#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TRIOBP	11078	hgsc.bcm.edu	37	22	38120876	38120876	+	Silent	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr22:38120876C>A	ENST00000406386.3	+	7	2568	c.2313C>A	c.(2311-2313)tcC>tcA	p.S771S		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	771					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TCAGAACATCCTGTACCCGAC	0.567																																					p.S771S		.											.	.	.	0			c.C2313A						.						140.0	150.0	147.0					22																	38120876		1970	4168	6138	SO:0001819	synonymous_variant	11078	exon7			AACATCCTGTACC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.2313C>A	22.37:g.38120876C>A		82	0		82	3	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	CCDS43015.1																																																																																			.		0.567	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
KLHL1	57626	hgsc.bcm.edu	37	13	70456537	70456537	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr13:70456537C>A	ENST00000377844.4	-	5	1864	c.1105G>T	c.(1105-1107)Gtt>Ttt	p.V369F	KLHL1_ENST00000545028.1_Missense_Mutation_p.V176F	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	369					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TCATCAGGAACATTGACATCA	0.423																																					p.V369F		.											KLHL1,right_lower_lobe,carcinoma,0,1	KLHL1	0	0			c.G1105T						.						150.0	124.0	133.0					13																	70456537		2203	4300	6503	SO:0001583	missense	57626	exon5			CAGGAACATTGAC	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1105G>T	13.37:g.70456537C>A	ENSP00000367075:p.Val369Phe	34	0		24	2	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589964	0.86851	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.73575	-0.76;-0.76	4.89	4.89	0.63831	BTB/Kelch-associated (2);	0.000000	0.56097	D	0.000028	D	0.91462	0.7305	H	0.97659	4.05	0.58432	D	0.999998	D;D	0.89917	0.999;1.0	D;D	0.83275	0.993;0.996	D	0.94593	0.7789	10	0.87932	D	0	.	18.3932	0.90490	0.0:1.0:0.0:0.0	.	369;369	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	F	369;176	ENSP00000367075:V369F;ENSP00000439602:V176F	ENSP00000367075:V369F	V	-	1	0	KLHL1	69354538	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	6.051000	0.71072	2.413000	0.81919	0.591000	0.81541	GTT	.		0.423	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
PIWIL1	9271	hgsc.bcm.edu;bcgsc.ca	37	12	130832683	130832683	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr12:130832683G>T	ENST00000245255.3	+	7	961	c.689G>T	c.(688-690)cGa>cTa	p.R230L		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	230					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CAAATTGGACGAAATTATTAT	0.333																																					p.R230L		.											PIWIL1,NS,carcinoma,0,2	PIWIL1	0	0			c.G689T						.						87.0	85.0	86.0					12																	130832683		2203	4300	6503	SO:0001583	missense	9271	exon7			TTGGACGAAATTA	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.689G>T	12.37:g.130832683G>T	ENSP00000245255:p.Arg230Leu	60	0		81	4	NM_004764	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	37	CCDS9268.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.908485	0.92107	.	.	ENSG00000125207	ENST00000245255;ENST00000540672	T;T	0.19806	2.12;2.12	5.76	4.87	0.63330	Argonaute/Dicer protein, PAZ (1);	0.048455	0.85682	D	0.000000	T	0.54711	0.1875	M	0.92026	3.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.66240	-0.5973	10	0.87932	D	0	-13.81	14.0748	0.64882	0.0723:0.0:0.9277:0.0	.	230;230	Q96J94;Q96J94-2	PIWL1_HUMAN;.	L	230;91	ENSP00000245255:R230L;ENSP00000441695:R91L	ENSP00000245255:R230L	R	+	2	0	PIWIL1	129398636	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.564000	0.98151	1.425000	0.47237	0.591000	0.81541	CGA	.		0.333	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1		
TAF3	83860	hgsc.bcm.edu	37	10	8019213	8019213	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr10:8019213G>T	ENST00000344293.5	+	4	2448	c.2242G>T	c.(2242-2244)Gaa>Taa	p.E748*		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	748					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)	p.E748*(1)		NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						GATAAAAGTGGAACCAGTCGC	0.448																																					p.E748X		.											TAF3,NS,carcinoma,0,1	TAF3	0	1	Substitution - Nonsense(1)	lung(1)	c.G2242T						.						77.0	78.0	77.0					10																	8019213		1854	4109	5963	SO:0001587	stop_gained	83860	exon4			AAAGTGGAACCAG	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.2242G>T	10.37:g.8019213G>T	ENSP00000340271:p.Glu748*	65	0		56	3	NM_031923	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Nonsense_Mutation	SNP	ENST00000344293.5	37	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	G	41	8.580851	0.98872	.	.	ENSG00000165632	ENST00000344293	.	.	.	6.05	6.05	0.98169	.	0.167695	0.40064	N	0.001187	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-32.8701	20.6087	0.99469	0.0:0.0:1.0:0.0	.	.	.	.	X	748	.	ENSP00000340271:E748X	E	+	1	0	TAF3	8059219	1.000000	0.71417	0.999000	0.59377	0.555000	0.35460	5.659000	0.68010	2.866000	0.98385	0.650000	0.86243	GAA	.		0.448	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046725.1	NM_031923	
LNP1	348801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	100170610	100170610	+	Silent	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:100170610G>A	ENST00000383693.3	+	3	1484	c.204G>A	c.(202-204)agG>agA	p.R68R	LNP1_ENST00000489752.1_Silent_p.R81R	NM_001085451.1	NP_001078920.1	A1A4G5	LNP1_HUMAN	leukemia NUP98 fusion partner 1	68										cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	6						ATCCTAGAAGGCATTCTCATG	0.428																																					p.R68R		.											.	.	.	0			c.G204A						.						95.0	86.0	89.0					3																	100170610		1874	4103	5977	SO:0001819	synonymous_variant	348801	exon3			TAGAAGGCATTCT		CCDS43120.1	3q12.2	2014-05-12			ENSG00000206535	ENSG00000206535			28014	protein-coding gene	gene with protein product						16467868	Standard	NM_001085451		Approved	NP3	uc003dtx.4	A1A4G5	OTTHUMG00000159082	ENST00000383693.3:c.204G>A	3.37:g.100170610G>A		54	0		39	4	NM_001085451	B7ZLT3	Silent	SNP	ENST00000383693.3	37	CCDS43120.1																																																																																			.		0.428	LNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353232.1		
PDE3B	5140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	14666369	14666369	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr11:14666369G>T	ENST00000282096.4	+	1	1101	c.748G>T	c.(748-750)Ggc>Tgc	p.G250C	PDE3B_ENST00000534317.1_3'UTR|PSMA1_ENST00000418988.2_5'Flank|PDE3B_ENST00000455098.2_Missense_Mutation_p.G250C	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	250					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	GCTGCTCTCCGGCCTGGTGGG	0.672																																					p.G250C		.											.	.	.	0			c.G748T						.						14.0	17.0	16.0					11																	14666369		2194	4286	6480	SO:0001583	missense	5140	exon1			CTCTCCGGCCTGG	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.748G>T	11.37:g.14666369G>T	ENSP00000282096:p.Gly250Cys	35	0		23	6	NM_000922	B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	ENST00000282096.4	37	CCDS7817.1	.	.	.	.	.	.	.	.	.	.	G	3.872	-0.027646	0.07589	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.59772	0.24;0.24	4.73	3.6	0.41247	.	7739.210000	0.00166	N	0.000000	T	0.35480	0.0933	N	0.01267	-0.92	0.34305	D	0.68479	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.0;0.0;0.002	T	0.23547	-1.0185	10	0.51188	T	0.08	.	10.6027	0.45375	0.0:0.0:0.3491:0.6509	.	250;250;250	B7ZM37;Q13370;A7E2E5	.;PDE3B_HUMAN;.	C	250	ENSP00000282096:G250C;ENSP00000388644:G250C	ENSP00000282096:G250C	G	+	1	0	PDE3B	14622945	0.999000	0.42202	0.998000	0.56505	0.987000	0.75469	1.874000	0.39568	0.674000	0.31244	-0.474000	0.04947	GGC	.		0.672	PDE3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386974.1	NM_000922	
ZNF648	127665	hgsc.bcm.edu	37	1	182025729	182025729	+	Missense_Mutation	SNP	C	C	T	rs546993253	byFrequency	TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr1:182025729C>T	ENST00000339948.3	-	2	1624	c.1417G>A	c.(1417-1419)Gag>Aag	p.E473K		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						AAGGGCCTCTCGCCAGTGTGG	0.667													C|||	2	0.000399361	0.0	0.0	5008	,	,		19534	0.0		0.0	False		,,,				2504	0.002				p.E473K	NSCLC(71;908 1374 5429 20458 35642)	.											ZNF648,right_upper_lobe,carcinoma,0,1	ZNF648	0	0			c.G1417A						.						38.0	35.0	36.0					1																	182025729		2202	4300	6502	SO:0001583	missense	127665	exon2			GCCTCTCGCCAGT	AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1417G>A	1.37:g.182025729C>T	ENSP00000344129:p.Glu473Lys	21	0		14	2	NM_001009992	B2RP16	Missense_Mutation	SNP	ENST00000339948.3	37	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.706565	0.68615	.	.	ENSG00000179930	ENST00000339948	T	0.24350	1.86	2.77	1.85	0.25348	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22898	0.0553	L	0.61218	1.895	0.40962	D	0.984637	P	0.51791	0.948	B	0.41646	0.362	T	0.09640	-1.0665	9	0.87932	D	0	.	4.7543	0.13075	0.0:0.7077:0.0:0.2923	.	473	Q5T619	ZN648_HUMAN	K	473	ENSP00000344129:E473K	ENSP00000344129:E473K	E	-	1	0	ZNF648	180292352	0.977000	0.34250	0.998000	0.56505	0.996000	0.88848	2.386000	0.44380	0.716000	0.32124	0.655000	0.94253	GAG	.		0.667	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
PRKCI	5584	hgsc.bcm.edu;bcgsc.ca	37	3	169999040	169999040	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:169999040G>T	ENST00000295797.4	+	10	1274	c.969G>T	c.(967-969)caG>caT	p.Q323H		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	323	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	CTTGCTTTCAGACAGAAAGCA	0.383																																					p.Q323H		.											.	.	.	0			c.G969T						.						114.0	104.0	107.0					3																	169999040		2203	4300	6503	SO:0001583	missense	5584	exon10			CTTTCAGACAGAA		CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.969G>T	3.37:g.169999040G>T	ENSP00000295797:p.Gln323His	49	0		68	4	NM_002740	D3DNQ4|Q8WW06	Missense_Mutation	SNP	ENST00000295797.4	37	CCDS3212.2	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224964	0.79576	.	.	ENSG00000163558	ENST00000295797	T	0.66280	-0.2	5.77	3.68	0.42216	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70996	0.3288	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67757	-0.5588	9	.	.	.	.	10.3893	0.44158	0.1859:0.0:0.8141:0.0	.	323	P41743	KPCI_HUMAN	H	323	ENSP00000295797:Q323H	.	Q	+	3	2	PRKCI	171481734	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.598000	0.61069	0.653000	0.30826	0.655000	0.94253	CAG	.		0.383	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316866.3	NM_002740	
ZC2HC1A	51101	hgsc.bcm.edu;bcgsc.ca	37	8	79590817	79590817	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr8:79590817G>T	ENST00000263849.4	+	3	215	c.113G>T	c.(112-114)tGc>tTc	p.C38F	ZC2HC1A_ENST00000521176.1_3'UTR	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	38							metal ion binding (GO:0046872)										GGACCCATTTGCCAGAAGACT	0.373																																					p.C38F		.											.	.	.	0			c.G113T						.						118.0	127.0	124.0					8																	79590817		2203	4300	6503	SO:0001583	missense	51101	exon3			CCATTTGCCAGAA		CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.113G>T	8.37:g.79590817G>T	ENSP00000263849:p.Cys38Phe	93	0		82	4	NM_016010	Q9Y372	Missense_Mutation	SNP	ENST00000263849.4	37	CCDS6223.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.416046	0.83449	.	.	ENSG00000104427	ENST00000263849	D	0.99960	-9.1	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.99967	0.9988	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96489	0.9362	9	.	.	.	-8.9169	19.8459	0.96707	0.0:0.0:1.0:0.0	.	38	Q96GY0	F164A_HUMAN	F	38	ENSP00000263849:C38F	.	C	+	2	0	FAM164A	79753372	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.144000	0.94629	2.788000	0.95919	0.585000	0.79938	TGC	.		0.373	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379423.2	NM_016010	
FLRT3	23767	hgsc.bcm.edu	37	20	14307246	14307246	+	Missense_Mutation	SNP	G	G	T	rs150799973		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr20:14307246G>T	ENST00000378053.3	-	2	1163	c.907C>A	c.(907-909)Cgc>Agc	p.R303S	FLRT3_ENST00000462077.1_5'Flank|MACROD2_ENST00000217246.4_Intron|MACROD2_ENST00000310348.4_Intron|FLRT3_ENST00000341420.4_Missense_Mutation_p.R303S	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	303					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.R303C(1)		breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		GGATTGTTGCGAAGAATCAGT	0.438																																					p.R303S		.											FLRT3,colon,carcinoma,0,1	FLRT3	0	1	Substitution - Missense(1)	large_intestine(1)	c.C907A						.						80.0	76.0	78.0					20																	14307246		2203	4300	6503	SO:0001583	missense	23767	exon2			TGTTGCGAAGAAT	AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.907C>A	20.37:g.14307246G>T	ENSP00000367292:p.Arg303Ser	34	0		45	2	NM_013281	D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Missense_Mutation	SNP	ENST00000378053.3	37	CCDS13121.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.369503	0.61624	.	.	ENSG00000125848	ENST00000378053;ENST00000341420;ENST00000541882	T;T	0.50548	0.74;0.74	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.36413	0.0966	N	0.00380	-1.58	0.80722	D	1	D	0.63880	0.993	D	0.68483	0.958	T	0.66131	-0.6000	10	0.27082	T	0.32	-8.1732	20.6397	0.99537	0.0:0.0:1.0:0.0	.	303	Q9NZU0	FLRT3_HUMAN	S	303	ENSP00000367292:R303S;ENSP00000339912:R303S	ENSP00000339912:R303S	R	-	1	0	FLRT3	14255246	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.932000	0.87634	2.880000	0.98712	0.650000	0.86243	CGC	.		0.438	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078075.1	NM_013281	
GYS1	2997	hgsc.bcm.edu	37	19	49473939	49473939	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr19:49473939C>T	ENST00000323798.3	-	14	1869	c.1673G>A	c.(1672-1674)cGc>cAc	p.R558H	GYS1_ENST00000541188.1_Missense_Mutation_p.R478H|GYS1_ENST00000544287.1_Missense_Mutation_p.R191H|GYS1_ENST00000263276.6_Missense_Mutation_p.R494H	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	558					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		ATCCAGGCTGCGGAACCGCCG	0.592											OREG0025611	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R558H		.											.	.	.	0			c.G1673A						.						37.0	40.0	39.0					19																	49473939		2203	4300	6503	SO:0001583	missense	2997	exon14			AGGCTGCGGAACC		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1673G>A	19.37:g.49473939C>T	ENSP00000317904:p.Arg558His	96	0	962	99	3	NM_002103	Q9BTT9	Missense_Mutation	SNP	ENST00000323798.3	37	CCDS12747.1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.549679	0.65311	.	.	ENSG00000104812	ENST00000323798;ENST00000263276;ENST00000541188;ENST00000544287	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.49	5.49	0.81192	.	0.053085	0.85682	D	0.000000	T	0.69895	0.3162	L	0.33485	1.01	0.80722	D	1	B;D;P	0.89917	0.377;1.0;0.759	B;D;B	0.69307	0.111;0.963;0.222	T	0.68017	-0.5520	10	0.40728	T	0.16	-27.3843	17.2422	0.87016	0.0:1.0:0.0:0.0	.	478;494;558	B7Z806;Q9BTT9;P13807	.;.;GYS1_HUMAN	H	558;494;478;191	ENSP00000317904:R558H;ENSP00000263276:R494H;ENSP00000437922:R478H;ENSP00000444004:R191H	ENSP00000263276:R494H	R	-	2	0	GYS1	54165751	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.361000	0.59461	2.756000	0.94617	0.561000	0.74099	CGC	.		0.592	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319791.1	NM_002103	
RPS10	6204	hgsc.bcm.edu	37	6	34392484	34392484	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:34392484C>G	ENST00000326199.8	-	3	377	c.284G>C	c.(283-285)cGc>cCc	p.R95P	RPS10_ENST00000344700.3_Missense_Mutation_p.R95P|RPS10-NUDT3_ENST00000605528.1_Missense_Mutation_p.R95P|RPS10_ENST00000494077.1_5'UTR	NM_001014.4|NM_001203245.2|NM_001204091.1	NP_001005.1|NP_001190174.1|NP_001191020.1	P46783	RS10_HUMAN	ribosomal protein S10	95					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	9						ACGGCTACGGCGTAGGGTGGC	0.502																																					p.R95P	Colon(121;749 1624 4895 8687 22360)	.											RPS10,colon,carcinoma,0,1	RPS10	0	0			c.G284C						.						27.0	29.0	28.0					6																	34392484		2203	4298	6501	SO:0001583	missense	6204	exon3			CTACGGCGTAGGG	U14972	CCDS4792.1	6p21.31	2011-04-05			ENSG00000124614	ENSG00000124614		"""S ribosomal proteins"""	10383	protein-coding gene	gene with protein product		603632				7772601, 9582194	Standard	NM_001014		Approved	MGC88819, S10		P46783	OTTHUMG00000014546	ENST00000326199.8:c.284G>C	6.37:g.34392484C>G	ENSP00000347271:p.Arg95Pro	58	1		57	3	NM_001203245	B2R4E3|Q5TZC0	Missense_Mutation	SNP	ENST00000326199.8	37	CCDS4792.1	.	.	.	.	.	.	.	.	.	.	C	30	5.050654	0.93740	.	.	ENSG00000124614	ENST00000326199;ENST00000344700	T;T	0.77750	-1.1;-1.12	5.19	5.19	0.71726	Plectin/S10, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81851	0.4910	L	0.55834	1.745	0.80722	D	1	D	0.55605	0.972	P	0.60068	0.868	D	0.83695	0.0179	10	0.72032	D	0.01	-8.4826	18.7885	0.91964	0.0:1.0:0.0:0.0	.	95	P46783	RS10_HUMAN	P	95	ENSP00000347271:R95P;ENSP00000363169:R95P	ENSP00000347271:R95P	R	-	2	0	RPS10	34500462	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.765000	0.85310	2.446000	0.82766	0.485000	0.47835	CGC	.		0.502	RPS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040230.1		
DRD1	1812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	174869423	174869423	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:174869423C>T	ENST00000393752.2	-	2	1672	c.680G>A	c.(679-681)cGc>cAc	p.R227H		NM_000794.3	NP_000785.1	P21728	DRD1_HUMAN	dopamine receptor D1	227					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult walking behavior (GO:0007628)|astrocyte development (GO:0014002)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|cellular response to catecholamine stimulus (GO:0071870)|cerebral cortex GABAergic interneuron migration (GO:0021853)|conditioned taste aversion (GO:0001661)|dentate gyrus development (GO:0021542)|dopamine metabolic process (GO:0042417)|dopamine transport (GO:0015872)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose import (GO:0046323)|grooming behavior (GO:0007625)|habituation (GO:0046959)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|maternal behavior (GO:0042711)|mating behavior (GO:0007617)|memory (GO:0007613)|neuronal action potential (GO:0019228)|operant conditioning (GO:0035106)|peristalsis (GO:0030432)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|prepulse inhibition (GO:0060134)|protein import into nucleus (GO:0006606)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|sensitization (GO:0046960)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|transmission of nerve impulse (GO:0019226)|vasodilation (GO:0042311)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acepromazine(DB01614)|Acetophenazine(DB01063)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Dopamine(DB00988)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Methylergometrine(DB00353)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Phenylpropanolamine(DB00397)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GGCCGCAATGCGCCGTATTTG	0.483																																					p.R227H		.											.	.	.	0			c.G680A						.						120.0	117.0	118.0					5																	174869423		2203	4300	6503	SO:0001583	missense	1812	exon2			GCAATGCGCCGTA	X55760	CCDS4393.1	5q34-q35	2012-08-08			ENSG00000184845	ENSG00000184845		"""GPCR / Class A : Dopamine receptors"""	3020	protein-coding gene	gene with protein product		126449					Standard	NM_000794		Approved		uc003mcz.3	P21728	OTTHUMG00000130557	ENST00000393752.2:c.680G>A	5.37:g.174869423C>T	ENSP00000377353:p.Arg227His	22	0		33	10	NM_000794	B2RA44|Q4QRJ0	Missense_Mutation	SNP	ENST00000393752.2	37	CCDS4393.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585979	0.86748	.	.	ENSG00000184845	ENST00000393752;ENST00000329144	T	0.73047	-0.71	5.39	5.39	0.77823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86615	0.5975	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.88074	0.2802	10	0.62326	D	0.03	.	18.512	0.90920	0.0:1.0:0.0:0.0	.	227	P21728	DRD1_HUMAN	H	227	ENSP00000377353:R227H	ENSP00000327652:R227H	R	-	2	0	DRD1	174802029	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.669000	0.83911	2.688000	0.91661	0.650000	0.86243	CGC	.		0.483	DRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252982.2	NM_000794	
WDR81	124997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	1628548	1628548	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr17:1628548C>T	ENST00000409644.1	+	1	295	c.295C>T	c.(295-297)Cct>Tct	p.P99S	RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000446363.1_Intron|WDR81_ENST00000309182.5_Intron|WDR81_ENST00000419248.1_Intron|WDR81_ENST00000437219.2_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	99					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCAAAGGCTGCCTGCCGGCTG	0.716																																					p.P99S		.											.	.	.	0			c.C295T						.						2.0	3.0	2.0					17																	1628548		590	1405	1995	SO:0001583	missense	124997	exon1			AGGCTGCCTGCCG	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.295C>T	17.37:g.1628548C>T	ENSP00000386609:p.Pro99Ser	17	0		16	6	NM_001163809	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	ENST00000409644.1	37	CCDS54062.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.059814	0.76074	.	.	ENSG00000167716	ENST00000409644	T	0.52295	0.67	5.92	3.83	0.44106	.	.	.	.	.	T	0.55909	0.1950	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56721	-0.7932	6	0.45353	T	0.12	.	11.4413	0.50099	0.0:0.8064:0.126:0.0676	.	.	.	.	S	99	ENSP00000386609:P99S	ENSP00000386609:P99S	P	+	1	0	WDR81	1575298	1.000000	0.71417	0.996000	0.52242	0.637000	0.38172	5.855000	0.69510	1.511000	0.48818	-0.145000	0.13849	CCT	.		0.716	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558341	11558341	+	Missense_Mutation	SNP	G	G	C	rs71166603|rs3217229	byFrequency	TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr19:11558341G>C	ENST00000589838.1	+	10	937	c.937G>C	c.(937-939)Gag>Cag	p.E313Q	PRKCSH_ENST00000587327.1_Missense_Mutation_p.E313Q|PRKCSH_ENST00000592741.1_Missense_Mutation_p.E313Q|PRKCSH_ENST00000591462.1_Missense_Mutation_p.E313Q|PRKCSH_ENST00000252455.2_Missense_Mutation_p.E313Q|PRKCSH_ENST00000412601.1_Missense_Mutation_p.E313Q			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	313	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						GTCGCCCACAgaggaggagga	0.657																																					p.E313Q		.											.,2	.	55	0			c.G937C						.						19.0	20.0	20.0					19																	11558341		2196	4291	6487	SO:0001583	missense	5589	exon11			CCCACAGAGGAGG		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.937G>C	19.37:g.11558341G>C	ENSP00000465461:p.Glu313Gln	22	1		29	3	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Missense_Mutation	SNP	ENST00000589838.1	37	CCDS32911.1	.	.	.	.	.	.	.	.	.	.	G	9.182	1.023840	0.19433	.	.	ENSG00000130175	ENST00000252455;ENST00000412601	T;T	0.73789	-0.78;-0.77	3.58	3.58	0.41010	.	2.963640	0.01189	N	0.007295	T	0.73393	0.3581	L	0.36672	1.1	0.52099	D	0.99994	P;B;D	0.56035	0.915;0.295;0.974	B;B;P	0.47299	0.374;0.13;0.543	T	0.65961	-0.6041	10	0.20519	T	0.43	-10.1062	13.4576	0.61208	0.0:0.0:1.0:0.0	.	313;313;313	E7EQZ9;A8K318;P14314	.;.;GLU2B_HUMAN	Q	313	ENSP00000252455:E313Q;ENSP00000395616:E313Q	ENSP00000252455:E313Q	E	+	1	0	PRKCSH	11419341	0.979000	0.34478	0.926000	0.36857	0.025000	0.11179	2.848000	0.48278	2.301000	0.77427	0.491000	0.48974	GAG	.		0.657	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
CUX2	23316	hgsc.bcm.edu	37	12	111747906	111747906	+	Silent	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr12:111747906C>A	ENST00000261726.6	+	15	1474	c.1320C>A	c.(1318-1320)ccC>ccA	p.P440P		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	440	Pro-rich.				cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						AGTCCTACCCCTCCCCTCAGC	0.647																																					p.P440P		.											.	.	.	0			c.C1320A						.						28.0	31.0	30.0					12																	111747906		1972	4153	6125	SO:0001819	synonymous_variant	23316	exon15			CTACCCCTCCCCT	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.1320C>A	12.37:g.111747906C>A		84	0		73	4	NM_015267	A7E2Y4	Silent	SNP	ENST00000261726.6	37	CCDS41837.1																																																																																			.		0.647	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
SV2C	22987	hgsc.bcm.edu	37	5	75427856	75427856	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:75427856A>G	ENST00000502798.2	+	2	723	c.281A>G	c.(280-282)cAg>cGg	p.Q94R	SV2C_ENST00000322285.7_Missense_Mutation_p.Q94R	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	94					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.Q94R(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GGGGAGTATCAGGGCATCCCC	0.547																																					p.Q94R		.											SV2C,colon,carcinoma,0,1	SV2C	0	1	Substitution - Missense(1)	large_intestine(1)	c.A281G						.						76.0	81.0	79.0					5																	75427856		2123	4259	6382	SO:0001583	missense	22987	exon2			AGTATCAGGGCAT	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.281A>G	5.37:g.75427856A>G	ENSP00000423541:p.Gln94Arg	27	0		28	2	NM_014979	Q496K1|Q9UPU8	Missense_Mutation	SNP	ENST00000502798.2	37	CCDS43331.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.665086	0.88251	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;T	0.31510	1.49;1.49	5.76	5.76	0.90799	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.58032	0.2094	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.63014	-0.6731	10	0.87932	D	0	-18.4431	16.075	0.80962	1.0:0.0:0.0:0.0	.	94	Q496J9	SV2C_HUMAN	R	94	ENSP00000423541:Q94R;ENSP00000316983:Q94R	ENSP00000316983:Q94R	Q	+	2	0	SV2C	75463612	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.339000	0.96797	2.195000	0.70347	0.533000	0.62120	CAG	.		0.547	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4		
DNAH3	55567	hgsc.bcm.edu	37	16	21080893	21080893	+	Missense_Mutation	SNP	C	C	A	rs577456196		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr16:21080893C>A	ENST00000261383.3	-	23	3223	c.3224G>T	c.(3223-3225)cGc>cTc	p.R1075L	DNAH3_ENST00000415178.1_Missense_Mutation_p.R1075L	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1075	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.R1075P(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GTCTTGTATGCGAATTAGCTT	0.453																																					p.R1075L		.											DNAH3_ENST00000261383,NS,carcinoma,-1,2	DNAH3_ENST00000261383	-1	2	Substitution - Missense(2)	lung(2)	c.G3224T						.						173.0	130.0	144.0					16																	21080893		2201	4300	6501	SO:0001583	missense	55567	exon23			TGTATGCGAATTA	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.3224G>T	16.37:g.21080893C>A	ENSP00000261383:p.Arg1075Leu	34	0		44	2	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	0.086	-1.174732	0.01646	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.60171	0.21;0.21	5.4	4.22	0.49857	Dynein heavy chain, domain-2 (1);	0.726956	0.12981	N	0.423277	T	0.18299	0.0439	N	0.00750	-1.22	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.47636	-0.9102	10	0.02654	T	1	.	2.0715	0.03614	0.3159:0.4174:0.1475:0.1193	.	1075	Q8TD57	DYH3_HUMAN	L	1075	ENSP00000261383:R1075L;ENSP00000394245:R1075L	ENSP00000261383:R1075L	R	-	2	0	DNAH3	20988394	0.001000	0.12720	0.952000	0.39060	0.634000	0.38068	0.318000	0.19504	2.696000	0.92011	0.655000	0.94253	CGC	.		0.453	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
DDX11	1663	hgsc.bcm.edu	37	12	31242358	31242358	+	Missense_Mutation	SNP	G	G	A	rs199585751		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr12:31242358G>A	ENST00000407793.2	+	8	1065	c.814G>A	c.(814-816)Gtg>Atg	p.V272M	DDX11_ENST00000542838.1_Missense_Mutation_p.V272M|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000228264.6_Missense_Mutation_p.V246M|DDX11_ENST00000545668.1_Missense_Mutation_p.V272M|DDX11_ENST00000350437.4_Missense_Mutation_p.V272M	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	272	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					AAATGAAGACGTGAAAAGCCT	0.522										Multiple Myeloma(12;0.14)																											p.V272M		.											.	.	.	0			c.G814A						.						87.0	86.0	86.0					12																	31242358		2203	4300	6503	SO:0001583	missense	1663	exon8			GAAGACGTGAAAA	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.814G>A	12.37:g.31242358G>A	ENSP00000384703:p.Val272Met	53	0		55	4	NM_030653	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444369	0.43429	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000228264;ENST00000438391;ENST00000545668;ENST00000350437	T;T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86;-0.86	3.3	1.43	0.22495	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.000000	0.85682	D	0.000000	D	0.88377	0.6420	H	0.97186	3.955	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.85977	0.1480	10	0.87932	D	0	.	7.1353	0.25525	0.2356:0.0:0.7644:0.0	.	272;272;272	Q96FC9;Q96FC9-4;Q96FC9-2	DDX11_HUMAN;.;.	M	272;272;246;243;272;272	ENSP00000443426:V272M;ENSP00000384703:V272M;ENSP00000228264:V246M;ENSP00000407646:V243M;ENSP00000440402:V272M;ENSP00000309965:V272M	ENSP00000228264:V246M	V	+	1	0	DDX11	31133625	1.000000	0.71417	0.002000	0.10522	0.000000	0.00434	8.747000	0.91610	0.132000	0.18615	-0.424000	0.05967	GTG	.		0.522	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
STRC	161497	hgsc.bcm.edu	37	15	43893654	43893654	+	Silent	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr15:43893654G>T	ENST00000450892.2	-	24	4718	c.4641C>A	c.(4639-4641)atC>atA	p.I1547I	RNU6-554P_ENST00000410466.1_RNA|STRC_ENST00000541030.1_Silent_p.I774I	NM_153700.2	NP_714544.1	Q7RTU9	STRC_HUMAN	stereocilin	1547					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)	kinocilium (GO:0060091)|stereocilium bundle tip (GO:0032426)				skin(4)	4		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		AGTCCACTAGGATCAGCTCCT	0.572																																					p.I1547I		.											STRC_ENST00000450892,NS,carcinoma,0,1	STRC_ENST00000450892	0	0			c.C4641A						.						100.0	91.0	94.0					15																	43893654		2200	4297	6497	SO:0001819	synonymous_variant	161497	exon24			CACTAGGATCAGC	BK000138	CCDS10098.1	15q15.3	2010-02-26			ENSG00000242866	ENSG00000242866			16035	protein-coding gene	gene with protein product		606440		DFNB16		11687802, 9429146	Standard	NM_153700		Approved		uc001zsf.3	Q7RTU9	OTTHUMG00000059899	ENST00000450892.2:c.4641C>A	15.37:g.43893654G>T		67	0		60	3	NM_153700		Silent	SNP	ENST00000450892.2	37	CCDS10098.1																																																																																			.		0.572	STRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133140.1	NM_153700	
NFASC	23114	hgsc.bcm.edu	37	1	204956669	204956669	+	Splice_Site	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr1:204956669G>A	ENST00000401399.1	+	21	2792		c.e21+1		NFASC_ENST00000338515.6_Splice_Site|NFASC_ENST00000495396.1_Splice_Site|NFASC_ENST00000338586.6_Splice_Site|NFASC_ENST00000367170.4_Splice_Site|NFASC_ENST00000513543.1_Splice_Site|NFASC_ENST00000539706.1_Splice_Site|NFASC_ENST00000339876.6_Splice_Site|NFASC_ENST00000404907.1_Splice_Site|NFASC_ENST00000404076.1_Splice_Site|NFASC_ENST00000367169.4_Splice_Site|NFASC_ENST00000367171.4_Splice_Site|NFASC_ENST00000367172.4_Splice_Site|NFASC_ENST00000360049.4_Splice_Site			O94856	NFASC_HUMAN	neurofascin						axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TATGTGGCCTGTACGTTCTGC	0.493																																					.		.											NFASC_ENST00000339876,NS,carcinoma,0,2	NFASC_ENST00000339876	0	0			c.2902+1G>A						.						183.0	155.0	165.0					1																	204956669		2203	4300	6503	SO:0001630	splice_region_variant	23114	exon23			TGGCCTGTACGTT	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.2593+1G>A	1.37:g.204956669G>A		57	0		50	2	NM_015090	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Splice_Site	SNP	ENST00000401399.1	37	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	G	9.829	1.187871	0.21954	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393;ENST00000367173;ENST00000425360	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.735	0.85444	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NFASC	203223292	1.000000	0.71417	0.981000	0.43875	0.021000	0.10359	4.987000	0.63857	2.731000	0.93534	0.591000	0.81541	.	.		0.493	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	Intron
BCAS3	54828	hgsc.bcm.edu	37	17	59112151	59112151	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr17:59112151G>T	ENST00000390652.5	+	18	1838	c.1807G>T	c.(1807-1809)Gat>Tat	p.D603Y	BCAS3_ENST00000589222.1_Splice_Site_p.D588Y|BCAS3_ENST00000408905.3_Splice_Site_p.D588Y|BCAS3_ENST00000588462.1_Splice_Site_p.D603Y|RP11-264B14.1_ENST00000588604.1_RNA|BCAS3_ENST00000588874.1_Splice_Site_p.D359Y|BCAS3_ENST00000585744.1_Splice_Site_p.D374Y|BCAS3_ENST00000407086.3_Splice_Site_p.D588Y	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			AAGAGAAAAAGGTATGTATTT	0.368																																					p.D603Y		.											.	.	.	0			c.G1807T						.						83.0	79.0	80.0					17																	59112151		1794	4070	5864	SO:0001630	splice_region_variant	54828	exon18			GAAAAAGGTATGT	AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.1807+1G>T	17.37:g.59112151G>T		47	0		74	4	NM_001099432		Missense_Mutation	SNP	ENST00000390652.5	37	CCDS45749.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664684	0.88251	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000405070;ENST00000408905;ENST00000360207	T;T;T	0.32988	1.43;1.45;1.43	6.06	6.06	0.98353	.	0.152324	0.56097	D	0.000027	T	0.48241	0.1489	L	0.34521	1.04	0.58432	D	0.999996	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.998;0.999;0.998;0.999;0.997	T	0.20273	-1.0280	10	0.40728	T	0.16	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	379;588;603;588;603;588	B4E3M9;Q9H6U6-3;Q9H6U6-8;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;.;.;BCAS3_HUMAN;.	Y	603;588;618;588;380	ENSP00000375067:D603Y;ENSP00000385323:D588Y;ENSP00000386173:D588Y	ENSP00000353336:D380Y	D	+	1	0	BCAS3	56466933	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.476000	0.97823	2.880000	0.98712	0.650000	0.86243	GAT	.		0.368	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449578.1	NM_017679	Missense_Mutation
CLK1	1195	hgsc.bcm.edu	37	2	201718691	201718691	+	Silent	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr2:201718691G>T	ENST00000321356.4	-	12	1381	c.1246C>A	c.(1246-1248)Cga>Aga	p.R416R	CLK1_ENST00000434813.2_Silent_p.R458R|CLK1_ENST00000409769.2_Silent_p.R239R	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	416	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CAGTCTAATCGATCGTGGTGA	0.358																																					p.R458R		.											CLK1_ENST00000434813,colon,carcinoma,0,2	CLK1_ENST00000434813	0	0			c.C1372A						.						113.0	108.0	110.0					2																	201718691		2203	4300	6503	SO:0001819	synonymous_variant	1195	exon12			CTAATCGATCGTG	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.1246C>A	2.37:g.201718691G>T		55	0		45	3	NM_001162407	B4DFW7|Q0P694|Q8N5V8	Silent	SNP	ENST00000321356.4	37	CCDS2331.1																																																																																			.		0.358	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2		
XAGE3	170626	hgsc.bcm.edu;bcgsc.ca	37	X	52893878	52893878	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chrX:52893878C>T	ENST00000346279.3	-	4	309	c.239G>A	c.(238-240)gGt>gAt	p.G80D	XAGE3_ENST00000375491.3_Missense_Mutation_p.G80D	NM_133179.2	NP_573440.1	Q8WTP9	XAGE3_HUMAN	X antigen family, member 3	80										kidney(1)|large_intestine(1)|lung(2)	4						TCCACATTCACCCCCAGTCTT	0.423																																					p.G80D		.											.	.	.	0			c.G239A						.						80.0	72.0	75.0					X																	52893878		2203	4299	6502	SO:0001583	missense	170626	exon4			CATTCACCCCCAG	BG354572	CCDS14347.1	Xp11.22	2010-09-27	2004-06-07	2005-01-27	ENSG00000171402	ENSG00000171402			14618	protein-coding gene	gene with protein product	"""cancer/testis antigen family 12, member 3a"", ""cancer/testis antigen family 12, member 3b"""	300740	"""placenta-specific 6; G antigen, family D, 4"""	PLAC6, GAGED4			Standard	NM_133179		Approved	XAGE-3, pp9012, CT12.3a, CT12.3b	uc004dre.3	Q8WTP9	OTTHUMG00000021587	ENST00000346279.3:c.239G>A	X.37:g.52893878C>T	ENSP00000303061:p.Gly80Asp	31	0		51	4	NM_133179	Q5JS82|Q8WYS9	Missense_Mutation	SNP	ENST00000346279.3	37	CCDS14347.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.475190	0.00011	.	.	ENSG00000171402	ENST00000375491;ENST00000346279	T;T	0.08458	3.09;3.09	1.09	-2.19	0.07015	.	.	.	.	.	T	0.02012	0.0063	N	0.01618	-0.8	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.27706	-1.0066	9	0.05436	T	0.98	.	4.0633	0.09849	0.1779:0.5121:0.0:0.31	.	80	Q8WTP9	GAGD4_HUMAN	D	80	ENSP00000364640:G80D;ENSP00000303061:G80D	ENSP00000303061:G80D	G	-	2	0	XAGE3	52910603	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.535000	0.02210	-3.108000	0.00242	-2.027000	0.00425	GGT	.		0.423	XAGE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056686.1	NM_133179	
SCARA5	286133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	27764677	27764677	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr8:27764677G>A	ENST00000354914.3	-	6	1569	c.1084C>T	c.(1084-1086)Cgt>Tgt	p.R362C	SCARA5_ENST00000380385.2_Missense_Mutation_p.R137C|SCARA5_ENST00000301906.4_Missense_Mutation_p.R319C|RP11-597M17.1_ENST00000517735.1_RNA|SCARA5_ENST00000524352.1_Missense_Mutation_p.R362C|SCARA5_ENST00000518030.1_Missense_Mutation_p.R319C	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	362	Collagen-like.				cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		TTGAACCCACGCATGCCCATT	0.592																																					p.R362C		.											SCARA5,caecum,carcinoma,0,1	SCARA5	0	0			c.C1084T						.						192.0	184.0	187.0					8																	27764677		2203	4300	6503	SO:0001583	missense	286133	exon6			ACCCACGCATGCC	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.1084C>T	8.37:g.27764677G>A	ENSP00000346990:p.Arg362Cys	36	0		30	7	NM_173833	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	37	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169763	0.78452	.	.	ENSG00000168079	ENST00000354914;ENST00000380385;ENST00000517320;ENST00000524352;ENST00000518030;ENST00000301906	D;D;D;D;D	0.93906	-1.78;-3.31;-1.78;-1.78;-1.78	5.86	5.86	0.93980	.	0.235220	0.36555	N	0.002533	D	0.96506	0.8860	M	0.78801	2.425	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.996;0.996;0.998	D	0.96466	0.9345	10	0.66056	D	0.02	.	15.6773	0.77338	0.0:0.0:1.0:0.0	.	137;362;319;362	Q6ZMJ2-4;Q6ZMJ2-2;Q6ZMJ2-3;Q6ZMJ2	.;.;.;SCAR5_HUMAN	C	362;137;162;362;319;319	ENSP00000346990:R362C;ENSP00000369746:R137C;ENSP00000428663:R362C;ENSP00000430713:R319C;ENSP00000301906:R319C	ENSP00000301906:R319C	R	-	1	0	SCARA5	27820596	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	3.562000	0.53777	2.778000	0.95560	0.655000	0.94253	CGT	.		0.592	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	52440916	52440916	+	Nonsense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:52440916C>T	ENST00000460680.1	-	8	1059	c.588G>A	c.(586-588)tgG>tgA	p.W196*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.W196*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.W196*(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CGTCCTCCCCCCAGGGCCCTA	0.612			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.W196X	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	BAP1,NS,carcinoma,-2,1	BAP1	-2	1	Substitution - Nonsense(1)	eye(1)	c.G588A						.						42.0	35.0	37.0					3																	52440916		2197	4297	6494	SO:0001587	stop_gained	8314	exon8			CTCCCCCCAGGGC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.588G>A	3.37:g.52440916C>T	ENSP00000417132:p.Trp196*	35	0		24	12	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	C	39	7.704533	0.98444	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.1917	20.1995	0.98256	0.0:1.0:0.0:0.0	.	.	.	.	X	196	.	ENSP00000296288:W196X	W	-	3	0	BAP1	52415956	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	7.783000	0.85696	2.876000	0.98609	0.650000	0.86243	TGG	.		0.612	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
UNC5A	90249	hgsc.bcm.edu	37	5	176304913	176304913	+	Nonsense_Mutation	SNP	G	G	T	rs149355192		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:176304913G>T	ENST00000329542.4	+	11	1928	c.1654G>T	c.(1654-1656)Gag>Tag	p.E552*	UNC5A_ENST00000261961.3_Nonsense_Mutation_p.E512*	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	552					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E552K(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCACCTGGGCGAGGAGGCGCC	0.662																																					p.E552X		.											UNC5A,mouth,carcinoma,0,1	UNC5A	0	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G1654T						.						21.0	21.0	21.0					5																	176304913		2201	4295	6496	SO:0001587	stop_gained	90249	exon11			CTGGGCGAGGAGG	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.1654G>T	5.37:g.176304913G>T	ENSP00000332737:p.Glu552*	35	0		34	2	NM_133369	B2RXE6|Q8TF26|Q96GP4	Nonsense_Mutation	SNP	ENST00000329542.4	37	CCDS34299.1	.	.	.	.	.	.	.	.	.	.	G	41	8.757006	0.98941	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-34.5453	14.5991	0.68427	0.0722:0.0:0.9278:0.0	.	.	.	.	X	552;512	.	ENSP00000261961:E512X	E	+	1	0	UNC5A	176237519	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	9.869000	0.99810	2.580000	0.87095	0.555000	0.69702	GAG	.		0.662	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300	
C7orf62	219557	hgsc.bcm.edu	37	7	88424178	88424178	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr7:88424178G>T	ENST00000297203.2	-	2	264	c.79C>A	c.(79-81)Cgt>Agt	p.R27S	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	27										NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						TAATTGCTACGTGGGACTTGG	0.418																																					p.R27S		.											C7orf62,right_upper_lobe,carcinoma,0,2	C7orf62	0	0			c.C79A						.																																			SO:0001583	missense	219557	exon2			TGCTACGTGGGAC	BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.79C>A	7.37:g.88424178G>T	ENSP00000297203:p.Arg27Ser	52	0		52	3	NM_152706		Missense_Mutation	SNP	ENST00000297203.2	37	CCDS34678.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541996	0.85917	.	.	ENSG00000164645	ENST00000297203	T	0.22134	1.97	6.16	6.16	0.99307	.	0.149795	0.46758	D	0.000264	T	0.48466	0.1501	M	0.73598	2.24	0.38914	D	0.957586	D	0.89917	1.0	D	0.91635	0.999	T	0.45775	-0.9238	10	0.62326	D	0.03	-6.0823	16.3599	0.83257	0.0:0.0:1.0:0.0	.	27	Q8TBZ9	CG062_HUMAN	S	27	ENSP00000297203:R27S	ENSP00000297203:R27S	R	-	1	0	C7orf62	88262114	1.000000	0.71417	0.946000	0.38457	0.827000	0.46813	2.999000	0.49473	2.937000	0.99478	0.650000	0.86243	CGT	.		0.418	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332714.1	NM_152706	
CDC27	996	hgsc.bcm.edu	37	17	45234625	45234625	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr17:45234625C>T	ENST00000066544.3	-	6	694	c.601G>A	c.(601-603)Gtt>Att	p.V201I	CDC27_ENST00000531206.1_Missense_Mutation_p.V201I|CDC27_ENST00000527547.1_Missense_Mutation_p.V201I|CDC27_ENST00000446365.2_Missense_Mutation_p.V140I|CDC27_ENST00000528748.1_5'UTR	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	201					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.V201I(2)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TCCGTAAGAACTGTCTCAGGC	0.338																																					p.V201I		.											CDC27_ENST00000531206,NS,carcinoma,0,2	CDC27_ENST00000531206	0	2	Substitution - Missense(2)	kidney(2)	c.G601A						.						58.0	59.0	59.0					17																	45234625		2203	4300	6503	SO:0001583	missense	996	exon6			TAAGAACTGTCTC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.601G>A	17.37:g.45234625C>T	ENSP00000066544:p.Val201Ile	55	1		50	6	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.164668	0.38217	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67171	-0.25;-0.23;0.02;-0.25;0.85	5.11	5.11	0.69529	.	0.065071	0.64402	D	0.000010	T	0.52805	0.1757	N	0.24115	0.695	0.53688	D	0.999973	B;B;B;B	0.22211	0.031;0.053;0.066;0.031	B;B;B;B	0.20577	0.024;0.022;0.03;0.01	T	0.47923	-0.9079	10	0.22109	T	0.4	-10.941	16.0383	0.80645	0.0:1.0:0.0:0.0	.	140;201;201;201	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	I	201;201;140;201;201	ENSP00000066544:V201I;ENSP00000434614:V201I;ENSP00000392802:V140I;ENSP00000437339:V201I;ENSP00000432105:V201I	ENSP00000066544:V201I	V	-	1	0	CDC27	42589624	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.951000	0.75983	2.391000	0.81399	0.557000	0.71058	GTT	.		0.338	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
TPRN	286262	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	140093584	140093584	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr9:140093584C>A	ENST00000409012.4	-	1	1666	c.1580G>T	c.(1579-1581)cGg>cTg	p.R527L	TPRN_ENST00000321773.2_Missense_Mutation_p.R466L|TPRN_ENST00000541945.1_Intron	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	527					sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						CTCGGCCTCCCGTGGCCGAGG	0.652																																					p.R527L		.											.	.	.	0			c.G1580T						.						66.0	65.0	65.0					9																	140093584		2203	4299	6502	SO:0001583	missense	286262	exon1			GCCTCCCGTGGCC	AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.1580G>T	9.37:g.140093584C>A	ENSP00000387100:p.Arg527Leu	18	0		14	5	NM_001128228	B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	Missense_Mutation	SNP	ENST00000409012.4	37	CCDS56594.1	.	.	.	.	.	.	.	.	.	.	C	0.309	-0.968960	0.02232	.	.	ENSG00000176058	ENST00000333046;ENST00000409012;ENST00000321773	.	.	.	3.49	-6.97	0.01616	.	2.217700	0.01899	N	0.039054	T	0.23611	0.0571	N	0.16478	0.41	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16276	-1.0408	9	0.56958	D	0.05	0.3779	3.3229	0.07057	0.2339:0.4591:0.1203:0.1866	.	527	Q4KMQ1	TPRN_HUMAN	L	325;527;466	.	ENSP00000313704:R466L	R	-	2	0	TPRN	139213405	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.528000	0.00945	-3.477000	0.00156	-2.495000	0.00193	CGG	.		0.652	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055323.3	NM_173691	
CLEC4A	50856	hgsc.bcm.edu	37	12	8287231	8287231	+	Intron	SNP	T	T	C			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr12:8287231T>C	ENST00000229332.5	+	4	545				CLEC4A_ENST00000360500.3_Intron|CLEC4A_ENST00000352620.3_Intron|CLEC4A_ENST00000345999.3_Intron	NM_016184.3|NM_194447.2|NM_194450.2	NP_057268.1|NP_919429.2|NP_919432.1	Q9UMR7	CLC4A_HUMAN	C-type lectin domain family 4, member A						cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)	11				Kidney(36;0.0915)		CAGTACGCCATCCCCCCGCAG	0.667																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	642559	.			ACGCCATCCCCCC	AJ133532	CCDS8590.1, CCDS8591.1, CCDS8592.1, CCDS41745.1	12p13	2005-02-09	2005-02-09	2005-02-09	ENSG00000111729	ENSG00000111729		"""C-type lectin domain containing"""	13257	protein-coding gene	gene with protein product		605306	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 6"""	CLECSF6		10438934	Standard	NM_016184		Approved	DCIR, DDB27	uc001qtz.1	Q9UMR7	OTTHUMG00000168571	ENST00000229332.5:c.299-950T>C	12.37:g.8287231T>C		157	0		146	6	.	Q17R69|Q8WXW9|Q9H2Z9|Q9NS33|Q9UI34	RNA	SNP	ENST00000229332.5	37	CCDS8590.1																																																																																			.		0.667	CLEC4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400257.1	NM_194450	
NIPBL	25836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	36961673	36961673	+	Missense_Mutation	SNP	A	A	C			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:36961673A>C	ENST00000282516.8	+	5	945	c.446A>C	c.(445-447)cAt>cCt	p.H149P	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Missense_Mutation_p.H149P	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	149					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			ACTATCTCACATAGCCCCTCC	0.348																																					p.H149P		.											.	.	.	0			c.A446C						.						115.0	113.0	114.0					5																	36961673		2203	4300	6503	SO:0001583	missense	25836	exon5			TCTCACATAGCCC	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.446A>C	5.37:g.36961673A>C	ENSP00000282516:p.His149Pro	43	0		59	14	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	8.666	0.901669	0.17760	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.93763	-3.28;-3.28	5.01	5.01	0.66863	.	0.061111	0.64402	D	0.000002	D	0.86293	0.5898	N	0.13043	0.29	0.41152	D	0.986035	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.82047	-0.0651	10	0.27082	T	0.32	.	13.9943	0.64386	1.0:0.0:0.0:0.0	.	149;149	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	P	149	ENSP00000282516:H149P;ENSP00000406266:H149P	ENSP00000282516:H149P	H	+	2	0	NIPBL	36997430	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.502000	0.53332	2.008000	0.58898	0.533000	0.62120	CAT	.		0.348	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
CHD3	1107	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	7798770	7798770	+	Silent	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr17:7798770C>T	ENST00000330494.7	+	10	1767	c.1617C>T	c.(1615-1617)ccC>ccT	p.P539P	CHD3_ENST00000358181.4_Silent_p.P539P|CHD3_ENST00000380358.4_Silent_p.P598P	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	539	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				TCCCACCCCCCCGTCCTCTTC	0.577																																					p.P598P		.											.	.	.	0			c.C1794T						.						133.0	105.0	114.0					17																	7798770		2203	4300	6503	SO:0001819	synonymous_variant	1107	exon10			ACCCCCCCGTCCT	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.1617C>T	17.37:g.7798770C>T		43	0		27	4	NM_001005271	D3DTQ9|E9PG89|Q9Y4I0	Silent	SNP	ENST00000330494.7	37	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	C	0.121	-1.125778	0.01770	.	.	ENSG00000170004	ENST00000452447	D	0.94232	-3.38	5.25	-6.54	0.01860	.	0.000000	0.45867	D	0.000324	D	0.88749	0.6521	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	T	0.77424	-0.2593	7	0.44086	T	0.13	-5.6162	1.3797	0.02228	0.1729:0.3015:0.1557:0.37	.	.	.	.	S	410	ENSP00000405861:P410S	ENSP00000405861:P410S	P	+	1	0	CHD3	7739495	0.000000	0.05858	0.004000	0.12327	0.103000	0.19146	-2.469000	0.00992	-1.540000	0.01730	-1.268000	0.01426	CCG	.		0.577	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
AVIL	10677	hgsc.bcm.edu	37	12	58201157	58201157	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr12:58201157C>T	ENST00000257861.3	-	12	1878	c.1448G>A	c.(1447-1449)cGc>cAc	p.R483H	AVIL_ENST00000537081.1_Missense_Mutation_p.R476H|AVIL_ENST00000550083.1_5'Flank|RP11-571M6.17_ENST00000602802.1_lincRNA|TSFM_ENST00000548851.1_Intron|RNU6-1083P_ENST00000384022.1_RNA	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	483	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					CATGAAGTGGCGTGGCTCCGT	0.522																																					p.R483H		.											AVIL,colon,carcinoma,0,1	AVIL	0	0			c.G1448A						.						160.0	140.0	146.0					12																	58201157		2203	4300	6503	SO:0001583	missense	10677	exon12			AAGTGGCGTGGCT	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.1448G>A	12.37:g.58201157C>T	ENSP00000257861:p.Arg483His	38	0		21	3	NM_006576	B2RAU7|Q2NKM9	Missense_Mutation	SNP	ENST00000257861.3	37	CCDS8959.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.460105	0.63401	.	.	ENSG00000135407	ENST00000537081;ENST00000257861	T;T	0.56103	0.48;0.48	4.77	4.77	0.60923	Gelsolin domain (1);	0.052065	0.85682	D	0.000000	T	0.54255	0.1847	M	0.67953	2.075	0.53688	D	0.999977	B;B	0.15719	0.012;0.014	B;B	0.17979	0.02;0.013	T	0.56092	-0.8036	10	0.59425	D	0.04	-12.7304	17.0565	0.86535	0.0:1.0:0.0:0.0	.	476;483	O75366-2;O75366	.;AVIL_HUMAN	H	476;483	ENSP00000443207:R476H;ENSP00000257861:R483H	ENSP00000257861:R483H	R	-	2	0	AVIL	56487424	0.508000	0.26154	1.000000	0.80357	0.980000	0.70556	2.125000	0.42016	2.627000	0.88993	0.561000	0.74099	CGC	.		0.522	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409276.1	NM_006576	
APH1A	51107	hgsc.bcm.edu	37	1	150238956	150238956	+	Missense_Mutation	SNP	C	C	A	rs368536742		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr1:150238956C>A	ENST00000369109.3	-	6	898	c.710G>T	c.(709-711)cGa>cTa	p.R237L	APH1A_ENST00000414276.2_Missense_Mutation_p.R167L|APH1A_ENST00000360244.4_Missense_Mutation_p.R237L|C1orf54_ENST00000369102.1_5'Flank|APH1A_ENST00000461320.1_5'UTR	NM_001077628.2	NP_001071096.1	Q96BI3	APH1A_HUMAN	APH1A gamma secretase subunit	237					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|metanephros development (GO:0001656)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)	p.R237L(1)		breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAATACTTCGGAGGGACCC	0.587																																					p.R237L		.											APH1A,trunk,malignant_melanoma,0,1	APH1A	0	1	Substitution - Missense(1)	skin(1)	c.G710T						.						52.0	57.0	55.0					1																	150238956		2037	4183	6220	SO:0001583	missense	51107	exon6			ATACTTCGGAGGG	AF151835	CCDS41390.1, CCDS41391.1, CCDS58025.1	1q21.2	2013-05-01	2013-05-01		ENSG00000117362	ENSG00000117362			29509	protein-coding gene	gene with protein product		607629	"""anterior pharynx defective 1 homolog A (C. elegans)"""			10810093, 12110170	Standard	NM_001077628		Approved	APH-1A, CGI-78	uc001ety.2	Q96BI3	OTTHUMG00000012545	ENST00000369109.3:c.710G>T	1.37:g.150238956C>A	ENSP00000358105:p.Arg237Leu	32	0		48	3	NM_001077628	B4DQK0|Q5TB22|Q5TB23|Q969R6|Q9BVG0|Q9Y386	Missense_Mutation	SNP	ENST00000369109.3	37	CCDS41390.1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729862	0.69074	.	.	ENSG00000117362	ENST00000369109;ENST00000360244;ENST00000414276	T;T;T	0.41758	0.99;0.99;0.99	6.07	4.21	0.49690	.	0.177285	0.38164	N	0.001789	T	0.48390	0.1497	M	0.83953	2.67	0.38697	D	0.9529	B;D;D;P;P;P	0.58620	0.042;0.965;0.983;0.865;0.889;0.941	B;P;P;P;P;P	0.59487	0.069;0.811;0.828;0.641;0.755;0.858	T	0.56013	-0.8049	10	0.59425	D	0.04	-0.109	8.2223	0.31549	0.0:0.7613:0.0:0.2387	.	121;180;167;237;237;237	B4DMX8;B4DUG7;B4DQK0;Q96BI3-2;Q5TB22;Q96BI3	.;.;.;.;.;APH1A_HUMAN	L	237;237;167	ENSP00000358105:R237L;ENSP00000353380:R237L;ENSP00000397473:R167L	ENSP00000353380:R237L	R	-	2	0	APH1A	148505580	0.386000	0.25180	1.000000	0.80357	0.991000	0.79684	0.820000	0.27323	0.908000	0.36671	0.650000	0.86243	CGA	.		0.587	APH1A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000035048.1	NM_016022	
SENP7	57337	hgsc.bcm.edu	37	3	101049208	101049208	+	Silent	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:101049208C>A	ENST00000394095.2	-	20	2774	c.2721G>T	c.(2719-2721)tcG>tcT	p.S907S	SENP7_ENST00000314261.7_Silent_p.S841S|SENP7_ENST00000358203.3_Silent_p.S743S|SENP7_ENST00000394085.3_Silent_p.S95S|SENP7_ENST00000348610.3_Silent_p.S874S|SENP7_ENST00000394094.2_Silent_p.S842S|SENP7_ENST00000394091.1_Silent_p.S743S	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	907	Protease.					intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.S841S(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AAGACAGTGTCGAAGTAGTAC	0.308																																					p.S907S		.											SENP7,rectum,carcinoma,0,1	SENP7	0	1	Substitution - coding silent(1)	large_intestine(1)	c.G2721T						.						102.0	99.0	100.0					3																	101049208		2203	4300	6503	SO:0001819	synonymous_variant	57337	exon20			CAGTGTCGAAGTA		CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2721G>T	3.37:g.101049208C>A		76	0		50	2	NM_020654	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Silent	SNP	ENST00000394095.2	37	CCDS2941.2																																																																																			.		0.308	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654	
MAML2	84441	hgsc.bcm.edu	37	11	95825221	95825221	+	Silent	SNP	C	C	T	rs571656416	byFrequency	TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr11:95825221C>T	ENST00000524717.1	-	2	3258	c.1974G>A	c.(1972-1974)caG>caA	p.Q658Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	658					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.527			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid								C|||	4	0.000798722	0.0015	0.0	5008	,	,		17889	0.002		0.0	False		,,,				2504	0.0				p.Q658Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,NS,carcinoma,0,1	MAML2	0	0			c.G1974A						.																																			SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1974G>A	11.37:g.95825221C>T		45	0		31	2	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.527	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
OR2A12	346525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	143792858	143792858	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr7:143792858A>T	ENST00000408949.2	+	1	718	c.658A>T	c.(658-660)Atc>Ttc	p.I220F		NM_001004135.1	NP_001004135.1	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A, member 12	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)	25	Melanoma(164;0.0783)					CTACTTGCACATCCTGGTGGC	0.597																																					p.I220F		.											.	.	.	0			c.A658T						.						173.0	168.0	170.0					7																	143792858		2001	4169	6170	SO:0001583	missense	346525	exon1			TTGCACATCCTGG		CCDS43670.1	7q35	2013-09-20	2002-11-13	2002-11-13	ENSG00000221858	ENSG00000221858		"""GPCR / Class A : Olfactory receptors"""	15082	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 12 pseudogene"""	OR2A12P			Standard	NM_001004135		Approved		uc011kty.2	Q8NGT7	OTTHUMG00000157996	ENST00000408949.2:c.658A>T	7.37:g.143792858A>T	ENSP00000386174:p.Ile220Phe	25	0		41	18	NM_001004135	Q6IF43	Missense_Mutation	SNP	ENST00000408949.2	37	CCDS43670.1	.	.	.	.	.	.	.	.	.	.	A	12.99	2.102452	0.37145	.	.	ENSG00000221858	ENST00000408949	T	0.00414	7.52	4.33	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01905	0.0060	H	0.96633	3.855	0.36702	D	0.880188	D	0.62365	0.991	D	0.70487	0.969	T	0.06075	-1.0847	9	0.87932	D	0	-29.0979	11.4879	0.50365	1.0:0.0:0.0:0.0	.	220	Q8NGT7	O2A12_HUMAN	F	220	ENSP00000386174:I220F	ENSP00000386174:I220F	I	+	1	0	OR2A12	143423791	1.000000	0.71417	0.392000	0.26245	0.013000	0.08279	6.898000	0.75676	1.817000	0.53016	0.413000	0.27773	ATC	.		0.597	OR2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349969.1		
CEP290	80184	hgsc.bcm.edu	37	12	88530507	88530507	+	Nonsense_Mutation	SNP	G	G	T	rs370725951		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr12:88530507G>T	ENST00000552810.1	-	6	697	c.354C>A	c.(352-354)tgC>tgA	p.C118*	CEP290_ENST00000309041.7_Nonsense_Mutation_p.C118*	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	118					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TTTCAAGTTGGCAAATTTCAT	0.338																																					p.C118X		.											.	.	.	0			c.C354A						.						142.0	132.0	135.0					12																	88530507		1828	4091	5919	SO:0001587	stop_gained	80184	exon6			AAGTTGGCAAATT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.354C>A	12.37:g.88530507G>T	ENSP00000448012:p.Cys118*	83	0		80	4	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Nonsense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	G	37	6.161531	0.97338	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000545139;ENST00000550962;ENST00000552770	.	.	.	5.15	2.29	0.28610	.	0.204064	0.42682	D	0.000665	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	2.9094	0.05732	0.148:0.2624:0.4546:0.135	.	.	.	.	X	118;118;118;20;118;60	.	ENSP00000308021:C118X	C	-	3	2	CEP290	87054638	0.996000	0.38824	1.000000	0.80357	0.957000	0.61999	0.215000	0.17562	0.547000	0.28938	-0.225000	0.12378	TGC	.		0.338	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
NDRG3	57446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	35315979	35315979	+	Missense_Mutation	SNP	T	T	C			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr20:35315979T>C	ENST00000349004.1	-	5	317	c.236A>G	c.(235-237)gAt>gGt	p.D79G	NDRG3_ENST00000373803.2_Missense_Mutation_p.D79G|NDRG3_ENST00000359675.2_Missense_Mutation_p.D67G|NDRG3_ENST00000540765.1_Intron|NDRG3_ENST00000373773.3_Intron	NM_032013.3	NP_114402.1	Q9UGV2	NDRG3_HUMAN	NDRG family member 3	79					cell differentiation (GO:0030154)|negative regulation of cell growth (GO:0030308)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12		Myeloproliferative disorder(115;0.00878)				CTCTTGCATATCCTCAAAGTT	0.453																																					p.D79G		.											.	.	.	0			c.A236G						.						104.0	90.0	95.0					20																	35315979		2203	4300	6503	SO:0001583	missense	57446	exon5			TGCATATCCTCAA	AL031662	CCDS13284.1, CCDS13285.1	20q11.21-q11.23	2008-07-28			ENSG00000101079	ENSG00000101079			14462	protein-coding gene	gene with protein product		605273				10831399, 17998568	Standard	NM_032013		Approved		uc002xfw.3	Q9UGV2	OTTHUMG00000032398	ENST00000349004.1:c.236A>G	20.37:g.35315979T>C	ENSP00000345292:p.Asp79Gly	53	0		62	25	NM_032013	A2A2S8|E1P5U7|E1P5U8|Q5TH32|Q96PL8|Q96SM2|Q9BXY7|Q9H3N7|Q9H411|Q9H8J6	Missense_Mutation	SNP	ENST00000349004.1	37	CCDS13285.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.261361	0.80246	.	.	ENSG00000101079	ENST00000349004;ENST00000373803;ENST00000359675;ENST00000422536	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	M	0.89287	3.02	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.74023	0.982;0.962	T	0.58730	-0.7585	10	0.56958	D	0.05	.	12.9261	0.58260	0.0:0.0:0.0:1.0	.	67;79	Q9UGV2-2;Q9UGV2	.;NDRG3_HUMAN	G	79;79;67;70	ENSP00000345292:D79G;ENSP00000362909:D79G;ENSP00000352703:D67G;ENSP00000416636:D70G	ENSP00000345292:D79G	D	-	2	0	NDRG3	34749393	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.768000	0.85345	2.151000	0.67156	0.459000	0.35465	GAT	.		0.453	NDRG3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079053.2		
CLIP4	79745	hgsc.bcm.edu	37	2	29380187	29380187	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr2:29380187C>A	ENST00000320081.5	+	11	1628	c.1373C>A	c.(1372-1374)cCt>cAt	p.P458H	CLIP4_ENST00000401605.1_Missense_Mutation_p.P458H|CLIP4_ENST00000401617.2_Missense_Mutation_p.P351H|CLIP4_ENST00000404424.1_Missense_Mutation_p.P458H	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	458	Ser-rich.									endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					AGCAAAAGCCCTTCCCTTTCA	0.428																																					p.P458H		.											CLIP4,colon,carcinoma,0,1	CLIP4	0	0			c.C1373A						.						167.0	163.0	165.0					2																	29380187		2203	4300	6503	SO:0001583	missense	79745	exon11			AAAGCCCTTCCCT	AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.1373C>A	2.37:g.29380187C>A	ENSP00000327009:p.Pro458His	69	0		56	3	NM_024692	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Missense_Mutation	SNP	ENST00000320081.5	37	CCDS1770.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244300	0.39697	.	.	ENSG00000115295	ENST00000401605;ENST00000401617;ENST00000404424;ENST00000402240;ENST00000320081;ENST00000379543;ENST00000530644	T;T;T;T	0.76709	-1.04;-0.72;-0.65;-0.65	5.8	5.8	0.92144	Cytoskeleton-associated protein, Gly-rich domain (1);	0.465732	0.24917	N	0.034576	T	0.75845	0.3905	L	0.56769	1.78	0.30046	N	0.812153	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.70784	-0.4778	10	0.46703	T	0.11	.	16.9798	0.86324	0.0:1.0:0.0:0.0	.	458;458	A8K6D0;Q8N3C7	.;CLIP4_HUMAN	H	458;351;458;458;458;459;418	ENSP00000384242:P458H;ENSP00000385148:P351H;ENSP00000385594:P458H;ENSP00000327009:P458H	ENSP00000327009:P458H	P	+	2	0	CLIP4	29233691	0.038000	0.19896	0.973000	0.42090	0.112000	0.19704	1.795000	0.38784	2.735000	0.93741	0.655000	0.94253	CCT	.		0.428	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692	
OTX2	5015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	57268926	57268926	+	Missense_Mutation	SNP	G	G	A	rs376333965		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr14:57268926G>A	ENST00000555006.1	-	4	805	c.397C>T	c.(397-399)Ccc>Tcc	p.P133S	RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000554559.1_3'UTR|OTX2_ENST00000408990.3_Missense_Mutation_p.P133S|OTX2_ENST00000339475.5_Missense_Mutation_p.P141S|OTX2_ENST00000554788.1_3'UTR			P32243	OTX2_HUMAN	orthodenticle homeobox 2	133			P -> T (in MCOPS5). {ECO:0000269|PubMed:15846561}.		axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					CTAGAGGGGGGAGTGAATTGG	0.537																																					p.P141S		.											.	.	.	0			c.C421T	GRCh37	CM051595	OTX2	M		.						101.0	89.0	93.0					14																	57268926		2203	4300	6503	SO:0001583	missense	5015	exon3			AGGGGGGAGTGAA	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.397C>T	14.37:g.57268926G>A	ENSP00000452336:p.Pro133Ser	31	0		31	12	NM_001270525	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	ENST00000555006.1	37	CCDS41960.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.168707	0.57584	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006;ENST00000554845;ENST00000555804	D;D;D;D;D	0.91843	-2.82;-2.79;-2.79;-2.9;-2.92	5.82	5.82	0.92795	.	0.000000	0.43110	D	0.000605	D	0.95439	0.8519	M	0.69463	2.115	0.80722	D	1	P;D	0.71674	0.696;0.998	B;D	0.68621	0.232;0.959	D	0.94614	0.7807	10	0.46703	T	0.11	.	19.0835	0.93192	0.0:0.0:1.0:0.0	.	141;133	F1T0D1;P32243	.;OTX2_HUMAN	S	141;133;133;141;133	ENSP00000343819:P141S;ENSP00000386185:P133S;ENSP00000452336:P133S;ENSP00000451357:P141S;ENSP00000451272:P133S	ENSP00000343819:P141S	P	-	1	0	OTX2	56338679	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.787000	0.99055	2.767000	0.95098	0.655000	0.94253	CCC	.		0.537	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.	
COPS2	9318	hgsc.bcm.edu	37	15	49420221	49420221	+	Nonsense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr15:49420221G>A	ENST00000388901.5	-	13	1331	c.1258C>T	c.(1258-1260)Cga>Tga	p.R420*	COPS2_ENST00000542928.1_Nonsense_Mutation_p.R356*|COPS2_ENST00000299259.6_Nonsense_Mutation_p.R427*	NM_001143887.1|NM_004236.3	NP_001137359.1|NP_004227.1	P61201	CSN2_HUMAN	COP9 signalosome subunit 2	420					cell proliferation (GO:0008283)|cullin deneddylation (GO:0010388)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)	p.R420*(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(2)	18		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		GCAGTATATCGTGCACCACCC	0.413																																					p.R427X	NSCLC(36;322 1063 10349 30082 48062)|Esophageal Squamous(122;685 1633 15569 21293 52803)	.											COPS2,NS,carcinoma,0,1	COPS2	0	1	Substitution - Nonsense(1)	kidney(1)	c.C1279T						.						176.0	164.0	168.0					15																	49420221		2196	4295	6491	SO:0001587	stop_gained	9318	exon13			TATATCGTGCACC	AF212227	CCDS32235.1, CCDS45257.1	15q21.2	2013-03-14	2013-03-14						30747	protein-coding gene	gene with protein product		604508	"""COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)"""			7776974, 9535219	Standard	NM_004236		Approved	TRIP15, ALIEN, CSN2	uc001zxh.3	P61201		ENST00000388901.5:c.1258C>T	15.37:g.49420221G>A	ENSP00000373553:p.Arg420*	37	0		40	2	NM_001143887	O88950|Q15647|Q6FGP4|Q9BY54|Q9R249|Q9UNI2|Q9UNQ5	Nonsense_Mutation	SNP	ENST00000388901.5	37	CCDS32235.1	.	.	.	.	.	.	.	.	.	.	G	35	5.527367	0.96431	.	.	ENSG00000166200	ENST00000299259;ENST00000388901;ENST00000542928	.	.	.	5.86	5.86	0.93980	.	0.118289	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	11.9432	20.2019	0.98263	0.0:0.0:1.0:0.0	.	.	.	.	X	427;420;356	.	ENSP00000299259:R427X	R	-	1	2	COPS2	47207513	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.970000	0.88000	2.776000	0.95493	0.655000	0.94253	CGA	.		0.413	COPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417840.1	NM_004236	
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	48314511	48314511	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr7:48314511C>T	ENST00000435803.1	+	17	5272	c.5248C>T	c.(5248-5250)Ctt>Ttt	p.L1750F		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1750					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GTACTATGTGCTTCCTCATGC	0.463																																					p.L1750F		.											.	.	.	0			c.C5248T						.						79.0	78.0	79.0					7																	48314511		2025	4202	6227	SO:0001583	missense	154664	exon17			TATGTGCTTCCTC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.5248C>T	7.37:g.48314511C>T	ENSP00000411096:p.Leu1750Phe	53	0		54	10	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.384663	0.42308	.	.	ENSG00000179869	ENST00000435803	T	0.22539	1.95	5.92	5.02	0.67125	.	0.000000	0.43110	D	0.000618	T	0.41305	0.1153	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.15983	-1.0418	9	.	.	.	.	13.8218	0.63325	0.1529:0.8471:0.0:0.0	.	1750	Q86UQ4	ABCAD_HUMAN	F	1750	ENSP00000411096:L1750F	.	L	+	1	0	ABCA13	48285057	0.687000	0.27671	0.378000	0.26068	0.063000	0.16089	1.042000	0.30303	1.470000	0.48102	0.557000	0.71058	CTT	.		0.463	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
USPL1	10208	hgsc.bcm.edu	37	13	31205413	31205413	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr13:31205413G>T	ENST00000255304.4	+	4	1012	c.670G>T	c.(670-672)Gct>Tct	p.A224S	USPL1_ENST00000465952.1_3'UTR	NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	224					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		ATTTCCCCAGGCTTTATGTGT	0.453																																					p.A224S	Ovarian(60;318 1180 1554 28110 31601)	.											.	.	.	0			c.G670T						.						215.0	190.0	199.0					13																	31205413		2203	4300	6503	SO:0001583	missense	10208	exon4			CCCCAGGCTTTAT	X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.670G>T	13.37:g.31205413G>T	ENSP00000255304:p.Ala224Ser	58	0		74	3	NM_005800	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	ENST00000255304.4	37	CCDS9336.1	.	.	.	.	.	.	.	.	.	.	A	6.412	0.444225	0.12164	.	.	ENSG00000132952	ENST00000255304	T	0.06068	3.35	6.07	-4.87	0.03123	.	1.079220	0.06995	N	0.822255	T	0.01222	0.0040	N	0.00538	-1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44802	-0.9304	10	0.09084	T	0.74	-5.0569	1.0311	0.01538	0.2613:0.2707:0.2769:0.1912	.	224	Q5W0Q7	USPL1_HUMAN	S	224	ENSP00000255304:A224S	ENSP00000255304:A224S	A	+	1	0	USPL1	30103413	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.781000	0.04648	-0.664000	0.05324	-0.982000	0.02568	GCT	.		0.453	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044369.1	NM_005800	
GPS2	2874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7216703	7216703	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr17:7216703C>G	ENST00000380728.2	-	8	1020	c.720G>C	c.(718-720)caG>caC	p.Q240H	GPS2_ENST00000389167.5_Missense_Mutation_p.Q240H|RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000391950.3_Missense_Mutation_p.Q240H			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	240					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				TATCACCTGTCTGAGTGGGCT	0.547											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q240H		.											.	.	.	0			c.G720C						.						96.0	99.0	98.0					17																	7216703		2203	4300	6503	SO:0001583	missense	2874	exon8			ACCTGTCTGAGTG	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.720G>C	17.37:g.7216703C>G	ENSP00000370104:p.Gln240His	41	0	640	28	14	NM_004489	B4DXA1|Q6FHM8	Missense_Mutation	SNP	ENST00000380728.2	37	CCDS11100.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396115	0.42512	.	.	ENSG00000132522	ENST00000391950;ENST00000380728;ENST00000389167;ENST00000315601	T;T	0.52526	0.66;0.66	4.74	1.51	0.23008	.	0.240755	0.26549	U	0.023748	T	0.40815	0.1132	N	0.17082	0.46	0.43408	D	0.995549	D	0.64830	0.994	P	0.62649	0.905	T	0.23511	-1.0186	10	0.31617	T	0.26	.	4.4745	0.11729	0.1622:0.5489:0.0:0.2889	.	240	Q13227	GPS2_HUMAN	H	240	ENSP00000370104:Q240H;ENSP00000379841:Q240H	ENSP00000319371:Q240H	Q	-	3	2	GPS2	7157427	0.991000	0.36638	1.000000	0.80357	0.994000	0.84299	-0.039000	0.12124	0.618000	0.30179	0.655000	0.94253	CAG	.		0.547	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489	
IARS2	55699	hgsc.bcm.edu	37	1	220284124	220284124	+	Intron	SNP	A	A	T	rs554865203		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr1:220284124A>T	ENST00000302637.5	+	11	1431				IARS2_ENST00000366922.1_Intron	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial						gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TTTTTTTTTTAAAGTTATAAA	0.338																																					.		.											.	.	.	0			.						.						40.0	46.0	44.0					1																	220284124		2203	4299	6502	SO:0001627	intron_variant	26828	.			TTTTTTAAAGTTA	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.1328-4A>T	1.37:g.220284124A>T		52	0		77	4	.	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	RNA	SNP	ENST00000302637.5	37	CCDS1523.1																																																																																			.		0.338	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
GRIN1	2902	hgsc.bcm.edu	37	9	140053112	140053112	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr9:140053112G>T	ENST00000371561.3	+	8	2250	c.1153G>T	c.(1153-1155)Gag>Tag	p.E385*	GRIN1_ENST00000371559.4_Nonsense_Mutation_p.E385*|GRIN1_ENST00000371546.4_Nonsense_Mutation_p.E406*|GRIN1_ENST00000371550.4_Nonsense_Mutation_p.E385*|GRIN1_ENST00000315048.3_Nonsense_Mutation_p.E385*|GRIN1_ENST00000371553.3_Nonsense_Mutation_p.E406*|GRIN1_ENST00000371555.4_Nonsense_Mutation_p.E406*|GRIN1_ENST00000371560.3_Nonsense_Mutation_p.E406*|GRIN1_ENST00000350902.5_Nonsense_Mutation_p.E385*|GRIN1_ENST00000471122.1_3'UTR	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	385					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCCAGGCGGAGAGACAGAGAA	0.627																																					p.E406X	NSCLC(113;717 1653 2089 20474 37618)	.											GRIN1,NS,carcinoma,0,1	GRIN1	0	0			c.G1216T						.						85.0	86.0	85.0					9																	140053112		2203	4300	6503	SO:0001587	stop_gained	2902	exon9			GGCGGAGAGACAG		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.1153G>T	9.37:g.140053112G>T	ENSP00000360616:p.Glu385*	74	0		68	3	NM_001185091	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Nonsense_Mutation	SNP	ENST00000371561.3	37	CCDS7031.1	.	.	.	.	.	.	.	.	.	.	G	36	5.966162	0.97156	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	.	.	.	4.27	4.27	0.50696	.	0.352416	0.28182	U	0.016291	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	15.2593	0.73610	0.0:0.0:1.0:0.0	.	.	.	.	X	385;385;385;385;406;406;406;385;406	.	ENSP00000316696:E385X	E	+	1	0	GRIN1	139172933	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.245000	0.95431	1.932000	0.55993	0.561000	0.74099	GAG	.		0.627	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327	
NR2E1	7101	hgsc.bcm.edu	37	6	108501554	108501554	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:108501554G>T	ENST00000368986.4	+	6	1378	c.670G>T	c.(670-672)Gaa>Taa	p.E224*	NR2E1_ENST00000368983.3_Nonsense_Mutation_p.E261*	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	224	Ligand-binding. {ECO:0000250}.				aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		TGCTTGGAGAGAACTGTTTGT	0.328																																					p.E224X		.											NR2E1,caecum,carcinoma,0,1	NR2E1	0	0			c.G670T						.						141.0	132.0	135.0					6																	108501554		2203	4300	6503	SO:0001587	stop_gained	7101	exon6			TGGAGAGAACTGT	Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.670G>T	6.37:g.108501554G>T	ENSP00000357982:p.Glu224*	53	0		39	2	NM_003269	Q6ZMP8	Nonsense_Mutation	SNP	ENST00000368986.4	37	CCDS5063.1	.	.	.	.	.	.	.	.	.	.	G	43	10.098514	0.99336	.	.	ENSG00000112333	ENST00000368986;ENST00000368983	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.4136	0.99023	0.0:0.0:1.0:0.0	.	.	.	.	X	224;261	.	ENSP00000357979:E261X	E	+	1	0	NR2E1	108608247	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.471000	0.97696	2.819000	0.97034	0.655000	0.94253	GAA	.		0.328	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041712.2		
ANPEP	290	hgsc.bcm.edu	37	15	90335685	90335685	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr15:90335685G>T	ENST00000300060.6	-	17	2671	c.2358C>A	c.(2356-2358)aaC>aaA	p.N786K		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	786	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	ACACTCACGGGTTATTATTGG	0.587																																					p.N786K	NSCLC(30;827 977 2459 19669 26125)	.											.	.	.	0			c.C2358A						.						139.0	124.0	129.0					15																	90335685		2200	4299	6499	SO:0001583	missense	290	exon17			TCACGGGTTATTA	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2358C>A	15.37:g.90335685G>T	ENSP00000300060:p.Asn786Lys	65	0		47	4	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.275096	0.59649	.	.	ENSG00000166825	ENST00000300060	T	0.05513	3.43	5.3	1.79	0.24919	.	0.212605	0.47093	D	0.000256	T	0.16896	0.0406	M	0.83483	2.645	0.46542	D	0.999099	D	0.61080	0.989	P	0.61940	0.896	T	0.24905	-1.0147	10	0.14656	T	0.56	.	6.7091	0.23266	0.1845:0.0:0.6659:0.1495	.	786	P15144	AMPN_HUMAN	K	786	ENSP00000300060:N786K	ENSP00000300060:N786K	N	-	3	2	ANPEP	88136689	1.000000	0.71417	0.977000	0.42913	0.622000	0.37654	3.295000	0.51794	0.572000	0.29383	0.555000	0.69702	AAC	.		0.587	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
RAD54L2	23132	hgsc.bcm.edu	37	3	51696927	51696927	+	Missense_Mutation	SNP	G	G	T	rs535074969		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:51696927G>T	ENST00000409535.2	+	22	4020	c.3895G>T	c.(3895-3897)Gtc>Ttc	p.V1299F	RAD54L2_ENST00000296477.3_Missense_Mutation_p.V993F	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1299						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CATGCCACCCGTCTCCTTAAA	0.602																																					p.V1299F		.											RAD54L2,colon,carcinoma,0,1	RAD54L2	0	0			c.G3895T						.						54.0	47.0	49.0					3																	51696927		2203	4300	6503	SO:0001583	missense	23132	exon22			CCACCCGTCTCCT	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.3895G>T	3.37:g.51696927G>T	ENSP00000386520:p.Val1299Phe	34	0		32	2	NM_015106	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.42|15.42	2.828910|2.828910	0.50845|0.50845	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000432863|ENST00000409535;ENST00000296477	.|D;D	.|0.93763	.|-3.19;-3.28	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.211630	.|0.41605	.|D	.|0.000841	D|D	0.87763|0.87763	0.6259|0.6259	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|P;P	.|0.40066	.|0.701;0.701	.|B;B	.|0.41271	.|0.352;0.265	D|D	0.88118|0.88118	0.2830|0.2830	5|10	.|0.45353	.|T	.|0.12	-18.191|-18.191	13.4518|13.4518	0.61176|0.61176	0.0:0.0:0.8435:0.1565|0.0:0.0:0.8435:0.1565	.|.	.|1299;888	.|Q9Y4B4;B3KV54	.|ARIP4_HUMAN;.	L|F	1127|1299;993	.|ENSP00000386520:V1299F;ENSP00000296477:V993F	.|ENSP00000296477:V993F	R|V	+|+	2|1	0|0	RAD54L2|RAD54L2	51671967|51671967	0.992000|0.992000	0.36948|0.36948	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	1.462000|1.462000	0.35266|0.35266	2.607000|2.607000	0.88179|0.88179	0.655000|0.655000	0.94253|0.94253	CGT|GTC	.		0.602	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
GPS2	2874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7216573	7216573	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr17:7216573C>A	ENST00000380728.2	-	9	1062	c.762G>T	c.(760-762)aaG>aaT	p.K254N	GPS2_ENST00000389167.5_Missense_Mutation_p.K254N|RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000391950.3_Missense_Mutation_p.K254N			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	254					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				GTTCCATCTGCTTTTGCAAGG	0.537											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K254N		.											.	.	.	0			c.G762T						.						130.0	127.0	128.0					17																	7216573		2203	4300	6503	SO:0001583	missense	2874	exon9			CATCTGCTTTTGC	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.762G>T	17.37:g.7216573C>A	ENSP00000370104:p.Lys254Asn	33	0	640	38	19	NM_004489	B4DXA1|Q6FHM8	Missense_Mutation	SNP	ENST00000380728.2	37	CCDS11100.1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.616199	0.66672	.	.	ENSG00000132522	ENST00000391950;ENST00000380728;ENST00000389167;ENST00000315601	T;T	0.61392	0.11;0.11	4.72	1.64	0.23874	.	0.000000	0.85682	U	0.000000	T	0.60196	0.2250	L	0.29908	0.895	0.54753	D	0.999981	D	0.76494	0.999	D	0.78314	0.991	T	0.58423	-0.7639	10	0.66056	D	0.02	-0.6767	8.6695	0.34140	0.0:0.739:0.0:0.261	.	254	Q13227	GPS2_HUMAN	N	254	ENSP00000370104:K254N;ENSP00000379841:K254N	ENSP00000319371:K254N	K	-	3	2	GPS2	7157297	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.431000	0.34925	0.215000	0.20761	0.643000	0.83706	AAG	.		0.537	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489	
ZNF45	7596	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44417593	44417593	+	Silent	SNP	A	A	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr19:44417593A>G	ENST00000269973.5	-	10	3085	c.1995T>C	c.(1993-1995)gaT>gaC	p.D665D	RP11-15A1.2_ENST00000586247.1_RNA|ZNF45_ENST00000589703.1_Silent_p.D665D	NM_003425.3	NP_003416.1	Q02386	ZNF45_HUMAN	zinc finger protein 45	665					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	17						TGTCACCCTCATCATCAGCAT	0.413																																					p.D665D		.											.	.	.	0			c.T1995C						.						82.0	75.0	77.0					19																	44417593		2203	4300	6503	SO:0001819	synonymous_variant	7596	exon10			ACCCTCATCATCA	M67509	CCDS12632.1	19q13.2	2013-01-08	2005-01-11			ENSG00000124459		"""Zinc fingers, C2H2-type"", ""-"""	13111	protein-coding gene	gene with protein product		194554	"""zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)"", ""zinc finger protein 13"""	ZNF13		9067431	Standard	NM_003425		Approved		uc002oxw.2	Q02386		ENST00000269973.5:c.1995T>C	19.37:g.44417593A>G		37	0		53	22	NM_003425	P17016|P78472|Q9P1U9	Silent	SNP	ENST00000269973.5	37	CCDS12632.1																																																																																			.		0.413	ZNF45-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459919.1	NM_003425	
NETO2	81831	hgsc.bcm.edu	37	16	47117434	47117434	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr16:47117434G>A	ENST00000562435.1	-	9	1660	c.1276C>T	c.(1276-1278)Cgg>Tgg	p.R426W	NETO2_ENST00000303155.5_Missense_Mutation_p.R419W	NM_018092.4	NP_060562.3	Q8NC67	NETO2_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 2	426					regulation of kainate selective glutamate receptor activity (GO:2000312)	kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)		p.R426W(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	29		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)				GAGGAGCGCCGCATCTTCTGG	0.532										HNSCC(25;0.065)																											p.R426W		.											NETO2,colon,carcinoma,0,1	NETO2	0	1	Substitution - Missense(1)	large_intestine(1)	c.C1276T						.						87.0	82.0	83.0					16																	47117434		2203	4300	6503	SO:0001583	missense	81831	exon9			AGCGCCGCATCTT	AK001292	CCDS10727.1, CCDS58460.1	16q11.2	2008-08-04			ENSG00000171208	ENSG00000171208			14644	protein-coding gene	gene with protein product		607974				11943477	Standard	NM_018092		Approved	FLJ10430, NEOT2	uc002eer.2	Q8NC67	OTTHUMG00000133101	ENST00000562435.1:c.1276C>T	16.37:g.47117434G>A	ENSP00000455169:p.Arg426Trp	42	0		39	2	NM_018092	J3KNF1|Q7Z381|Q8ND51|Q96SP4|Q9NVY8	Missense_Mutation	SNP	ENST00000562435.1	37	CCDS10727.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565128	0.45694	.	.	ENSG00000171208	ENST00000303155	T	0.44881	0.91	5.78	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.37544	0.1007	L	0.47716	1.5	0.54753	D	0.999989	B;B;B	0.29301	0.241;0.153;0.238	B;B;B	0.25759	0.063;0.018;0.04	T	0.23190	-1.0195	10	0.54805	T	0.06	.	14.2876	0.66256	0.0:0.0:0.5757:0.4243	.	283;426;102	B7Z4I7;Q8NC67;Q8NC67-2	.;NETO2_HUMAN;.	W	426	ENSP00000306726:R426W	ENSP00000306726:R426W	R	-	1	2	NETO2	45674935	1.000000	0.71417	0.999000	0.59377	0.813000	0.45954	1.196000	0.32198	1.398000	0.46701	0.655000	0.94253	CGG	.		0.532	NETO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256766.2	NM_018092	
ZDHHC21	340481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	14619079	14619079	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr9:14619079G>A	ENST00000380916.4	-	10	1149	c.683C>T	c.(682-684)cCa>cTa	p.P228L		NM_178566.4	NP_848661.1	Q8IVQ6	ZDH21_HUMAN	zinc finger, DHHC-type containing 21	228					hair follicle development (GO:0001942)|nitric oxide metabolic process (GO:0046209)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)|regulation of nitric-oxide synthase activity (GO:0050999)|sebaceous gland development (GO:0048733)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(2)|skin(1)	9				GBM - Glioblastoma multiforme(50;4.31e-06)		CTGCTGCCATGGCTTTCGGGG	0.493																																					p.P228L		.											.	.	.	0			c.C683T						.						98.0	95.0	96.0					9																	14619079		2203	4300	6503	SO:0001583	missense	340481	exon10			TGCCATGGCTTTC	AF161360	CCDS6475.1	9p22.3	2010-02-09			ENSG00000175893	ENSG00000175893		"""Zinc fingers, DHHC-type"""	20750	protein-coding gene	gene with protein product		614605				19956733	Standard	NM_178566		Approved	HSPC097, DNZ1	uc003zlg.2	Q8IVQ6	OTTHUMG00000019573	ENST00000380916.4:c.683C>T	9.37:g.14619079G>A	ENSP00000370303:p.Pro228Leu	16	0		18	9	NM_178566	A8KA95|D3DRI7|Q5VWG1	Missense_Mutation	SNP	ENST00000380916.4	37	CCDS6475.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.636078	0.47049	.	.	ENSG00000175893	ENST00000380916	T	0.44881	0.91	5.82	5.82	0.92795	.	0.050905	0.85682	D	0.000000	T	0.52677	0.1749	N	0.19112	0.55	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	T	0.55490	-0.8133	10	0.59425	D	0.04	-5.5751	20.0938	0.97831	0.0:0.0:1.0:0.0	.	228	Q8IVQ6	ZDH21_HUMAN	L	228	ENSP00000370303:P228L	ENSP00000370303:P228L	P	-	2	0	ZDHHC21	14609079	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.477000	0.81069	2.757000	0.94681	0.585000	0.79938	CCA	.		0.493	ZDHHC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051748.2	NM_178566	
POLE	5426	hgsc.bcm.edu;bcgsc.ca	37	12	133233951	133233951	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr12:133233951G>T	ENST00000320574.5	-	28	3486	c.3443C>A	c.(3442-3444)cCt>cAt	p.P1148H	POLE_ENST00000535270.1_Missense_Mutation_p.P1121H	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1148					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CAGGGCCGCAGGGATGGTGAT	0.577								DNA polymerases (catalytic subunits)																													p.P1148H		.											.	.	.	0			c.C3443A						.						66.0	64.0	65.0					12																	133233951		2203	4300	6503	SO:0001583	missense	5426	exon28			GCCGCAGGGATGG		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.3443C>A	12.37:g.133233951G>T	ENSP00000322570:p.Pro1148His	33	0		45	4	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.867705	0.91587	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000536445;ENST00000376577	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.58722	0.2142	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69738	-0.5064	10	0.87932	D	0	.	20.6242	0.99512	0.0:0.0:1.0:0.0	.	1121;1148	F5H1D6;Q07864	.;DPOE1_HUMAN	H	1148;1159;1121;928;125;1083	ENSP00000322570:P1148H;ENSP00000406383:P1159H;ENSP00000445753:P1121H;ENSP00000442519:P928H	ENSP00000322570:P1148H	P	-	2	0	POLE	131744024	1.000000	0.71417	0.654000	0.29608	0.834000	0.47266	9.715000	0.98748	2.880000	0.98712	0.650000	0.86243	CCT	.		0.577	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
ENAM	10117	hgsc.bcm.edu	37	4	71510219	71510219	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr4:71510219G>T	ENST00000396073.3	+	9	3357	c.3076G>T	c.(3076-3078)Gaa>Taa	p.E1026*	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	1026					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.E1026Q(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			TACACCTGATGAAGGCTCCAA	0.433																																					p.E1026X		.											ENAM_ENST00000396073,NS,carcinoma,0,1	ENAM_ENST00000396073	0	1	Substitution - Missense(1)	lung(1)	c.G3076T						.						120.0	106.0	110.0					4																	71510219		2203	4300	6503	SO:0001587	stop_gained	10117	exon9			CCTGATGAAGGCT	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.3076G>T	4.37:g.71510219G>T	ENSP00000379383:p.Glu1026*	41	0		32	2	NM_031889	Q17RI5|Q9H3D1	Nonsense_Mutation	SNP	ENST00000396073.3	37	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	G	38	6.681755	0.97759	.	.	ENSG00000132464	ENST00000396073	.	.	.	5.97	1.41	0.22369	.	0.334009	0.26010	N	0.026897	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-9.535	4.7276	0.12948	0.2261:0.3184:0.4555:0.0	.	.	.	.	X	1026	.	ENSP00000379383:E1026X	E	+	1	0	ENAM	71729083	0.399000	0.25287	0.104000	0.21259	0.247000	0.25773	0.605000	0.24179	0.216000	0.20781	0.655000	0.94253	GAA	.		0.433	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889	
SHROOM3	57619	hgsc.bcm.edu	37	4	77700128	77700128	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr4:77700128C>T	ENST00000296043.6	+	11	6742	c.5789C>T	c.(5788-5790)aCg>aTg	p.T1930M	RP11-359D14.3_ENST00000449007.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1930	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			ATGAAGTCCACGCTCCTCATT	0.542																																					p.T1930M		.											SHROOM3,NS,carcinoma,0,1	SHROOM3	0	0			c.C5789T						.						103.0	100.0	101.0					4																	77700128		2203	4300	6503	SO:0001583	missense	57619	exon11			AGTCCACGCTCCT	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.5789C>T	4.37:g.77700128C>T	ENSP00000296043:p.Thr1930Met	34	0		21	2	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	37	CCDS3579.2	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820523	0.71028	.	.	ENSG00000138771	ENST00000296043	T	0.30714	1.52	5.31	4.47	0.54385	Apx/shroom, ASD2 (2);	0.652135	0.15514	N	0.258405	T	0.27489	0.0675	L	0.36672	1.1	0.37705	D	0.924345	D	0.54397	0.966	B	0.41412	0.356	T	0.29366	-1.0014	10	0.87932	D	0	-4.0445	14.0021	0.64439	0.0:0.9277:0.0:0.0723	.	1930	Q8TF72	SHRM3_HUMAN	M	1930	ENSP00000296043:T1930M	ENSP00000296043:T1930M	T	+	2	0	SHROOM3	77919152	0.999000	0.42202	0.349000	0.25694	0.685000	0.39939	5.563000	0.67352	1.482000	0.48325	0.591000	0.81541	ACG	.		0.542	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
HLA-B	3106	hgsc.bcm.edu	37	6	31322910	31322910	+	Missense_Mutation	SNP	G	G	A	rs74189305		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:31322910G>A	ENST00000412585.2	-	5	1014	c.986C>T	c.(985-987)gCt>gTt	p.A329V		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	329			A -> T (in dbSNP:rs1051488).		antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.A329V(4)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						ACACATCACAGCAGCGACCAC	0.587									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.A329V		.											HLA-B,NS,carcinoma,-1,4	HLA-B	-1	4	Substitution - Missense(4)	kidney(4)	c.C986T						.						102.0	101.0	101.0					6																	31322910		1511	2709	4220	SO:0001583	missense	3106	exon5	Familial Cancer Database	;Lichen Sclerosis, Familial	ATCACAGCAGCGA	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.986C>T	6.37:g.31322910G>A	ENSP00000399168:p.Ala329Val	53	2		54	3	NM_005514	Q29764	Missense_Mutation	SNP	ENST00000412585.2	37	CCDS34394.1	.	.	.	.	.	.	.	.	.	.	N	9.051	0.992087	0.18966	.	.	ENSG00000234745	ENST00000412585;ENST00000428231	T	0.00622	6.16	3.73	-3.02	0.05446	.	.	.	.	.	T	0.00109	0.0003	N	0.00729	-1.24	0.09310	N	1	B	0.20052	0.041	B	0.29077	0.098	T	0.22906	-1.0203	9	0.49607	T	0.09	.	5.2273	0.15401	0.4363:0.3516:0.2121:0.0	.	329	P01889	1B07_HUMAN	V	329;208	ENSP00000399168:A329V	ENSP00000399168:A329V	A	-	2	0	HLA-B	31430889	0.000000	0.05858	0.128000	0.21923	0.021000	0.10359	0.033000	0.13754	-0.241000	0.09681	0.448000	0.29417	GCT	.		0.587	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
ARSI	340075	hgsc.bcm.edu	37	5	149678175	149678175	+	Splice_Site	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:149678175C>A	ENST00000328668.7	-	2	891	c.312G>T	c.(310-312)agG>agT	p.R104S		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	104					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGATCTGGTACCTGGTGGGGA	0.612																																					p.R104S		.											.	.	.	0			c.G312T						.						49.0	54.0	53.0					5																	149678175		2180	4274	6454	SO:0001630	splice_region_variant	340075	exon2			CTGGTACCTGGTG	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.312-1G>T	5.37:g.149678175C>A		20	0		34	4	NM_001012301	A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	ENST00000328668.7	37	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456559	0.63401	.	.	ENSG00000183876	ENST00000328668	D	0.97016	-4.21	4.41	2.59	0.31030	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.97439	0.9162	M	0.91140	3.18	0.80722	D	1	P	0.46859	0.885	P	0.53760	0.734	D	0.96600	0.9444	10	0.72032	D	0.01	.	9.5578	0.39351	0.0:0.8256:0.0:0.1744	.	104	Q5FYB1	ARSI_HUMAN	S	104	ENSP00000333395:R104S	ENSP00000333395:R104S	R	-	3	2	ARSI	149658368	1.000000	0.71417	0.997000	0.53966	0.771000	0.43674	2.079000	0.41577	0.475000	0.27415	0.561000	0.74099	AGG	.		0.612	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301	Missense_Mutation
KPNA5	3841	hgsc.bcm.edu	37	6	117045494	117045494	+	Missense_Mutation	SNP	A	A	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:117045494A>G	ENST00000368564.1	+	10	1103	c.955A>G	c.(955-957)Agg>Ggg	p.R319G	KPNA5_ENST00000356348.1_Missense_Mutation_p.R319G			O15131	IMA6_HUMAN	karyopherin alpha 5 (importin alpha 6)	316	NLS binding site (minor). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(6)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		ACCTGCATTAAGGGCAGTTGG	0.274																																					p.R319G		.											KPNA5,caecum,carcinoma,-2,1	KPNA5	-2	0			c.A955G						.						90.0	90.0	90.0					6																	117045494		2203	4295	6498	SO:0001583	missense	3841	exon10			GCATTAAGGGCAG	AF005361	CCDS5111.1	6q22.2	2013-02-14			ENSG00000196911	ENSG00000196911		"""Importins"", ""Armadillo repeat containing"""	6398	protein-coding gene	gene with protein product		604545				9395085	Standard	NM_002269		Approved	SRP6, IPOA6	uc003pxh.3	O15131	OTTHUMG00000015448	ENST00000368564.1:c.955A>G	6.37:g.117045494A>G	ENSP00000357552:p.Arg319Gly	52	0		48	2	NM_002269	B2RAI5|Q86X23	Missense_Mutation	SNP	ENST00000368564.1	37	CCDS5111.1	.	.	.	.	.	.	.	.	.	.	A	18.29	3.591801	0.66219	.	.	ENSG00000196911	ENST00000368564;ENST00000356348	T;T	0.66815	-0.23;-0.23	5.49	4.31	0.51392	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84584	0.5504	H	0.97611	4.04	0.45025	D	0.998047	D	0.89917	1.0	D	0.97110	1.0	D	0.89058	0.3460	10	0.87932	D	0	.	12.5675	0.56318	0.8608:0.1392:0.0:0.0	.	316	O15131	IMA5_HUMAN	G	319	ENSP00000357552:R319G;ENSP00000348704:R319G	ENSP00000348704:R319G	R	+	1	2	KPNA5	117152187	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.233000	0.32648	0.893000	0.36288	-0.435000	0.05868	AGG	.		0.274	KPNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041967.1	NM_002269	
CD36	948	hgsc.bcm.edu	37	7	80302680	80302680	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr7:80302680G>T	ENST00000435819.1	+	16	1893	c.1209G>T	c.(1207-1209)aaG>aaT	p.K403N	CD36_ENST00000544133.1_3'UTR|CD36_ENST00000432207.1_Missense_Mutation_p.K403N|CD36_ENST00000433696.2_Missense_Mutation_p.K364N|CD36_ENST00000394788.3_Missense_Mutation_p.K403N|CD36_ENST00000538969.1_Missense_Mutation_p.K343N|CD36_ENST00000534394.1_Missense_Mutation_p.K327N|CD36_ENST00000447544.2_Missense_Mutation_p.K403N|CD36_ENST00000309881.7_Missense_Mutation_p.K403N			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	403					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						GAGTATTAAAGAATCTGAAGA	0.249																																					p.K403N		.											CD36_ENST00000447544,NS,carcinoma,0,8	CD36_ENST00000447544	0	0			c.G1209T						.						64.0	67.0	66.0					7																	80302680		2202	4271	6473	SO:0001583	missense	948	exon11			ATTAAAGAATCTG	Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.1209G>T	7.37:g.80302680G>T	ENSP00000399421:p.Lys403Asn	77	0		50	2	NM_001127444	D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Missense_Mutation	SNP	ENST00000435819.1	37	CCDS34673.1	.	.	.	.	.	.	.	.	.	.	G	8.228	0.804067	0.16467	.	.	ENSG00000135218	ENST00000435819;ENST00000309881;ENST00000534394;ENST00000394788;ENST00000447544;ENST00000432207;ENST00000419819;ENST00000538969;ENST00000433696	T;T;T;T;T;T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76;-0.76;-0.76;-0.76;-0.76;-0.76	5.83	2.86	0.33363	.	0.630622	0.16735	N	0.201646	T	0.61198	0.2328	L	0.51914	1.62	0.09310	N	0.999999	B	0.18013	0.025	B	0.22601	0.04	T	0.45731	-0.9241	9	.	.	.	-14.9671	1.0385	0.01554	0.2507:0.1471:0.4305:0.1717	.	403	P16671	CD36_HUMAN	N	403;403;327;403;403;403;403;343;364	ENSP00000399421:K403N;ENSP00000308165:K403N;ENSP00000431296:K327N;ENSP00000378268:K403N;ENSP00000415743:K403N;ENSP00000411411:K403N;ENSP00000392298:K403N;ENSP00000439543:K343N;ENSP00000401863:K364N	.	K	+	3	2	CD36	80140616	0.191000	0.23288	0.541000	0.28102	0.015000	0.08874	0.555000	0.23422	1.473000	0.48159	0.655000	0.94253	AAG	.		0.249	CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339767.6	NM_001001547	
MGA	23269	hgsc.bcm.edu	37	15	42046766	42046766	+	Splice_Site	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr15:42046766G>A	ENST00000570161.1	+	17	7139		c.e17+1		MGA_ENST00000389936.4_Splice_Site|MGA_ENST00000545763.1_Splice_Site|MGA_ENST00000566586.1_Splice_Site|MGA_ENST00000219905.7_Splice_Site			O43451	MGA_HUMAN	MGA, MAX dimerization protein						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TCAAACAGCCGTAAGTCTTAT	0.433																																					.		.											MGA,NS,carcinoma,0,1	MGA	0	0			c.6512+1G>A						.						57.0	61.0	60.0					15																	42046766		1931	4127	6058	SO:0001630	splice_region_variant	23269	exon17			ACAGCCGTAAGTC	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7139+1G>A	15.37:g.42046766G>A		44	0		44	2	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Splice_Site	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759179	0.69763	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0525	0.93051	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MGA	39834058	1.000000	0.71417	0.977000	0.42913	0.721000	0.41392	6.778000	0.75043	2.503000	0.84419	0.484000	0.47621	.	.		0.433	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	Intron
PCDHA4	56144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140188703	140188703	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:140188703G>A	ENST00000530339.1	+	1	1931	c.1931G>A	c.(1930-1932)cGc>cAc	p.R644H	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.R644H|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.R644H	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	644	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R644H(2)		breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGCTCCGCGCCACCGCCTA	0.682																																					p.R644H		.											PCDHA4_ENST00000530339,NS,carcinoma,0,2	PCDHA4_ENST00000530339	0	2	Substitution - Missense(2)	endometrium(2)	c.G1931A						.						76.0	78.0	78.0					5																	140188703		2203	4300	6503	SO:0001583	missense	56144	exon1			CTCCGCGCCACCG	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1931G>A	5.37:g.140188703G>A	ENSP00000435300:p.Arg644His	58	1		63	20	NM_031500	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	g	4.234	0.042396	0.08196	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.52754	0.65;0.65;0.65	4.08	2.23	0.28157	Cadherin (4);Cadherin-like (1);	0.194269	0.23758	U	0.044856	T	0.38772	0.1053	L	0.43598	1.365	0.09310	N	1	B;B;B	0.31383	0.321;0.282;0.282	B;B;B	0.37047	0.073;0.082;0.24	T	0.35798	-0.9774	10	0.72032	D	0.01	.	5.2422	0.15477	0.172:0.0:0.6642:0.1638	.	644;644;644	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	H	644	ENSP00000423470:R644H;ENSP00000349344:R644H;ENSP00000435300:R644H	ENSP00000349344:R644H	R	+	2	0	PCDHA4	140168887	0.000000	0.05858	0.046000	0.18839	0.017000	0.09413	0.275000	0.18698	0.299000	0.22661	-0.516000	0.04426	CGC	.		0.682	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
ZNF100	163227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	21910728	21910728	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr19:21910728T>A	ENST00000358296.6	-	5	584	c.386A>T	c.(385-387)gAa>gTa	p.E129V	ZNF100_ENST00000305570.6_Missense_Mutation_p.E65V	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	129					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						CAGAATCGCTTCTTGAAAAGA	0.318																																					p.E129V		.											.	.	.	0			c.A386T						.						59.0	57.0	58.0					19																	21910728		1930	4167	6097	SO:0001583	missense	163227	exon5			ATCGCTTCTTGAA	BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.386A>T	19.37:g.21910728T>A	ENSP00000351042:p.Glu129Val	78	0		45	21	NM_173531	Q7M4M0	Missense_Mutation	SNP	ENST00000358296.6	37	CCDS42538.1	.	.	.	.	.	.	.	.	.	.	.	9.776	1.173969	0.21704	.	.	ENSG00000197020	ENST00000358296	T	0.05717	3.4	0.131	0.131	0.14755	.	.	.	.	.	T	0.04998	0.0134	L	0.40543	1.245	0.20196	N	0.999926	B;P	0.38745	0.136;0.645	B;B	0.32533	0.04;0.147	T	0.34900	-0.9810	9	0.66056	D	0.02	.	6.0091	0.19565	0.0:1.0E-4:0.0:0.9999	.	129;183	Q8IYN0;Q4G131	ZN100_HUMAN;.	V	129	ENSP00000351042:E129V	ENSP00000351042:E129V	E	-	2	0	ZNF100	21702568	0.034000	0.19679	0.097000	0.21041	0.096000	0.18686	0.903000	0.28475	0.148000	0.19059	0.147000	0.16070	GAA	.		0.318	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464087.1	NM_173531	
DIAPH3	81624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	60435664	60435664	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr13:60435664C>A	ENST00000400324.4	-	22	2834	c.2614G>T	c.(2614-2616)Gac>Tac	p.D872Y	DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400320.1_Missense_Mutation_p.D826Y|DIAPH3_ENST00000377908.2_Missense_Mutation_p.D861Y|DIAPH3_ENST00000400319.1_Missense_Mutation_p.D802Y|DIAPH3_ENST00000400330.1_Missense_Mutation_p.D872Y|DIAPH3_ENST00000267215.4_Missense_Mutation_p.D872Y	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	872	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		GATTTTGTGTCCTTTAGCTAA	0.323																																					p.D872Y		.											.	.	.	0			c.G2614T						.						130.0	119.0	122.0					13																	60435664		1823	4084	5907	SO:0001583	missense	81624	exon22			TTGTGTCCTTTAG	AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2614G>T	13.37:g.60435664C>A	ENSP00000383178:p.Asp872Tyr	75	0		89	9	NM_001042517	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	37	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618116	0.87359	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	T;T;T;T;T;T	0.54071	1.9;1.9;1.9;1.9;1.9;0.59	5.62	5.62	0.85841	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.81578	0.4852	H	0.94620	3.56	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	D	0.86360	0.1716	10	0.87932	D	0	.	19.6569	0.95845	0.0:1.0:0.0:0.0	.	609;609;872	Q9NSV4-2;Q9NSV4-1;Q9NSV4	.;.;DIAP3_HUMAN	Y	872;872;861;826;802;861;802;826;872;609;872	ENSP00000383178:D872Y;ENSP00000383184:D872Y;ENSP00000367141:D861Y;ENSP00000383173:D802Y;ENSP00000383174:D826Y;ENSP00000267215:D872Y	ENSP00000267214:D609Y	D	-	1	0	DIAPH3	59333665	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.487000	0.81328	2.652000	0.90054	0.561000	0.74099	GAC	.		0.323	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
TPTEP1	387590	hgsc.bcm.edu	37	22	17135026	17135026	+	lincRNA	SNP	T	T	C			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr22:17135026T>C	ENST00000426585.1	+	0	11450									transmembrane phosphatase with tensin homology pseudogene 1																		AAATGTAATGTGGTACTAAAC	0.303																																					.		.											.	.	.	0			.						.																																					23783	.			GTAATGTGGTACT			22q11.1	2013-10-15			ENSG00000100181	ENSG00000100181			43648	pseudogene	pseudogene						14659893	Standard	NR_001591		Approved	psiTPTE22	uc002zlr.3		OTTHUMG00000141300		22.37:g.17135026T>C		21	0		33	4	.		RNA	SNP	ENST00000426585.1	37																																																																																				.		0.303	TPTEP1-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000280575.1	NR_001591	
MYH13	8735	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	10215287	10215287	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr17:10215287G>A	ENST00000418404.3	-	31	4635	c.4472C>T	c.(4471-4473)gCc>gTc	p.A1491V	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.A1491V			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1491					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTCCTCATAGGCATTCCTCAT	0.527																																					p.A1491V		.											.	.	.	0			c.C4472T						.						105.0	106.0	105.0					17																	10215287		2059	4207	6266	SO:0001583	missense	8735	exon32			TCATAGGCATTCC	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4472C>T	17.37:g.10215287G>A	ENSP00000404570:p.Ala1491Val	36	0		33	4	NM_003802	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.368914	0.61624	.	.	ENSG00000006788	ENST00000252172	T	0.78707	-1.2	4.45	4.45	0.53987	Myosin tail (1);	.	.	.	.	D	0.85570	0.5727	M	0.88105	2.93	0.43536	D	0.99582	B	0.16603	0.018	B	0.37451	0.25	D	0.86081	0.1544	9	0.72032	D	0.01	.	17.6487	0.88157	0.0:0.0:1.0:0.0	.	1491	Q9UKX3	MYH13_HUMAN	V	1491	ENSP00000252172:A1491V	ENSP00000252172:A1491V	A	-	2	0	MYH13	10156012	1.000000	0.71417	0.744000	0.31058	0.538000	0.34931	9.596000	0.98267	2.465000	0.83290	0.655000	0.94253	GCC	.		0.527	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
GPR144	347088	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	127239301	127239301	+	Silent	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr9:127239301C>T	ENST00000334810.1	+	20	2814	c.2814C>T	c.(2812-2814)agC>agT	p.S938S				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	938					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						AGGAGCACAGCCTGCCTTTCT	0.652																																					p.S938S		.											.	.	.	0			c.C2814T						.						114.0	121.0	119.0					9																	127239301		692	1591	2283	SO:0001819	synonymous_variant	347088	exon20			GCACAGCCTGCCT	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.2814C>T	9.37:g.127239301C>T		66	0		61	10	NM_001161808	Q86SL4|Q8NH12	Silent	SNP	ENST00000334810.1	37	CCDS48016.1																																																																																			.		0.652	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
MYO1C	4641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	1384109	1384109	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr17:1384109C>A	ENST00000575158.1	-	6	769	c.593G>T	c.(592-594)gGg>gTg	p.G198V	MYO1C_ENST00000438665.2_Missense_Mutation_p.G214V|MYO1C_ENST00000545534.2_Missense_Mutation_p.G209V|MYO1C_ENST00000359786.5_Missense_Mutation_p.G233V|MYO1C_ENST00000573198.1_5'UTR|MYO1C_ENST00000361007.2_Missense_Mutation_p.G198V			Q12965	MYO1E_HUMAN	myosin IC	205	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GTTCCGCTCCCCATGATTCTG	0.622																																					p.G233V		.											.	.	.	0			c.G698T						.						102.0	100.0	100.0					17																	1384109		2203	4300	6503	SO:0001583	missense	4641	exon6			CGCTCCCCATGAT	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.593G>T	17.37:g.1384109C>A	ENSP00000459174:p.Gly198Val	79	0		68	33	NM_001080779	Q14778	Missense_Mutation	SNP	ENST00000575158.1	37	CCDS11003.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376460	0.82682	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534;ENST00000535421	T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91	4.96	4.96	0.65561	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.90390	0.6992	H	0.95745	3.715	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93137	0.6538	10	0.87932	D	0	.	17.366	0.87364	0.0:1.0:0.0:0.0	.	209;233;214	B7Z3E5;O00159;O00159-3	.;MYO1C_HUMAN;.	V	233;214;214;198;209;198	ENSP00000352834:G233V;ENSP00000412197:G214V;ENSP00000354283:G198V;ENSP00000437685:G209V	ENSP00000352834:G233V	G	-	2	0	MYO1C	1330859	1.000000	0.71417	0.987000	0.45799	0.745000	0.42441	7.651000	0.83577	2.575000	0.86900	0.462000	0.41574	GGG	.		0.622	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2		
GPR37	2861	hgsc.bcm.edu	37	7	124404434	124404434	+	Silent	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr7:124404434C>T	ENST00000303921.2	-	1	1247	c.597G>A	c.(595-597)aaG>aaA	p.K199K		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	199					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CATTGGCCGTCTTGGACAGGG	0.612																																					p.K199K		.											.	.	.	0			c.G597A						.						45.0	52.0	50.0					7																	124404434		2203	4299	6502	SO:0001819	synonymous_variant	2861	exon1			GGCCGTCTTGGAC		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.597G>A	7.37:g.124404434C>T		90	0		79	3	NM_005302	A4D0Y6|O00348|O14768|Q8TD39	Silent	SNP	ENST00000303921.2	37	CCDS5792.1																																																																																			.		0.612	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	
BRD2	6046	hgsc.bcm.edu	37	6	32945701	32945701	+	Missense_Mutation	SNP	G	G	T	rs3918142|rs200978040|rs483352931	byFrequency	TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:32945701G>T	ENST00000374825.4	+	9	3198	c.1497G>T	c.(1495-1497)gaG>gaT	p.E499D	BRD2_ENST00000449085.2_Missense_Mutation_p.E452D|BRD2_ENST00000395289.2_Missense_Mutation_p.E499D|BRD2_ENST00000443797.2_Missense_Mutation_p.E379D|BRD2_ENST00000374831.4_Missense_Mutation_p.E499D|BRD2_ENST00000395287.1_Missense_Mutation_p.E499D	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	499	Glu/Ser-rich.|Poly-Glu.				chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						aggaagatgaggaggacgagg	0.512																																					p.E499D		.											BRD2_ENST00000395289,uveal_tract,malignant_melanoma,0,1	BRD2_ENST00000395289	0	0			c.G1497T						.						114.0	95.0	102.0					6																	32945701		1510	2708	4218	SO:0001583	missense	6046	exon9			AGATGAGGAGGAC	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1497G>T	6.37:g.32945701G>T	ENSP00000363958:p.Glu499Asp	36	1		23	4	NM_005104	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	ENST00000374825.4	37	CCDS4762.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.831|9.831	1.188373|1.188373	0.21954|0.21954	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085|ENST00000449025	T;T;T;T;T;T|.	0.08720|.	4.22;4.22;4.22;3.06;4.22;4.22|.	4.75|4.75	-6.4|-6.4	0.01944|0.01944	.|.	0.309061|.	0.23519|.	N|.	0.047310|.	T|T	0.06005|0.06005	0.0156|0.0156	L|L	0.29908|0.29908	0.895|0.895	0.26798|0.26798	N|N	0.969267|0.969267	B;B|.	0.26445|.	0.069;0.149|.	B;B|.	0.20955|.	0.032;0.032|.	T|T	0.21381|0.21381	-1.0247|-1.0247	10|5	0.30078|.	T|.	0.28|.	-7.3676|-7.3676	0.775|0.775	0.01031|0.01031	0.3776:0.1096:0.1989:0.3139|0.3776:0.1096:0.1989:0.3139	.|.	499;499|.	A2AAU0;P25440|.	.;BRD2_HUMAN|.	D|M	499;499;499;379;499;452|505	ENSP00000363958:E499D;ENSP00000363964:E499D;ENSP00000378704:E499D;ENSP00000413495:E379D;ENSP00000378702:E499D;ENSP00000409145:E452D|.	ENSP00000363958:E499D|.	E|R	+|+	3|2	2|0	BRD2|BRD2	33053679|33053679	0.784000|0.784000	0.28713|0.28713	0.069000|0.069000	0.20011|0.20011	0.954000|0.954000	0.61252|0.61252	-0.683000|-0.683000	0.05179|0.05179	-1.921000|-1.921000	0.01068|0.01068	-0.834000|-0.834000	0.03071|0.03071	GAG|AGG	.		0.512	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	169509839	169509839	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:169509839G>A	ENST00000256935.8	+	52	5550	c.5470G>A	c.(5470-5472)Gac>Aac	p.D1824N	DOCK2_ENST00000540750.1_Missense_Mutation_p.D885N|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.D1316N	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1824					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACAGATCCCAGACTCGCTGTC	0.512																																					p.D1824N		.											.	.	.	0			c.G5470A						.						86.0	82.0	84.0					5																	169509839		2203	4300	6503	SO:0001583	missense	1794	exon52			ATCCCAGACTCGC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5470G>A	5.37:g.169509839G>A	ENSP00000256935:p.Asp1824Asn	37	0		54	18	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468588	0.43839	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.10005	3.62;3.22;2.92	4.54	3.67	0.42095	.	0.267746	0.35124	N	0.003435	T	0.05273	0.0140	N	0.08118	0	0.09310	N	1	B;B;B	0.27498	0.18;0.007;0.001	B;B;B	0.21546	0.035;0.003;0.002	T	0.33777	-0.9855	10	0.41790	T	0.15	.	8.9209	0.35610	0.102:0.0:0.898:0.0	.	1316;380;1824	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	N	1824;1316;885	ENSP00000256935:D1824N;ENSP00000429283:D1316N;ENSP00000438827:D885N	ENSP00000256935:D1824N	D	+	1	0	DOCK2	169442417	0.764000	0.28473	0.091000	0.20842	0.023000	0.10783	2.599000	0.46231	1.277000	0.44412	0.650000	0.86243	GAC	.		0.512	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
OGDHL	55753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	50960205	50960205	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr10:50960205G>T	ENST00000374103.4	-	5	653	c.568C>A	c.(568-570)Ctg>Atg	p.L190M	OGDHL_ENST00000419399.1_Missense_Mutation_p.L133M|OGDHL_ENST00000432695.1_De_novo_Start_InFrame	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	190					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						ATCTCCCGCAGAGAGAGGGTG	0.582																																					p.L190M		.											.	.	.	0			c.C568A						.						53.0	54.0	54.0					10																	50960205		2203	4300	6503	SO:0001583	missense	55753	exon5			CCCGCAGAGAGAG	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.568C>A	10.37:g.50960205G>T	ENSP00000363216:p.Leu190Met	43	0		30	7	NM_018245	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414175	0.83449	.	.	ENSG00000197444	ENST00000374103;ENST00000419399	T;T	0.17370	2.28;2.28	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000002	T	0.40932	0.1137	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.20806	-1.0264	10	0.54805	T	0.06	.	10.5926	0.45318	0.1171:0.0:0.8829:0.0	.	133;190	Q9ULD0-2;Q9ULD0	.;OGDHL_HUMAN	M	190;133	ENSP00000363216:L190M;ENSP00000401356:L133M	ENSP00000363216:L190M	L	-	1	2	OGDHL	50630211	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	3.390000	0.52523	2.615000	0.88500	0.591000	0.81541	CTG	.		0.582	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
PCNXL2	80003	hgsc.bcm.edu	37	1	233275579	233275579	+	Silent	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr1:233275579G>A	ENST00000258229.9	-	20	3774	c.3540C>T	c.(3538-3540)ttC>ttT	p.F1180F	PCNXL2_ENST00000488780.2_Silent_p.F313F|PCNXL2_ENST00000520463.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1180						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				AGAGTCTTTCGAACCACATTA	0.323																																					p.F1180F		.											.,1	.	204	0			c.C3540T						.						53.0	50.0	51.0					1																	233275579		1836	4077	5913	SO:0001819	synonymous_variant	80003	exon20			TCTTTCGAACCAC	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.3540C>T	1.37:g.233275579G>A		85	0		76	3	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Silent	SNP	ENST00000258229.9	37	CCDS44335.1																																																																																			.		0.323	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
WEE2	494551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	141429375	141429375	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr7:141429375C>T	ENST00000397541.2	+	11	1986	c.1580C>T	c.(1579-1581)aCc>aTc	p.T527I	WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000459753.1_RNA|RNU1-82P_ENST00000390851.1_RNA|WEE2-AS1_ENST00000484172.1_RNA|WEE2-AS1_ENST00000486906.1_RNA|WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000488785.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	527					female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					CAGGGATATACCCATCATGGT	0.522																																					p.T527I		.											.	.	.	0			c.C1580T						.						86.0	85.0	85.0					7																	141429375		1861	4120	5981	SO:0001583	missense	494551	exon11			GATATACCCATCA	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.1580C>T	7.37:g.141429375C>T	ENSP00000380675:p.Thr527Ile	46	0		54	9	NM_001105558		Missense_Mutation	SNP	ENST00000397541.2	37	CCDS43660.1	.	.	.	.	.	.	.	.	.	.	C	5.332	0.246495	0.10130	.	.	ENSG00000214102	ENST00000397541	T	0.56103	0.48	3.92	-7.84	0.01196	Protein kinase-like domain (1);	1.916520	0.02965	U	0.143625	T	0.37544	0.1007	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26292	-1.0107	10	0.35671	T	0.21	.	9.4911	0.38960	0.0:0.4769:0.3158:0.2073	.	527	P0C1S8	WEE2_HUMAN	I	527	ENSP00000380675:T527I	ENSP00000380675:T527I	T	+	2	0	WEE2	141075844	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-5.078000	0.00153	-3.001000	0.00276	-1.268000	0.01426	ACC	.		0.522	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349091.1	NM_001105558	
ZDHHC6	64429	hgsc.bcm.edu	37	10	114190585	114190585	+	Nonsense_Mutation	SNP	C	C	A	rs369541274		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr10:114190585C>A	ENST00000369405.3	-	11	1642	c.1219G>T	c.(1219-1221)Gag>Tag	p.E407*	ZDHHC6_ENST00000482410.1_5'UTR|ZDHHC6_ENST00000369404.3_Nonsense_Mutation_p.E403*	NM_022494.1	NP_071939.1	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6	407					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		TTCTCCCCCTCTGGGGCTTGA	0.358																																					p.E407X		.											ZDHHC6,NS,carcinoma,0,1	ZDHHC6	0	0			c.G1219T						.						99.0	96.0	97.0					10																	114190585		2203	4300	6503	SO:0001587	stop_gained	64429	exon11			CCCCCTCTGGGGC	AK025605	CCDS7574.1	10q26.11	2008-05-02			ENSG00000023041	ENSG00000023041		"""Zinc fingers, DHHC-type"""	19160	protein-coding gene	gene with protein product							Standard	NM_022494		Approved	ZNF376, FLJ21952	uc001kzv.3	Q9H6R6	OTTHUMG00000019062	ENST00000369405.3:c.1219G>T	10.37:g.114190585C>A	ENSP00000358413:p.Glu407*	68	0		47	2	NM_022494	D3DRB6|Q53G45|Q96IV7|Q9H605	Nonsense_Mutation	SNP	ENST00000369405.3	37	CCDS7574.1	.	.	.	.	.	.	.	.	.	.	C	37	6.114990	0.97296	.	.	ENSG00000023041	ENST00000369405;ENST00000369404	.	.	.	5.8	5.8	0.92144	.	0.243498	0.48286	D	0.000183	.	.	.	.	.	.	0.58432	D	0.999992	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-10.3688	20.418	0.99029	0.0:1.0:0.0:0.0	.	.	.	.	X	407;403	.	ENSP00000358412:E403X	E	-	1	0	ZDHHC6	114180575	1.000000	0.71417	0.967000	0.41034	0.517000	0.34286	5.150000	0.64869	2.902000	0.99343	0.650000	0.86243	GAG	.		0.358	ZDHHC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050393.1	NM_022494	
BRWD3	254065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	79941034	79941034	+	Splice_Site	SNP	C	C	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chrX:79941034C>G	ENST00000373275.4	-	36	4223	c.4007G>C	c.(4006-4008)gGt>gCt	p.G1336A	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1336	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						CTCCTGATGACCCTATTAGGG	0.388																																					p.G1336A		.											.	.	.	0			c.G4007C						.						81.0	61.0	68.0					X																	79941034		2203	4299	6502	SO:0001630	splice_region_variant	254065	exon36			TGATGACCCTATT		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.4006-1G>C	X.37:g.79941034C>G		36	0		51	34	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.556634	0.00910	.	.	ENSG00000165288	ENST00000373275	T	0.52983	0.64	4.59	-0.762	0.11034	Bromodomain (4);	0.805402	0.11201	N	0.588811	T	0.17619	0.0423	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18681	-1.0329	9	.	.	.	0.5552	2.3496	0.04280	0.3044:0.3081:0.2919:0.0955	.	1336	Q6RI45	BRWD3_HUMAN	A	1336	ENSP00000362372:G1336A	.	G	-	2	0	BRWD3	79827690	0.012000	0.17670	0.101000	0.21167	0.366000	0.29705	-0.290000	0.08354	-0.416000	0.07473	0.462000	0.41574	GGT	.		0.388	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	Missense_Mutation
SASH1	23328	hgsc.bcm.edu	37	6	148792601	148792601	+	Missense_Mutation	SNP	G	G	T	rs575597604		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:148792601G>T	ENST00000367467.3	+	6	951	c.476G>T	c.(475-477)cGa>cTa	p.R159L		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	159					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		CAGAACTTCCGAAAGAACCAG	0.348																																					p.R159L		.											SASH1,NS,carcinoma,0,2	SASH1	0	0			c.G476T						.						62.0	60.0	60.0					6																	148792601		2203	4300	6503	SO:0001583	missense	23328	exon6			ACTTCCGAAAGAA	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.476G>T	6.37:g.148792601G>T	ENSP00000356437:p.Arg159Leu	124	0		75	3	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.830265	0.91036	.	.	ENSG00000111961	ENST00000367467	T	0.13657	2.57	5.92	5.92	0.95590	.	0.174764	0.51477	D	0.000087	T	0.15782	0.0380	L	0.27053	0.805	0.54753	D	0.999988	D	0.89917	1.0	D	0.68192	0.956	T	0.01068	-1.1462	10	0.87932	D	0	-9.4902	13.1725	0.59606	0.0733:0.0:0.9267:0.0	.	159	O94885	SASH1_HUMAN	L	159	ENSP00000356437:R159L	ENSP00000356437:R159L	R	+	2	0	SASH1	148834294	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.314000	0.65804	2.809000	0.96659	0.655000	0.94253	CGA	.		0.348	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
SH3PXD2A	9644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	105526913	105526913	+	Missense_Mutation	SNP	A	A	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr10:105526913A>T	ENST00000369774.4	-	3	444	c.168T>A	c.(166-168)gaT>gaA	p.D56E	SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.D56E			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	56	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		TGGGAAACTTATCCAAAAGCT	0.542																																					p.D56E		.											.	.	.	0			c.T168A						.						91.0	71.0	78.0					10																	105526913		2203	4300	6503	SO:0001583	missense	9644	exon3			AAACTTATCCAAA	AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.168T>A	10.37:g.105526913A>T	ENSP00000358789:p.Asp56Glu	48	0		18	4	NM_014631	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	ENST00000369774.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.80|16.80	3.224446|3.224446	0.58668|0.58668	.|.	.|.	ENSG00000107957|ENSG00000107957	ENST00000369774;ENST00000355946|ENST00000420222	T;T|.	0.36699|.	1.24;1.24|.	5.38|5.38	4.23|4.23	0.50019|0.50019	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.32346|.	0.0826|.	N|N	0.05608|0.05608	-0.01|-0.01	0.80722|0.80722	D|D	1|1	P|.	0.43701|.	0.815|.	P|.	0.47573|.	0.55|.	T|.	0.07966|.	-1.0745|.	10|.	0.12430|.	T|.	0.62|.	-17.8564|-17.8564	8.2969|8.2969	0.31990|0.31990	0.8991:0.0:0.1009:0.0|0.8991:0.0:0.1009:0.0	.|.	56|.	Q5TCZ1-3|.	.|.	E|K	56|11	ENSP00000358789:D56E;ENSP00000348215:D56E|.	ENSP00000348215:D56E|.	D|X	-|-	3|1	2|0	SH3PXD2A|SH3PXD2A	105516903|105516903	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.569000|2.569000	0.45973|0.45973	0.879000|0.879000	0.35944|0.35944	0.459000|0.459000	0.35465|0.35465	GAT|TAA	.		0.542	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631	
SNX21	90203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	44463735	44463735	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr20:44463735G>A	ENST00000491381.1	+	3	495	c.427G>A	c.(427-429)Gac>Aac	p.D143N	SNX21_ENST00000462307.1_Missense_Mutation_p.D143N|SNX21_ENST00000372542.1_Missense_Mutation_p.D134N|SNX21_ENST00000344780.4_3'UTR|SNX21_ENST00000372541.1_Missense_Mutation_p.D134N|SNX21_ENST00000342644.5_Missense_Mutation_p.D143N|TNNC2_ENST00000372557.1_5'Flank			Q969T3	SNX21_HUMAN	sorting nexin family member 21	143	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	7		Myeloproliferative disorder(115;0.0122)				CGTTGTCAAGGACCCGCCCTC	0.592																																					p.D143N		.											.	.	.	0			c.G427A						.						48.0	46.0	47.0					20																	44463735		2203	4300	6503	SO:0001583	missense	90203	exon3			GTCAAGGACCCGC	AK095851	CCDS13376.1, CCDS13377.1, CCDS42883.1	20q13.12	2013-01-10	2006-07-24	2006-07-24	ENSG00000124104	ENSG00000124104		"""Sorting nexins"", ""Tetratricopeptide (TTC) repeat domain containing"""	16154	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 161"""	C20orf161		12461558, 12459172	Standard	NM_152897		Approved	dJ337O18.4, SNX-L	uc002xpv.1	Q969T3	OTTHUMG00000032624	ENST00000491381.1:c.427G>A	20.37:g.44463735G>A	ENSP00000418593:p.Asp143Asn	19	0		26	8	NM_033421	Q5JZH5|Q5JZH6|Q5JZH7|Q8WUR6|Q9BR16	Missense_Mutation	SNP	ENST00000491381.1	37	CCDS13377.1	.	.	.	.	.	.	.	.	.	.	G	33	5.252095	0.95336	.	.	ENSG00000124104	ENST00000462307;ENST00000491381;ENST00000342644;ENST00000372542;ENST00000372541;ENST00000372545	T;T;T	0.32023	1.47;1.47;1.47	5.25	5.25	0.73442	Phox homologous domain (4);	0.159648	0.56097	D	0.000035	T	0.43656	0.1257	L	0.29908	0.895	0.42783	D	0.993874	D;D;D;D;D;D	0.71674	0.992;0.982;0.982;0.992;0.998;0.994	P;P;P;P;D;D	0.78314	0.856;0.864;0.864;0.856;0.991;0.946	T	0.19289	-1.0310	10	0.40728	T	0.16	-18.6741	16.168	0.81785	0.0:0.0:1.0:0.0	.	134;134;143;143;143;143	Q5JZH4;Q5JZH3;Q969T3;Q5JZH7;Q05DJ0;Q5JZH5	.;.;SNX21_HUMAN;.;.;.	N	143;143;143;134;134;134	ENSP00000418593:D143N;ENSP00000344586:D143N;ENSP00000361620:D134N	ENSP00000344586:D143N	D	+	1	0	SNX21	43897142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.691000	0.84191	2.724000	0.93272	0.563000	0.77884	GAC	.		0.592	SNX21-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079534.1	NM_033421	
OR10H4	126541	hgsc.bcm.edu	37	19	16060516	16060516	+	Silent	SNP	C	C	T	rs370722157		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr19:16060516C>T	ENST00000322107.1	+	1	699	c.699C>T	c.(697-699)gcC>gcT	p.A233A		NM_001004465.1	NP_001004465.1	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H, member 4	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	17						TTCCCTCTGCCGAAGGCCGGC	0.512																																					p.A233A		.											OR10H4,NS,carcinoma,0,1	OR10H4	0	0			c.C699T						.	C		0,4406		0,0,2203	196.0	179.0	185.0		699	-1.6	0.1	19		185	2,8598		0,2,4298	no	coding-synonymous	OR10H4	NM_001004465.1		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		233/317	16060516	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	126541	exon1			CTCTGCCGAAGGC	AC011517	CCDS32941.1	19p13.12	2013-09-24			ENSG00000176231	ENSG00000176231		"""GPCR / Class A : Olfactory receptors"""	15388	protein-coding gene	gene with protein product							Standard	NM_001004465		Approved		uc010xov.2	Q8NGA5	OTTHUMG00000182268	ENST00000322107.1:c.699C>T	19.37:g.16060516C>T		30	0		41	2	NM_001004465	Q6IFJ2|Q96R57	Silent	SNP	ENST00000322107.1	37	CCDS32941.1																																																																																			.		0.512	OR10H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460311.1		
FAM105A	54491	hgsc.bcm.edu;bcgsc.ca	37	5	14601188	14601188	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:14601188G>T	ENST00000274217.3	+	2	299	c.179G>T	c.(178-180)tGc>tTc	p.C60F		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	60										large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					GCTGCCATCTGCTACTTCCGG	0.433																																					p.C60F		.											.	.	.	0			c.G179T						.						165.0	153.0	157.0					5																	14601188		2203	4300	6503	SO:0001583	missense	54491	exon2			CCATCTGCTACTT		CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.179G>T	5.37:g.14601188G>T	ENSP00000274217:p.Cys60Phe	47	0		47	4	NM_019018	Q53H50|Q9H037	Missense_Mutation	SNP	ENST00000274217.3	37	CCDS3884.1	.	.	.	.	.	.	.	.	.	.	G	0.215	-1.033589	0.02029	.	.	ENSG00000145569	ENST00000274217	T	0.16597	2.33	5.5	5.5	0.81552	.	0.189963	0.48767	D	0.000174	T	0.11879	0.0289	L	0.27053	0.805	0.33508	D	0.590777	B	0.22983	0.078	B	0.21151	0.033	T	0.05683	-1.0870	10	0.02654	T	1	-14.0285	16.9211	0.86164	0.0:0.0:1.0:0.0	.	60	Q9NUU6	F105A_HUMAN	F	60	ENSP00000274217:C60F	ENSP00000274217:C60F	C	+	2	0	FAM105A	14654188	1.000000	0.71417	0.905000	0.35620	0.197000	0.23852	4.054000	0.57434	2.735000	0.93741	0.655000	0.94253	TGC	.		0.433	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253710.1	NM_019018	
DNAJC6	9829	hgsc.bcm.edu	37	1	65855273	65855273	+	Silent	SNP	C	C	T	rs139447717		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr1:65855273C>T	ENST00000395325.3	+	11	1417	c.1260C>T	c.(1258-1260)taC>taT	p.Y420Y	DNAJC6_ENST00000263441.7_Silent_p.Y407Y|DNAJC6_ENST00000371069.4_Silent_p.Y477Y	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	420					cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						CCAGGCATTACGGACAAAGTG	0.398																																					p.Y477Y		.											DNAJC6,NS,carcinoma,0,1	DNAJC6	0	0			c.C1431T						.	C		2,4404	4.2+/-10.8	0,2,2201	179.0	165.0	169.0		1260	-5.8	0.0	1	dbSNP_134	169	0,8600		0,0,4300	no	coding-synonymous	DNAJC6	NM_014787.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		420/914	65855273	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	9829	exon11			GCATTACGGACAA	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.1260C>T	1.37:g.65855273C>T		37	0		48	2	NM_001256864	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Silent	SNP	ENST00000395325.3	37	CCDS30739.1																																																																																			0.000		0.398	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1		
RBP2	5948	hgsc.bcm.edu	37	3	139173596	139173596	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:139173596C>A	ENST00000232217.2	-	3	385	c.329G>T	c.(328-330)tGg>tTg	p.W110L	RP11-319G6.1_ENST00000510068.1_RNA|RP11-319G6.1_ENST00000515247.1_RNA	NM_004164.2	NP_004155.2	P50120	RET2_HUMAN	retinol binding protein 2, cellular	110					epidermis development (GO:0008544)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)	p.W110*(1)		breast(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12					Vitamin A(DB00162)	CCCCTCAATCCACTGCTTCCA	0.532																																					p.W110L		.											RBP2,NS,carcinoma,0,1	RBP2	0	1	Substitution - Nonsense(1)	lung(1)	c.G329T						.						240.0	204.0	216.0					3																	139173596		2203	4300	6503	SO:0001583	missense	5948	exon3			TCAATCCACTGCT	U13831	CCDS3109.1	3q23	2013-03-01	2001-11-28		ENSG00000114113	ENSG00000114113		"""Fatty acid binding protein family"""	9920	protein-coding gene	gene with protein product		180280	"""retinol-binding protein 2, cellular"""			7657783, 10072590	Standard	NM_004164		Approved	CRBP2, RBPC2, CRBPII, CRABP-II	uc003eth.3	P50120	OTTHUMG00000159956	ENST00000232217.2:c.329G>T	3.37:g.139173596C>A	ENSP00000232217:p.Trp110Leu	37	0		25	2	NM_004164	A8K7G3|Q6ISQ9|Q6ISS7	Missense_Mutation	SNP	ENST00000232217.2	37	CCDS3109.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333498	0.81801	.	.	ENSG00000114113	ENST00000232217	T	0.08634	3.07	5.0	5.0	0.66597	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.33498	0.0865	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.07501	-1.0769	10	0.42905	T	0.14	.	18.6877	0.91571	0.0:1.0:0.0:0.0	.	110	P50120	RET2_HUMAN	L	110	ENSP00000232217:W110L	ENSP00000232217:W110L	W	-	2	0	RBP2	140656286	1.000000	0.71417	0.997000	0.53966	0.754000	0.42855	7.689000	0.84165	2.477000	0.83638	0.563000	0.77884	TGG	.		0.532	RBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358490.1	NM_004164	
MRAP2	112609	hgsc.bcm.edu	37	6	84772626	84772626	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:84772626G>T	ENST00000257776.4	+	3	277	c.142G>T	c.(142-144)Gga>Tga	p.G48*		NM_138409.2	NP_612418.2	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2	48					energy homeostasis (GO:0097009)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|identical protein binding (GO:0042802)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(4)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	19						CATTGTGATTGGATTTTGGGT	0.398																																					p.G48X		.											.	.	.	0			c.G142T						.						265.0	235.0	245.0					6																	84772626		2203	4300	6503	SO:0001587	stop_gained	112609	exon3			GTGATTGGATTTT	AK090775	CCDS5001.1	6q14.3	2009-10-06	2008-07-16	2008-07-16	ENSG00000135324	ENSG00000135324			21232	protein-coding gene	gene with protein product		615410	"""chromosome 6 open reading frame 117"""	C6orf117			Standard	NM_138409		Approved	bA51G5.2	uc003pkg.4	Q96G30	OTTHUMG00000015121	ENST00000257776.4:c.142G>T	6.37:g.84772626G>T	ENSP00000257776:p.Gly48*	56	0		52	4	NM_138409	A8K9M1|Q8IXM9|Q8N2D1	Nonsense_Mutation	SNP	ENST00000257776.4	37	CCDS5001.1	.	.	.	.	.	.	.	.	.	.	G	38	6.658918	0.97743	.	.	ENSG00000135324	ENST00000257776	.	.	.	5.66	5.66	0.87406	.	0.124098	0.53938	D	0.000046	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.554	19.7439	0.96243	0.0:0.0:1.0:0.0	.	.	.	.	X	48	.	ENSP00000257776:G48X	G	+	1	0	MRAP2	84829345	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.290000	0.78711	2.669000	0.90835	0.655000	0.94253	GGA	.		0.398	MRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041367.1	NM_138409	
PCDHA9	9752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140230059	140230059	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:140230059C>G	ENST00000532602.1	+	1	3012	c.1979C>G	c.(1978-1980)aCg>aGg	p.T660R	PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.T660R|PCDHA6_ENST00000527624.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	660	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGCGCTGACGGCCACGGCC	0.692																																					p.T660R	Melanoma(55;1800 1972 14909)	.											.	.	.	0			c.C1979G						.						44.0	47.0	46.0					5																	140230059		2197	4268	6465	SO:0001583	missense	9752	exon1			CGCTGACGGCCAC	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1979C>G	5.37:g.140230059C>G	ENSP00000436042:p.Thr660Arg	50	0		70	21	NM_031857	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.318119	0.23994	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.53857	0.6;0.6	4.13	2.14	0.27477	Cadherin (4);Cadherin-like (1);	1.901430	0.04248	U	0.338208	T	0.64136	0.2571	L	0.56769	1.78	0.24104	N	0.995865	B;D	0.63046	0.049;0.992	B;P	0.55871	0.088;0.786	T	0.48410	-0.9038	10	0.87932	D	0	.	8.6375	0.33957	0.0:0.7604:0.153:0.0866	.	660;660	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	R	660	ENSP00000436042:T660R;ENSP00000367362:T660R	ENSP00000367362:T660R	T	+	2	0	PCDHA9	140210243	0.002000	0.14202	0.596000	0.28811	0.127000	0.20565	1.476000	0.35420	0.823000	0.34589	0.313000	0.20887	ACG	.		0.692	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
LONRF1	91694	hgsc.bcm.edu	37	8	12586483	12586483	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr8:12586483C>A	ENST00000398246.3	-	10	2006	c.1937G>T	c.(1936-1938)cGg>cTg	p.R646L	LONRF1_ENST00000525024.1_Missense_Mutation_p.R72L|MIR3926-2_ENST00000578598.1_RNA|LONRF1_ENST00000533751.1_Missense_Mutation_p.R289L	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	646	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		AACCCTAAACCGCTTTCCTCC	0.368																																					p.R646L		.											LONRF1,NS,carcinoma,0,1	LONRF1	0	0			c.G1937T						.						162.0	151.0	154.0					8																	12586483		1848	4092	5940	SO:0001583	missense	91694	exon10			CTAAACCGCTTTC	AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.1937G>T	8.37:g.12586483C>A	ENSP00000381298:p.Arg646Leu	48	0		34	3	NM_152271	B4DM29|B4DU84|Q8TEA0|Q9BSV1	Missense_Mutation	SNP	ENST00000398246.3	37	CCDS5987.2	.	.	.	.	.	.	.	.	.	.	C	32	5.143881	0.94603	.	.	ENSG00000154359	ENST00000398246;ENST00000525024;ENST00000533751;ENST00000524526	T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44	5.04	5.04	0.67666	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.000000	0.85682	D	0.000000	D	0.88164	0.6363	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91615	0.5306	10	0.87932	D	0	-13.0207	19.2731	0.94018	0.0:1.0:0.0:0.0	.	635;646	Q17RB8-2;Q17RB8	.;LONF1_HUMAN	L	646;72;289;249	ENSP00000381298:R646L;ENSP00000436770:R72L;ENSP00000432130:R289L;ENSP00000433327:R249L	ENSP00000381298:R646L	R	-	2	0	LONRF1	12630854	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.055000	0.71103	2.733000	0.93635	0.557000	0.71058	CGG	.		0.368	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251693.2	NM_152271	
RPSAP58	388524	hgsc.bcm.edu	37	19	24010294	24010294	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr19:24010294C>G	ENST00000496398.1	+	4	754	c.331C>G	c.(331-333)Cag>Gag	p.Q111E	RP11-255H23.2_ENST00000471224.1_RNA|RPSAP58_ENST00000354585.4_Missense_Mutation_p.Q111E|RP11-255H23.4_ENST00000599944.1_lincRNA					ribosomal protein SA pseudogene 58									p.Q111E(12)		endometrium(1)|kidney(5)|lung(2)|prostate(1)|urinary_tract(1)	10						CTTCACTAACCAGATCCAGGC	0.567																																					.		.											RPSAP58_ENST00000496398,NS,carcinoma,0,40	RPSAP58_ENST00000496398	0	12	Substitution - Missense(12)	kidney(6)|urinary_tract(2)|prostate(2)|endometrium(2)	.						.																																			SO:0001583	missense	388524	.			ACTAACCAGATCC			19p12	2010-06-16			ENSG00000205246	ENSG00000205246			36809	pseudogene	pseudogene						19123937	Standard	NR_003662		Approved		uc002nrn.3		OTTHUMG00000158122	ENST00000496398.1:c.331C>G	19.37:g.24010294C>G	ENSP00000417240:p.Gln111Glu	34	0		25	2	.		RNA	SNP	ENST00000496398.1	37		.	.	.	.	.	.	.	.	.	.	.	13.90	2.375690	0.42105	.	.	ENSG00000205246	ENST00000496398;ENST00000354585	T;T	0.21932	1.98;1.98	2.52	2.52	0.30459	.	0.000000	0.64402	U	0.000001	T	0.17619	0.0423	.	.	.	0.48830	D	0.999718	B	0.34226	0.443	B	0.32624	0.149	T	0.11084	-1.0602	9	0.72032	D	0.01	.	10.8987	0.47038	0.0:1.0:0.0:0.0	.	111	A6NE09	.	E	111	ENSP00000417240:Q111E;ENSP00000346598:Q111E	ENSP00000346598:Q111E	Q	+	1	0	RPSAP58	23802134	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	4.812000	0.62613	1.477000	0.48234	0.627000	0.83407	CAG	.		0.567	RPSAP58-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350238.1	NR_003662	
ADAM30	11085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	120438659	120438659	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr1:120438659C>T	ENST00000369400.1	-	1	459	c.301G>A	c.(301-303)Gag>Aag	p.E101K		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	101					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E101K(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		GGATGATCCTCCAGCAGTTCC	0.507																																					p.E101K		.											ADAM30,hand,carcinoma,0,1	ADAM30	0	1	Substitution - Missense(1)	skin(1)	c.G301A						.						66.0	63.0	64.0					1																	120438659		2203	4300	6503	SO:0001583	missense	11085	exon1			GATCCTCCAGCAG	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.301G>A	1.37:g.120438659C>T	ENSP00000358407:p.Glu101Lys	37	0		44	14	NM_021794	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	37	CCDS907.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.616706	0.87359	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.06142	3.34	4.76	4.76	0.60689	Peptidase M12B, propeptide (1);	0.000000	0.41001	D	0.000962	T	0.12902	0.0313	M	0.80616	2.505	0.31467	N	0.668825	P	0.46952	0.887	P	0.57548	0.823	T	0.00443	-1.1736	10	0.51188	T	0.08	.	13.147	0.59467	0.0:1.0:0.0:0.0	.	101	Q9UKF2	ADA30_HUMAN	K	101	ENSP00000358407:E101K	ENSP00000358407:E101K	E	-	1	0	ADAM30	120240182	0.892000	0.30473	0.988000	0.46212	0.843000	0.47879	1.859000	0.39418	2.464000	0.83262	0.462000	0.41574	GAG	.		0.507	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
ZP1	22917	hgsc.bcm.edu;bcgsc.ca	37	11	60638604	60638604	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr11:60638604G>T	ENST00000278853.5	+	5	1001	c.1001G>T	c.(1000-1002)gGa>gTa	p.G334V		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	334	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						ACCCACTGTGGAACCACAATG	0.617																																					p.G334V		.											.	.	.	0			c.G1001T						.						74.0	69.0	71.0					11																	60638604		2203	4299	6502	SO:0001583	missense	22917	exon5			ACTGTGGAACCAC	BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.1001G>T	11.37:g.60638604G>T	ENSP00000278853:p.Gly334Val	49	0		48	4	NM_207341		Missense_Mutation	SNP	ENST00000278853.5	37	CCDS31572.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604070	0.46423	.	.	ENSG00000149506	ENST00000278853;ENST00000544498	D	0.91843	-2.92	4.95	3.07	0.35406	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.000000	0.85682	D	0.000000	D	0.96128	0.8738	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95084	0.8216	10	0.87932	D	0	-8.2212	9.0849	0.36574	0.1723:0.0:0.8277:0.0	.	334	P60852	ZP1_HUMAN	V	334;41	ENSP00000278853:G334V	ENSP00000278853:G334V	G	+	2	0	ZP1	60395180	1.000000	0.71417	0.565000	0.28409	0.299000	0.27559	5.490000	0.66881	0.505000	0.28104	0.313000	0.20887	GGA	.		0.617	ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396329.1	NM_207341	
GRIK2	2898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	102124680	102124680	+	Splice_Site	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:102124680G>T	ENST00000421544.1	+	4	1213		c.e4+1		GRIK2_ENST00000318991.6_Splice_Site|GRIK2_ENST00000369138.1_Splice_Site|GRIK2_ENST00000369137.3_Splice_Site|GRIK2_ENST00000369134.4_Splice_Site|GRIK2_ENST00000413795.1_Splice_Site|GRIK2_ENST00000358361.3_Splice_Site	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TTTAAAACAGGTAACCTTTAA	0.294																																					.		.											.	.	.	0			c.723+1G>T						.						60.0	62.0	61.0					6																	102124680		2203	4300	6503	SO:0001630	splice_region_variant	2898	exon4			AAACAGGTAACCT		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.723+1G>T	6.37:g.102124680G>T		62	0		53	21	NM_175768	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Splice_Site	SNP	ENST00000421544.1	37	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.807253	0.70797	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076;ENST00000455610	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9928	0.97374	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRIK2	102231373	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	9.867000	0.99620	2.745000	0.94114	0.650000	0.86243	.	.		0.294	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		Intron
TRHR	7201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	8	110131447	110131447	+	Nonsense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr8:110131447C>A	ENST00000518632.1	+	3	1311	c.960C>A	c.(958-960)taC>taA	p.Y320*	TRHR_ENST00000311762.2_Nonsense_Mutation_p.Y320*			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	320					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			CGGTGATTTACAATCTCATGT	0.428																																					p.Y320X		.											.	.	.	0			c.C960A						.						208.0	205.0	206.0					8																	110131447		2203	4299	6502	SO:0001587	stop_gained	7201	exon2			GATTTACAATCTC		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.960C>A	8.37:g.110131447C>A	ENSP00000430711:p.Tyr320*	41	0		51	14	NM_003301	Q2M339	Nonsense_Mutation	SNP	ENST00000518632.1	37	CCDS6311.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670430	0.88348	.	.	ENSG00000174417	ENST00000518632;ENST00000311762	.	.	.	6.07	3.32	0.38043	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-37.9842	10.2241	0.43214	0.0:0.7292:0.0:0.2708	.	.	.	.	X	320	.	ENSP00000309818:Y320X	Y	+	3	2	TRHR	110200623	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	0.944000	0.29043	0.900000	0.36469	0.585000	0.79938	TAC	.		0.428	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380892.1		
TPR	7175	hgsc.bcm.edu	37	1	186304588	186304588	+	Missense_Mutation	SNP	C	C	T	rs369991503		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr1:186304588C>T	ENST00000367478.4	-	34	5089	c.4793G>A	c.(4792-4794)cGc>cAc	p.R1598H		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1598					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)	p.R1599P(1)|p.R1598P(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CGCAGTAATGCGAACATCCAA	0.418			T	NTRK1	papillary thyroid																																p.R1598H		.		Dom	yes		1	1q25	7175	translocated promoter region		E	TPR_ENST00000367478,NS,carcinoma,-1,2	TPR_ENST00000367478	-1	2	Substitution - Missense(2)	breast(2)	c.G4793A						.	C	HIS/ARG	1,3755		0,1,1877	173.0	154.0	160.0		4793	5.1	1.0	1		160	0,8224		0,0,4112	no	missense	TPR	NM_003292.2	29	0,1,5989	TT,TC,CC		0.0,0.0266,0.0083	probably-damaging	1598/2364	186304588	1,11979	1878	4112	5990	SO:0001583	missense	7175	exon34			GTAATGCGAACAT	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.4793G>A	1.37:g.186304588C>T	ENSP00000356448:p.Arg1598His	43	0		40	2	NM_003292	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	C	33	5.219266	0.95139	2.66E-4	0.0	ENSG00000047410	ENST00000367478	T	0.27256	1.68	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.59563	-0.7431	10	0.56958	D	0.05	.	18.9661	0.92697	0.0:1.0:0.0:0.0	.	1598	P12270	TPR_HUMAN	H	1598	ENSP00000356448:R1598H	ENSP00000356448:R1598H	R	-	2	0	TPR	184571211	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	7.168000	0.77570	2.545000	0.85829	0.650000	0.86243	CGC	.		0.418	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
CLK3	1198	hgsc.bcm.edu	37	15	74922183	74922183	+	Nonsense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr15:74922183G>T	ENST00000395066.3	+	13	2337	c.1876G>T	c.(1876-1878)Gag>Tag	p.E626*	CLK3_ENST00000348245.3_3'UTR|CLK3_ENST00000345005.4_Nonsense_Mutation_p.E478*|CLK3_ENST00000352989.5_Nonsense_Mutation_p.E455*	NM_001130028.1	NP_001123500.1	P49761	CLK3_HUMAN	CDC-like kinase 3	626					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	cytoplasmic vesicle (GO:0031410)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)|stomach(2)|urinary_tract(1)	15						CCTGACCCCTGAGGAGCGGTC	0.632																																					p.E626X	Ovarian(133;694 1754 28950 29027 31859)	.											CLK3_ENST00000454830,NS,carcinoma,0,2	CLK3_ENST00000454830	0	0			c.G1876T						.						26.0	22.0	24.0					15																	74922183		2195	4296	6491	SO:0001587	stop_gained	1198	exon13			ACCCCTGAGGAGC	L29220	CCDS10265.1, CCDS45304.1	15q24	2008-05-02			ENSG00000179335	ENSG00000179335		"""CDC-like kinases"""	2071	protein-coding gene	gene with protein product		602990				7990150, 9856501	Standard	NM_003992		Approved	clk3	uc010uln.2	P49761	OTTHUMG00000141320	ENST00000395066.3:c.1876G>T	15.37:g.74922183G>T	ENSP00000378505:p.Glu626*	26	0		24	2	NM_001130028	D3DW59|Q53Y48|Q9BRS3|Q9BUJ7	Nonsense_Mutation	SNP	ENST00000395066.3	37	CCDS45304.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790183	0.90367	.	.	ENSG00000179335	ENST00000345005;ENST00000395066;ENST00000454830;ENST00000352989	.	.	.	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	18.3608	0.90374	0.0:0.0:1.0:0.0	.	.	.	.	X	478;478;626;455	.	ENSP00000344112:E478X	E	+	1	0	CLK3	72709236	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	4.067000	0.57527	2.452000	0.82932	0.555000	0.69702	GAG	.		0.632	CLK3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390442.3		
GRM1	2911	hgsc.bcm.edu	37	6	146720582	146720582	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:146720582C>T	ENST00000282753.1	+	7	2642	c.2407C>T	c.(2407-2409)Ccc>Tcc	p.P803S	GRM1_ENST00000355289.4_Missense_Mutation_p.P803S|GRM1_ENST00000392299.2_Missense_Mutation_p.P803S|GRM1_ENST00000507907.1_Missense_Mutation_p.P803S|GRM1_ENST00000361719.2_Missense_Mutation_p.P803S|GRM1_ENST00000492807.2_Missense_Mutation_p.P803S			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	803					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.P803S(2)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		AGCTTTTGTGCCCATTTACTT	0.488																																					p.P803S		.											GRM1_ENST00000392299,NS,carcinoma,0,2	GRM1_ENST00000392299	0	2	Substitution - Missense(2)	lung(2)	c.C2407T						.						166.0	137.0	147.0					6																	146720582		2203	4300	6503	SO:0001583	missense	2911	exon8			TTTGTGCCCATTT	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2407C>T	6.37:g.146720582C>T	ENSP00000282753:p.Pro803Ser	24	0		34	2	NM_000838	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.543993	0.86022	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76;-2.76;-2.76	5.68	5.68	0.88126	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95928	0.8674	M	0.86420	2.815	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.997	D	0.95970	0.8969	10	0.87932	D	0	.	19.7753	0.96389	0.0:1.0:0.0:0.0	.	803;803;803	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	S	803	ENSP00000354896:P803S;ENSP00000376119:P803S;ENSP00000424095:P803S;ENSP00000282753:P803S;ENSP00000347437:P803S;ENSP00000425599:P803S	ENSP00000282753:P803S	P	+	1	0	GRM1	146762275	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.686000	0.91538	0.585000	0.79938	CCC	.		0.488	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
SLCO2A1	6578	hgsc.bcm.edu	37	3	133657273	133657273	+	Splice_Site	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:133657273C>T	ENST00000310926.4	-	12	1963	c.1690G>A	c.(1690-1692)Gcc>Acc	p.A564T	SLCO2A1_ENST00000493729.1_Splice_Site_p.A488T	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	564					lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	AGACACTTACCCAGCAAGCGC	0.537																																					p.A564T		.											SLCO2A1,NS,carcinoma,0,1	SLCO2A1	0	0			c.G1690A						.						146.0	130.0	136.0					3																	133657273		2203	4300	6503	SO:0001630	splice_region_variant	6578	exon12			ACTTACCCAGCAA		CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.1690+1G>A	3.37:g.133657273C>T		47	0		31	2	NM_005630	Q86V98|Q8IUN2	Missense_Mutation	SNP	ENST00000310926.4	37	CCDS3084.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880458	0.72294	.	.	ENSG00000174640	ENST00000310926;ENST00000493729	T;T	0.49432	0.78;0.78	5.79	5.79	0.91817	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.048832	0.85682	D	0.000000	T	0.70762	0.3261	M	0.79614	2.46	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.936	T	0.70821	-0.4768	9	.	.	.	.	18.2017	0.89840	0.0:1.0:0.0:0.0	.	488;564	E7EU40;Q92959	.;SO2A1_HUMAN	T	564;488	ENSP00000311291:A564T;ENSP00000418893:A488T	.	A	-	1	0	SLCO2A1	135139963	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	5.176000	0.65026	2.735000	0.93741	0.561000	0.74099	GCC	.		0.537	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357131.1	NM_005630	Missense_Mutation
PTPN2	5771	hgsc.bcm.edu	37	18	12802116	12802116	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr18:12802116G>T	ENST00000309660.5	-	8	986	c.893C>A	c.(892-894)tCt>tAt	p.S298Y	PTPN2_ENST00000327283.3_Missense_Mutation_p.S298Y|PTPN2_ENST00000353319.4_Missense_Mutation_p.S298Y|PTPN2_ENST00000591115.1_Missense_Mutation_p.S321Y|PTPN2_ENST00000591497.1_Missense_Mutation_p.S269Y	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	298					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				AAAGGCAGGAGATAAGTCTTC	0.318																																					p.S321Y		.											PTPN2,colon,carcinoma,0,1	PTPN2	0	0			c.C962A						.						95.0	82.0	87.0					18																	12802116		2203	4300	6503	SO:0001583	missense	5771	exon9			GCAGGAGATAAGT	M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.893C>A	18.37:g.12802116G>T	ENSP00000311857:p.Ser298Tyr	46	0		49	3	NM_001207013	A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Missense_Mutation	SNP	ENST00000309660.5	37	CCDS11865.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.963469	0.53507	.	.	ENSG00000175354	ENST00000327283;ENST00000353319;ENST00000341361;ENST00000309660	T;T;T	0.04156	3.7;3.72;3.69	5.52	1.58	0.23477	.	0.539313	0.16636	N	0.205840	T	0.03220	0.0094	L	0.36672	1.1	0.18873	N	0.999987	P;P;P;P;B	0.44478	0.667;0.482;0.836;0.498;0.351	B;B;B;B;B	0.39152	0.285;0.292;0.285;0.098;0.153	T	0.38001	-0.9681	10	0.11182	T	0.66	.	4.6839	0.12748	0.0837:0.3344:0.4538:0.1281	.	298;298;275;298;298	P17706;P17706-2;Q59F91;Q96AU5;A8K3N4	PTN2_HUMAN;.;.;.;.	Y	298;298;275;298	ENSP00000320298:S298Y;ENSP00000320546:S298Y;ENSP00000311857:S298Y	ENSP00000311857:S298Y	S	-	2	0	PTPN2	12792116	0.995000	0.38212	0.650000	0.29550	0.988000	0.76386	1.748000	0.38308	0.066000	0.16515	0.557000	0.71058	TCT	.		0.318	PTPN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254613.3	NM_002828, NM_080422, NM_080423	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	110431382	110431382	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr8:110431382C>A	ENST00000378402.5	+	22	2521	c.2417C>A	c.(2416-2418)aCa>aAa	p.T806K		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	806					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TACACTGGGACAAATGTTTCT	0.383										HNSCC(38;0.096)																											p.T806K		.											.	.	.	0			c.C2417A						.						123.0	115.0	118.0					8																	110431382		1889	4105	5994	SO:0001583	missense	93035	exon22			CTGGGACAAATGT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2417C>A	8.37:g.110431382C>A	ENSP00000367655:p.Thr806Lys	36	0		53	17	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	3.503	-0.101447	0.06967	.	.	ENSG00000205038	ENST00000378402	D	0.85861	-2.04	5.92	4.98	0.66077	.	0.293029	0.32901	N	0.005510	T	0.77068	0.4076	L	0.35723	1.085	0.20403	N	0.999909	B	0.09022	0.002	B	0.06405	0.002	T	0.62006	-0.6945	10	0.31617	T	0.26	.	10.6119	0.45427	0.2354:0.7646:0.0:0.0	.	806	Q86WI1	PKHL1_HUMAN	K	806	ENSP00000367655:T806K	ENSP00000367655:T806K	T	+	2	0	PKHD1L1	110500558	0.386000	0.25180	0.700000	0.30305	0.109000	0.19521	1.092000	0.30927	2.809000	0.96659	0.655000	0.94253	ACA	.		0.383	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PLA2G4C	8605	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	48565379	48565379	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr19:48565379C>T	ENST00000599921.1	-	14	1490	c.1133G>A	c.(1132-1134)cGg>cAg	p.R378Q	CTD-2265M8.2_ENST00000601950.1_RNA|PLA2G4C_ENST00000599111.1_Missense_Mutation_p.R388Q|PLA2G4C_ENST00000596510.1_5'UTR|PLA2G4C_ENST00000354276.3_Missense_Mutation_p.R378Q|CTD-2265M8.2_ENST00000601548.1_RNA|PLA2G4C_ENST00000413144.2_Missense_Mutation_p.R378Q|CTD-2265M8.2_ENST00000596552.1_RNA			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	378	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		GAGGTGCTTCCGGCTGCTCAT	0.577																																					p.R388Q		.											.	.	.	0			c.G1163A						.						71.0	54.0	60.0					19																	48565379		2203	4300	6503	SO:0001583	missense	8605	exon14			TGCTTCCGGCTGC	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1133G>A	19.37:g.48565379C>T	ENSP00000469473:p.Arg378Gln	27	0		35	5	NM_001159322	B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	37	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	C	10.07	1.248717	0.22880	.	.	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.12361	2.69;2.69	2.79	-0.043	0.13861	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	17.580700	0.00815	N	0.001520	T	0.09291	0.0229	L	0.29908	0.895	0.09310	N	1	B;B	0.25312	0.051;0.123	B;B	0.09377	0.004;0.003	T	0.21861	-1.0233	10	0.15952	T	0.53	-4.9703	4.0954	0.09988	0.0:0.5062:0.0:0.4938	.	388;378	B4DI40;Q9UP65	.;PA24C_HUMAN	Q	378	ENSP00000346228:R378Q;ENSP00000400036:R378Q	ENSP00000346228:R378Q	R	-	2	0	PLA2G4C	53257191	0.000000	0.05858	0.006000	0.13384	0.048000	0.14542	0.032000	0.13732	0.273000	0.22049	0.405000	0.27470	CGG	.		0.577	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1		
OSBP	5007	hgsc.bcm.edu	37	11	59369134	59369134	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr11:59369134C>G	ENST00000263847.1	-	4	1479	c.1000G>C	c.(1000-1002)Ggc>Cgc	p.G334R		NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	334					lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		CCCACATTGCCAGGAGTGTTT	0.542																																					p.G334R		.											OSBP,colon,carcinoma,0,1	OSBP	0	0			c.G1000C						.						142.0	138.0	139.0					11																	59369134		2201	4295	6496	SO:0001583	missense	5007	exon4			CATTGCCAGGAGT	AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.1000G>C	11.37:g.59369134C>G	ENSP00000263847:p.Gly334Arg	32	0		35	2	NM_002556	Q6P524	Missense_Mutation	SNP	ENST00000263847.1	37	CCDS7974.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183520	0.38609	.	.	ENSG00000110048	ENST00000263847	T	0.29142	1.58	5.95	5.95	0.96441	.	0.436377	0.28209	N	0.016195	T	0.24890	0.0604	N	0.08118	0	0.50039	D	0.999842	D	0.54047	0.964	P	0.49752	0.621	T	0.05835	-1.0861	10	0.16420	T	0.52	-22.1319	18.1595	0.89704	0.0:1.0:0.0:0.0	.	334	P22059	OSBP1_HUMAN	R	334	ENSP00000263847:G334R	ENSP00000263847:G334R	G	-	1	0	OSBP	59125710	0.935000	0.31712	0.997000	0.53966	0.881000	0.50899	1.996000	0.40776	2.822000	0.97130	0.655000	0.94253	GGC	.		0.542	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1		
CDCA7	83879	hgsc.bcm.edu;bcgsc.ca	37	2	174231093	174231093	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr2:174231093G>A	ENST00000347703.3	+	7	1025	c.881G>A	c.(880-882)gGc>gAc	p.G294D	CDCA7_ENST00000410101.3_Missense_Mutation_p.G329D|CDCA7_ENST00000410019.3_Missense_Mutation_p.G252D|CDCA7_ENST00000306721.3_Missense_Mutation_p.G373D|CDCA7_ENST00000392567.2_Intron	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7	294	Mediates transcriptional activity.				apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			GGCGTTCGAGGCCAGTTCTGT	0.532																																					p.G373D		.											.	.	.	0			c.G1118A						.						118.0	114.0	115.0					2																	174231093		2203	4300	6503	SO:0001583	missense	83879	exon8			TTCGAGGCCAGTT	BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.881G>A	2.37:g.174231093G>A	ENSP00000272789:p.Gly294Asp	76	0		56	4	NM_031942	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Missense_Mutation	SNP	ENST00000347703.3	37	CCDS2253.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.942010	0.92526	.	.	ENSG00000144354	ENST00000347703;ENST00000306721;ENST00000410101;ENST00000410019	T;T;T;T	0.55760	0.58;0.5;0.55;0.58	5.67	4.76	0.60689	Zinc-finger domain of monoamine-oxidase A repressor R1 (1);	0.000000	0.85682	D	0.000000	T	0.74809	0.3765	M	0.84156	2.68	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.998	T	0.78727	-0.2091	10	0.72032	D	0.01	-19.4052	16.7239	0.85416	0.0:0.1286:0.8714:0.0	.	252;329;294;373	B4DLP8;B4DV66;Q9BWT1;Q9BWT1-2	.;.;CDCA7_HUMAN;.	D	294;373;329;252	ENSP00000272789:G294D;ENSP00000306968:G373D;ENSP00000386656:G329D;ENSP00000386833:G252D	ENSP00000306968:G373D	G	+	2	0	CDCA7	173939339	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.831000	0.99420	2.677000	0.91161	0.655000	0.94253	GGC	.		0.532	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1	NM_031942	
HDLBP	3069	hgsc.bcm.edu	37	2	242189360	242189360	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr2:242189360G>T	ENST00000391975.1	-	12	1635	c.1408C>A	c.(1408-1410)Cgc>Agc	p.R470S	HDLBP_ENST00000427183.2_Missense_Mutation_p.R437S|HDLBP_ENST00000476807.1_5'UTR|HDLBP_ENST00000391976.2_Missense_Mutation_p.R470S|HDLBP_ENST00000310931.4_Missense_Mutation_p.R470S	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	470	KH 5. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		GGAGGGATGCGCACGGACACC	0.507																																					p.R470S		.											HDLBP,NS,carcinoma,+1,1	HDLBP	+1	0			c.C1408A						.						253.0	190.0	212.0					2																	242189360		2203	4300	6503	SO:0001583	missense	3069	exon12			GGATGCGCACGGA		CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.1408C>A	2.37:g.242189360G>T	ENSP00000375836:p.Arg470Ser	41	0		45	2	NM_005336	B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	ENST00000391975.1	37	CCDS2547.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.44|16.44	3.123395|3.123395	0.56613|0.56613	.|.	.|.	ENSG00000115677|ENSG00000115677	ENST00000373292|ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183	.|T;T;T;T	.|0.30981	.|1.51;1.51;1.51;1.51	5.6|5.6	4.68|4.68	0.58851|0.58851	.|K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	.|0.048738	.|0.85682	.|D	.|0.000000	T|T	0.47358|0.47358	0.1441|0.1441	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	.|B;D	.|0.61697	.|0.119;0.99	.|B;D	.|0.65010	.|0.29;0.931	T|T	0.22347|0.22347	-1.0219|-1.0219	5|10	.|0.10111	.|T	.|0.7	-5.4297|-5.4297	16.4634|16.4634	0.84071|0.84071	0.0:0.0:0.8687:0.1313|0.0:0.0:0.8687:0.1313	.|.	.|437;470	.|E7EM71;Q00341	.|.;VIGLN_HUMAN	E|S	278|470;470;470;437	.|ENSP00000375836:R470S;ENSP00000375837:R470S;ENSP00000312042:R470S;ENSP00000399139:R437S	.|ENSP00000312042:R470S	A|R	-|-	2|1	0|0	HDLBP|HDLBP	241838033|241838033	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.781000|7.781000	0.85668|0.85668	2.806000|2.806000	0.96561|0.96561	0.655000|0.655000	0.94253|0.94253	GCG|CGC	.		0.507	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257245.5	NM_203346	
TSC2	7249	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	2126499	2126499	+	Missense_Mutation	SNP	G	G	T	rs397515046		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr16:2126499G>T	ENST00000219476.3	+	25	3380	c.2750G>T	c.(2749-2751)cGg>cTg	p.R917L	TSC2_ENST00000401874.2_Missense_Mutation_p.R917L|TSC2_ENST00000568454.1_Missense_Mutation_p.R928L|TSC2_ENST00000350773.4_Missense_Mutation_p.R917L|TSC2_ENST00000382538.6_Missense_Mutation_p.R868L|TSC2_ENST00000439673.2_Missense_Mutation_p.R880L|TSC2_ENST00000353929.4_Missense_Mutation_p.R917L	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	917					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CAGGGCCTGCGGTCCAATGTC	0.642			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.R917L		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	.	.	0			c.G2750T						.						109.0	101.0	104.0					16																	2126499		2198	4300	6498	SO:0001583	missense	7249	exon25	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GCCTGCGGTCCAA	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2750G>T	16.37:g.2126499G>T	ENSP00000219476:p.Arg917Leu	28	0		22	4	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.594575	0.86953	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D;D	0.89196	-2.45;-2.37;-2.37;-2.48;-2.43;-2.45	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.91978	0.7459	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D;D	0.71674	0.998;0.996;0.998;0.998;0.996;0.995	D;D;D;D;D;D	0.81914	0.981;0.97;0.978;0.995;0.961;0.968	D	0.89068	0.3467	10	0.15499	T	0.54	-27.8281	18.0005	0.89196	0.0:0.0:1.0:0.0	.	868;880;917;917;917;917	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	L	917;917;917;880;868;917	ENSP00000219476:R917L;ENSP00000384468:R917L;ENSP00000248099:R917L;ENSP00000399232:R880L;ENSP00000371978:R868L;ENSP00000344383:R917L	ENSP00000219476:R917L	R	+	2	0	TSC2	2066500	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.147000	0.94646	2.319000	0.78375	0.561000	0.74099	CGG	.		0.642	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
ATP9A	10079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	50290700	50290700	+	Silent	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr20:50290700G>A	ENST00000338821.5	-	11	1293	c.1029C>T	c.(1027-1029)atC>atT	p.I343I	ATP9A_ENST00000311637.5_Silent_p.I207I|ATP9A_ENST00000402822.1_Silent_p.I222I	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	343					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ACCTAATGGGGATGATGTTGG	0.488																																					p.I343I		.											ATP9A,NS,malignant_melanoma,0,2	ATP9A	0	0			c.C1029T						.						93.0	77.0	82.0					20																	50290700		2203	4300	6503	SO:0001819	synonymous_variant	10079	exon11			AATGGGGATGATG	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1029C>T	20.37:g.50290700G>A		35	0		39	8	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Silent	SNP	ENST00000338821.5	37	CCDS33489.1																																																																																			.		0.488	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
STIL	6491	broad.mit.edu	37	1	47770618	47770618	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr1:47770618G>A	ENST00000360380.3	-	4	458	c.95C>T	c.(94-96)gCa>gTa	p.A32V	STIL_ENST00000243182.6_Missense_Mutation_p.A32V|STIL_ENST00000371877.3_Missense_Mutation_p.A32V|STIL_ENST00000396221.2_Missense_Mutation_p.A32V|STIL_ENST00000337817.5_Missense_Mutation_p.A32V	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	32					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				GTTCCAAAGTGCACATTTTGA	0.358																																					p.A32V													.	STIL	91	0			c.C95T						.						109.0	105.0	106.0					1																	47770618		2203	4300	6503	SO:0001583	missense	6491	exon3			CAAAGTGCACATT	M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.95C>T	1.37:g.47770618G>A	ENSP00000353544:p.Ala32Val	145	0		163	4	NM_003035	Q5T0C5|Q68CN9	Missense_Mutation	SNP	ENST00000360380.3	37	CCDS548.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029352	0.54790	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475;ENST00000413565	T;T;T;T;T;T;T	0.51325	2.09;2.09;2.1;2.09;2.09;0.82;0.71	5.59	3.5	0.40072	.	0.199684	0.52532	N	0.000077	T	0.42585	0.1209	L	0.46157	1.445	0.49582	D	0.999807	P;P;P;P;P	0.48998	0.635;0.918;0.635;0.918;0.918	B;P;B;P;P	0.44732	0.26;0.459;0.26;0.459;0.459	T	0.29366	-1.0014	10	0.34782	T	0.22	-10.8606	11.2024	0.48749	0.1958:0.0:0.8042:0.0	.	32;32;32;32;32	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	V	32;32;32;32;32;32;36	ENSP00000353544:A32V;ENSP00000337367:A32V;ENSP00000360944:A32V;ENSP00000379523:A32V;ENSP00000243182:A32V;ENSP00000411664:A32V;ENSP00000412019:A36V	ENSP00000243182:A32V	A	-	2	0	STIL	47543205	0.998000	0.40836	0.995000	0.50966	0.983000	0.72400	2.859000	0.48364	1.360000	0.45960	0.585000	0.79938	GCA	.		0.358	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035	
FMN2	56776	broad.mit.edu;bcgsc.ca	37	1	240371322	240371322	+	Silent	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr1:240371322C>T	ENST00000319653.9	+	5	3440	c.3210C>T	c.(3208-3210)ccC>ccT	p.P1070P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1070	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCCCTCTACCCGGAGCGGGCA	0.741																																					p.P1070P													.	FMN2	451	0			c.C3210T						.						2.0	3.0	2.0					1																	240371322		1184	2469	3653	SO:0001819	synonymous_variant	56776	exon5			TCTACCCGGAGCG	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3210C>T	1.37:g.240371322C>T		54	0		62	10	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			.		0.741	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
OR5M11	219487	broad.mit.edu	37	11	56309838	56309838	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr11:56309838G>T	ENST00000528616.2	-	1	919	c.896C>A	c.(895-897)gCc>gAc	p.A299D		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						ATTCTTCAAGGCCTGCTTCAC	0.383																																					p.A299D													.	OR5M11	60	0			c.C896A						.						73.0	66.0	68.0					11																	56309838		1914	4139	6053	SO:0001583	missense	219487	exon1			TTCAAGGCCTGCT	AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.896C>A	11.37:g.56309838G>T	ENSP00000432417:p.Ala299Asp	34	0		28	3	NM_001005245	B2RNL5|B2RNL7	Missense_Mutation	SNP	ENST00000528616.2	37	CCDS53629.1	.	.	.	.	.	.	.	.	.	.	G	8.776	0.927031	0.18056	.	.	ENSG00000255223	ENST00000528616	T	0.46063	0.88	4.85	3.95	0.45737	.	.	.	.	.	T	0.75686	0.3883	H	0.99211	4.47	0.09310	N	1	D	0.62365	0.991	P	0.61592	0.891	T	0.71866	-0.4463	9	0.87932	D	0	.	11.0357	0.47799	0.0905:0.0:0.9095:0.0	.	299	Q96RB7	OR5MB_HUMAN	D	299	ENSP00000432417:A299D	ENSP00000432417:A299D	A	-	2	0	OR5M11	56066414	0.005000	0.15991	0.071000	0.20095	0.103000	0.19146	1.400000	0.34577	1.318000	0.45170	-0.162000	0.13425	GCC	.		0.383	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391608.1	NM_001005245	
SPTBN2	6712	broad.mit.edu;bcgsc.ca	37	11	66460137	66460137	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr11:66460137C>T	ENST00000533211.1	-	26	5391	c.5060G>A	c.(5059-5061)cGg>cAg	p.R1687Q	SPTBN2_ENST00000309996.2_Missense_Mutation_p.R1687Q|SPTBN2_ENST00000529997.1_Missense_Mutation_p.R1687Q			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1687					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CAGGCGCTCCCGCCGCTCTCC	0.667																																					p.R1687Q													.	SPTBN2	188	0			c.G5060A						.						30.0	27.0	28.0					11																	66460137		2200	4295	6495	SO:0001583	missense	6712	exon25			CGCTCCCGCCGCT	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.5060G>A	11.37:g.66460137C>T	ENSP00000432568:p.Arg1687Gln	22	0		8	4	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	34	5.403350	0.96051	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.51325	0.71;0.71;0.71	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.46502	0.1396	L	0.41632	1.29	0.53005	D	0.999962	D	0.54397	0.966	P	0.49953	0.627	T	0.45041	-0.9288	10	0.59425	D	0.04	.	10.5997	0.45360	0.0:0.9108:0.0:0.0892	.	1687	O15020	SPTN2_HUMAN	Q	1687	ENSP00000432568:R1687Q;ENSP00000311489:R1687Q;ENSP00000433593:R1687Q	ENSP00000311489:R1687Q	R	-	2	0	SPTBN2	66216713	0.948000	0.32251	0.998000	0.56505	0.993000	0.82548	3.206000	0.51098	2.550000	0.86006	0.462000	0.41574	CGG	.		0.667	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
PPP1R1A	5502	broad.mit.edu	37	12	54976556	54976556	+	Silent	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr12:54976556C>T	ENST00000257905.8	-	4	377	c.207G>A	c.(205-207)cgG>cgA	p.R69R	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	69					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						TCTTCCGTTGCCGTGGAGACA	0.582																																					p.R69R													PPP1R1A_ENST00000257905,NS,carcinoma,-2,2	PPP1R1A	18	0			c.G207A						.						154.0	160.0	158.0					12																	54976556		2071	4198	6269	SO:0001819	synonymous_variant	5502	exon4			CCGTTGCCGTGGA	U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.207G>A	12.37:g.54976556C>T		66	0		50	3	NM_006741	Q6IB01|Q8TBJ2|Q8WWV2	Silent	SNP	ENST00000257905.8	37	CCDS44912.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297839	0.23650	.	.	ENSG00000135447	ENST00000553113	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	T	0.64427	0.2597	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63296	-0.6669	4	.	.	.	.	13.0892	0.59158	0.0:1.0:0.0:0.0	.	.	.	.	D	40	.	.	G	-	2	0	PPP1R1A	53262823	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.147000	0.31602	2.235000	0.73313	0.561000	0.74099	GGC	.		0.582	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406604.1	NM_006741	
RFC3	5983	broad.mit.edu;bcgsc.ca	37	13	34398073	34398073	+	Missense_Mutation	SNP	T	T	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr13:34398073T>A	ENST00000380071.3	+	3	375	c.245T>A	c.(244-246)aTt>aAt	p.I82N	RFC3_ENST00000434425.1_Missense_Mutation_p.I82N	NM_002915.3	NP_002906.1	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	82					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		AAAAAAAAAATTGAAATTAGC	0.284																																					p.I82N													.	RFC3	40	0			c.T245A						.						28.0	31.0	30.0					13																	34398073		2196	4285	6481	SO:0001583	missense	5983	exon3			AAAAAATTGAAAT		CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000380071.3:c.245T>A	13.37:g.34398073T>A	ENSP00000369411:p.Ile82Asn	217	0		212	6	NM_002915	C9JU95|O15252|Q5W0E8	Missense_Mutation	SNP	ENST00000380071.3	37	CCDS9352.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.462673	0.84425	.	.	ENSG00000133119	ENST00000380071;ENST00000434425	T;T	0.42513	0.97;0.97	5.74	5.74	0.90152	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.046773	0.85682	D	0.000000	T	0.67268	0.2875	M	0.85197	2.74	0.80722	D	1	D;D;D	0.60160	0.987;0.977;0.977	P;D;D	0.65573	0.879;0.936;0.936	T	0.73388	-0.3998	10	0.87932	D	0	-24.8682	15.2146	0.73254	0.0:0.0:0.0:1.0	.	82;82;82	B4DKE6;C9JU95;P40938	.;.;RFC3_HUMAN	N	82	ENSP00000369411:I82N;ENSP00000401001:I82N	ENSP00000369411:I82N	I	+	2	0	RFC3	33296073	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.498000	0.81546	2.195000	0.70347	0.533000	0.62120	ATT	.		0.284	RFC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044450.2	NM_002915	
TRAV27	28655	broad.mit.edu;bcgsc.ca	37	14	22616076	22616076	+	RNA	SNP	T	T	C			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr14:22616076T>C	ENST00000390457.2	+	0	128									T cell receptor alpha variable 27																		GTCCATTCTTTGGATTCAGTT	0.428																																					.													.	.	.	0			.						.						73.0	79.0	77.0					14																	22616076		1853	4110	5963			0	.			ATTCTTTGGATTC	AE000660		14q11.2	2012-02-07			ENSG00000211809	ENSG00000211809		"""T cell receptors / TRA locus"""	12125	other	T cell receptor gene						8188290	Standard	NG_001332		Approved				OTTHUMG00000170656		14.37:g.22616076T>C		43	0		45	5	.		RNA	SNP	ENST00000390457.2	37																																																																																				.		0.428	TRAV27-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TR_V_gene	OTTHUMT00000409904.1	NG_001332	
ERVK13-1	100507321	broad.mit.edu	37	16	2712543	2712543	+	RNA	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr16:2712543C>T	ENST00000568395.1	-	0	4184					NR_040023.1		Q9NX77	ENK13_HUMAN	endogenous retrovirus group K13, member 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)	structural molecule activity (GO:0005198)										ttttggagcccaatcaataac	0.388																																					.													.	.	.	0			.						.						113.0	90.0	97.0					16																	2712543		692	1591	2283			0	.			GGAGCCCAATCAA			16p13.3	2011-12-16				ENSG00000260565			27548	other	endogenous retrovirus	"""HERV-K_16p3.3 provirus ancestral Env polyprotein"""						Standard	NR_040023		Approved		uc010bss.2	Q9NX77			16.37:g.2712543C>T		69	1		62	6	.	A8K9G3	RNA	SNP	ENST00000568395.1	37																																																																																				.		0.388	ERVK13-1-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000431428.1	NR_040023	
GPS2	2874	broad.mit.edu;bcgsc.ca	37	17	7216378	7216378	+	Missense_Mutation	SNP	C	C	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr17:7216378C>G	ENST00000380728.2	-	10	1170	c.870G>C	c.(868-870)caG>caC	p.Q290H	GPS2_ENST00000389167.5_Missense_Mutation_p.Q290H|RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000391950.3_Missense_Mutation_p.Q290H			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	290					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				GCACAGGGAGCTGGGGGGAAG	0.557																																					p.Q290H													.	GPS2	44	0			c.G870C						.						64.0	75.0	71.0					17																	7216378		2203	4300	6503	SO:0001583	missense	2874	exon10			AGGGAGCTGGGGG	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.870G>C	17.37:g.7216378C>G	ENSP00000370104:p.Gln290His	18	0		7	3	NM_004489	B4DXA1|Q6FHM8	Missense_Mutation	SNP	ENST00000380728.2	37	CCDS11100.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.538210	0.45176	.	.	ENSG00000132522	ENST00000391950;ENST00000380728;ENST00000389167;ENST00000315601	T;T	0.45276	0.9;0.9	4.59	3.62	0.41486	.	0.366635	0.25022	U	0.033760	T	0.38401	0.1039	N	0.19112	0.55	0.34456	D	0.701208	D	0.53885	0.963	P	0.52217	0.693	T	0.55451	-0.8139	10	0.66056	D	0.02	-2.5989	11.8244	0.52259	0.0:0.9129:0.0:0.087	.	290	Q13227	GPS2_HUMAN	H	290	ENSP00000370104:Q290H;ENSP00000379841:Q290H	ENSP00000319371:Q290H	Q	-	3	2	GPS2	7157102	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	1.211000	0.32382	1.160000	0.42584	-0.150000	0.13652	CAG	.		0.557	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489	
TTC27	55622	broad.mit.edu	37	2	32891802	32891802	+	Silent	SNP	T	T	C			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr2:32891802T>C	ENST00000317907.4	+	7	1137	c.906T>C	c.(904-906)acT>acC	p.T302T		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	302										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						GTGAATTCACTCCAGCACCCA	0.393																																					p.T302T													.	TTC27	71	0			c.T906C						.						115.0	111.0	112.0					2																	32891802		2203	4300	6503	SO:0001819	synonymous_variant	55622	exon7			ATTCACTCCAGCA	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.906T>C	2.37:g.32891802T>C		52	0		64	3	NM_017735	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Silent	SNP	ENST00000317907.4	37	CCDS33176.1																																																																																			.		0.393	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
BMP2	650	broad.mit.edu	37	20	6759625	6759625	+	Silent	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr20:6759625C>T	ENST00000378827.4	+	3	2299	c.1080C>T	c.(1078-1080)tgC>tgT	p.C360C		NM_001200.2	NP_001191.1	P12643	BMP2_HUMAN	bone morphogenetic protein 2	360					activation of MAPK activity (GO:0000187)|atrioventricular valve morphogenesis (GO:0003181)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|bone mineralization (GO:0030282)|bone mineralization involved in bone maturation (GO:0035630)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiocyte differentiation (GO:0035051)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation (GO:0002062)|corticotropin hormone secreting cell differentiation (GO:0060128)|embryo development (GO:0009790)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchyme development (GO:0060485)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of calcium-independent cell-cell adhesion (GO:0051042)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|pericardium development (GO:0060039)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of odontogenesis (GO:0042482)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of Wnt signaling pathway by BMP signaling pathway (GO:0060804)|protein destabilization (GO:0031648)|protein phosphorylation (GO:0006468)|proteoglycan metabolic process (GO:0006029)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP receptor binding (GO:0070700)|phosphatase activator activity (GO:0019211)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)|retinol dehydrogenase activity (GO:0004745)|SMAD binding (GO:0046332)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	13						CTAAGGCATGCTGTGTCCCGA	0.448																																					p.C360C													.	BMP2	45	0			c.C1080T						.						126.0	99.0	108.0					20																	6759625		2203	4300	6503	SO:0001819	synonymous_variant	650	exon3			GGCATGCTGTGTC		CCDS13099.1	20p12	2014-01-30			ENSG00000125845	ENSG00000125845		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1069	protein-coding gene	gene with protein product		112261		BMP2A		2376592	Standard	NM_001200		Approved		uc002wmu.1	P12643	OTTHUMG00000031833	ENST00000378827.4:c.1080C>T	20.37:g.6759625C>T		41	0		29	3	NM_001200		Silent	SNP	ENST00000378827.4	37	CCDS13099.1																																																																																			.		0.448	BMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077918.3		
AADACL2-AS1	101928142	broad.mit.edu	37	3	151491023	151491023	+	RNA	DEL	T	T	-	rs541683669	byFrequency	TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:151491023delT	ENST00000483843.2	-	0	499				RP11-454C18.2_ENST00000475855.1_RNA|RP11-64D22.2_ENST00000483636.1_RNA																							aattctttACTTTTTTTTTTA	0.378													|||unknown(HR)	63	0.0125799	0.0182	0.0101	5008	,	,		19875	0.0139		0.0099	False		,,,				2504	0.0082				.													.	.	.	0			.						.																																					0	.			CTTTACTTTTTTT																													3.37:g.151491023delT		5	0		6	2	.		RNA	DEL	ENST00000483843.2	37																																																																																				.		0.378	RP11-454C18.2-001	KNOWN	basic	antisense	antisense	OTTHUMT00000357888.2		
MUC4	4585	broad.mit.edu	37	3	195508902	195508902	+	Silent	SNP	C	C	G	rs144571919		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:195508902C>G	ENST00000463781.3	-	2	10008	c.9549G>C	c.(9547-9549)acG>acC	p.T3183T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T3183T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGCGTGGTGTCAC	0.597																																					p.T3183T													MUC4_ENST00000463781,NS,malignant_melanoma,-1,2	MUC4	1505	0			c.G9549C						.																																			SO:0001819	synonymous_variant	4585	exon2			AAGAGGCGTGGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9549G>C	3.37:g.195508902C>G		87	0		131	6	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			C|0.500;G|0.500		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
HMGB3P22	729595	broad.mit.edu	37	5	179121146	179121151	+	RNA	DEL	AAAAAA	AAAAAA	-	rs544126756|rs55708497	byFrequency	TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:179121146_179121151delAAAAAA	ENST00000442010.2	+	0	253									high mobility group box 3 pseudogene 22																		actccgtctcaaaaaaaaaaaaaaaa	0.485														4217	0.842053	0.6808	0.9063	5008	,	,		14866	0.9246		0.8966	False		,,,				2504	0.8732				.													.	.	.	0			.						.																																					0	.			CGTCTCAAAAAAA			5q35.3	2011-09-21	2011-04-05		ENSG00000225051	ENSG00000225051		"""High mobility group / HMG-box pseudogenes"""	39314	pseudogene	pseudogene			"""high-mobility group box 3 pseudogene 22"""			12727900	Standard	NG_028953		Approved				OTTHUMG00000163166		5.37:g.179121152_179121157delAAAAAA		6	0		8	1	.		RNA	DEL	ENST00000442010.2	37																																																																																				.		0.485	HMGB3P22-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000371885.1		
CYP3A43	64816	broad.mit.edu	37	7	99445221	99445221	+	Missense_Mutation	SNP	G	G	T	rs373256715		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr7:99445221G>T	ENST00000354829.2	+	5	532	c.429G>T	c.(427-429)aaG>aaT	p.K143N	CYP3A43_ENST00000342499.4_5'UTR|CYP3A43_ENST00000415413.1_Intron|CYP3A43_ENST00000222382.5_Missense_Mutation_p.K143N|CYP3A43_ENST00000444905.1_Intron|CYP3A43_ENST00000477658.1_3'UTR|CYP3A43_ENST00000417625.1_Intron|CYP3A43_ENST00000312017.5_Missense_Mutation_p.K143N	NM_022820.3|NM_057095.1	NP_073731.1|NP_476436.1	Q9HB55	CP343_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 43	143			Missing (in allele CYP3A43*2).		small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)				Dexamethasone(DB01234)|Dolutegravir(DB08930)|Ethosuximide(DB00593)|Oxazepam(DB00842)|Phenelzine(DB00780)|Praziquantel(DB01058)|Rifampicin(DB01045)|Rifapentine(DB01201)|Testosterone(DB00624)|Troleandomycin(DB01361)|Zalcitabine(DB00943)	TAAAATTCAAGGAAGTAAGAA	0.353																																					p.K143N													.	CYP3A43	52	0			c.G429T						.						89.0	96.0	93.0					7																	99445221		2203	4300	6503	SO:0001583	missense	64816	exon5			ATTCAAGGAAGTA	AF319634	CCDS5675.1, CCDS5676.1, CCDS5677.1, CCDS64723.1	7q21.1	2007-12-14	2003-01-14		ENSG00000021461	ENSG00000021461		"""Cytochrome P450s"""	17450	protein-coding gene	gene with protein product		606534	"""cytochrome P450, subfamily IIIA, polypeptide 43"""			11160876, 11266076	Standard	NM_022820		Approved		uc003ury.1	Q9HB55	OTTHUMG00000156498	ENST00000354829.2:c.429G>T	7.37:g.99445221G>T	ENSP00000346887:p.Lys143Asn	62	1		52	3	NM_057096	Q495Y1|Q75MK2|Q75MK3|Q9HB52|Q9HB53|Q9HB54|Q9HB57	Missense_Mutation	SNP	ENST00000354829.2	37	CCDS5676.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.218130	0.39201	.	.	ENSG00000021461	ENST00000354829;ENST00000312017;ENST00000222382	T;T;T	0.70164	-0.46;-0.46;-0.46	2.58	2.58	0.30949	.	0.000000	0.85682	D	0.000000	D	0.83519	0.5272	H	0.95745	3.715	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.985;0.985	D	0.83654	0.0157	10	0.87932	D	0	.	5.93	0.19134	0.1659:0.0:0.8341:0.0	.	143;143;143	Q9HB55-3;Q75MK2;Q9HB55	.;.;CP343_HUMAN	N	143	ENSP00000346887:K143N;ENSP00000312110:K143N;ENSP00000222382:K143N	ENSP00000222382:K143N	K	+	3	2	CYP3A43	99283157	0.946000	0.32159	1.000000	0.80357	0.717000	0.41224	-0.048000	0.11944	1.367000	0.46095	0.205000	0.17691	AAG	.		0.353	CYP3A43-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000344379.1		
HAS2	3037	broad.mit.edu	37	8	122626911	122626911	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr8:122626911G>T	ENST00000303924.4	-	4	1634	c.1097C>A	c.(1096-1098)gCa>gAa	p.A366E		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	366					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			AAACCACATTGCATTGTACAG	0.438																																					p.A366E													.	HAS2	87	0			c.C1097A						.						171.0	146.0	155.0					8																	122626911		2203	4300	6503	SO:0001583	missense	3037	exon4			CACATTGCATTGT	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1097C>A	8.37:g.122626911G>T	ENSP00000306991:p.Ala366Glu	53	0		40	3	NM_005328	Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	37	CCDS6335.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.278066	0.80692	.	.	ENSG00000170961	ENST00000303924	T	0.47177	0.85	6.02	6.02	0.97574	.	0.045698	0.85682	D	0.000000	T	0.68778	0.3038	M	0.83692	2.655	0.80722	D	1	P	0.49862	0.929	P	0.56216	0.794	T	0.66654	-0.5869	10	0.39692	T	0.17	-14.8778	20.5385	0.99246	0.0:0.0:1.0:0.0	.	366	Q92819	HAS2_HUMAN	E	366	ENSP00000306991:A366E	ENSP00000306991:A366E	A	-	2	0	HAS2	122696092	1.000000	0.71417	0.907000	0.35723	0.953000	0.61014	9.846000	0.99502	2.863000	0.98299	0.549000	0.68633	GCA	.		0.438	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328	
TUBBP5	643224	broad.mit.edu	37	9	141069223	141069223	+	RNA	SNP	T	T	C			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr9:141069223T>C	ENST00000503395.1	+	0	922									tubulin, beta pseudogene 5																		actaaagacgtgggaggaagt	0.512																																					.													.	.	.	0			.						.																																					0	.			AAGACGTGGGAGG	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141069223T>C		44	1		52	5	.		RNA	SNP	ENST00000503395.1	37																																																																																				.		0.512	TUBBP5-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000373087.1	NR_027156	
MT-ND2	4536	broad.mit.edu	37	M	2534	2534	+	5'Flank	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chrM:2534G>A	ENST00000361453.3	+	0	0				MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TCACCAGTATTAGAGGCACCG	0.463																																					.													.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			GTATTAGAGGCAC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2534G>A	Exception_encountered	263	0		964	7	.	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																				.		0.463	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
FAT1	2195	ucsc.edu;bcgsc.ca	37	4	187539158	187539158	+	Missense_Mutation	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr4:187539158G>A	ENST00000441802.2	-	10	8791	c.8582C>T	c.(8581-8583)gCc>gTc	p.A2861V		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2861	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CATGTTAATGGCAAAGGATTC	0.413										HNSCC(5;0.00058)																											p.A2861V	Colon(197;1040 2055 4143 4984 49344)												.	FAT1	500	0			c.C8582T						.						150.0	134.0	139.0					4																	187539158		1937	4153	6090	SO:0001583	missense	2195	exon10			TTAATGGCAAAGG	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8582C>T	4.37:g.187539158G>A	ENSP00000406229:p.Ala2861Val	39	0		33	4	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.304274	0.60305	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.53206	0.63	4.86	4.86	0.63082	Cadherin (4);Cadherin-like (1);	0.171968	0.51477	D	0.000099	T	0.50103	0.1596	L	0.33710	1.025	0.80722	D	1	P	0.42584	0.784	P	0.50378	0.639	T	0.34179	-0.9839	10	0.27785	T	0.31	.	18.5503	0.91062	0.0:0.0:1.0:0.0	.	2861	Q14517	FAT1_HUMAN	V	2861;2863	ENSP00000406229:A2861V	ENSP00000260147:A2863V	A	-	2	0	FAT1	187776152	1.000000	0.71417	0.996000	0.52242	0.686000	0.39977	7.860000	0.86993	2.682000	0.91365	0.650000	0.86243	GCC	.		0.413	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
JADE2	23338	ucsc.edu	37	5	133871604	133871604	+	Splice_Site	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr5:133871604C>T	ENST00000402835.1	+	2	312	c.57C>T	c.(55-57)gaC>gaT	p.D19D	PHF15_ENST00000282605.4_Splice_Site_p.D19D|PHF15_ENST00000361895.2_Splice_Site_p.D19D|PHF15_ENST00000395003.1_Splice_Site_p.D19D|PHF15_ENST00000515554.1_3'UTR																NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACACCACTGACAGTAAGGCCT	0.512																																					p.D19D													.	PHF15	60	0			c.C57T						.						168.0	124.0	139.0					5																	133871604		2203	4300	6503	SO:0001630	splice_region_variant	0	exon2			CACTGACAGTAAG																												ENST00000402835.1:c.58+1C>T	5.37:g.133871604C>T		35	0		39	4	NM_015288		Silent	SNP	ENST00000402835.1	37																																																																																				.		0.512	PHF15-007	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000318543.1		Silent
EEF1A1	1915	ucsc.edu	37	6	74227940	74227940	+	Silent	SNP	A	A	C	rs11556677	byFrequency	TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:74227940A>C	ENST00000316292.9	-	6	2068	c.1077T>G	c.(1075-1077)ccT>ccG	p.P359P	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Silent_p.P359P|EEF1A1_ENST00000309268.6_Silent_p.P359P	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	359					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						AATCCAATACAGGGGCATAGC	0.448																																					p.P359P													EEF1A1,bladder,carcinoma,-2,1	EEF1A1	56	0			c.T1077G						.						36.0	40.0	38.0					6																	74227940		2195	4298	6493	SO:0001819	synonymous_variant	1915	exon7			CAATACAGGGGCA	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1077T>G	6.37:g.74227940A>C		49	1		44	6	NM_001402	P04719|P04720|Q6IQ15	Silent	SNP	ENST00000316292.9	37	CCDS4980.1																																																																																			C|1.000;|0.000		0.448	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
RORB	6096	ucsc.edu;bcgsc.ca	37	9	77300435	77300435	+	Silent	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr9:77300435G>T	ENST00000396204.2	+	10	1314	c.1314G>T	c.(1312-1314)ctG>ctT	p.L438L	RORB_ENST00000376896.3_Silent_p.L427L			Q92753	RORB_HUMAN	RAR-related orphan receptor B	438	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	GGGAGAAGCTGCAGGTATTTA	0.473																																					p.L427L													.	RORB	89	0			c.G1281T						.						168.0	154.0	159.0					9																	77300435		2203	4300	6503	SO:0001819	synonymous_variant	6096	exon10			GAAGCTGCAGGTA	Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.1314G>T	9.37:g.77300435G>T		29	0		39	4	NM_006914	Q8WX73	Silent	SNP	ENST00000396204.2	37																																																																																				.		0.473	RORB-201	KNOWN	basic	protein_coding	protein_coding			
USP8	9101	ucsc.edu	37	15	50785016	50785016	+	Missense_Mutation	SNP	A	A	G	rs148783236	byFrequency	TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr15:50785016A>G	ENST00000396444.3	+	15	2691	c.2353A>G	c.(2353-2355)Act>Gct	p.T785A	USP8_ENST00000307179.4_Missense_Mutation_p.T785A|RP11-562A8.5_ENST00000560159.1_lincRNA|USP8_ENST00000425032.3_Missense_Mutation_p.T679A|USP8_ENST00000433963.1_Missense_Mutation_p.T785A	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	785	USP.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)	p.T785A(2)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		CTTAGGAAATACTTGTTATAT	0.398																																					p.T785A													USP8,NS,carcinoma,0,3	USP8	90	2	Substitution - Missense(2)	prostate(2)	c.A2353G						.						118.0	105.0	110.0					15																	50785016		2196	4294	6490	SO:0001583	missense	9101	exon15			GGAAATACTTGTT	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.2353A>G	15.37:g.50785016A>G	ENSP00000379721:p.Thr785Ala	25	1		37	9	NM_001128610	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	ENST00000396444.3	37	CCDS10137.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.653902	0.88056	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032;ENST00000419830;ENST00000396440	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.22	5.22	0.72569	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.74496	0.3724	H	0.95712	3.71	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.79108	0.964;0.992	T	0.83303	-0.0027	10	0.87932	D	0	-18.2981	15.3993	0.74827	1.0:0.0:0.0:0.0	.	679;785	B4DKA8;P40818	.;UBP8_HUMAN	A	785;785;785;679;10;10	ENSP00000379721:T785A;ENSP00000405537:T785A;ENSP00000302239:T785A;ENSP00000412682:T679A	ENSP00000302239:T785A	T	+	1	0	USP8	48572308	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.648000	0.91062	2.096000	0.63516	0.528000	0.53228	ACT	G|1.000;|0.000		0.398	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154	
USP8	9101	ucsc.edu	37	15	50785054	50785054	+	Silent	SNP	C	C	T	rs199814360		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr15:50785054C>T	ENST00000396444.3	+	15	2729	c.2391C>T	c.(2389-2391)aaC>aaT	p.N797N	USP8_ENST00000307179.4_Silent_p.N797N|RP11-562A8.5_ENST00000560159.1_lincRNA|USP8_ENST00000425032.3_Silent_p.N691N|USP8_ENST00000433963.1_Silent_p.N797N	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	797	USP.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GCCTATGTAACGCTCCACATT	0.363																																					p.N797N													.	USP8	90	0			c.C2391T						.						105.0	96.0	99.0					15																	50785054		2196	4293	6489	SO:0001819	synonymous_variant	9101	exon15			ATGTAACGCTCCA	D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.2391C>T	15.37:g.50785054C>T		24	0		34	8	NM_001128610	B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Silent	SNP	ENST00000396444.3	37	CCDS10137.1																																																																																			.		0.363	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254541.1	NM_005154	
ITGB3	3690	ucsc.edu	37	17	45368459	45368459	+	Intron	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr17:45368459G>T	ENST00000559488.1	+	9	1276				ITGB3_ENST00000435993.2_Intron|ITGB3_ENST00000571680.1_Missense_Mutation_p.R422M|ITGB3_ENST00000560629.1_Intron	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)						activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	GACACGGTGAGGTGGGCTGGG	0.522																																					.													.	ITGB3	157	0			.						.						91.0	79.0	83.0					17																	45368459		2203	4300	6503	SO:0001627	intron_variant	3690	.			CGGTGAGGTGGGC		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.1260+5G>T	17.37:g.45368459G>T		33	0		25	4	.	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Missense_Mutation	SNP	ENST00000559488.1	37	CCDS11511.1																																																																																			.		0.522	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212	
ATP13A1	57130	ucsc.edu;bcgsc.ca	37	19	19765461	19765461	+	Silent	SNP	G	G	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr19:19765461G>A	ENST00000357324.6	-	13	1730	c.1704C>T	c.(1702-1704)caC>caT	p.H568H	ATP13A1_ENST00000496082.1_5'UTR|ATP13A1_ENST00000291503.5_Silent_p.H450H	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	568						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CCAGGGCCCGGTGTGTTTCTA	0.647																																					p.H568H	Esophageal Squamous(142;920 1789 9047 14684 24777)												.	ATP13A1	82	0			c.C1704T						.						110.0	90.0	97.0					19																	19765461		2203	4300	6503	SO:0001819	synonymous_variant	57130	exon13			GGCCCGGTGTGTT	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.1704C>T	19.37:g.19765461G>A		29	0		26	4	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Silent	SNP	ENST00000357324.6	37	CCDS32970.2																																																																																			.		0.647	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
GPR32	2854	ucsc.edu	37	19	51274851	51274851	+	Missense_Mutation	SNP	A	A	C	rs201404376		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr19:51274851A>C	ENST00000270590.4	+	1	1131	c.994A>C	c.(994-996)Act>Cct	p.T332P		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CCAGTCTTTGACTTCTGCCCT	0.552																																					p.T332P	Esophageal Squamous(113;152 1581 5732 15840 44398)												GPR32,NS,carcinoma,0,5	GPR32	68	0			c.A994C						.						66.0	71.0	69.0					19																	51274851		2203	4298	6501	SO:0001583	missense	2854	exon1			TCTTTGACTTCTG	AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.994A>C	19.37:g.51274851A>C	ENSP00000270590:p.Thr332Pro	52	1		45	5	NM_001506	Q502U7|Q6NWS5	Missense_Mutation	SNP	ENST00000270590.4	37	CCDS12801.1	.	.	.	.	.	.	.	.	.	.	a	0.006	-2.066505	0.00382	.	.	ENSG00000142511	ENST00000270590	T	0.36699	1.24	2.71	-0.781	0.10965	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	9	0.02654	T	1	.	3.6506	0.08202	0.205:0.5623:0.0:0.2327	.	332	O75388	GPR32_HUMAN	P	332	ENSP00000270590:T332P	ENSP00000270590:T332P	T	+	1	0	GPR32	55966663	0.000000	0.05858	0.025000	0.17156	0.653000	0.38743	0.089000	0.15002	-0.262000	0.09392	-0.755000	0.03482	ACT	.		0.552	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465016.1		
PNPT1	87178	bcgsc.ca	37	2	55874589	55874589	+	Splice_Site	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr2:55874589C>A	ENST00000447944.2	-	19	1582		c.e19-1			NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1						cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATTGGAACCCCTATAATTGGG	0.383																																					.													.	PNPT1	68	0			c.1496-1G>T						.						64.0	65.0	64.0					2																	55874589		2203	4300	6503	SO:0001630	splice_region_variant	87178	exon20			GAACCCCTATAAT	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.1496-1G>T	2.37:g.55874589C>A		144	0		148	5	NM_033109	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Splice_Site	SNP	ENST00000447944.2	37	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980236	0.74474	.	.	ENSG00000138035	ENST00000447944	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.792	0.96463	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PNPT1	55728093	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	6.789000	0.75110	2.740000	0.93945	0.557000	0.71058	.	.		0.383	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	Intron
DGKG	1608	bcgsc.ca	37	3	186038225	186038225	+	Silent	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:186038225G>T	ENST00000265022.3	-	2	563	c.24C>A	c.(22-24)tcC>tcA	p.S8S	DGKG_ENST00000382164.4_Silent_p.S8S|DGKG_ENST00000344484.4_Silent_p.S8S|DGKG_ENST00000544847.1_Silent_p.S8S	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	8					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	CTGGAGTGAGGGAGACCCACC	0.468																																					p.S8S													.	DGKG	98	0			c.C24A						.						141.0	134.0	136.0					3																	186038225		2203	4300	6503	SO:0001819	synonymous_variant	1608	exon2			AGTGAGGGAGACC	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.24C>A	3.37:g.186038225G>T		72	0		59	4	NM_001346	B2RAH4|Q2M1H4|Q5FWG1	Silent	SNP	ENST00000265022.3	37	CCDS3274.1																																																																																			.		0.468	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
LOC647323	647323	bcgsc.ca	37	3	193677710	193677710	+	lincRNA	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr3:193677710G>T	ENST00000397645.2	-	0	115					NR_033944.1																						GTGCTCCTGGGAGGTGAAGCT	0.493																																					.													.	.	.	0			.						.																																					0	.			TCCTGGGAGGTGA																													3.37:g.193677710G>T		52	0		39	4	.		RNA	SNP	ENST00000397645.2	37																																																																																				.		0.493	RP11-699L21.1-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000342625.1		
NAF1	92345	bcgsc.ca	37	4	164050118	164050118	+	Silent	SNP	A	A	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr4:164050118A>G	ENST00000274054.2	-	8	1609	c.1416T>C	c.(1414-1416)ccT>ccC	p.P472P	NAF1_ENST00000509434.1_Intron|NAF1_ENST00000422287.2_Intron	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	472	Pro-rich.				pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				gtggagggggagggggtgggg	0.512																																					p.P472P													.	NAF1	69	0			c.T1416C						.																																			SO:0001819	synonymous_variant	92345	exon8			AGGGGGAGGGGGT		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.1416T>C	4.37:g.164050118A>G		69	1		25	12	NM_138386	D3DP28|E9PAZ2	Silent	SNP	ENST00000274054.2	37	CCDS3803.1																																																																																			.		0.512	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386	
NAF1	92345	bcgsc.ca	37	4	164050124	164050124	+	Silent	SNP	T	T	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr4:164050124T>G	ENST00000274054.2	-	8	1603	c.1410A>C	c.(1408-1410)ccA>ccC	p.P470P	NAF1_ENST00000509434.1_Intron|NAF1_ENST00000422287.2_Intron	NM_138386.2	NP_612395.2	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 ribonucleoprotein	470	Pro-rich.				pseudouridine synthesis (GO:0001522)|ribosome biogenesis (GO:0042254)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(10)|ovary(2)	21	all_hematologic(180;0.166)	Prostate(90;0.109)				ggggagggggtgggggtaggg	0.522																																					p.P470P													.	NAF1	69	0			c.A1410C						.						10.0	10.0	10.0					4																	164050124		2188	4274	6462	SO:0001819	synonymous_variant	92345	exon8			AGGGGGTGGGGGT		CCDS3803.1, CCDS47159.1	4q32.2	2013-03-05	2013-03-05			ENSG00000145414			25126	protein-coding gene	gene with protein product			"""nuclear assembly factor 1 homolog (S. cerevisiae)"""			16618814, 16601202	Standard	NM_138386		Approved		uc003iqj.3	Q96HR8		ENST00000274054.2:c.1410A>C	4.37:g.164050124T>G		67	2		28	13	NM_138386	D3DP28|E9PAZ2	Silent	SNP	ENST00000274054.2	37	CCDS3803.1																																																																																			.		0.522	NAF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364684.2	NM_138386	
Unknown	0	bcgsc.ca	37	6	112937924	112937924	+	IGR	SNP	T	T	C			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr6:112937924T>C								AL357514.1 (84437 upstream) : RNU6-1163P (354770 downstream)																							AGCTTCATTTTCTTCTAATAT	0.507																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TCATTTTCTTCTA																													6.37:g.112937924T>C		47	0		30	4	.		RNA	SNP		37																																																																																				.	0	0.507								
PRSS1	5644	bcgsc.ca	37	7	142460339	142460339	+	Missense_Mutation	SNP	G	G	A	rs200973660		TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr7:142460339G>A	ENST00000311737.7	+	4	518	c.512G>A	c.(511-513)tGt>tAt	p.C171Y	PRSS1_ENST00000486171.1_Missense_Mutation_p.C185Y	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	171	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	CAGGCTAAGTGTGAAGCCTCC	0.527																																					p.C171Y													.	PRSS1	68	0			c.G512A						.						293.0	285.0	288.0					7																	142460339		2203	4300	6503	SO:0001583	missense	5644	exon4			CTAAGTGTGAAGC	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.512G>A	7.37:g.142460339G>A	ENSP00000308720:p.Cys171Tyr	92	2		89	13	NM_002769	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	37	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153199	0.38021	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	D;D;D	0.96992	-4.2;-4.2;-2.52	3.28	3.28	0.37604	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.98918	0.9633	H	0.99104	4.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98703	1.0701	10	0.87932	D	0	.	14.0086	0.64481	0.0:0.0:1.0:0.0	.	185;171	E7EQ64;P07477	.;TRY1_HUMAN	Y	185;171;161;121	ENSP00000417854:C185Y;ENSP00000308720:C171Y;ENSP00000419912:C121Y	ENSP00000308720:C171Y	C	+	2	0	PRSS1	142139913	1.000000	0.71417	0.080000	0.20451	0.020000	0.10135	9.762000	0.98944	1.789000	0.52484	0.398000	0.26397	TGT	.		0.527	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
OR7E161P	389626	bcgsc.ca	37	8	11786595	11786595	+	IGR	SNP	A	A	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr8:11786595A>G								CTSB (60857 upstream) : DEFB136 (44850 downstream)																							CTGAGGAAAAAGGACACCAAA	0.478																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	389626	.			GGAAAAAGGACAC																													8.37:g.11786595A>G		81	0		65	4	.		RNA	SNP		37																																																																																				.	0	0.478								
CSPP1	79848	bcgsc.ca	37	8	68028315	68028315	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr8:68028315G>T	ENST00000262210.5	+	11	1470	c.1439G>T	c.(1438-1440)cGc>cTc	p.R480L	CSPP1_ENST00000412460.1_Missense_Mutation_p.R186L	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	515	Pro-rich.				positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GAAGATTTGCGCAGTGGACTC	0.458																																					p.R480L													.	CSPP1	129	0			c.G1439T						.						150.0	147.0	148.0					8																	68028315		1909	4124	6033	SO:0001583	missense	79848	exon11			ATTTGCGCAGTGG	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.1439G>T	8.37:g.68028315G>T	ENSP00000262210:p.Arg480Leu	64	0		57	4	NM_024790	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	ENST00000262210.5	37	CCDS43744.1	.	.	.	.	.	.	.	.	.	.	G	8.662	0.900866	0.17686	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.29917	1.57;1.55;1.55	5.61	3.04	0.35103	.	0.365634	0.25408	N	0.030895	T	0.14485	0.0350	N	0.08118	0	0.09310	N	0.999997	B;B;B;B	0.17465	0.006;0.022;0.003;0.003	B;B;B;B	0.16289	0.015;0.015;0.015;0.015	T	0.19031	-1.0318	10	0.35671	T	0.21	-0.5009	7.8132	0.29243	0.7871:0.1384:0.0745:0.0	.	186;480;515;515	Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5;F8W7C3	.;.;CSPP1_HUMAN;.	L	480;515;186;186	ENSP00000262210:R480L;ENSP00000415782:R186L;ENSP00000430092:R186L	ENSP00000262210:R480L	R	+	2	0	CSPP1	68190869	0.983000	0.35010	0.190000	0.23270	0.094000	0.18550	1.681000	0.37618	0.386000	0.24997	-0.290000	0.09829	CGC	.		0.458	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790	
TRIM51GP	120824	bcgsc.ca	37	11	49002943	49002943	+	IGR	SNP	A	A	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr11:49002943A>G								OR4A47 (491611 upstream) : TRIM49B (47560 downstream)																							TTCACAGAACATCTCCTTTGT	0.517																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	120824	.			CAGAACATCTCCT																													11.37:g.49002943A>G		115	0		83	19	.		RNA	SNP		37																																																																																				.	0	0.517								
ANKRD13D	338692	bcgsc.ca	37	11	67068427	67068427	+	Intron	SNP	G	G	T	rs368733850	byFrequency	TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr11:67068427G>T	ENST00000447274.2	+	11	1987				ANKRD13D_ENST00000511455.2_Intron|SSH3_ENST00000308127.4_5'Flank|ANKRD13D_ENST00000514166.1_Intron|ANKRD13D_ENST00000515828.1_5'UTR|ANKRD13D_ENST00000308440.6_Intron|SSH3_ENST00000376757.5_5'Flank|SSH3_ENST00000308298.7_5'Flank			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D							endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GCCACCAGCCGTGCCTCACCC	0.637																																					.													.	ANKRD13D	71	0			.						.						64.0	51.0	56.0					11																	67068427		2199	4295	6494	SO:0001627	intron_variant	338692	.			CCAGCCGTGCCTC	AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.813-34G>T	11.37:g.67068427G>T		35	0		23	3	.	D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	ENST00000447274.2	37																																																																																				.		0.637	ANKRD13D-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000371067.2	NM_207354	
OR6X1	390260	bcgsc.ca	37	11	123624820	123624820	+	Missense_Mutation	SNP	C	C	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr11:123624820C>T	ENST00000327930.2	-	1	433	c.407G>A	c.(406-408)aGc>aAc	p.S136N		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GCAGAGTTTGCTGGTCATGAT	0.537																																					p.S136N													.	OR6X1	54	0			c.G407A						.						111.0	112.0	112.0					11																	123624820		2202	4299	6501	SO:0001583	missense	390260	exon1			AGTTTGCTGGTCA	AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.407G>A	11.37:g.123624820C>T	ENSP00000333724:p.Ser136Asn	28	0		17	3	NM_001005188	B9EGW9|Q6IFA0	Missense_Mutation	SNP	ENST00000327930.2	37	CCDS31695.1	.	.	.	.	.	.	.	.	.	.	C	9.381	1.072983	0.20147	.	.	ENSG00000221931	ENST00000327930	T	0.37411	1.2	4.55	1.62	0.23740	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.19005	0.0456	N	0.25201	0.72	0.24301	N	0.995122	B	0.10296	0.003	B	0.08055	0.003	T	0.31861	-0.9928	9	0.10377	T	0.69	-5.8296	5.1928	0.15218	0.1648:0.6521:0.0:0.1831	.	136	Q8NH79	OR6X1_HUMAN	N	136	ENSP00000333724:S136N	ENSP00000333724:S136N	S	-	2	0	OR6X1	123130030	0.000000	0.05858	0.371000	0.25978	0.989000	0.77384	-0.224000	0.09164	0.174000	0.19809	0.650000	0.86243	AGC	.		0.537	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387436.1	NM_001005188	
TMEM260	54916	bcgsc.ca	37	14	57114069	57114069	+	Missense_Mutation	SNP	C	C	A			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr14:57114069C>A	ENST00000261556.6	+	16	2100	c.1978C>A	c.(1978-1980)Cct>Act	p.P660T	RP11-1085N6.2_ENST00000555924.1_RNA|TMEM260_ENST00000536419.1_Missense_Mutation_p.P194T|RP11-1085N6.2_ENST00000553800.1_RNA	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	660						integral component of membrane (GO:0016021)											AGATGCAGATCCTGAAGTGCT	0.473																																					p.P660T													.	.	.	0			c.C1978A						.						92.0	77.0	82.0					14																	57114069		2203	4300	6503	SO:0001583	missense	54916	exon16			GCAGATCCTGAAG	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.1978C>A	14.37:g.57114069C>A	ENSP00000261556:p.Pro660Thr	51	0		32	3	NM_017799	A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	ENST00000261556.6	37	CCDS9727.2	.	.	.	.	.	.	.	.	.	.	C	7.511	0.654576	0.14580	.	.	ENSG00000070269	ENST00000261556;ENST00000536419	T;T	0.45668	1.48;0.89	5.43	2.48	0.30137	.	0.179653	0.49916	D	0.000128	T	0.30135	0.0755	L	0.32530	0.975	0.22719	N	0.998814	P	0.36282	0.546	B	0.29267	0.1	T	0.08638	-1.0712	10	0.51188	T	0.08	-1.8146	15.0588	0.71936	0.0:0.599:0.401:0.0	.	660	Q9NX78	CN101_HUMAN	T	660;194	ENSP00000261556:P660T;ENSP00000438742:P194T	ENSP00000261556:P660T	P	+	1	0	C14orf101	56183822	0.992000	0.36948	0.018000	0.16275	0.184000	0.23303	2.033000	0.41136	0.357000	0.24183	0.650000	0.86243	CCT	.		0.473	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799	
AREL1	9870	bcgsc.ca	37	14	75179687	75179687	+	5'UTR	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr14:75179687G>T	ENST00000356357.4	-	0	131				FCF1_ENST00000553615.1_5'Flank|FCF1_ENST00000534938.2_5'Flank|SNORA7_ENST00000410672.1_RNA|FCF1_ENST00000341162.4_5'Flank|AC007956.1_ENST00000338772.5_Silent_p.P38P|AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1						apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GTCCTGGGAAGGGGCGGCAGC	0.652																																					.													.	KIAA0317	68	0			.						.																																			SO:0001623	5_prime_UTR_variant	0	.			TGGGAAGGGGCGG	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.-385C>A	14.37:g.75179687G>T		54	0		36	4	.	B4E2C7|Q7LDY1|Q8IYY9	Silent	SNP	ENST00000356357.4	37	CCDS41971.1																																																																																			.		0.652	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821	
ZNF271	10778	bcgsc.ca	37	18	32889539	32889539	+	RNA	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr18:32889539G>T	ENST00000399070.3	+	0	3933					NR_024565.1|NR_024566.1		Q14591	ZN271_HUMAN	zinc finger protein 271						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(9)	12						aaaaactgaaggacaggattc	0.488																																					.													.	ZNF271	16	0			.						.																																					10778	.			ACTGAAGGACAGG	X78930		18q12.2	2013-04-03			ENSG00000257267	ENSG00000257267		"""Zinc fingers, C2H2-type"""	13065	other	unknown		604754				7865130, 11777961	Standard	NR_024565		Approved	HZF7, ZNFEB	uc002kyp.4	Q14591	OTTHUMG00000132563		18.37:g.32889539G>T		40	0		22	3	.	B3KN34|Q96T29|Q9BSX2|Q9UN33|Q9Y5B7	RNA	SNP	ENST00000399070.3	37																																																																																				.		0.488	ZNF271-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000255767.2	NR_024565	
PRKCSH	5589	bcgsc.ca	37	19	11560245	11560245	+	Splice_Site	SNP	T	T	G			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr19:11560245T>G	ENST00000589838.1	+	16	1603		c.e16+2		PRKCSH_ENST00000587327.1_Splice_Site|PRKCSH_ENST00000592741.1_Splice_Site|PRKCSH_ENST00000591462.1_Splice_Site|PRKCSH_ENST00000252455.2_Splice_Site|PRKCSH_ENST00000412601.1_Splice_Site			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H						cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						GGCGCAGAGGTGGGCGGGGAG	0.672																																					.													.	PRKCSH	55	0			c.1603+2T>G						.						26.0	32.0	30.0					19																	11560245		2186	4269	6455	SO:0001630	splice_region_variant	5589	exon17			CAGAGGTGGGCGG		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.1584+2T>G	19.37:g.11560245T>G		22	2		16	12	NM_002743	A8K318|Q96BU9|Q96D06|Q9P0W9	Splice_Site	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																			.		0.672	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		Intron
CSE1L	1434	bcgsc.ca	37	20	47712955	47712955	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr20:47712955G>T	ENST00000262982.2	+	25	3019	c.2896G>T	c.(2896-2898)Gcc>Tcc	p.A966S	CSE1L_ENST00000542325.1_Missense_Mutation_p.A749S|CSE1L_ENST00000469700.1_3'UTR|CSE1L_ENST00000396192.3_Missense_Mutation_p.A910S	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	966					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			CCTTCAGGCAGCCAGTGTGAC	0.473																																					p.A966S													.	CSE1L	83	0			c.G2896T						.						129.0	107.0	114.0					20																	47712955		2203	4300	6503	SO:0001583	missense	1434	exon25			CAGGCAGCCAGTG	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.2896G>T	20.37:g.47712955G>T	ENSP00000262982:p.Ala966Ser	30	0		49	4	NM_001316	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Missense_Mutation	SNP	ENST00000262982.2	37	CCDS13412.1	.	.	.	.	.	.	.	.	.	.	G	19.74	3.884138	0.72410	.	.	ENSG00000124207	ENST00000417408;ENST00000262982;ENST00000542325;ENST00000396192	T;T;T	0.32753	2.17;1.44;2.43	5.72	5.72	0.89469	.	0.045207	0.85682	D	0.000000	T	0.19565	0.0470	N	0.08118	0	0.80722	D	1	B;B;B;B	0.30455	0.049;0.28;0.227;0.049	B;B;B;B	0.25614	0.033;0.062;0.059;0.033	T	0.06058	-1.0848	10	0.35671	T	0.21	-8.3768	20.244	0.98389	0.0:0.0:1.0:0.0	.	749;910;910;966	B4DUC5;A3RLL6;F8W904;P55060	.;.;.;XPO2_HUMAN	S	564;966;749;910	ENSP00000262982:A966S;ENSP00000446477:A749S;ENSP00000379495:A910S	ENSP00000262982:A966S	A	+	1	0	CSE1L	47146362	1.000000	0.71417	0.977000	0.42913	0.986000	0.74619	9.420000	0.97426	2.865000	0.98341	0.655000	0.94253	GCC	.		0.473	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
CARD10	29775	bcgsc.ca	37	22	37888537	37888537	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chr22:37888537G>T	ENST00000403299.1	-	19	2872	c.2656C>A	c.(2656-2658)Ctg>Atg	p.L886M	CARD10_ENST00000251973.5_Missense_Mutation_p.L886M|CARD10_ENST00000406271.3_Missense_Mutation_p.L600M			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	886					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					GATGGGCACAGTTCCTCCCCA	0.677																																					p.L886M													.	CARD10	55	0			c.C2656A						.						32.0	40.0	38.0					22																	37888537		2202	4300	6502	SO:0001583	missense	29775	exon18			GGCACAGTTCCTC	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.2656C>A	22.37:g.37888537G>T	ENSP00000384570:p.Leu886Met	56	0		59	4	NM_014550	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Missense_Mutation	SNP	ENST00000403299.1	37	CCDS13948.1	.	.	.	.	.	.	.	.	.	.	G	3.732	-0.055305	0.07362	.	.	ENSG00000100065	ENST00000403299;ENST00000406271;ENST00000251973	T;T;T	0.42513	0.97;2.67;0.97	4.81	3.78	0.43462	.	0.969423	0.08523	N	0.933140	T	0.28366	0.0701	N	0.08118	0	0.09310	N	1	B;P	0.39181	0.412;0.663	B;B	0.40101	0.125;0.319	T	0.19128	-1.0315	10	0.34782	T	0.22	-6.4448	12.1956	0.54294	0.0:0.1722:0.8278:0.0	.	886;600	Q9BWT7;Q8NC81	CAR10_HUMAN;.	M	886;600;886	ENSP00000384570:L886M;ENSP00000385799:L600M;ENSP00000251973:L886M	ENSP00000251973:L886M	L	-	1	2	CARD10	36218483	0.398000	0.25279	0.216000	0.23742	0.026000	0.11368	2.480000	0.45206	1.245000	0.43885	-0.176000	0.13171	CTG	.		0.677	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
GPC3	2719	bcgsc.ca	37	X	133119350	133119350	+	Missense_Mutation	SNP	G	G	T			TCGA-W5-AA31-01A-11D-A417-09	TCGA-W5-AA31-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d14106d7-8efd-42d5-b203-5e2ede2aa7d8	619671b3-2530-4b47-bd7a-eaaa2c6e9e23	g.chrX:133119350G>T	ENST00000370818.3	-	1	572	c.127C>A	c.(127-129)Cag>Aag	p.Q43K	GPC3_ENST00000394299.2_Missense_Mutation_p.Q43K|GPC3_ENST00000543339.1_Missense_Mutation_p.Q43K	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	43					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					TGCAGTCTCTGGAAGAAGGAG	0.692			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																												p.Q43K			yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	.	GPC3	88	0			c.C127A						.						31.0	28.0	29.0					X																	133119350		2201	4299	6500	SO:0001583	missense	2719	exon1	Familial Cancer Database	SGBS	GTCTCTGGAAGAA	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.127C>A	X.37:g.133119350G>T	ENSP00000359854:p.Gln43Lys	60	0		57	4	NM_001164617	C9JLE3|G3V1R0|Q2L880|Q2L882	Missense_Mutation	SNP	ENST00000370818.3	37	CCDS14638.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.685246	0.68157	.	.	ENSG00000147257	ENST00000370818;ENST00000394299;ENST00000543339	T;T;T	0.62105	0.76;0.76;0.05	4.47	4.47	0.54385	.	0.319390	0.26248	N	0.025467	T	0.70979	0.3286	L	0.58810	1.83	0.31193	N	0.700671	P;P;P;B	0.47191	0.891;0.811;0.87;0.368	P;P;P;B	0.57846	0.771;0.828;0.657;0.292	T	0.74853	-0.3523	10	0.66056	D	0.02	.	11.7642	0.51920	0.0:0.0:1.0:0.0	.	43;43;43;43	B4DTD8;G3V1R0;C9JLE3;P51654	.;.;.;GPC3_HUMAN	K	43	ENSP00000359854:Q43K;ENSP00000377836:Q43K;ENSP00000444222:Q43K	ENSP00000359854:Q43K	Q	-	1	0	GPC3	132947016	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.768000	0.62293	1.811000	0.52892	0.529000	0.55759	CAG	.		0.692	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484	
