#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ALB	213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	74279212	74279212	+	Frame_Shift_Del	DEL	C	C	-			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr4:74279212delC	ENST00000503124.1	+	6	676	c.469delC	c.(469-471)ctgfs	p.L158fs	ALB_ENST00000505649.1_3'UTR|ALB_ENST00000509063.1_Frame_Shift_Del_p.L308fs|ALB_ENST00000415165.2_Frame_Shift_Del_p.L116fs|ALB_ENST00000401494.3_Frame_Shift_Del_p.L193fs|ALB_ENST00000295897.4_Frame_Shift_Del_p.L308fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGAAAAACCTCTGTTGGAAAA	0.408																																					p.P306fs		.											.	.	.	0			c.918delT						.						126.0	121.0	123.0					4																	74279212		2203	4300	6503	SO:0001589	frameshift_variant	213	exon8			AAACCTCTGTTGG	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.469delC	4.37:g.74279212delC	ENSP00000421027:p.Leu158fs	90	0		89	42	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	37																																																																																				.		0.408	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
IL32	9235	hgsc.bcm.edu	37	16	3119299	3119300	+	Frame_Shift_Ins	INS	-	-	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr16:3119299_3119300insC	ENST00000534507.1	+	6	859_860	c.648_649insC	c.(649-651)gggfs	p.G217fs	IL32_ENST00000552664.1_Frame_Shift_Ins_p.G171fs|IL32_ENST00000533097.2_Frame_Shift_Ins_p.G171fs|IL32_ENST00000526464.2_Frame_Shift_Ins_p.G171fs|IL32_ENST00000382213.3_Frame_Shift_Ins_p.G162fs|IL32_ENST00000529550.1_Frame_Shift_Ins_p.G171fs|IL32_ENST00000551513.1_Frame_Shift_Ins_p.G208fs|IL32_ENST00000530890.1_Frame_Shift_Ins_p.G151fs|IL32_ENST00000530538.2_Frame_Shift_Ins_p.G171fs|IL32_ENST00000396887.3_Frame_Shift_Ins_p.G114fs|IL32_ENST00000548476.1_Frame_Shift_Ins_p.G217fs|IL32_ENST00000552936.1_Frame_Shift_Ins_p.G195fs|IL32_ENST00000440815.3_Frame_Shift_Ins_p.G171fs|IL32_ENST00000528163.2_Frame_Shift_Ins_p.G171fs|IL32_ENST00000548652.1_Frame_Shift_Ins_p.G162fs|IL32_ENST00000008180.9_Frame_Shift_Ins_p.G151fs|IL32_ENST00000548246.1_Frame_Shift_Ins_p.G131fs|IL32_ENST00000549213.1_Frame_Shift_Ins_p.G114fs|IL32_ENST00000551122.1_Frame_Shift_Ins_p.G114fs|IL32_ENST00000529699.1_Frame_Shift_Ins_p.G151fs|IL32_ENST00000531965.1_Frame_Shift_Ins_p.G161fs|IL32_ENST00000396890.2_Frame_Shift_Ins_p.G217fs|RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000444393.3_Frame_Shift_Ins_p.G171fs|IL32_ENST00000525643.2_Frame_Shift_Ins_p.G171fs|IL32_ENST00000552356.1_Frame_Shift_Ins_p.G151fs|IL32_ENST00000325568.5_Frame_Shift_Ins_p.G171fs			P24001	IL32_HUMAN	interleukin 32	217					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)		p.D172fs*12(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						GAGCCCCACGGGGGGACAAGGA	0.574																																					p.R170fs		.											.	.	.	1	Insertion - Frameshift(1)	pancreas(1)	c.510_511insC						.																																			SO:0001589	frameshift_variant	9235	exon7			CCCACGGGGGGAC	M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	Exception_encountered	16.37:g.3119299_3119300insC	ENSP00000431775:p.Gly217fs	81	0		103	21	NM_004221	A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Frame_Shift_Ins	INS	ENST00000534507.1	37																																																																																				.		0.574	IL32-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000394812.2	NM_004221	
ZNF233	353355	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	44777811	44777812	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	AG	AG	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:44777811_44777812delAG	ENST00000391958.2	+	5	1125_1126	c.998_999delAG	c.(997-999)cagfs	p.Q333fs	ZNF233_ENST00000592581.1_3'UTR|ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000334152.1_Frame_Shift_Del_p.Q315fs	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	333					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				CAACCTCATCAGAGAGTCAGCA	0.525																																					p.333_333del		.											.	.	.	0			c.997_998del						.																																			SO:0001589	frameshift_variant	353355	exon5			CTCATCAGAGAGT	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.998_999delAG	19.37:g.44777815_44777816delAG	ENSP00000375820:p.Gln333fs	34	0		30	11	NM_001207005	B2RN78|B2RN79|Q86WL8	Frame_Shift_Del	DEL	ENST00000391958.2	37	CCDS33047.1																																																																																			.		0.525	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
PBRM1	55193	hgsc.bcm.edu	37	3	52621438	52621439	+	In_Frame_Ins	INS	-	-	AAT			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr3:52621438_52621439insAAT	ENST00000296302.7	-	19	3054_3055	c.3053_3054insATT	c.(3052-3054)ttt>ttATTt	p.1017_1018insL	PBRM1_ENST00000409767.1_In_Frame_Ins_p.1032_1033insL|PBRM1_ENST00000356770.4_In_Frame_Ins_p.985_986insL|PBRM1_ENST00000409114.3_In_Frame_Ins_p.1032_1033insL|PBRM1_ENST00000409057.1_In_Frame_Ins_p.1017_1018insL|PBRM1_ENST00000394830.3_In_Frame_Ins_p.992_993insL|PBRM1_ENST00000337303.4_In_Frame_Ins_p.1017_1018insL|PBRM1_ENST00000410007.1_In_Frame_Ins_p.992_993insL			Q86U86	PB1_HUMAN	polybromo 1	1017	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGTCACTCTTAAAAACTTCTTT	0.366			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.F993delinsLF		.		Rec	yes		3	3p21	55193	polybromo 1		E	.,1	.	1252	0			c.2979_2980insATT						.																																			SO:0001652	inframe_insertion	55193	exon20			ACTCTTAAAAACT	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3053_3054insATT	3.37:g.52621438_52621439insAAT	ENSP00000296302:p.Val1017_Phe1018insLeu	76	0		45	27	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	In_Frame_Ins	INS	ENST00000296302.7	37																																																																																				.		0.366	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
HHLA2	11148	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	108072349	108072349	+	Frame_Shift_Del	DEL	T	T	-			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr3:108072349delT	ENST00000357759.5	+	4	554	c.140delT	c.(139-141)atafs	p.I48fs	HHLA2_ENST00000467761.1_Frame_Shift_Del_p.I48fs|HHLA2_ENST00000467562.1_Intron|HHLA2_ENST00000489514.2_Frame_Shift_Del_p.I48fs|HHLA2_ENST00000491820.1_Frame_Shift_Del_p.I48fs	NM_007072.2	NP_009003.1	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2	48					positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(14)|ovary(1)	18						GATGAAGATATAATTCTCCCT	0.383																																					p.I47X		.											.	.	.	0			c.139delA						.						52.0	47.0	49.0					3																	108072349		1857	4098	5955	SO:0001589	frameshift_variant	11148	exon4			AAGATATAATTCT	AF126162	CCDS46883.1, CCDS63713.1, CCDS74975.1	3q13.13	2013-01-11			ENSG00000114455	ENSG00000114455		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	4905	protein-coding gene	gene with protein product		604371				10444326	Standard	NM_007072		Approved	B7H7	uc003dwz.3	Q9UM44	OTTHUMG00000159224	ENST00000357759.5:c.140delT	3.37:g.108072349delT	ENSP00000350402:p.Ile48fs	77	0		73	23	NM_007072	B4DKN2|D3DN60|Q9NWQ6	Frame_Shift_Del	DEL	ENST00000357759.5	37	CCDS46883.1																																																																																			.		0.383	HHLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353924.1	NM_007072	
RBM26	64062	hgsc.bcm.edu	37	13	79918911	79918911	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr13:79918911C>T	ENST00000438737.2	-	15	2517	c.2077G>A	c.(2077-2079)Ggc>Agc	p.G693S	RBM26_ENST00000267229.7_Missense_Mutation_p.G666S|RBM26_ENST00000438724.1_Missense_Mutation_p.G669S			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	693					mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G693S(1)|p.G666S(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		TTTGTTAGGCCAGTAGATGTA	0.343																																					p.G666S		.											RBM26_ENST00000327303,trunk,malignant_melanoma,0,2	RBM26_ENST00000327303	0	2	Substitution - Missense(2)	skin(2)	c.G1996A						.						88.0	84.0	85.0					13																	79918911		2202	4300	6502	SO:0001583	missense	64062	exon14			TTAGGCCAGTAGA	AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.2077G>A	13.37:g.79918911C>T	ENSP00000387531:p.Gly693Ser	66	0		41	3	NM_022118	B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Missense_Mutation	SNP	ENST00000438737.2	37		.	.	.	.	.	.	.	.	.	.	C	23.7	4.453027	0.84209	.	.	ENSG00000139746	ENST00000267229;ENST00000438737;ENST00000327303;ENST00000438724	D;D	0.93133	-3.17;-3.17	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.95262	0.8463	L	0.46157	1.445	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.87578	0.998;0.98;0.998;0.98	D	0.94648	0.7836	9	.	.	.	-1.6352	17.9591	0.89079	0.0:1.0:0.0:0.0	.	50;669;693;666	B4DZH7;Q5T8P6-2;Q5T8P6;Q5T8P6-3	.;.;RBM26_HUMAN;.	S	666;694;693;669	ENSP00000267229:G666S;ENSP00000390222:G669S	.	G	-	1	0	RBM26	78816912	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.875000	0.75551	2.235000	0.73313	0.585000	0.79938	GGC	.		0.343	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045373.4	NM_022118	
KCNQ3	3786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	133153423	133153423	+	Missense_Mutation	SNP	C	C	T	rs138181943		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr8:133153423C>T	ENST00000388996.4	-	10	1838	c.1418G>A	c.(1417-1419)cGc>cAc	p.R473H	KCNQ3_ENST00000521134.1_Missense_Mutation_p.R353H|KCNQ3_ENST00000519445.1_Missense_Mutation_p.R473H	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	473					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GAAGGCCGTGCGGAAACGCTC	0.458																																					p.R473H		.											.	.	.	0			c.G1418A						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	129.0	133.0	132.0		1058,1418	5.6	1.0	8	dbSNP_134	132	0,8600		0,0,4300	no	missense,missense	KCNQ3	NM_001204824.1,NM_004519.3	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	353/753,473/873	133153423	1,13005	2203	4300	6503	SO:0001583	missense	3786	exon10			GCCGTGCGGAAAC	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1418G>A	8.37:g.133153423C>T	ENSP00000373648:p.Arg473His	44	0		35	13	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945963	0.73672	2.27E-4	0.0	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.99758	-6.65;-6.65;-6.65	5.63	5.63	0.86233	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.171949	0.50627	D	0.000107	D	0.99588	0.9851	L	0.43152	1.355	0.50813	D	0.99989	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98290	1.0513	10	0.62326	D	0.03	-15.7267	18.6978	0.91607	0.0:1.0:0.0:0.0	.	473;473	E7ET42;O43525	.;KCNQ3_HUMAN	H	473;353;473;462;352	ENSP00000373648:R473H;ENSP00000429799:R353H;ENSP00000428790:R473H	ENSP00000373648:R473H	R	-	2	0	KCNQ3	133222605	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.469000	0.80959	2.652000	0.90054	0.655000	0.94253	CGC	0.000		0.458	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
BANK1	55024	hgsc.bcm.edu	37	4	102816512	102816512	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr4:102816512G>T	ENST00000322953.4	+	6	1228	c.954G>T	c.(952-954)gaG>gaT	p.E318D	BANK1_ENST00000444316.2_Missense_Mutation_p.E288D|BANK1_ENST00000504592.1_Missense_Mutation_p.E303D|BANK1_ENST00000508653.1_Missense_Mutation_p.E185D|BANK1_ENST00000428908.1_Missense_Mutation_p.E185D	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	318	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TCAAACATGAGATACCATATT	0.303																																					p.E318D		.											BANK1,NS,carcinoma,0,1	BANK1	0	0			c.G954T						.						88.0	91.0	90.0					4																	102816512		2202	4297	6499	SO:0001583	missense	55024	exon6			ACATGAGATACCA	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.954G>T	4.37:g.102816512G>T	ENSP00000320509:p.Glu318Asp	66	0		59	3	NM_017935	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	37	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339259	0.41398	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.18810	2.88;2.88;2.19;2.19;2.88	4.94	1.69	0.24217	DBB domain (1);	0.286884	0.28871	N	0.013868	T	0.29882	0.0747	L	0.58101	1.795	0.25289	N	0.989379	P;D;D	0.56035	0.949;0.974;0.974	P;P;P	0.58721	0.844;0.806;0.806	T	0.11275	-1.0594	10	0.25106	T	0.35	.	7.035	0.24989	0.3693:0.0:0.6307:0.0	.	185;318;303	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	D	303;318;185;185;288	ENSP00000421443:E303D;ENSP00000320509:E318D;ENSP00000412748:E185D;ENSP00000422314:E185D;ENSP00000388817:E288D	ENSP00000320509:E318D	E	+	3	2	BANK1	103035535	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	0.194000	0.17135	0.068000	0.16574	0.585000	0.79938	GAG	.		0.303	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	230672523	230672523	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr2:230672523C>G	ENST00000283943.5	-	16	2431	c.2253G>C	c.(2251-2253)aaG>aaC	p.K751N	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Missense_Mutation_p.K799N|TRIP12_ENST00000389045.3_Missense_Mutation_p.K454N	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	751	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CATTTCCCTTCTTCAACATGG	0.403																																					p.K751N		.											.	.	.	0			c.G2253C						.						150.0	122.0	131.0					2																	230672523		2203	4300	6503	SO:0001583	missense	9320	exon16			TCCCTTCTTCAAC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.2253G>C	2.37:g.230672523C>G	ENSP00000283943:p.Lys751Asn	29	0		42	12	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313097	0.40895	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.37235	1.57;1.21;1.57	5.23	4.35	0.52113	WWE domain (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.47414	0.1444	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.71674	0.998;0.981;0.981;0.981	D;D;D;D	0.76071	0.987;0.95;0.95;0.95	T	0.32428	-0.9907	10	0.30854	T	0.27	.	13.2217	0.59892	0.0:0.9217:0.0:0.0783	.	757;454;799;751	D4HL82;Q14CF1;Q14CA3;Q14669	.;.;.;TRIPC_HUMAN	N	751;454;799	ENSP00000283943:K751N;ENSP00000373697:K454N;ENSP00000373696:K799N	ENSP00000283943:K751N	K	-	3	2	TRIP12	230380767	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.136000	0.50554	1.308000	0.44962	0.467000	0.42956	AAG	.		0.403	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
UCKL1	54963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62577877	62577877	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr20:62577877G>A	ENST00000354216.6	-	2	275	c.233C>T	c.(232-234)aCc>aTc	p.T78I	UCKL1_ENST00000369892.3_Missense_Mutation_p.T78I|UCKL1_ENST00000358711.3_Missense_Mutation_p.T78I|UCKL1_ENST00000492660.1_5'Flank|UCKL1_ENST00000369908.5_Missense_Mutation_p.T63I	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	78					CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGTGTAGATGGTACGCTTGCT	0.662																																					p.T78I		.											.	.	.	0			c.C233T						.						73.0	70.0	71.0					20																	62577877		2202	4296	6498	SO:0001583	missense	54963	exon2			TAGATGGTACGCT	AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.233C>T	20.37:g.62577877G>A	ENSP00000346155:p.Thr78Ile	48	0		47	9	NM_017859	B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Missense_Mutation	SNP	ENST00000354216.6	37	CCDS13547.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.332125	0.60853	.	.	ENSG00000198276	ENST00000354216;ENST00000369892;ENST00000358711;ENST00000369908;ENST00000418992	.	.	.	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.76292	0.3967	M	0.76727	2.345	0.80722	D	1	D;D	0.62365	0.991;0.968	P;P	0.61201	0.885;0.661	T	0.80400	-0.1398	9	0.72032	D	0.01	-50.4594	15.4917	0.75611	0.0:0.0:1.0:0.0	.	63;78	B7Z8N2;Q9NWZ5	.;UCKL1_HUMAN	I	78;78;78;63;63	.	ENSP00000346155:T78I	T	-	2	0	UCKL1	62048321	1.000000	0.71417	0.997000	0.53966	0.038000	0.13279	9.264000	0.95635	2.063000	0.61619	0.313000	0.20887	ACC	.		0.662	UCKL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080236.1	NM_017859	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110457602	110457602	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr8:110457602C>A	ENST00000378402.5	+	38	5608	c.5504C>A	c.(5503-5505)tCt>tAt	p.S1835Y		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1835	IPT/TIG 11.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CCAGTAGCATCTCTATCACCA	0.498										HNSCC(38;0.096)																											p.S1835Y		.											PKHD1L1,NS,carcinoma,0,1	PKHD1L1	0	0			c.C5504A						.						76.0	77.0	77.0					8																	110457602		1947	4134	6081	SO:0001583	missense	93035	exon38			TAGCATCTCTATC	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5504C>A	8.37:g.110457602C>A	ENSP00000367655:p.Ser1835Tyr	32	0		35	2	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313706	0.40996	.	.	ENSG00000205038	ENST00000378402	T	0.81247	-1.47	6.03	5.15	0.70609	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.549745	0.19099	N	0.122752	D	0.92156	0.7513	M	0.93720	3.45	0.26168	N	0.979904	D	0.89917	1.0	D	0.79108	0.992	D	0.87182	0.2228	10	0.87932	D	0	.	15.2224	0.73324	0.0:0.8589:0.1411:0.0	.	1835	Q86WI1	PKHL1_HUMAN	Y	1835	ENSP00000367655:S1835Y	ENSP00000367655:S1835Y	S	+	2	0	PKHD1L1	110526778	0.055000	0.20627	0.761000	0.31378	0.220000	0.24768	2.420000	0.44679	1.547000	0.49401	0.655000	0.94253	TCT	.		0.498	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
RBL2	5934	hgsc.bcm.edu	37	16	53513070	53513070	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr16:53513070C>A	ENST00000262133.6	+	18	2845	c.2708C>A	c.(2707-2709)aCa>aAa	p.T903K	RBL2_ENST00000544545.1_Intron|RBL2_ENST00000379935.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	903	Domain B.|Pocket; binds E1A.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)	p.T903K(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TGCCAGGTCACAAAAGAAGAT	0.458																																					p.T903K		.											RBL2,NS,carcinoma,0,1	RBL2	0	1	Substitution - Missense(1)	lung(1)	c.C2708A						.						99.0	92.0	95.0					16																	53513070		2198	4300	6498	SO:0001583	missense	5934	exon18			AGGTCACAAAAGA	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.2708C>A	16.37:g.53513070C>A	ENSP00000262133:p.Thr903Lys	21	0		22	2	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	37	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	C	31	5.101878	0.94245	.	.	ENSG00000103479	ENST00000262133;ENST00000379935	D	0.89617	-2.54	5.05	5.05	0.67936	Retinoblastoma-associated protein, B-box (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	D	0.90693	0.7080	L	0.31526	0.94	0.80722	D	1	D;D	0.67145	0.996;0.994	D;P	0.68621	0.959;0.891	D	0.92114	0.5698	10	0.87932	D	0	-13.3215	16.1796	0.81890	0.0:1.0:0.0:0.0	.	613;903	E9PG04;Q08999	.;RBL2_HUMAN	K	903;613	ENSP00000262133:T903K	ENSP00000262133:T903K	T	+	2	0	RBL2	52070571	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.932000	0.75869	2.338000	0.79540	0.650000	0.86243	ACA	.		0.458	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
DNAJC5	80331	hgsc.bcm.edu	37	20	62551131	62551131	+	Intron	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr20:62551131G>A	ENST00000360864.4	+	2	142				MIR941-1_ENST00000401127.2_RNA|MIR941-3_ENST00000401376.2_RNA|DNAJC5_ENST00000369911.2_Intron|MIR941-2_ENST00000401322.2_RNA	NM_025219.2	NP_079495.1	Q9H3Z4	DNJC5_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5						cell death (GO:0008219)|exocytosis (GO:0006887)|negative regulation of neuron apoptotic process (GO:0043524)|neurotransmitter secretion (GO:0007269)|regulated secretory pathway (GO:0045055)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)				cervix(1)|endometrium(1)|lung(1)|pancreas(1)|upper_aerodigestive_tract(1)	5	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CCCAGGGCCCGGGACAGCGCC	0.692																																					.		.											ENSG00000101152,right_lower_lobe,carcinoma,0,1	ENSG00000101152	0	0			.						.						12.0	25.0	22.0					20																	62551131		948	2530	3478	SO:0001627	intron_variant	100126352	.			GGGCCCGGGACAG		CCDS13546.1	20q13.33	2014-09-17			ENSG00000101152	ENSG00000101152		"""Heat shock proteins / DNAJ (HSP40)"""	16235	protein-coding gene	gene with protein product		611203	"""ceroid-lipofuscinosis, neuronal 4 (Kufs disease)"""	CLN4			Standard	NM_025219		Approved	FLJ00118, FLJ13070, DNAJC5A	uc002yhf.3	Q9H3Z4	OTTHUMG00000033007	ENST00000360864.4:c.-11-8557G>A	20.37:g.62551131G>A		29	1		49	3	.	A8K0M0|B3KY68|E1P5G8|Q9H3Z5|Q9H7H2	RNA	SNP	ENST00000360864.4	37	CCDS13546.1																																																																																			.		0.692	DNAJC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080244.1	NM_025219	
PRG4	10216	hgsc.bcm.edu	37	1	186276306	186276306	+	Silent	SNP	T	T	C	rs78867190	byFrequency	TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:186276306T>C	ENST00000445192.2	+	7	1500	c.1455T>C	c.(1453-1455)acT>acC	p.T485T	PRG4_ENST00000367485.4_Silent_p.T392T|PRG4_ENST00000367483.4_Silent_p.T444T|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Silent_p.T442T	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	485	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.T485T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CTGCACCCACTGCCCCCAAGA	0.652													-|||	47	0.00938498	0.0348	0.0	5008	,	,		8279	0.0		0.0	False		,,,				2504	0.001				p.T485T		.											PRG4,NS,carcinoma,0,1	PRG4	0	1	Substitution - coding silent(1)	endometrium(1)	c.T1455C						.						98.0	105.0	103.0					1																	186276306		2203	4298	6501	SO:0001819	synonymous_variant	10216	exon7			ACCCACTGCCCCC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1455T>C	1.37:g.186276306T>C		77	1		86	4	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	CCDS1369.1																																																																																			.		0.652	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
RIOK2	55781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	96504525	96504525	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr5:96504525C>A	ENST00000283109.3	-	7	879	c.811G>T	c.(811-813)Gat>Tat	p.D271Y	CTD-2215E18.1_ENST00000509481.1_Intron|RIOK2_ENST00000508447.1_Missense_Mutation_p.D271Y	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	271	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		ATAAAGAAATCTTTAATGCAT	0.318																																					p.D271Y		.											.	.	.	0			c.G811T						.						82.0	92.0	89.0					5																	96504525		2203	4297	6500	SO:0001583	missense	55781	exon7			AGAAATCTTTAAT	AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.811G>T	5.37:g.96504525C>A	ENSP00000283109:p.Asp271Tyr	87	0		96	39	NM_001159749	D6RDI3|Q9NUT0	Missense_Mutation	SNP	ENST00000283109.3	37	CCDS4089.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024393	0.54683	.	.	ENSG00000058729	ENST00000283109;ENST00000508447	T;T	0.07021	3.23;3.23	5.81	4.94	0.65067	Protein kinase-like domain (1);RIO-like kinase (1);	0.181068	0.64402	D	0.000017	T	0.14141	0.0342	M	0.65320	2	0.80722	D	1	B;B	0.30605	0.287;0.152	B;B	0.35899	0.213;0.098	T	0.01604	-1.1314	10	0.54805	T	0.06	-1.7976	14.8365	0.70187	0.0:0.9302:0.0:0.0698	.	271;271	D6RDI3;Q9BVS4	.;RIOK2_HUMAN	Y	271	ENSP00000283109:D271Y;ENSP00000420932:D271Y	ENSP00000283109:D271Y	D	-	1	0	RIOK2	96530281	1.000000	0.71417	0.997000	0.53966	0.705000	0.40729	5.767000	0.68850	1.461000	0.47929	0.650000	0.86243	GAT	.		0.318	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250628.1	NM_018343	
EPRS	2058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	220151958	220151958	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:220151958T>A	ENST00000366923.3	-	28	4282	c.4013A>T	c.(4012-4014)aAc>aTc	p.N1338I		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1338	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	AACGCGGATGTTAACACTGAG	0.398																																					p.N1338I		.											.	.	.	0			c.A4013T						.						135.0	125.0	129.0					1																	220151958		2203	4300	6503	SO:0001583	missense	2058	exon28			CGGATGTTAACAC	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.4013A>T	1.37:g.220151958T>A	ENSP00000355890:p.Asn1338Ile	58	0		43	15	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	T	14.50	2.552868	0.45487	.	.	ENSG00000136628	ENST00000366923	D	0.83075	-1.68	5.92	3.53	0.40419	Anticodon-binding (3);	0.372776	0.34025	N	0.004322	T	0.80303	0.4598	L	0.52126	1.63	0.09310	N	1	B	0.27013	0.166	B	0.37650	0.255	T	0.72653	-0.4228	10	0.87932	D	0	-4.6696	7.77	0.29001	0.0:0.0755:0.1384:0.7861	.	1338	P07814	SYEP_HUMAN	I	1338	ENSP00000355890:N1338I	ENSP00000355890:N1338I	N	-	2	0	EPRS	218218581	0.001000	0.12720	0.002000	0.10522	0.760000	0.43138	0.818000	0.27295	0.452000	0.26830	0.533000	0.62120	AAC	.		0.398	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
MUM1	84939	hgsc.bcm.edu	37	19	1360675	1360675	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:1360675C>T	ENST00000415183.3	+	4	784	c.758C>T	c.(757-759)gCc>gTc	p.A253V	MUM1_ENST00000344663.3_Missense_Mutation_p.A253V|MUM1_ENST00000311401.5_Missense_Mutation_p.A184V|MUM1_ENST00000591806.1_Missense_Mutation_p.A253V			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	252					chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCTGGGCAGCCCCGTCCTTG	0.647																																					p.A253V		.											MUM1,NS,malignant_melanoma,0,1	MUM1	0	0			c.C758T						.						52.0	53.0	52.0					19																	1360675		2203	4300	6503	SO:0001583	missense	84939	exon5			GGGCAGCCCCGTC	AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.758C>T	19.37:g.1360675C>T	ENSP00000394925:p.Ala253Val	24	0		48	3	NM_032853	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	ENST00000415183.3	37		.	.	.	.	.	.	.	.	.	.	C	0.971	-0.700175	0.03279	.	.	ENSG00000160953	ENST00000344663;ENST00000311401;ENST00000415183	T;T;T	0.23147	1.95;1.95;1.92	3.5	-1.29	0.09288	.	1.752180	0.03001	N	0.148161	T	0.12603	0.0306	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.25235	0.121;0.121;0.077;0.031	B;B;B;B	0.24155	0.051;0.051;0.037;0.009	T	0.10042	-1.0647	10	0.02654	T	1	.	1.3313	0.02136	0.1646:0.3161:0.3218:0.1975	.	253;253;184;252	B7ZLY8;D6W5Y8;Q2TAK8-2;Q2TAK8	.;.;.;MUM1_HUMAN	V	253;184;253	ENSP00000345789:A253V;ENSP00000309135:A184V;ENSP00000394925:A253V	ENSP00000309135:A184V	A	+	2	0	MUM1	1311675	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.630000	0.05502	-0.113000	0.11958	0.650000	0.86243	GCC	.		0.647	MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1	NM_032853	
SPATA4	132851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	177114178	177114178	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr4:177114178G>A	ENST00000280191.2	-	3	506	c.398C>T	c.(397-399)aCa>aTa	p.T133I	SPATA4_ENST00000515234.1_5'UTR	NM_144644.2	NP_653245.2	Q8NEY3	SPAT4_HUMAN	spermatogenesis associated 4	133						cytoplasm (GO:0005737)				NS(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)	22		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.9e-20)|Epithelial(43;1.99e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.58e-09)|GBM - Glioblastoma multiforme(59;0.000162)|STAD - Stomach adenocarcinoma(60;0.000543)|LUSC - Lung squamous cell carcinoma(193;0.096)		ACAATGAATTGTTCCATGGAT	0.279																																					p.T133I		.											.	.	.	0			c.C398T						.						54.0	56.0	55.0					4																	177114178		2202	4290	6492	SO:0001583	missense	132851	exon3			TGAATTGTTCCAT	AY040204	CCDS3826.1	4q34.2	2008-02-05			ENSG00000150628	ENSG00000150628			17333	protein-coding gene	gene with protein product		609879					Standard	NM_144644		Approved	TSARG2, SPEF1B	uc003iuo.1	Q8NEY3	OTTHUMG00000160788	ENST00000280191.2:c.398C>T	4.37:g.177114178G>A	ENSP00000280191:p.Thr133Ile	121	0		66	22	NM_144644	Q8NCS5|Q8WW15	Missense_Mutation	SNP	ENST00000280191.2	37	CCDS3826.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105909	0.77096	.	.	ENSG00000150628	ENST00000280191	T	0.17370	2.28	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.28067	0.0692	L	0.28458	0.855	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.02042	-1.1224	10	0.11485	T	0.65	-15.9476	16.5682	0.84604	0.0:0.0:1.0:0.0	.	133	Q8NEY3	SPAT4_HUMAN	I	133	ENSP00000280191:T133I	ENSP00000280191:T133I	T	-	2	0	SPATA4	177351172	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.868000	0.69605	2.705000	0.92388	0.655000	0.94253	ACA	.		0.279	SPATA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362326.1	NM_144644	
CEMIP	57214	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	81212524	81212524	+	Silent	SNP	T	T	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr15:81212524T>A	ENST00000394685.3	+	15	2306	c.1887T>A	c.(1885-1887)ctT>ctA	p.L629L	RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Silent_p.L629L|KIAA1199_ENST00000356249.5_Silent_p.L629L			Q8WUJ3	CEMIP_HUMAN		629					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						ACCACTGTCTTGGCCTCCTTG	0.562																																					p.L629L		.											.	.	.	0			c.T1887A						.						186.0	124.0	145.0					15																	81212524		2203	4300	6503	SO:0001819	synonymous_variant	57214	exon14			CTGTCTTGGCCTC																												ENST00000394685.3:c.1887T>A	15.37:g.81212524T>A		39	0		49	4	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	ENST00000394685.3	37	CCDS10315.1																																																																																			.		0.562	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
TAS2R31	259290	hgsc.bcm.edu;broad.mit.edu	37	12	11183199	11183199	+	Missense_Mutation	SNP	T	T	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr12:11183199T>G	ENST00000390675.2	-	1	807	c.736A>C	c.(736-738)Atg>Ctg	p.M246L	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176885.2	NP_795366.2	P59538	T2R31_HUMAN	taste receptor, type 2, member 31	246					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|lung(6)	7						ACTGATATCATTATGGACAGA	0.403																																					p.M246L		.											.	.	.	0			c.A736C						.						195.0	204.0	201.0					12																	11183199		2200	4298	6498	SO:0001583	missense	259290	exon1			ATATCATTATGGA	AX097748, AF494228	CCDS53747.1	12p13.2	2012-08-22				ENSG00000256436		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19113	protein-coding gene	gene with protein product		612669	"""taste receptor, type 2, member 44"""	TAS2R44			Standard	NM_176885		Approved	T2R31, T2R53	uc001qzo.1	P59538		ENST00000390675.2:c.736A>C	12.37:g.11183199T>G	ENSP00000375093:p.Met246Leu	117	0		96	4	NM_176885	P59547|Q17R84|Q645X5	Missense_Mutation	SNP	ENST00000390675.2	37	CCDS53747.1	.	.	.	.	.	.	.	.	.	.	.	4.119	0.020200	0.08006	.	.	ENSG00000256436	ENST00000390675	T	0.29917	1.55	2.62	0.014	0.14098	.	.	.	.	.	T	0.09598	0.0236	N	0.02357	-0.585	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.31888	-0.9927	9	0.21014	T	0.42	.	2.5476	0.04741	0.0:0.1739:0.2905:0.5355	.	246	P59538	T2R31_HUMAN	L	246	ENSP00000375093:M246L	ENSP00000375093:M246L	M	-	1	0	TAS2R31	11074466	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	-1.133000	0.03232	0.210000	0.20664	0.163000	0.16589	ATG	.		0.403	TAS2R31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400233.1	NM_176885	
RNF180	285671	hgsc.bcm.edu;bcgsc.ca	37	5	63621158	63621158	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr5:63621158G>T	ENST00000389100.4	+	6	1445	c.1373G>T	c.(1372-1374)cGg>cTg	p.R458L		NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	458	Interaction with ZIC2. {ECO:0000250}.			R -> G (in Ref. 2; CAD89939). {ECO:0000305}.	adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		CCCTGCTTACGGACTCTGGCC	0.423																																					p.R458L		.											.	.	.	0			c.G1373T						.						256.0	204.0	220.0					5																	63621158		692	1591	2283	SO:0001583	missense	285671	exon6			GCTTACGGACTCT	AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.1373G>T	5.37:g.63621158G>T	ENSP00000373752:p.Arg458Leu	77	0		82	4	NM_001113561	Q0JSU3|Q495A8|Q8NBD1	Missense_Mutation	SNP	ENST00000389100.4	37	CCDS47219.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.952079	0.92660	.	.	ENSG00000164197	ENST00000389100	T	0.67523	-0.27	5.16	5.16	0.70880	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.142061	0.42682	D	0.000666	T	0.67951	0.2948	N	0.11106	0.095	0.80722	D	1	D	0.71674	0.998	D	0.68621	0.959	T	0.75139	-0.3423	10	0.66056	D	0.02	-4.2552	18.0217	0.89257	0.0:0.0:1.0:0.0	.	458	Q86T96	RN180_HUMAN	L	458	ENSP00000373752:R458L	ENSP00000373752:R458L	R	+	2	0	RNF180	63656914	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.302000	0.96175	2.566000	0.86566	0.643000	0.83706	CGG	.		0.423	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368394.1	NM_178532	
MT-CO1	4512	hgsc.bcm.edu;broad.mit.edu	37	M	3003	3003	+	5'Flank	SNP	A	A	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chrM:3003A>G	ENST00000361624.2	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TGTTGGATCAGGACATCCCGA	0.448																																					.		.											.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	6053	.			ATCAGGACATCCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3003A>G	Exception_encountered	21	0		66	51	.	Q34770	RNA	SNP	ENST00000361624.2	37																																																																																				.		0.448	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
TJP1	7082	hgsc.bcm.edu;bcgsc.ca	37	15	30011982	30011982	+	Splice_Site	SNP	T	T	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr15:30011982T>G	ENST00000346128.6	-	20	3476	c.3002A>C	c.(3001-3003)aAg>aCg	p.K1001T	TJP1_ENST00000400011.2_Intron|TJP1_ENST00000545208.2_Intron|TJP1_ENST00000356107.6_Splice_Site_p.K1001T	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1001					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CACAGGTACCTTTGTTGGATC	0.418																																					p.K1001T	Melanoma(77;681 1843 6309 6570)	.											.	.	.	0			c.A3002C						.						179.0	177.0	178.0					15																	30011982		2037	4185	6222	SO:0001630	splice_region_variant	7082	exon20			GGTACCTTTGTTG		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.3003+1A>C	15.37:g.30011982T>G		41	0		50	4	NM_003257	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	T	17.12	3.307992	0.60305	.	.	ENSG00000104067	ENST00000346128;ENST00000545208	T	0.08896	3.04	6.02	6.02	0.97574	.	0.311754	0.39475	N	0.001342	T	0.10895	0.0266	L	0.36672	1.1	0.80722	D	1	P;P	0.48089	0.905;0.905	B;B	0.43623	0.425;0.425	T	0.01688	-1.1295	10	0.56958	D	0.05	.	16.5446	0.84426	0.0:0.0:0.0:1.0	.	994;1001	A9CQZ8;Q07157	.;ZO1_HUMAN	T	1001	ENSP00000281537:K1001T	ENSP00000281537:K1001T	K	-	2	0	TJP1	27799274	1.000000	0.71417	0.978000	0.43139	0.892000	0.51952	6.383000	0.73172	2.311000	0.77944	0.533000	0.62120	AAG	.		0.418	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	Missense_Mutation
KIAA1614	57710	hgsc.bcm.edu	37	1	180886014	180886014	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:180886014C>A	ENST00000367588.4	+	2	830	c.775C>A	c.(775-777)Ctg>Atg	p.L259M		NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	259								p.L259M(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						TAGCACATCCCTGACCTCCGA	0.582																																					p.L259M		.											KIAA1614,NS,carcinoma,0,1	KIAA1614	0	1	Substitution - Missense(1)	lung(1)	c.C775A						.						144.0	158.0	153.0					1																	180886014		2071	4206	6277	SO:0001583	missense	57710	exon2			ACATCCCTGACCT	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.775C>A	1.37:g.180886014C>A	ENSP00000356560:p.Leu259Met	27	0		40	2	NM_020950	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.608961	0.28623	.	.	ENSG00000135835	ENST00000367588	T	0.05925	3.37	4.57	2.71	0.32032	.	0.607548	0.12570	N	0.457382	T	0.14614	0.0353	L	0.44542	1.39	0.23391	N	0.99778	D	0.89917	1.0	D	0.72075	0.976	T	0.14671	-1.0464	9	0.56958	D	0.05	-1.8665	6.2175	0.20663	0.0:0.6952:0.0:0.3048	.	259	Q5VZ46	K1614_HUMAN	M	259	ENSP00000356560:L259M	ENSP00000356560:L259M	L	+	1	2	KIAA1614	179152637	0.004000	0.15560	0.003000	0.11579	0.410000	0.31052	0.051000	0.14141	0.557000	0.29117	0.563000	0.77884	CTG	.		0.582	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531	
TDRD6	221400	hgsc.bcm.edu	37	6	46657979	46657979	+	Missense_Mutation	SNP	A	A	G	rs144670071|rs199792181|rs398110088	byFrequency	TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr6:46657979A>G	ENST00000316081.6	+	1	2114	c.2114A>G	c.(2113-2115)gAa>gGa	p.E705G	TDRD6_ENST00000544460.1_Missense_Mutation_p.E705G|RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	705					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			AAGACTGGAGAAGGAGAGCAG	0.408																																					p.E705G		.											.,2	.	205	0			c.A2114G						.						41.0	41.0	41.0					6																	46657979		2203	4297	6500	SO:0001583	missense	221400	exon1			CTGGAGAAGGAGA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2114A>G	6.37:g.46657979A>G	ENSP00000346065:p.Glu705Gly	42	1		35	3	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	A	12.42	1.933470	0.34096	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.15372	2.43;2.44	5.02	3.88	0.44766	.	1.210510	0.05411	N	0.542504	T	0.03434	0.0099	N	0.22421	0.69	0.09310	N	0.999999	B;B	0.19331	0.035;0.009	B;B	0.16289	0.015;0.007	T	0.37865	-0.9687	10	0.21014	T	0.42	-15.361	3.7682	0.08630	0.7698:0.0:0.2302:0.0	.	705;705	F5H5M3;O60522	.;TDRD6_HUMAN	G	705	ENSP00000443299:E705G;ENSP00000346065:E705G	ENSP00000346065:E705G	E	+	2	0	TDRD6	46765938	0.000000	0.05858	0.853000	0.33588	0.497000	0.33675	0.360000	0.20250	1.891000	0.54761	0.533000	0.62120	GAA	.		0.408	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
MT-CO2	4513	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	M	7854	7854	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chrM:7854T>C	ENST00000361739.1	+	1	269	c.269T>C	c.(268-270)gTc>gCc	p.V90A	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	90					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						AACAGACGAGGTCAACGATCC	0.498																																					p.V90A		.											.	.	.	0			c.T269C						.																																			SO:0001583	missense	5743	exon1			ACGAGGTCAACGA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.269T>C	M.37:g.7854T>C	ENSP00000354876:p.Val90Ala	201	0		572	487	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	37																																																																																				.		0.498	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
PEPD	5184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	33953903	33953903	+	Missense_Mutation	SNP	T	T	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:33953903T>G	ENST00000244137.7	-	9	702	c.669A>C	c.(667-669)gaA>gaC	p.E223D	PEPD_ENST00000436370.3_Missense_Mutation_p.E159D|PEPD_ENST00000397032.4_Intron	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	223					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					TGGCTTACCTTTCCAACTCAT	0.408																																					p.E223D		.											.	.	.	0			c.A669C						.						222.0	202.0	208.0					19																	33953903		1883	4110	5993	SO:0001583	missense	5184	exon9			TTACCTTTCCAAC	BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.669A>C	19.37:g.33953903T>G	ENSP00000244137:p.Glu223Asp	72	0		49	20	NM_000285	A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Missense_Mutation	SNP	ENST00000244137.7	37	CCDS42544.1	.	.	.	.	.	.	.	.	.	.	T	17.30	3.353483	0.61293	.	.	ENSG00000124299	ENST00000244137;ENST00000436370	T;T	0.76839	-1.05;-1.05	5.3	2.02	0.26589	Peptidase M24, structural domain (3);	0.154277	0.64402	D	0.000012	D	0.87136	0.6102	M	0.88181	2.935	0.54753	D	0.999983	D;D	0.67145	0.994;0.996	D;D	0.73708	0.981;0.962	D	0.85061	0.0934	10	0.87932	D	0	-24.6413	7.8477	0.29435	0.0:0.3436:0.0:0.6564	.	159;223	E9PCE8;P12955	.;PEPD_HUMAN	D	223;159	ENSP00000244137:E223D;ENSP00000391890:E159D	ENSP00000244137:E223D	E	-	3	2	PEPD	38645743	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	0.517000	0.22832	0.078000	0.16900	-0.290000	0.09829	GAA	.		0.408	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451432.3	NM_000285	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	1273681	1273681	+	Missense_Mutation	SNP	C	C	T	rs377111871		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:1273681C>T	ENST00000529681.1	+	32	15030	c.14972C>T	c.(14971-14973)cCg>cTg	p.P4991L	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.P4994L	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4991					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCTCCCCACCGCCAGTGTCC	0.662																																					p.P4991L		.											.	.	.	0			c.C14972T						.	C	LEU/PRO	0,4212		0,0,2106	42.0	54.0	50.0		14972	4.6	0.1	11		50	1,8409		0,1,4204	no	missense	MUC5B	NM_002458.2	98	0,1,6310	TT,TC,CC		0.0119,0.0,0.0079	probably-damaging	4991/5763	1273681	1,12621	2106	4205	6311	SO:0001583	missense	727897	exon32			CCCCACCGCCAGT	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14972C>T	11.37:g.1273681C>T	ENSP00000436812:p.Pro4991Leu	44	0		48	18	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566295	0.27915	0.0	1.19E-4	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.19250	2.16;2.35	4.63	4.63	0.57726	.	.	.	.	.	T	0.40979	0.1139	M	0.64170	1.965	0.20975	N	0.999811	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	T	0.16100	-1.0414	9	0.87932	D	0	.	9.4062	0.38462	0.0:0.8986:0.0:0.1014	.	5313;4994	A7Y9J9;E9PBJ0	.;.	L	4991;4994;4935;4690	ENSP00000436812:P4991L;ENSP00000415793:P4994L	ENSP00000343037:P4935L	P	+	2	0	MUC5B	1230257	0.000000	0.05858	0.090000	0.20809	0.011000	0.07611	0.671000	0.25172	2.508000	0.84585	0.561000	0.74099	CCG	.		0.662	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KMT2C	58508	hgsc.bcm.edu	37	7	151921114	151921114	+	Nonsense_Mutation	SNP	A	A	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr7:151921114A>T	ENST00000262189.6	-	20	3527	c.3309T>A	c.(3307-3309)tgT>tgA	p.C1103*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.C1103*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1103					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C1103*(10)									CACATTGTCTACATTGCAGAA	0.338																																					p.C1103X		.											MLL3_ENST00000355193,NS,carcinoma,0,10	MLL3_ENST00000355193	0	10	Substitution - Nonsense(10)	kidney(6)|endometrium(4)	c.T3309A						.						56.0	51.0	52.0					7																	151921114		2203	4300	6503	SO:0001587	stop_gained	58508	exon20			TTGTCTACATTGC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3309T>A	7.37:g.151921114A>T	ENSP00000262189:p.Cys1103*	88	2		103	6	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	41	8.814636	0.98964	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.39	-2.79	0.05841	.	0.000000	0.50627	D	0.000105	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2367	0.59972	0.4373:0.0:0.5627:0.0	rs4024337	.	.	.	X	1103	.	ENSP00000262189:C1103X	C	-	3	2	MLL3	151552047	0.735000	0.28153	0.983000	0.44433	0.992000	0.81027	-0.154000	0.10130	-0.431000	0.07307	0.528000	0.53228	TGT	.		0.338	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
EPHA2	1969	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	16451813	16451813	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:16451813T>A	ENST00000358432.5	-	17	2982	c.2828A>T	c.(2827-2829)gAc>gTc	p.D943V		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	943	Negatively regulates interaction with ARHGEF16.|SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	CCTCTTGATGTCGCTGTGGGC	0.687																																					p.D943V		.											.	.	.	0			c.A2828T						.						34.0	28.0	30.0					1																	16451813		2203	4300	6503	SO:0001583	missense	1969	exon17			TTGATGTCGCTGT	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2828A>T	1.37:g.16451813T>A	ENSP00000351209:p.Asp943Val	37	0		30	18	NM_004431	B5A968|Q8N3Z2	Missense_Mutation	SNP	ENST00000358432.5	37	CCDS169.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.382022	0.82792	.	.	ENSG00000142627	ENST00000358432	T	0.59638	0.25	4.88	4.88	0.63580	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.53938	D	0.000041	T	0.80798	0.4692	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85688	0.1305	10	0.87932	D	0	.	13.6594	0.62357	0.0:0.0:0.0:1.0	.	943	P29317	EPHA2_HUMAN	V	943	ENSP00000351209:D943V	ENSP00000351209:D943V	D	-	2	0	EPHA2	16324400	1.000000	0.71417	0.993000	0.49108	0.880000	0.50808	7.946000	0.87746	1.825000	0.53177	0.459000	0.35465	GAC	.		0.687	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
MUC21	394263	hgsc.bcm.edu	37	6	30954618	30954618	+	Silent	SNP	T	T	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr6:30954618T>C	ENST00000376296.3	+	2	907	c.666T>C	c.(664-666)gcT>gcC	p.A222A	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	222	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAATGGGGCTGGCACAGCCA	0.637																																					p.A222A		.											MUC21,rectum,carcinoma,0,2	MUC21	0	0			c.T666C						.						149.0	149.0	149.0					6																	30954618		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			TGGGGCTGGCACA	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.666T>C	6.37:g.30954618T>C		78	1		73	4	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																			.		0.637	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
S1PR5	53637	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	10624541	10624541	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:10624541C>T	ENST00000439028.3	-	2	1272	c.1147G>A	c.(1147-1149)Ggt>Agt	p.G383S	S1PR5_ENST00000333430.4_Missense_Mutation_p.G383S	NM_001166215.1	NP_001159687.1	Q9H228	S1PR5_HUMAN	sphingosine-1-phosphate receptor 5	383					regulation of neuron differentiation (GO:0045664)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	12					Fingolimod(DB08868)	GTGGGTGCACCGGGGCTGCCT	0.657																																					p.G383S		.											.	.	.	0			c.G1147A						.						21.0	27.0	25.0					19																	10624541		2163	4228	6391	SO:0001583	missense	53637	exon2			GTGCACCGGGGCT	AK074661	CCDS12240.1	19p13.2	2012-08-08	2008-04-30	2008-04-30		ENSG00000180739		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	14299	protein-coding gene	gene with protein product		605146	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 8"""	EDG8		10799507	Standard	NM_030760		Approved	Edg-8	uc002mou.2	Q9H228		ENST00000439028.3:c.1147G>A	19.37:g.10624541C>T	ENSP00000416915:p.Gly383Ser	27	0		30	5	NM_030760	Q6NW11	Missense_Mutation	SNP	ENST00000439028.3	37	CCDS12240.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654790	0.47467	.	.	ENSG00000180739	ENST00000439028;ENST00000333430	T;T	0.80824	-1.42;-1.42	4.51	2.15	0.27550	.	3.055300	0.02354	N	0.076264	T	0.71195	0.3311	N	0.19112	0.55	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.59532	-0.7437	10	0.66056	D	0.02	.	8.6821	0.34214	0.0:0.7331:0.0:0.2669	.	383	Q9H228	S1PR5_HUMAN	S	383	ENSP00000416915:G383S;ENSP00000328472:G383S	ENSP00000328472:G383S	G	-	1	0	S1PR5	10485541	0.000000	0.05858	0.006000	0.13384	0.013000	0.08279	0.039000	0.13884	0.859000	0.35456	0.313000	0.20887	GGT	.		0.657	S1PR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452015.1	NM_030760	
PKD2L1	9033	hgsc.bcm.edu	37	10	102059361	102059361	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr10:102059361G>T	ENST00000318222.3	-	3	846	c.464C>A	c.(463-465)gCg>gAg	p.A155E	PKD2L1_ENST00000353274.3_Missense_Mutation_p.A155E|PKD2L1_ENST00000338519.3_Missense_Mutation_p.A155E	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	155					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		CCAGAAGTCCGCCATGCTGCT	0.493																																					p.A155E		.											PKD2L1,colon,carcinoma,0,1	PKD2L1	0	0			c.C464A						.						106.0	97.0	100.0					10																	102059361		2203	4300	6503	SO:0001583	missense	9033	exon3			AAGTCCGCCATGC	AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.464C>A	10.37:g.102059361G>T	ENSP00000325296:p.Ala155Glu	53	0		37	2	NM_016112	O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	ENST00000318222.3	37	CCDS7492.1	.	.	.	.	.	.	.	.	.	.	G	1.587	-0.530192	0.04112	.	.	ENSG00000107593	ENST00000338519;ENST00000353274;ENST00000318222;ENST00000339977	T;T;T	0.67865	-0.29;-0.29;-0.29	5.31	0.55	0.17219	Polycystin cation channel, PKD1/PKD2 (1);	0.513904	0.22212	N	0.063098	T	0.44726	0.1307	N	0.17278	0.47	0.09310	N	1	B;B	0.17268	0.021;0.001	B;B	0.17722	0.019;0.015	T	0.25606	-1.0127	10	0.02654	T	1	-0.3116	15.3864	0.74706	0.0:0.0:0.4356:0.5644	.	108;155	Q1L4F0;Q9P0L9	.;PK2L1_HUMAN	E	155	ENSP00000345068:A155E;ENSP00000266049:A155E;ENSP00000325296:A155E	ENSP00000325296:A155E	A	-	2	0	PKD2L1	102049351	0.769000	0.28531	0.287000	0.24848	0.922000	0.55478	0.695000	0.25527	0.191000	0.20236	0.555000	0.69702	GCG	.		0.493	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112	
TTC28	23331	hgsc.bcm.edu	37	22	28385466	28385466	+	Intron	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr22:28385466C>T	ENST00000397906.2	-	21	5849				TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000428584.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000452612.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						TGGCACAAAGCCATTTGTACC	0.408																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	284900	.			ACAAAGCCATTTG	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.5707+399G>A	22.37:g.28385466C>T		32	0		13	4	.	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	RNA	SNP	ENST00000397906.2	37	CCDS46678.1																																																																																			.		0.408	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	1256439	1256439	+	Missense_Mutation	SNP	T	T	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:1256439T>G	ENST00000529681.1	+	22	2813	c.2755T>G	c.(2755-2757)Tac>Gac	p.Y919D	MUC5B_ENST00000447027.1_Missense_Mutation_p.Y922D	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	919	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.|VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTGCGAGTACATCTTGGC	0.652																																					p.Y919D		.											.	.	.	0			c.T2755G						.						81.0	94.0	89.0					11																	1256439		2119	4228	6347	SO:0001583	missense	727897	exon22			TGCGAGTACATCT	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2755T>G	11.37:g.1256439T>G	ENSP00000436812:p.Tyr919Asp	33	0		42	13	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	T	9.926	1.213439	0.22289	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.68025	-0.3;-0.3	4.31	4.31	0.51392	von Willebrand factor, type D domain (3);	.	.	.	.	D	0.87132	0.6101	H	0.96691	3.865	0.48901	D	0.999725	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.99;0.998;0.998	D	0.91285	0.5054	9	0.87932	D	0	.	13.7682	0.63008	0.0:0.0:0.0:1.0	.	919;1578;922	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	D	919;922;920;955	ENSP00000436812:Y919D;ENSP00000415793:Y922D	ENSP00000343037:Y920D	Y	+	1	0	MUC5B	1213015	1.000000	0.71417	0.995000	0.50966	0.284000	0.27059	5.971000	0.70440	1.837000	0.53436	0.449000	0.29647	TAC	.		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
SLC24A2	25769	hgsc.bcm.edu;bcgsc.ca	37	9	19786216	19786216	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr9:19786216G>T	ENST00000341998.2	-	1	710	c.649C>A	c.(649-651)Ctc>Atc	p.L217I	SLC24A2_ENST00000286344.3_Missense_Mutation_p.L217I	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	217					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		ATAACAAAGAGGATGTTGAAT	0.433																																					p.L217I		.											.	.	.	0			c.C649A						.						106.0	99.0	101.0					9																	19786216		2203	4300	6503	SO:0001583	missense	25769	exon1			CAAAGAGGATGTT	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.649C>A	9.37:g.19786216G>T	ENSP00000344801:p.Leu217Ile	53	0		34	4	NM_001193288	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.768055	0.69878	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.69561	-0.41;-0.41	5.91	5.02	0.67125	Sodium/calcium exchanger membrane region (1);	0.059732	0.64402	D	0.000002	D	0.87321	0.6148	H	0.96269	3.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91362	0.5112	9	.	.	.	.	15.0355	0.71744	0.0679:0.0:0.9321:0.0	.	217;217	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	I	217	ENSP00000344801:L217I;ENSP00000286344:L217I	.	L	-	1	0	SLC24A2	19776216	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.747000	0.74872	1.508000	0.48769	0.655000	0.94253	CTC	.		0.433	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
UBR1	197131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43244513	43244513	+	Missense_Mutation	SNP	C	C	T	rs550798440		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr15:43244513C>T	ENST00000290650.4	-	45	5047	c.4969G>A	c.(4969-4971)Gca>Aca	p.A1657T	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1657					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		CAGTGAAGTGCGTGAAAAATG	0.473													C|||	1	0.000199681	0.0	0.0	5008	,	,		17545	0.0		0.0	False		,,,				2504	0.001				p.A1657T		.											.	.	.	0			c.G4969A						.						133.0	136.0	135.0					15																	43244513		2203	4299	6502	SO:0001583	missense	197131	exon45			GAAGTGCGTGAAA		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.4969G>A	15.37:g.43244513C>T	ENSP00000290650:p.Ala1657Thr	31	0		36	11	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720505	0.48728	.	.	ENSG00000159459	ENST00000290650	T	0.52983	0.64	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.51958	0.1705	N	0.17564	0.495	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.46400	-0.9194	10	0.17832	T	0.49	-31.1538	17.8752	0.88823	0.0:1.0:0.0:0.0	.	1657	Q8IWV7	UBR1_HUMAN	T	1657	ENSP00000290650:A1657T	ENSP00000290650:A1657T	A	-	1	0	UBR1	41031805	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	4.806000	0.62569	2.432000	0.82394	0.467000	0.42956	GCA	.		0.473	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
DNA2	1763	hgsc.bcm.edu	37	10	70209804	70209804	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr10:70209804G>T	ENST00000358410.3	-	6	970	c.920C>A	c.(919-921)tCt>tAt	p.S307Y	DNA2_ENST00000399180.2_Missense_Mutation_p.S393Y|DNA2_ENST00000399179.2_Missense_Mutation_p.S307Y	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	307	Nuclease activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						GTGTTCAATAGAATTTGATTC	0.318																																					p.S307Y		.											DNA2L,NS,carcinoma,0,2	DNA2L	0	0			c.C920A						.						72.0	62.0	65.0					10																	70209804		1810	4078	5888	SO:0001583	missense	1763	exon6			TCAATAGAATTTG	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.920C>A	10.37:g.70209804G>T	ENSP00000351185:p.Ser307Tyr	72	0		32	2	NM_001080449	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	37		.	.	.	.	.	.	.	.	.	.	G	22.0	4.236606	0.79800	.	.	ENSG00000138346	ENST00000551118;ENST00000399180;ENST00000399179;ENST00000358410	D;D;D	0.95171	-3.12;-3.63;-3.09	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.97281	0.9111	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97510	1.0066	10	0.54805	T	0.06	.	18.525	0.90968	0.0:0.0:1.0:0.0	.	307;307	F8VR31;P51530	.;DNA2L_HUMAN	Y	307;393;307;307	ENSP00000382133:S393Y;ENSP00000382132:S307Y;ENSP00000351185:S307Y	ENSP00000351185:S307Y	S	-	2	0	DNA2	69879810	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.086000	0.94088	2.389000	0.81357	0.655000	0.94253	TCT	.		0.318	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		
CD300C	10871	hgsc.bcm.edu	37	17	72540765	72540765	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:72540765T>A	ENST00000330793.1	-	2	743	c.383A>T	c.(382-384)gAg>gTg	p.E128V		NM_006678.3	NP_006669.1	Q08708	CLM6_HUMAN	CD300c molecule	128	Ig-like V-type.|Pro-rich.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.E128V(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|skin(2)|upper_aerodigestive_tract(1)	21						CACGGACACCTCAACCTCGAC	0.577																																					p.E128V	Esophageal Squamous(66;421 1121 20537 25337 27468)	.											CD300C,caecum,carcinoma,0,1	CD300C	0	1	Substitution - Missense(1)	large_intestine(1)	c.A383T						.						134.0	118.0	123.0					17																	72540765		2203	4300	6503	SO:0001583	missense	10871	exon2			GACACCTCAACCT	BC022279	CCDS11701.1	17q25.2	2014-05-15	2006-03-28		ENSG00000167850	ENSG00000167850		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19320	protein-coding gene	gene with protein product		606786	"""CD300c antigen"""			1349532, 10746781	Standard	NM_006678		Approved	CMRF35, LIR, CMRF-35A, CMRF35A, IGSF16	uc002jky.2	Q08708	OTTHUMG00000067608	ENST00000330793.1:c.383A>T	17.37:g.72540765T>A	ENSP00000329507:p.Glu128Val	58	0		67	3	NM_006678		Missense_Mutation	SNP	ENST00000330793.1	37	CCDS11701.1	.	.	.	.	.	.	.	.	.	.	T	7.156	0.584829	0.13749	.	.	ENSG00000167850	ENST00000330793	T	0.04049	3.72	4.33	-8.67	0.00863	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.727610	0.03315	N	0.191014	T	0.04679	0.0127	L	0.35487	1.065	0.09310	N	1	B	0.25105	0.118	B	0.32289	0.143	T	0.17992	-1.0351	10	0.34782	T	0.22	.	8.1724	0.31262	0.419:0.0:0.4502:0.1308	.	128	Q08708	CLM6_HUMAN	V	128	ENSP00000329507:E128V	ENSP00000329507:E128V	E	-	2	0	CD300C	70052360	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-4.676000	0.00200	-3.237000	0.00208	0.454000	0.30748	GAG	.		0.577	CD300C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145084.1	NM_006678	
MUC4	4585	hgsc.bcm.edu	37	3	195508971	195508971	+	Silent	SNP	T	T	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr3:195508971T>C	ENST00000463781.3	-	2	9939	c.9480A>G	c.(9478-9480)tcA>tcG	p.S3160S	MUC4_ENST00000475231.1_Silent_p.S3160S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGTGGATGCTGAGGAAGTGT	0.587																																					p.S3160S		.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4_ENST00000463781	0	0			c.A9480G						.						5.0	3.0	4.0					3																	195508971		555	1260	1815	SO:0001819	synonymous_variant	4585	exon2			GGATGCTGAGGAA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9480A>G	3.37:g.195508971T>C		87	1		83	6	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ACIN1	22985	hgsc.bcm.edu	37	14	23540342	23540342	+	Intron	SNP	G	G	T	rs111237085		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr14:23540342G>T	ENST00000262710.1	-	9	2625				ACIN1_ENST00000457657.1_Intron|ACIN1_ENST00000357481.2_Missense_Mutation_p.S5R|ACIN1_ENST00000557515.1_Missense_Mutation_p.S5R|ACIN1_ENST00000555352.1_Intron|ACIN1_ENST00000555053.1_Intron|ACIN1_ENST00000397341.3_Missense_Mutation_p.S5R|ACIN1_ENST00000338631.6_Intron|ACIN1_ENST00000605057.1_Intron	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1						apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		ACCCTTCTTTGCTTTCTGATA	0.413																																					p.S5R		.											.	.	.	0			c.C15A						.						244.0	227.0	232.0					14																	23540342		692	1591	2283	SO:0001627	intron_variant	22985	exon2			TTCTTTGCTTTCT	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.2298-1516C>A	14.37:g.23540342G>T		62	0		77	3	NM_001164817	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.773229	0.49680	.	.	ENSG00000100813	ENST00000557515;ENST00000357481;ENST00000397341;ENST00000555566	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	T	0.67439	0.2893	.	.	.	0.80722	D	1	P	0.42518	0.782	P	0.45538	0.484	T	0.68652	-0.5352	7	0.66056	D	0.02	.	18.3732	0.90420	0.0:0.0:1.0:0.0	.	5	Q9UKV3-3	.	R	5	.	ENSP00000350073:S5R	S	-	3	2	ACIN1	22610182	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.159000	0.64923	2.941000	0.99782	0.655000	0.94253	AGC	.		0.413	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
TRPC6	7225	hgsc.bcm.edu	37	11	101343020	101343020	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:101343020G>T	ENST00000344327.3	-	8	2477	c.2053C>A	c.(2053-2055)Ctt>Att	p.L685I	TRPC6_ENST00000348423.4_Missense_Mutation_p.L569I|TRPC6_ENST00000360497.4_Missense_Mutation_p.L630I|TRPC6_ENST00000532133.1_Missense_Mutation_p.L607I	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	685					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		ACTTCAGAAAGTCCAAATATA	0.313																																					p.L685I	Colon(166;1315 1927 11094 12848 34731)	.											TRPC6,colon,carcinoma,0,1	TRPC6	0	0			c.C2053A						.						39.0	42.0	41.0					11																	101343020		2193	4286	6479	SO:0001583	missense	7225	exon8			CAGAAAGTCCAAA	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.2053C>A	11.37:g.101343020G>T	ENSP00000340913:p.Leu685Ile	48	0		50	2	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.291735	0.80914	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	D;D;D;D	0.98474	-4.95;-4.95;-4.45;-4.45	6.17	6.17	0.99709	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98975	0.9651	M	0.77406	2.37	0.50467	D	0.999878	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.998;0.995	D	0.99364	1.0918	10	0.59425	D	0.04	-1.0343	20.8794	0.99867	0.0:0.0:1.0:0.0	.	630;569;685	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	I	685;607;569;630	ENSP00000340913:L685I;ENSP00000435574:L607I;ENSP00000343672:L569I;ENSP00000353687:L630I	ENSP00000340913:L685I	L	-	1	0	TRPC6	100848230	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.679000	0.74513	2.941000	0.99782	0.655000	0.94253	CTT	.		0.313	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
RNF208	727800	hgsc.bcm.edu;broad.mit.edu	37	9	140114946	140114946	+	Missense_Mutation	SNP	C	C	A	rs565557716		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr9:140114946C>A	ENST00000392827.1	-	2	887	c.719G>T	c.(718-720)cGg>cTg	p.R240L	RNF208_ENST00000391553.1_Missense_Mutation_p.R240L			Q9H0X6	RN208_HUMAN	ring finger protein 208	240					protein autoubiquitination (GO:0051865)		ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			lung(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		ACAGTACTGCCGGAAGGTCTG	0.701																																					p.R240L		.											.	.	.	0			c.G719T						.						18.0	21.0	20.0					9																	140114946		2171	4287	6458	SO:0001583	missense	727800	exon1			TACTGCCGGAAGG	AF416715	CCDS7037.2	9q34.3	2007-01-19				ENSG00000212864		"""RING-type (C3HC4) zinc fingers"""	25420	protein-coding gene	gene with protein product						11230166	Standard	NM_031297		Approved	DKFZP761H1710	uc004clz.2	Q9H0X6		ENST00000392827.1:c.719G>T	9.37:g.140114946C>A	ENSP00000376572:p.Arg240Leu	8	0		7	5	NM_031297	A2BFA0	Missense_Mutation	SNP	ENST00000392827.1	37	CCDS7037.2	.	.	.	.	.	.	.	.	.	.	C	21.4	4.149736	0.78001	.	.	ENSG00000212864	ENST00000392827;ENST00000391553	T;T	0.34072	1.38;1.38	4.22	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.44201	0.1282	L	0.43152	1.355	0.58432	D	0.999997	D	0.67145	0.996	P	0.60173	0.87	T	0.35251	-0.9796	10	0.56958	D	0.05	-13.3462	9.1648	0.37046	0.0:0.8976:0.0:0.1024	.	240	Q9H0X6	RN208_HUMAN	L	240	ENSP00000376572:R240L;ENSP00000375397:R240L	ENSP00000375397:R240L	R	-	2	0	RNF208	139234767	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.913000	0.63341	2.169000	0.68431	0.491000	0.48974	CGG	.		0.701	RNF208-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254714.1	NM_031297	
RPS6KC1	26750	hgsc.bcm.edu	37	1	213415426	213415426	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:213415426G>T	ENST00000366960.3	+	11	2757	c.2607G>T	c.(2605-2607)aaG>aaT	p.K869N	RPS6KC1_ENST00000543354.1_Missense_Mutation_p.K572N|RPS6KC1_ENST00000490299.1_3'UTR|RPS6KC1_ENST00000366959.3_Missense_Mutation_p.K857N|RPS6KC1_ENST00000543470.1_Missense_Mutation_p.K657N	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	869	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		CTGAGACTAAGGGTGAAAGTG	0.383																																					p.K869N		.											RPS6KC1,NS,carcinoma,0,1	RPS6KC1	0	0			c.G2607T						.						114.0	118.0	117.0					1																	213415426		2203	4300	6503	SO:0001583	missense	26750	exon11			GACTAAGGGTGAA	AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.2607G>T	1.37:g.213415426G>T	ENSP00000355927:p.Lys869Asn	41	0		48	2	NM_012424	B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Missense_Mutation	SNP	ENST00000366960.3	37	CCDS1513.1	.	.	.	.	.	.	.	.	.	.	G	8.846	0.943344	0.18281	.	.	ENSG00000136643	ENST00000543470;ENST00000366960;ENST00000366959;ENST00000543354	T;T;T;T	0.48522	1.4;1.42;1.42;0.81	5.91	5.0	0.66597	Protein kinase, catalytic domain (1);	0.484215	0.24341	N	0.039379	T	0.31918	0.0812	N	0.14661	0.345	0.09310	N	1	P;B;B	0.35684	0.515;0.372;0.372	B;B;B	0.38225	0.268;0.213;0.213	T	0.20940	-1.0260	10	0.49607	T	0.09	-32.4603	9.1112	0.36730	0.0729:0.0:0.7816:0.1454	.	657;869;857	F5H7T0;Q96S38;B1APS8	.;KS6C1_HUMAN;.	N	657;869;857;572	ENSP00000442306:K657N;ENSP00000355927:K869N;ENSP00000355926:K857N;ENSP00000439282:K572N	ENSP00000355926:K857N	K	+	3	2	RPS6KC1	211482049	0.405000	0.25336	0.008000	0.14137	0.753000	0.42808	2.109000	0.41863	1.505000	0.48720	0.655000	0.94253	AAG	.		0.383	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089690.3	NM_012424	
FOXO3	2309	hgsc.bcm.edu	37	6	108985269	108985269	+	Silent	SNP	C	C	T	rs34079373		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr6:108985269C>T	ENST00000343882.6	+	3	1537	c.1233C>T	c.(1231-1233)agC>agT	p.S411S	FOXO3_ENST00000540898.1_Silent_p.S191S|FOXO3_ENST00000406360.1_Silent_p.S411S	NM_201559.2	NP_963853.1	O43524	FOXO3_HUMAN	forkhead box O3	411					antral ovarian follicle growth (GO:0001547)|cellular response to oxidative stress (GO:0034599)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|initiation of primordial ovarian follicle growth (GO:0001544)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|ovulation from ovarian follicle (GO:0001542)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S411S(1)		central_nervous_system(5)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		TGCAGCGGAGCTCTAGCTTCC	0.592																																					p.S411S		.											FOXO3,NS,carcinoma,0,1	FOXO3	0	1	Substitution - coding silent(1)	prostate(1)	c.C1233T						.						57.0	60.0	59.0					6																	108985269		2203	4300	6503	SO:0001819	synonymous_variant	2309	exon2			GCGGAGCTCTAGC	AF032886	CCDS5068.1	6q21	2008-09-08	2007-05-02	2007-05-02	ENSG00000118689	ENSG00000118689		"""Forkhead boxes"""	3821	protein-coding gene	gene with protein product		602681		FKHRL1, FOXO3A		9479491	Standard	NM_001455		Approved	AF6q21, FOXO2	uc003psm.2	O43524	OTTHUMG00000015327	ENST00000343882.6:c.1233C>T	6.37:g.108985269C>T		41	1		25	2	NM_001455	B4DVZ6|E1P5E6|O15171|Q5T2I7|Q9BZ04	Silent	SNP	ENST00000343882.6	37	CCDS5068.1																																																																																			.		0.592	FOXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041722.2		
SNED1	25992	hgsc.bcm.edu	37	2	241976736	241976736	+	Silent	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr2:241976736C>T	ENST00000310397.8	+	6	1011	c.1011C>T	c.(1009-1011)tgC>tgT	p.C337C	SNED1_ENST00000342631.6_Silent_p.C337C|AC005237.4_ENST00000458377.1_RNA|SNED1_ENST00000401884.1_Silent_p.C337C|SNED1_ENST00000405547.3_Silent_p.C337C	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	337	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GCTGCCAGTGCCCGGCTGGCT	0.632																																					p.C337C		.											.	.	.	0			c.C1011T						.						35.0	39.0	38.0					2																	241976736		2033	4181	6214	SO:0001819	synonymous_variant	25992	exon6			CCAGTGCCCGGCT	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.1011C>T	2.37:g.241976736C>T		68	0		82	4	NM_001080437	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Silent	SNP	ENST00000310397.8	37	CCDS46562.1	.	.	.	.	.	.	.	.	.	.	C	5.267	0.234754	0.09969	.	.	ENSG00000162804	ENST00000401644	.	.	.	4.72	2.92	0.33932	.	.	.	.	.	T	0.56046	0.1959	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47573	-0.9107	4	.	.	.	.	7.6157	0.28156	0.0:0.6683:0.0:0.3317	.	.	.	.	S	34	.	.	P	+	1	0	SNED1	241625409	0.835000	0.29415	0.992000	0.48379	0.222000	0.24845	0.645000	0.24782	0.419000	0.25927	0.563000	0.77884	CCC	.		0.632	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
R3HCC1L	27291	hgsc.bcm.edu	37	10	99968068	99968068	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr10:99968068C>A	ENST00000298999.3	+	5	500	c.197C>A	c.(196-198)cCg>cAg	p.P66Q	R3HCC1L_ENST00000314594.5_5'UTR|R3HCC1L_ENST00000370586.2_Intron|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.P66Q	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	66							nucleotide binding (GO:0000166)										AAAGACAAACCGGAGGCTCGA	0.368																																					p.P66Q		.											C10orf28,NS,carcinoma,0,1	C10orf28	0	0			c.C197A						.						71.0	79.0	76.0					10																	99968068		2202	4299	6501	SO:0001583	missense	27291	exon4			ACAAACCGGAGGC	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.197C>A	10.37:g.99968068C>A	ENSP00000298999:p.Pro66Gln	59	0		43	2	NM_001256620	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	37	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	C	5.800	0.331933	0.10956	.	.	ENSG00000166024	ENST00000370584;ENST00000538495;ENST00000298999	T;T	0.07908	3.15;3.15	5.95	0.925	0.19424	.	0.550760	0.17907	N	0.157995	T	0.09512	0.0234	L	0.46157	1.445	0.09310	N	0.999998	P;P	0.49696	0.927;0.927	P;P	0.47864	0.559;0.457	T	0.18808	-1.0325	9	.	.	.	0.6222	5.3852	0.16215	0.0:0.5611:0.135:0.3039	.	66;66	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	Q	66	ENSP00000359616:P66Q;ENSP00000298999:P66Q	.	P	+	2	0	C10orf28	99958058	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-0.405000	0.07196	-0.063000	0.13065	-0.124000	0.14976	CCG	.		0.368	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472	
WDR7	23335	hgsc.bcm.edu	37	18	54424284	54424284	+	Silent	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr18:54424284C>T	ENST00000254442.3	+	15	2671	c.2460C>T	c.(2458-2460)tgC>tgT	p.C820C	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Silent_p.C820C	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	820					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		ATGAAGTTTGCCTGGATCGCC	0.468																																					p.C820C		.											WDR7,NS,carcinoma,0,1	WDR7	0	0			c.C2460T						.						194.0	184.0	187.0					18																	54424284		2203	4300	6503	SO:0001819	synonymous_variant	23335	exon15			AGTTTGCCTGGAT	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.2460C>T	18.37:g.54424284C>T		52	0		48	2	NM_052834	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Silent	SNP	ENST00000254442.3	37	CCDS11962.1																																																																																			.		0.468	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		
C2orf16	84226	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	27799950	27799950	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr2:27799950G>T	ENST00000408964.2	+	1	562	c.511G>T	c.(511-513)Ggc>Tgc	p.G171C		NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	171						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					GGCATATAAAGGCATAGATAC	0.423																																					p.G171C		.											.	.	.	0			c.G511T						.						77.0	72.0	73.0					2																	27799950		1875	4104	5979	SO:0001583	missense	84226	exon1			TATAAAGGCATAG	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.511G>T	2.37:g.27799950G>T	ENSP00000386190:p.Gly171Cys	59	0		42	4	NM_032266	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	37	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.376893	0.42105	.	.	ENSG00000221843	ENST00000408964	T	0.13196	2.61	3.91	-0.821	0.10822	.	.	.	.	.	T	0.11367	0.0277	L	0.27053	0.805	0.09310	N	1	D	0.61697	0.99	P	0.50192	0.634	T	0.19031	-1.0318	9	0.51188	T	0.08	.	3.5599	0.07878	0.4412:0.1993:0.3595:0.0	.	171	Q68DN1	CB016_HUMAN	C	171	ENSP00000386190:G171C	ENSP00000386190:G171C	G	+	1	0	C2orf16	27653454	0.010000	0.17322	0.002000	0.10522	0.044000	0.14063	0.721000	0.25911	-0.052000	0.13311	0.563000	0.77884	GGC	.		0.423	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
LPHN3	23284	hgsc.bcm.edu	37	4	62845391	62845391	+	Silent	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr4:62845391G>T	ENST00000514591.1	+	17	3041	c.2712G>T	c.(2710-2712)ggG>ggT	p.G904G	LPHN3_ENST00000507625.1_Silent_p.G972G|LPHN3_ENST00000509896.1_Silent_p.G972G|LPHN3_ENST00000507164.1_Silent_p.G972G|LPHN3_ENST00000508693.1_Silent_p.G972G|LPHN3_ENST00000506700.1_Silent_p.G904G|LPHN3_ENST00000545650.1_Silent_p.G904G|LPHN3_ENST00000514157.1_Silent_p.G904G|LPHN3_ENST00000512091.2_Silent_p.G904G|LPHN3_ENST00000506720.1_Silent_p.G972G|LPHN3_ENST00000514996.1_Silent_p.G904G|LPHN3_ENST00000504896.1_Silent_p.G904G|LPHN3_ENST00000508946.1_Silent_p.G904G|LPHN3_ENST00000506746.1_Silent_p.G972G|LPHN3_ENST00000511324.1_Silent_p.G972G			Q9HAR2	LPHN3_HUMAN	latrophilin 3	891					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TTTTCCGGGGGCTCCAGAGTG	0.498																																					p.G904G		.											LPHN3_ENST00000514591,right_upper_lobe,carcinoma,0,3	LPHN3_ENST00000514591	0	0			c.G2712T						.						216.0	217.0	217.0					4																	62845391		2048	4219	6267	SO:0001819	synonymous_variant	23284	exon15			CCGGGGGCTCCAG	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2712G>T	4.37:g.62845391G>T		52	0		48	2	NM_015236	E9PE04|O94867|Q9NWK5	Silent	SNP	ENST00000514591.1	37	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	9.104	1.004932	0.19199	.	.	ENSG00000150471	ENST00000502815	.	.	.	5.5	0.174	0.15040	.	.	.	.	.	T	0.44371	0.1290	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23013	-1.0200	4	.	.	.	.	3.8968	0.09143	0.1979:0.2105:0.4939:0.0977	.	.	.	.	S	362	.	.	A	+	1	0	LPHN3	62527986	0.961000	0.32948	0.993000	0.49108	0.980000	0.70556	0.092000	0.15066	0.012000	0.14892	-0.499000	0.04595	GCT	.		0.498	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
DPP4	1803	hgsc.bcm.edu	37	2	162875264	162875264	+	Silent	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr2:162875264C>A	ENST00000360534.3	-	16	1955	c.1395G>T	c.(1393-1395)gcG>gcT	p.A465A	DPP4_ENST00000491591.1_5'Flank	NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	465					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A465A(2)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	GATAATACTTCGCCTCTTTAC	0.473																																					p.A465A		.											DPP4,NS,carcinoma,-1,2	DPP4	-1	2	Substitution - coding silent(2)	large_intestine(2)	c.G1395T						.						128.0	116.0	120.0					2																	162875264		2203	4300	6503	SO:0001819	synonymous_variant	1803	exon16			ATACTTCGCCTCT	M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1395G>T	2.37:g.162875264C>A		34	0		30	2	NM_001935	Q53TN1	Silent	SNP	ENST00000360534.3	37	CCDS2216.1																																																																																			.		0.473	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2		
HSF5	124535	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	56540279	56540279	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:56540279G>A	ENST00000323777.3	-	4	1515	c.1406C>T	c.(1405-1407)cCt>cTt	p.P469L		NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	469					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ATTTTCAACAGGCTGAGCTGT	0.443																																					p.P469L		.											.	.	.	0			c.C1406T						.						250.0	220.0	230.0					17																	56540279		2203	4300	6503	SO:0001583	missense	124535	exon4			TCAACAGGCTGAG	BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.1406C>T	17.37:g.56540279G>A	ENSP00000313243:p.Pro469Leu	35	0		49	22	NM_001080439	Q08EH7|Q8N7V2	Missense_Mutation	SNP	ENST00000323777.3	37	CCDS32690.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859525	0.71834	.	.	ENSG00000176160	ENST00000412540;ENST00000323777	T	0.69175	-0.38	5.57	5.57	0.84162	.	0.099262	0.45126	D	0.000397	T	0.68513	0.3009	N	0.24115	0.695	0.46336	D	0.998995	D	0.69078	0.997	P	0.58520	0.84	T	0.72724	-0.4207	10	0.87932	D	0	.	16.2733	0.82630	0.0:0.0:1.0:0.0	.	469	Q4G112	HSF5_HUMAN	L	369;469	ENSP00000313243:P469L	ENSP00000313243:P469L	P	-	2	0	HSF5	53895278	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.434000	0.59935	2.632000	0.89209	0.650000	0.86243	CCT	.		0.443	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444719.1	XM_064190	
PIGR	5284	hgsc.bcm.edu	37	1	207107996	207107996	+	Nonsense_Mutation	SNP	C	C	A	rs538734889		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:207107996C>A	ENST00000356495.4	-	6	1657	c.1474G>T	c.(1474-1476)Gag>Tag	p.E492*	PIGR_ENST00000487208.1_5'Flank	NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	492	Ig-like V-type 5.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)	p.E492*(1)		central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CAGTATTTCTCGTACGAGGAG	0.562																																					p.E492X		.											PIGR,NS,carcinoma,0,2	PIGR	0	1	Substitution - Nonsense(1)	lung(1)	c.G1474T						.						77.0	76.0	76.0					1																	207107996		2203	4300	6503	SO:0001587	stop_gained	5284	exon6			ATTTCTCGTACGA		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1474G>T	1.37:g.207107996C>A	ENSP00000348888:p.Glu492*	16	0		35	2	NM_002644	Q68D81|Q8IZY7	Nonsense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	C	37	6.046674	0.97231	.	.	ENSG00000162896	ENST00000356495	.	.	.	5.77	3.92	0.45320	.	0.333042	0.29486	N	0.012010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-5.0706	7.2223	0.25994	0.0:0.7128:0.1395:0.1477	.	.	.	.	X	492	.	ENSP00000348888:E492X	E	-	1	0	PIGR	205174619	0.010000	0.17322	0.453000	0.27007	0.434000	0.31775	-0.034000	0.12225	0.814000	0.34374	0.561000	0.74099	GAG	.		0.562	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
TRIP13	9319	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	908545	908545	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr5:908545G>A	ENST00000166345.3	+	9	1191	c.835G>A	c.(835-837)Gct>Act	p.A279T		NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	279					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			CGTGGTCAATGCTGTCTTGAC	0.527																																					p.A279T		.											.	.	.	0			c.G835A						.						83.0	84.0	83.0					5																	908545		2203	4300	6503	SO:0001583	missense	9319	exon9			GTCAATGCTGTCT	L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.835G>A	5.37:g.908545G>A	ENSP00000166345:p.Ala279Thr	35	0		35	4	NM_004237	C9K0T3|D3DTC0|O15324	Missense_Mutation	SNP	ENST00000166345.3	37	CCDS3858.1	.	.	.	.	.	.	.	.	.	.	.	19.43	3.825480	0.71143	.	.	ENSG00000071539	ENST00000166345	D	0.92965	-3.14	5.95	5.95	0.96441	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.048338	0.85682	D	0.000000	D	0.95576	0.8562	M	0.66506	2.035	0.80722	D	1	D	0.71674	0.998	D	0.69479	0.964	D	0.94764	0.7939	10	0.51188	T	0.08	-0.5064	19.9739	0.97296	0.0:0.0:1.0:0.0	.	279	Q15645	PCH2_HUMAN	T	279	ENSP00000166345:A279T	ENSP00000166345:A279T	A	+	1	0	TRIP13	961545	1.000000	0.71417	0.382000	0.26119	0.219000	0.24729	5.181000	0.65054	2.826000	0.97356	0.563000	0.77884	GCT	.		0.527	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206721.2	NM_004237	
CABYR	26256	hgsc.bcm.edu	37	18	21736349	21736349	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr18:21736349C>A	ENST00000399481.2	+	2	742	c.590C>A	c.(589-591)tCt>tAt	p.S197Y	CABYR_ENST00000415309.2_Intron|CABYR_ENST00000327201.6_Intron|CABYR_ENST00000399499.1_Intron|CABYR_ENST00000399496.3_Intron|CABYR_ENST00000581397.1_Intron			O75952	CABYR_HUMAN	calcium binding tyrosine-(Y)-phosphorylation regulated	295					epithelial cilium movement (GO:0003351)|sperm capacitation (GO:0048240)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)	11	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					CATATATCATCTGTCTATAAC	0.413																																					p.S295Y		.											CABYR,NS,carcinoma,0,1	CABYR	0	0			c.C884A						.						80.0	77.0	78.0					18																	21736349		2203	4300	6503	SO:0001583	missense	26256	exon4			TATCATCTGTCTA	AF088868	CCDS11881.1, CCDS11882.1, CCDS11883.1, CCDS42420.1, CCDS45840.1	18q11.2	2009-08-06	2007-11-22		ENSG00000154040	ENSG00000154040			15569	protein-coding gene	gene with protein product	"""fibrousheathin 2"", ""cancer/testis antigen 88"""	612135				11820818, 17317841, 16139264	Standard	NM_012189		Approved	FSP-2, CBP86, CT88	uc002kux.3	O75952	OTTHUMG00000037365	ENST00000399481.2:c.590C>A	18.37:g.21736349C>A	ENSP00000382404:p.Ser197Tyr	49	0		46	2	NM_012189	B2R857|Q8WXW5|Q9HAY3|Q9HAY4|Q9HAY5|Q9HCY9	Missense_Mutation	SNP	ENST00000399481.2	37		.	.	.	.	.	.	.	.	.	.	C	11.85	1.761671	0.31228	.	.	ENSG00000154040	ENST00000399481	T	0.37235	1.21	5.74	5.74	0.90152	.	0.243150	0.29609	N	0.011676	T	0.54727	0.1876	L	0.50333	1.59	0.25633	N	0.986281	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.987	T	0.48127	-0.9062	9	.	.	.	-13.2696	16.6285	0.84993	0.0:1.0:0.0:0.0	.	277;295	O75952-2;O75952	.;CABYR_HUMAN	Y	197	ENSP00000382404:S197Y	.	S	+	2	0	CABYR	19990347	0.165000	0.22948	0.921000	0.36526	0.866000	0.49608	4.240000	0.58701	2.698000	0.92095	0.591000	0.81541	TCT	.		0.413	CABYR-201	KNOWN	basic	protein_coding	protein_coding		NM_153770	
NEUROD1	4760	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	182542721	182542721	+	Silent	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr2:182542721C>T	ENST00000295108.3	-	2	1324	c.867G>A	c.(865-867)ccG>ccA	p.P289P	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	289					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			ACTCGGCGGACGGTTCGTGTT	0.537																																					p.P289P		.											.	.	.	0			c.G867A						.						89.0	88.0	88.0					2																	182542721		2203	4300	6503	SO:0001819	synonymous_variant	4760	exon2			GGCGGACGGTTCG	U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.867G>A	2.37:g.182542721C>T		29	0		22	5	NM_002500	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Silent	SNP	ENST00000295108.3	37	CCDS2283.1																																																																																			.		0.537	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500	
TRAP1	10131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3729751	3729751	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr16:3729751T>C	ENST00000246957.5	-	5	600	c.512A>G	c.(511-513)aAc>aGc	p.N171S	TRAP1_ENST00000575671.1_5'Flank|TRAP1_ENST00000573872.1_5'Flank|TRAP1_ENST00000538171.1_Missense_Mutation_p.N118S	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	171					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				CGTCCCCAGGTTGGACACCAG	0.627																																					p.N171S		.											.	.	.	0			c.A512G						.						77.0	63.0	68.0					16																	3729751		2197	4300	6497	SO:0001583	missense	10131	exon5			CCCAGGTTGGACA	AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.512A>G	16.37:g.3729751T>C	ENSP00000246957:p.Asn171Ser	22	0		32	11	NM_016292	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Missense_Mutation	SNP	ENST00000246957.5	37	CCDS10508.1	.	.	.	.	.	.	.	.	.	.	T	18.15	3.558944	0.65538	.	.	ENSG00000126602	ENST00000246957;ENST00000538171	T;T	0.77358	-1.09;-1.09	5.26	5.26	0.73747	Heat shock protein Hsp90, N-terminal (1);ATPase-like, ATP-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.87939	0.6304	M	0.85373	2.75	0.80722	D	1	P;P	0.51147	0.929;0.942	P;P	0.62382	0.84;0.901	D	0.89563	0.3808	10	0.62326	D	0.03	-61.9987	14.6366	0.68694	0.0:0.0:0.0:1.0	.	118;171	F5H897;Q12931	.;TRAP1_HUMAN	S	171;118	ENSP00000246957:N171S;ENSP00000442070:N118S	ENSP00000246957:N171S	N	-	2	0	TRAP1	3669752	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	7.402000	0.79972	2.109000	0.64355	0.533000	0.62120	AAC	.		0.627	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251586.2	NM_016292	
ZNF728	388523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	23170160	23170160	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:23170160C>T	ENST00000594710.1	-	3	321	c.176G>A	c.(175-177)gGa>gAa	p.G59E		NM_001267716.1	NP_001254645.1	P0DKX0	ZN728_HUMAN	zinc finger protein 728	59	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										GGGCTCTTTTCCTTGCTCCAG	0.423																																					p.G59E		.											.	.	.	0			c.G176A						.																																			SO:0001583	missense	388523	exon3			TCTTTTCCTTGCT	BC128130	CCDS59370.1	19p12	2014-02-14			ENSG00000269067	ENSG00000269067		"""Zinc fingers, C2H2-type"", ""-"""	32463	protein-coding gene	gene with protein product							Standard	NM_001267716		Approved		uc002nqz.2	P0DKX0	OTTHUMG00000183124	ENST00000594710.1:c.176G>A	19.37:g.23170160C>T	ENSP00000471593:p.Gly59Glu	98	0		86	24	NM_001267716		Missense_Mutation	SNP	ENST00000594710.1	37	CCDS59370.1																																																																																			.		0.423	ZNF728-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465176.1	NM_001267716	
SMARCAL1	50485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	217315693	217315693	+	Missense_Mutation	SNP	G	G	A	rs568131335		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr2:217315693G>A	ENST00000357276.4	+	12	2306	c.1976G>A	c.(1975-1977)cGc>cAc	p.R659H	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.R659H	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	659					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GCCAAGCAGCGCAAGATAGTG	0.587									Schimke Immuno-Osseous Dysplasia				G|||	1	0.000199681	0.0008	0.0	5008	,	,		19836	0.0		0.0	False		,,,				2504	0.0				p.R659H		.											.	.	.	0			c.G1976A						.						60.0	61.0	61.0					2																	217315693		2203	4300	6503	SO:0001583	missense	50485	exon12	Familial Cancer Database	SIOD	AGCAGCGCAAGAT	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.1976G>A	2.37:g.217315693G>A	ENSP00000349823:p.Arg659His	18	0		28	11	NM_014140	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	G	34	5.386865	0.95967	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;T	0.92965	-3.14;-3.14;-0.98	5.47	5.47	0.80525	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.96204	0.8762	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96551	0.9408	10	0.87932	D	0	-5.1217	18.3269	0.90258	0.0:0.0:1.0:0.0	.	659	Q9NZC9	SMAL1_HUMAN	H	659;659;501	ENSP00000349823:R659H;ENSP00000350940:R659H;ENSP00000375974:R501H	ENSP00000349823:R659H	R	+	2	0	SMARCAL1	217023938	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.795000	0.99099	2.559000	0.86315	0.650000	0.86243	CGC	.		0.587	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
KLHL11	55175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40010293	40010293	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:40010293T>C	ENST00000319121.3	-	2	1886	c.1826A>G	c.(1825-1827)gAt>gGt	p.D609G	RP11-156E6.1_ENST00000560400.1_RNA	NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	609										NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				GAAGACATCATCTTTGTAATA	0.433																																					p.D609G		.											.	.	.	0			c.A1826G						.						93.0	93.0	93.0					17																	40010293		2203	4300	6503	SO:0001583	missense	55175	exon2			ACATCATCTTTGT		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.1826A>G	17.37:g.40010293T>C	ENSP00000314608:p.Asp609Gly	58	0		46	21	NM_018143		Missense_Mutation	SNP	ENST00000319121.3	37	CCDS11411.1	.	.	.	.	.	.	.	.	.	.	T	11.43	1.637329	0.29157	.	.	ENSG00000178502	ENST00000319121;ENST00000540254	T	0.72835	-0.69	5.59	5.59	0.84812	Kelch-type beta propeller (1);	0.055070	0.64402	D	0.000001	T	0.53562	0.1804	N	0.19112	0.55	0.80722	D	1	B	0.18610	0.029	B	0.21151	0.033	T	0.52003	-0.8633	10	0.02654	T	1	1.4316	16.0549	0.80794	0.0:0.0:0.0:1.0	.	609	Q9NVR0	KLH11_HUMAN	G	609;472	ENSP00000314608:D609G	ENSP00000314608:D609G	D	-	2	0	KLHL11	37263819	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.559000	0.82265	2.246000	0.74042	0.528000	0.53228	GAT	.		0.433	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143	
DMBT1	1755	hgsc.bcm.edu	37	10	124390549	124390549	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr10:124390549G>T	ENST00000338354.3	+	46	5817	c.5711G>T	c.(5710-5712)gGt>gTt	p.G1904V	DMBT1_ENST00000368955.3_Missense_Mutation_p.G1894V|DMBT1_ENST00000359586.6_Missense_Mutation_p.G624V|DMBT1_ENST00000368909.3_Missense_Mutation_p.G1904V|DMBT1_ENST00000330163.4_Missense_Mutation_p.G1276V|DMBT1_ENST00000344338.3_Missense_Mutation_p.G1894V|DMBT1_ENST00000368956.2_Missense_Mutation_p.G1276V			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1904	SRCR 14. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.G2033V(1)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATTTACCATGGTGGCACCTGG	0.493																																					p.G1904V	Ovarian(182;93 2026 18125 22222 38972)	.											DMBT1_ENST00000368915,NS,carcinoma,0,1	DMBT1_ENST00000368915	0	1	Substitution - Missense(1)	ovary(1)	c.G5711T						.						128.0	124.0	125.0					10																	124390549		2001	4161	6162	SO:0001583	missense	1755	exon46			ACCATGGTGGCAC		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.5711G>T	10.37:g.124390549G>T	ENSP00000342210:p.Gly1904Val	99	1		66	3	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	G	13.45	2.239565	0.39598	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46;1.46	5.3	-6.03	0.02185	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.48021	0.1477	M	0.64404	1.975	0.09310	N	1	P;D;P;D;D;D;D	0.89917	0.951;0.998;0.589;0.998;1.0;0.99;0.971	P;D;B;D;D;D;D	0.79108	0.674;0.947;0.272;0.991;0.992;0.92;0.93	T	0.53599	-0.8416	9	0.54805	T	0.06	.	15.174	0.72896	0.7333:0.0:0.2667:0.0	.	624;1884;1153;2033;1276;1894;1904	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	V	1904;2033;1904;1904;1904;1904;1276;1894;1276;1276;1904;1894;1276;50;624	ENSP00000342210:G1904V;ENSP00000343175:G1894V;ENSP00000327747:G1276V;ENSP00000357905:G1904V;ENSP00000357951:G1894V;ENSP00000357952:G1276V;ENSP00000352593:G624V	ENSP00000331522:G1276V	G	+	2	0	DMBT1	124380539	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.548000	0.02184	-0.980000	0.03524	-0.136000	0.14681	GGT	.		0.493	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
MUC21	394263	hgsc.bcm.edu	37	6	30954918	30954918	+	Silent	SNP	A	A	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr6:30954918A>G	ENST00000376296.3	+	2	1207	c.966A>G	c.(964-966)acA>acG	p.T322T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	322	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T322T(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						ACTCCAGCACAACCTCCAGTG	0.617																																					p.T322T		.											MUC21,NS,carcinoma,0,1	MUC21	0	1	Substitution - coding silent(1)	lung(1)	c.A966G						.						144.0	143.0	144.0					6																	30954918		2202	4300	6502	SO:0001819	synonymous_variant	394263	exon2			CAGCACAACCTCC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.966A>G	6.37:g.30954918A>G		48	1		56	6	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																			.		0.617	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
PDXDC2P	283970	hgsc.bcm.edu	37	16	70013392	70013392	+	RNA	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr16:70013392C>A	ENST00000531894.1	-	0	2519				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										AAAGATGCCCCCTGCAACCTT	0.488																																					.		.											.	.	.	0			.						.																																					283970	.			ATGCCCCCTGCAA			16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70013392C>A		85	0		58	4	.	A8K9Z5	RNA	SNP	ENST00000531894.1	37																																																																																				.		0.488	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000395258.1		
OR4Q3	441669	hgsc.bcm.edu	37	14	20216038	20216038	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr14:20216038G>T	ENST00000331723.1	+	1	452	c.452G>T	c.(451-453)tGt>tTt	p.C151F		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C151Y(1)		NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GCCTGCTGGTGTGGGGGTTTT	0.498																																					p.C151F		.											OR4Q3,NS,carcinoma,0,1	OR4Q3	0	1	Substitution - Missense(1)	lung(1)	c.G452T						.						89.0	91.0	91.0					14																	20216038		2203	4298	6501	SO:0001583	missense	441669	exon1			GCTGGTGTGGGGG	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.452G>T	14.37:g.20216038G>T	ENSP00000330049:p.Cys151Phe	78	0		71	3	NM_172194	Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	7.111	0.575940	0.13623	.	.	ENSG00000182652	ENST00000331723	T	0.35421	1.31	4.09	0.988	0.19796	GPCR, rhodopsin-like superfamily (1);	0.403439	0.17772	U	0.162549	T	0.12135	0.0295	N	0.01438	-0.865	0.09310	N	0.999997	B	0.02656	0.0	B	0.04013	0.001	T	0.20706	-1.0267	10	0.49607	T	0.09	.	6.2602	0.20895	0.0:0.3238:0.3622:0.3139	.	151	Q8NH05	OR4Q3_HUMAN	F	151	ENSP00000330049:C151F	ENSP00000330049:C151F	C	+	2	0	OR4Q3	19285878	0.000000	0.05858	1.000000	0.80357	0.793000	0.44817	0.935000	0.28924	0.891000	0.36235	0.406000	0.27484	TGT	.		0.498	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2		
IDE	3416	hgsc.bcm.edu	37	10	94228698	94228698	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr10:94228698G>A	ENST00000265986.6	-	19	2314	c.2258C>T	c.(2257-2259)gCt>gTt	p.A753V	IDE_ENST00000496903.1_5'UTR|IDE_ENST00000371581.5_Missense_Mutation_p.A198V	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	753					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TTTGGTATGAGCATGTTCAAT	0.398																																					p.A753V		.											IDE,colon,carcinoma,0,1	IDE	0	0			c.C2258T						.						124.0	113.0	116.0					10																	94228698		2203	4300	6503	SO:0001583	missense	3416	exon19			GTATGAGCATGTT	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2258C>T	10.37:g.94228698G>A	ENSP00000265986:p.Ala753Val	45	0		47	2	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	37	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777421	0.49786	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.08458	3.09;3.09	5.6	5.6	0.85130	Peptidase M16, C-terminal (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.08044	0.0201	L	0.33245	0.995	0.80722	D	1	P;P	0.39551	0.655;0.678	B;B	0.32805	0.1;0.153	T	0.34825	-0.9813	10	0.28530	T	0.3	-11.1077	19.2269	0.93821	0.0:0.0:1.0:0.0	.	753;198	P14735;B3KSB8	IDE_HUMAN;.	V	753;198	ENSP00000265986:A753V;ENSP00000360637:A198V	ENSP00000265986:A753V	A	-	2	0	IDE	94218678	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	9.134000	0.94467	2.638000	0.89438	0.655000	0.94253	GCT	.		0.398	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
PKNOX2	63876	hgsc.bcm.edu	37	11	125280125	125280125	+	Nonsense_Mutation	SNP	G	G	T	rs572689602		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:125280125G>T	ENST00000298282.9	+	8	893	c.622G>T	c.(622-624)Gga>Tga	p.G208*	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Nonsense_Mutation_p.G144*	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	208					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)	p.G208R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		TTCCATGTCCGGAGTCTCCAA	0.572																																					p.G208X		.											PKNOX2,larynx,carcinoma,0,1	PKNOX2	0	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G622T						.						124.0	129.0	127.0					11																	125280125		2066	4220	6286	SO:0001587	stop_gained	63876	exon8			ATGTCCGGAGTCT	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.622G>T	11.37:g.125280125G>T	ENSP00000298282:p.Gly208*	23	0		22	2	NM_022062	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Nonsense_Mutation	SNP	ENST00000298282.9	37	CCDS41730.1	.	.	.	.	.	.	.	.	.	.	G	38	7.085612	0.98051	.	.	ENSG00000165495	ENST00000530517;ENST00000531116;ENST00000298282;ENST00000542175;ENST00000535518	.	.	.	5.62	5.62	0.85841	.	0.092956	0.44902	D	0.000403	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-6.3419	19.2564	0.93947	0.0:0.0:1.0:0.0	.	.	.	.	X	179;179;208;144;196	.	ENSP00000298282:G208X	G	+	1	0	PKNOX2	124785335	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	2.309000	0.43699	2.633000	0.89246	0.655000	0.94253	GGA	.		0.572	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3		
CST13P	164380	hgsc.bcm.edu;bcgsc.ca	37	20	23514887	23514887	+	RNA	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr20:23514887G>A	ENST00000400563.2	+	0	754					NR_001279.2				cystatin 13, pseudogene																		CGAACAATTTGCAAGAAAATT	0.353																																					.		.											.	.	.	0			.						.																																					164380	.			CAATTTGCAAGAA			20p11.21	2012-08-14			ENSG00000204663	ENSG00000204663			44335	pseudogene	pseudogene	"""cystatin T"""					20565543	Standard	NR_001279		Approved	CTES6, CSTT	uc002wti.3		OTTHUMG00000032078		20.37:g.23514887G>A		82	0		83	4	.		RNA	SNP	ENST00000400563.2	37																																																																																				.		0.353	CST13P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000078343.2		
KANK1	23189	hgsc.bcm.edu	37	9	732477	732477	+	Silent	SNP	G	G	A	rs569686873|rs370051574		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr9:732477G>A	ENST00000382303.1	+	10	3757	c.3105G>A	c.(3103-3105)gaG>gaA	p.E1035E	KANK1_ENST00000382297.2_Silent_p.E1035E|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Silent_p.E877E	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1035					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TTGAAGAAGAGGAGGAGGAGG	0.468													G|||	1	0.000199681	0.0	0.0	5008	,	,		19819	0.0		0.0	False		,,,				2504	0.001				p.E1035E		.											KANK1_ENST00000382303,NS,carcinoma,0,4	KANK1_ENST00000382303	0	0			c.G3105A						.						153.0	134.0	140.0					9																	732477		2203	4300	6503	SO:0001819	synonymous_variant	23189	exon10			AGAAGAGGAGGAG	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3105G>A	9.37:g.732477G>A		51	1		55	3	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	ENST00000382303.1	37	CCDS34976.1																																																																																			.		0.468	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
ATP7B	540	hgsc.bcm.edu	37	13	52549277	52549277	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr13:52549277G>T	ENST00000242839.4	-	2	235	c.79C>A	c.(79-81)Cgt>Agt	p.R27S	ATP7B_ENST00000400366.3_Missense_Mutation_p.R27S|ATP7B_ENST00000400370.3_Missense_Mutation_p.R27S|ATP7B_ENST00000542656.1_5'UTR|ATP7B_ENST00000344297.5_Missense_Mutation_p.R27S|ATP7B_ENST00000418097.2_Missense_Mutation_p.R27S|ATP7B_ENST00000448424.2_Missense_Mutation_p.R27S|ATP7B_ENST00000482841.1_5'Flank	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	27					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TCCCAGGCACGGGTAGGCAAA	0.428									Wilson disease																												p.R27S		.											ATP7B,NS,carcinoma,0,1	ATP7B	0	0			c.C79A						.						83.0	80.0	81.0					13																	52549277		1871	4103	5974	SO:0001583	missense	540	exon2	Familial Cancer Database		AGGCACGGGTAGG	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.79C>A	13.37:g.52549277G>T	ENSP00000242839:p.Arg27Ser	31	0		31	2	NM_001243182	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	37	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	g	10.23	1.293382	0.23564	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000448424;ENST00000400370;ENST00000418097	D;D;D;D;D;D	0.97089	-3.8;-3.84;-3.93;-3.75;-4.24;-3.81	5.63	2.54	0.30619	.	0.623354	0.17138	N	0.185573	D	0.89880	0.6843	N	0.14661	0.345	0.19300	N	0.999978	B;B;B;B;B;B;B	0.30605	0.005;0.006;0.103;0.256;0.287;0.095;0.004	B;B;B;B;B;B;B	0.27715	0.006;0.006;0.021;0.082;0.05;0.074;0.003	T	0.80999	-0.1131	10	0.09843	T	0.71	-0.0067	7.4889	0.27449	0.353:0.0:0.647:0.0	.	27;27;27;27;27;27;27	E7ET55;B7ZLR4;F5H748;F5H562;P35670-3;P35670-2;P35670	.;.;.;.;.;.;ATP7B_HUMAN	S	27	ENSP00000242839:R27S;ENSP00000383217:R27S;ENSP00000342559:R27S;ENSP00000416738:R27S;ENSP00000383221:R27S;ENSP00000393343:R27S	ENSP00000242839:R27S	R	-	1	0	ATP7B	51447278	0.002000	0.14202	0.001000	0.08648	0.014000	0.08584	1.390000	0.34464	0.763000	0.33175	-0.779000	0.03376	CGT	.		0.428	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
DLK1	8788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	101201136	101201136	+	Missense_Mutation	SNP	A	A	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr14:101201136A>C	ENST00000341267.4	+	5	1297	c.1055A>C	c.(1054-1056)cAg>cCg	p.Q352P	RP11-566J3.4_ENST00000608876.1_lincRNA|DLK1_ENST00000331224.6_Missense_Mutation_p.Q279P	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	352					cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				CTGCTGCTTCAGTACAACAGC	0.567																																					p.Q352P		.											.	.	.	0			c.A1055C						.						105.0	97.0	100.0					14																	101201136		2203	4300	6503	SO:0001583	missense	8788	exon5			TGCTTCAGTACAA	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.1055A>C	14.37:g.101201136A>C	ENSP00000340292:p.Gln352Pro	25	0		17	9	NM_003836	P15803|Q96DW5	Missense_Mutation	SNP	ENST00000341267.4	37	CCDS9963.1	.	.	.	.	.	.	.	.	.	.	A	11.69	1.714389	0.30413	.	.	ENSG00000185559	ENST00000341267;ENST00000331224	D;D	0.87809	-2.3;-2.21	4.61	2.04	0.26737	.	0.715730	0.12062	N	0.503092	T	0.75796	0.3898	N	0.08118	0	0.26840	N	0.968392	P;P	0.47604	0.898;0.734	P;B	0.47075	0.536;0.185	T	0.66324	-0.5952	10	0.35671	T	0.21	.	6.4108	0.21690	0.7405:0.1619:0.0976:0.0	.	279;352	P80370-2;P80370	.;DLK1_HUMAN	P	352;279	ENSP00000340292:Q352P;ENSP00000331081:Q279P	ENSP00000331081:Q279P	Q	+	2	0	DLK1	100270889	0.373000	0.25073	0.997000	0.53966	0.223000	0.24884	1.039000	0.30266	1.718000	0.51419	0.402000	0.26972	CAG	.		0.567	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1		
DMD	1756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	32361350	32361350	+	Nonsense_Mutation	SNP	A	A	T	rs398123993		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chrX:32361350A>T	ENST00000357033.4	-	40	5846	c.5640T>A	c.(5638-5640)taT>taA	p.Y1880*	DMD_ENST00000378677.2_Nonsense_Mutation_p.Y1876*	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1880	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCTTGTACTGATACCACTGAT	0.368																																					p.Y1880X		.											.	.	.	0			c.T5640A						.						114.0	103.0	107.0					X																	32361350		2202	4300	6502	SO:0001587	stop_gained	1756	exon40			GTACTGATACCAC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5640T>A	X.37:g.32361350A>T	ENSP00000354923:p.Tyr1880*	23	0		17	13	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	A	47	13.089895	0.99719	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000493412	.	.	.	6.06	6.06	0.98353	.	0.000000	0.34133	U	0.004233	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	15.4917	0.75611	1.0:0.0:0.0:0.0	.	.	.	.	X	1872;539;536;1876;1880;1880;1757;99	.	ENSP00000354923:Y1880X	Y	-	3	2	DMD	32271271	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.031000	0.64134	2.043000	0.60533	0.481000	0.45027	TAT	.		0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
LRTM2	654429	hgsc.bcm.edu	37	12	1943445	1943445	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr12:1943445A>G	ENST00000543818.1	+	5	1513	c.671A>G	c.(670-672)gAc>gGc	p.D224G	LRTM2_ENST00000299194.1_Missense_Mutation_p.D224G|CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000588077.1_Intron|LRTM2_ENST00000535041.1_Missense_Mutation_p.D224G|CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000585732.1_Intron|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000382722.5_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	224	LRRCT.					integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			GGACGCTTGGACCAGCTTGCC	0.587																																					p.D224G		.											.	.	.	0			c.A671G						.						46.0	44.0	44.0					12																	1943445		2203	4300	6503	SO:0001583	missense	654429	exon5			GCTTGGACCAGCT	AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.671A>G	12.37:g.1943445A>G	ENSP00000446278:p.Asp224Gly	37	0		92	2	NM_001039029	A7E2U6	Missense_Mutation	SNP	ENST00000543818.1	37	CCDS31726.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.519951	0.85495	.	.	ENSG00000166159	ENST00000543818;ENST00000299194;ENST00000535041	T;T;T	0.52295	0.67;0.67;0.67	5.35	5.35	0.76521	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58963	0.2159	L	0.35341	1.055	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.62849	-0.6767	10	0.72032	D	0.01	.	15.3345	0.74241	1.0:0.0:0.0:0.0	.	224	Q8N967	LRTM2_HUMAN	G	224	ENSP00000446278:D224G;ENSP00000299194:D224G;ENSP00000444737:D224G	ENSP00000299194:D224G	D	+	2	0	LRTM2	1813706	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.300000	0.96151	2.021000	0.59480	0.460000	0.39030	GAC	.		0.587	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398055.1		
ADCY10	55811	hgsc.bcm.edu	37	1	167780114	167780114	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:167780114G>T	ENST00000367851.4	-	32	4703	c.4519C>A	c.(4519-4521)Cct>Act	p.P1507T	ADCY10_ENST00000367848.1_Missense_Mutation_p.P1415T|ADCY10_ENST00000545172.1_Missense_Mutation_p.P1354T	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1507					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.P1507T(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CAAAAGACAGGGCCAGTGGTA	0.443																																					p.P1507T		.											ADCY10,NS,carcinoma,0,1	ADCY10	0	1	Substitution - Missense(1)	lung(1)	c.C4519A						.						69.0	69.0	69.0					1																	167780114		2203	4300	6503	SO:0001583	missense	55811	exon32			AGACAGGGCCAGT	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4519C>A	1.37:g.167780114G>T	ENSP00000356825:p.Pro1507Thr	68	0		52	3	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	37	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967818	0.53507	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.37058	1.22;1.24;1.23	5.25	3.32	0.38043	.	0.126999	0.36519	N	0.002558	T	0.37919	0.1021	M	0.65975	2.015	0.33157	D	0.546421	D;D	0.63046	0.992;0.986	P;P	0.57101	0.813;0.655	T	0.45440	-0.9261	9	0.87932	D	0	-3.9266	11.9646	0.53027	0.0:0.3369:0.6631:0.0	.	1415;1507	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	T	1354;1507;1415	ENSP00000441992:P1354T;ENSP00000356825:P1507T;ENSP00000356822:P1415T	ENSP00000356822:P1415T	P	-	1	0	ADCY10	166046738	0.997000	0.39634	0.803000	0.32268	0.860000	0.49131	1.068000	0.30629	0.560000	0.29169	0.561000	0.74099	CCT	.		0.443	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
CCDC141	285025	hgsc.bcm.edu	37	2	179733971	179733971	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr2:179733971G>T	ENST00000420890.2	-	15	2384	c.2267C>A	c.(2266-2268)gCc>gAc	p.A756D	CCDC141_ENST00000295723.5_Missense_Mutation_p.A181D	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	756								p.A181D(1)|p.A756D(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TTTTACAGGGGCTCCTCTGCC	0.363																																					p.A756D		.											CCDC141_ENST00000420890,NS,carcinoma,0,2	CCDC141_ENST00000420890	0	2	Substitution - Missense(2)	lung(2)	c.C2267A						.						106.0	96.0	99.0					2																	179733971		2203	4299	6502	SO:0001583	missense	285025	exon15			ACAGGGGCTCCTC	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2267C>A	2.37:g.179733971G>T	ENSP00000395995:p.Ala756Asp	55	0		42	2	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37		.	.	.	.	.	.	.	.	.	.	G	17.69	3.450656	0.63290	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758	T;T;T;T	0.44482	0.92;1.46;1.45;1.53	5.33	1.45	0.22620	.	0.483230	0.19381	N	0.115647	T	0.38558	0.1045	L	0.27053	0.805	0.27813	N	0.94205	D	0.61697	0.99	P	0.61201	0.885	T	0.26292	-1.0107	10	0.12430	T	0.62	-2.3845	7.2256	0.26014	0.4336:0.0:0.5664:0.0	.	181	Q6ZP82	CC141_HUMAN	D	756;200;181;756	ENSP00000395995:A756D;ENSP00000344627:A200D;ENSP00000295723:A181D;ENSP00000390190:A756D	ENSP00000295723:A181D	A	-	2	0	CCDC141	179442216	0.982000	0.34865	0.996000	0.52242	0.990000	0.78478	1.266000	0.33039	0.308000	0.22923	0.655000	0.94253	GCC	.		0.363	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
FEZ1	9638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	125359627	125359627	+	Missense_Mutation	SNP	C	C	G	rs138856048		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:125359627C>G	ENST00000278919.3	-	2	281	c.47G>C	c.(46-48)cGa>cCa	p.R16P	FEZ1_ENST00000366139.3_Missense_Mutation_p.R16P|FEZ1_ENST00000524435.1_Missense_Mutation_p.R16P	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)	16					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		GCAGGAGGGTCGAAGGTCCTC	0.527																																					p.R16P	Melanoma(180;509 2033 10762 15939 24711)	.											.	.	.	0			c.G47C						.						68.0	71.0	70.0					11																	125359627		2201	4299	6500	SO:0001583	missense	9638	exon2			GAGGGTCGAAGGT	U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886	ENST00000278919.3:c.47G>C	11.37:g.125359627C>G	ENSP00000278919:p.Arg16Pro	35	0		46	22	NM_022549	O00679|O00728|Q6IBI7	Missense_Mutation	SNP	ENST00000278919.3	37	CCDS31716.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.038817	0.93630	.	.	ENSG00000149557	ENST00000278919;ENST00000529053;ENST00000366139;ENST00000524435;ENST00000527534	T	0.33865	1.39	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.48660	0.1512	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.72625	0.978;0.959	T	0.36768	-0.9734	10	0.35671	T	0.21	-3.0637	19.2535	0.93935	0.0:1.0:0.0:0.0	.	16;16	B4DKG5;Q99689	.;FEZ1_HUMAN	P	16	ENSP00000278919:R16P	ENSP00000278919:R16P	R	-	2	0	FEZ1	124864837	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.339000	0.79282	2.646000	0.89796	0.655000	0.94253	CGA	.		0.527	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386875.1	NM_005103	
SP140	11262	hgsc.bcm.edu	37	2	231159016	231159016	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr2:231159016C>T	ENST00000392045.3	+	21	2113	c.1999C>T	c.(1999-2001)Cgt>Tgt	p.R667C	SP140_ENST00000417495.3_Missense_Mutation_p.R553C|SP140_ENST00000350136.5_Missense_Mutation_p.R536C|SP140_ENST00000486687.2_Missense_Mutation_p.R591C|SP140_ENST00000343805.6_Missense_Mutation_p.R607C|SP140_ENST00000420434.3_Missense_Mutation_p.R640C	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	667					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R667C(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TCCAAGAATACGTTACAGGAA	0.368																																					p.R667C		.											SP140_ENST00000392045,NS,carcinoma,0,1	SP140_ENST00000392045	0	1	Substitution - Missense(1)	endometrium(1)	c.C1999T						.						127.0	127.0	127.0					2																	231159016		1868	4103	5971	SO:0001583	missense	11262	exon21			AGAATACGTTACA	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.1999C>T	2.37:g.231159016C>T	ENSP00000375899:p.Arg667Cys	102	0		68	3	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	C	7.043	0.563017	0.13498	.	.	ENSG00000079263	ENST00000486687;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	T;T;T;T;T	0.59083	0.51;0.77;0.57;0.29;0.59	3.19	-1.55	0.08558	SAND domain-like (1);	.	.	.	.	T	0.30386	0.0763	N	0.08118	0	0.09310	N	1	P;P;P;P	0.52577	0.938;0.824;0.954;0.875	B;B;B;B	0.42112	0.376;0.075;0.335;0.092	T	0.18461	-1.0336	9	0.49607	T	0.09	-1.3402	2.6773	0.05084	0.1978:0.2486:0.0:0.5535	.	640;553;607;667	E7EUR5;E7ESH9;E9PFJ6;Q13342	.;.;.;LY10_HUMAN	C	591;536;667;553;607;640	ENSP00000440107:R591C;ENSP00000345846:R536C;ENSP00000375899:R667C;ENSP00000342096:R607C;ENSP00000398210:R640C	ENSP00000342096:R607C	R	+	1	0	SP140	230867260	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.104000	0.15313	-0.329000	0.08527	-1.161000	0.01788	CGT	.		0.368	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
ATM	472	hgsc.bcm.edu	37	11	108218091	108218091	+	Splice_Site	SNP	A	A	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:108218091A>G	ENST00000452508.2	+	60	8859	c.8670A>G	c.(8668-8670)ctA>ctG	p.L2890L	ATM_ENST00000525178.1_3'UTR|C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Splice_Site_p.L2890L|C11orf65_ENST00000526725.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2890	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		L -> V (in T-prolymphocytic leukemia). {ECO:0000269|PubMed:9288106, ECO:0000269|PubMed:9488043}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ATATAGATCTAGGTAAGTAAT	0.308			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.L2890L		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	ATM_ENST00000278616,colon,carcinoma,0,6	ATM_ENST00000278616	0	0			c.A8670G						.						75.0	80.0	78.0					11																	108218091		2201	4297	6498	SO:0001630	splice_region_variant	472	exon59	Familial Cancer Database	AT, Louis-Bar syndrome	AGATCTAGGTAAG	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8671+1A>G	11.37:g.108218091A>G		30	0		37	2	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Silent	SNP	ENST00000452508.2	37	CCDS31669.1																																																																																			.		0.308	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	Silent
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	179983051	179983051	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:179983051C>T	ENST00000367607.3	+	10	1881	c.1463C>T	c.(1462-1464)tCa>tTa	p.S488L		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	488					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CAAAGAAACTCAGAACGTTCG	0.383																																					p.S488L		.											.	.	.	0			c.C1463T						.						65.0	69.0	68.0					1																	179983051		2203	4300	6503	SO:0001583	missense	9857	exon10			GAAACTCAGAACG	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.1463C>T	1.37:g.179983051C>T	ENSP00000356579:p.Ser488Leu	98	0		87	29	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	C	16.69	3.192203	0.58017	.	.	ENSG00000135837	ENST00000367607	D	0.90133	-2.62	5.78	5.78	0.91487	.	0.385118	0.18950	N	0.126717	D	0.89979	0.6872	M	0.69823	2.125	0.53005	D	0.999965	B;B	0.25563	0.104;0.129	B;B	0.21708	0.036;0.033	D	0.86096	0.1553	9	.	.	.	.	17.7934	0.88562	0.0:1.0:0.0:0.0	.	488;488	E7EU22;Q5VT06	.;CE350_HUMAN	L	488	ENSP00000356579:S488L	.	S	+	2	0	CEP350	178249674	1.000000	0.71417	0.988000	0.46212	0.597000	0.36814	2.562000	0.45914	2.729000	0.93468	0.650000	0.86243	TCA	.		0.383	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	7578509	7578509	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:7578509A>G	ENST00000269305.4	-	5	610	c.421T>C	c.(421-423)Tgc>Cgc	p.C141R	TP53_ENST00000420246.2_Missense_Mutation_p.C141R|TP53_ENST00000455263.2_Missense_Mutation_p.C141R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.C141R|TP53_ENST00000413465.2_Missense_Mutation_p.C141R|TP53_ENST00000359597.4_Missense_Mutation_p.C141R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	141	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C141R(13)|p.0?(8)|p.A138_P142delAKTCP(4)|p.N131fs*27(2)|p.C141S(2)|p.C141fs*8(2)|p.L137_W146del10(1)|p.K139fs*4(1)|p.A45_P49delAKTCP(1)|p.C141fs*34(1)|p.C141fs*30(1)|p.C9R(1)|p.A6_P10delAKTCP(1)|p.A138_V143delAKTCPV(1)|p.C48R(1)|p.C141fs*29(1)|p.C141A(1)|p.C141G(1)|p.K139_C141>N(1)|p.K139fs*29(1)|p.T140fs*28(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCACAGGGCAGGTCTTGGCC	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C141R	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,+1,28	TP53_ENST00000545858	+1	47	Substitution - Missense(19)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(4)|Complex - frameshift(1)|Complex - deletion inframe(1)	ovary(11)|large_intestine(7)|breast(7)|central_nervous_system(5)|bone(4)|upper_aerodigestive_tract(2)|stomach(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|prostate(2)|biliary_tract(1)|lung(1)|oesophagus(1)	c.T421C						.						56.0	55.0	56.0					17																	7578509		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CAGGGCAGGTCTT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.421T>C	17.37:g.7578509A>G	ENSP00000269305:p.Cys141Arg	13	0		13	8	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	13.32	2.203306	0.38905	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99820	-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93	5.48	4.41	0.53225	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.046412	0.85682	D	0.000000	D	0.99806	0.9916	M	0.90309	3.105	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.994;1.0;0.999;1.0;1.0	D	0.97577	1.0108	10	0.87932	D	0	-26.1094	9.8103	0.40820	0.918:0.0:0.082:0.0	.	102;141;141;48;141;141;141	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	141;141;141;141;141;141;130;48;9;48;9;141	ENSP00000410739:C141R;ENSP00000352610:C141R;ENSP00000269305:C141R;ENSP00000398846:C141R;ENSP00000391127:C141R;ENSP00000391478:C141R;ENSP00000425104:C9R;ENSP00000423862:C48R;ENSP00000424104:C141R	ENSP00000269305:C141R	C	-	1	0	TP53	7519234	1.000000	0.71417	0.996000	0.52242	0.026000	0.11368	5.164000	0.64954	1.020000	0.39573	-0.256000	0.11100	TGC	.		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
RGS8	85397	hgsc.bcm.edu;bcgsc.ca	37	1	182640815	182640815	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:182640815C>A	ENST00000483095.2	-	0	131				RGS8_ENST00000491420.2_5'UTR|RGS8_ENST00000367557.4_De_novo_Start_OutOfFrame|RGS8_ENST00000367556.1_De_novo_Start_OutOfFrame|RGS8_ENST00000258302.4_Missense_Mutation_p.Q19H			P57771	RGS8_HUMAN	regulator of G-protein signaling 8						positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						TCCTCATGGCCTGAGGGTCTT	0.463																																					p.Q19H	Ovarian(189;1262 3804 41973)	.											.	.	.	0			c.G57T						.						157.0	158.0	158.0					1																	182640815		2203	4300	6503			85397	exon2			CATGGCCTGAGGG	AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.-127G>T	1.37:g.182640815C>A		77	0		59	4	NM_033345	B4DGL9|Q3SYD2	Missense_Mutation	SNP	ENST00000483095.2	37	CCDS41443.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508239	0.44660	.	.	ENSG00000135824	ENST00000258302	T	0.46063	0.88	5.28	4.37	0.52481	.	2.341800	0.03305	U	0.189600	T	0.67258	0.2874	.	.	.	0.80722	D	1	D	0.54397	0.966	D	0.72338	0.977	T	0.34054	-0.9844	9	0.66056	D	0.02	.	10.8879	0.46978	0.0:0.9115:0.0:0.0885	.	19	P57771-2	.	H	19	ENSP00000258302:Q19H	ENSP00000258302:Q19H	Q	-	3	2	RGS8	180907438	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.754000	0.38369	1.222000	0.43521	0.563000	0.77884	CAG	.		0.463	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358979.1	NM_033345	
C19orf26	255057	hgsc.bcm.edu	37	19	1235857	1235857	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:1235857C>T	ENST00000382477.2	-	3	422	c.148G>A	c.(148-150)Gtg>Atg	p.V50M	C19orf26_ENST00000590083.1_Missense_Mutation_p.V56M|AC004221.2_ENST00000592843.1_lincRNA|C19orf26_ENST00000215376.6_Missense_Mutation_p.V50M			Q8N350	DOS_HUMAN	chromosome 19 open reading frame 26	50						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGCCCCCCACGAACAGCGAC	0.677										HNSCC(14;0.022)																											p.V56M		.											.	.	.	0			c.G166A						.						154.0	121.0	132.0					19																	1235857		2203	4300	6503	SO:0001583	missense	255057	exon3			CCCCCACGAACAG	BC028156	CCDS12057.1, CCDS12057.2	19p13.3	2012-10-24			ENSG00000099625	ENSG00000099625			28617	protein-coding gene	gene with protein product	"""downstream of STK11"""					12477932	Standard	NM_152769		Approved	MGC40084, DOS	uc002lrm.3	Q8N350	OTTHUMG00000180141	ENST00000382477.2:c.148G>A	19.37:g.1235857C>T	ENSP00000371917:p.Val50Met	36	0		59	4	NM_152769	O43385	Missense_Mutation	SNP	ENST00000382477.2	37		.	.	.	.	.	.	.	.	.	.	C	13.36	2.212694	0.39102	.	.	ENSG00000099625	ENST00000382477;ENST00000215376	.	.	.	4.31	0.393	0.16294	.	0.677351	0.13524	N	0.381500	T	0.17323	0.0416	N	0.12182	0.205	0.09310	N	1	B	0.26845	0.161	B	0.19148	0.024	T	0.15435	-1.0437	9	0.40728	T	0.16	.	7.028	0.24950	0.0:0.4938:0.0:0.5062	.	50	Q8N350-2	.	M	50	.	ENSP00000215376:V50M	V	-	1	0	C19orf26	1186857	0.031000	0.19500	0.100000	0.21137	0.585000	0.36419	-0.045000	0.12003	0.294000	0.22547	0.561000	0.74099	GTG	.		0.677	C19orf26-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_152769	
NKX2-5	1482	hgsc.bcm.edu	37	5	172659642	172659642	+	Missense_Mutation	SNP	G	G	A	rs371380388		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr5:172659642G>A	ENST00000329198.4	-	2	1178	c.905C>T	c.(904-906)gCg>gTg	p.A302V		NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	302					adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCTCTGAACCGCATTCAAGTC	0.672																																					p.A302V	Esophageal Squamous(72;810 1219 2387 13420 44943)	.											NKX2-5,NS,carcinoma,+1,1	NKX2-5	+1	0			c.C905T						.						35.0	37.0	37.0					5																	172659642		2203	4300	6503	SO:0001583	missense	1482	exon2			TGAACCGCATTCA	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.905C>T	5.37:g.172659642G>A	ENSP00000327758:p.Ala302Val	39	0		35	2	NM_004387	A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	ENST00000329198.4	37	CCDS4387.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018276	0.35606	.	.	ENSG00000183072	ENST00000329198	D	0.90563	-2.69	4.26	4.26	0.50523	.	0.465762	0.18317	N	0.144915	D	0.85513	0.5714	L	0.39898	1.24	0.52099	D	0.99994	B	0.20261	0.043	B	0.17098	0.017	T	0.81634	-0.0844	10	0.35671	T	0.21	.	11.4868	0.50358	0.0872:0.0:0.9128:0.0	.	302	P52952	NKX25_HUMAN	V	302	ENSP00000327758:A302V	ENSP00000327758:A302V	A	-	2	0	NKX2-5	172592248	1.000000	0.71417	0.985000	0.45067	0.778000	0.44026	4.612000	0.61169	2.207000	0.71202	0.542000	0.68232	GCG	.		0.672	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2		
CPD	1362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	28772983	28772983	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:28772983T>C	ENST00000225719.4	+	12	2894	c.2818T>C	c.(2818-2820)Tca>Cca	p.S940P	CPD_ENST00000543464.2_Missense_Mutation_p.S693P	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	940	Carboxypeptidase-like 3.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						CAAAGACTTATCAGAGTTTCT	0.373																																					p.S940P		.											.	.	.	0			c.T2818C						.						83.0	83.0	83.0					17																	28772983		2203	4300	6503	SO:0001583	missense	1362	exon12			GACTTATCAGAGT	U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.2818T>C	17.37:g.28772983T>C	ENSP00000225719:p.Ser940Pro	54	0		43	16	NM_001304	B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Missense_Mutation	SNP	ENST00000225719.4	37	CCDS11257.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.499030	0.44455	.	.	ENSG00000108582	ENST00000225719;ENST00000543464	T;T	0.03358	3.96;3.96	5.33	5.33	0.75918	Peptidase M14, carboxypeptidase A (1);	0.000000	0.85682	D	0.000000	T	0.13500	0.0327	L	0.55834	1.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.07693	-1.0759	10	0.27785	T	0.31	.	14.7845	0.69790	0.0:0.0:0.0:1.0	.	693;940	F5GZH6;O75976	.;CBPD_HUMAN	P	940;693	ENSP00000225719:S940P;ENSP00000444443:S693P	ENSP00000225719:S940P	S	+	1	0	CPD	25797109	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.148000	0.64857	2.157000	0.67596	0.533000	0.62120	TCA	.		0.373	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3	NM_001304	
ZNF441	126068	hgsc.bcm.edu	37	19	11891967	11891967	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:11891967G>T	ENST00000357901.4	+	4	1430	c.1328G>T	c.(1327-1329)gGg>gTg	p.G443V	ZNF441_ENST00000454339.2_Missense_Mutation_p.G376V	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	443					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G443E(1)|p.G376E(1)		central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						ATTCACACTGGGGAGAGACCC	0.388																																					p.G443V		.											ZNF441_ENST00000357901,NS,carcinoma,0,2	ZNF441_ENST00000357901	0	2	Substitution - Missense(2)	lung(2)	c.G1328T						.						43.0	45.0	44.0					19																	11891967		2203	4300	6503	SO:0001583	missense	126068	exon4			ACACTGGGGAGAG	AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.1328G>T	19.37:g.11891967G>T	ENSP00000350576:p.Gly443Val	57	0		33	2	NM_152355		Missense_Mutation	SNP	ENST00000357901.4	37	CCDS12266.2	.	.	.	.	.	.	.	.	.	.	-	18.95	3.732324	0.69189	.	.	ENSG00000197044	ENST00000409902;ENST00000357901;ENST00000454339	T;T	0.23552	1.9;1.9	1.22	1.22	0.21188	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.49440	0.1557	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55224	-0.8174	9	0.72032	D	0.01	.	9.9894	0.41860	0.0:0.0:1.0:0.0	.	443	Q8N8Z8	ZN441_HUMAN	V	399;443;376	ENSP00000350576:G443V;ENSP00000403738:G376V	ENSP00000350576:G443V	G	+	2	0	ZNF441	11752967	0.977000	0.34250	0.016000	0.15963	0.732000	0.41865	2.682000	0.46934	0.968000	0.38212	0.305000	0.20034	GGG	.		0.388	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335273.3	NM_152355	
UBN2	254048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	138978118	138978118	+	Silent	SNP	C	C	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr7:138978118C>G	ENST00000473989.3	+	16	3810	c.3810C>G	c.(3808-3810)ccC>ccG	p.P1270P	UBN2_ENST00000288561.8_Silent_p.P1187P	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	1270						extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						TCCAGTTTCCCTTGGAGATAT	0.498																																					p.P1270P		.											.	.	.	0			c.C3810G						.						109.0	105.0	106.0					7																	138978118		1954	4158	6112	SO:0001819	synonymous_variant	254048	exon16			GTTTCCCTTGGAG	AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.3810C>G	7.37:g.138978118C>G		59	0		50	16	NM_173569	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Silent	SNP	ENST00000473989.3	37	CCDS43655.2																																																																																			.		0.498	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569	
LSR	51599	hgsc.bcm.edu	37	19	35757268	35757268	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:35757268C>T	ENST00000361790.3	+	6	1088	c.929C>T	c.(928-930)gCc>gTc	p.A310V	LSR_ENST00000602122.1_Missense_Mutation_p.A291V|USF2_ENST00000222305.3_5'Flank|AD000684.2_ENST00000602262.1_RNA|LSR_ENST00000354900.3_Missense_Mutation_p.A291V|LSR_ENST00000360798.3_Missense_Mutation_p.A242V|USF2_ENST00000594064.1_5'Flank|USF2_ENST00000595068.1_5'Flank|LSR_ENST00000347609.4_Missense_Mutation_p.A273V|USF2_ENST00000343550.5_5'Flank|LSR_ENST00000427250.1_Missense_Mutation_p.A154V|USF2_ENST00000379134.3_5'Flank	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	310					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)		p.A310V(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ACAGTGTATGCCGCCGGCAAA	0.617																																					p.A310V		.											LSR,NS,carcinoma,0,2	LSR	0	1	Substitution - Missense(1)	lung(1)	c.C929T						.						81.0	82.0	82.0					19																	35757268		2203	4300	6503	SO:0001583	missense	51599	exon6			TGTATGCCGCCGG	AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.929C>T	19.37:g.35757268C>T	ENSP00000354575:p.Ala310Val	41	0		47	2	NM_205834	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Missense_Mutation	SNP	ENST00000361790.3	37	CCDS12450.1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.708858	0.30322	.	.	ENSG00000105699	ENST00000361790;ENST00000354900;ENST00000360798;ENST00000347609;ENST00000427250	T;T;T;T;T	0.64438	0.49;0.64;0.29;0.31;-0.1	3.99	2.78	0.32641	.	0.138581	0.47455	D	0.000227	T	0.40448	0.1117	L	0.44542	1.39	0.28193	N	0.92769	B;B;B;P;B;B	0.35011	0.007;0.004;0.052;0.48;0.031;0.016	B;B;B;B;B;B	0.28465	0.015;0.006;0.022;0.09;0.01;0.01	T	0.28522	-1.0041	10	0.06891	T	0.86	-5.4264	4.5353	0.12026	0.2068:0.6652:0.0:0.1279	.	248;273;291;242;291;310	Q9BT33;Q86X29-2;Q86X29-3;A6NDW3;E9PHD4;Q86X29	.;.;.;.;.;LSR_HUMAN	V	310;291;242;273;154	ENSP00000354575:A310V;ENSP00000346976:A291V;ENSP00000354034:A242V;ENSP00000262627:A273V;ENSP00000394479:A154V	ENSP00000262627:A273V	A	+	2	0	LSR	40449108	0.983000	0.35010	0.413000	0.26509	0.596000	0.36781	0.971000	0.29396	0.705000	0.31890	0.462000	0.41574	GCC	.		0.617	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465513.2	NM_015925	
SPATS2	65244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49918486	49918486	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr12:49918486A>G	ENST00000553127.1	+	14	1646	c.1133A>G	c.(1132-1134)tAt>tGt	p.Y378C	SPATS2_ENST00000552918.1_Missense_Mutation_p.Y378C|SPATS2_ENST00000321898.6_Missense_Mutation_p.Y378C			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	378	Ser-rich.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						AAGAACAGCTATTCGACCAGA	0.443																																					p.Y378C		.											.	.	.	0			c.A1133G						.						173.0	157.0	162.0					12																	49918486		2203	4300	6503	SO:0001583	missense	65244	exon13			ACAGCTATTCGAC	AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.1133A>G	12.37:g.49918486A>G	ENSP00000448228:p.Tyr378Cys	22	0		16	7	NM_023071	A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Missense_Mutation	SNP	ENST00000553127.1	37	CCDS31794.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.999191	0.74818	.	.	ENSG00000123352	ENST00000553127;ENST00000321898;ENST00000552918;ENST00000395063	.	.	.	5.51	5.51	0.81932	.	0.110592	0.64402	D	0.000005	T	0.77678	0.4166	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80294	-0.1443	9	0.87932	D	0	-12.2493	13.8869	0.63714	1.0:0.0:0.0:0.0	.	378	Q86XZ4	SPAS2_HUMAN	C	378	.	ENSP00000326841:Y378C	Y	+	2	0	SPATS2	48204753	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.133000	0.71682	2.231000	0.72958	0.460000	0.39030	TAT	.		0.443	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404023.1	NM_023071	
ABCB8	11194	hgsc.bcm.edu	37	7	150733641	150733641	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr7:150733641G>T	ENST00000297504.6	+	10	1239	c.1173G>T	c.(1171-1173)ttG>ttT	p.L391F	ABCB8_ENST00000498578.1_Missense_Mutation_p.L374F|ABCB8_ENST00000477719.1_Missense_Mutation_p.L374F|ABCB8_ENST00000358849.4_Missense_Mutation_p.L374F|ABCB8_ENST00000477092.1_Missense_Mutation_p.L374F|ABCB8_ENST00000542328.1_Missense_Mutation_p.L286F|ABCB8_ENST00000356058.4_Missense_Mutation_p.L411F			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	391	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	GCATGGTCTTGGGTACCCTAT	0.612																																					p.L374F		.											.,1	.	65	0			c.G1122T						.						109.0	99.0	102.0					7																	150733641		2203	4300	6503	SO:0001583	missense	11194	exon9			GGTCTTGGGTACC	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.1173G>T	7.37:g.150733641G>T	ENSP00000297504:p.Leu391Phe	21	0		48	2	NM_007188	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.21|16.21	3.058602|3.058602	0.55325|0.55325	.|.	.|.	ENSG00000197150|ENSG00000197150	ENST00000491920|ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328;ENST00000498578;ENST00000356058;ENST00000477719;ENST00000477092	.|D;D;D;D;D;D;D	.|0.89875	.|-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	5.17|5.17	2.38|2.38	0.29361|0.29361	.|ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	.|0.000000	.|0.64402	.|D	.|0.000003	D|D	0.93390|0.93390	0.7892|0.7892	M|M	0.82517|0.82517	2.595|2.595	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|0.998;1.0;0.999;0.999;1.0;1.0	.|D;D;D;D;D;D	.|0.91635	.|0.996;0.998;0.998;0.996;0.999;0.999	D|D	0.91717|0.91717	0.5386|0.5386	5|10	.|0.72032	.|D	.|0.01	-2.2446|-2.2446	8.7793|8.7793	0.34781|0.34781	0.2529:0.0:0.7471:0.0|0.2529:0.0:0.7471:0.0	.|.	.|286;374;391;374;374;411	.|G3XAP3;A5D8W3;Q9NUT2;Q9NUT2-2;C9JTY4;E7ENE8	.|.;.;ABCB8_HUMAN;.;.;.	W|F	107|374;357;391;286;374;411;374;374	.|ENSP00000351717:L374F;ENSP00000297504:L391F;ENSP00000438776:L286F;ENSP00000418271:L374F;ENSP00000348353:L411F;ENSP00000419891:L374F;ENSP00000419558:L374F	.|ENSP00000297504:L391F	G|L	+|+	1|3	0|2	ABCB8|ABCB8	150364574|150364574	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.751000|0.751000	0.42716|0.42716	0.918000|0.918000	0.28678|0.28678	0.207000|0.207000	0.20607|0.20607	-0.291000|-0.291000	0.09656|0.09656	GGG|TTG	.		0.612	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188	
NAV3	89795	hgsc.bcm.edu	37	12	78225326	78225326	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr12:78225326C>A	ENST00000397909.2	+	1	258	c.85C>A	c.(85-87)Ctt>Att	p.L29I	NAV3_ENST00000536525.2_Missense_Mutation_p.L29I|NAV3_ENST00000266692.7_Missense_Mutation_p.L29I|NAV3_ENST00000228327.6_Missense_Mutation_p.L29I			Q8IVL0	NAV3_HUMAN	neuron navigator 3	29						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GATACCAAATCTTGGCACTAC	0.463										HNSCC(70;0.22)																											p.L29I		.											NAV3,NS,carcinoma,0,1	NAV3	0	0			c.C85A						.						140.0	135.0	136.0					12																	78225326		1917	4134	6051	SO:0001583	missense	89795	exon1			CCAAATCTTGGCA	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.85C>A	12.37:g.78225326C>A	ENSP00000381007:p.Leu29Ile	32	0		46	2	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	C	16.52	3.145544	0.57044	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.59083	0.29;1.79;1.8;1.79;1.69	5.54	4.65	0.58169	Calponin homology domain (1);	.	.	.	.	T	0.39036	0.1063	N	0.14661	0.345	0.80722	D	1	B;B	0.18741	0.018;0.03	B;B	0.20184	0.012;0.028	T	0.18335	-1.0340	9	0.33141	T	0.24	-4.6124	10.2192	0.43188	0.0:0.7935:0.1349:0.0716	.	29;29	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	I	29	ENSP00000446628:L29I;ENSP00000446132:L29I;ENSP00000381007:L29I;ENSP00000228327:L29I;ENSP00000266692:L29I	ENSP00000228327:L29I	L	+	1	0	NAV3	76749457	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.090000	0.41682	1.352000	0.45808	0.655000	0.94253	CTT	.		0.463	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
ACTC1	70	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	35082738	35082738	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr15:35082738G>A	ENST00000290378.4	-	7	1664	c.1009C>T	c.(1009-1011)Cgt>Tgt	p.R337C	ACTC1_ENST00000557860.1_5'Flank|RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	337					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GAGTATTTACGCTCAGGGGGA	0.483																																					p.R337C		.											.	.	.	0			c.C1009T						.						75.0	79.0	78.0					15																	35082738		2201	4298	6499	SO:0001583	missense	70	exon7			ATTTACGCTCAGG	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.1009C>T	15.37:g.35082738G>A	ENSP00000290378:p.Arg337Cys	61	0		49	24	NM_005159	P04270	Missense_Mutation	SNP	ENST00000290378.4	37	CCDS10041.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.917794	0.33815	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.96365	-3.99	4.77	4.77	0.60923	.	0.000000	0.53938	U	0.000043	D	0.99086	0.9686	H	0.99929	4.97	0.80722	D	1	D	0.65815	0.995	D	0.68483	0.958	D	0.98254	1.0495	10	0.87932	D	0	.	14.1224	0.65198	0.0:0.0:0.8493:0.1506	.	337	P68032	ACTC_HUMAN	C	337;302	ENSP00000290378:R337C	ENSP00000290378:R337C	R	-	1	0	ACTC1	32870030	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.942000	0.63547	2.624000	0.88883	0.563000	0.77884	CGT	.		0.483	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159	
GATA3	2625	hgsc.bcm.edu;bcgsc.ca	37	10	8100409	8100409	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr10:8100409G>T	ENST00000346208.3	+	3	838	c.383G>T	c.(382-384)gGg>gTg	p.G128V	GATA3_ENST00000379328.3_Missense_Mutation_p.G128V|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	128					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GGCTCCCCGGGGCCCCTCTCC	0.721			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																														p.G128V		.		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	.	.	.	0			c.G383T						.						54.0	68.0	63.0					10																	8100409		2203	4299	6502	SO:0001583	missense	2625	exon3			CCCCGGGGCCCCT	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.383G>T	10.37:g.8100409G>T	ENSP00000341619:p.Gly128Val	110	0		106	5	NM_002051	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	37	CCDS7083.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105324	0.77096	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.96554	-4.05;-4.0	5.4	5.4	0.78164	.	0.112559	0.64402	D	0.000017	D	0.95984	0.8692	M	0.73962	2.25	0.80722	D	1	P;B	0.45986	0.87;0.118	B;B	0.41571	0.36;0.098	D	0.96351	0.9258	10	0.59425	D	0.04	-19.9044	19.1817	0.93627	0.0:0.0:1.0:0.0	.	128;128	P23771;P23771-2	GATA3_HUMAN;.	V	128	ENSP00000368632:G128V;ENSP00000341619:G128V	ENSP00000341619:G128V	G	+	2	0	GATA3	8140415	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.014000	0.76380	2.526000	0.85167	0.561000	0.74099	GGG	.		0.721	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295	
MAGED1	9500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	51640334	51640334	+	Nonsense_Mutation	SNP	A	A	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chrX:51640334A>T	ENST00000375722.1	+	5	1705	c.1453A>T	c.(1453-1455)Aag>Tag	p.K485*	MAGED1_ENST00000326587.7_Nonsense_Mutation_p.K485*|MAGED1_ENST00000375695.2_Nonsense_Mutation_p.K541*|MAGED1_ENST00000375772.3_Nonsense_Mutation_p.K485*|MAGED1_ENST00000494718.1_3'UTR			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	485	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CTTGATGCTTAAGGACTACAC	0.423										Multiple Myeloma(10;0.10)																											p.K541X		.											.	.	.	0			c.A1621T						.						97.0	72.0	81.0					X																	51640334		2203	4300	6503	SO:0001587	stop_gained	9500	exon6			ATGCTTAAGGACT	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1453A>T	X.37:g.51640334A>T	ENSP00000364874:p.Lys485*	24	0		16	8	NM_001005333	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Nonsense_Mutation	SNP	ENST00000375722.1	37	CCDS14337.1	.	.	.	.	.	.	.	.	.	.	A	38	7.023926	0.98010	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	.	.	.	3.54	3.54	0.40534	.	0.000000	0.40302	N	0.001129	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7128	0.28688	1.0:0.0:0.0:0.0	.	.	.	.	X	485;485;485;541	.	ENSP00000325333:K485X	K	+	1	0	MAGED1	51657074	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	4.727000	0.61993	1.634000	0.50500	0.350000	0.21858	AAG	.		0.423	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332	
PHYH	5264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	13337503	13337503	+	Missense_Mutation	SNP	G	G	A	rs369205198		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr10:13337503G>A	ENST00000263038.4	-	3	296	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C	PHYH_ENST00000396913.2_De_novo_Start_OutOfFrame|PHYH_ENST00000396920.3_Missense_Mutation_p.R61C	NM_006214.3	NP_006205.1	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase	80					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|isoprenoid metabolic process (GO:0006720)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|electron carrier activity (GO:0009055)|L-ascorbic acid binding (GO:0031418)|metal ion binding (GO:0046872)|phytanoyl-CoA dioxygenase activity (GO:0048244)			NS(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	25		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	TACCGAAAGCGTTGAATATCG	0.348																																					p.R80C		.											.	.	.	0			c.C238T						.	G	,CYS/ARG	0,4402		0,0,2201	81.0	82.0	82.0		,238	3.8	0.0	10		82	1,8599	1.2+/-3.3	0,1,4299	no	utr-5,missense	PHYH	NM_001037537.1,NM_006214.3	,180	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	,benign	,80/339	13337503	1,13001	2201	4300	6501	SO:0001583	missense	5264	exon3			GAAAGCGTTGAAT		CCDS7097.1, CCDS41489.1	10p13	2010-04-27	2006-01-09		ENSG00000107537	ENSG00000107537	1.14.11.18		8940	protein-coding gene	gene with protein product	"""Refsum disease"", ""phytanoyl-CoA dioxygenase"""	602026	"""phytanoyl-CoA hydroxylase (Refsum disease)"", ""phytanoyl-CoA hydroxylase"""			9326939	Standard	XM_005252469		Approved	PAHX, RD, PHYH1	uc001imf.3	O14832	OTTHUMG00000017693	ENST00000263038.4:c.238C>T	10.37:g.13337503G>A	ENSP00000263038:p.Arg80Cys	132	0		150	40	NM_006214	A8MTS8|B1ALH5	Missense_Mutation	SNP	ENST00000263038.4	37	CCDS7097.1	.	.	.	.	.	.	.	.	.	.	G	6.097	0.386147	0.11524	0.0	1.16E-4	ENSG00000107537	ENST00000263038;ENST00000396920;ENST00000479604	D;D;D	0.90324	-2.65;-2.65;-2.65	5.63	3.79	0.43588	.	0.102433	0.64402	D	0.000004	D	0.87454	0.6181	L	0.60455	1.87	0.58432	D	0.999999	B;B	0.28419	0.211;0.125	B;B	0.30572	0.052;0.117	T	0.82979	-0.0188	10	0.46703	T	0.11	-7.6869	8.6893	0.34256	0.2924:0.0:0.7076:0.0	.	61;80	B1ALH6;O14832	.;PAHX_HUMAN	C	80;61;80	ENSP00000263038:R80C;ENSP00000380126:R61C;ENSP00000420117:R80C	ENSP00000263038:R80C	R	-	1	0	PHYH	13377509	0.985000	0.35326	0.008000	0.14137	0.047000	0.14425	1.488000	0.35551	0.750000	0.32877	0.552000	0.68991	CGC	.		0.348	PHYH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046845.2		
UNC13C	440279	hgsc.bcm.edu	37	15	54592537	54592537	+	Missense_Mutation	SNP	C	C	T	rs370227736		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr15:54592537C>T	ENST00000260323.11	+	12	4234	c.4234C>T	c.(4234-4236)Cgt>Tgt	p.R1412C	UNC13C_ENST00000545554.1_Missense_Mutation_p.R1412C|UNC13C_ENST00000537900.1_Missense_Mutation_p.R1410C	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1412					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.R1412C(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ATTTGCTATGCGTTATGGAAT	0.353																																					p.R1412C		.											UNC13C_ENST00000260323,colon,carcinoma,0,2	UNC13C_ENST00000260323	0	2	Substitution - Missense(2)	large_intestine(2)	c.C4234T						.	C	CYS/ARG	0,3684		0,0,1842	100.0	92.0	95.0		4234	5.6	1.0	15		95	1,8251		0,1,4125	no	missense	UNC13C	NM_001080534.1	180	0,1,5967	TT,TC,CC		0.0121,0.0,0.0084	probably-damaging	1412/2215	54592537	1,11935	1842	4126	5968	SO:0001583	missense	440279	exon11			GCTATGCGTTATG	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4234C>T	15.37:g.54592537C>T	ENSP00000260323:p.Arg1412Cys	82	0		65	3	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256026	0.80246	0.0	1.21E-4	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.83075	-1.67;-1.68;-1.67	5.61	5.61	0.85477	.	0.052585	0.64402	D	0.000001	D	0.92011	0.7469	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	D	0.92727	0.6196	10	0.87932	D	0	.	18.6257	0.91336	0.0:1.0:0.0:0.0	.	1412;1412	F5H090;Q8NB66	.;UN13C_HUMAN	C	1412;1412;1410	ENSP00000260323:R1412C;ENSP00000438156:R1412C;ENSP00000442569:R1410C	ENSP00000260323:R1412C	R	+	1	0	UNC13C	52379829	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.110000	0.71535	2.640000	0.89533	0.655000	0.94253	CGT	.		0.353	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
DCAF4L2	138009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	88886183	88886183	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr8:88886183G>A	ENST00000319675.3	-	1	113	c.17C>T	c.(16-18)cCg>cTg	p.P6L		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	6										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GAGCAGTCGCGGTCTTTTGCT	0.512																																					p.P6L		.											DCAF4L2,NS,carcinoma,0,1	DCAF4L2	0	0			c.C17T						.						44.0	44.0	44.0					8																	88886183		2203	4300	6503	SO:0001583	missense	138009	exon1			AGTCGCGGTCTTT	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.17C>T	8.37:g.88886183G>A	ENSP00000316496:p.Pro6Leu	30	0		30	11	NM_152418		Missense_Mutation	SNP	ENST00000319675.3	37	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	G	3.331	-0.136650	0.06711	.	.	ENSG00000176566	ENST00000319675	T	0.57273	0.41	1.39	-2.79	0.05841	.	0.486110	0.21957	N	0.066645	T	0.14141	0.0342	N	0.00760	-1.21	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.16012	-1.0417	10	0.23891	T	0.37	.	2.2198	0.03970	0.5561:0.0:0.2011:0.2428	.	6	Q8NA75	DC4L2_HUMAN	L	6	ENSP00000316496:P6L	ENSP00000316496:P6L	P	-	2	0	DCAF4L2	88955299	0.879000	0.30193	0.001000	0.08648	0.014000	0.08584	0.238000	0.18004	-1.064000	0.03172	-0.518000	0.04402	CCG	.		0.512	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
TECTA	7007	hgsc.bcm.edu	37	11	120979961	120979961	+	Silent	SNP	C	C	T	rs142064539		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:120979961C>T	ENST00000392793.1	+	4	511	c.240C>T	c.(238-240)agC>agT	p.S80S	TECTA_ENST00000264037.2_Silent_p.S80S			O75443	TECTA_HUMAN	tectorin alpha	80					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGCTAGTGAGCCAGTTCACGC	0.463																																					p.S80S		.											TECTA,caecum,carcinoma,0,1	TECTA	0	0			c.C240T						.	C		0,4406		0,0,2203	101.0	91.0	94.0		240	4.4	1.0	11	dbSNP_134	94	2,8596	2.2+/-6.3	0,2,4297	no	coding-synonymous	TECTA	NM_005422.2		0,2,6500	TT,TC,CC		0.0233,0.0,0.0154		80/2156	120979961	2,13002	2203	4299	6502	SO:0001819	synonymous_variant	7007	exon3			AGTGAGCCAGTTC	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.240C>T	11.37:g.120979961C>T		40	0		48	2	NM_005422		Silent	SNP	ENST00000392793.1	37	CCDS8434.1																																																																																			0.000		0.463	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
ETS1	2113	hgsc.bcm.edu	37	11	128350152	128350152	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:128350152G>A	ENST00000319397.6	-	6	1234	c.925C>T	c.(925-927)Cgg>Tgg	p.R309W	ETS1_ENST00000345075.4_Intron|ETS1_ENST00000531611.1_Intron|ETS1_ENST00000392668.4_Missense_Mutation_p.R353W|ETS1_ENST00000526145.2_Intron|ETS1_ENST00000535549.1_Missense_Mutation_p.R93W	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	309					angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		GCACGGTCCCGCACATAGTCC	0.597																																					p.R353W		.											ETS1_ENST00000392668,NS,carcinoma,0,2	ETS1_ENST00000392668	0	0			c.C1057T						.						128.0	107.0	114.0					11																	128350152		2201	4297	6498	SO:0001583	missense	2113	exon8			GGTCCCGCACATA		CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.925C>T	11.37:g.128350152G>A	ENSP00000324578:p.Arg309Trp	32	0		40	2	NM_001143820	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	ENST00000319397.6	37	CCDS8475.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258584	0.80246	.	.	ENSG00000134954	ENST00000535549;ENST00000392668;ENST00000319397	T;T;T	0.14391	2.51;2.51;2.51	5.19	5.19	0.71726	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	L	0.44542	1.39	0.58432	D	0.999995	D;D;D	0.89917	0.998;0.996;1.0	B;P;P	0.58820	0.342;0.753;0.846	T	0.00438	-1.1739	10	0.66056	D	0.02	.	13.6788	0.62472	0.0:0.0:0.8457:0.1543	.	309;93;353	P14921;F5GYX9;Q6N087	ETS1_HUMAN;.;.	W	93;353;309	ENSP00000441430:R93W;ENSP00000376436:R353W;ENSP00000324578:R309W	ENSP00000324578:R309W	R	-	1	2	ETS1	127855362	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.805000	0.69143	2.400000	0.81607	0.650000	0.86243	CGG	.		0.597	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386269.2	NM_005238	
BLK	640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	11412317	11412317	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr8:11412317C>T	ENST00000259089.4	+	7	1130	c.538C>T	c.(538-540)Cgc>Tgc	p.R180C	RP11-148O21.3_ENST00000527922.1_RNA|BLK_ENST00000529894.1_Missense_Mutation_p.R109C|RP11-148O21.6_ENST00000602626.1_lincRNA|RP11-148O21.4_ENST00000528629.1_RNA	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	180	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		CTATAAGATCCGCTGCCTGGA	0.567																																					p.R180C		.											.	.	.	0			c.C538T						.						74.0	70.0	71.0					8																	11412317		2203	4300	6503	SO:0001583	missense	640	exon7			AAGATCCGCTGCC	BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.538C>T	8.37:g.11412317C>T	ENSP00000259089:p.Arg180Cys	46	0		39	16	NM_001715	Q16291|Q96IN1	Missense_Mutation	SNP	ENST00000259089.4	37	CCDS5982.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.341693	0.61073	.	.	ENSG00000136573	ENST00000259089;ENST00000427279;ENST00000529894	D;D	0.89196	-2.48;-2.48	4.57	4.57	0.56435	SH2 motif (5);	0.000000	0.43919	D	0.000511	D	0.94850	0.8336	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95378	0.8470	10	0.87932	D	0	.	11.9079	0.52723	0.1741:0.8259:0.0:0.0	.	180	P51451	BLK_HUMAN	C	180;180;109	ENSP00000259089:R180C;ENSP00000433663:R109C	ENSP00000259089:R180C	R	+	1	0	BLK	11449726	1.000000	0.71417	0.997000	0.53966	0.671000	0.39405	3.594000	0.54008	2.249000	0.74217	0.462000	0.41574	CGC	.		0.567	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207460.1		
PCDHB15	56121	hgsc.bcm.edu	37	5	140627110	140627110	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr5:140627110C>T	ENST00000231173.3	+	1	1964	c.1964C>T	c.(1963-1965)aCc>aTc	p.T655I		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	655	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T655I(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCTCGGCCACCGCCACGCTG	0.706																																					p.T655I		.											PCDHB15,NS,carcinoma,+1,1	PCDHB15	+1	1	Substitution - Missense(1)	liver(1)	c.C1964T						.						35.0	38.0	37.0					5																	140627110		2180	4262	6442	SO:0001583	missense	56121	exon1			CGGCCACCGCCAC	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1964C>T	5.37:g.140627110C>T	ENSP00000231173:p.Thr655Ile	53	0		44	2	NM_018935	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	37	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.238518	0.39598	.	.	ENSG00000113248	ENST00000231173	T	0.56444	0.46	4.58	1.49	0.22878	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.70842	0.3270	M	0.77313	2.365	0.27262	N	0.958601	P	0.46064	0.872	P	0.60609	0.877	T	0.67189	-0.5733	9	0.87932	D	0	.	15.589	0.76510	0.0:0.5695:0.4305:0.0	.	655	Q9Y5E8	PCDBF_HUMAN	I	655	ENSP00000231173:T655I	ENSP00000231173:T655I	T	+	2	0	PCDHB15	140607294	0.209000	0.23505	1.000000	0.80357	0.150000	0.21749	1.032000	0.30178	0.474000	0.27392	-0.332000	0.08345	ACC	.		0.706	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
FAM86DP	692099	hgsc.bcm.edu	37	3	75476590	75476590	+	RNA	SNP	C	C	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr3:75476590C>G	ENST00000459803.1	-	0	766					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		GCTGCAATGACAACATCTGGC	0.592																																					.		.											ENSG00000163612,lower_third,carcinoma,0,1	ENSG00000163612	0	0			.						.																																					692099	.			CAATGACAACATC	BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75476590C>G		70	0		12	3	.		RNA	SNP	ENST00000459803.1	37																																																																																				.		0.592	FAM86DP-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000352425.1	NR_024241	
CADM2	253559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	86010630	86010630	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr3:86010630T>C	ENST00000407528.2	+	7	838	c.776T>C	c.(775-777)gTt>gCt	p.V259A	CADM2_ENST00000405615.2_Missense_Mutation_p.V261A|CADM2_ENST00000383699.3_Missense_Mutation_p.V268A	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	259	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		CCAGAACCTGTTTTGTGGACA	0.343																																					p.V268A		.											.	.	.	0			c.T803C						.						140.0	137.0	138.0					3																	86010630		2203	4300	6503	SO:0001583	missense	253559	exon8			AACCTGTTTTGTG	AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.776T>C	3.37:g.86010630T>C	ENSP00000384575:p.Val259Ala	94	0		41	27	NM_001167675	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	ENST00000407528.2	37	CCDS54614.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.449910	0.84101	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.76578	-1.03;-1.03;-1.03	5.4	5.4	0.78164	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.88127	0.6353	M	0.81112	2.525	0.80722	D	1	D;D;D	0.76494	0.961;0.999;0.999	P;D;D	0.72625	0.774;0.973;0.978	D	0.89480	0.3749	10	0.62326	D	0.03	.	15.7234	0.77732	0.0:0.0:0.0:1.0	.	261;268;259	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	A	268;259;261	ENSP00000373200:V268A;ENSP00000384575:V259A;ENSP00000384193:V261A	ENSP00000373200:V268A	V	+	2	0	CADM2	86093320	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.630000	0.83225	2.162000	0.67917	0.528000	0.53228	GTT	.		0.343	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352822.1	NM_153184	
MME	4311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	154836538	154836538	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr3:154836538G>A	ENST00000460393.1	+	8	778	c.658G>A	c.(658-660)Gac>Aac	p.D220N	MME_ENST00000360490.2_Missense_Mutation_p.D220N|MME_ENST00000492661.1_Missense_Mutation_p.D220N|MME_ENST00000493237.1_Missense_Mutation_p.D220N|MME_ENST00000462745.1_Missense_Mutation_p.D220N	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	220					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	TTTATAGATTGACCAACCTCG	0.284																																					p.D220N		.											.	.	.	0			c.G658A						.						25.0	25.0	25.0					3																	154836538		2183	4289	6472	SO:0001583	missense	4311	exon8			TAGATTGACCAAC		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.658G>A	3.37:g.154836538G>A	ENSP00000418525:p.Asp220Asn	97	0		97	36	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	G	32	5.147394	0.94603	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000481828;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97;-0.97	5.51	5.51	0.81932	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	D	0.89280	0.6670	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91090	0.4906	10	0.87932	D	0	-30.0758	19.0357	0.92976	0.0:0.0:1.0:0.0	.	220	P08473	NEP_HUMAN	N	220	ENSP00000420389:D220N;ENSP00000418525:D220N;ENSP00000420101:D220N;ENSP00000419653:D220N;ENSP00000417079:D220N;ENSP00000353679:D220N	ENSP00000353679:D220N	D	+	1	0	MME	156319232	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	9.390000	0.97246	2.586000	0.87340	0.650000	0.86243	GAC	.		0.284	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
ZNF691	51058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	43317239	43317239	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:43317239A>T	ENST00000372506.1	+	4	950	c.610A>T	c.(610-612)Agc>Tgc	p.S204C	ZNF691_ENST00000372504.1_Missense_Mutation_p.S226C|ZNF691_ENST00000372502.1_Missense_Mutation_p.S226C|ZNF691_ENST00000372507.1_Missense_Mutation_p.S204C|ZNF691_ENST00000397044.3_Missense_Mutation_p.S235C|ZNF691_ENST00000372508.3_Missense_Mutation_p.S204C	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	235						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GTGTGGGAAGAGCTTCAGCAA	0.577																																					p.S235C		.											.	.	.	0			c.A703T						.						84.0	72.0	76.0					1																	43317239		2203	4300	6503	SO:0001583	missense	51058	exon4			GGGAAGAGCTTCA		CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.610A>T	1.37:g.43317239A>T	ENSP00000361584:p.Ser204Cys	12	0		14	4	NM_001242739	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	ENST00000372506.1	37	CCDS476.1	.	.	.	.	.	.	.	.	.	.	A	16.64	3.178925	0.57692	.	.	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000372503;ENST00000372502	T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48	5.31	5.31	0.75309	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000003	T	0.64472	0.2601	L	0.42529	1.33	0.39527	D	0.968604	D;D	0.89917	1.0;1.0	D;D	0.72625	0.978;0.978	T	0.68484	-0.5396	10	0.72032	D	0.01	-27.3103	13.8549	0.63519	1.0:0.0:0.0:0.0	.	235;235	B4DJR7;Q5VV52	.;ZN691_HUMAN	C	204;204;204;235;226;235;226	ENSP00000361586:S204C;ENSP00000361585:S204C;ENSP00000361584:S204C;ENSP00000380237:S235C;ENSP00000361582:S226C;ENSP00000361580:S226C	ENSP00000361580:S226C	S	+	1	0	ZNF691	43089826	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.232000	0.32636	2.313000	0.78055	0.455000	0.32223	AGC	.		0.577	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020192.1	NM_015911	
NF1P1	100419006	hgsc.bcm.edu	37	15	21129136	21129136	+	IGR	SNP	T	T	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr15:21129136T>A								POTEB2 (57493 upstream) : MIR5701-1 (16444 downstream)																							CCCTTCCGATTCTAGGTGGTG	0.383																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	440225	.			TCCGATTCTAGGT																													15.37:g.21129136T>A		65	0		68	45	.		RNA	SNP		37																																																																																				.	0	0.383								
SMARCA5	8467	hgsc.bcm.edu	37	4	144460080	144460080	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr4:144460080C>A	ENST00000283131.3	+	13	2221	c.1759C>A	c.(1759-1761)Ctt>Att	p.L587I		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	587	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					CCAAGTAGATCTTCAGGCTAT	0.393																																					p.L587I		.											SMARCA5,NS,carcinoma,0,1	SMARCA5	0	0			c.C1759A						.						150.0	148.0	149.0					4																	144460080		2203	4300	6503	SO:0001583	missense	8467	exon13			GTAGATCTTCAGG	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.1759C>A	4.37:g.144460080C>A	ENSP00000283131:p.Leu587Ile	40	0		46	2	NM_003601		Missense_Mutation	SNP	ENST00000283131.3	37	CCDS3761.1	.	.	.	.	.	.	.	.	.	.	C	33	5.228192	0.95173	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	T	0.72282	-0.64	5.85	5.85	0.93711	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.80287	0.4595	L	0.46670	1.46	0.80722	D	1	P	0.41080	0.737	P	0.57057	0.812	T	0.79892	-0.1611	10	0.87932	D	0	0.2376	20.1766	0.98178	0.0:1.0:0.0:0.0	.	587	O60264	SMCA5_HUMAN	I	587;530;530	ENSP00000283131:L587I	ENSP00000283131:L587I	L	+	1	0	SMARCA5	144679530	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.993000	0.70616	2.772000	0.95346	0.655000	0.94253	CTT	.		0.393	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
OR5H6	79295	hgsc.bcm.edu	37	3	97983496	97983496	+	Missense_Mutation	SNP	C	C	T	rs398062605|rs74203917|rs145155372	byFrequency	TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr3:97983496C>T	ENST00000383696.2	+	1	409	c.368C>T	c.(367-369)aCt>aTt	p.T123I	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CTTGTAACCACTGTAACCACA	0.383																																					p.T123I		.											.	.	.	0			c.C368T						.						94.0	59.0	70.0					3																	97983496		2193	4234	6427	SO:0001583	missense	79295	exon1			TAACCACTGTAAC	BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.368C>T	3.37:g.97983496C>T	ENSP00000373196:p.Thr123Ile	40	0		61	4	NM_001005479	Q6IF88	Missense_Mutation	SNP	ENST00000383696.2	37	CCDS33800.1	.	.	.	.	.	.	.	.	.	.	-	2.074	-0.412329	0.04799	.	.	ENSG00000230301	ENST00000383696	T	0.00469	7.21	2.19	-0.203	0.13204	GPCR, rhodopsin-like superfamily (1);	0.914442	0.09287	N	0.822835	T	0.00241	0.0007	N	0.11560	0.145	0.09310	N	1	B	0.23591	0.088	B	0.23275	0.045	T	0.37776	-0.9691	10	0.72032	D	0.01	.	4.9951	0.14235	0.0:0.4399:0.3432:0.217	.	123	Q8NGV6	OR5H6_HUMAN	I	123	ENSP00000373196:T123I	ENSP00000373196:T123I	T	+	2	0	OR5H6	99466186	0.000000	0.05858	0.076000	0.20297	0.003000	0.03518	0.098000	0.15189	0.251000	0.21505	-1.188000	0.01700	ACT	.		0.383	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2		
HSH2D	84941	hgsc.bcm.edu	37	19	16268032	16268032	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:16268032C>T	ENST00000253680.6	+	8	1018	c.487C>T	c.(487-489)Cca>Tca	p.P163S	HSH2D_ENST00000397372.4_Missense_Mutation_p.P74S|HSH2D_ENST00000593154.2_Missense_Mutation_p.P163S|HSH2D_ENST00000588246.1_Missense_Mutation_p.P163S			Q96JZ2	HSH2D_HUMAN	hematopoietic SH2 domain containing	163					negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of mitochondrial depolarization (GO:0051902)|positive regulation of signal transduction (GO:0009967)|T cell activation (GO:0042110)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(2)	4						CTCCCCAAAGCCAGTCCTGTG	0.562																																					p.P163S		.											.	.	.	0			c.C487T						.						40.0	43.0	42.0					19																	16268032		1900	4121	6021	SO:0001583	missense	84941	exon8			CCAAAGCCAGTCC	AK027792	CCDS74304.1	19p13.12	2013-02-14				ENSG00000196684		"""SH2 domain containing"""	24920	protein-coding gene	gene with protein product		608349				11700021	Standard	NM_032855		Approved	ALX, HSH2, FLJ14886	uc002ndp.4	Q96JZ2		ENST00000253680.6:c.487C>T	19.37:g.16268032C>T	ENSP00000253680:p.Pro163Ser	70	0		71	4	NM_032855	B5ME72|Q6ZNG7	Missense_Mutation	SNP	ENST00000253680.6	37		.	.	.	.	.	.	.	.	.	.	C	15.60	2.882618	0.51908	.	.	ENSG00000196684	ENST00000397372;ENST00000253680	T	0.50277	0.75	2.59	2.59	0.31030	.	1.396740	0.06345	U	0.708628	T	0.55465	0.1922	L	0.41824	1.3	0.09310	N	1	D;D	0.89917	1.0;0.997	D;P	0.72338	0.977;0.878	T	0.48364	-0.9042	10	0.12103	T	0.63	.	8.8379	0.35123	0.0:1.0:0.0:0.0	.	106;163	Q96JZ2-2;Q96JZ2	.;HSH2D_HUMAN	S	74;163	ENSP00000253680:P163S	ENSP00000253680:P163S	P	+	1	0	HSH2D	16129032	0.000000	0.05858	0.014000	0.15608	0.392000	0.30506	-0.137000	0.10389	1.753000	0.51906	0.491000	0.48974	CCA	.		0.562	HSH2D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032855	
ZNF525	170958	hgsc.bcm.edu;bcgsc.ca	37	19	53879488	53879488	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:53879488T>C	ENST00000491101.1	+	4	362	c.239T>C	c.(238-240)gTa>gCa	p.V80A	ZNF525_ENST00000474037.1_Intron|ZNF525_ENST00000467003.1_Intron|ZNF525_ENST00000475179.1_Intron|ZNF525_ENST00000593918.1_Intron			Q8N782	ZN525_HUMAN	zinc finger protein 525	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						ccaacccccgtaccTAACTAT	0.468																																					.		.											.	.	.	0			.						.																																			SO:0001583	missense	170958	.			CCCCCGTACCTAA	AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000491101.1:c.239T>C	19.37:g.53879488T>C	ENSP00000420476:p.Val80Ala	87	0		87	23	.	Q8TF23	RNA	SNP	ENST00000491101.1	37		.	.	.	.	.	.	.	.	.	.	T	3.078	-0.189601	0.06299	.	.	ENSG00000203326	ENST00000491101	T	0.01516	4.81	0.122	0.122	0.14702	.	.	.	.	.	T	0.01489	0.0048	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.50524	-0.8818	5	0.23891	T	0.37	.	.	.	.	.	.	.	.	A	80	ENSP00000420476:V80A	ENSP00000420476:V80A	V	+	2	0	ZNF525	58571300	0.003000	0.15002	0.020000	0.16555	0.020000	0.10135	0.233000	0.17911	0.166000	0.19597	0.165000	0.16767	GTA	.		0.468	ZNF525-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000350590.1	NR_003699	
RIC1	57589	hgsc.bcm.edu;bcgsc.ca	37	9	5745941	5745941	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr9:5745941C>A	ENST00000414202.2	+	11	1297	c.1106C>A	c.(1105-1107)gCa>gAa	p.A369E	KIAA1432_ENST00000251879.6_Missense_Mutation_p.A369E|KIAA1432_ENST00000449720.2_Missense_Mutation_p.A290E|KIAA1432_ENST00000418622.3_Missense_Mutation_p.A290E|KIAA1432_ENST00000381532.2_Missense_Mutation_p.A290E	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		AGCTGGGGTGCAGAAGGCTAT	0.413																																					p.A369E		.											.	.	.	0			c.C1106A						.						98.0	93.0	95.0					9																	5745941		2203	4300	6503	SO:0001583	missense	57589	exon11			GGGGTGCAGAAGG																												ENST00000414202.2:c.1106C>A	9.37:g.5745941C>A	ENSP00000416696:p.Ala369Glu	63	0		69	4	NM_001206557		Missense_Mutation	SNP	ENST00000414202.2	37	CCDS34982.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.7|20.7	4.038791|4.038791	0.75617|0.75617	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720|ENST00000545641	T;T;T;T;T|.	0.43688|.	0.94;0.94;0.94;0.94;0.94|.	6.17|6.17	6.17|6.17	0.99709|0.99709	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.162637|.	0.53938|.	D|.	0.000044|.	T|.	0.69468|.	0.3114|.	L|L	0.42245|0.42245	1.32|1.32	0.47214|0.47214	D|D	0.99935|0.99935	B;B;B|.	0.33583|.	0.361;0.418;0.302|.	B;B;B|.	0.31101|.	0.058;0.079;0.124|.	T|.	0.61816|.	-0.6985|.	10|.	0.06757|.	T|.	0.87|.	-17.9966|-17.9966	20.4898|20.4898	0.99202|0.99202	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	290;369;369|.	B7ZM67;Q4ADV7;G5E932|.	.;RIC1_HUMAN;.|.	E|X	369;369;290;290;290|297	ENSP00000251879:A369E;ENSP00000416696:A369E;ENSP00000370943:A290E;ENSP00000402240:A290E;ENSP00000398823:A290E|.	ENSP00000251879:A369E|.	A|C	+|+	2|3	0|2	KIAA1432|KIAA1432	5735941|5735941	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	5.308000|5.308000	0.65768|0.65768	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCA|TGC	.		0.413	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
CEP97	79598	hgsc.bcm.edu;bcgsc.ca	37	3	101451412	101451412	+	Silent	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr3:101451412C>A	ENST00000341893.3	+	6	1394	c.642C>A	c.(640-642)atC>atA	p.I214I	CEP97_ENST00000327230.4_Silent_p.I214I|CEP97_ENST00000494050.1_Silent_p.I214I			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	214	LRRCT.				cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						CACCATCCATCCCAGGATTTG	0.423																																					p.I214I		.											.	.	.	0			c.C642A						.						146.0	134.0	138.0					3																	101451412		2203	4300	6503	SO:0001819	synonymous_variant	79598	exon6			ATCCATCCCAGGA	AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.642C>A	3.37:g.101451412C>A		69	0		69	4	NM_024548	B5MDY8|Q8NA71|Q9H5T9	Silent	SNP	ENST00000341893.3	37	CCDS2944.1																																																																																			.		0.423	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2	NM_024548	
LMNB1	4001	hgsc.bcm.edu;bcgsc.ca	37	5	126156635	126156635	+	Silent	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr5:126156635G>T	ENST00000261366.5	+	7	1555	c.1194G>T	c.(1192-1194)gtG>gtT	p.V398V	LMNB1_ENST00000460265.1_3'UTR	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	398	Tail.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		CTTCCCGTGTGACAGTATCCC	0.418																																					p.V398V		.											.	.	.	0			c.G1194T						.						97.0	83.0	88.0					5																	126156635		2203	4300	6503	SO:0001819	synonymous_variant	4001	exon7			CCGTGTGACAGTA	L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.1194G>T	5.37:g.126156635G>T		60	0		54	4	NM_005573	B2R6J6|Q3SYN7|Q96EI6	Silent	SNP	ENST00000261366.5	37	CCDS4140.1																																																																																			.		0.418	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250956.2	NM_005573	
FAM71F2	346653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	128315770	128315770	+	Silent	SNP	T	T	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr7:128315770T>C	ENST00000480462.1	+	2	328	c.222T>C	c.(220-222)tcT>tcC	p.S74S	FAM71F2_ENST00000477515.1_Silent_p.S74S|FAM71F2_ENST00000460349.1_3'UTR|FAM71F2_ENST00000378704.3_Silent_p.S65S			Q6NXP2	F71F2_HUMAN	family with sequence similarity 71, member F2	74										NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(2)	7						GTGAAGGGTCTGCCACCGTGA	0.572																																					p.S74S		.											.	.	.	0			c.T222C						.						58.0	59.0	59.0					7																	128315770		1970	4160	6130	SO:0001819	synonymous_variant	346653	exon2			AGGGTCTGCCACC	BC047310	CCDS47701.1, CCDS47702.1	7q32.1	2009-04-17	2007-11-20	2007-11-20	ENSG00000205085	ENSG00000205085			27998	protein-coding gene	gene with protein product			"""family with sequence similarity 137, member B"""	FAM137B		12477932	Standard	XM_006715964		Approved		uc003vnk.4	Q6NXP2	OTTHUMG00000158275	ENST00000480462.1:c.222T>C	7.37:g.128315770T>C		31	0		40	18	NM_001012454	Q0VGF6|Q0VGF7|Q86X39	Silent	SNP	ENST00000480462.1	37	CCDS47701.1																																																																																			.		0.572	FAM71F2-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350537.1		
CPLX4	339302	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	56963944	56963944	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr18:56963944A>T	ENST00000299721.3	-	3	655	c.469T>A	c.(469-471)Tgt>Agt	p.C157S	CPLX4_ENST00000587244.1_Intron	NM_181654.3	NP_857637.1	Q7Z7G2	CPLX4_HUMAN	complexin 4	157					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter secretion (GO:0046928)	cell junction (GO:0030054)|membrane (GO:0016020)|synapse (GO:0045202)		p.C157R(1)		autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	16		Colorectal(73;0.175)				ATCACGGAACACTTCTGCTCC	0.498																																					p.C157S		.											CPLX4,NS,haematopoietic_neoplasm,0,1	CPLX4	0	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.T469A						.						88.0	80.0	83.0					18																	56963944		2203	4300	6503	SO:0001583	missense	339302	exon3			CGGAACACTTCTG	AY286502	CCDS11973.1	18q21.32	2005-08-02			ENSG00000166569	ENSG00000166569			24330	protein-coding gene	gene with protein product		609586				15911881	Standard	NM_181654		Approved	CPX-IV	uc002lhy.3	Q7Z7G2	OTTHUMG00000132756	ENST00000299721.3:c.469T>A	18.37:g.56963944A>T	ENSP00000299721:p.Cys157Ser	24	0		23	4	NM_181654	F1T0L6	Missense_Mutation	SNP	ENST00000299721.3	37	CCDS11973.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.891663	0.91889	.	.	ENSG00000166569	ENST00000299721	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.78685	0.4322	M	0.74881	2.28	0.80722	D	1	D	0.57899	0.981	D	0.69824	0.966	T	0.81395	-0.0952	9	0.87932	D	0	-12.6254	15.557	0.76203	1.0:0.0:0.0:0.0	.	157	Q7Z7G2	CPLX4_HUMAN	S	157	.	ENSP00000299721:C157S	C	-	1	0	CPLX4	55114924	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.884000	0.92432	2.144000	0.66660	0.459000	0.35465	TGT	.		0.498	CPLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256127.1	NM_181654	
CAPN12	147968	hgsc.bcm.edu	37	19	39234742	39234742	+	Missense_Mutation	SNP	C	C	T	rs565347573		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:39234742C>T	ENST00000328867.4	-	1	372	c.64G>A	c.(64-66)Ggg>Agg	p.G22R	CAPN12_ENST00000601953.1_Intron	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	22					proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			TGCAGGCGCCCGGCTCCGACC	0.647													c|||	1	0.000199681	0.0	0.0	5008	,	,		14036	0.001		0.0	False		,,,				2504	0.0				p.G22R		.											.	.	.	0			c.G64A						.						53.0	52.0	52.0					19																	39234742		2203	4300	6503	SO:0001583	missense	147968	exon1			GGCGCCCGGCTCC	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.64G>A	19.37:g.39234742C>T	ENSP00000331636:p.Gly22Arg	69	0		87	4	NM_144691		Missense_Mutation	SNP	ENST00000328867.4	37	CCDS12519.1	.	.	.	.	.	.	.	.	.	.	c	5.054	0.195574	0.09599	.	.	ENSG00000182472	ENST00000328867	T	0.15487	2.42	4.68	-9.35	0.00633	.	1.206320	0.06059	N	0.658044	T	0.06096	0.0158	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.30707	-0.9969	10	0.15952	T	0.53	.	2.8159	0.05456	0.0996:0.2201:0.3824:0.2979	.	22	Q6ZSI9	CAN12_HUMAN	R	22	ENSP00000331636:G22R	ENSP00000331636:G22R	G	-	1	0	CAPN12	43926582	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	-2.624000	0.00876	-1.616000	0.01572	0.457000	0.33378	GGG	.		0.647	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
PCDHB5	26167	hgsc.bcm.edu	37	5	140517100	140517100	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr5:140517100C>A	ENST00000231134.5	+	1	2301	c.2084C>A	c.(2083-2085)tCg>tAg	p.S695*		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	695					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S695L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCATTGGCCTCGGTGTCGTCG	0.701																																					p.S695X		.											PCDHB5,face,carcinoma,0,1	PCDHB5	0	1	Substitution - Missense(1)	skin(1)	c.C2084A						.						86.0	89.0	88.0					5																	140517100		2203	4298	6501	SO:0001587	stop_gained	26167	exon1			TGGCCTCGGTGTC	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.2084C>A	5.37:g.140517100C>A	ENSP00000231134:p.Ser695*	64	0		46	2	NM_015669	Q549F4|Q9UFU9	Nonsense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	C	36	5.640168	0.96693	.	.	ENSG00000113209	ENST00000231134	.	.	.	4.56	3.65	0.41850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.2987	0.21101	0.0:0.547:0.2976:0.1554	.	.	.	.	X	695	.	ENSP00000231134:S695X	S	+	2	0	PCDHB5	140497284	0.000000	0.05858	0.332000	0.25469	0.053000	0.15095	-0.319000	0.08039	0.990000	0.38787	0.505000	0.49811	TCG	.		0.701	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
ROR1	4919	broad.mit.edu	37	1	64603123	64603123	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:64603123G>A	ENST00000371079.1	+	5	929	c.554G>A	c.(553-555)cGc>cAc	p.R185H	ROR1_ENST00000482426.1_3'UTR|ROR1_ENST00000371080.1_Missense_Mutation_p.R185H|ROR1_ENST00000545203.1_5'UTR|RP11-24J23.2_ENST00000424995.1_RNA	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	185	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						ATTGGCAACCGCACCGTCTAT	0.398																																					p.R185H													.	ROR1	113	0			c.G554A						.						149.0	144.0	146.0					1																	64603123		2203	4300	6503	SO:0001583	missense	4919	exon5			GCAACCGCACCGT	M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.554G>A	1.37:g.64603123G>A	ENSP00000360120:p.Arg185His	61	0		51	3	NM_001083592	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.917359	0.73098	.	.	ENSG00000185483	ENST00000371080;ENST00000371079;ENST00000544776	T;T	0.75938	-0.98;-0.98	6.07	6.07	0.98685	Frizzled domain (2);	0.000000	0.43260	D	0.000584	T	0.61961	0.2389	M	0.63843	1.955	0.80722	D	1	B;B	0.25312	0.123;0.056	B;B	0.21708	0.036;0.018	T	0.61903	-0.6967	10	0.46703	T	0.11	.	13.8057	0.63230	0.0695:0.0:0.9305:0.0	.	185;185	Q01973;Q66K77	ROR1_HUMAN;.	H	185;185;188	ENSP00000360121:R185H;ENSP00000360120:R185H	ENSP00000360120:R185H	R	+	2	0	ROR1	64375711	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.029000	0.88807	2.885000	0.99019	0.655000	0.94253	CGC	.		0.398	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
CHI3L1	1116	broad.mit.edu;bcgsc.ca	37	1	203148988	203148988	+	Silent	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:203148988G>A	ENST00000255409.3	-	9	1037	c.912C>T	c.(910-912)cgC>cgT	p.R304R		NM_001276.2	NP_001267.2	P36222	CH3L1_HUMAN	chitinase 3-like 1 (cartilage glycoprotein-39)	304					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to tumor necrosis factor (GO:0071356)|chitin catabolic process (GO:0006032)|inflammatory response (GO:0006954)|interleukin-8 secretion (GO:0072606)|lung development (GO:0030324)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase B signaling (GO:0051897)|response to interleukin-1 (GO:0070555)|response to interleukin-6 (GO:0070741)|response to mechanical stimulus (GO:0009612)|response to tumor necrosis factor (GO:0034612)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|extracellular matrix structural constituent (GO:0005201)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|skin(1)	18						CTGTGGCTCCGCGGAGGAAGT	0.572																																					p.R304R													CHI3L1,colon,carcinoma,-2,1	CHI3L1	51	0			c.C912T						.						120.0	105.0	110.0					1																	203148988		2203	4300	6503	SO:0001819	synonymous_variant	1116	exon9			GGCTCCGCGGAGG	BC008568	CCDS1435.1	1q32.1	2008-02-05			ENSG00000133048	ENSG00000133048			1932	protein-coding gene	gene with protein product		601525				8245017, 9244440	Standard	NM_001276		Approved	GP39, YKL40	uc001gzi.2	P36222	OTTHUMG00000042122	ENST00000255409.3:c.912C>T	1.37:g.203148988G>A		24	0		19	8	NM_001276	B2R7B0|P30923|Q8IVA4|Q96HI7	Silent	SNP	ENST00000255409.3	37	CCDS1435.1	.	.	.	.	.	.	.	.	.	.	G	7.039	0.562105	0.13498	.	.	ENSG00000133048	ENST00000404436	T	0.05513	3.43	4.73	-9.47	0.00594	.	1.969070	0.02532	N	0.093697	T	0.06416	0.0165	.	.	.	0.39691	D	0.971044	.	.	.	.	.	.	T	0.38243	-0.9670	7	0.54805	T	0.06	0.1062	2.2363	0.04009	0.4308:0.0918:0.0967:0.3808	.	.	.	.	W	73	ENSP00000385350:R73W	ENSP00000385350:R73W	R	-	1	2	CHI3L1	201415611	0.000000	0.05858	0.001000	0.08648	0.829000	0.46940	-4.098000	0.00295	-2.639000	0.00430	0.313000	0.20887	CGG	.		0.572	CHI3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100265.1	NM_001276	
CD81	975	broad.mit.edu	37	11	2416708	2416708	+	Silent	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:2416708C>T	ENST00000263645.5	+	5	673	c.417C>T	c.(415-417)gaC>gaT	p.D139D	CD81_ENST00000524805.1_3'UTR|CD81_ENST00000381036.3_Silent_p.D177D|CD81_ENST00000492627.1_Silent_p.D68D|CD81_ENST00000526072.1_Silent_p.D68D|CD81_ENST00000481687.1_Silent_p.D145D	NM_004356.3	NP_004347.1	P60033	CD81_HUMAN	CD81 molecule	139					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of 1-phosphatidylinositol 4-kinase activity (GO:0043128)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization (GO:0008104)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of immune response (GO:0050776)|viral entry into host cell (GO:0046718)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	MHC class II protein complex binding (GO:0023026)			endometrium(1)|lung(3)|skin(1)	5		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)		TGGATGATGACGCCAACAACG	0.672																																					p.D139D													.	CD81	11	0			c.C417T						.						93.0	86.0	89.0					11																	2416708		2202	4298	6500	SO:0001819	synonymous_variant	975	exon5			TGATGACGCCAAC		CCDS7734.1, CCDS73240.1	11p15.5	2014-09-17	2006-03-28		ENSG00000110651	ENSG00000110651		"""CD molecules"", ""Tetraspanins"""	1701	protein-coding gene	gene with protein product		186845	"""CD81 antigen (target of antiproliferative antibody 1)"""	TAPA1		1650385	Standard	XM_005253260		Approved	TAPA-1, TSPAN28	uc001lwf.1	P60033	OTTHUMG00000009892	ENST00000263645.5:c.417C>T	11.37:g.2416708C>T		39	0		41	3	NM_004356	P18582|Q5U0J6	Silent	SNP	ENST00000263645.5	37	CCDS7734.1	.	.	.	.	.	.	.	.	.	.	C	5.491	0.275600	0.10403	.	.	ENSG00000110651	ENST00000464784	.	.	.	3.63	-7.27	0.01461	.	.	.	.	.	T	0.26484	0.0647	.	.	.	0.32883	D	0.510867	.	.	.	.	.	.	T	0.17806	-1.0357	4	.	.	.	.	1.5265	0.02526	0.4601:0.1224:0.1079:0.3096	.	.	.	.	M	124	.	.	T	+	2	0	CD81	2373284	0.000000	0.05858	0.472000	0.27241	0.660000	0.38997	-7.477000	0.00035	-3.149000	0.00231	-1.028000	0.02416	ACG	.		0.672	CD81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027357.4	NM_004356	
MYEOV	26579	broad.mit.edu	37	11	69063836	69063836	+	Missense_Mutation	SNP	C	C	A	rs147884839		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:69063836C>A	ENST00000308946.3	+	3	1369	c.919C>A	c.(919-921)Ctc>Atc	p.L307I	MYEOV_ENST00000535407.1_Missense_Mutation_p.L249I|MYEOV_ENST00000441339.2_Missense_Mutation_p.L307I	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	307								p.L307I(3)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		cctcctcctcctcatcatcat	0.547																																					p.L307I													MYEOV,NS,haematopoietic_neoplasm,0,3	MYEOV	42	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.C919A						.	C	ILE/LEU	0,4394		0,0,2197	34.0	30.0	32.0		919	-1.5	0.0	11	dbSNP_134	32	2,8576		0,2,4287	yes	missense	MYEOV	NM_138768.2	5	0,2,6484	AA,AC,CC		0.0233,0.0,0.0154	benign	307/314	69063836	2,12970	2197	4289	6486	SO:0001583	missense	26579	exon3			CTCCTCCTCATCA	AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.919C>A	11.37:g.69063836C>A	ENSP00000308330:p.Leu307Ile	20	0		25	3	NM_138768	Q9UGN6|Q9UGN7	Missense_Mutation	SNP	ENST00000308946.3	37	CCDS8190.1	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.613296	0.00835	0.0	2.33E-4	ENSG00000172927	ENST00000441339;ENST00000308946;ENST00000535407	T;T;T	0.25250	1.81;1.81;1.81	0.761	-1.52	0.08637	.	.	.	.	.	T	0.11922	0.0290	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18147	-1.0346	9	0.87932	D	0	.	6.2599	0.20893	0.6536:0.3464:0.0:0.0	.	307	Q96EZ4	MYEOV_HUMAN	I	307;307;249	ENSP00000412482:L307I;ENSP00000308330:L307I;ENSP00000438100:L249I	ENSP00000308330:L307I	L	+	1	0	MYEOV	68820412	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.000000	0.00653	-2.447000	0.00545	-3.020000	0.00074	CTC	C|1.000;A|0.000		0.547	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396548.1		
GABRB3	2562	broad.mit.edu	37	15	26793037	26793037	+	Missense_Mutation	SNP	A	A	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr15:26793037A>C	ENST00000311550.5	-	9	1436	c.1325T>G	c.(1324-1326)cTa>cGa	p.L442R	GABRB3_ENST00000299267.4_Missense_Mutation_p.L442R|GABRB3_ENST00000541819.2_Missense_Mutation_p.L498R|GABRB3_ENST00000400188.3_Missense_Mutation_p.L371R|GABRB3_ENST00000545868.1_Missense_Mutation_p.L357R	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	442					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CACATCGGTTAGATCAGGTAT	0.463																																					p.L442R													.	GABRB3	338	0			c.T1325G						.						115.0	96.0	102.0					15																	26793037		2203	4300	6503	SO:0001583	missense	2562	exon9			TCGGTTAGATCAG		CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.1325T>G	15.37:g.26793037A>C	ENSP00000308725:p.Leu442Arg	27	0		23	3	NM_021912	B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	37	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.854920	0.71719	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868	D;D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02	6.03	6.03	0.97812	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.90779	0.7105	L	0.58354	1.805	0.80722	D	1	D;D;P	0.65815	0.995;0.99;0.789	D;P;B	0.72982	0.979;0.906;0.411	D	0.91528	0.5240	10	0.87932	D	0	.	15.7393	0.77876	1.0:0.0:0.0:0.0	.	498;442;442	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	R	442;498;442;371;357	ENSP00000308725:L442R;ENSP00000442408:L498R;ENSP00000299267:L442R;ENSP00000383049:L371R;ENSP00000439169:L357R	ENSP00000299267:L442R	L	-	2	0	GABRB3	24344130	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	9.204000	0.95041	2.308000	0.77769	0.533000	0.62120	CTA	.		0.463	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2		
WASIR2	100132169	broad.mit.edu	37	16	74629	74629	+	RNA	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr16:74629G>A	ENST00000527434.1	+	0	560				WASIR2_ENST00000329244.5_RNA|Z84812.4_ENST00000568710.1_RNA					WASH and IL9R antisense RNA 2																		acagtcatgcgccatcacgcc	0.547																																					.													.	.	.	0			.						.																																					0	.			TCATGCGCCATCA	BC032901, CR605219		16p13.3	2012-10-12	2012-08-15	2011-04-28	ENSG00000231439	ENSG00000231439		"""Long non-coding RNAs"""	38609	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 286A"", ""WASH and IL9R antisense RNA 2 (non-protein coding)"""	NCRNA00286A		11157797	Standard	XR_243326		Approved				OTTHUMG00000060721		16.37:g.74629G>A		10	0		9	3	.		RNA	SNP	ENST00000527434.1	37																																																																																				.		0.547	WASIR2-001	KNOWN	basic	antisense	antisense	OTTHUMT00000134191.1	XR_078518	
ZNF469	84627	broad.mit.edu	37	16	88500278	88500278	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr16:88500278G>T	ENST00000437464.1	+	2	6316	c.6316G>T	c.(6316-6318)Gac>Tac	p.D2106Y	ZNF469_ENST00000565624.1_Missense_Mutation_p.D2134Y	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2106					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GCCCCGTGAAGACCCACTTAC	0.721																																					p.D2106Y													.	ZNF469	121	0			c.G6316T						.						3.0	5.0	5.0					16																	88500278		632	1508	2140	SO:0001583	missense	84627	exon2			CGTGAAGACCCAC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.6316G>T	16.37:g.88500278G>T	ENSP00000402343:p.Asp2106Tyr	23	0		21	3	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	G	11.28	1.592957	0.28357	.	.	ENSG00000225614	ENST00000437464	T	0.14144	2.53	4.28	1.06	0.20224	.	.	.	.	.	T	0.12305	0.0299	N	0.24115	0.695	0.09310	N	1	D	0.54772	0.968	P	0.50970	0.655	T	0.17228	-1.0376	9	0.72032	D	0.01	.	4.1506	0.10237	0.2269:0.2191:0.554:0.0	.	2106	Q96JG9	ZN469_HUMAN	Y	2106	ENSP00000402343:D2106Y	ENSP00000402343:D2106Y	D	+	1	0	ZNF469	87027779	0.001000	0.12720	0.005000	0.12908	0.030000	0.12068	0.514000	0.22786	0.353000	0.24079	0.561000	0.74099	GAC	.		0.721	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
LRRC48	83450	broad.mit.edu	37	17	17907739	17907739	+	Silent	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:17907739C>T	ENST00000399187.1	+	10	1280	c.1062C>T	c.(1060-1062)tgC>tgT	p.C354C	LRRC48_ENST00000411504.2_Silent_p.C354C|LRRC48_ENST00000313838.8_Silent_p.C354C|LRRC48_ENST00000584166.1_Silent_p.C354C|LRRC48_ENST00000399182.1_Silent_p.C354C	NM_031294.3	NP_112584.3	Q9H069	LRC48_HUMAN	leucine rich repeat containing 48	354						cytoplasm (GO:0005737)				breast(1)|large_intestine(2)|lung(2)|pancreas(1)|urinary_tract(1)	7	all_neural(463;0.228)					TCCTAGAATGCAGTGCTGACA	0.498																																					p.C354C													.	LRRC48	49	0			c.C1062T						.						102.0	103.0	102.0					17																	17907739		2127	4251	6378	SO:0001819	synonymous_variant	83450	exon10			AGAATGCAGTGCT	AK093317	CCDS45622.1, CCDS45623.1	17p11.2	2014-07-18			ENSG00000171962	ENSG00000171962			25384	protein-coding gene	gene with protein product						11997338, 23354437	Standard	NM_001130090		Approved	DKFZP586M1120	uc021trk.1	Q9H069	OTTHUMG00000059355	ENST00000399187.1:c.1062C>T	17.37:g.17907739C>T		54	0		42	3	NM_031294	A8KAE6|Q86SF9|Q86W73|Q8IWG0	Silent	SNP	ENST00000399187.1	37	CCDS45622.1																																																																																			.		0.498	LRRC48-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131945.3	NM_031294	
TRAF4	9618	broad.mit.edu	37	17	27076180	27076180	+	Missense_Mutation	SNP	T	T	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:27076180T>G	ENST00000262395.5	+	7	1127	c.998T>G	c.(997-999)tTc>tGc	p.F333C	TRAF4_ENST00000444415.3_Missense_Mutation_p.F333C|AC010761.9_ENST00000577325.1_RNA|TRAF4_ENST00000262396.6_Intron|AC010761.10_ENST00000579468.1_RNA	NM_004295.3	NP_004286.2	Q9BUZ4	TRAF4_HUMAN	TNF receptor-associated factor 4	333	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein kinase activity (GO:0045860)|regulation of apoptotic process (GO:0042981)|respiratory gaseous exchange (GO:0007585)|respiratory tube development (GO:0030323)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	DNA binding (GO:0003677)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|WW domain binding (GO:0050699)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10	Lung NSC(42;0.01)		Epithelial(11;3.26e-05)|all cancers(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.235)			CTTGAGTGCTTCAGCCCAGCC	0.552																																					p.F333C													.	TRAF4	20	0			c.T998G						.						77.0	74.0	75.0					17																	27076180		2203	4300	6503	SO:0001583	missense	9618	exon7			AGTGCTTCAGCCC	X80200	CCDS11243.1	17q11-q21.3	2013-01-09			ENSG00000076604	ENSG00000076604		"""RING-type (C3HC4) zinc fingers"""	12034	protein-coding gene	gene with protein product		602464				7592751, 7490069	Standard	NM_004295		Approved	CART1, MLN62, RNF83	uc002hcs.3	Q9BUZ4	OTTHUMG00000132677	ENST00000262395.5:c.998T>G	17.37:g.27076180T>G	ENSP00000262395:p.Phe333Cys	41	0		51	3	NM_004295	O75615|Q14848|Q2KJU4|Q2PJN8	Missense_Mutation	SNP	ENST00000262395.5	37	CCDS11243.1	.	.	.	.	.	.	.	.	.	.	T	12.53	1.964241	0.34659	.	.	ENSG00000076604	ENST00000262395;ENST00000444415	T;T	0.44881	0.91;0.91	5.69	5.69	0.88448	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.41026	0.1141	L	0.54965	1.715	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.18398	-1.0338	10	0.36615	T	0.2	.	15.1284	0.72500	0.0:0.0:0.0:1.0	.	333	Q9BUZ4	TRAF4_HUMAN	C	333	ENSP00000262395:F333C;ENSP00000438154:F333C	ENSP00000262395:F333C	F	+	2	0	TRAF4	24100307	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.402000	0.79972	2.161000	0.67846	0.533000	0.62120	TTC	.		0.552	TRAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255944.2	NM_145751	
TLK2	11011	broad.mit.edu	37	17	60598179	60598179	+	Missense_Mutation	SNP	G	G	A	rs200158456		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:60598179G>A	ENST00000326270.9	+	3	395	c.127G>A	c.(127-129)Gga>Aga	p.G43R	TLK2_ENST00000343388.7_Missense_Mutation_p.G43R|TLK2_ENST00000542523.1_Missense_Mutation_p.G43R|TLK2_ENST00000582809.1_5'UTR|TLK2_ENST00000346027.5_Missense_Mutation_p.G43R	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	43					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G43R(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						GTGCAGCGTCGGATCCTTGAG	0.393																																					p.G43R													TLK2_ENST00000346027,NS,carcinoma,0,1	TLK2	223	1	Substitution - Missense(1)	kidney(1)	c.G127A						.						124.0	108.0	114.0					17																	60598179		2203	4300	6503	SO:0001583	missense	11011	exon3			AGCGTCGGATCCT	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.127G>A	17.37:g.60598179G>A	ENSP00000316512:p.Gly43Arg	71	1		83	3	NM_001112707	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	37		.	.	.	.	.	.	.	.	.	.	g	9.101	1.004227	0.19199	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82	5.49	4.53	0.55603	.	0.000000	0.85682	D	0.000000	D	0.91192	0.7225	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.947	D	0.91980	0.5594	10	0.87932	D	0	.	13.6299	0.62189	0.0743:0.0:0.9257:0.0	.	43;43;43	Q86UE8;Q86UE8-3;Q86UE8-2	TLK2_HUMAN;.;.	R	43	ENSP00000275780:G43R;ENSP00000340800:G43R;ENSP00000316512:G43R;ENSP00000442311:G43R	ENSP00000316512:G43R	G	+	1	0	TLK2	57951911	1.000000	0.71417	1.000000	0.80357	0.275000	0.26752	7.789000	0.85783	1.333000	0.45449	-0.186000	0.12905	GGA	.		0.393	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852	
AMZ2P1	201283	broad.mit.edu	37	17	62968690	62968690	+	RNA	SNP	A	A	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:62968690A>G	ENST00000430983.1	-	0	1554					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		AAAATTCCACAAGTCTCTTGG	0.373																																					.													.	.	.	0			.						.																																					0	.			TTCCACAAGTCTC	AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62968690A>G		77	0		95	3	.		RNA	SNP	ENST00000430983.1	37																																																																																				.		0.373	AMZ2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000255102.1	NM_153032	
ZNF536	9745	broad.mit.edu	37	19	30934714	30934714	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr19:30934714C>T	ENST00000355537.3	+	2	392	c.245C>T	c.(244-246)gCg>gTg	p.A82V		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	82					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGTCAGATGGCGCTCCTGGCC	0.677																																					p.A82V													ZNF536,NS,carcinoma,-1,1	ZNF536	424	0			c.C245T						.						26.0	28.0	27.0					19																	30934714		2202	4300	6502	SO:0001583	missense	9745	exon2			AGATGGCGCTCCT		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.245C>T	19.37:g.30934714C>T	ENSP00000347730:p.Ala82Val	55	0		65	5	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864381	0.51482	.	.	ENSG00000198597	ENST00000355537	T	0.10099	2.91	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.25644	0.0624	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.00470	-1.1720	10	0.44086	T	0.13	-23.068	19.7691	0.96356	0.0:1.0:0.0:0.0	.	82;82	A7E228;O15090	.;ZN536_HUMAN	V	82	ENSP00000347730:A82V	ENSP00000347730:A82V	A	+	2	0	ZNF536	35626554	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	7.791000	0.85805	2.689000	0.91719	0.462000	0.41574	GCG	.		0.677	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
SNRNP200	23020	broad.mit.edu	37	2	96961292	96961292	+	Silent	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr2:96961292C>T	ENST00000323853.5	-	14	1853	c.1776G>A	c.(1774-1776)aaG>aaA	p.K592K	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	592	Helicase ATP-binding 1. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TGATGTCCCACTTCTCGGGGG	0.552																																					p.K592K													.	SNRNP200	195	0			c.G1776A						.						112.0	93.0	99.0					2																	96961292		2203	4300	6503	SO:0001819	synonymous_variant	23020	exon14			GTCCCACTTCTCG	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.1776G>A	2.37:g.96961292C>T		15	0		4	2	NM_014014	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Silent	SNP	ENST00000323853.5	37	CCDS2020.1																																																																																			.		0.552	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
NCOA6	23054	broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																					p.Q269Q													NCOA6,NS,carcinoma,0,18	NCOA6	219	15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)	c.G807A						.						64.0	52.0	56.0					20																	33345744		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			CTGCTGCTGTTGT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T		24	2		33	6	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																			.		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
RBM15B	29890	broad.mit.edu;bcgsc.ca	37	3	51430852	51430853	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr3:51430852_51430853delCT	ENST00000323686.4	+	1	2122_2123	c.2022_2023delCT	c.(2020-2025)gactctfs	p.S676fs		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	676	His-rich.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGGCTGCAGACTCTTCCCACGG	0.604																																					p.674_675del													.	RBM15B	47	0			c.2022_2023del						.																																			SO:0001589	frameshift_variant	29890	exon1			TGCAGACTCTTCC	AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.2022_2023delCT	3.37:g.51430854_51430855delCT	ENSP00000313890:p.Ser676fs	22	0		12	5	NM_013286	A4QPG7|Q6QE19|Q9BV96	Frame_Shift_Del	DEL	ENST00000323686.4	37	CCDS33764.1																																																																																			.		0.604	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346489.1	NM_013286	
FBN2	2201	broad.mit.edu	37	5	127624882	127624882	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr5:127624882C>A	ENST00000508053.1	-	58	7548	c.6574G>T	c.(6574-6576)Gga>Tga	p.G2192*	FBN2_ENST00000262464.4_Nonsense_Mutation_p.G2192*			P35556	FBN2_HUMAN	fibrillin 2	2192	EGF-like 36; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CGAAAAGATCCGTCGGTGTTG	0.413																																					p.G2192X													.	FBN2	858	0			c.G6574T						.						161.0	150.0	154.0					5																	127624882		2203	4300	6503	SO:0001587	stop_gained	2201	exon52			AAGATCCGTCGGT	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.6574G>T	5.37:g.127624882C>A	ENSP00000424571:p.Gly2192*	18	0		16	4	NM_001999	B4DU01|Q59ES6	Nonsense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	50	16.752088	0.99871	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	.	.	.	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.3242	0.98691	0.0:1.0:0.0:0.0	.	.	.	.	X	2192	.	ENSP00000262464:G2192X	G	-	1	0	FBN2	127652781	1.000000	0.71417	0.586000	0.28679	0.785000	0.44390	7.706000	0.84615	2.882000	0.98803	0.655000	0.94253	GGA	.		0.413	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.	.	0			.						.																																					0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G		27	0		29	4	.		RNA	SNP	ENST00000425256.1	37																																																																																				T|0.500;G|0.500		0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345921.1	NR_002164	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72664015	72664015	+	RNA	SNP	C	C	G	rs202030378|rs372212945	byFrequency	TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr7:72664015C>G	ENST00000425256.1	-	0	885									GTF2I repeat domain containing 2 pseudogene 1																		ATACCACCCCCGGGGCATGCC	0.507																																					.													.	.	.	0			.						.																																					0	.			CACCCCCGGGGCA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72664015C>G		15	0		11	3	.		RNA	SNP	ENST00000425256.1	37																																																																																				.		0.507	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000345921.1	NR_002164	
PCLO	27445	broad.mit.edu	37	7	82595713	82595713	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr7:82595713C>G	ENST00000333891.9	-	4	3728	c.3391G>C	c.(3391-3393)Gga>Cga	p.G1131R	PCLO_ENST00000423517.2_Missense_Mutation_p.G1131R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCTTTGGGTCCTGATGGTGCA	0.433																																					p.G1131R													.	PCLO	1506	0			c.G3391C						.						122.0	119.0	120.0					7																	82595713		2033	4194	6227	SO:0001583	missense	27445	exon4			TGGGTCCTGATGG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3391G>C	7.37:g.82595713C>G	ENSP00000334319:p.Gly1131Arg	27	0		23	3	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	5.501	0.277386	0.10403	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15834	2.39;2.39	5.59	5.59	0.84812	.	.	.	.	.	T	0.12689	0.0308	L	0.29908	0.895	0.20703	N	0.999866	P;P	0.49090	0.919;0.919	B;B	0.40009	0.246;0.316	T	0.20472	-1.0274	9	0.87932	D	0	.	7.1662	0.25691	0.1438:0.7165:0.0:0.1396	.	1131;1131	Q9Y6V0-5;Q9Y6V0-6	.;.	R	1070;1131;1131	ENSP00000334319:G1131R;ENSP00000388393:G1131R	ENSP00000334319:G1131R	G	-	1	0	PCLO	82433649	0.081000	0.21417	0.743000	0.31040	0.038000	0.13279	1.046000	0.30354	2.763000	0.94921	0.655000	0.94253	GGA	.		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
AASS	10157	broad.mit.edu	37	7	121716630	121716630	+	Silent	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr7:121716630G>T	ENST00000393376.1	-	23	2789	c.2694C>A	c.(2692-2694)ccC>ccA	p.P898P	AASS_ENST00000473553.1_5'UTR|AASS_ENST00000417368.2_Silent_p.P898P			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	898	Saccharopine dehydrogenase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						CCTTTGAAAAGGGCCCCATTA	0.363																																					p.P898P													.	AASS	123	0			c.C2694A						.						102.0	103.0	102.0					7																	121716630		2203	4300	6503	SO:0001819	synonymous_variant	10157	exon24			TGAAAAGGGCCCC	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.2694C>A	7.37:g.121716630G>T		70	0		79	3	NM_005763	O95462	Silent	SNP	ENST00000393376.1	37	CCDS5783.1																																																																																			.		0.363	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
PCDH11X	27328	broad.mit.edu	37	X	91133148	91133148	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chrX:91133148G>A	ENST00000373094.1	+	2	2754	c.1909G>A	c.(1909-1911)Gaa>Aaa	p.E637K	PCDH11X_ENST00000406881.1_Missense_Mutation_p.E637K|PCDH11X_ENST00000373088.1_Missense_Mutation_p.E637K|PCDH11X_ENST00000504220.2_Missense_Mutation_p.E637K|PCDH11X_ENST00000298274.8_Missense_Mutation_p.E637K|PCDH11X_ENST00000395337.2_Missense_Mutation_p.E637K|PCDH11X_ENST00000373097.1_Missense_Mutation_p.E637K|PCDH11X_ENST00000361724.1_Missense_Mutation_p.E637K|PCDH11X_ENST00000361655.2_Missense_Mutation_p.E637K	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	637	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						AGAAAAACAAGAATCTTACAC	0.373																																					p.E637K	NSCLC(38;925 1092 2571 38200 45895)												.	PCDH11X	714	0			c.G1909A						.						32.0	30.0	31.0					X																	91133148		2197	4278	6475	SO:0001583	missense	27328	exon2			AAACAAGAATCTT	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1909G>A	X.37:g.91133148G>A	ENSP00000362186:p.Glu637Lys	96	1		46	31	NM_001168363	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103378	0.56291	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13;0.13;0.13;0.13;0.13	5.35	5.35	0.76521	Cadherin (5);Cadherin-like (1);	0.230367	0.44285	D	0.000463	T	0.51702	0.1690	N	0.04043	-0.29	0.33919	D	0.640638	P;P;P;P;P;P;P;P	0.51933	0.837;0.564;0.936;0.936;0.936;0.949;0.837;0.837	P;P;P;P;P;P;P;P	0.55508	0.458;0.467;0.669;0.669;0.669;0.777;0.458;0.458	T	0.69953	-0.5005	10	0.87932	D	0	.	16.9558	0.86259	0.0:0.0:1.0:0.0	.	637;637;637;637;637;637;637;637	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	K	637	ENSP00000378746:E637K;ENSP00000362186:E637K;ENSP00000362189:E637K;ENSP00000355040:E637K;ENSP00000362180:E637K;ENSP00000423762:E637K;ENSP00000355105:E637K;ENSP00000384758:E637K;ENSP00000298274:E637K	ENSP00000298274:E637K	E	+	1	0	PCDH11X	91019804	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.069000	0.64370	2.212000	0.71576	0.415000	0.27848	GAA	.		0.373	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
RFTN1P1	360015	broad.mit.edu	37	Y	7636011	7636011	+	RNA	DEL	A	A	-	rs60072953		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chrY:7636011delA	ENST00000442584.2	-	0	600									raftlin, lipid raft linker 1 pseudogene 1																		gactccatctaaaaaaaaaaa	0.383																																					.													.	.	.	0			.						.																																					0	.			CCATCTAAAAAAA			Yp11.2	2010-04-09			ENSG00000241916	ENSG00000234795			23971	pseudogene	pseudogene						12815422	Standard	NG_002933		Approved				OTTHUMG00000041013		Y.37:g.7636011delA		5	0		6	2	.		RNA	DEL	ENST00000442584.2	37																																																																																				.		0.383	RFTN1P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000471806.1	NG_002933	
COL6A3	1293	ucsc.edu;bcgsc.ca	37	2	238289918	238289918	+	Missense_Mutation	SNP	G	G	A	rs369379463		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr2:238289918G>A	ENST00000295550.4	-	5	1989	c.1537C>T	c.(1537-1539)Cgg>Tgg	p.R513W	COL6A3_ENST00000353578.4_Missense_Mutation_p.R307W|COL6A3_ENST00000347401.3_Missense_Mutation_p.R312W|COL6A3_ENST00000392004.3_Missense_Mutation_p.R307W|COL6A3_ENST00000346358.4_Missense_Mutation_p.R513W|COL6A3_ENST00000409809.1_Missense_Mutation_p.R307W|COL6A3_ENST00000392003.2_Missense_Mutation_p.R106W|COL6A3_ENST00000472056.1_Missense_Mutation_p.R106W	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	513	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTCATTTTCCGCACAGCGGTT	0.527																																					p.R513W													.	COL6A3	608	0			c.C1537T						.						99.0	109.0	106.0					2																	238289918		2203	4300	6503	SO:0001583	missense	1293	exon5			TTTTCCGCACAGC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.1537C>T	2.37:g.238289918G>A	ENSP00000295550:p.Arg513Trp	20	0		27	4	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.357464	0.41801	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003;ENST00000433762	T;T;T;T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.05	5.5	2.51	0.30379	von Willebrand factor, type A (3);	0.130904	0.32459	N	0.006071	T	0.67608	0.2911	M	0.88181	2.935	0.18873	N	0.999986	D;D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D	0.81914	0.965;0.995;0.93;0.992;0.988;0.965	T	0.63892	-0.6534	10	0.87932	D	0	.	13.631	0.62196	0.0:0.0:0.3563:0.6437	.	513;106;106;307;307;513	E9PCV6;E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;.;CO6A3_HUMAN	W	513;312;307;106;307;513;307;106;513	ENSP00000295550:R513W;ENSP00000315609:R312W;ENSP00000315873:R307W;ENSP00000418285:R106W;ENSP00000386844:R307W;ENSP00000295546:R513W;ENSP00000375861:R307W;ENSP00000375860:R106W;ENSP00000389539:R513W	ENSP00000295550:R513W	R	-	1	2	COL6A3	237954657	0.000000	0.05858	0.438000	0.26821	0.292000	0.27327	0.564000	0.23563	0.654000	0.30846	0.655000	0.94253	CGG	.		0.527	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
ZFYVE19	84936	ucsc.edu	37	15	41099910	41099910	+	Silent	SNP	A	A	G	rs62018606		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr15:41099910A>G	ENST00000355341.4	+	1	624	c.123A>G	c.(121-123)gcA>gcG	p.A41A	ZFYVE19_ENST00000336455.5_Intron|ZFYVE19_ENST00000299173.10_Silent_p.A41A|ZFYVE19_ENST00000570108.1_Intron|ZFYVE19_ENST00000563530.1_3'UTR|DNAJC17_ENST00000220496.4_5'Flank|ZFYVE19_ENST00000564258.1_Intron	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	41					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		Ggggcggggcagggcagggaa	0.716																																					p.A41A													.	ZFYVE19	31	0			c.A123G						.						16.0	22.0	20.0					15																	41099910		1992	4147	6139	SO:0001819	synonymous_variant	84936	exon1			CGGGGCAGGGCAG	AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.123A>G	15.37:g.41099910A>G		12	0		21	7	NM_001077268	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Silent	SNP	ENST00000355341.4	37	CCDS42025.1																																																																																			.		0.716	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418996.1	NM_032850	
SLC16A11	162515	ucsc.edu;bcgsc.ca	37	17	6946310	6946310	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:6946310G>T	ENST00000308009.1	-	2	694	c.357C>A	c.(355-357)ttC>ttA	p.F119L	SLC16A11_ENST00000447225.1_Missense_Mutation_p.F95L	NM_153357.1	NP_699188.1	Q8NCK7	MOT11_HUMAN	solute carrier family 16, member 11	119					lipid metabolic process (GO:0006629)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(2)|ovary(1)|skin(2)	9						CCGAGAAGACGAAGCCCAGCG	0.697																																					p.F119L													.	SLC16A11	25	0			c.C357A						.						22.0	26.0	25.0					17																	6946310		2196	4296	6492	SO:0001583	missense	162515	exon2			GAAGACGAAGCCC	AK074674	CCDS11086.1	17p13.2	2013-07-18	2013-07-18		ENSG00000174326	ENSG00000174326		"""Solute carriers"""	23093	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 11"""	615765	"""solute carrier family 16 (monocarboxylic acid transporters), member 11"""				Standard	NM_153357		Approved	FLJ90193, MCT11	uc002gei.1	Q8NCK7	OTTHUMG00000102087	ENST00000308009.1:c.357C>A	17.37:g.6946310G>T	ENSP00000310490:p.Phe119Leu	47	0		44	4	NM_153357		Missense_Mutation	SNP	ENST00000308009.1	37	CCDS11086.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.607018	0.28623	.	.	ENSG00000174326	ENST00000308009;ENST00000447225	T;T	0.35605	1.3;1.3	5.18	0.763	0.18459	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.116521	0.64402	N	0.000016	T	0.13543	0.0328	N	0.10809	0.05	0.25579	N	0.986811	B	0.06786	0.001	B	0.11329	0.006	T	0.33650	-0.9860	10	0.02654	T	1	.	6.6026	0.22708	0.1713:0.4569:0.3718:0.0	.	119	Q8NCK7	MOT11_HUMAN	L	119;95	ENSP00000310490:F119L;ENSP00000394449:F95L	ENSP00000310490:F119L	F	-	3	2	SLC16A11	6887034	0.023000	0.18921	0.998000	0.56505	0.965000	0.64279	0.057000	0.14279	0.042000	0.15717	0.555000	0.69702	TTC	.		0.697	SLC16A11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219921.1	NM_153357	
CDC42EP4	23580	ucsc.edu	37	17	71282351	71282351	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:71282351G>A	ENST00000335793.3	-	2	683	c.289C>T	c.(289-291)Cgg>Tgg	p.R97W	CDC42EP4_ENST00000439510.2_Intron|CDC42EP4_ENST00000581014.1_Intron			Q9H3Q1	BORG4_HUMAN	CDC42 effector protein (Rho GTPase binding) 4	97					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(7)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			CGCTGCTCCCGCTCCCCCCTG	0.617																																					p.R97W													.	CDC42EP4	19	0			c.C289T						.						46.0	46.0	46.0					17																	71282351		2203	4300	6503	SO:0001583	missense	23580	exon2			GCTCCCGCTCCCC	AB042237	CCDS11695.1	17q24-q25	2008-07-18				ENSG00000179604			17147	protein-coding gene	gene with protein product	"""Cdc42 effector protein 4"", ""binder of Rho GTPases 4"""	605468				11035016, 10490598	Standard	NM_012121		Approved	CEP4, KAIA1777, BORG4, MGC3740, MGC17125	uc002jjo.3	Q9H3Q1		ENST00000335793.3:c.289C>T	17.37:g.71282351G>A	ENSP00000338258:p.Arg97Trp	34	0		41	4	NM_012121	B3KUS7|O95828|Q96FT3	Missense_Mutation	SNP	ENST00000335793.3	37	CCDS11695.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.775871	0.31411	.	.	ENSG00000179604	ENST00000335793	T	0.33438	1.41	4.29	3.3	0.37823	.	0.521995	0.21112	N	0.079968	T	0.36663	0.0975	L	0.57536	1.79	0.80722	D	1	D	0.61697	0.99	P	0.47744	0.556	T	0.29397	-1.0013	10	0.56958	D	0.05	-20.4293	12.9804	0.58559	0.0:0.0:0.8366:0.1634	.	97	Q9H3Q1	BORG4_HUMAN	W	97	ENSP00000338258:R97W	ENSP00000338258:R97W	R	-	1	2	CDC42EP4	68793946	1.000000	0.71417	0.997000	0.53966	0.630000	0.37929	1.730000	0.38125	0.993000	0.38866	0.484000	0.47621	CGG	.		0.617	CDC42EP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441898.1	NM_012121	
CASS4	57091	ucsc.edu	37	20	55033541	55033541	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr20:55033541C>T	ENST00000360314.3	+	7	2324	c.2099C>T	c.(2098-2100)gCg>gTg	p.A700V	CASS4_ENST00000434344.1_Missense_Mutation_p.A263V|AL121914.1_ENST00000390795.2_RNA|CASS4_ENST00000371336.3_Missense_Mutation_p.A700V	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	700					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						AGCCAGCCCGCGGAGATCATC	0.592																																					p.A700V													CASS4,colon,carcinoma,+1,1	CASS4	121	0			c.C2099T						.						70.0	64.0	66.0					20																	55033541		2203	4300	6503	SO:0001583	missense	57091	exon6			AGCCCGCGGAGAT	AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.2099C>T	20.37:g.55033541C>T	ENSP00000353462:p.Ala700Val	34	0		39	4	NM_020356	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	ENST00000360314.3	37	CCDS33492.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913722	0.52439	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.23950	1.88;1.88;1.88	5.9	5.9	0.94986	CAS family, DUF3513 (1);	0.114404	0.64402	D	0.000013	T	0.18635	0.0447	N	0.08118	0	0.40064	D	0.975937	B;B;B	0.32829	0.386;0.02;0.224	B;B;B	0.32980	0.156;0.002;0.076	T	0.13629	-1.0502	10	0.87932	D	0	-26.9255	20.2789	0.98501	0.0:1.0:0.0:0.0	.	646;263;700	B4DII4;Q9NQ75-3;Q9NQ75	.;.;CASS4_HUMAN	V	700;700;263	ENSP00000353462:A700V;ENSP00000360387:A700V;ENSP00000410027:A263V	ENSP00000353462:A700V	A	+	2	0	CASS4	54466948	1.000000	0.71417	0.264000	0.24511	0.002000	0.02628	7.071000	0.76770	2.788000	0.95919	0.650000	0.86243	GCG	.		0.592	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
CNN3	1266	bcgsc.ca	37	1	95364930	95364930	+	Silent	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:95364930G>A	ENST00000370206.4	-	6	1028	c.645C>T	c.(643-645)agC>agT	p.S215S	CNN3_ENST00000487539.1_5'UTR|CNN3_ENST00000545882.1_Silent_p.S174S|CNN3_ENST00000394202.4_Silent_p.S169S|CNN3_ENST00000538964.1_Silent_p.S215S	NM_001839.3	NP_001830.1	Q15417	CNN3_HUMAN	calponin 3, acidic	215					actomyosin structure organization (GO:0031032)|epithelial cell differentiation (GO:0030855)	focal adhesion (GO:0005925)				breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|stomach(1)|urinary_tract(2)	18		all_lung(203;0.00206)|Lung NSC(277;0.00948)		all cancers(265;0.0325)|Epithelial(280;0.0861)		TGCTTACCTGGCTGGCTCCTT	0.363																																					p.S215S													.	CNN3	23	0			c.C645T						.						126.0	118.0	120.0					1																	95364930		2203	4300	6503	SO:0001819	synonymous_variant	1266	exon6			TACCTGGCTGGCT	BC025372	CCDS30775.1, CCDS65592.1, CCDS65593.1	1p22-p21	2010-07-08			ENSG00000117519	ENSG00000117519			2157	protein-coding gene	gene with protein product		602374				8526917	Standard	NM_001839		Approved		uc001dqz.4	Q15417	OTTHUMG00000010783	ENST00000370206.4:c.645C>T	1.37:g.95364930G>A		56	0		64	4	NM_001839	B4DFK6|B4DP09|F8WA86|Q6FHA7	Silent	SNP	ENST00000370206.4	37	CCDS30775.1																																																																																			.		0.363	CNN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029702.2	NM_001839	
RASAL2	9462	bcgsc.ca	37	1	178408564	178408564	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:178408564G>A	ENST00000462775.1	+	4	363	c.238G>A	c.(238-240)Ggg>Agg	p.G80R	RASAL2_ENST00000448150.3_Missense_Mutation_p.G210R|RASAL2_ENST00000367649.3_Missense_Mutation_p.G228R	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	80	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TAGGTCTCGTGGGCTGCCTAA	0.423																																					p.G228R													.	RASAL2	334	0			c.G682A						.						111.0	97.0	102.0					1																	178408564		2203	4300	6503	SO:0001583	missense	9462	exon6			TCTCGTGGGCTGC	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.238G>A	1.37:g.178408564G>A	ENSP00000420558:p.Gly80Arg	60	0		27	3	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	37	CCDS1322.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545854	0.65198	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	T;T;T	0.19532	2.14;2.14;2.15	6.16	6.16	0.99307	Pleckstrin homology domain (1);	0.241638	0.40064	N	0.001197	T	0.37839	0.1018	L	0.44542	1.39	0.58432	D	0.999997	D;P	0.64830	0.994;0.904	P;P	0.57679	0.825;0.648	T	0.01081	-1.1458	10	0.62326	D	0.03	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	80;228	Q9UJF2;F8W755	NGAP_HUMAN;.	R	210;228;80	ENSP00000407768:G210R;ENSP00000356621:G228R;ENSP00000420558:G80R	ENSP00000356621:G228R	G	+	1	0	RASAL2	176675187	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.067000	0.64357	2.937000	0.99478	0.650000	0.86243	GGG	.		0.423	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	
TUBB8P6	200149	bcgsc.ca	37	1	242220951	242220951	+	IGR	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr1:242220951G>A								RNU6-1139P (33595 upstream) : PLD5 (25336 downstream)																							CTGGAGCCGGGCACCCTGGAC	0.652																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			AGCCGGGCACCCT																													1.37:g.242220951G>A		26	0		35	5	.		RNA	SNP		37																																																																																				.	0	0.652								
GPR160	26996	bcgsc.ca	37	3	169802265	169802265	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr3:169802265G>T	ENST00000355897.5	+	4	1113	c.505G>T	c.(505-507)Gct>Tct	p.A169S		NM_014373.2	NP_055188.1	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)	8	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			GGCACAGAATGCTTATTCTCG	0.363																																					p.A169S													.	GPR160	26	0			c.G505T						.						72.0	72.0	72.0					3																	169802265		2203	4300	6503	SO:0001583	missense	26996	exon4			CAGAATGCTTATT	AB083583	CCDS3211.1	3q26.2-q27	2012-08-21			ENSG00000173890	ENSG00000173890		"""GPCR / Class A : Orphans"""	23693	protein-coding gene	gene with protein product						12044878	Standard	NM_014373		Approved	GPCR150, GPCR1	uc003fgi.3	Q9UJ42	OTTHUMG00000158776	ENST00000355897.5:c.505G>T	3.37:g.169802265G>T	ENSP00000348161:p.Ala169Ser	27	0		25	3	NM_014373	D3DNQ2	Missense_Mutation	SNP	ENST00000355897.5	37	CCDS3211.1	.	.	.	.	.	.	.	.	.	.	G	1.854	-0.464335	0.04476	.	.	ENSG00000173890	ENST00000355897	.	.	.	5.96	-0.407	0.12385	GPCR, rhodopsin-like superfamily (1);	1.899140	0.02442	N	0.084647	T	0.15955	0.0384	N	0.08118	0	0.09310	N	1	B	0.23249	0.082	B	0.25140	0.058	T	0.12528	-1.0544	9	0.07482	T	0.82	.	1.3225	0.02119	0.2673:0.1994:0.3716:0.1617	.	169	Q9UJ42	GP160_HUMAN	S	169	.	ENSP00000348161:A169S	A	+	1	0	GPR160	171284959	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.316000	0.08071	0.109000	0.17891	-0.150000	0.13652	GCT	.		0.363	GPR160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352167.1	NM_014373	
TRMT10A	93587	bcgsc.ca	37	4	100477351	100477351	+	Silent	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr4:100477351C>T	ENST00000273962.3	-	5	759	c.447G>A	c.(445-447)caG>caA	p.Q149Q	TRMT10A_ENST00000394877.3_Silent_p.Q149Q|TRMT10A_ENST00000394876.2_Silent_p.Q149Q	NM_152292.4	NP_689505.1	Q8TBZ6	TM10A_HUMAN	tRNA methyltransferase 10 homolog A (S. cerevisiae)	149	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.				magnesium ion homeostasis (GO:0010960)	extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										TCTTTTTCAGCTGGCCTCCGT	0.313																																					p.Q149Q													.	.	.	0			c.G447A						.						157.0	145.0	149.0					4																	100477351		2202	4299	6501	SO:0001819	synonymous_variant	93587	exon5			TTTCAGCTGGCCT	BC028373	CCDS3650.1	4q23	2012-06-28	2012-06-28	2012-06-28	ENSG00000145331	ENSG00000145331			28403	protein-coding gene	gene with protein product			"""RNA (guanine-9-) methyltransferase domain containing 2"""	RG9MTD2		12477932	Standard	NM_152292		Approved	MGC27034, TRM10	uc003hva.4	Q8TBZ6	OTTHUMG00000131025	ENST00000273962.3:c.447G>A	4.37:g.100477351C>T		87	0		84	4	NM_001134666	B2R8X7|Q9Y2T9	Silent	SNP	ENST00000273962.3	37	CCDS3650.1																																																																																			.		0.313	TRMT10A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253668.1	NM_152292	
Unknown	0	bcgsc.ca	37	4	189660032	189660032	+	IGR	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr4:189660032G>T								RNU7-192P (22153 upstream) : RP11-756P10.4 (18800 downstream)																							GAAGTAGGTGGCCTTAGACAT	0.398																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TAGGTGGCCTTAG																													4.37:g.189660032G>T		61	0		31	17	.		RNA	SNP		37																																																																																				.	0	0.398								
SSU72P8	136157	bcgsc.ca	37	7	124116783	124116783	+	IGR	SNP	T	T	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr7:124116783T>G								RP5-921G16.1 (81611 upstream) : RNU6-102P (170989 downstream)																							GACACAGTGGTGGAAGATCTG	0.473																																					.													.	.	.	0			.						.						60.0	58.0	59.0					7																	124116783		1927	4150	6077	SO:0001628	intergenic_variant	136157	.			CAGTGGTGGAAGA																													7.37:g.124116783T>G		92	0		128	6	.		RNA	SNP		37																																																																																				.	0	0.473								
Unknown	0	bcgsc.ca	37	8	73124317	73124317	+	IGR	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr8:73124317G>T								RP11-142A23.1 (9813 upstream) : RNA5SP271 (145645 downstream)																							CTGCAGATGGGCTGCTATTTC	0.378																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			AGATGGGCTGCTA																													8.37:g.73124317G>T		44	0		69	4	.		RNA	SNP		37																																																																																				.	0	0.378								
WDR37	22884	bcgsc.ca	37	10	1170283	1170283	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr10:1170283C>T	ENST00000358220.1	+	12	1373	c.1229C>T	c.(1228-1230)gCc>gTc	p.A410V	WDR37_ENST00000263150.4_Missense_Mutation_p.A410V|WDR37_ENST00000482165.1_3'UTR			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	410										breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		ACGGACTCTGCCATTAACAGG	0.423																																					p.A410V													.	WDR37	52	0			c.C1229T						.						116.0	106.0	109.0					10																	1170283		2203	4300	6503	SO:0001583	missense	22884	exon12			ACTCTGCCATTAA	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.1229C>T	10.37:g.1170283C>T	ENSP00000350954:p.Ala410Val	43	0		61	4	NM_014023	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	37	CCDS7057.1	.	.	.	.	.	.	.	.	.	.	C	33	5.248609	0.95305	.	.	ENSG00000047056	ENST00000358220;ENST00000263150	T;T	0.01359	4.98;4.98	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.06735	0.0172	M	0.73217	2.22	0.80722	D	1	D;D	0.67145	0.97;0.996	P;P	0.60609	0.681;0.877	T	0.55153	-0.8185	10	0.16420	T	0.52	.	19.6953	0.96022	0.0:1.0:0.0:0.0	.	411;410	A8K976;Q9Y2I8	.;WDR37_HUMAN	V	410	ENSP00000350954:A410V;ENSP00000263150:A410V	ENSP00000263150:A410V	A	+	2	0	WDR37	1160283	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.665000	0.83852	2.665000	0.90641	0.591000	0.81541	GCC	.		0.423	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023	
DEAF1	10522	bcgsc.ca	37	11	674557	674557	+	Silent	SNP	G	G	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:674557G>A	ENST00000382409.3	-	10	1966	c.1482C>T	c.(1480-1482)caC>caT	p.H494H	DEAF1_ENST00000338675.6_Silent_p.H405H|RP11-754B17.1_ENST00000527799.1_RNA|DEAF1_ENST00000525904.1_5'UTR	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor	494					anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CTGCGTCAGCGTGGATCTTGG	0.592																																					p.H494H													.	DEAF1	47	0			c.C1482T						.						221.0	169.0	186.0					11																	674557		2203	4300	6503	SO:0001819	synonymous_variant	10522	exon10			GTCAGCGTGGATC	AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.1482C>T	11.37:g.674557G>A		41	0		25	3	NM_021008	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Silent	SNP	ENST00000382409.3	37	CCDS31327.1																																																																																			.		0.592	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383614.3	NM_021008	
TRIM51GP	120824	bcgsc.ca	37	11	49000600	49000600	+	IGR	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:49000600C>A								OR4A47 (489268 upstream) : TRIM49B (49903 downstream)																							TGGAAAAATGCAACCATCTTA	0.393																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	120824	.			AAAATGCAACCAT																													11.37:g.49000600C>A		162	0		68	51	.		RNA	SNP		37																																																																																				.	0	0.393								
RPLP0P2	113157	bcgsc.ca	37	11	61405178	61405178	+	RNA	SNP	T	T	A	rs34791988|rs1143563|rs397937549	byFrequency	TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:61405178T>A	ENST00000496593.1	+	0	1782					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		cttacttctttaaaaaaaaaa	0.299																																					.													.	.	.	0			.						.																																					113157	.			CTTCTTTAAAAAA	BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61405178T>A		107	3		130	7	.		RNA	SNP	ENST00000496593.1	37																																																																																				.		0.299	RPLP0P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000350911.1	NR_002775	
TRIM64DP	727828	bcgsc.ca	37	11	89515303	89515303	+	IGR	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr11:89515303G>T								RP11-313I2.11 (27182 upstream) : TRIM49 (15519 downstream)																							TATCGTTATTGATTCTGATGA	0.438																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	727828	.			GTTATTGATTCTG																													11.37:g.89515303G>T		164	0		156	37	.		RNA	SNP		37																																																																																				.	0	0.438								
OR7E140P	344729	bcgsc.ca	37	12	8568398	8568398	+	IGR	SNP	C	C	T	rs9669230		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr12:8568398C>T								LINC00937 (18999 upstream) : AC092865.2 (10797 downstream)																							AGATAAAAACCAGCCCTTAAT	0.443																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			AAAAACCAGCCCT																													12.37:g.8568398C>T		49	0		43	21	.		RNA	SNP		37																																																																																				.	0	0.443								
Unknown	0	bcgsc.ca	37	15	20467206	20467206	+	IGR	SNP	A	A	G			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr15:20467206A>G								RP11-173D3.1 (114000 upstream) : CHEK2P2 (20790 downstream)																							GTATGTCATCAGCAGTTCCAC	0.582																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GTCATCAGCAGTT																													15.37:g.20467206A>G		82	1		96	17	.		RNA	SNP		37																																																																																				.	0	0.582								
SSTR5-AS1	146336	bcgsc.ca	37	16	1115568	1115568	+	RNA	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr16:1115568G>T	ENST00000569832.1	-	0	1388				RP11-161M6.5_ENST00000564390.1_lincRNA	NR_027242.1				SSTR5 antisense RNA 1																		CCCGGGGCtgggggcaaccga	0.662																																					.													.	.	.	0			.						.																																					146336	.			GGGCTGGGGGCAA	AK056814		16p13.3	2012-10-12	2012-08-15		ENSG00000261713	ENSG00000261713		"""Long non-coding RNAs"""	26502	non-coding RNA	RNA, long non-coding			"""SSTR5 antisense RNA 1 (non-protein coding)"""				Standard	NR_027242		Approved		uc002cko.3		OTTHUMG00000172831		16.37:g.1115568G>T		59	0		62	5	.		RNA	SNP	ENST00000569832.1	37																																																																																				.		0.662	SSTR5-AS1-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000420783.1	NR_02724	
KRTAP2-5P	85343	bcgsc.ca	37	17	39228370	39228370	+	IGR	SNP	G	G	T	rs571171776		TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:39228370G>T								KRTAP2-4 (6239 upstream) : KRTAP4-7 (12088 downstream)																							CAGTCCCTGTGCTGCCCCAGC	0.597																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	85343	.			CCCTGTGCTGCCC																													17.37:g.39228370G>T		26	0		14	3	.		RNA	SNP		37																																																																																				.	0	0.597								
CDC27	996	bcgsc.ca	37	17	45234386	45234386	+	Silent	SNP	G	G	T			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chr17:45234386G>T	ENST00000066544.3	-	7	828	c.735C>A	c.(733-735)gtC>gtA	p.V245V	CDC27_ENST00000527547.1_Silent_p.V245V|CDC27_ENST00000531206.1_Silent_p.V245V|CDC27_ENST00000446365.2_Silent_p.V184V|CDC27_ENST00000528748.1_5'Flank	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	245					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.V245V(9)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTCCCAGTGGGACAGTATCAG	0.358																																					p.V245V													CDC27_ENST00000531206,NS,carcinoma,0,8	CDC27	337	9	Substitution - coding silent(9)	prostate(9)	c.C735A						.						48.0	53.0	51.0					17																	45234386		2196	4292	6488	SO:0001819	synonymous_variant	996	exon7			CAGTGGGACAGTA	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.735C>A	17.37:g.45234386G>T		119	0		98	9	NM_001114091	G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	37	CCDS11509.1																																																																																			.		0.358	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
Unknown	0	bcgsc.ca	37	X	65176467	65176467	+	IGR	SNP	G	G	C			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chrX:65176467G>C								MSN (214676 upstream) : RP6-159A1.3 (43125 downstream)																							GGTGGACCTCGGTAACTATCT	0.542																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GACCTCGGTAACT																													X.37:g.65176467G>C		26	0		19	7	.		RNA	SNP		37																																																																																				.	0	0.542								
HDX	139324	bcgsc.ca	37	X	83581279	83581279	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA2I-01A-32D-A417-09	TCGA-W5-AA2I-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	0d35cc49-75c0-4c1d-8319-d6812d7a5d08	2cb8b919-012e-4f36-9620-0517dd7b02ca	g.chrX:83581279C>A	ENST00000297977.5	-	9	1965	c.1854G>T	c.(1852-1854)gaG>gaT	p.E618D	HDX_ENST00000373177.2_Missense_Mutation_p.E618D|HDX_ENST00000506585.2_Missense_Mutation_p.E560D	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	618						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GAATCTCGAGCTCATTTTCAA	0.328																																					p.E618D	Pancreas(53;231 1169 36156 43751 51139)												.	HDX	124	0			c.G1854T						.						70.0	65.0	67.0					X																	83581279		2202	4299	6501	SO:0001583	missense	139324	exon9			CTCGAGCTCATTT	BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.1854G>T	X.37:g.83581279C>A	ENSP00000297977:p.Glu618Asp	45	0		30	3	NM_144657	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	ENST00000297977.5	37	CCDS35342.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.227899	0.39399	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585	T;T;T	0.44482	0.99;0.92;0.99	5.04	1.25	0.21368	.	0.000000	0.85682	D	0.000000	T	0.27454	0.0674	L	0.32530	0.975	0.29987	N	0.81724	P	0.46784	0.884	B	0.38225	0.268	T	0.20571	-1.0271	10	0.59425	D	0.04	-25.7244	9.1626	0.37032	0.0:0.6228:0.0:0.3772	.	618	Q7Z353	HDX_HUMAN	D	618;560;618	ENSP00000297977:E618D;ENSP00000362272:E560D;ENSP00000423670:E618D	ENSP00000297977:E618D	E	-	3	2	HDX	83467935	0.997000	0.39634	0.998000	0.56505	0.996000	0.88848	0.287000	0.18920	0.071000	0.16664	0.586000	0.80456	GAG	.		0.328	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	NM_144657	
