1952	c.1953C>A	c.(1951-1953)aaC>aaA	p.N651K	CORIN_ENST00000508498.1_Missense_Mutation_p.N512K|CORIN_ENST00000502252.1_Missense_Mutation_p.N584K|CORIN_ENST00000504584.1_Missense_Mutation_p.N614K|CORIN_ENST00000505909.1_Missense_Mutation_p.N614K	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	651	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						ACTTACAGCAGTTTTTCTCGT	0.378																																					p.N651K													.	CORIN	154	0			c.C1953A						.						146.0	138.0	141.0					4																	47647102		2203	4300	6503	SO:0001583	missense	10699	exon14			ACAGCAGTTTTTC	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.1953C>A	4.37:g.47647102G>T	ENSP00000273857:p.Asn651Lys	68	0		47	4	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	37	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.235704	0.58886	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23	6.07	2.51	0.30379	.	0.000000	0.85682	D	0.000000	T	0.73938	0.3651	M	0.81802	2.56	0.43503	D	0.995756	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.83275	0.996;0.933;0.982	T	0.71830	-0.4474	10	0.40728	T	0.16	.	11.9848	0.53140	0.2705:0.0:0.7295:0.0	.	614;584;651	B4E2W9;B4E1Y7;Q9Y5Q5	.;.;CORIN_HUMAN	K	651;512;584;614;614	ENSP00000273857:N651K;ENSP00000425597:N512K;ENSP00000424212:N584K;ENSP00000425401:N614K;ENSP00000423216:N614K	ENSP00000273857:N651K	N	-	3	2	CORIN	47341859	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	2.581000	0.46077	0.167000	0.19631	0.655000	0.94253	AAC	.		0.378	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
G3BP2	9908	bcgsc.ca	37	4	76582169	76582169	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr4:76582169G>T	ENST00000359707.4	-	5	1166	c.381C>A	c.(379-381)caC>caA	p.H127Q	G3BP2_ENST00000502654.1_5'UTR|G3BP2_ENST00000395719.3_Missense_Mutation_p.H127Q|G3BP2_ENST00000357854.3_Missense_Mutation_p.H127Q	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	127	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ACATATCATTGTGAACATAAA	0.328																																					p.H127Q													.	G3BP2	52	0			c.C381A						.						116.0	121.0	119.0					4																	76582169		2203	4298	6501	SO:0001583	missense	9908	exon5			ATCATTGTGAACA	AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.381C>A	4.37:g.76582169G>T	ENSP00000352738:p.His127Gln	78	0		49	4	NM_012297	A8K6X1|O60606|O75149|Q9UPA1	Missense_Mutation	SNP	ENST00000359707.4	37	CCDS3571.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.823865	0.50739	.	.	ENSG00000138757	ENST00000395719;ENST00000359707;ENST00000357854;ENST00000503660;ENST00000507745	T;T;T	0.78364	-1.17;-1.17;-1.14	5.95	-0.789	0.10935	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.000000	0.85682	D	0.000000	T	0.80576	0.4649	L	0.48362	1.52	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.993;0.999	T	0.75048	-0.3455	10	0.23891	T	0.37	.	12.2667	0.54683	0.5702:0.0:0.4298:0.0	.	127;127	Q9UN86-2;Q9UN86	.;G3BP2_HUMAN	Q	127	ENSP00000379069:H127Q;ENSP00000352738:H127Q;ENSP00000350518:H127Q	ENSP00000350518:H127Q	H	-	3	2	G3BP2	76801193	1.000000	0.71417	0.994000	0.49952	0.282000	0.26991	2.167000	0.42415	-0.114000	0.11936	0.655000	0.94253	CAC	.		0.328	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252399.2	NM_012297	
NEDD9	4739	bcgsc.ca	37	6	11191311	11191311	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:11191311G>T	ENST00000379446.5	-	5	957	c.791C>A	c.(790-792)cCt>cAt	p.P264H	RP3-510L9.1_ENST00000500636.2_RNA|NEDD9_ENST00000504387.1_Missense_Mutation_p.P264H	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	264					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			GCAGGTTGGAGGAATGTCATA	0.557																																					p.P264H													.	NEDD9	191	0			c.C791A						.						84.0	75.0	78.0					6																	11191311		2203	4300	6503	SO:0001583	missense	4739	exon6			GTTGGAGGAATGT	L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.791C>A	6.37:g.11191311G>T	ENSP00000368759:p.Pro264His	72	0		55	4	NM_001142393	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	ENST00000379446.5	37	CCDS4520.1	.	.	.	.	.	.	.	.	.	.	g	14.95	2.687790	0.48097	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.60548	0.18;0.25	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.71576	0.3356	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.994	T	0.74429	-0.3668	10	0.87932	D	0	-27.3874	13.797	0.63177	0.0696:0.0:0.9304:0.0	.	264;264;264	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	H	264	ENSP00000368759:P264H;ENSP00000422871:P264H	ENSP00000368759:P264H	P	-	2	0	NEDD9	11299297	1.000000	0.71417	1.000000	0.80357	0.060000	0.15804	7.479000	0.81095	2.891000	0.99171	0.651000	0.88453	CCT	.		0.557	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2	NM_006403	
PRRC2A	7916	bcgsc.ca	37	6	31604380	31604380	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr6:31604380C>A	ENST00000376033.2	+	27	6163	c.5929C>A	c.(5929-5931)Cag>Aag	p.Q1977K	PRRC2A_ENST00000376007.4_Missense_Mutation_p.Q1977K	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1977	3 X 50 AA type C repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						GGCTCCTGCCCAGCAGGTATA	0.522																																					p.Q1977K													.	PRRC2A	152	0			c.C5929A						.						110.0	129.0	122.0					6																	31604380		1510	2707	4217	SO:0001583	missense	7916	exon27			CCTGCCCAGCAGG	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.5929C>A	6.37:g.31604380C>A	ENSP00000365201:p.Gln1977Lys	48	0		41	4	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	C	9.839	1.190618	0.21954	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.02103	4.45;4.45	5.35	5.35	0.76521	.	0.000000	0.48767	D	0.000168	T	0.02688	0.0081	L	0.52573	1.65	0.41048	D	0.985289	P	0.48764	0.915	P	0.47299	0.543	T	0.51957	-0.8639	10	0.87932	D	0	-11.5305	16.1031	0.81201	0.0:1.0:0.0:0.0	.	1977	P48634	PRC2A_HUMAN	K	1969;1958;1977;1977;1202	ENSP00000365175:Q1977K;ENSP00000365201:Q1977K	ENSP00000365175:Q1977K	Q	+	1	0	PRRC2A	31712359	1.000000	0.71417	0.999000	0.59377	0.617000	0.37484	4.329000	0.59260	2.784000	0.95788	0.551000	0.68910	CAG	.		0.522	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
HTR3B	9177	bcgsc.ca	37	11	113813745	113813745	+	Silent	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr11:113813745G>A	ENST00000260191.2	+	7	995	c.738G>A	c.(736-738)ctG>ctA	p.L246L	HTR3B_ENST00000537778.1_Silent_p.L235L	NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	246					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	TCGTGAGTCTGCTGATTCCTA	0.557																																					p.L246L													.	HTR3B	50	0			c.G738A						.						110.0	90.0	97.0					11																	113813745		2201	4296	6497	SO:0001819	synonymous_variant	9177	exon7			GAGTCTGCTGATT	AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.738G>A	11.37:g.113813745G>A		31	0		12	3	NM_006028	B0YJ23|Q0VJC3	Silent	SNP	ENST00000260191.2	37	CCDS8364.1																																																																																			.		0.557	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398842.1	NM_006028	
NAV3	89795	bcgsc.ca	37	12	78583941	78583941	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr12:78583941G>T	ENST00000397909.2	+	34	6406	c.6233G>T	c.(6232-6234)gGa>gTa	p.G2078V	NAV3_ENST00000228327.6_Missense_Mutation_p.G2056V|NAV3_ENST00000536525.2_Missense_Mutation_p.G2056V|NAV3_ENST00000266692.7_Missense_Mutation_p.G1879V|NAV3_ENST00000552300.1_3'UTR			Q8IVL0	NAV3_HUMAN	neuron navigator 3	2078						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACCAAATCTGGAAGGAAAAAA	0.373										HNSCC(70;0.22)																											p.G2056V													.	NAV3	506	0			c.G6167T						.						56.0	51.0	53.0					12																	78583941		1864	4086	5950	SO:0001583	missense	89795	exon33			AATCTGGAAGGAA	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.6233G>T	12.37:g.78583941G>T	ENSP00000381007:p.Gly2078Val	62	0		27	3	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.315853|4.315853	0.81469|0.81469	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	T;T;T;T;T|.	0.30182|.	1.6;1.6;1.6;1.54;2.4|.	4.55|4.55	4.55|4.55	0.56014|0.56014	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);|.	0.000000|.	0.40818|.	U|.	0.001015|.	D|D	0.85775|0.85775	0.5775|0.5775	M|M	0.92555|0.92555	3.32|3.32	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.999;1.0;1.0|.	D|D	0.89814|0.89814	0.3984|0.3984	10|5	0.72032|.	D|.	0.01|.	-3.2691|-3.2691	17.6734|17.6734	0.88224|0.88224	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2056;1879;2078;2056|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	V|C	2056;2078;2056;1879;670;678|950	ENSP00000446132:G2056V;ENSP00000381007:G2078V;ENSP00000228327:G2056V;ENSP00000266692:G1879V;ENSP00000448303:G678V|.	ENSP00000228327:G2056V|.	G|W	+|+	2|3	0|0	NAV3|NAV3	77108072|77108072	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.926000|0.926000	0.56050|0.56050	9.698000|9.698000	0.98700|0.98700	2.245000|2.245000	0.73994|0.73994	0.467000|0.467000	0.42956|0.42956	GGA|TGG	.		0.373	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
HIRIP3	8479	bcgsc.ca	37	16	30007577	30007577	+	5'UTR	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr16:30007577G>A	ENST00000279392.3	-	0	180				HIRIP3_ENST00000566471.1_5'Flank|INO80E_ENST00000563040.1_3'UTR|INO80E_ENST00000567254.1_5'UTR|INO80E_ENST00000563197.1_5'UTR|INO80E_ENST00000304516.7_5'UTR|INO80E_ENST00000567705.1_5'UTR|HIRIP3_ENST00000564026.1_5'Flank	NM_003609.4	NP_003600.2	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3						chromatin assembly or disassembly (GO:0006333)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(9)	17						CGGCACGGCAGCCACTGCTTG	0.677																																					.													.	INO80E	26	0			.						.						11.0	16.0	14.0					16																	30007577		691	1588	2279	SO:0001623	5_prime_UTR_variant	8479	.			ACGGCAGCCACTG	AJ223351	CCDS10664.1, CCDS58449.1	16p12.1	2008-02-05	2001-11-29		ENSG00000149929	ENSG00000149929			4917	protein-coding gene	gene with protein product		603365	"""HIRA-interacting protein 3"""			9710638	Standard	NM_003609		Approved		uc002dve.3	Q9BW71	OTTHUMG00000132118	ENST00000279392.3:c.-651C>T	16.37:g.30007577G>A		44	0		31	5	.	H3BSR3|O75707|O75708	Missense_Mutation	SNP	ENST00000279392.3	37	CCDS10664.1																																																																																			.		0.677	HIRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255160.2	NM_003609	
Unknown	0	bcgsc.ca	37	16	32014100	32014100	+	IGR	SNP	C	C	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr16:32014100C>A								RP11-1166P10.1 (8294 upstream) : RP11-1166P10.6 (5658 downstream)																							CAGGCAGTGCCCAACATTGAG	0.662																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			CAGTGCCCAACAT																													16.37:g.32014100C>A		90	0		54	4	.		RNA	SNP		37																																																																																				.	0	0.662								
HAS3	3038	bcgsc.ca	37	16	69148716	69148716	+	Silent	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr16:69148716G>T	ENST00000306560.1	+	4	1365	c.1209G>T	c.(1207-1209)cgG>cgT	p.R403R	HAS3_ENST00000219322.3_Intron|HAS3_ENST00000569188.1_Silent_p.R403R	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	403					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		TTTTCTACCGGGGCCGCATCT	0.547																																					p.R403R													.	HAS3	61	0			c.G1209T						.						119.0	111.0	114.0					16																	69148716		2198	4300	6498	SO:0001819	synonymous_variant	3038	exon4			CTACCGGGGCCGC	BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1209G>T	16.37:g.69148716G>T		26	0		17	3	NM_005329	A8K5T5|Q8WTZ0|Q9NYP0	Silent	SNP	ENST00000306560.1	37	CCDS10871.1																																																																																			.		0.547	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2	NM_138612	
ALOX15	246	bcgsc.ca	37	17	4542400	4542400	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr17:4542400C>T	ENST00000570836.1	-	4	461	c.365G>A	c.(364-366)gGc>gAc	p.G122D	ALOX15_ENST00000293761.3_Missense_Mutation_p.G122D|ALOX15_ENST00000545513.1_Missense_Mutation_p.G144D|ALOX15_ENST00000574640.1_Missense_Mutation_p.G83D			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	122	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		CTGGAACAGGCCCTGAGGGTC	0.597																																					p.G122D													.	ALOX15	70	0			c.G365A						.						145.0	134.0	138.0					17																	4542400		2203	4300	6503	SO:0001583	missense	246	exon3			AACAGGCCCTGAG	M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.365G>A	17.37:g.4542400C>T	ENSP00000458832:p.Gly122Asp	44	0		18	3	NM_001140	A8K2P4|B7ZA11|Q8N6R7|Q99657	Missense_Mutation	SNP	ENST00000570836.1	37	CCDS11049.1	.	.	.	.	.	.	.	.	.	.	C	0.259	-1.000997	0.02128	.	.	ENSG00000161905	ENST00000293761;ENST00000545513	T;T	0.06528	3.29;3.29	4.22	1.09	0.20402	Lipoxygenase, C-terminal (2);	0.452245	0.21652	N	0.071162	T	0.02970	0.0088	N	0.16743	0.435	0.09310	N	1	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.13407	0.002;0.009;0.008	T	0.47446	-0.9117	10	0.06236	T	0.91	-0.0774	6.4335	0.21811	0.0:0.683:0.0:0.317	.	144;83;122	F5H0G8;B7ZA11;P16050	.;.;LOX15_HUMAN	D	122;144	ENSP00000293761:G122D;ENSP00000439855:G144D	ENSP00000293761:G122D	G	-	2	0	ALOX15	4489149	0.000000	0.05858	0.008000	0.14137	0.029000	0.11900	-0.783000	0.04638	0.181000	0.19994	-0.140000	0.14226	GGC	.		0.597	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207487.2		
Unknown	0	bcgsc.ca	37	20	29873762	29873762	+	IGR	SNP	C	C	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr20:29873762C>T								DEFB115 (26327 upstream) : DEFB116 (17252 downstream)																							ATGCCCCAGTCGATTCCAGCA	0.572																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			CCCAGTCGATTCC																													20.37:g.29873762C>T		34	0		14	5	.		RNA	SNP		37																																																																																				.	0	0.572								
GPX1P2	2884	bcgsc.ca	37	21	28516116	28516116	+	IGR	SNP	G	G	A	rs567996429	byFrequency	TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr21:28516116G>A								ADAMTS5 (177284 upstream) : AP001604.3 (215087 downstream)																							GTGTAGTCCCGGACCGTGGTG	0.706													G|||	3	0.000599042	0.0	0.0	5008	,	,		11105	0.0		0.0	False		,,,				2504	0.0031				.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	2884	.			AGTCCCGGACCGT																													21.37:g.28516116G>A		52	0		23	7	.		RNA	SNP		37																																																																																				.	0	0.706								
IGLV7-46	28775	bcgsc.ca	37	22	22724062	22724062	+	RNA	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr22:22724062G>T	ENST00000390295.2	+	0	80									immunoglobulin lambda variable 7-46 (gene/pseudogene)																		TGCTGCCCAGGTTAAGAGAGA	0.478																																					.													.	.	.	0			.						.																																					28775	.			GCCCAGGTTAAGA	Z73674		22q11.2	2012-02-08	2008-09-12		ENSG00000211649	ENSG00000211649		"""Immunoglobulins / IGL locus"""	5930	other	immunoglobulin gene			"""immunoglobulin lambda variable 7-46"""				Standard	NG_000002		Approved				OTTHUMG00000151040		22.37:g.22724062G>T		157	0		89	4	.		Splice_Site	SNP	ENST00000390295.2	37																																																																																				.		0.478	IGLV7-46-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene	OTTHUMT00000321099.1	NG_000002	
Unknown	0	bcgsc.ca	37	22	41471016	41471016	+	IGR	SNP	G	G	A			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chr22:41471016G>A								Y_RNA (9366 upstream) : EP300 (16773 downstream)																							CCCCGTTGGCGATGATGCCAT	0.597																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GTTGGCGATGATG																													22.37:g.41471016G>A		50	0		21	3	.		RNA	SNP		37																																																																																				.	0	0.597								
SH3KBP1	30011	bcgsc.ca	37	X	19725065	19725065	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2Q-01A-11D-A417-09	TCGA-W5-AA2Q-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	dd6f3b9d-7920-4d6f-9409-3875cdc98529	129f8032-36f2-4e17-8be5-861814b73983	g.chrX:19725065G>T	ENST00000397821.3	-	4	614	c.324C>A	c.(322-324)agC>agA	p.S108R	SH3KBP1_ENST00000379698.4_Missense_Mutation_p.S71R|SH3KBP1_ENST00000379697.3_Missense_Mutation_p.S108R	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	108	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						GGGGCAGGTAGCTGAATGCCA	0.537																																					p.S108R													.	SH3KBP1	96	0			c.C324A						.						87.0	70.0	76.0					X																	19725065		2203	4300	6503	SO:0001583	missense	30011	exon4			CAGGTAGCTGAAT	AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.324C>A	X.37:g.19725065G>T	ENSP00000380921:p.Ser108Arg	40	0		16	3	NM_031892	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Missense_Mutation	SNP	ENST00000397821.3	37	CCDS14193.1	.	.	.	.	.	.	.	.	.	.	g	18.41	3.617585	0.66787	.	.	ENSG00000147010	ENST00000379702;ENST00000397821;ENST00000397804;ENST00000379698;ENST00000379726;ENST00000379697;ENST00000432234;ENST00000431164	T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97	5.92	4.88	0.63580	Src homology-3 domain (3);Variant SH3 (1);	0.560040	0.22692	N	0.056806	T	0.57140	0.2033	L	0.58354	1.805	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.996	T	0.54788	-0.8241	10	0.44086	T	0.13	-14.1078	10.0213	0.42044	0.1763:0.0:0.8237:0.0	.	108;71	Q96B97;Q5JPT5	SH3K1_HUMAN;.	R	49;108;16;71;44;108;55;16	ENSP00000380921:S108R;ENSP00000369020:S71R;ENSP00000369049:S44R;ENSP00000369019:S108R;ENSP00000388766:S55R;ENSP00000409292:S16R	ENSP00000369019:S108R	S	-	3	2	SH3KBP1	19634986	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.056000	0.41355	2.491000	0.84063	0.597000	0.82753	AGC	.		0.537	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055992.1	NM_031892	
