#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EPHA2	1969	hgsc.bcm.edu	37	1	16475262	16475263	+	Frame_Shift_Ins	INS	-	-	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:16475262_16475263insT	ENST00000358432.5	-	3	587_588	c.433_434insA	c.(433-435)attfs	p.I145fs	EPHA2_ENST00000461614.1_5'UTR	NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	145	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Mediates interaction with CLDN4.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	ATCGGGCGCAATGGTGTCAATC	0.604																																					p.I145fs		.											.	.	.	0			c.434_435insA						.																																			SO:0001589	frameshift_variant	1969	exon3			GGCGCAATGGTGT	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.434dupA	1.37:g.16475263_16475263dupT	ENSP00000351209:p.Ile145fs	16	0		19	12	NM_004431	B5A968|Q8N3Z2	Frame_Shift_Ins	INS	ENST00000358432.5	37	CCDS169.1																																																																																			.		0.604	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
ARID1A	8289	hgsc.bcm.edu	37	1	27101427	27101428	+	Frame_Shift_Ins	INS	-	-	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:27101427_27101428insT	ENST00000324856.7	+	18	5080_5081	c.4709_4710insT	c.(4708-4713)tctaacfs	p.N1571fs	ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000457599.2_Intron|ARID1A_ENST00000374152.2_Frame_Shift_Ins_p.N1188fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1571					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.N1571fs*40(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCCCCTCCATCTAACTACCAGC	0.629			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.S1570fs		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.,1	.	842	1	Deletion - Frameshift(1)	ovary(1)	c.4709_4710insT						.																																			SO:0001589	frameshift_variant	8289	exon18			CTCCATCTAACTA	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4710dupT	1.37:g.27101428_27101428dupT	ENSP00000320485:p.Asn1571fs	73	0		24	13	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Ins	INS	ENST00000324856.7	37	CCDS285.1																																																																																			.		0.629	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
PCDHB6	56130	hgsc.bcm.edu	37	5	140530549	140530549	+	Silent	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr5:140530549C>T	ENST00000231136.1	+	1	711	c.711C>T	c.(709-711)aaC>aaT	p.N237N	PCDHB6_ENST00000543635.1_Silent_p.N101N	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	237	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N237K(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAATGACAACGTCCCCGAGT	0.562																																					p.N237N		.											PCDHB6,NS,carcinoma,0,1	PCDHB6	0	1	Substitution - Missense(1)	lung(1)	c.C711T						.						46.0	49.0	48.0					5																	140530549		2203	4300	6503	SO:0001819	synonymous_variant	56130	exon1			TGACAACGTCCCC	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.711C>T	5.37:g.140530549C>T		37	0		32	3	NM_018939	B2R8R9	Silent	SNP	ENST00000231136.1	37	CCDS4248.1																																																																																			.		0.562	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
KCNIP2	30819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	103587678	103587678	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr10:103587678C>T	ENST00000356640.2	-	8	945	c.670G>A	c.(670-672)Gcc>Acc	p.A224T	KCNIP2_ENST00000343195.4_Missense_Mutation_p.A174T|KCNIP2_ENST00000353068.3_Missense_Mutation_p.A181T|KCNIP2_ENST00000348850.5_Missense_Mutation_p.A179T|KCNIP2_ENST00000370046.1_Missense_Mutation_p.A138T|KCNIP2_ENST00000355657.2_5'UTR|KCNIP2-AS1_ENST00000412353.1_RNA|KCNIP2_ENST00000461105.1_Missense_Mutation_p.A239T|KCNIP2_ENST00000358038.3_Missense_Mutation_p.A206T	NM_014591.4|NM_173191.2	NP_055406.2|NP_775283.1	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2	224	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.			A -> P (in Ref. 2; BAA96740/BAA96741). {ECO:0000305}.	clustering of voltage-gated potassium channels (GO:0045163)|detection of calcium ion (GO:0005513)|membrane repolarization (GO:0086009)|muscle contraction (GO:0006936)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|calcium ion binding (GO:0005509)|ER retention sequence binding (GO:0046923)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein N-terminus binding (GO:0047485)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)		TCCCTTGGGGCCTCCTCCCGG	0.552																																					p.A239T		.											.	.	.	0			c.G715A						.						112.0	100.0	104.0					10																	103587678		2203	4300	6503	SO:0001583	missense	30819	exon8			TTGGGGCCTCCTC		CCDS7521.1, CCDS7522.1, CCDS7523.1, CCDS7524.1, CCDS7525.1, CCDS7526.1, CCDS41562.1	10q24.32	2013-09-20	2001-11-29		ENSG00000120049	ENSG00000120049		"""EF-hand domain containing"""	15522	protein-coding gene	gene with protein product		604661	"""Kv channel-interacting protein 2"""			10676964	Standard	NM_173192		Approved	KCHIP2	uc001kuc.3	Q9NS61	OTTHUMG00000018937	ENST00000356640.2:c.670G>A	10.37:g.103587678C>T	ENSP00000349055:p.Ala224Thr	42	0		16	4	NM_014591	A6NJE5|A8MQ75|Q3YAC6|Q3YAC8|Q3YAC9|Q7Z6F1|Q96K86|Q96T41|Q96T42|Q96T43|Q96T44|Q9H0N4|Q9HD10|Q9HD11|Q9NS60|Q9NY10|Q9NZI1	Missense_Mutation	SNP	ENST00000356640.2	37	CCDS7522.1	.	.	.	.	.	.	.	.	.	.	C	14.10	2.435288	0.43224	.	.	ENSG00000120049	ENST00000348850;ENST00000358038;ENST00000359877;ENST00000370059;ENST00000356640;ENST00000370046;ENST00000434163;ENST00000353068;ENST00000461105;ENST00000343195;ENST00000239117	T;T;T;T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55	4.95	4.95	0.65309	EF-hand-like domain (1);	0.108029	0.64402	D	0.000011	T	0.56187	0.1968	N	0.16833	0.445	0.80722	D	1	B;B;B;B;B;B;B;B;B;B;B;B;B	0.24768	0.035;0.005;0.02;0.012;0.015;0.012;0.111;0.024;0.066;0.018;0.041;0.014;0.035	B;B;B;B;B;B;B;B;B;B;B;B;B	0.32465	0.02;0.052;0.092;0.05;0.084;0.05;0.045;0.025;0.146;0.062;0.042;0.02;0.045	T	0.52749	-0.8534	10	0.02654	T	1	.	18.3765	0.90437	0.0:1.0:0.0:0.0	.	138;179;168;170;174;174;206;181;239;224;155;179;131	Q9NS61-9;B4DW99;B4DHY9;Q9NS61-5;Q3YAC7;Q9NS61-3;Q9NS61-2;Q9NS61-7;Q9NS61-6;Q9NS61;B3KSZ5;Q3YAC6;Q9NS61-8	.;.;.;.;.;.;.;.;.;KCIP2_HUMAN;.;.;.	T	179;206;155;206;224;138;131;181;239;174;138	ENSP00000239118:A179T;ENSP00000350733:A206T;ENSP00000349055:A224T;ENSP00000359063:A138T;ENSP00000411679:A131T;ENSP00000341624:A181T;ENSP00000420040:A239T;ENSP00000344169:A174T;ENSP00000239117:A138T	ENSP00000239117:A138T	A	-	1	0	KCNIP2	103577668	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.912000	0.69948	2.571000	0.86741	0.561000	0.74099	GCC	.		0.552	KCNIP2-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049973.1		
CPD	1362	hgsc.bcm.edu	37	17	28750570	28750570	+	Silent	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr17:28750570G>T	ENST00000225719.4	+	6	1780	c.1704G>T	c.(1702-1704)gtG>gtT	p.V568V	CPD_ENST00000543464.2_Silent_p.V321V	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	568	Carboxypeptidase-like 2.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)	p.V568V(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						GAAATGAAGTGGTTGGAAGAG	0.358																																					p.V568V		.											CPD,NS,carcinoma,0,1	CPD	0	1	Substitution - coding silent(1)	kidney(1)	c.G1704T						.						136.0	130.0	132.0					17																	28750570		2203	4300	6503	SO:0001819	synonymous_variant	1362	exon6			TGAAGTGGTTGGA	U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.1704G>T	17.37:g.28750570G>T		97	0		65	3	NM_001304	B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Silent	SNP	ENST00000225719.4	37	CCDS11257.1																																																																																			.		0.358	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3	NM_001304	
WDR12	55759	hgsc.bcm.edu	37	2	203748929	203748929	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:203748929C>T	ENST00000261015.4	-	10	1729	c.980G>A	c.(979-981)cGa>cAa	p.R327Q		NM_018256.3	NP_060726.3			WD repeat domain 12											endometrium(3)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)	13						ACCTTTAGTTCGGGGATCCCA	0.388																																					p.R327Q		.											WDR12,colon,carcinoma,0,1	WDR12	0	0			c.G980A						.						82.0	76.0	78.0					2																	203748929		2203	4300	6503	SO:0001583	missense	55759	exon10			TTAGTTCGGGGAT	AF242546	CCDS2356.1	2q33.1	2013-01-09			ENSG00000138442	ENSG00000138442		"""WD repeat domain containing"""	14098	protein-coding gene	gene with protein product						16043514, 17353269	Standard	NM_018256		Approved	YTM1, FLJ10881	uc002uzl.3	Q9GZL7	OTTHUMG00000132855	ENST00000261015.4:c.980G>A	2.37:g.203748929C>T	ENSP00000261015:p.Arg327Gln	54	0		33	2	NM_018256		Missense_Mutation	SNP	ENST00000261015.4	37	CCDS2356.1	.	.	.	.	.	.	.	.	.	.	C	36	5.727695	0.96847	.	.	ENSG00000138442	ENST00000261015	T	0.20332	2.08	5.75	5.75	0.90469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.44180	0.1281	L	0.52759	1.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.08554	-1.0716	10	0.48119	T	0.1	-4.9717	20.0071	0.97436	0.0:1.0:0.0:0.0	.	327;327	Q53T99;Q9GZL7	.;WDR12_HUMAN	Q	327	ENSP00000261015:R327Q	ENSP00000261015:R327Q	R	-	2	0	WDR12	203457174	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.747000	0.85070	2.721000	0.93114	0.549000	0.68633	CGA	.		0.388	WDR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256329.4	NM_018256	
ATP5G2	517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	54063070	54063070	+	Missense_Mutation	SNP	C	C	T	rs13819		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr12:54063070C>T	ENST00000549164.1	-	4	360	c.173G>A	c.(172-174)aGc>aAc	p.S58N	ATP5G2_ENST00000550241.1_5'Flank|ATP5G2_ENST00000602871.1_Missense_Mutation_p.S58N|ATP5G2_ENST00000394349.3_Missense_Mutation_p.S115N|ATP5G2_ENST00000338662.5_Missense_Mutation_p.S74N			Q06055	AT5G2_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)	58			S -> I (in dbSNP:rs13819).		ATP hydrolysis coupled proton transport (GO:0015991)|ATP synthesis coupled proton transport (GO:0015986)|response to ethanol (GO:0045471)	integral component of membrane (GO:0016021)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|lipid binding (GO:0008289)|transporter activity (GO:0005215)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	6						GGTTTGGAAGCTGCGGCTAGA	0.532																																					p.S115N		.											.	.	.	0			c.G344A						.						55.0	52.0	53.0					12																	54063070		2203	4300	6503	SO:0001583	missense	517	exon4			TGGAAGCTGCGGC	X69908	CCDS8863.2, CCDS31812.1	12q13.13	2012-10-12	2010-06-11		ENSG00000135390	ENSG00000135390		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	842	protein-coding gene	gene with protein product		603193	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9)"""			8328972	Standard	NM_005176		Approved		uc001sec.3	Q06055	OTTHUMG00000133442	ENST00000549164.1:c.173G>A	12.37:g.54063070C>T	ENSP00000447317:p.Ser58Asn	58	0		42	10	NM_005176	B3KQQ6	Missense_Mutation	SNP	ENST00000549164.1	37		.	.	.	.	.	.	.	.	.	.	C	14.06	2.421314	0.42918	.	.	ENSG00000135390	ENST00000394349;ENST00000549164;ENST00000338662	T;T;T	0.24350	1.86;1.91;1.9	5.26	4.37	0.52481	.	0.389447	0.31233	N	0.008001	T	0.31167	0.0788	L	0.51914	1.62	0.23636	N	0.997233	P;P;D	0.56287	0.568;0.73;0.975	B;B;P	0.53185	0.193;0.359;0.72	T	0.09818	-1.0657	10	0.37606	T	0.19	-1.1773	7.3662	0.26774	0.0:0.7553:0.0:0.2447	.	58;74;115	Q06055;Q06055-3;Q06055-2	AT5G2_HUMAN;.;.	N	115;58;74	ENSP00000377878:S115N;ENSP00000447317:S58N;ENSP00000340315:S74N	ENSP00000340315:S74N	S	-	2	0	ATP5G2	52349337	0.018000	0.18449	0.999000	0.59377	0.920000	0.55202	0.884000	0.28214	1.610000	0.50200	-0.126000	0.14955	AGC	.		0.532	ATP5G2-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000407403.1	NM_005176	
PTPRE	5791	hgsc.bcm.edu	37	10	129861358	129861358	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr10:129861358G>T	ENST00000254667.3	+	10	916	c.637G>T	c.(637-639)Gaa>Taa	p.E213*	PTPRE_ENST00000419012.2_Nonsense_Mutation_p.E213*|PTPRE_ENST00000306042.5_Nonsense_Mutation_p.E155*|PTPRE_ENST00000430713.2_3'UTR	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	213	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E213K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	TCCCAAACAGGAAACGGTTAA	0.522																																					p.E213X	Colon(52;977 1184 20575 41685)	.											PTPRE,rectum,carcinoma,0,1	PTPRE	0	1	Substitution - Missense(1)	large_intestine(1)	c.G637T						.						96.0	87.0	90.0					10																	129861358		2203	4300	6503	SO:0001587	stop_gained	5791	exon10			AAACAGGAAACGG	AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.637G>T	10.37:g.129861358G>T	ENSP00000254667:p.Glu213*	55	0		41	2	NM_006504	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Nonsense_Mutation	SNP	ENST00000254667.3	37	CCDS7657.1	.	.	.	.	.	.	.	.	.	.	G	39	7.745269	0.98465	.	.	ENSG00000132334	ENST00000254667;ENST00000439034;ENST00000419012;ENST00000306042	.	.	.	4.38	4.38	0.52667	.	0.062472	0.64402	U	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.4948	0.84237	0.0:0.0:1.0:0.0	.	.	.	.	X	213;191;213;155	.	ENSP00000254667:E213X	E	+	1	0	PTPRE	129751348	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.378000	0.97191	2.433000	0.82419	0.563000	0.77884	GAA	.		0.522	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1		
PDDC1	347862	hgsc.bcm.edu	37	11	775135	775135	+	Silent	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr11:775135C>A	ENST00000319863.8	-	2	93	c.72G>T	c.(70-72)tcG>tcT	p.S24S	PDDC1_ENST00000524550.1_Silent_p.S24S|PDDC1_ENST00000526325.1_Silent_p.S24S|PDDC1_ENST00000529966.1_Intron|PDDC1_ENST00000397472.2_Silent_p.S24S|AP006621.5_ENST00000530083.1_5'Flank|PDDC1_ENST00000442059.2_Intron	NM_182612.2	NP_872418.1	Q8NB37	PDDC1_HUMAN	Parkinson disease 7 domain containing 1	24						extracellular vesicular exosome (GO:0070062)				kidney(1)|lung(3)|urinary_tract(1)	5		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;3.66e-26)|Epithelial(43;2.43e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-19)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGACTGGGCCGACACACCTG	0.652																																					p.S24S		.											PDDC1,NS,carcinoma,0,1	PDDC1	0	0			c.G72T						.						76.0	66.0	70.0					11																	775135		2197	4292	6489	SO:0001819	synonymous_variant	347862	exon2			CTGGGCCGACACA	AK128653	CCDS7713.1	11p15.5	2005-10-26			ENSG00000177225	ENSG00000177225			26616	protein-coding gene	gene with protein product							Standard	XM_005252898		Approved	FLJ34283	uc001lrc.3	Q8NB37	OTTHUMG00000133315	ENST00000319863.8:c.72G>T	11.37:g.775135C>A		115	0		47	2	NM_182612	B7ZKW5|Q2NL76|Q6ZQY0|Q8NAE0	Silent	SNP	ENST00000319863.8	37	CCDS7713.1																																																																																			.		0.652	PDDC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258051.2	NM_182612	
FN1	2335	hgsc.bcm.edu	37	2	216243985	216243985	+	Silent	SNP	G	G	A	rs376598003		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:216243985G>A	ENST00000359671.1	-	33	5482	c.5217C>T	c.(5215-5217)agC>agT	p.S1739S	FN1_ENST00000490833.1_5'UTR|FN1_ENST00000323926.6_Silent_p.S1830S|FN1_ENST00000421182.1_Silent_p.S1649S|FN1_ENST00000356005.4_Silent_p.S1649S|FN1_ENST00000432072.2_Silent_p.S1740S|FN1_ENST00000354785.4_Silent_p.S1830S|FN1_ENST00000357867.4_Silent_p.S1649S|FN1_ENST00000336916.4_Silent_p.S1739S|FN1_ENST00000346544.3_Silent_p.S1739S|FN1_ENST00000357009.2_Silent_p.S1739S|FN1_ENST00000345488.5_Silent_p.S1739S|FN1_ENST00000443816.1_Silent_p.S1649S|FN1_ENST00000446046.1_Silent_p.S1739S			P02751	FINC_HUMAN	fibronectin 1	1739	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Heparin-binding 2.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.S1739S(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TCCACTGGGCGCTCAGGCTTG	0.512																																					p.S1830S		.											FN1,colon,carcinoma,0,1	FN1	0	1	Substitution - coding silent(1)	large_intestine(1)	c.C5490T						.	G	,,,,	1,4405	2.1+/-5.4	0,1,2202	113.0	108.0	110.0		5217,4947,4947,5217,5490	-9.3	0.2	2		110	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	FN1	NM_002026.2,NM_212474.1,NM_212476.1,NM_212478.1,NM_212482.1	,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,	1739/2356,1649/2177,1649/2297,1739/2331,1830/2478	216243985	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2335	exon34			CTGGGCGCTCAGG		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.5217C>T	2.37:g.216243985G>A		46	0		41	2	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	ENST00000359671.1	37																																																																																				.		0.512	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
CHD1L	9557	hgsc.bcm.edu	37	1	146751820	146751820	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:146751820C>T	ENST00000369258.4	+	15	1681	c.1661C>T	c.(1660-1662)gCc>gTc	p.A554V	CHD1L_ENST00000369259.3_Missense_Mutation_p.A350V|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000361293.5_Missense_Mutation_p.A273V|CHD1L_ENST00000431239.1_Missense_Mutation_p.A460V	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	554					ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					GTCTCTGATGCCTTGCCTGCA	0.522																																					p.A554V		.											CHD1L,caecum,carcinoma,0,1	CHD1L	0	0			c.C1661T						.						87.0	80.0	83.0					1																	146751820		2203	4300	6503	SO:0001583	missense	9557	exon15			CTGATGCCTTGCC	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.1661C>T	1.37:g.146751820C>T	ENSP00000358262:p.Ala554Val	68	0		45	2	NM_004284	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	ENST00000369258.4	37	CCDS927.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.549009	0.27652	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	D;T;D;D	0.89617	-2.54;-1.39;-2.43;-1.51	6.07	1.93	0.25924	.	0.495969	0.24861	N	0.035018	T	0.71660	0.3366	L	0.56769	1.78	0.09310	N	1	B;B;B	0.21452	0.056;0.002;0.0	B;B;B	0.25506	0.061;0.006;0.002	T	0.60845	-0.7182	10	0.27785	T	0.31	.	4.4249	0.11498	0.1557:0.599:0.0:0.2453	.	460;350;554	Q86WJ1-2;Q86WJ1-3;Q86WJ1	.;.;CHD1L_HUMAN	V	460;350;554;273	ENSP00000389031:A460V;ENSP00000358263:A350V;ENSP00000358262:A554V;ENSP00000355100:A273V	ENSP00000355100:A273V	A	+	2	0	CHD1L	145218444	0.000000	0.05858	0.001000	0.08648	0.921000	0.55340	-0.619000	0.05572	0.444000	0.26612	0.655000	0.94253	GCC	.		0.522	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	
SLC6A6	6533	hgsc.bcm.edu	37	3	14513785	14513785	+	Missense_Mutation	SNP	T	T	C			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr3:14513785T>C	ENST00000454876.2	+	10	1498	c.1169T>C	c.(1168-1170)cTt>cCt	p.L390P	SLC6A6_ENST00000360861.3_Missense_Mutation_p.L390P			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	390					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						TGGTCCATTCTTTTTTTTATT	0.532																																					p.L390P		.											.,1	.	58	0			c.T1169C						.						127.0	114.0	118.0					3																	14513785		2203	4300	6503	SO:0001583	missense	6533	exon10			CCATTCTTTTTTT		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.1169T>C	3.37:g.14513785T>C	ENSP00000398063:p.Leu390Pro	82	1		32	2	NM_003043	B2RNU7|Q9BRI2|Q9BXB0	Missense_Mutation	SNP	ENST00000454876.2	37	CCDS33705.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.608445	0.87258	.	.	ENSG00000131389	ENST00000454876;ENST00000360861	D;D	0.81739	-1.53;-1.53	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.93746	0.8001	H	0.98466	4.24	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.96116	0.9081	10	0.87932	D	0	.	15.3456	0.74334	0.0:0.0:0.0:1.0	.	390	P31641	SC6A6_HUMAN	P	390	ENSP00000398063:L390P;ENSP00000354107:L390P	ENSP00000354107:L390P	L	+	2	0	SLC6A6	14488789	1.000000	0.71417	0.977000	0.42913	0.998000	0.95712	8.040000	0.89188	2.021000	0.59480	0.482000	0.46254	CTT	.		0.532	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340507.1	NM_003043	
DHTKD1	55526	hgsc.bcm.edu;broad.mit.edu	37	10	12126673	12126673	+	Missense_Mutation	SNP	C	C	T	rs141125831		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr10:12126673C>T	ENST00000263035.4	+	3	507	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W	DHTKD1_ENST00000465617.1_Intron	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	149					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.R149W(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GTTTGCCAAGCGGTTTGAGGA	0.448																																					p.R149W		.											DHTKD1,colon,carcinoma,0,1	DHTKD1	0	1	Substitution - Missense(1)	large_intestine(1)	c.C445T						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	160.0	163.0	162.0		445	-5.9	0.2	10	dbSNP_134	162	0,8600		0,0,4300	no	missense	DHTKD1	NM_018706.5	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	149/920	12126673	1,13005	2203	4300	6503	SO:0001583	missense	55526	exon3			GCCAAGCGGTTTG	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.445C>T	10.37:g.12126673C>T	ENSP00000263035:p.Arg149Trp	78	0		55	3	NM_018706	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	CCDS7087.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655357	0.67586	2.27E-4	0.0	ENSG00000181192	ENST00000263035;ENST00000437298	T;T	0.15603	2.41;2.41	5.39	-5.95	0.02241	.	0.091412	0.64402	D	0.000001	T	0.38639	0.1048	M	0.77712	2.385	0.42829	D	0.99401	D	0.89917	1.0	D	0.68765	0.96	T	0.58509	-0.7624	10	0.87932	D	0	-13.7078	20.7673	0.99721	0.784:0.216:0.0:0.0	.	149	Q96HY7	DHTK1_HUMAN	W	149	ENSP00000263035:R149W;ENSP00000388163:R149W	ENSP00000263035:R149W	R	+	1	2	DHTKD1	12166679	0.879000	0.30193	0.221000	0.23827	0.987000	0.75469	0.484000	0.22308	-0.625000	0.05604	-0.249000	0.11873	CGG	.		0.448	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
PJA1	64219	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	68382847	68382847	+	Missense_Mutation	SNP	A	A	G			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chrX:68382847A>G	ENST00000361478.1	-	2	612	c.235T>C	c.(235-237)Tgg>Cgg	p.W79R	PJA1_ENST00000477231.1_5'UTR|PJA1_ENST00000374571.4_Missense_Mutation_p.W24R|PJA1_ENST00000374583.1_Missense_Mutation_p.W79R|PJA1_ENST00000374584.3_Missense_Mutation_p.W79R	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	79					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						CTGTCGTCCCAACTACGACGA	0.522																																					p.W79R		.											.	.	.	0			c.T235C						.						152.0	130.0	138.0					X																	68382847		2203	4300	6503	SO:0001583	missense	64219	exon2			CGTCCCAACTACG	AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.235T>C	X.37:g.68382847A>G	ENSP00000355014:p.Trp79Arg	35	0		20	14	NM_145119	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	ENST00000361478.1	37	CCDS14393.1	.	.	.	.	.	.	.	.	.	.	A	8.357	0.832183	0.16820	.	.	ENSG00000181191	ENST00000396010;ENST00000374584;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T;T	0.11277	3.54;3.48;3.48;2.79	3.39	3.39	0.38822	.	0.798137	0.10222	U	0.700748	T	0.22589	0.0545	L	0.44542	1.39	0.20307	N	0.999917	D;D	0.76494	0.999;0.994	D;D	0.83275	0.996;0.984	T	0.11299	-1.0593	10	0.41790	T	0.15	-5.4485	7.5826	0.27974	1.0:0.0:0.0:0.0	.	79;79	Q8NG27;Q8NG27-2	PJA1_HUMAN;.	R	24;79;79;79;24	ENSP00000363712:W79R;ENSP00000363711:W79R;ENSP00000355014:W79R;ENSP00000363699:W24R	ENSP00000355014:W79R	W	-	1	0	PJA1	68299572	0.924000	0.31332	0.490000	0.27465	0.046000	0.14306	1.588000	0.36633	1.603000	0.50134	0.433000	0.28618	TGG	.		0.522	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119	
HERC3	8916	hgsc.bcm.edu	37	4	89591061	89591061	+	Missense_Mutation	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr4:89591061C>A	ENST00000402738.1	+	15	1923	c.1684C>A	c.(1684-1686)Ctc>Atc	p.L562I	HERC3_ENST00000264345.3_Missense_Mutation_p.L562I|HERC3_ENST00000543130.1_Missense_Mutation_p.L6I	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	562					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.L562I(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GCTGGTAAACCTCTATAAAGG	0.373																																					p.L562I		.											HERC3,colon,carcinoma,0,1	HERC3	0	1	Substitution - Missense(1)	large_intestine(1)	c.C1684A						.						104.0	107.0	106.0					4																	89591061		2203	4300	6503	SO:0001583	missense	8916	exon15			GTAAACCTCTATA	D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.1684C>A	4.37:g.89591061C>A	ENSP00000385684:p.Leu562Ile	107	0		58	3	NM_014606	A8K1S5|Q8IXX3	Missense_Mutation	SNP	ENST00000402738.1	37	CCDS34028.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.956643	0.34565	.	.	ENSG00000138641	ENST00000402738;ENST00000264345;ENST00000543130	T;T;T	0.39787	1.06;1.06;1.21	5.08	5.08	0.68730	.	0.124528	0.56097	D	0.000025	T	0.26085	0.0636	N	0.11313	0.125	0.47949	D	0.999556	P	0.35456	0.502	B	0.30572	0.117	T	0.07271	-1.0781	10	0.30078	T	0.28	.	19.0331	0.92965	0.0:1.0:0.0:0.0	.	562	Q15034	HERC3_HUMAN	I	562;562;6	ENSP00000385684:L562I;ENSP00000264345:L562I;ENSP00000441703:L6I	ENSP00000264345:L562I	L	+	1	0	HERC3	89810084	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.643000	0.61390	2.802000	0.96397	0.655000	0.94253	CTC	.		0.373	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2	NM_014606	
CUBN	8029	hgsc.bcm.edu;bcgsc.ca	37	10	17113484	17113484	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr10:17113484G>T	ENST00000377833.4	-	19	2631	c.2566C>A	c.(2566-2568)Ctc>Atc	p.L856I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	856	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTGAAGTTGAGGAGAATGACT	0.428																																					p.L856I		.											CUBN,caecum,carcinoma,0,1	CUBN	0	0			c.C2566A						.						87.0	86.0	87.0					10																	17113484		2203	4300	6503	SO:0001583	missense	8029	exon19			AGTTGAGGAGAAT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2566C>A	10.37:g.17113484G>T	ENSP00000367064:p.Leu856Ile	102	1		82	4	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.416822	0.62511	.	.	ENSG00000107611	ENST00000377833	T	0.30182	1.54	5.23	5.23	0.72850	CUB (5);	0.000000	0.36409	N	0.002614	T	0.52224	0.1721	L	0.56340	1.77	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	T	0.48614	-0.9020	10	0.46703	T	0.11	.	18.8527	0.92238	0.0:0.0:1.0:0.0	.	856	O60494	CUBN_HUMAN	I	856	ENSP00000367064:L856I	ENSP00000367064:L856I	L	-	1	0	CUBN	17153490	1.000000	0.71417	0.997000	0.53966	0.316000	0.28119	5.396000	0.66297	2.460000	0.83146	0.502000	0.49764	CTC	.		0.428	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
KCNJ4	3761	hgsc.bcm.edu	37	22	38824085	38824085	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr22:38824085C>T	ENST00000303592.3	-	2	311	c.53G>A	c.(52-54)cGc>cAc	p.R18H	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	18					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)	p.R18H(1)		endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					GAAGCGGTTGCGGCGCTTCCG	0.647																																					p.R18H		.											KCNJ4,NS,carcinoma,0,1	KCNJ4	0	1	Substitution - Missense(1)	endometrium(1)	c.G53A						.						254.0	217.0	230.0					22																	38824085		2203	4300	6503	SO:0001583	missense	3761	exon2			CGGTTGCGGCGCT	U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.53G>A	22.37:g.38824085C>T	ENSP00000306497:p.Arg18His	40	0		32	2	NM_004981	Q14D44	Missense_Mutation	SNP	ENST00000303592.3	37	CCDS13971.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504094	0.85176	.	.	ENSG00000168135	ENST00000303592	D	0.90732	-2.72	4.4	4.4	0.53042	.	0.000000	0.85682	D	0.000000	D	0.94321	0.8175	M	0.76002	2.32	0.58432	D	0.999998	D	0.76494	0.999	P	0.61722	0.893	D	0.95064	0.8198	10	0.66056	D	0.02	.	17.4411	0.87565	0.0:1.0:0.0:0.0	.	18	P48050	IRK4_HUMAN	H	18	ENSP00000306497:R18H	ENSP00000306497:R18H	R	-	2	0	KCNJ4	37154031	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.057000	0.71119	2.182000	0.69389	0.555000	0.69702	CGC	.		0.647	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981	
ITGB6	3694	hgsc.bcm.edu	37	2	161030579	161030579	+	Missense_Mutation	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:161030579C>A	ENST00000283249.2	-	5	902	c.665G>T	c.(664-666)aGa>aTa	p.R222I	ITGB6_ENST00000428609.2_Missense_Mutation_p.R180I|ITGB6_ENST00000485635.1_5'UTR|ITGB6_ENST00000409872.1_Missense_Mutation_p.R222I|ITGB6_ENST00000409967.2_Missense_Mutation_p.R222I	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	222	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)	p.R222I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						TTCATTGAATCTTTCAGCATC	0.353																																					p.R222I		.											ITGB6,NS,carcinoma,0,2	ITGB6	0	1	Substitution - Missense(1)	large_intestine(1)	c.G665T						.						87.0	83.0	84.0					2																	161030579		2203	4300	6503	SO:0001583	missense	3694	exon5			TTGAATCTTTCAG		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.665G>T	2.37:g.161030579C>A	ENSP00000283249:p.Arg222Ile	48	0		36	2	NM_000888	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	ENST00000283249.2	37	CCDS2212.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.525854	0.44969	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11	5.3	2.47	0.30058	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.193347	0.53938	D	0.000044	D	0.89294	0.6674	M	0.69823	2.125	0.58432	D	0.999999	B;B	0.33777	0.425;0.425	B;B	0.31016	0.123;0.123	D	0.86683	0.1918	10	0.54805	T	0.06	.	9.9365	0.41554	0.0:0.6511:0.0:0.3489	.	180;222	E9PEE8;P18564	.;ITB6_HUMAN	I	222;180;222;222	ENSP00000283249:R222I;ENSP00000408024:R180I;ENSP00000386828:R222I;ENSP00000386367:R222I	ENSP00000283249:R222I	R	-	2	0	ITGB6	160738825	0.700000	0.27796	1.000000	0.80357	0.960000	0.62799	-0.031000	0.12287	0.729000	0.32403	0.491000	0.48974	AGA	.		0.353	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888	
GPRIN3	285513	hgsc.bcm.edu	37	4	90169820	90169820	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr4:90169820G>T	ENST00000609438.1	-	2	1960	c.1442C>A	c.(1441-1443)aCa>aAa	p.T481K	GPRIN3_ENST00000333209.4_Missense_Mutation_p.T481K	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	481										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TCCATAACTTGTTTCAGCTTG	0.443																																					p.T481K		.											GPRIN3,right_lower_lobe,carcinoma,0,1	GPRIN3	0	0			c.C1442A						.						100.0	105.0	103.0					4																	90169820		2203	4300	6503	SO:0001583	missense	285513	exon2			TAACTTGTTTCAG	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.1442C>A	4.37:g.90169820G>T	ENSP00000476603:p.Thr481Lys	29	0		40	2	NM_198281	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.151717	0.38021	.	.	ENSG00000185477	ENST00000333209	T	0.10860	2.83	5.38	0.496	0.16896	.	1.525110	0.04572	N	0.393554	T	0.08044	0.0201	L	0.27053	0.805	0.09310	N	1	B	0.33583	0.418	B	0.30943	0.122	T	0.33701	-0.9858	10	0.59425	D	0.04	4.3768	4.3946	0.11356	0.4789:0.3593:0.1618:0.0	.	481	Q6ZVF9	GRIN3_HUMAN	K	481	ENSP00000328672:T481K	ENSP00000328672:T481K	T	-	2	0	GPRIN3	90388843	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.597000	0.24059	-0.052000	0.13311	-0.175000	0.13238	ACA	.		0.443	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281	
KLHL31	401265	hgsc.bcm.edu	37	6	53519100	53519100	+	Missense_Mutation	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr6:53519100C>A	ENST00000407079.1	-	1	970	c.971G>T	c.(970-972)cGc>cTc	p.R324L	KLHL31_ENST00000370905.3_Missense_Mutation_p.R324L			Q9H511	KLH31_HUMAN	kelch-like family member 31	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					AAGGCCTGGGCGTCCCCCAAC	0.478																																					p.R324L		.											KLHL31,NS,carcinoma,0,1	KLHL31	0	0			c.G971T						.						110.0	104.0	106.0					6																	53519100		2203	4300	6503	SO:0001583	missense	401265	exon2			CCTGGGCGTCCCC		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.971G>T	6.37:g.53519100C>A	ENSP00000384644:p.Arg324Leu	30	0		35	2	NM_001003760	A6N9J2|B2RP49	Missense_Mutation	SNP	ENST00000407079.1	37	CCDS34478.1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.794849	0.70452	.	.	ENSG00000124743	ENST00000370905;ENST00000407079	T;T	0.64618	-0.11;-0.11	5.49	5.49	0.81192	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.67078	0.2855	L	0.55103	1.725	0.80722	D	1	D	0.65815	0.995	P	0.61592	0.891	T	0.61312	-0.7088	10	0.27785	T	0.31	.	19.4094	0.94662	0.0:1.0:0.0:0.0	.	324	Q9H511	KLH31_HUMAN	L	324	ENSP00000359942:R324L;ENSP00000384644:R324L	ENSP00000359942:R324L	R	-	2	0	KLHL31	53627059	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	7.818000	0.86416	2.583000	0.87209	0.561000	0.74099	CGC	.		0.478	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	NM_001003760	
ZNF175	7728	hgsc.bcm.edu	37	19	52090212	52090212	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:52090212G>T	ENST00000262259.2	+	5	986	c.628G>T	c.(628-630)Gaa>Taa	p.E210*	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	210					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		GCTGAACCTAGAAGTGAACGG	0.463																																					p.E210X		.											ZNF175,colon,carcinoma,0,1	ZNF175	0	0			c.G628T						.						83.0	78.0	80.0					19																	52090212		2203	4299	6502	SO:0001587	stop_gained	7728	exon5			AACCTAGAAGTGA	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.628G>T	19.37:g.52090212G>T	ENSP00000262259:p.Glu210*	49	0		43	2	NM_007147	A8K9H2	Nonsense_Mutation	SNP	ENST00000262259.2	37	CCDS12837.1	.	.	.	.	.	.	.	.	.	.	G	31	5.084611	0.94100	.	.	ENSG00000105497	ENST00000262259	.	.	.	2.73	1.59	0.23543	.	.	.	.	.	.	.	.	.	.	.	0.51233	D	0.999916	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	4.9517	0.14017	0.202:0.0:0.798:0.0	.	.	.	.	X	210	.	ENSP00000262259:E210X	E	+	1	0	ZNF175	56782024	0.000000	0.05858	0.803000	0.32268	0.365000	0.29674	0.647000	0.24812	0.416000	0.25844	-0.345000	0.07892	GAA	.		0.463	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	NM_007147	
LRP2	4036	hgsc.bcm.edu	37	2	170062925	170062925	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:170062925G>T	ENST00000263816.3	-	39	7590	c.7305C>A	c.(7303-7305)ttC>ttA	p.F2435L		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2435					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.F2435Y(1)|p.F2435F(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AATTTTGTGTGAAGTAGATTC	0.433																																					p.F2435L		.											LRP2,NS,carcinoma,0,1	LRP2	0	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)	c.C7305A						.						84.0	87.0	86.0					2																	170062925		2203	4300	6503	SO:0001583	missense	4036	exon39			TTGTGTGAAGTAG		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7305C>A	2.37:g.170062925G>T	ENSP00000263816:p.Phe2435Leu	88	0		62	3	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.134537	0.37630	.	.	ENSG00000081479	ENST00000263816	D	0.91407	-2.84	5.87	1.57	0.23409	Six-bladed beta-propeller, TolB-like (1);	0.090529	0.85682	N	0.000000	D	0.87696	0.6242	M	0.69358	2.11	0.80722	D	1	B	0.13594	0.008	B	0.10450	0.005	T	0.82851	-0.0253	10	0.62326	D	0.03	.	9.904	0.41364	0.4346:0.0:0.5654:0.0	.	2435	P98164	LRP2_HUMAN	L	2435	ENSP00000263816:F2435L	ENSP00000263816:F2435L	F	-	3	2	LRP2	169771171	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	1.362000	0.34148	0.400000	0.25396	0.591000	0.81541	TTC	.		0.433	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
APOA4	337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	116691593	116691593	+	Missense_Mutation	SNP	A	A	C			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr11:116691593A>C	ENST00000357780.3	-	3	1295	c.1181T>G	c.(1180-1182)tTg>tGg	p.L394W		NM_000482.3	NP_000473.2	P06727	APOA4_HUMAN	apolipoprotein A-IV	394					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron assembly (GO:0034378)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle remodeling (GO:0034375)|hydrogen peroxide catabolic process (GO:0042744)|innate immune response in mucosa (GO:0002227)|leukocyte cell-cell adhesion (GO:0007159)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|multicellular organismal lipid catabolic process (GO:0044240)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|phosphatidylcholine metabolic process (GO:0046470)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|protein-lipid complex assembly (GO:0065005)|regulation of cholesterol transport (GO:0032374)|regulation of intestinal cholesterol absorption (GO:0030300)|removal of superoxide radicals (GO:0019430)|response to lipid hydroperoxide (GO:0006982)|response to stilbenoid (GO:0035634)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|cholesterol transporter activity (GO:0017127)|copper ion binding (GO:0005507)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		TCAGCTCTCCAAAGGGGCCAG	0.612																																					p.L394W		.											.	.	.	0			c.T1181G						.						50.0	48.0	49.0					11																	116691593		2201	4296	6497	SO:0001583	missense	337	exon3			CTCTCCAAAGGGG		CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244		"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690					Standard	NM_000482		Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.1181T>G	11.37:g.116691593A>C	ENSP00000350425:p.Leu394Trp	75	0		53	17	NM_000482	A8MSL6|Q14CW8|Q6Q787	Missense_Mutation	SNP	ENST00000357780.3	37	CCDS31681.1	.	.	.	.	.	.	.	.	.	.	A	13.99	2.401985	0.42613	.	.	ENSG00000110244	ENST00000357780	T	0.80033	-1.33	4.75	3.64	0.41730	.	0.468236	0.15779	N	0.245042	T	0.75421	0.3847	N	0.08118	0	0.09310	N	1	D	0.71674	0.998	D	0.69479	0.964	T	0.63625	-0.6595	10	0.87932	D	0	-6.9083	6.3168	0.21194	0.8916:0.0:0.1084:0.0	.	394	P06727	APOA4_HUMAN	W	394	ENSP00000350425:L394W	ENSP00000350425:L394W	L	-	2	0	APOA4	116196803	0.000000	0.05858	0.104000	0.21259	0.281000	0.26958	-0.267000	0.08619	2.080000	0.62538	0.455000	0.32223	TTG	.		0.612	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106279.2	NM_000482	
KCNK13	56659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	90650699	90650699	+	Silent	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr14:90650699C>T	ENST00000282146.4	+	2	1020	c.579C>T	c.(577-579)tcC>tcT	p.S193S		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	193					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				GGAAGCCCTCCGTGTACTACG	0.627																																					p.S193S		.											.	.	.	0			c.C579T						.						134.0	114.0	121.0					14																	90650699		2203	4300	6503	SO:0001819	synonymous_variant	56659	exon2			GCCCTCCGTGTAC	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.579C>T	14.37:g.90650699C>T		27	0		20	7	NM_022054	B5TJL8|Q96E79	Silent	SNP	ENST00000282146.4	37	CCDS9889.1																																																																																			.		0.627	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411251.1	NM_022054	
KCNMA1	3778	hgsc.bcm.edu	37	10	78704653	78704653	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr10:78704653G>T	ENST00000286628.8	-	23	2779	c.2780C>A	c.(2779-2781)tCa>tAa	p.S927*	KCNMA1_ENST00000372443.1_Nonsense_Mutation_p.S869*|KCNMA1_ENST00000404771.3_Nonsense_Mutation_p.S927*|KCNMA1_ENST00000372440.1_Nonsense_Mutation_p.S869*|KCNMA1_ENST00000404857.1_Nonsense_Mutation_p.S910*|KCNMA1_ENST00000354353.5_Nonsense_Mutation_p.S930*|KCNMA1_ENST00000406533.3_Nonsense_Mutation_p.S931*|RP11-443A13.5_ENST00000458661.2_RNA|RP11-443A13.5_ENST00000426234.1_RNA|KCNMA1_ENST00000286627.5_Nonsense_Mutation_p.S869*|RP11-443A13.5_ENST00000600782.1_RNA|RP11-443A13.5_ENST00000608791.1_RNA|RP11-443A13.5_ENST00000598613.1_RNA	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	927					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	CTGATTGGCTGACAGGATAAC	0.433																																					p.S927X		.											.	.	.	0			c.C2780A						.						172.0	137.0	149.0					10																	78704653		2203	4300	6503	SO:0001587	stop_gained	3778	exon23			TTGGCTGACAGGA	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2780C>A	10.37:g.78704653G>T	ENSP00000286628:p.Ser927*	55	0		57	4	NM_001161352	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Nonsense_Mutation	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.237429|8.237429	0.98719|0.98719	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708	.|.	.|.	.|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.48223|.	0.1488|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37454|.	-0.9705|.	3|.	.|0.02654	.|T	.|1	-6.4058|-6.4058	19.9196|19.9196	0.97082|0.97082	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	K|X	820|869;806;862;901;864;869;869;901;931;930;910;680	.|.	.|ENSP00000286627:S869X	Q|S	-|-	1|2	0|0	KCNMA1|KCNMA1	78374659|78374659	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.758000|9.758000	0.98927|0.98927	2.708000|2.708000	0.92522|0.92522	0.650000|0.650000	0.86243|0.86243	CAG|TCA	.		0.433	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
RHPN2	85415	hgsc.bcm.edu	37	19	33517507	33517507	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:33517507C>T	ENST00000254260.3	-	3	252	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	RHPN2_ENST00000400226.4_De_novo_Start_OutOfFrame	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	73					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.V73M(2)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TCCAGCCGCACTTGCTCCCGC	0.552																																					p.V73M		.											RHPN2,face,carcinoma,0,2	RHPN2	0	2	Substitution - Missense(2)	NS(1)|skin(1)	c.G217A						.						84.0	83.0	83.0					19																	33517507		2203	4300	6503	SO:0001583	missense	85415	exon3			GCCGCACTTGCTC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.217G>A	19.37:g.33517507C>T	ENSP00000254260:p.Val73Met	26	2		10	2	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542997	0.65198	.	.	ENSG00000131941	ENST00000254260	T	0.39787	1.06	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71984	-0.4427	10	0.87932	D	0	11.9954	16.025	0.80536	0.0:1.0:0.0:0.0	.	73	Q8IUC4	RHPN2_HUMAN	M	73	ENSP00000254260:V73M	ENSP00000254260:V73M	V	-	1	0	RHPN2	38209347	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.267000	0.78462	2.167000	0.68274	0.557000	0.71058	GTG	.		0.552	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
ZNF132	7691	hgsc.bcm.edu	37	19	58945596	58945596	+	Silent	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:58945596G>A	ENST00000254166.3	-	3	1615	c.1215C>T	c.(1213-1215)tgC>tgT	p.C405C		NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		CACATTGACTGCACTCATAAG	0.468																																					p.C405C		.											.	.	.	0			c.C1215T						.						112.0	105.0	108.0					19																	58945596		2203	4300	6503	SO:0001819	synonymous_variant	7691	exon3			TTGACTGCACTCA	U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.1215C>T	19.37:g.58945596G>A		40	0		32	4	NM_003433	Q32MI9	Silent	SNP	ENST00000254166.3	37	CCDS12980.1																																																																																			.		0.468	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1	NM_003433	
KRT8	3856	hgsc.bcm.edu	37	12	53294404	53294404	+	Nonsense_Mutation	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr12:53294404C>A	ENST00000552551.1	-	5	1090	c.658G>T	c.(658-660)Gag>Tag	p.E220*	KRT8_ENST00000552150.1_Nonsense_Mutation_p.E248*|KRT8_ENST00000293308.6_Nonsense_Mutation_p.E220*|KRT8_ENST00000546897.1_Nonsense_Mutation_p.E220*			P05787	K2C8_HUMAN	keratin 8	220	Coil 1B.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	AAGTTGATCTCGTCGGTCAGC	0.572																																					p.E248X		.											KRT8,NS,lymphoid_neoplasm,0,1	KRT8	0	0			c.G742T						.						106.0	104.0	105.0					12																	53294404		2203	4300	6503	SO:0001587	stop_gained	3856	exon5			TGATCTCGTCGGT	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.658G>T	12.37:g.53294404C>A	ENSP00000447566:p.Glu220*	31	0		16	3	NM_001256282	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Nonsense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	C	36	5.806311	0.96967	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000547176;ENST00000548998;ENST00000546900	.	.	.	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.6987	0.85343	0.0:1.0:0.0:0.0	.	.	.	.	X	220;220;220;220;248;220;50;260;103	.	ENSP00000293308:E220X	E	-	1	0	KRT8	51580671	1.000000	0.71417	0.947000	0.38551	0.434000	0.31775	6.087000	0.71362	2.453000	0.82957	0.313000	0.20887	GAG	.		0.572	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
ESYT1	23344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56524868	56524868	+	Silent	SNP	A	A	G			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr12:56524868A>G	ENST00000394048.5	+	4	876	c.612A>G	c.(610-612)aaA>aaG	p.K204K	RP11-603J24.5_ENST00000550947.1_RNA|RP11-603J24.5_ENST00000549438.1_RNA|ESYT1_ENST00000267113.4_Silent_p.K204K|ESYT1_ENST00000541590.1_Silent_p.K204K	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	204	Glycerophospholipid-binding barrel-like domain. {ECO:0000250}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						GTCAGAGAAAAGAGCAGATCC	0.507																																					p.K204K		.											.	.	.	0			c.A612G						.						174.0	160.0	165.0					12																	56524868		2203	4300	6503	SO:0001819	synonymous_variant	23344	exon4			GAGAAAAGAGCAG	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.612A>G	12.37:g.56524868A>G		55	0		33	14	NM_015292	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Silent	SNP	ENST00000394048.5	37	CCDS8904.1																																																																																			.		0.507	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
EZR	7430	hgsc.bcm.edu	37	6	159197491	159197491	+	Silent	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr6:159197491G>T	ENST00000367075.3	-	8	912	c.744C>A	c.(742-744)atC>atA	p.I248I	EZR_ENST00000392177.4_Silent_p.I216I|EZR_ENST00000337147.7_Silent_p.I248I	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	248	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		CATTGAAAGAGATGTTCCTGA	0.373			T	ROS1	NSCLC																																p.I248I		.		Dom	yes		6	6q25.3	7430	ezrin		E	EZR,NS,carcinoma,0,1	EZR	0	0			c.C744A						.						127.0	125.0	126.0					6																	159197491		2203	4300	6503	SO:0001819	synonymous_variant	7430	exon7			GAAAGAGATGTTC	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.744C>A	6.37:g.159197491G>T		44	0		22	2	NM_003379	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Silent	SNP	ENST00000367075.3	37	CCDS5258.1																																																																																			.		0.373	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379	
DLG5	9231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	79576791	79576791	+	Missense_Mutation	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr10:79576791G>A	ENST00000372391.2	-	19	3853	c.3848C>T	c.(3847-3849)cCg>cTg	p.P1283L	DLG5_ENST00000372388.2_Missense_Mutation_p.P943L|DLG5_ENST00000459739.1_5'UTR	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1283					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)	p.P1283L(1)		breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GACACTCCGCGGATATCTTGG	0.502																																					p.P1283L		.											DLG5,NS,carcinoma,0,1	DLG5	0	1	Substitution - Missense(1)	endometrium(1)	c.C3848T						.						185.0	166.0	172.0					10																	79576791		2203	4300	6503	SO:0001583	missense	9231	exon19			CTCCGCGGATATC	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.3848C>T	10.37:g.79576791G>A	ENSP00000361467:p.Pro1283Leu	66	0		43	9	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	G	18.74	3.689510	0.68271	.	.	ENSG00000151208	ENST00000372391;ENST00000424842;ENST00000372388	T;T;T	0.06142	3.53;3.34;3.6	5.4	5.4	0.78164	.	0.000000	0.38605	N	0.001621	T	0.19248	0.0462	L	0.43923	1.385	0.80722	D	1	D;D;B	0.89917	1.0;1.0;0.442	D;D;B	0.65684	0.937;0.923;0.142	T	0.00182	-1.1946	10	0.72032	D	0.01	.	19.1954	0.93686	0.0:0.0:1.0:0.0	.	1173;1283;943	Q8TDM6-4;Q8TDM6;Q8TDM6-2	.;DLG5_HUMAN;.	L	1283;244;943	ENSP00000361467:P1283L;ENSP00000394797:P244L;ENSP00000361464:P943L	ENSP00000361464:P943L	P	-	2	0	DLG5	79246797	1.000000	0.71417	0.257000	0.24404	0.031000	0.12232	9.230000	0.95299	2.535000	0.85469	0.650000	0.86243	CCG	.		0.502	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
CYSLTR1	10800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	77529104	77529104	+	Missense_Mutation	SNP	A	A	G			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chrX:77529104A>G	ENST00000373304.3	-	3	432	c.140T>C	c.(139-141)gTc>gCc	p.V47A		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	47					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	TTTTATGAGGACATAGAGCAC	0.423																																					p.V47A		.											.	.	.	0			c.T140C						.						128.0	104.0	112.0					X																	77529104		2203	4300	6503	SO:0001583	missense	10800	exon3			ATGAGGACATAGA	AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.140T>C	X.37:g.77529104A>G	ENSP00000362401:p.Val47Ala	42	0		18	14	NM_006639	B2R954|D3DTE4|Q5JS94|Q8IV19	Missense_Mutation	SNP	ENST00000373304.3	37	CCDS14439.1	.	.	.	.	.	.	.	.	.	.	a	13.23	2.175452	0.38413	.	.	ENSG00000173198	ENST00000373304	T	0.40225	1.04	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.125328	0.52532	D	0.000066	T	0.40956	0.1138	L	0.58101	1.795	0.36269	D	0.855027	B	0.17852	0.024	B	0.24394	0.053	T	0.50734	-0.8793	10	0.87932	D	0	.	10.9063	0.47081	1.0:0.0:0.0:0.0	.	47	Q9Y271	CLTR1_HUMAN	A	47	ENSP00000362401:V47A	ENSP00000362401:V47A	V	-	2	0	CYSLTR1	77415760	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	7.188000	0.77739	1.467000	0.48044	0.368000	0.22195	GTC	.		0.423	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057315.1		
ZNF165	7718	hgsc.bcm.edu	37	6	28053623	28053623	+	Missense_Mutation	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr6:28053623C>A	ENST00000377325.1	+	2	921	c.365C>A	c.(364-366)aCc>aAc	p.T122N		NM_003447.3	NP_003438.1	P49910	ZN165_HUMAN	zinc finger protein 165	122	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GAGGCAGTGACCATACTAGAA	0.517																																					p.T122N		.											ZNF165,colon,carcinoma,0,1	ZNF165	0	0			c.C365A						.						68.0	69.0	68.0					6																	28053623		2203	4300	6503	SO:0001583	missense	7718	exon2			CAGTGACCATACT	U78722	CCDS4643.1	6p21	2013-01-09			ENSG00000197279	ENSG00000197279		"""-"", ""Zinc fingers, C2H2-type"""	12953	protein-coding gene	gene with protein product	"""cancer/testis antigen 53"""	600834				7490084	Standard	NM_003447		Approved	ZSCAN7, CT53	uc021yro.1	P49910	OTTHUMG00000014505	ENST00000377325.1:c.365C>A	6.37:g.28053623C>A	ENSP00000366542:p.Thr122Asn	22	0		15	2	NM_003447		Missense_Mutation	SNP	ENST00000377325.1	37	CCDS4643.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.397747	0.42512	.	.	ENSG00000197279	ENST00000377325	T	0.06294	3.32	3.06	2.12	0.27331	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.07143	0.0181	M	0.92412	3.305	0.09310	N	1	P	0.44946	0.846	B	0.41666	0.363	T	0.08659	-1.0711	9	0.87932	D	0	.	9.5125	0.39085	0.0:0.7816:0.2184:0.0	.	122	P49910	ZN165_HUMAN	N	122	ENSP00000366542:T122N	ENSP00000366542:T122N	T	+	2	0	ZNF165	28161602	0.003000	0.15002	0.029000	0.17559	0.891000	0.51852	1.084000	0.30828	0.792000	0.33850	0.655000	0.94253	ACC	.		0.517	ZNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040173.1	NM_003447	
MDM2	4193	hgsc.bcm.edu	37	12	69229765	69229765	+	Splice_Site	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr12:69229765G>T	ENST00000350057.5	+	7	747		c.e7+1		MDM2_ENST00000478070.1_Intron|MDM2_ENST00000517852.1_Intron|MDM2_ENST00000428863.2_Splice_Site|MDM2_ENST00000356290.4_Splice_Site|MDM2_ENST00000393410.1_Intron|MDM2_ENST00000258149.5_Splice_Site|MDM2_ENST00000393412.3_Intron|MDM2_ENST00000462284.1_Splice_Site|MDM2_ENST00000540827.1_Splice_Site|MDM2_ENST00000258148.7_Splice_Site|MDM2_ENST00000544561.1_Intron|MDM2_ENST00000348801.2_Splice_Site|MDM2_ENST00000360430.2_Splice_Site|MDM2_ENST00000545204.1_Intron|MDM2_ENST00000393413.3_Intron|MDM2_ENST00000299252.4_Splice_Site			Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase						cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			AGATGATGAGGTAGTATTTTT	0.294			A		"""sarcoma, glioma, colorectal, other"""																																.		.		Dom	yes		12	12q15	4193	Mdm2 p53 binding protein homolog		"""M, O, E, L"""	.	.	.	0			c.840+1G>T						.						106.0	97.0	100.0					12																	69229765		1805	4071	5876	SO:0001630	splice_region_variant	4193	exon9			GATGAGGTAGTAT		CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000350057.5:c.747+1G>T	12.37:g.69229765G>T		112	0		90	4	NM_002392	A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Splice_Site	SNP	ENST00000350057.5	37		.	.	.	.	.	.	.	.	.	.	G	16.86	3.239000	0.58995	.	.	ENSG00000135679	ENST00000462284;ENST00000544648;ENST00000258149;ENST00000356290;ENST00000540827;ENST00000428863;ENST00000358483;ENST00000311420;ENST00000258148;ENST00000543323;ENST00000523991;ENST00000350057;ENST00000299252;ENST00000360430;ENST00000348801	.	.	.	4.59	3.68	0.42216	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6435	0.68742	0.0:0.0:0.8528:0.1472	.	.	.	.	.	-1	.	.	.	+	.	.	MDM2	67516032	1.000000	0.71417	0.999000	0.59377	0.854000	0.48673	6.002000	0.70693	1.215000	0.43411	0.460000	0.39030	.	.		0.294	MDM2-033	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000402665.1	NM_006880	Intron
AGBL4	84871	hgsc.bcm.edu	37	1	49056576	49056576	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:49056576C>T	ENST00000371839.1	-	10	1149	c.1033G>A	c.(1033-1035)Gat>Aat	p.D345N	AGBL4_ENST00000334103.7_Missense_Mutation_p.D78N	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	345					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		CGTTCCTCATCCTCAAAGATG	0.478																																					p.D345N		.											AGBL4,parotid,carcinoma,0,1	AGBL4	0	0			c.G1033A						.						61.0	63.0	62.0					1																	49056576		1955	4134	6089	SO:0001583	missense	84871	exon10			CCTCATCCTCAAA	AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.1033G>A	1.37:g.49056576C>T	ENSP00000360905:p.Asp345Asn	49	0		24	2	NM_032785	B3KT26|B4DG37	Missense_Mutation	SNP	ENST00000371839.1	37	CCDS44137.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.116518	0.56505	.	.	ENSG00000186094	ENST00000371839;ENST00000411952;ENST00000334103	T;T	0.12774	2.65;2.65	5.79	5.79	0.91817	Peptidase M14, carboxypeptidase A (1);	0.307834	0.41194	D	0.000938	T	0.14399	0.0348	L	0.47078	1.49	0.39711	D	0.971336	B;B;B;B;B	0.22746	0.028;0.005;0.074;0.049;0.049	B;B;B;B;B	0.31686	0.012;0.006;0.073;0.134;0.134	T	0.10019	-1.0648	9	.	.	.	-34.4359	9.8923	0.41298	0.0:0.785:0.1402:0.0748	.	160;357;78;190;345	A0AVJ2;Q5VU57-2;B4DGK1;B1AMW2;Q5VU57	.;.;.;.;CBPC6_HUMAN	N	345;339;78	ENSP00000360905:D345N;ENSP00000335516:D78N	.	D	-	1	0	AGBL4	48829163	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.509000	0.60448	2.744000	0.94065	0.650000	0.86243	GAT	.		0.478	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021346.4	NM_032785	
FLT3	2322	hgsc.bcm.edu	37	13	28610128	28610128	+	Silent	SNP	C	C	A	rs573741842		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr13:28610128C>A	ENST00000241453.7	-	11	1443	c.1362G>T	c.(1360-1362)tcG>tcT	p.S454S	FLT3_ENST00000537084.1_Silent_p.S454S|FLT3_ENST00000380982.4_Silent_p.S454S	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	454					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGTATCCATCCGAGAAACAGG	0.453			"""Mis, O"""		"""AML, ALL"""																																p.S454S		.		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	FLT3,NS,carcinoma,-1,1	FLT3	-1	0			c.G1362T						.						206.0	198.0	200.0					13																	28610128		2203	4300	6503	SO:0001819	synonymous_variant	2322	exon11			TCCATCCGAGAAA	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1362G>T	13.37:g.28610128C>A		42	0		29	2	NM_004119	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Silent	SNP	ENST00000241453.7	37	CCDS31953.1																																																																																			.		0.453	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2		
AFF3	3899	hgsc.bcm.edu	37	2	100199456	100199456	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:100199456G>T	ENST00000409236.2	-	15	2709	c.2597C>A	c.(2596-2598)gCa>gAa	p.A866E	AFF3_ENST00000409579.1_Missense_Mutation_p.A891E|AFF3_ENST00000317233.4_Missense_Mutation_p.A866E|AFF3_ENST00000356421.2_Missense_Mutation_p.A891E			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	866					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TATTGGTATTGCCACACTGAA	0.418																																					p.A891E		.											AFF3,colon,carcinoma,0,1	AFF3	0	0			c.C2672A						.						72.0	70.0	71.0					2																	100199456		2203	4300	6503	SO:0001583	missense	3899	exon16			GGTATTGCCACAC	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2597C>A	2.37:g.100199456G>T	ENSP00000387207:p.Ala866Glu	23	1		28	2	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807889	0.50421	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236	T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02	6.07	6.07	0.98685	.	0.102910	0.42294	D	0.000734	T	0.67841	0.2936	L	0.51422	1.61	0.35127	D	0.767609	D;B;P	0.58268	0.982;0.208;0.928	P;B;P	0.59825	0.864;0.082;0.714	T	0.64867	-0.6306	10	0.07813	T	0.8	.	15.2162	0.73267	0.0:0.1397:0.8603:0.0	.	1019;866;891	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	E	866;891;891;866	ENSP00000317421:A866E;ENSP00000348793:A891E;ENSP00000386834:A891E;ENSP00000387207:A866E	ENSP00000317421:A866E	A	-	2	0	AFF3	99565888	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.654000	0.61469	2.885000	0.99019	0.655000	0.94253	GCA	.		0.418	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
ZNF500	26048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	4802537	4802537	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr16:4802537C>T	ENST00000219478.6	-	6	1582	c.1283G>A	c.(1282-1284)cGc>cAc	p.R428H	ZNF500_ENST00000591026.1_5'UTR|RP11-127I20.7_ENST00000588099.1_RNA|ZNF500_ENST00000545009.1_Missense_Mutation_p.R428H			O60304	ZN500_HUMAN	zinc finger protein 500	428					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						GTGCGTCCGGCGGTGGGCGCT	0.692																																					p.R428H		.											.	.	.	0			c.G1283A						.						16.0	18.0	17.0					16																	4802537		2179	4274	6453	SO:0001583	missense	26048	exon6			GTCCGGCGGTGGG	AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.1283G>A	16.37:g.4802537C>T	ENSP00000219478:p.Arg428His	31	0		32	10	NM_021646	A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Missense_Mutation	SNP	ENST00000219478.6	37	CCDS32383.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.054434	0.55218	.	.	ENSG00000103199	ENST00000545009;ENST00000219478	T;T	0.37584	3.3;1.19	3.93	1.89	0.25635	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33309	N	0.005058	T	0.41305	0.1153	L	0.39633	1.23	0.09310	N	1	D;D	0.71674	0.996;0.998	P;D	0.64042	0.747;0.921	T	0.10086	-1.0645	10	0.45353	T	0.12	.	6.5182	0.22260	0.0:0.6674:0.0:0.3326	.	428;428	B4DNN9;O60304	.;ZN500_HUMAN	H	428	ENSP00000445714:R428H;ENSP00000219478:R428H	ENSP00000219478:R428H	R	-	2	0	ZNF500	4742538	0.000000	0.05858	0.620000	0.29132	0.775000	0.43874	-1.567000	0.02146	0.642000	0.30620	0.561000	0.74099	CGC	.		0.692	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432461.1	XM_085507	
MRVI1	10335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	10597943	10597943	+	Missense_Mutation	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr11:10597943G>A	ENST00000436272.1	-	20	2672	c.2594C>T	c.(2593-2595)tCg>tTg	p.S865L	MRVI1_ENST00000558540.1_Missense_Mutation_p.S577L|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000421747.1_Missense_Mutation_p.S883L|MRVI1_ENST00000531107.1_Missense_Mutation_p.S884L|MRVI1_ENST00000423302.2_Missense_Mutation_p.S892L|MRVI1_ENST00000541483.1_Missense_Mutation_p.S686L|MRVI1_ENST00000547195.1_Missense_Mutation_p.S801L|MRVI1-AS1_ENST00000529979.1_RNA|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000552103.1_Missense_Mutation_p.S801L|MRVI1_ENST00000424001.1_Missense_Mutation_p.S577L|MRVI1_ENST00000527509.2_Missense_Mutation_p.S801L|MRVI1_ENST00000545852.1_Missense_Mutation_p.S577L|MRVI1_ENST00000534266.2_Missense_Mutation_p.S577L			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	865					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CTGGGCTGCCGAGCAAGTGGA	0.572																																					p.S892L		.											.	.	.	0			c.C2675T						.						73.0	75.0	74.0					11																	10597943		2005	4161	6166	SO:0001583	missense	10335	exon21			GCTGCCGAGCAAG	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.2594C>T	11.37:g.10597943G>A	ENSP00000412229:p.Ser865Leu	34	0		12	6	NM_130385	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	ENST00000436272.1	37		.	.	.	.	.	.	.	.	.	.	G	31	5.089806	0.94149	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76;1.76	5.82	5.82	0.92795	.	0.000000	0.53938	D	0.000050	T	0.50922	0.1644	L	0.57536	1.79	0.46586	D	0.999119	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.87578	0.99;0.998;0.998;0.996	T	0.46624	-0.9178	10	0.87932	D	0	-9.0927	19.7158	0.96119	0.0:0.0:1.0:0.0	.	686;865;884;883	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	L	883;866;865;801;801;577;577;892;686;884;801	ENSP00000414598:S883L;ENSP00000412229:S865L;ENSP00000448278:S801L;ENSP00000446764:S801L;ENSP00000441971:S577L;ENSP00000401205:S577L;ENSP00000412130:S892L;ENSP00000437784:S686L;ENSP00000432436:S884L;ENSP00000432067:S801L	ENSP00000307885:S866L	S	-	2	0	MRVI1	10554519	1.000000	0.71417	0.976000	0.42696	0.975000	0.68041	6.752000	0.74898	2.757000	0.94681	0.655000	0.94253	TCG	.		0.572	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
CPED1	79974	hgsc.bcm.edu	37	7	120765873	120765873	+	Splice_Site	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr7:120765873G>T	ENST00000310396.5	+	9	1528		c.e9-1		CPED1_ENST00000450913.2_Splice_Site|CPED1_ENST00000423795.1_Splice_Site	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1							endoplasmic reticulum (GO:0005783)		p.?(1)									TTTCATTTTAGATGCAGATTC	0.373																																					.		.											C7orf58,NS,carcinoma,0,1	C7orf58	0	1	Unknown(1)	kidney(1)	c.1062-1G>T						.						188.0	160.0	170.0					7																	120765873		2203	4300	6503	SO:0001630	splice_region_variant	79974	exon9			ATTTTAGATGCAG		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.1062-1G>T	7.37:g.120765873G>T		47	0		21	2	NM_024913	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Splice_Site	SNP	ENST00000310396.5	37	CCDS34739.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789354	0.70337	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000423795;ENST00000443817	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7368	0.91757	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C7orf58	120553109	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	6.095000	0.71439	2.598000	0.87819	0.655000	0.94253	.	.		0.373	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913	Intron
ADAMTS16	170690	hgsc.bcm.edu	37	5	5209265	5209265	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr5:5209265C>T	ENST00000274181.7	+	10	1649	c.1511C>T	c.(1510-1512)cCt>cTt	p.P504L	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.P504L	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	504	Disintegrin.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P504H(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TACAAGTATCCTGAGAAATTG	0.463																																					p.P504L		.											ADAMTS16_ENST00000274181,colon,carcinoma,0,2	ADAMTS16_ENST00000274181	0	2	Substitution - Missense(2)	large_intestine(2)	c.C1511T						.						147.0	144.0	145.0					5																	5209265		1902	4138	6040	SO:0001583	missense	170690	exon10			AGTATCCTGAGAA	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1511C>T	5.37:g.5209265C>T	ENSP00000274181:p.Pro504Leu	49	0		38	2	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893260	0.72524	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	T;T	0.11063	2.81;2.81	5.9	5.9	0.94986	Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39809	0.1092	M	0.82517	2.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.994	T	0.18335	-1.0340	10	0.87932	D	0	.	19.0504	0.93041	0.0:1.0:0.0:0.0	.	504;504;504	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	L	504	ENSP00000274181:P504L;ENSP00000421631:P504L	ENSP00000274181:P504L	P	+	2	0	ADAMTS16	5262265	1.000000	0.71417	0.881000	0.34555	0.222000	0.24845	6.856000	0.75450	2.788000	0.95919	0.650000	0.86243	CCT	.		0.463	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
CFHR3	10878	hgsc.bcm.edu	37	1	196759347	196759347	+	Silent	SNP	A	A	T	rs149352569		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:196759347A>T	ENST00000367425.4	+	5	878	c.786A>T	c.(784-786)ccA>ccT	p.P262P	CFHR3_ENST00000391985.3_Silent_p.P201P	NM_021023.5	NP_066303.2	Q02985	FHR3_HUMAN	complement factor H-related 3	262	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.P262P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18						CGGAACCACCAAGATGCATAC	0.363																																					p.P262P		.											CFHR3,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	CFHR3	0	1	Substitution - coding silent(1)	central_nervous_system(1)	c.A786T						.						29.0	39.0	36.0					1																	196759347		1522	3863	5385	SO:0001819	synonymous_variant	10878	exon5			ACCACCAAGATGC	X68679	CCDS30958.1, CCDS53453.1	1q32	2014-09-17		2006-02-28	ENSG00000116785	ENSG00000116785		"""Complement system"""	16980	protein-coding gene	gene with protein product	"""complement factor H related 3"""	605336		CFHL3		8428964, 10380701	Standard	NM_021023		Approved	FHR-3, HLF4, FHR3, DOWN16	uc001gtl.3	Q02985	OTTHUMG00000035929	ENST00000367425.4:c.786A>T	1.37:g.196759347A>T		54	1		34	7	NM_021023	B4DPR0|Q9UJ16	Silent	SNP	ENST00000367425.4	37	CCDS30958.1																																																																																			.		0.363	CFHR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087505.2	NM_021023	
MT-ND2	4536	hgsc.bcm.edu;broad.mit.edu	37	M	2698	2698	+	5'Flank	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chrM:2698G>A	ENST00000361453.3	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TV_ENST00000387342.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						gcccgtgaagaggcgggcatg	0.448																																					.		.											.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	6053	.			GAAGAGGCGGGCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2698G>A	Exception_encountered	823	0		2868	247	.	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	ENST00000361453.3	37																																																																																				.		0.448	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
HLA-B	3106	hgsc.bcm.edu	37	6	31322910	31322910	+	Missense_Mutation	SNP	G	G	A	rs74189305		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr6:31322910G>A	ENST00000412585.2	-	5	1014	c.986C>T	c.(985-987)gCt>gTt	p.A329V		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	329			A -> T (in dbSNP:rs1051488).		antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.A329V(4)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						ACACATCACAGCAGCGACCAC	0.587									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.A329V		.											HLA-B,NS,carcinoma,-1,4	HLA-B	-1	4	Substitution - Missense(4)	kidney(4)	c.C986T						.						102.0	101.0	101.0					6																	31322910		1511	2709	4220	SO:0001583	missense	3106	exon5	Familial Cancer Database	;Lichen Sclerosis, Familial	ATCACAGCAGCGA	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.986C>T	6.37:g.31322910G>A	ENSP00000399168:p.Ala329Val	51	2		45	8	NM_005514	Q29764	Missense_Mutation	SNP	ENST00000412585.2	37	CCDS34394.1	.	.	.	.	.	.	.	.	.	.	N	9.051	0.992087	0.18966	.	.	ENSG00000234745	ENST00000412585;ENST00000428231	T	0.00622	6.16	3.73	-3.02	0.05446	.	.	.	.	.	T	0.00109	0.0003	N	0.00729	-1.24	0.09310	N	1	B	0.20052	0.041	B	0.29077	0.098	T	0.22906	-1.0203	9	0.49607	T	0.09	.	5.2273	0.15401	0.4363:0.3516:0.2121:0.0	.	329	P01889	1B07_HUMAN	V	329;208	ENSP00000399168:A329V	ENSP00000399168:A329V	A	-	2	0	HLA-B	31430889	0.000000	0.05858	0.128000	0.21923	0.021000	0.10359	0.033000	0.13754	-0.241000	0.09681	0.448000	0.29417	GCT	.		0.587	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
RNF103	7844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	86831421	86831421	+	Missense_Mutation	SNP	T	T	C			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:86831421T>C	ENST00000237455.4	-	4	2571	c.1603A>G	c.(1603-1605)Act>Gct	p.T535A	RNF103_ENST00000477307.1_5'Flank|RNF103-CHMP3_ENST00000604011.1_Intron|CHMP3_ENST00000439940.2_Intron|AC015971.2_ENST00000597638.1_RNA|AC015971.2_ENST00000426549.1_RNA|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000439077.1_RNA	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	535					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						TCATTTTCAGTATCTTGAGAC	0.408																																					p.T535A		.											.	.	.	0			c.A1603G						.						166.0	173.0	171.0					2																	86831421		2203	4300	6503	SO:0001583	missense	7844	exon4			TTTCAGTATCTTG	D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.1603A>G	2.37:g.86831421T>C	ENSP00000237455:p.Thr535Ala	29	0		21	11	NM_005667	A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Missense_Mutation	SNP	ENST00000237455.4	37	CCDS33237.1	.	.	.	.	.	.	.	.	.	.	T	1.037	-0.680167	0.03353	.	.	ENSG00000239305	ENST00000237455	T	0.41400	1.0	5.73	4.53	0.55603	.	0.847141	0.10908	N	0.620898	T	0.20251	0.0487	N	0.03608	-0.345	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.11251	-1.0595	10	0.16896	T	0.51	-0.2063	10.1044	0.42524	0.0:0.069:0.1252:0.8058	.	535	O00237	RN103_HUMAN	A	535	ENSP00000237455:T535A	ENSP00000237455:T535A	T	-	1	0	RNF103	86684932	0.628000	0.27138	0.757000	0.31301	0.859000	0.49053	2.047000	0.41269	2.179000	0.69175	0.377000	0.23210	ACT	.		0.408	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330041.2	NM_005667	
HIST1H3G	8355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	26271507	26271507	+	Missense_Mutation	SNP	C	C	A	rs567908596		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr6:26271507C>A	ENST00000305910.3	-	1	105	c.106G>T	c.(106-108)Gtg>Ttg	p.V36L	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	36					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						GGTTTCTTCACGCCGCCGGTG	0.647																																					p.V36L		.											.	.	.	0			c.G106T						.						35.0	41.0	39.0					6																	26271507		2203	4300	6503	SO:0001583	missense	8355	exon1			TCTTCACGCCGCC	Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.106G>T	6.37:g.26271507C>A	ENSP00000439660:p.Val36Leu	48	0		21	14	NM_003534	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000305910.3	37	CCDS4602.1	.	.	.	.	.	.	.	.	.	.	.	13.46	2.242832	0.39598	.	.	ENSG00000256018	ENST00000305910	T	0.43688	0.94	4.56	3.7	0.42460	.	.	.	.	.	T	0.33089	0.0851	.	.	.	0.27307	N	0.957409	.	.	.	.	.	.	T	0.18618	-1.0331	6	0.87932	D	0	.	11.9332	0.52857	0.0:0.915:0.0:0.085	.	.	.	.	L	36	ENSP00000439660:V36L	ENSP00000439660:V36L	V	-	1	0	HIST1H3G	26379486	1.000000	0.71417	0.998000	0.56505	0.753000	0.42808	5.850000	0.69473	1.064000	0.40671	0.563000	0.77884	GTG	.		0.647	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040099.2	NM_003534	
GUCY1A3	2982	hgsc.bcm.edu	37	4	156638432	156638432	+	Missense_Mutation	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr4:156638432C>A	ENST00000296518.7	+	8	1903	c.1694C>A	c.(1693-1695)tCt>tAt	p.S565Y	GUCY1A3_ENST00000455639.2_Missense_Mutation_p.S565Y|GUCY1A3_ENST00000511507.1_Missense_Mutation_p.S565Y|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.S565Y|GUCY1A3_ENST00000506455.1_Missense_Mutation_p.S565Y|GUCY1A3_ENST00000393832.3_Missense_Mutation_p.S307Y|GUCY1A3_ENST00000513574.1_Missense_Mutation_p.S565Y			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	565	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.S565Y(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GAAGTTATGTCTCCCCATGGA	0.428																																					p.S565Y		.											GUCY1A3,colon,carcinoma,0,1	GUCY1A3	0	1	Substitution - Missense(1)	large_intestine(1)	c.C1694A						.						119.0	109.0	112.0					4																	156638432		2203	4300	6503	SO:0001583	missense	2982	exon8			TTATGTCTCCCCA		CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1694C>A	4.37:g.156638432C>A	ENSP00000296518:p.Ser565Tyr	46	0		24	2	NM_001130687	D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	ENST00000296518.7	37	CCDS34085.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888494	0.91814	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000393832;ENST00000296518;ENST00000513574	T;T;T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45;-1.45;-1.45	5.64	5.64	0.86602	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.64402	D	0.000007	D	0.88228	0.6380	M	0.65975	2.015	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.66196	0.942;0.942	D	0.85588	0.1244	10	0.30854	T	0.27	.	19.6996	0.96048	0.0:1.0:0.0:0.0	.	565;565	B3KU69;Q02108	.;GCYA3_HUMAN	Y	565;565;565;565;307;565;565	ENSP00000424361:S565Y;ENSP00000421493:S565Y;ENSP00000426968:S565Y;ENSP00000412201:S565Y;ENSP00000377418:S307Y;ENSP00000296518:S565Y;ENSP00000426040:S565Y	ENSP00000296518:S565Y	S	+	2	0	GUCY1A3	156857882	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.768000	0.85345	2.646000	0.89796	0.655000	0.94253	TCT	.		0.428	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2		
IBTK	25998	hgsc.bcm.edu;bcgsc.ca	37	6	82920614	82920614	+	Missense_Mutation	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr6:82920614G>A	ENST00000306270.7	-	16	2975	c.2426C>T	c.(2425-2427)gCa>gTa	p.A809V	IBTK_ENST00000510291.1_Missense_Mutation_p.A809V|RNU6-130P_ENST00000411112.1_RNA|IBTK_ENST00000503631.1_Missense_Mutation_p.A608V	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	809	BTB 2. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TTCCAGAGCTGCACAACTGGA	0.279																																					p.A809V		.											.	.	.	0			c.C2426T						.						62.0	69.0	67.0					6																	82920614		2202	4289	6491	SO:0001583	missense	25998	exon16			AGAGCTGCACAAC	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.2426C>T	6.37:g.82920614G>A	ENSP00000305721:p.Ala809Val	66	0		49	4	NM_015525	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	ENST00000306270.7	37	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.298140	0.60086	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.66638	-0.22;-0.22;-0.22	5.48	5.48	0.80851	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.407029	0.26731	N	0.022796	T	0.45074	0.1324	N	0.10837	0.055	0.30504	N	0.77013	D;B;P;B	0.59357	0.985;0.4;0.575;0.4	P;B;B;B	0.58820	0.846;0.287;0.22;0.287	T	0.43829	-0.9367	10	0.25106	T	0.35	-8.2051	9.3382	0.38062	0.0778:0.1469:0.7753:0.0	.	608;809;809;809	E9PDR5;E7EPI0;Q9P2D0-2;Q9P2D0	.;.;.;IBTK_HUMAN	V	809;608;809	ENSP00000305721:A809V;ENSP00000422762:A608V;ENSP00000426405:A809V	ENSP00000305721:A809V	A	-	2	0	IBTK	82977333	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.110000	0.77069	2.584000	0.87258	0.563000	0.77884	GCA	.		0.279	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
TLR9	54106	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	52255290	52255290	+	Silent	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr3:52255290G>A	ENST00000360658.2	-	2	3675	c.3042C>T	c.(3040-3042)acC>acT	p.T1014T	TLR9_ENST00000597542.1_Silent_p.T1038T|TLR9_ENST00000494383.1_Nonsense_Mutation_p.Q1168*	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	1014	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	GGTTGTCCCTGGTCAGGGCCA	0.662																																					p.T1014T		.											.	.	.	0			c.C3042T						.						75.0	81.0	79.0					3																	52255290		2203	4300	6503	SO:0001819	synonymous_variant	54106	exon2			GTCCCTGGTCAGG	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.3042C>T	3.37:g.52255290G>A		26	0		23	4	NM_017442	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Silent	SNP	ENST00000360658.2	37	CCDS2848.1	.	.	.	.	.	.	.	.	.	.	G	5.754	0.323469	0.10900	.	.	ENSG00000173366	ENST00000494383	.	.	.	4.93	3.08	0.35506	.	.	.	.	.	.	.	.	.	.	.	0.36530	D	0.870687	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.8454	0.23984	0.0935:0.3436:0.563:0.0	.	.	.	.	X	1168	.	.	Q	-	1	0	RP11-330H6.5	52230330	0.004000	0.15560	1.000000	0.80357	0.931000	0.56810	-0.406000	0.07187	0.634000	0.30469	0.591000	0.81541	CAG	.		0.662	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
MEF2B	100271849	hgsc.bcm.edu	37	19	19261516	19261516	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:19261516C>T	ENST00000602424.2	-	4	755	c.29G>A	c.(28-30)cGc>cAc	p.R10H	MEF2B_ENST00000409447.2_Missense_Mutation_p.R10H|MEF2BNB-MEF2B_ENST00000514819.3_Missense_Mutation_p.R27H|MEF2B_ENST00000162023.5_Missense_Mutation_p.R10H|MEF2B_ENST00000409224.1_Missense_Mutation_p.R10H|MEF2B_ENST00000410050.1_Missense_Mutation_p.R10H|MEF2BNB-MEF2B_ENST00000444486.3_Missense_Mutation_p.R10H|MEF2B_ENST00000424583.2_Missense_Mutation_p.R10H|MEF2BNB-MEF2B_ENST00000602276.1_5'UTR	NM_005919.3	NP_005910.1	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B	10	Lys-rich (basic).|MADS-box. {ECO:0000255|PROSITE- ProRule:PRU00251}.				muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R10H(2)		breast(1)|haematopoietic_and_lymphoid_tissue(21)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			GTCCAGGATGCGGGAGATCTG	0.557																																					p.R10H		.											MEF2BNB-MEF2B,NS,carcinoma,0,4	MEF2BNB-MEF2B	0	2	Substitution - Missense(2)	breast(2)	c.G29A						.						195.0	147.0	163.0					19																	19261516		2203	4300	6503	SO:0001583	missense	4207	exon4			AGGATGCGGGAGA	X63380	CCDS12394.1, CCDS46024.1	19p13.11	2010-05-12	2007-04-24					"""Myocyte enhancer factors"""	6995	protein-coding gene	gene with protein product		600661				1516833, 8575763	Standard	NM_001145785		Approved	RSRFR2	uc002nll.2	Q02080		ENST00000602424.2:c.29G>A	19.37:g.19261516C>T	ENSP00000473308:p.Arg10His	47	0		20	2	NM_005919	A0AV80|B4DVH7|B7ZVY1|G5E9M1	Missense_Mutation	SNP	ENST00000602424.2	37	CCDS12394.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486525	0.84854	.	.	ENSG00000213999	ENST00000409224;ENST00000424583;ENST00000410050;ENST00000444486;ENST00000409447;ENST00000162023	D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82	4.27	4.27	0.50696	Transcription factor, MADS-box (6);	0.000000	0.64402	D	0.000005	D	0.93028	0.7781	M	0.88640	2.97	0.50467	D	0.999876	P;P;D;D;D	0.89917	0.95;0.892;1.0;0.977;0.981	P;P;D;P;P	0.87578	0.698;0.586;0.998;0.669;0.698	D	0.94377	0.7601	10	0.87932	D	0	-21.7055	14.5386	0.67979	0.0:1.0:0.0:0.0	.	10;57;10;10;10	Q02080;B8ZZJ5;C9J4J4;G5E9M1;B3KQ23	MEF2B_HUMAN;.;.;.;.	H	10;10;10;10;57;10	ENSP00000386480:R10H;ENSP00000402154:R10H;ENSP00000386374:R10H;ENSP00000390762:R10H;ENSP00000162023:R10H	ENSP00000162023:R10H	R	-	2	0	MEF2B	19122516	1.000000	0.71417	0.999000	0.59377	0.888000	0.51559	6.754000	0.74909	2.083000	0.62718	0.491000	0.48974	CGC	.		0.557	MEF2B-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_005919	
TMTC1	83857	hgsc.bcm.edu	37	12	29786213	29786213	+	Missense_Mutation	SNP	A	A	G			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr12:29786213A>G	ENST00000539277.1	-	6	1053	c.995T>C	c.(994-996)gTg>gCg	p.V332A	TMTC1_ENST00000256062.5_Missense_Mutation_p.V224A|TMTC1_ENST00000319685.8_5'UTR|TMTC1_ENST00000381224.2_Missense_Mutation_p.V286A|TMTC1_ENST00000551659.1_Missense_Mutation_p.V394A|TMTC1_ENST00000552618.1_Missense_Mutation_p.V394A	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	332						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GCACAGGGTCACGGGTGCAAG	0.498																																					p.V332A		.											TMTC1,NS,carcinoma,-1,1	TMTC1	-1	0			c.T995C						.						107.0	91.0	97.0					12																	29786213		2203	4300	6503	SO:0001583	missense	83857	exon6			AGGGTCACGGGTG		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.995T>C	12.37:g.29786213A>G	ENSP00000442046:p.Val332Ala	45	0		48	2	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	37	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	.	4.133	0.023042	0.08006	.	.	ENSG00000133687	ENST00000540901;ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	5.53	5.53	0.82687	Domain of unknown function DUF1736 (1);	0.511988	0.21019	N	0.081549	T	0.22282	0.0537	N	0.04746	-0.17	0.09310	N	1	B;B;P	0.35107	0.015;0.0;0.484	B;B;B	0.31614	0.009;0.002;0.133	T	0.12041	-1.0563	9	.	.	.	-11.9906	14.4869	0.67624	1.0:0.0:0.0:0.0	.	286;332;394	Q8IUR5-3;Q8IUR5;F8VTQ9	.;TMTC1_HUMAN;.	A	95;224;394;394;332;286	ENSP00000256062:V224A;ENSP00000448112:V394A;ENSP00000449043:V394A;ENSP00000442046:V332A;ENSP00000370622:V286A	.	V	-	2	0	TMTC1	29677480	0.643000	0.27269	0.784000	0.31847	0.979000	0.70002	5.388000	0.66249	2.096000	0.63516	0.533000	0.62120	GTG	.		0.498	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
NAV1	89796	hgsc.bcm.edu	37	1	201754410	201754410	+	Intron	SNP	C	C	T	rs56117427|rs36061932	byFrequency	TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:201754410C>T	ENST00000367296.4	+	8	3224				NAV1_ENST00000367302.1_Intron|NAV1_ENST00000367297.4_Intron|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367295.1_Intron|NAV1_ENST00000469130.1_Intron|NAV1_ENST00000367300.3_Intron|NAV1_ENST00000295624.6_Intron	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1						microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CTCTCTCTCTCTTTTTTTTTT	0.428																																					.		.											.	.	.	0			.						.						59.0	66.0	64.0					1																	201754410		2203	4300	6503	SO:0001627	intron_variant	100873779	.			CTCTCTCTTTTTT	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.2805-28C>T	1.37:g.201754410C>T		33	0		24	2	.	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	RNA	SNP	ENST00000367296.4	37	CCDS1414.2																																																																																			.		0.428	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
RASGRF2	5924	hgsc.bcm.edu	37	5	80511667	80511667	+	Intron	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr5:80511667C>A	ENST00000265080.4	+	24	3421				CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000511495.1_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		GTATTTTCATCACACTAAGTT	0.343																																					.		.											.	.	.	0			.						.						10.0	11.0	11.0					5																	80511667		2073	4187	6260	SO:0001627	intron_variant	26830	.			TTTCATCACACTA	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.3355-28C>A	5.37:g.80511667C>A		149	0		137	11	.	B9EG89|Q9UK56	RNA	SNP	ENST00000265080.4	37	CCDS4052.1																																																																																			.		0.343	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	
NFE2L3	9603	hgsc.bcm.edu;bcgsc.ca	37	7	26224962	26224962	+	Silent	SNP	T	T	C			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr7:26224962T>C	ENST00000056233.3	+	4	1903	c.1644T>C	c.(1642-1644)ccT>ccC	p.P548P		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	548					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						TGCATATCCCTTTTTCTGTAG	0.418																																					p.P548P		.											.	.	.	0			c.T1644C						.						125.0	114.0	118.0					7																	26224962		2203	4300	6503	SO:0001819	synonymous_variant	9603	exon4			TATCCCTTTTTCT	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1644T>C	7.37:g.26224962T>C		110	0		78	4	NM_004289	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Silent	SNP	ENST00000056233.3	37	CCDS5396.1																																																																																			.		0.418	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1		
KIAA0391	9692	hgsc.bcm.edu	37	14	35593125	35593125	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr14:35593125G>T	ENST00000557565.1	+	2	1055	c.674G>T	c.(673-675)aGa>aTa	p.R225I	KIAA0391_ENST00000603588.1_Intron|PPP2R3C_ENST00000555644.1_5'Flank|KIAA0391_ENST00000605870.1_Intron|KIAA0391_ENST00000534898.4_Missense_Mutation_p.R225I|PPP2R3C_ENST00000261475.5_5'Flank|KIAA0391_ENST00000603544.1_Missense_Mutation_p.R225I|KIAA0391_ENST00000321130.10_Missense_Mutation_p.R225I|KIAA0391_ENST00000604948.1_Missense_Mutation_p.R130I|KIAA0391_ENST00000250377.7_Missense_Mutation_p.R130I	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	225					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)		p.R225T(1)		central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		CATTCAGACAGATGGAGAGAA	0.373																																					p.R225I		.											KIAA0391,NS,carcinoma,0,1	KIAA0391	0	1	Substitution - Missense(1)	endometrium(1)	c.G674T						.						45.0	45.0	45.0					14																	35593125		2202	4299	6501	SO:0001583	missense	9692	exon2			CAGACAGATGGAG	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.674G>T	14.37:g.35593125G>T	ENSP00000454657:p.Arg225Ile	60	0		46	2	NM_014672	B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Missense_Mutation	SNP	ENST00000557565.1	37	CCDS32063.1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.401440	0.62288	.	.	ENSG00000100890	ENST00000554896;ENST00000250377;ENST00000321130;ENST00000534898;ENST00000556121	T;T;T	0.54071	0.63;0.59;0.6	5.21	3.36	0.38483	.	0.150202	0.42548	D	0.000694	T	0.63212	0.2492	M	0.74881	2.28	0.53688	D	0.999972	D;D	0.62365	0.991;0.991	D;D	0.64042	0.914;0.921	T	0.60949	-0.7161	10	0.21014	T	0.42	-8.9114	7.2129	0.25943	0.1365:0.0:0.7103:0.1533	.	225;225	O15091-2;O15091	.;MRRP3_HUMAN	I	130;130;225;225;225	ENSP00000250377:R130I;ENSP00000324697:R225I;ENSP00000440915:R225I	ENSP00000250377:R130I	R	+	2	0	KIAA0391	34662876	0.995000	0.38212	1.000000	0.80357	0.700000	0.40528	4.422000	0.59854	1.173000	0.42796	0.557000	0.71058	AGA	.		0.373	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000411280.1	NM_014672	
FAT4	79633	hgsc.bcm.edu	37	4	126373374	126373374	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr4:126373374C>T	ENST00000394329.3	+	9	11216	c.11203C>T	c.(11203-11205)Cgc>Tgc	p.R3735C	FAT4_ENST00000335110.5_Missense_Mutation_p.R2033C	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3735					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCATTTTTTACGCATTGCCAG	0.458																																					p.R3735C		.											FAT4_ENST00000394329,NS,carcinoma,0,2	FAT4_ENST00000394329	0	0			c.C11203T						.						142.0	135.0	137.0					4																	126373374		2203	4300	6503	SO:0001583	missense	79633	exon9			TTTTTACGCATTG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11203C>T	4.37:g.126373374C>T	ENSP00000377862:p.Arg3735Cys	70	0		38	3	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838173	0.91117	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.58358	0.34;0.34	5.76	5.76	0.90799	.	0.000000	0.35235	U	0.003351	T	0.65913	0.2737	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70935	0.95;0.971;0.95	T	0.66618	-0.5878	10	0.66056	D	0.02	.	19.9788	0.97318	0.0:1.0:0.0:0.0	.	2033;3735;3735	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	C	3735;2033	ENSP00000377862:R3735C;ENSP00000335169:R2033C	ENSP00000335169:R2033C	R	+	1	0	FAT4	126592824	1.000000	0.71417	0.957000	0.39632	0.989000	0.77384	7.662000	0.83803	2.719000	0.93026	0.555000	0.69702	CGC	.		0.458	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
DDX56	54606	hgsc.bcm.edu	37	7	44611136	44611136	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr7:44611136C>T	ENST00000258772.5	-	6	951	c.845G>A	c.(844-846)aGc>aAc	p.S282N	DDX56_ENST00000431640.1_Missense_Mutation_p.S282N|DDX56_ENST00000485367.1_5'UTR	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	282	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						GGTGGGGATGCTGAACTGTTC	0.507																																					p.S282N		.											.	.	.	0			c.G845A						.						73.0	70.0	71.0					7																	44611136		2203	4300	6503	SO:0001583	missense	54606	exon6			GGGATGCTGAACT	AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.845G>A	7.37:g.44611136C>T	ENSP00000258772:p.Ser282Asn	55	0		56	4	NM_001257189	A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	ENST00000258772.5	37	CCDS5492.1	.	.	.	.	.	.	.	.	.	.	.	21.8	4.208030	0.79240	.	.	ENSG00000136271	ENST00000258772;ENST00000431640	T;T	0.74315	-0.83;3.89	5.93	5.93	0.95920	Helicase, C-terminal (3);	0.118452	0.85682	D	0.000000	T	0.73369	0.3578	L	0.52206	1.635	0.50171	D	0.999856	B;B	0.21147	0.006;0.052	B;B	0.28553	0.009;0.091	T	0.69412	-0.5152	10	0.62326	D	0.03	-21.6302	17.8301	0.88679	0.0:1.0:0.0:0.0	.	282;282	C9JV95;Q9NY93	.;DDX56_HUMAN	N	282	ENSP00000258772:S282N;ENSP00000393488:S282N	ENSP00000258772:S282N	S	-	2	0	DDX56	44577661	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	5.400000	0.66320	2.814000	0.96858	0.563000	0.77884	AGC	.		0.507	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251291.1	NM_019082	
GLG1	2734	hgsc.bcm.edu	37	16	74566028	74566028	+	Silent	SNP	G	G	A	rs2550807		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr16:74566028G>A	ENST00000422840.2	-	2	461	c.462C>T	c.(460-462)gaC>gaT	p.D154D	GLG1_ENST00000205061.5_Silent_p.D154D|GLG1_ENST00000447066.2_Intron	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	154					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.D154D(1)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CATGATTGCAGTCTGAAGAAA	0.323																																					p.D154D		.											GLG1,NS,carcinoma,0,1	GLG1	0	1	Substitution - coding silent(1)	prostate(1)	c.C462T						.						80.0	74.0	76.0					16																	74566028		2198	4300	6498	SO:0001819	synonymous_variant	2734	exon2			ATTGCAGTCTGAA		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.462C>T	16.37:g.74566028G>A		60	0		52	6	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent	SNP	ENST00000422840.2	37	CCDS45527.1																																																																																			.		0.323	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
MPPED1	758	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	22	43870630	43870630	+	Missense_Mutation	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr22:43870630G>A	ENST00000417669.2	+	4	865	c.421G>A	c.(421-423)Gag>Aag	p.E141K	MPPED1_ENST00000414469.2_Missense_Mutation_p.E35K|MPPED1_ENST00000542779.1_Missense_Mutation_p.E141K|MPPED1_ENST00000439548.1_5'UTR|MPPED1_ENST00000538182.1_Missense_Mutation_p.E174K|MPPED1_ENST00000443721.1_Missense_Mutation_p.E141K			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	141							hydrolase activity (GO:0016787)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				CCTGCCCTACGAGTACAAGAT	0.582																																					p.E141K		.											.	.	.	0			c.G421A						.						101.0	103.0	103.0					22																	43870630		2113	4251	6364	SO:0001583	missense	758	exon4			CCCTACGAGTACA	U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.421G>A	22.37:g.43870630G>A	ENSP00000388137:p.Glu141Lys	15	0		13	5	NM_001044370	A8K159|B7Z2S9|Q8N361	Missense_Mutation	SNP	ENST00000417669.2	37	CCDS46723.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.143961	0.37825	.	.	ENSG00000186732	ENST00000417669;ENST00000443721;ENST00000545165;ENST00000414469;ENST00000542779;ENST00000538182	T;T;T;T;T	0.41400	1.0;1.0;1.13;1.0;1.0	5.08	5.08	0.68730	Metallophosphoesterase domain (1);	0.055168	0.64402	D	0.000001	T	0.35248	0.0925	N	0.11023	0.085	0.80722	D	1	D;B	0.59357	0.985;0.272	P;B	0.53185	0.72;0.051	T	0.09952	-1.0651	10	0.08599	T	0.76	-41.4658	18.5263	0.90974	0.0:0.0:1.0:0.0	.	174;141	B7Z2S9;O15442	.;MPPD1_HUMAN	K	141;141;119;35;141;174	ENSP00000388137:E141K;ENSP00000400686:E141K;ENSP00000388245:E35K;ENSP00000444532:E141K;ENSP00000438335:E174K	ENSP00000388245:E35K	E	+	1	0	MPPED1	42200574	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.457000	0.97630	2.365000	0.80145	0.551000	0.68910	GAG	.		0.582	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318938.2	NM_001044370	
BMP15	9210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	50659359	50659359	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chrX:50659359G>T	ENST00000252677.3	+	2	931	c.931G>T	c.(931-933)Gct>Tct	p.A311S		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	311					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					CTGGATCATTGCTCCCCCTTT	0.493																																					p.A311S		.											.	.	.	0			c.G931T						.						158.0	132.0	141.0					X																	50659359		2203	4299	6502	SO:0001583	missense	9210	exon2			ATCATTGCTCCCC	AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.931G>T	X.37:g.50659359G>T	ENSP00000252677:p.Ala311Ser	45	0		20	16	NM_005448	Q17RM6|Q5JST1|Q9UMS1	Missense_Mutation	SNP	ENST00000252677.3	37	CCDS14334.1	.	.	.	.	.	.	.	.	.	.	g	15.20	2.764413	0.49574	.	.	ENSG00000130385	ENST00000252677	D	0.84298	-1.83	5.58	5.58	0.84498	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.91888	0.7432	M	0.74546	2.27	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.92282	0.5834	10	0.56958	D	0.05	.	15.8666	0.79069	0.0:0.0:1.0:0.0	.	311	O95972	BMP15_HUMAN	S	311	ENSP00000252677:A311S	ENSP00000252677:A311S	A	+	1	0	BMP15	50676099	1.000000	0.71417	1.000000	0.80357	0.124000	0.20399	4.670000	0.61583	2.346000	0.79739	0.594000	0.82650	GCT	.		0.493	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448	
PHKA1	5255	hgsc.bcm.edu	37	X	71825199	71825199	+	Missense_Mutation	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chrX:71825199C>A	ENST00000373542.4	-	25	2896	c.2737G>T	c.(2737-2739)Gct>Tct	p.A913S	PHKA1_ENST00000339490.3_Missense_Mutation_p.A913S|PHKA1_ENST00000541944.1_Missense_Mutation_p.A854S|PHKA1_ENST00000373539.3_Missense_Mutation_p.A913S|PHKA1_ENST00000373545.3_Missense_Mutation_p.A854S	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	913					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					AACATTTCAGCAAAGAGGCCA	0.413																																					p.A913S		.											.	.	.	0			c.G2737T						.						101.0	83.0	89.0					X																	71825199		2203	4299	6502	SO:0001583	missense	5255	exon25			TTTCAGCAAAGAG		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2737G>T	X.37:g.71825199C>A	ENSP00000362643:p.Ala913Ser	41	0		38	4	NM_002637	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	C	9.249	1.040167	0.19669	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14	5.8	5.8	0.92144	Glycoside hydrolase 15-related (1);	0.136089	0.64402	D	0.000002	T	0.68375	0.2994	N	0.01649	-0.78	0.30430	N	0.777222	B;B;B	0.21688	0.059;0.006;0.016	B;B;B	0.17433	0.018;0.006;0.015	T	0.58075	-0.7700	10	0.08599	T	0.76	-19.1792	16.2856	0.82720	0.0:1.0:0.0:0.0	.	854;913;913	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	S	854;913;854;913;913	ENSP00000362646:A854S;ENSP00000362643:A913S;ENSP00000441251:A854S;ENSP00000342469:A913S;ENSP00000362640:A913S	ENSP00000342469:A913S	A	-	1	0	PHKA1	71741924	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.749000	0.26320	2.450000	0.82876	0.594000	0.82650	GCT	.		0.413	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
PDE4DIP	9659	hgsc.bcm.edu	37	1	144931041	144931041	+	Intron	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:144931041C>T	ENST00000369354.3	-	6	826				PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.S223N|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.S223N|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000369349.3_Intron|PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000479408.2_Intron|PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000369351.3_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.S223I(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TACCTTTGTGCTTGCTAAGTC	0.562			T	PDGFRB	MPD																																p.S223N		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	PDE4DIP_ENST00000313431,colon,carcinoma,0,1	PDE4DIP_ENST00000313431	0	1	Substitution - Missense(1)	large_intestine(1)	c.G668A						.						91.0	93.0	92.0					1																	144931041		2203	4300	6503	SO:0001627	intron_variant	9659	exon1			TTTGTGCTTGCTA	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.637-7220G>A	1.37:g.144931041C>T		34	0		20	2	NM_001002811	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	C	5.744	0.321662	0.10845	.	.	ENSG00000178104	ENST00000369353;ENST00000313431;ENST00000529945	T;T	0.12147	2.71;2.71	4.96	0.91	0.19337	.	.	.	.	.	T	0.03011	0.0089	L	0.51422	1.61	0.09310	N	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.47058	-0.9146	9	0.15499	T	0.54	.	4.6215	0.12455	0.0:0.4999:0.1525:0.3476	.	223	Q5VU43-2	.	N	223	ENSP00000316434:S223N;ENSP00000433392:S223N	ENSP00000316434:S223N	S	-	2	0	PDE4DIP	143642398	0.000000	0.05858	0.003000	0.11579	0.985000	0.73830	0.219000	0.17641	-0.081000	0.12662	0.313000	0.20887	AGC	.		0.562	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	209113113	209113113	+	Missense_Mutation	SNP	G	G	A	rs121913499		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:209113113G>A	ENST00000415913.1	-	4	775	c.394C>T	c.(394-396)Cgt>Tgt	p.R132C	IDH1_ENST00000345146.2_Missense_Mutation_p.R132C|IDH1_ENST00000446179.1_Missense_Mutation_p.R132C	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132C(446)|p.R132G(125)|p.R132S(106)|p.G131_R132>VL(1)|p.R132V(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TAAGCATGACGACCTATGATG	0.398			Mis		gliobastoma																																p.R132C	Pancreas(158;264 1958 3300 35450 36047)	.		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	IDH1,NS,haematopoietic_neoplasm,0,788	IDH1	0	679	Substitution - Missense(678)|Complex - compound substitution(1)	haematopoietic_and_lymphoid_tissue(280)|central_nervous_system(181)|bone(177)|biliary_tract(21)|soft_tissue(12)|large_intestine(2)|skin(2)|autonomic_ganglia(1)|endometrium(1)|NS(1)|prostate(1)	c.C394T						.						81.0	74.0	76.0					2																	209113113		2203	4300	6503	SO:0001583	missense	3417	exon4			CATGACGACCTAT		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.394C>T	2.37:g.209113113G>A	ENSP00000390265:p.Arg132Cys	46	0		38	16	NM_005896	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550898	0.86127	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	5.57	5.57	0.84162	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.94049	0.8093	H	0.99379	4.54	0.80722	D	1	B	0.29862	0.259	B	0.31245	0.126	D	0.94048	0.7315	10	0.87932	D	0	-20.0399	19.5341	0.95242	0.0:0.0:1.0:0.0	.	132	O75874	IDHC_HUMAN	C	132	ENSP00000260985:R132C;ENSP00000410513:R132C;ENSP00000390265:R132C;ENSP00000391075:R132C	ENSP00000260985:R132C	R	-	1	0	IDH1	208821358	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.074000	0.76791	2.616000	0.88540	0.555000	0.69702	CGT	.		0.398	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1		
CSDE1	7812	hgsc.bcm.edu	37	1	115262239	115262239	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:115262239C>T	ENST00000358528.4	-	18	2603	c.2177G>A	c.(2176-2178)cGc>cAc	p.R726H	CSDE1_ENST00000438362.2_Missense_Mutation_p.R772H|CSDE1_ENST00000261443.5_Missense_Mutation_p.R695H|CSDE1_ENST00000534699.1_Missense_Mutation_p.R726H|NRAS_ENST00000369535.4_5'Flank|CSDE1_ENST00000339438.6_Missense_Mutation_p.R695H|CSDE1_ENST00000483407.1_5'Flank|CSDE1_ENST00000530886.1_Missense_Mutation_p.R596H|CSDE1_ENST00000369530.1_Missense_Mutation_p.R741H	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	726	CSD 9.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTGCCAGTGCGCTGATTAAG	0.453																																					p.R772H		.											CSDE1_ENST00000369530,NS,carcinoma,-1,2	CSDE1_ENST00000369530	-1	0			c.G2315A						.						144.0	144.0	144.0					1																	115262239		2203	4300	6503	SO:0001583	missense	7812	exon19			CCAGTGCGCTGAT		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.2177G>A	1.37:g.115262239C>T	ENSP00000351329:p.Arg726His	48	0		33	2	NM_001242891	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	ENST00000358528.4	37	CCDS30812.1	.	.	.	.	.	.	.	.	.	.	C	33	5.227100	0.95173	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699	.	.	.	6.17	4.33	0.51752	Cold shock protein (1);Nucleic acid-binding, OB-fold-like (1);Cold-shock protein, DNA-binding (1);Nucleic acid-binding, OB-fold (1);	0.092767	0.85682	D	0.000000	T	0.64811	0.2632	M	0.87328	2.875	0.80722	D	1	D;B;B	0.59767	0.986;0.003;0.003	P;B;B	0.49597	0.616;0.005;0.003	T	0.73219	-0.4052	9	0.87932	D	0	-1.1453	12.9091	0.58171	0.0:0.8703:0.0:0.1297	.	741;726;772	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	H	695;772;726;695;596;741;726	.	ENSP00000261443:R695H	R	-	2	0	CSDE1	115063762	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.433000	0.80362	0.955000	0.37878	0.655000	0.94253	CGC	.		0.453	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158	
ADAM9	8754	hgsc.bcm.edu	37	8	38854669	38854669	+	Silent	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr8:38854669G>T	ENST00000487273.2	+	1	165	c.87G>T	c.(85-87)gcG>gcT	p.A29A	TM2D2_ENST00000412303.1_5'Flank|ADAM9_ENST00000466936.1_Silent_p.A29A|ADAM9_ENST00000481513.1_Silent_p.A29A|TM2D2_ENST00000456397.2_5'Flank|TM2D2_ENST00000522434.1_5'Flank|TM2D2_ENST00000456845.2_5'Flank|TM2D2_ENST00000397070.2_5'Flank	NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	29				Missing (in Ref. 2; no nucleotide entry). {ECO:0000305}.	activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			TCCTCGGTGCGGCGCGGCCAG	0.716																																					p.A29A		.											.	.	.	0			c.G87T						.						41.0	38.0	39.0					8																	38854669		2197	4297	6494	SO:0001819	synonymous_variant	8754	exon1			CGGTGCGGCGCGG	U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.87G>T	8.37:g.38854669G>T		58	0		22	4	NM_003816	B7ZLN7|Q10718|Q8NFM6	Silent	SNP	ENST00000487273.2	37	CCDS6112.1																																																																																			.		0.716	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357291.2		
RXFP1	59350	hgsc.bcm.edu	37	4	159514595	159514595	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr4:159514595C>T	ENST00000307765.5	+	3	481	c.230C>T	c.(229-231)gCc>gTc	p.A77V	RXFP1_ENST00000343542.5_Missense_Mutation_p.A77V|RXFP1_ENST00000448688.2_5'UTR|RXFP1_ENST00000460056.2_5'UTR|RXFP1_ENST00000470033.1_Intron|RXFP1_ENST00000423548.1_Missense_Mutation_p.A77V	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	77					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)	p.A77D(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		AAATATTTTGCCAGTTACTAC	0.333																																					p.A77V		.											RXFP1,NS,carcinoma,0,1	RXFP1	0	1	Substitution - Missense(1)	lung(1)	c.C230T						.						117.0	100.0	105.0					4																	159514595		1818	4086	5904	SO:0001583	missense	59350	exon3			ATTTTGCCAGTTA	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.230C>T	4.37:g.159514595C>T	ENSP00000303248:p.Ala77Val	109	0		47	3	NM_021634	B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	37	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.972506	0.34848	.	.	ENSG00000171509	ENST00000307765;ENST00000423548;ENST00000343542	T;T;T	0.69435	-0.36;-0.36;-0.4	5.49	2.82	0.32997	.	0.833845	0.11215	N	0.587325	T	0.56232	0.1971	M	0.63428	1.95	0.43868	D	0.996474	B;B;B	0.16166	0.016;0.002;0.007	B;B;B	0.17098	0.017;0.006;0.01	T	0.44742	-0.9308	10	0.19590	T	0.45	.	1.7209	0.02911	0.1458:0.4791:0.1413:0.2337	.	77;77;77	B4DGP2;Q9HBX9-4;Q9HBX9	.;.;RXFP1_HUMAN	V	77	ENSP00000303248:A77V;ENSP00000405841:A77V;ENSP00000345889:A77V	ENSP00000303248:A77V	A	+	2	0	RXFP1	159734045	0.014000	0.17966	0.007000	0.13788	0.736000	0.42039	-0.129000	0.10515	0.279000	0.22186	0.557000	0.71058	GCC	.		0.333	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634	
TMC4	147798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54664886	54664886	+	Missense_Mutation	SNP	G	G	C			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:54664886G>C	ENST00000376591.4	-	12	1947	c.1816C>G	c.(1816-1818)Ctg>Gtg	p.L606V	TMC4_ENST00000416963.1_Missense_Mutation_p.L188V|LENG1_ENST00000222224.3_5'Flank|TMC4_ENST00000301187.4_Missense_Mutation_p.L600V	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	606					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTGTAAAGCAGGGGAACGCTG	0.617																																					p.L606V		.											.	.	.	0			c.C1816G						.						24.0	31.0	29.0					19																	54664886		2202	4300	6502	SO:0001583	missense	147798	exon12			AAAGCAGGGGAAC	AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.1816C>G	19.37:g.54664886G>C	ENSP00000365776:p.Leu606Val	56	0		38	16	NM_001145303	Q7Z5M3|Q8N5E4|Q8TBS7	Missense_Mutation	SNP	ENST00000376591.4	37	CCDS46174.1	.	.	.	.	.	.	.	.	.	.	G	1.625	-0.520402	0.04171	.	.	ENSG00000167608	ENST00000301187;ENST00000416963;ENST00000376591	T;T;T	0.70749	-0.47;-0.51;-0.46	4.73	3.68	0.42216	.	0.242001	0.38778	N	0.001577	T	0.34948	0.0915	N	0.00666	-1.275	0.26870	N	0.967763	B;B;B	0.09022	0.0;0.002;0.001	B;B;B	0.14578	0.001;0.011;0.005	T	0.21280	-1.0250	10	0.07813	T	0.8	-18.7383	12.3146	0.54948	0.0:0.8195:0.1805:0.0	.	606;600;188	Q7Z404;Q7Z404-1;Q7Z404-3	TMC4_HUMAN;.;.	V	600;188;606	ENSP00000301187:L600V;ENSP00000405023:L188V;ENSP00000365776:L606V	ENSP00000301187:L600V	L	-	1	2	TMC4	59356698	0.755000	0.28372	0.758000	0.31321	0.540000	0.34992	1.209000	0.32357	1.148000	0.42385	-0.321000	0.08615	CTG	.		0.617	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000156164.2		
ZSCAN18	65982	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	58596277	58596277	+	Silent	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:58596277G>A	ENST00000240727.6	-	7	1707	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	ZSCAN18_ENST00000421612.2_Silent_p.G300G|ZSCAN18_ENST00000600404.1_Silent_p.G492G|ZSCAN18_ENST00000601144.1_Silent_p.G436G	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	436					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GCTTCCGGCCGCCATGGCTGC	0.662																																					p.G492G		.											.	.	.	0			c.C1476T						.						20.0	17.0	18.0					19																	58596277		2194	4293	6487	SO:0001819	synonymous_variant	65982	exon7			CCGGCCGCCATGG	AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.1308C>T	19.37:g.58596277G>A		65	0		42	17	NM_001145542	B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Silent	SNP	ENST00000240727.6	37	CCDS12971.1																																																																																			.		0.662	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466706.1	NM_023926	
GNL3	26354	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	52727227	52727227	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr3:52727227G>T	ENST00000418458.1	+	11	1242	c.1069G>T	c.(1069-1071)Ggc>Tgc	p.G357C	SNORD69_ENST00000391150.1_RNA|SNORD19B_ENST00000459623.1_RNA|GNL3_ENST00000394799.2_Missense_Mutation_p.G345C|GLT8D1_ENST00000463827.1_5'Flank|SNORD19_ENST00000410413.1_RNA	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)	357	Intermediate. {ECO:0000250}.				cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		TACTGTCCCAGGCTACAGGAA	0.398																																					p.G357C		.											.	.	.	0			c.G1069T						.						94.0	102.0	100.0					3																	52727227		2203	4299	6502	SO:0001583	missense	26354	exon11			GTCCCAGGCTACA	AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.1069G>T	3.37:g.52727227G>T	ENSP00000395772:p.Gly357Cys	22	0		18	4	NM_014366	B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Missense_Mutation	SNP	ENST00000418458.1	37	CCDS2861.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.826126	0.50739	.	.	ENSG00000163938	ENST00000418458;ENST00000394799	T;T	0.29397	1.57;1.57	6.0	3.91	0.45181	.	0.457768	0.28301	N	0.015856	T	0.41811	0.1175	L	0.47716	1.5	0.25454	N	0.987971	P	0.47762	0.9	P	0.56343	0.796	T	0.21348	-1.0248	10	0.72032	D	0.01	.	12.144	0.54014	0.1557:0.0:0.8443:0.0	.	357	Q9BVP2	GNL3_HUMAN	C	357;345	ENSP00000395772:G357C;ENSP00000378278:G345C	ENSP00000378278:G345C	G	+	1	0	GNL3	52702267	1.000000	0.71417	0.162000	0.22713	0.284000	0.27059	3.932000	0.56537	1.547000	0.49401	0.655000	0.94253	GGC	.		0.398	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352032.1	NM_014366	
EPC1	80314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	32576188	32576188	+	Missense_Mutation	SNP	A	A	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr10:32576188A>T	ENST00000263062.8	-	7	1259	c.990T>A	c.(988-990)gaT>gaA	p.D330E	EPC1_ENST00000375110.2_Missense_Mutation_p.D280E|EPC1_ENST00000319778.6_Missense_Mutation_p.D330E	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	330					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				GTCGGATAAGATCGGCTTTAT	0.418																																					p.D330E		.											.	.	.	0			c.T990A						.						114.0	101.0	105.0					10																	32576188		2203	4300	6503	SO:0001583	missense	80314	exon7			GATAAGATCGGCT	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.990T>A	10.37:g.32576188A>T	ENSP00000263062:p.Asp330Glu	68	0		34	12	NM_025209	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	ENST00000263062.8	37	CCDS7172.1	.	.	.	.	.	.	.	.	.	.	A	11.40	1.626325	0.28978	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	T;T;T	0.64618	-0.11;-0.11;-0.11	5.7	3.34	0.38264	.	0.043389	0.85682	D	0.000000	T	0.38214	0.1032	N	0.08118	0	0.39900	D	0.97388	B;B;B;B	0.21147	0.005;0.009;0.004;0.052	B;B;B;B	0.25140	0.023;0.01;0.012;0.058	T	0.09552	-1.0669	10	0.21540	T	0.41	-7.7772	8.5775	0.33607	0.8017:0.1309:0.0674:0.0	.	330;280;330;330	B8XCX7;Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;.;EPC1_HUMAN	E	280;330;330	ENSP00000364251:D280E;ENSP00000318559:D330E;ENSP00000263062:D330E	ENSP00000263062:D330E	D	-	3	2	EPC1	32616194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.798000	0.38814	0.425000	0.26087	0.455000	0.32223	GAT	.		0.418	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		
PRLH	51052	hgsc.bcm.edu	37	2	238475690	238475690	+	Missense_Mutation	SNP	G	G	A	rs147108124		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:238475690G>A	ENST00000165524.1	+	2	136	c.136G>A	c.(136-138)Ggg>Agg	p.G46R		NM_015893.1	NP_056977.1	P81277	PRRP_HUMAN	prolactin releasing hormone	46					autonomic nervous system development (GO:0048483)|energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|lipid metabolic process (GO:0006629)|reduction of food intake in response to dietary excess (GO:0002023)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.G46R(1)		endometrium(1)|large_intestine(1)	2		Lung NSC(271;0.142)|all_lung(227;0.175)		Epithelial(121;8.28e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.03e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.19e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000329)|Lung(119;0.0106)|LUSC - Lung squamous cell carcinoma(224;0.0249)		CGCCAGTCGCGGGATCAGGCC	0.672													g|||	1	0.000199681	0.0008	0.0	5008	,	,		15849	0.0		0.0	False		,,,				2504	0.0				p.G46R		.											PRLH,NS,carcinoma,0,1	PRLH	0	1	Substitution - Missense(1)	endometrium(1)	c.G136A						.		ARG/GLY	0,4406		0,0,2203	69.0	56.0	60.0		136	-2.2	0.0	2	dbSNP_134	60	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PRLH	NM_015893.1	125	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	46/88	238475690	2,13004	2203	4300	6503	SO:0001583	missense	51052	exon2			AGTCGCGGGATCA	AB015419	CCDS2519.1	2q37.3	2013-02-28			ENSG00000071677	ENSG00000071677		"""Endogenous ligands"""	17945	protein-coding gene	gene with protein product		602663				9607765	Standard	NM_015893		Approved	PRH	uc010znl.2	P81277	OTTHUMG00000133296	ENST00000165524.1:c.136G>A	2.37:g.238475690G>A	ENSP00000165524:p.Gly46Arg	40	0		41	2	NM_015893		Missense_Mutation	SNP	ENST00000165524.1	37	CCDS2519.1	.	.	.	.	.	.	.	.	.	.	g	3.784	-0.045040	0.07452	0.0	2.33E-4	ENSG00000071677	ENST00000165524	.	.	.	4.27	-2.21	0.06973	.	0.641577	0.12186	N	0.491683	T	0.26593	0.0650	.	.	.	0.09310	N	1	B	0.24768	0.111	B	0.18263	0.021	T	0.10636	-1.0621	8	0.38643	T	0.18	-7.8534	9.2435	0.37511	0.4448:0.0:0.5552:0.0	.	46	P81277	PRRP_HUMAN	R	46	.	ENSP00000165524:G46R	G	+	1	0	PRLH	238140429	0.266000	0.24112	0.001000	0.08648	0.087000	0.18053	0.377000	0.20552	-0.832000	0.04251	-0.461000	0.05368	GGG	0.000		0.672	PRLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257081.1	NM_015893	
DENND3	22898	hgsc.bcm.edu;ucsc.edu	37	8	142160984	142160984	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr8:142160984G>T	ENST00000262585.2	+	6	825	c.547G>T	c.(547-549)Gaa>Taa	p.E183*	DENND3_ENST00000424248.1_Nonsense_Mutation_p.E183*|DENND3_ENST00000519811.1_Nonsense_Mutation_p.E263*	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	183	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			AGCAGACCCCGAAAGCCCCAT	0.597																																					p.E183X		.											.	.	.	0			c.G547T						.						123.0	116.0	119.0					8																	142160984		2203	4300	6503	SO:0001587	stop_gained	22898	exon6			GACCCCGAAAGCC	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.547G>T	8.37:g.142160984G>T	ENSP00000262585:p.Glu183*	68	0		43	4	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Nonsense_Mutation	SNP	ENST00000262585.2	37	CCDS34947.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.93|12.93	2.086952|2.086952	0.36855|0.36855	.|.	.|.	ENSG00000105339|ENSG00000105339	ENST00000262585;ENST00000424248;ENST00000519811;ENST00000520986;ENST00000523058|ENST00000518668	.|.	.|.	.|.	5.4|5.4	4.51|4.51	0.55191|0.55191	.|.	0.295540|.	0.40385|.	N|.	0.001110|.	.|T	.|0.71459	.|0.3342	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74639	.|-0.3598	.|3	0.48119|.	T|.	0.1|.	-10.2397|-10.2397	16.383|16.383	0.83481|0.83481	0.0:0.1322:0.8678:0.0|0.0:0.1322:0.8678:0.0	.|.	.|.	.|.	.|.	X|L	183;183;263;185;284|239	.|.	ENSP00000262585:E183X|.	E|R	+|+	1|2	0|0	DENND3|DENND3	142230166|142230166	1.000000|1.000000	0.71417|0.71417	0.097000|0.097000	0.21041|0.21041	0.086000|0.086000	0.17979|0.17979	6.662000|6.662000	0.74426|0.74426	1.389000|1.389000	0.46526|0.46526	0.561000|0.561000	0.74099|0.74099	GAA|CGA	.		0.597	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
GBP4	115361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	89650997	89650997	+	Silent	SNP	A	A	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:89650997A>T	ENST00000355754.6	-	11	1960	c.1863T>A	c.(1861-1863)acT>acA	p.T621T	GBP4_ENST00000471938.1_5'UTR	NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	621						cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		CCCCAGGTAGAGTGACAATCA	0.358																																					p.T621T		.											.	.	.	0			c.T1863A						.						125.0	111.0	116.0					1																	89650997		2203	4300	6503	SO:0001819	synonymous_variant	115361	exon11			AGGTAGAGTGACA	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.1863T>A	1.37:g.89650997A>T		68	0		54	21	NM_052941	B2R630|Q05D63|Q6NSL0|Q86T99	Silent	SNP	ENST00000355754.6	37	CCDS721.1																																																																																			.		0.358	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941	
RP1	6101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	55542175	55542175	+	Silent	SNP	T	T	C			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr8:55542175T>C	ENST00000220676.1	+	4	5881	c.5733T>C	c.(5731-5733)taT>taC	p.Y1911Y		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1911					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ATAAACTGTATGCTCTTTGTG	0.393																																					p.Y1911Y	Colon(91;1014 1389 7634 14542 40420)	.											.	.	.	0			c.T5733C						.						95.0	94.0	94.0					8																	55542175		2203	4300	6503	SO:0001819	synonymous_variant	6101	exon4			ACTGTATGCTCTT	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5733T>C	8.37:g.55542175T>C		41	0		27	10	NM_006269		Silent	SNP	ENST00000220676.1	37	CCDS6160.1																																																																																			.		0.393	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
CDKL5	6792	hgsc.bcm.edu;bcgsc.ca	37	X	18638035	18638035	+	Missense_Mutation	SNP	G	G	T	rs587783122		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chrX:18638035G>T	ENST00000379989.3	+	17	2610	c.2325G>T	c.(2323-2325)gaG>gaT	p.E775D	CDKL5_ENST00000379996.3_Missense_Mutation_p.E775D|CDKL5_ENST00000463994.1_3'UTR	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	775					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					AGGAAAAAGAGAAGCAAGGAT	0.289																																					p.E775D		.											.	.	.	0			c.G2325T	GRCh37	CD083285	CDKL5	D		.						36.0	36.0	36.0					X																	18638035		2202	4294	6496	SO:0001583	missense	6792	exon16			AAAAGAGAAGCAA	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2325G>T	X.37:g.18638035G>T	ENSP00000369325:p.Glu775Asp	126	0		80	4	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.046619	0.36085	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.79653	-1.29;-1.29	5.43	1.3	0.21679	.	0.043233	0.85682	D	0.000000	T	0.81259	0.4785	L	0.32530	0.975	0.28865	N	0.895316	D	0.69078	0.997	D	0.72625	0.978	T	0.74438	-0.3665	10	0.72032	D	0.01	-23.0158	8.7847	0.34814	0.4388:0.0:0.5612:0.0	.	775	O76039	CDKL5_HUMAN	D	775	ENSP00000369332:E775D;ENSP00000369325:E775D	ENSP00000369325:E775D	E	+	3	2	CDKL5	18547956	1.000000	0.71417	0.998000	0.56505	0.153000	0.21895	1.721000	0.38032	0.127000	0.18452	0.594000	0.82650	GAG	.		0.289	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
Unknown	0	hgsc.bcm.edu	37	16	33537355	33537355	+	IGR	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr16:33537355C>T								BMS1P8 (38263 upstream) : IGHV3OR16-12 (67875 downstream)																							CAAAAATGAGCACGTTCATTT	0.378																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	100873777	.			AATGAGCACGTTC																													16.37:g.33537355C>T		122	0		96	8	.		RNA	SNP		37																																																																																				.	0	0.378								
SLC4A9	83697	hgsc.bcm.edu	37	5	139751848	139751848	+	Missense_Mutation	SNP	C	C	G			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr5:139751848C>G	ENST00000230993.6	+	20	2799	c.2764C>G	c.(2764-2766)Cga>Gga	p.R922G	SLC4A9_ENST00000507527.1_Missense_Mutation_p.R922G|SLC4A9_ENST00000506757.2_Missense_Mutation_p.R898G|SLC4A9_ENST00000506545.1_Missense_Mutation_p.R835G|SLC4A9_ENST00000432095.2_Missense_Mutation_p.R884G|CTC-329D1.2_ENST00000507521.1_RNA	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	922	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.R922*(2)|p.R896*(1)		endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGGGGGTCCGAAAGGCCCT	0.542																																					p.R922G		.											SLC4A9_ENST00000506757,NS,carcinoma,0,2	SLC4A9_ENST00000506757	0	3	Substitution - Nonsense(3)	lung(3)	c.C2764G						.						27.0	28.0	28.0					5																	139751848		1882	4108	5990	SO:0001583	missense	83697	exon20			GGGGTCCGAAAGG	AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.2764C>G	5.37:g.139751848C>G	ENSP00000230993:p.Arg922Gly	28	0		23	2	NM_001258428	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Missense_Mutation	SNP	ENST00000230993.6	37	CCDS58973.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.660244	0.67586	.	.	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59	4.99	4.09	0.47781	.	0.000000	0.52532	D	0.000069	D	0.91633	0.7356	M	0.87758	2.905	0.58432	D	0.999998	D;D;D;D	0.89917	0.995;1.0;1.0;1.0	D;D;D;D	0.91635	0.968;0.997;0.998;0.999	D	0.92986	0.6410	10	0.87932	D	0	.	14.2128	0.65776	0.1506:0.8494:0.0:0.0	.	835;922;884;898	E9PDK1;Q96Q91;Q96Q91-2;Q96Q91-3	.;B3A4_HUMAN;.;.	G	922;898;884;835;922	ENSP00000230993:R922G;ENSP00000424424:R898G;ENSP00000410056:R884G;ENSP00000422855:R835G;ENSP00000427661:R922G	ENSP00000230993:R922G	R	+	1	2	SLC4A9	139732032	0.487000	0.25988	1.000000	0.80357	0.997000	0.91878	0.310000	0.19356	1.275000	0.44379	0.557000	0.71058	CGA	.		0.542	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372823.1	NM_031467	
TAS2R20	259295	hgsc.bcm.edu	37	12	11150167	11150167	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr12:11150167C>T	ENST00000538986.1	-	1	307	c.308G>A	c.(307-309)aGc>aAc	p.S103N	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	103					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S103I(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						ATAAAATATGCTGAGGCTAGT	0.358																																					p.S103N		.											TAS2R20,NS,carcinoma,0,1	TAS2R20	0	1	Substitution - Missense(1)	lung(1)	c.G308A						.						81.0	87.0	85.0					12																	11150167		2203	4300	6503	SO:0001583	missense	259295	exon1			AATATGCTGAGGC	AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.308G>A	12.37:g.11150167C>T	ENSP00000441624:p.Ser103Asn	53	0		38	2	NM_176889	P59549|Q2HIZ4|Q496D8|Q645X9	Missense_Mutation	SNP	ENST00000538986.1	37	CCDS8639.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.442323	0.25987	.	.	ENSG00000255837	ENST00000538986	T	0.52526	0.66	2.77	2.77	0.32553	.	0.295625	0.26796	U	0.022445	T	0.62514	0.2434	M	0.78344	2.41	0.21416	N	0.999699	D	0.58620	0.983	P	0.59357	0.856	T	0.55522	-0.8128	10	0.87932	D	0	.	11.2764	0.49170	0.0:1.0:0.0:0.0	.	103	P59543	T2R20_HUMAN	N	103	ENSP00000441624:S103N	ENSP00000441624:S103N	S	-	2	0	TAS2R20	11041434	0.161000	0.22892	0.047000	0.18901	0.063000	0.16089	0.558000	0.23469	1.561000	0.49584	0.591000	0.81541	AGC	.		0.358	TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370130.2	NM_176889	
TMEM216	51259	hgsc.bcm.edu	37	11	61161386	61161386	+	Missense_Mutation	SNP	T	T	C			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr11:61161386T>C	ENST00000515837.2	+	3	1112	c.167T>C	c.(166-168)cTa>cCa	p.L56P	TMEM216_ENST00000334888.5_Missense_Mutation_p.L56P|TMEM216_ENST00000398979.3_5'UTR			Q9P0N5	TM216_HUMAN	transmembrane protein 216	56					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				endometrium(1)|large_intestine(2)|lung(1)|prostate(2)	6						ACAGCTAACCTAGTACTGGAT	0.438																																					p.L56P		.											.	.	.	0			c.T167C						.						159.0	158.0	158.0					11																	61161386		1958	4145	6103	SO:0001583	missense	51259	exon3			CTAACCTAGTACT		CCDS53640.1	11q13.1	2014-09-17			ENSG00000187049	ENSG00000187049			25018	protein-coding gene	gene with protein product		613277	"""cerebello-oculo-renal syndrome 2"", ""Meckel syndrome, type 2"""	CORS2, MKS2		11042152, 20036350, 20512146	Standard	NM_016499		Approved	MGC13379, HSPC244, JBTS2	uc021qkf.1	Q9P0N5		ENST00000515837.2:c.167T>C	11.37:g.61161386T>C	ENSP00000440638:p.Leu56Pro	71	0		51	4	NM_001173990	A8MZ23|B7Z8N1	Missense_Mutation	SNP	ENST00000515837.2	37	CCDS53640.1	.	.	.	.	.	.	.	.	.	.	T	16.09	3.024169	0.54683	.	.	ENSG00000187049	ENST00000515837;ENST00000334888	D;D	0.89875	-2.58;-2.58	5.95	5.95	0.96441	.	.	.	.	.	D	0.94437	0.8210	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.94863	0.8023	9	0.66056	D	0.02	.	13.9469	0.64091	0.0:0.0:0.0:1.0	.	49	Q9P0N5	TM216_HUMAN	P	56	ENSP00000440638:L56P;ENSP00000334844:L56P	ENSP00000334844:L56P	L	+	2	0	TMEM216	60917962	0.995000	0.38212	0.474000	0.27266	0.126000	0.20510	5.347000	0.65998	2.279000	0.76181	0.533000	0.62120	CTA	.		0.438	TMEM216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398430.1	NM_016499	
BIRC6	57448	hgsc.bcm.edu	37	2	32725169	32725169	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:32725169G>T	ENST00000421745.2	+	46	9158	c.9024G>T	c.(9022-9024)atG>atT	p.M3008I		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3008					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)	p.M2980I(1)		NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CCATGGCAATGATAATTGGTA	0.348																																					p.M3008I	Pancreas(94;175 1509 16028 18060 45422)	.											BIRC6_ENST00000421745,colon,carcinoma,+2,1	BIRC6_ENST00000421745	+2	1	Substitution - Missense(1)	skin(1)	c.G9024T						.						68.0	72.0	71.0					2																	32725169		2150	4281	6431	SO:0001583	missense	57448	exon46			GGCAATGATAATT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.9024G>T	2.37:g.32725169G>T	ENSP00000393596:p.Met3008Ile	80	0		40	2	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	19.86	3.904797	0.72868	.	.	ENSG00000115760	ENST00000421745	T	0.76709	-1.04	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.85843	0.5791	L	0.61218	1.895	0.80722	D	1	P	0.45126	0.851	P	0.58391	0.838	D	0.87007	0.2120	10	0.87932	D	0	.	18.8672	0.92298	0.0:0.0:1.0:0.0	.	3008	Q9NR09	BIRC6_HUMAN	I	3008	ENSP00000393596:M3008I	ENSP00000393596:M3008I	M	+	3	0	BIRC6	32578673	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.030000	0.88816	2.444000	0.82710	0.655000	0.94253	ATG	.		0.348	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
SOCS4	122809	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	55510680	55510680	+	Silent	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr14:55510680C>T	ENST00000395472.2	+	2	1253	c.921C>T	c.(919-921)acC>acT	p.T307T	SOCS4_ENST00000555846.1_Silent_p.T307T|SOCS4_ENST00000339298.2_Silent_p.T307T	NM_080867.2|NM_199421.1	NP_543143.1|NP_955453.1	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	307	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				intracellular signal transduction (GO:0035556)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)					central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	14						CAGAGGGTACCTTTTTACTTC	0.423																																					p.T307T		.											.	.	.	0			c.C921T						.						121.0	121.0	121.0					14																	55510680		2203	4300	6503	SO:0001819	synonymous_variant	122809	exon2			GGGTACCTTTTTA	AF424815	CCDS9722.1	14q22.1	2013-02-14	2004-02-25	2004-02-27	ENSG00000180008	ENSG00000180008		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19392	protein-coding gene	gene with protein product			"""suppressor of cytokine signaling 7"""	SOCS7		12076535, 10500304	Standard	NM_080867		Approved		uc001xbp.3	Q8WXH5	OTTHUMG00000140311	ENST00000395472.2:c.921C>T	14.37:g.55510680C>T		68	0		52	23	NM_080867		Silent	SNP	ENST00000395472.2	37	CCDS9722.1																																																																																			.		0.423	SOCS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276910.1		
DMXL2	23312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	51766722	51766722	+	Silent	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr15:51766722C>T	ENST00000251076.5	-	28	7316	c.7029G>A	c.(7027-7029)ttG>ttA	p.L2343L	DMXL2_ENST00000543779.2_Silent_p.L2344L|RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000449909.3_Silent_p.L1707L	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2343						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CTTCACATAGCAAAATGTTCA	0.378																																					p.L2344L		.											.	.	.	0			c.G7032A						.						83.0	80.0	81.0					15																	51766722		2196	4293	6489	SO:0001819	synonymous_variant	23312	exon28			ACATAGCAAAATG	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7029G>A	15.37:g.51766722C>T		59	0		47	15	NM_001174116	B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	ENST00000251076.5	37	CCDS10141.1																																																																																			.		0.378	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
SEMA3D	223117	hgsc.bcm.edu	37	7	84727276	84727276	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr7:84727276G>T	ENST00000284136.6	-	2	200	c.157C>A	c.(157-159)Ctg>Atg	p.L53M	SEMA3D_ENST00000444867.1_Missense_Mutation_p.L53M	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	53	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TTTGAAAGCAGCAAGTCTATG	0.373																																					p.L53M	Ovarian(63;442 1191 17318 29975 31528)	.											SEMA3D,right_lower_lobe,carcinoma,0,1	SEMA3D	0	0			c.C157A						.						61.0	65.0	63.0					7																	84727276		2203	4300	6503	SO:0001583	missense	223117	exon2			AAAGCAGCAAGTC	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.157C>A	7.37:g.84727276G>T	ENSP00000284136:p.Leu53Met	48	0		26	2	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.045848	0.36085	.	.	ENSG00000153993	ENST00000284136;ENST00000444867	T;T	0.25085	1.82;1.82	5.55	4.67	0.58626	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.068958	0.64402	D	0.000012	T	0.38214	0.1032	L	0.45228	1.405	0.44643	D	0.997622	D;D	0.63880	0.993;0.96	P;P	0.62813	0.907;0.708	T	0.09292	-1.0681	10	0.45353	T	0.12	.	11.7154	0.51650	0.1427:0.0:0.8573:0.0	.	53;53	C9JYT6;O95025	.;SEM3D_HUMAN	M	53	ENSP00000284136:L53M;ENSP00000401366:L53M	ENSP00000284136:L53M	L	-	1	2	SEMA3D	84565212	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.046000	0.49846	1.476000	0.48215	0.585000	0.79938	CTG	.		0.373	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
FOXP1	27086	hgsc.bcm.edu	37	3	71179760	71179760	+	Intron	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr3:71179760G>T	ENST00000318789.4	-	7	706				FOXP1_ENST00000493089.1_Intron|FOXP1_ENST00000484350.1_Intron|FOXP1_ENST00000468577.1_Intron|FOXP1_ENST00000498215.1_Intron|FOXP1_ENST00000475937.1_Intron|FOXP1_ENST00000491238.1_Nonsense_Mutation_p.Y25*	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		TTGCCGAGTGGTAAAAAAGAT	0.502			T	PAX5	ALL																																p.Y25X		.		Dom	yes		3	3p14.1	27086	forkhead box P1		L	.	.	.	0			c.C75A						.						62.0	59.0	60.0					3																	71179760		876	1991	2867	SO:0001627	intron_variant	27086	exon1			CGAGTGGTAAAAA	AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.181-17972C>A	3.37:g.71179760G>T		28	0		30	6	NM_001244815	A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Nonsense_Mutation	SNP	ENST00000318789.4	37	CCDS2914.1	.	.	.	.	.	.	.	.	.	.	G	39	7.529778	0.98339	.	.	ENSG00000114861	ENST00000491238	.	.	.	5.83	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1306	0.42676	0.0709:0.138:0.791:0.0	.	.	.	.	X	25	.	.	Y	-	3	2	FOXP1	71262450	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.477000	0.66799	1.393000	0.46605	0.655000	0.94253	TAC	.		0.502	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352250.1	NM_032682	
TXNDC11	51061	hgsc.bcm.edu	37	16	11785750	11785750	+	Nonsense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr16:11785750C>T	ENST00000356957.3	-	9	1484	c.1377G>A	c.(1375-1377)tgG>tgA	p.W459*	TXNDC11_ENST00000283033.5_Nonsense_Mutation_p.W432*|TXNDC11_ENST00000570917.1_5'Flank			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	459					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						AGAAGGAGTGCCACTGGGGCA	0.632																																					p.W432X		.											.	.	.	0			c.G1296A						.						46.0	42.0	44.0					16																	11785750		2197	4300	6497	SO:0001587	stop_gained	51061	exon8			GGAGTGCCACTGG	BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.1377G>A	16.37:g.11785750C>T	ENSP00000349439:p.Trp459*	30	0		29	4	NM_015914	O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Nonsense_Mutation	SNP	ENST00000356957.3	37		.	.	.	.	.	.	.	.	.	.	C	37	6.472741	0.97594	.	.	ENSG00000153066	ENST00000356957;ENST00000283033	.	.	.	5.53	3.49	0.39957	.	0.286198	0.32258	N	0.006356	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.5302	8.5294	0.33324	0.1511:0.7651:0.0:0.0838	.	.	.	.	X	459;432	.	ENSP00000283033:W432X	W	-	3	0	TXNDC11	11693251	1.000000	0.71417	0.968000	0.41197	0.987000	0.75469	2.031000	0.41117	0.611000	0.30052	0.561000	0.74099	TGG	.		0.632	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000437057.1	NM_015914	
TCF7L2	6934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	114901068	114901068	+	Silent	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr10:114901068C>A	ENST00000355995.4	+	6	1185	c.678C>A	c.(676-678)ccC>ccA	p.P226P	TCF7L2_ENST00000534894.1_Silent_p.P226P|TCF7L2_ENST00000369397.4_Silent_p.P203P|TCF7L2_ENST00000543371.1_Silent_p.P226P|TCF7L2_ENST00000542695.1_5'UTR|TCF7L2_ENST00000349937.2_Silent_p.P226P|TCF7L2_ENST00000545257.1_Silent_p.P226P|TCF7L2_ENST00000369389.1_5'Flank|TCF7L2_ENST00000538897.1_Silent_p.P226P|TCF7L2_ENST00000352065.5_Silent_p.P203P|TCF7L2_ENST00000369395.1_Silent_p.P251P|TCF7L2_ENST00000355717.4_Silent_p.P250P|TCF7L2_ENST00000536810.1_Silent_p.P226P			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	226	Mediates interaction with MAD2L2.|Pro-rich.			P -> L (in Ref. 4; ADK35180). {ECO:0000305}.	blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		ACGTAGACCCCAAAACAGGTA	0.597			T	VTI1A	colorectal																																p.P250P		.		Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	.	.	0			c.C750A						.						106.0	91.0	96.0					10																	114901068		2203	4300	6503	SO:0001819	synonymous_variant	6934	exon6			AGACCCCAAAACA	X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.678C>A	10.37:g.114901068C>A		62	0		46	18	NM_001146283	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Silent	SNP	ENST00000355995.4	37																																																																																				.		0.597	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
INSM2	84684	hgsc.bcm.edu	37	14	36004201	36004201	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr14:36004201C>T	ENST00000307169.3	+	1	954	c.743C>T	c.(742-744)gCg>gTg	p.A248V		NM_032594.3	NP_115983.3	Q96T92	INSM2_HUMAN	insulinoma-associated 2	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A248E(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	10	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		GAGCCCGGAGCGCCGTCCCGG	0.642																																					p.A248V		.											INSM2,NS,carcinoma,0,1	INSM2	0	1	Substitution - Missense(1)	lung(1)	c.C743T						.																																			SO:0001583	missense	84684	exon1			CCGGAGCGCCGTC	AF260323	CCDS9657.1	14q13.1	2013-01-08			ENSG00000168348	ENSG00000168348		"""Zinc fingers, C2H2-type"""	17539	protein-coding gene	gene with protein product	"""mlt 1"""	614027					Standard	NM_032594		Approved	IA-6	uc001wth.1	Q96T92	OTTHUMG00000140223	ENST00000307169.3:c.743C>T	14.37:g.36004201C>T	ENSP00000306523:p.Ala248Val	57	0		34	2	NM_032594	A1L432|J9Y024|Q8N8K7|Q96Q84	Missense_Mutation	SNP	ENST00000307169.3	37	CCDS9657.1	.	.	.	.	.	.	.	.	.	.	C	5.156	0.214355	0.09810	.	.	ENSG00000168348	ENST00000307169	T	0.00902	5.56	4.32	4.32	0.51571	.	.	.	.	.	T	0.01092	0.0036	L	0.38175	1.15	0.09310	N	1	B	0.18610	0.029	B	0.11329	0.006	T	0.45425	-0.9262	9	0.38643	T	0.18	-17.7356	8.0317	0.30470	0.0:0.8909:0.0:0.1091	.	248	Q96T92	INSM2_HUMAN	V	248	ENSP00000306523:A248V	ENSP00000306523:A248V	A	+	2	0	INSM2	35073952	0.000000	0.05858	0.092000	0.20876	0.220000	0.24768	0.411000	0.21115	2.212000	0.71576	0.563000	0.77884	GCG	.		0.642	INSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276686.1		
ESRP1	54845	hgsc.bcm.edu;bcgsc.ca	37	8	95655629	95655629	+	Silent	SNP	T	T	C			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr8:95655629T>C	ENST00000433389.2	+	3	550	c.360T>C	c.(358-360)ccT>ccC	p.P120P	ESRP1_ENST00000358397.5_Silent_p.P120P|ESRP1_ENST00000454170.2_Silent_p.P120P|ESRP1_ENST00000423620.2_Silent_p.P120P	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	120					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						TCCTGCATCCTGAGGCTTCCA	0.428																																					p.P120P		.											.	.	.	0			c.T360C						.						81.0	78.0	79.0					8																	95655629		1897	4112	6009	SO:0001819	synonymous_variant	54845	exon3			GCATCCTGAGGCT	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.360T>C	8.37:g.95655629T>C		96	0		64	4	NM_001122827	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Silent	SNP	ENST00000433389.2	37	CCDS47897.1																																																																																			.		0.428	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
SYN3	8224	hgsc.bcm.edu	37	22	33376642	33376642	+	Silent	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr22:33376642G>T	ENST00000358763.2	-	3	599	c.357C>A	c.(355-357)atC>atA	p.I119I	SYN3_ENST00000332840.5_Silent_p.I119I	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III	119	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						GCTCCACTCGGATCTCAATCT	0.473																																					p.I119I		.											SYN3,caecum,carcinoma,0,1	SYN3	0	0			c.C357A						.						334.0	288.0	303.0					22																	33376642		2203	4300	6503	SO:0001819	synonymous_variant	8224	exon3			CACTCGGATCTCA	AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.357C>A	22.37:g.33376642G>T		57	0		28	3	NM_001135774	B1B1F9	Silent	SNP	ENST00000358763.2	37	CCDS13908.1																																																																																			.		0.473	SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075892.4		
RUNDC3A	10900	hgsc.bcm.edu	37	17	42392345	42392345	+	Silent	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr17:42392345C>T	ENST00000426726.3	+	6	871	c.597C>T	c.(595-597)atC>atT	p.I199I	RUNDC3A_ENST00000590941.1_Silent_p.I194I|RUNDC3A_ENST00000225441.7_Silent_p.I199I|AC003102.3_ENST00000588097.1_RNA	NM_001144825.1	NP_001138297.1	Q59EK9	RUN3A_HUMAN	RUN domain containing 3A	199	Interaction with RAP2A. {ECO:0000250}.				positive regulation of cGMP biosynthetic process (GO:0030828)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanylate cyclase activator activity (GO:0030250)|small GTPase regulator activity (GO:0005083)			large_intestine(1)|lung(1)|ovary(2)	4		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CCGTGGTCATCGATTACACGC	0.647																																					p.I199I	Pancreas(82;1061 1416 11136 20771 23901)	.											RUNDC3A_ENST00000225441,NS,carcinoma,0,2	RUNDC3A_ENST00000225441	0	0			c.C597T						.						70.0	76.0	74.0					17																	42392345		1960	4137	6097	SO:0001819	synonymous_variant	10900	exon6			GGTCATCGATTAC	AF055026	CCDS45698.1, CCDS45699.1, CCDS59294.1	17q21.31	2008-02-05			ENSG00000108309	ENSG00000108309			16984	protein-coding gene	gene with protein product		605448				9523700	Standard	NM_006695		Approved	RPIP8, RAP2IP	uc002igl.4	Q59EK9	OTTHUMG00000169259	ENST00000426726.3:c.597C>T	17.37:g.42392345C>T		75	0		48	2	NM_001144825	B2R974|O15483|O60651|Q7Z3S2|Q9UF50	Silent	SNP	ENST00000426726.3	37	CCDS45698.1																																																																																			.		0.647	RUNDC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403173.2	NM_006695	
CSF1	1435	hgsc.bcm.edu	37	1	110456921	110456921	+	Missense_Mutation	SNP	C	C	A	rs202209718		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:110456921C>A	ENST00000329608.6	+	2	471	c.80C>A	c.(79-81)gCg>gAg	p.A27E	CSF1_ENST00000344188.5_Missense_Mutation_p.A27E|CSF1_ENST00000369801.1_Missense_Mutation_p.A27E|CSF1_ENST00000369802.3_Missense_Mutation_p.A27E|CSF1_ENST00000420111.2_Missense_Mutation_p.A27E	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	27					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGTCTCCTGGCGAGCAGGAGT	0.587																																					p.A27E		.											CSF1,NS,carcinoma,0,1	CSF1	0	0			c.C80A						.						170.0	156.0	161.0					1																	110456921		2203	4300	6503	SO:0001583	missense	1435	exon2			TCCTGGCGAGCAG	BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.80C>A	1.37:g.110456921C>A	ENSP00000327513:p.Ala27Glu	37	0		29	2	NM_172210	A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Missense_Mutation	SNP	ENST00000329608.6	37	CCDS816.1	.	.	.	.	.	.	.	.	.	.	C	11.27	1.589847	0.28357	.	.	ENSG00000184371	ENST00000527192;ENST00000357302;ENST00000344188;ENST00000329608;ENST00000369802;ENST00000420111;ENST00000369801	T;T;T;T;T;T;T	0.12039	2.72;2.72;2.72;2.72;2.72;2.72;2.72	5.1	-0.00881	0.14003	.	0.554702	0.16637	N	0.205801	T	0.01940	0.0061	N	0.08118	0	0.22684	N	0.998856	B;B;B	0.18968	0.032;0.031;0.025	B;B;B	0.19148	0.024;0.013;0.02	T	0.43798	-0.9369	10	0.54805	T	0.06	.	7.8602	0.29506	0.0:0.3634:0.0:0.6366	.	27;27;27	P09603-3;P09603;P09603-2	.;CSF1_HUMAN;.	E	34;27;27;27;27;27;27	ENSP00000434527:A34E;ENSP00000349854:A27E;ENSP00000342718:A27E;ENSP00000327513:A27E;ENSP00000358817:A27E;ENSP00000407317:A27E;ENSP00000358816:A27E	ENSP00000327513:A27E	A	+	2	0	CSF1	110258444	1.000000	0.71417	0.988000	0.46212	0.530000	0.34684	0.192000	0.17096	-0.176000	0.10707	-0.331000	0.08364	GCG	.		0.587	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032208.1	NM_000757	
ADAM7	8756	hgsc.bcm.edu	37	8	24300078	24300078	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr8:24300078G>T	ENST00000175238.6	+	2	228	c.145G>T	c.(145-147)Gat>Tat	p.D49Y	RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM7_ENST00000380789.1_Missense_Mutation_p.D49Y|ADAM7_ENST00000441335.2_Missense_Mutation_p.D49Y	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		CACCCATGATGATGACATACT	0.423																																					p.D49Y		.											ADAM7,colon,carcinoma,0,1	ADAM7	0	0			c.G145T						.						181.0	169.0	173.0					8																	24300078		2203	4300	6503	SO:0001583	missense	8756	exon2			CATGATGATGACA	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.145G>T	8.37:g.24300078G>T	ENSP00000175238:p.Asp49Tyr	85	0		59	3	NM_003817	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	ENST00000175238.6	37	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	G	7.050	0.564286	0.13498	.	.	ENSG00000069206	ENST00000441335;ENST00000175238;ENST00000380789	T;T;T	0.29142	2.33;1.58;1.58	4.33	-4.81	0.03180	Peptidase M12B, propeptide (1);	1.596890	0.03673	N	0.244360	T	0.13543	0.0328	N	0.11560	0.145	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.14476	-1.0471	10	0.51188	T	0.08	.	0.8367	0.01141	0.158:0.2512:0.2867:0.3042	.	49;49	Q9H2U9;Q6PEJ6	ADAM7_HUMAN;.	Y	49	ENSP00000393073:D49Y;ENSP00000175238:D49Y;ENSP00000370166:D49Y	ENSP00000175238:D49Y	D	+	1	0	ADAM7	24356023	0.000000	0.05858	0.000000	0.03702	0.621000	0.37620	-0.680000	0.05197	-0.888000	0.03956	0.557000	0.71058	GAT	.		0.423	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	
GPR124	25960	hgsc.bcm.edu	37	8	37692771	37692771	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr8:37692771G>T	ENST00000412232.2	+	12	1701	c.1688G>T	c.(1687-1689)aGg>aTg	p.R563M	GPR124_ENST00000315215.7_Intron	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	563					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R556K(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCCTTCCAGAGGAGGGAGGGA	0.672																																					p.R563M		.											GPR124,NS,carcinoma,0,1	GPR124	0	1	Substitution - Missense(1)	lung(1)	c.G1688T						.						47.0	47.0	47.0					8																	37692771		2203	4300	6503	SO:0001583	missense	25960	exon12			TCCAGAGGAGGGA	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1688G>T	8.37:g.37692771G>T	ENSP00000406367:p.Arg563Met	73	0		47	2	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268364	0.80469	.	.	ENSG00000020181	ENST00000416514;ENST00000412232	T	0.58060	0.36	5.34	4.26	0.50523	.	0.202841	0.37304	N	0.002145	T	0.48696	0.1514	L	0.40543	1.245	0.34891	D	0.745558	P	0.52842	0.956	P	0.46975	0.533	T	0.64141	-0.6477	10	0.62326	D	0.03	-27.517	12.4567	0.55708	0.1414:0.0:0.8586:0.0	.	563	Q96PE1	GP124_HUMAN	M	556;563	ENSP00000406367:R563M	ENSP00000406367:R563M	R	+	2	0	GPR124	37811929	0.988000	0.35896	1.000000	0.80357	0.984000	0.73092	1.736000	0.38187	2.507000	0.84556	0.655000	0.94253	AGG	.		0.672	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
CATSPERD	257062	hgsc.bcm.edu	37	19	5768201	5768201	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:5768201G>T	ENST00000381624.3	+	18	1643	c.1582G>T	c.(1582-1584)Ggc>Tgc	p.G528C	CATSPERD_ENST00000381614.2_Missense_Mutation_p.G186C|CATSPERD_ENST00000309164.7_3'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	528					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											CTGTTCCATGGGCATCCTGGA	0.522																																					p.G528C		.											TMEM146,caecum,carcinoma,0,1	TMEM146	0	0			c.G1582T						.						83.0	82.0	82.0					19																	5768201		2058	4197	6255	SO:0001583	missense	257062	exon18			TCCATGGGCATCC	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.1582G>T	19.37:g.5768201G>T	ENSP00000371037:p.Gly528Cys	29	0		27	2	NM_152784	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	37	CCDS12149.2	.	.	.	.	.	.	.	.	.	.	G	14.81	2.646970	0.47258	.	.	ENSG00000174898	ENST00000394548;ENST00000381624;ENST00000381614;ENST00000309164;ENST00000381613	T;T	0.41065	1.01;1.01	3.44	3.44	0.39384	.	0.141481	0.31636	N	0.007309	T	0.58047	0.2095	M	0.62723	1.935	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.46105	-0.9215	10	0.87932	D	0	-29.5079	10.7432	0.46166	0.0:0.0:1.0:0.0	.	454;528	B7WNK5;Q86XM0	.;TM146_HUMAN	C	454;528;186;199;197	ENSP00000371037:G528C;ENSP00000371027:G186C	ENSP00000310546:G199C	G	+	1	0	TMEM146	5719201	0.023000	0.18921	0.043000	0.18650	0.006000	0.05464	1.237000	0.32695	2.221000	0.72209	0.549000	0.68633	GGC	.		0.522	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
BAI1	575	hgsc.bcm.edu	37	8	143599537	143599537	+	Silent	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr8:143599537C>T	ENST00000517894.1	+	19	3750	c.2856C>T	c.(2854-2856)atC>atT	p.I952I	BAI1_ENST00000323289.5_Silent_p.I952I			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	952					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TGACGCTCATCGTGGGCTGTG	0.647																																					p.I952I		.											BAI1,NS,carcinoma,0,1	BAI1	0	0			c.C2856T						.						180.0	181.0	180.0					8																	143599537		2203	4298	6501	SO:0001819	synonymous_variant	575	exon18			GCTCATCGTGGGC	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2856C>T	8.37:g.143599537C>T		34	0		24	2	NM_001702		Silent	SNP	ENST00000517894.1	37																																																																																				.		0.647	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
PLA2G15	23659	hgsc.bcm.edu	37	16	68289247	68289247	+	Missense_Mutation	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr16:68289247G>A	ENST00000219345.5	+	4	549	c.466G>A	c.(466-468)Gtc>Atc	p.V156I	PLA2G15_ENST00000444212.2_Intron|PLA2G15_ENST00000566188.1_Missense_Mutation_p.V156I|RP11-96D1.7_ENST00000569843.1_RNA|RP11-96D1.7_ENST00000563175.1_RNA|PLA2G15_ENST00000413021.2_Missense_Mutation_p.M103I	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	156					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)	p.V156F(1)		kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						GGGTGAGGATGTCCGAGGGGC	0.567																																					p.V156I		.											PLA2G15,ear,carcinoma,0,1	PLA2G15	0	1	Substitution - Missense(1)	skin(1)	c.G466A						.						59.0	59.0	59.0					16																	68289247		2198	4300	6498	SO:0001583	missense	23659	exon4			GAGGATGTCCGAG	AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	ENST00000219345.5:c.466G>A	16.37:g.68289247G>A	ENSP00000219345:p.Val156Ile	40	0		37	2	NM_012320	B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Missense_Mutation	SNP	ENST00000219345.5	37	CCDS10864.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.50|13.50	2.257120|2.257120	0.39896|0.39896	.|.	.|.	ENSG00000103066|ENSG00000103066	ENST00000413021|ENST00000219345	D|D	0.95918|0.96619	-3.85|-4.07	5.2|5.2	4.25|4.25	0.50352|0.50352	.|.	.|0.229770	.|0.44483	.|N	.|0.000449	D|D	0.91821|0.91821	0.7412|0.7412	L|L	0.37630|0.37630	1.12|1.12	0.80722|0.80722	D|D	1|1	B|P;B	0.10296|0.34934	0.003|0.476;0.008	B|B;B	0.09377|0.32393	0.004|0.145;0.015	D|D	0.89221|0.89221	0.3571|0.3571	8|10	.|0.22706	.|T	.|0.39	-9.6194|-9.6194	10.8142|10.8142	0.46564|0.46564	0.1542:0.0:0.8458:0.0|0.1542:0.0:0.8458:0.0	.|.	103|156;156	B4DUD1|B4DJW4;Q8NCC3	.|.;PAG15_HUMAN	I|I	103|156	ENSP00000394197:M103I|ENSP00000219345:V156I	.|ENSP00000219345:V156I	M|V	+|+	3|1	0|0	PLA2G15|PLA2G15	66846748|66846748	0.984000|0.984000	0.35163|0.35163	0.931000|0.931000	0.37212|0.37212	0.995000|0.995000	0.86356|0.86356	1.862000|1.862000	0.39448|0.39448	1.430000|1.430000	0.47334|0.47334	0.655000|0.655000	0.94253|0.94253	ATG|GTC	.		0.567	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268888.2	NM_012320	
TCAIM	285343	hgsc.bcm.edu	37	3	44441862	44441862	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr3:44441862C>T	ENST00000342649.4	+	9	1328	c.901C>T	c.(901-903)Cca>Tca	p.P301S	TCAIM_ENST00000417237.1_Missense_Mutation_p.P301S	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	301						mitochondrion (GO:0005739)		p.P301S(1)									TGAAAGATTGCCAAGTTATTT	0.294																																					p.P301S		.											C3orf23,colon,carcinoma,0,1	C3orf23	0	1	Substitution - Missense(1)	large_intestine(1)	c.C901T						.						77.0	79.0	78.0					3																	44441862		2203	4299	6502	SO:0001583	missense	285343	exon9			AGATTGCCAAGTT		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.901C>T	3.37:g.44441862C>T	ENSP00000341539:p.Pro301Ser	68	0		37	2	NM_173826	A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Missense_Mutation	SNP	ENST00000342649.4	37	CCDS2712.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.389742	0.82902	.	.	ENSG00000179152	ENST00000417237;ENST00000342649	T;T	0.44083	0.93;0.93	5.74	5.74	0.90152	.	0.050857	0.85682	D	0.000000	T	0.51058	0.1652	L	0.49455	1.56	0.80722	D	1	D	0.56521	0.976	P	0.52424	0.698	T	0.28870	-1.0030	10	0.21540	T	0.41	.	19.9173	0.97066	0.0:1.0:0.0:0.0	.	301	Q8N3R3	CC023_HUMAN	S	301	ENSP00000402581:P301S;ENSP00000341539:P301S	ENSP00000341539:P301S	P	+	1	0	C3orf23	44416866	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	6.280000	0.72626	2.707000	0.92482	0.563000	0.77884	CCA	.		0.294	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256655.2	NM_173826	
PZP	5858	hgsc.bcm.edu	37	12	9356365	9356365	+	Splice_Site	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr12:9356365G>T	ENST00000261336.2	-	2	294	c.266C>A	c.(265-267)aCt>aAt	p.T89N	PZP_ENST00000381997.2_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	89					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.T89I(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						AGCACTCACAGTGAAGGAGAC	0.512																																					p.T89N	Melanoma(125;1402 1695 4685 34487 38571)	.											PZP,NS,carcinoma,0,1	PZP	0	1	Substitution - Missense(1)	ovary(1)	c.C266A						.						91.0	76.0	81.0					12																	9356365		2203	4300	6503	SO:0001630	splice_region_variant	5858	exon2			CTCACAGTGAAGG	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.267+1C>A	12.37:g.9356365G>T		74	0		35	2	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	G	6.497	0.459816	0.12342	.	.	ENSG00000126838	ENST00000261336	T	0.08370	3.1	2.08	2.08	0.27032	.	0.413883	0.15949	U	0.236816	T	0.15739	0.0379	M	0.83953	2.67	0.80722	D	1	P	0.48640	0.913	P	0.48030	0.564	T	0.05683	-1.0870	10	0.31617	T	0.26	.	7.7209	0.28731	0.0:0.0:1.0:0.0	.	89	P20742	PZP_HUMAN	N	89	ENSP00000261336:T89N	ENSP00000261336:T89N	T	-	2	0	PZP	9247632	0.025000	0.19082	0.927000	0.36925	0.114000	0.19823	-0.026000	0.12392	1.491000	0.48482	0.467000	0.42956	ACT	.		0.512	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	Missense_Mutation
CDC27	996	hgsc.bcm.edu	37	17	45249328	45249328	+	Missense_Mutation	SNP	G	G	A	rs142853734		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr17:45249328G>A	ENST00000066544.3	-	3	299	c.206C>T	c.(205-207)cCg>cTg	p.P69L	CDC27_ENST00000531206.1_Missense_Mutation_p.P69L|CDC27_ENST00000446365.2_Intron|CDC27_ENST00000527547.1_Missense_Mutation_p.P69L|RP5-867C24.5_ENST00000572193.1_RNA|CDC27_ENST00000528748.1_5'UTR	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	69					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTTGCATTGCGGTGTAGTACA	0.358																																					p.P69L		.											CDC27_ENST00000531206,NS,haematopoietic_neoplasm,0,2	CDC27_ENST00000531206	0	0			c.C206T						.						42.0	42.0	42.0					17																	45249328		2202	4300	6502	SO:0001583	missense	996	exon3			CATTGCGGTGTAG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.206C>T	17.37:g.45249328G>A	ENSP00000066544:p.Pro69Leu	40	0		37	2	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.916798	0.92249	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000527547;ENST00000526866	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	5.69	4.7	0.59300	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.81389	0.4812	L	0.57536	1.79	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.992	P;P;P	0.57425	0.742;0.803;0.82	T	0.78183	-0.2303	10	0.19147	T	0.46	-28.2366	13.6664	0.62398	0.0:0.0:0.844:0.156	.	69;69;69	G5EA36;G3V1C4;P30260	.;.;CDC27_HUMAN	L	69	ENSP00000066544:P69L;ENSP00000434614:P69L;ENSP00000437339:P69L;ENSP00000432105:P69L	ENSP00000066544:P69L	P	-	2	0	CDC27	42604327	1.000000	0.71417	0.906000	0.35671	0.977000	0.68977	9.568000	0.98166	1.376000	0.46267	0.591000	0.81541	CCG	.		0.358	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
SLC35F2	54733	hgsc.bcm.edu	37	11	107686612	107686612	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr11:107686612C>T	ENST00000525815.1	-	2	610	c.190G>A	c.(190-192)Gca>Aca	p.A64T	SLC35F2_ENST00000525071.1_Missense_Mutation_p.A64T|SLC35F2_ENST00000375682.4_Missense_Mutation_p.A17T|SLC35F2_ENST00000429869.1_Missense_Mutation_p.A64T|SLC35F2_ENST00000265836.7_Intron	NM_017515.4	NP_059985.2	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	64					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		TATCTTTCTGCCAAATACTGG	0.398																																					p.A64T		.											.,1	.	29	0			c.G190A						.						130.0	125.0	127.0					11																	107686612		1911	4122	6033	SO:0001583	missense	54733	exon2			TTTCTGCCAAATA		CCDS41709.1	11q22.3	2013-05-22			ENSG00000110660	ENSG00000110660		"""Solute carriers"""	23615	protein-coding gene	gene with protein product						9119394	Standard	NM_017515		Approved	FLJ13018	uc001pjq.3	Q8IXU6	OTTHUMG00000166366	ENST00000525815.1:c.190G>A	11.37:g.107686612C>T	ENSP00000436785:p.Ala64Thr	93	0		45	2	NM_017515	Q14963|Q5JPA8|Q6ZRQ3|Q9H947	Missense_Mutation	SNP	ENST00000525815.1	37	CCDS41709.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.515096	0.85389	.	.	ENSG00000110660	ENST00000525815;ENST00000525071;ENST00000375682;ENST00000429869	.	.	.	5.82	4.91	0.64330	.	0.048331	0.85682	D	0.000000	T	0.75095	0.3803	M	0.65975	2.015	0.80722	D	1	P;P	0.50617	0.568;0.937	P;P	0.61722	0.627;0.893	T	0.76479	-0.2944	9	0.49607	T	0.09	.	15.1009	0.72276	0.0:0.932:0.0:0.068	.	64;64	E9PJD1;Q8IXU6	.;S35F2_HUMAN	T	64;64;17;64	.	ENSP00000364834:A17T	A	-	1	0	SLC35F2	107191822	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.465000	0.53064	1.464000	0.47987	0.650000	0.86243	GCA	.		0.398	SLC35F2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389417.1	NM_017515	
TRIM13	10206	hgsc.bcm.edu;ucsc.edu	37	13	50590789	50590789	+	3'UTR	SNP	G	G	T	rs531900662		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr13:50590789G>T	ENST00000378182.3	+	0	5451				KCNRG_ENST00000360473.4_Intron|KCNRG_ENST00000312942.1_Intron|TRIM13_ENST00000478111.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		AAGGATAGTTGCTCCTGAGTC	0.413													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15896	0.0		0.0	False		,,,				2504	0.0				.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	10206	.			ATAGTTGCTCCTG	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*3489G>T	13.37:g.50590789G>T		79	0		54	6	.	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	SNP	ENST00000378182.3	37	CCDS9423.1																																																																																			.		0.413	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
FAM214A	56204	hgsc.bcm.edu;bcgsc.ca	37	15	52874470	52874470	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr15:52874470G>T	ENST00000261844.7	-	13	3264	c.3112C>A	c.(3112-3114)Cat>Aat	p.H1038N	FAM214A_ENST00000546305.2_Missense_Mutation_p.H1045N|RP11-23N2.4_ENST00000562062.1_RNA|RP11-23N2.4_ENST00000566344.1_RNA	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	1038																	ACGTCTCTATGGAGGTAGATC	0.363																																					p.H1038N		.											.	.	.	0			c.C3112A						.						69.0	63.0	65.0					15																	52874470		1815	4078	5893	SO:0001583	missense	56204	exon13			CTCTATGGAGGTA	AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.3112C>A	15.37:g.52874470G>T	ENSP00000261844:p.His1038Asn	67	0		55	4	NM_019600	A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Missense_Mutation	SNP	ENST00000261844.7	37	CCDS45263.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449760	0.63290	.	.	ENSG00000047346	ENST00000261844;ENST00000399202;ENST00000546305	T;T	0.40476	1.03;1.03	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.59636	0.2208	L	0.61036	1.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.984;0.991	T	0.62666	-0.6806	10	0.87932	D	0	.	12.2201	0.54429	0.0823:0.0:0.9177:0.0	.	1045;1038	F5H8G0;Q32MH5	.;K1370_HUMAN	N	1038;1038;1045	ENSP00000261844:H1038N;ENSP00000443598:H1045N	ENSP00000261844:H1038N	H	-	1	0	KIAA1370	50661762	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.428000	0.80296	2.413000	0.81919	0.446000	0.29264	CAT	.		0.363	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419914.1	NM_019600	
GON4L	54856	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	155792141	155792141	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:155792141C>T	ENST00000368331.1	-	4	872	c.824G>A	c.(823-825)cGt>cAt	p.R275H	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000361040.5_Missense_Mutation_p.R275H|GON4L_ENST00000271883.5_Missense_Mutation_p.R275H|GON4L_ENST00000437809.1_Missense_Mutation_p.R275H	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	275					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTCCAAGGTACGGTCAAGCAT	0.463																																					p.R275H													.	GON4L	392	0			c.G824A						.						378.0	286.0	317.0					1																	155792141		2203	4300	6503	SO:0001583	missense	54856	exon4			AAGGTACGGTCAA	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.824G>A	1.37:g.155792141C>T	ENSP00000357315:p.Arg275His	81	0		41	4	NM_032292	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		.	.	.	.	.	.	.	.	.	.	C	17.86	3.493214	0.64186	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000539959;ENST00000361040	T;T;T;T	0.13307	2.78;2.78;2.78;2.6	5.4	5.4	0.78164	.	0.065849	0.64402	D	0.000011	T	0.21881	0.0527	M	0.71036	2.16	0.26808	N	0.969057	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.69824	0.955;0.966;0.925;0.966	T	0.05451	-1.0884	10	0.87932	D	0	.	9.5335	0.39209	0.0:0.8456:0.0:0.1544	.	275;275;275;275	A4PB68;Q3T8J9-2;Q3T8J9;Q3T8J9-3	.;.;GON4L_HUMAN;.	H	275	ENSP00000396117:R275H;ENSP00000357315:R275H;ENSP00000271883:R275H;ENSP00000354322:R275H	ENSP00000271883:R275H	R	-	2	0	GON4L	154058765	0.976000	0.34144	0.972000	0.41901	0.560000	0.35617	2.332000	0.43903	2.813000	0.96785	0.561000	0.74099	CGT	.		0.463	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
POTEG	404785	broad.mit.edu	37	14	19553567	19553567	+	Missense_Mutation	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr14:19553567G>A	ENST00000409832.3	+	1	203	c.151G>A	c.(151-153)Gat>Aat	p.D51N		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	51										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						AGACCACGACGATTCTGCTAT	0.602																																					p.D51N													.	POTEG	118	0			c.G151A						.						101.0	139.0	126.0					14																	19553567		2198	4286	6484	SO:0001583	missense	404785	exon1			CACGACGATTCTG		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.151G>A	14.37:g.19553567G>A	ENSP00000386971:p.Asp51Asn	372	0		258	24	NM_001005356	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	g	11.02	1.515679	0.27123	.	.	ENSG00000222036	ENST00000409832	T	0.39997	1.05	.	.	.	.	.	.	.	.	T	0.48572	0.1507	L	0.43152	1.355	0.09310	N	1	D	0.89917	1.0	D	0.68353	0.957	T	0.34304	-0.9834	7	0.36615	T	0.2	.	.	.	.	.	51	Q6S5H5	POTEG_HUMAN	N	51	ENSP00000386971:D51N	ENSP00000386971:D51N	D	+	1	0	POTEG	18623567	0.001000	0.12720	0.010000	0.14722	0.010000	0.07245	0.488000	0.22371	0.162000	0.19483	0.165000	0.16767	GAT	.		0.602	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356	
AREL1	9870	broad.mit.edu	37	14	75137486	75137486	+	Missense_Mutation	SNP	G	G	T	rs375792805		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr14:75137486G>T	ENST00000356357.4	-	13	2102	c.1587C>A	c.(1585-1587)ttC>ttA	p.F529L	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	529	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TGTTGTCACTGAACCGGGTGA	0.453																																					p.F529L													.	KIAA0317	68	0			c.C1587A						.						94.0	92.0	92.0					14																	75137486		1899	4130	6029	SO:0001583	missense	9870	exon13			GTCACTGAACCGG	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.1587C>A	14.37:g.75137486G>T	ENSP00000348714:p.Phe529Leu	54	0		43	3	NM_001039479	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	ENST00000356357.4	37	CCDS41971.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.554214	0.86231	.	.	ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202	T;T	0.56611	0.45;0.45	5.87	4.06	0.47325	HECT (4);	0.000000	0.85682	D	0.000000	T	0.70263	0.3204	M	0.79693	2.465	0.80722	D	1	D;B	0.56035	0.974;0.382	D;P	0.67725	0.953;0.449	T	0.71048	-0.4705	10	0.49607	T	0.09	.	11.2687	0.49124	0.2014:0.0:0.7986:0.0	.	529;529	O15033-2;O15033	.;K0317_HUMAN	L	529;368;368	ENSP00000348714:F529L;ENSP00000452101:F368L	ENSP00000348714:F529L	F	-	3	2	KIAA0317	74207239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.501000	0.53325	0.833000	0.34828	0.655000	0.94253	TTC	.		0.453	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821	
KIAA1024	23251	broad.mit.edu	37	15	79750676	79750676	+	Silent	SNP	G	G	A	rs139072268		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr15:79750676G>A	ENST00000305428.3	+	2	2262	c.2187G>A	c.(2185-2187)tcG>tcA	p.S729S		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	729						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						TCTCCAACTCGCCCAGAGACT	0.507																																					p.S729S													.	KIAA1024	146	0			c.G2187A						.	G		1,4391	2.1+/-5.4	0,1,2195	79.0	76.0	77.0		2187	-8.2	0.9	15	dbSNP_134	77	0,8586		0,0,4293	no	coding-synonymous	KIAA1024	NM_015206.2		0,1,6488	AA,AG,GG		0.0,0.0228,0.0077		729/917	79750676	1,12977	2196	4293	6489	SO:0001819	synonymous_variant	23251	exon2			CAACTCGCCCAGA	AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.2187G>A	15.37:g.79750676G>A		56	0		42	3	NM_015206	A7MD43	Silent	SNP	ENST00000305428.3	37	CCDS32306.1																																																																																			G|1.000;A|0.000		0.507	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206	
HAGHL	84264	broad.mit.edu	37	16	777490	777490	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr16:777490G>A	ENST00000341413.4	+	0	262				HAGHL_ENST00000564545.1_De_novo_Start_OutOfFrame|HAGHL_ENST00000549114.1_De_novo_Start_OutOfFrame|HAGHL_ENST00000564537.1_De_novo_Start_OutOfFrame|CCDC78_ENST00000293889.6_5'Flank|HAGHL_ENST00000389703.3_De_novo_Start_OutOfFrame|NARFL_ENST00000562862.1_5'Flank|HAGHL_ENST00000561546.1_De_novo_Start_OutOfFrame			Q6PII5	HAGHL_HUMAN	hydroxyacylglutathione hydrolase-like								hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			lung(3)	3		Hepatocellular(780;0.00335)				AGCAGGCACCGGTGGCCGAGC	0.672																																					.	Pancreas(46;538 1326 12403 32360)												.	HAGHL	18	0			.						.						47.0	36.0	40.0					16																	777490		2183	4287	6470			84264	.			GGCACCGGTGGCC	AK054841	CCDS32354.1	16p13.3	2008-02-05	2003-11-04						14177	protein-coding gene	gene with protein product			"""hydroxyacyl glutathione hydrolase-like"""			12477932	Standard	XM_005255629		Approved	MGC2605	uc002cjo.1	Q6PII5		ENST00000341413.4:c.-20G>A	16.37:g.777490G>A		134	0		65	3	.	A6NCC4|D3DU64|Q59FX8|Q96BZ3|Q96NR5|Q96S11|Q9BT45	Translation_Start_Site	SNP	ENST00000341413.4	37																																																																																				.		0.672	HAGHL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409607.1	NM_032304	
B9D1	27077	broad.mit.edu	37	17	19251158	19251158	+	Missense_Mutation	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr17:19251158C>A	ENST00000261499.4	-	4	423	c.280G>T	c.(280-282)Gtg>Ttg	p.V94L	B9D1_ENST00000395616.3_Missense_Mutation_p.V94L|B9D1_ENST00000477478.2_Missense_Mutation_p.M69I|B9D1_ENST00000268841.6_Missense_Mutation_p.V94L|B9D1_ENST00000395615.1_Missense_Mutation_p.V94L|B9D1_ENST00000575403.1_Missense_Mutation_p.M69I|B9D1_ENST00000461069.2_Missense_Mutation_p.V94L	NM_015681.3	NP_056496.1	Q9UPM9	B9D1_HUMAN	B9 protein domain 1	94	B9. {ECO:0000255|PROSITE- ProRule:PRU00713}.				camera-type eye development (GO:0043010)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|in utero embryonic development (GO:0001701)|neuroepithelial cell differentiation (GO:0060563)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)|vasculature development (GO:0001944)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)	hedgehog receptor activity (GO:0008158)			large_intestine(3)|urinary_tract(1)	4	all_cancers(12;2.04e-05)|all_epithelial(12;0.000806)|Hepatocellular(7;0.00345)|Breast(13;0.143)					TTCCCGAACACATCTGGTCCA	0.622																																					p.M113I													.	B9D1	8	0			c.G339T						.						122.0	75.0	91.0					17																	19251158		2203	4300	6503	SO:0001583	missense	27077	exon4			CGAACACATCTGG	BC002944	CCDS11205.1, CCDS58528.1	17p11.2	2014-09-17			ENSG00000108641	ENSG00000108641			24123	protein-coding gene	gene with protein product	"""endothelial precursor protein B9"""	614144				21493627	Standard	NM_015681		Approved	B9, EPPB9, MKS9	uc010vyr.2	Q9UPM9	OTTHUMG00000059586	ENST00000261499.4:c.280G>T	17.37:g.19251158C>A	ENSP00000261499:p.Val94Leu	29	0		21	3	NM_001243473	Q9BU22	Missense_Mutation	SNP	ENST00000261499.4	37	CCDS11205.1	.	.	.	.	.	.	.	.	.	.	C	7.624	0.677479	0.14841	.	.	ENSG00000108641	ENST00000395615;ENST00000261499;ENST00000395616;ENST00000268841;ENST00000440841	T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4	5.28	-1.15	0.09709	.	0.456980	0.24377	N	0.039052	T	0.49541	0.1563	L	0.49640	1.575	0.18873	N	0.999983	B	0.06786	0.001	B	0.10450	0.005	T	0.30475	-0.9977	10	0.11182	T	0.66	.	6.2221	0.20687	0.1241:0.5018:0.0:0.3741	.	94	Q9UPM9	B9D1_HUMAN	L	94;94;94;94;85	ENSP00000378977:V94L;ENSP00000261499:V94L;ENSP00000378978:V94L;ENSP00000268841:V94L;ENSP00000410835:V85L	ENSP00000261499:V94L	V	-	1	0	B9D1	19191751	0.003000	0.15002	0.165000	0.22776	0.963000	0.63663	0.036000	0.13819	-0.027000	0.13873	-0.215000	0.12644	GTG	.		0.622	B9D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132494.1	NM_015681	
RPTOR	57521	broad.mit.edu	37	17	78727809	78727809	+	Splice_Site	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr17:78727809G>T	ENST00000306801.3	+	6	1016		c.e6-1		RPTOR_ENST00000537330.1_Splice_Site|RPTOR_ENST00000544334.2_Splice_Site|RPTOR_ENST00000575542.1_Splice_Site|RPTOR_ENST00000570891.1_Splice_Site	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1						cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CTGCCCTTCAGGTAGCTGCAA	0.498																																					.													.	RPTOR	122	0			c.655-1G>T						.						195.0	189.0	191.0					17																	78727809		2203	4300	6503	SO:0001630	splice_region_variant	57521	exon6			CCTTCAGGTAGCT		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.655-1G>T	17.37:g.78727809G>T		39	0		33	3	NM_001163034	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Splice_Site	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810783	0.50421	.	.	ENSG00000141564	ENST00000537330;ENST00000306801;ENST00000544334	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9662	0.92697	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RPTOR	76342404	1.000000	0.71417	0.943000	0.38184	0.376000	0.30014	7.776000	0.85560	2.472000	0.83506	0.655000	0.94253	.	.		0.498	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	Intron
ANKRD62	342850	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	12125725	12125725	+	Silent	SNP	C	C	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr18:12125725C>A	ENST00000587848.2	+	13	2070	c.1905C>A	c.(1903-1905)ctC>ctA	p.L635L	ANKRD62_ENST00000418274.2_3'UTR|ANKRD62_ENST00000314074.8_Silent_p.L621L			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	635										breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						ATACAATGCTCAATTCTGAGC	0.398																																					.													.	.	.	0			.						.																																			SO:0001819	synonymous_variant	342850	.			AATGCTCAATTCT	BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.1905C>A	18.37:g.12125725C>A		70	0		53	18	.		Silent	SNP	ENST00000587848.2	37																																																																																				.		0.398	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000452521.2	XM_001715728	
CYP2B7P	1556	broad.mit.edu	37	19	41448329	41448329	+	RNA	DEL	T	T	-			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:41448329delT	ENST00000599198.1	+	0	1018					NR_001278.1															NS(1)|endometrium(6)|kidney(1)|lung(2)|ovary(1)|skin(1)	12						CTCAAGGATCttttttttttt	0.473																																					.													.	CYP2B7P1	27	0			.						.																																					0	.			AGGATCTTTTTTT																													19.37:g.41448329delT		3	0		6	2	.		RNA	DEL	ENST00000599198.1	37																																																																																				.		0.473	CYP2B7P1-006	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000465180.1		
HDAC4	9759	broad.mit.edu;bcgsc.ca	37	2	240016733	240016733	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:240016733G>T	ENST00000345617.3	-	17	3029	c.2238C>A	c.(2236-2238)ttC>ttA	p.F746L	HDAC4_ENST00000541256.1_Missense_Mutation_p.F720L|HDAC4_ENST00000543185.1_Missense_Mutation_p.F330L	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	746	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GGAGCCGGACGAACACGGAGG	0.612																																					p.F746L													HDAC4,NS,carcinoma,0,1	HDAC4	127	0			c.C2238A						.						77.0	85.0	82.0					2																	240016733		2203	4300	6503	SO:0001583	missense	9759	exon17			CCGGACGAACACG	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2238C>A	2.37:g.240016733G>T	ENSP00000264606:p.Phe746Leu	183	1		104	8	NM_006037	Q9UND6	Missense_Mutation	SNP	ENST00000345617.3	37	CCDS2529.1	.	.	.	.	.	.	.	.	.	.	G	8.926	0.962203	0.18583	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185;ENST00000541256;ENST00000393621	T;T;T	0.65364	0.22;-0.15;0.73	4.46	-8.93	0.00771	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	T	0.65207	0.2669	L	0.48935	1.535	0.40990	D	0.984848	D;B;B;B;B;B	0.54601	0.967;0.222;0.013;0.014;0.016;0.2	P;B;B;B;B;B	0.58577	0.841;0.094;0.016;0.005;0.037;0.146	T	0.79305	-0.1858	10	0.56958	D	0.05	.	20.7024	0.99706	0.2754:0.0:0.7246:0.0	.	746;629;720;720;714;746	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	L	746;634;330;720;629	ENSP00000264606:F746L;ENSP00000440481:F330L;ENSP00000443057:F720L	ENSP00000264606:F746L	F	-	3	2	HDAC4	239681670	0.411000	0.25384	0.125000	0.21846	0.040000	0.13550	-0.171000	0.09883	-2.355000	0.00614	-0.768000	0.03414	TTC	.		0.612	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037	
DNAJB8	165721	broad.mit.edu;bcgsc.ca	37	3	128181874	128181874	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr3:128181874C>T	ENST00000469083.1	-	2	2772	c.215G>A	c.(214-216)aGc>aAc	p.S72N	DNAJB8_ENST00000319153.3_Missense_Mutation_p.S72N|DNAJB8-AS1_ENST00000471626.1_RNA			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	72					chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		AGCCCGCCAGCTGTCACAGCC	0.592																																					p.S72N													.	DNAJB8	34	0			c.G215A						.						93.0	96.0	95.0					3																	128181874		2203	4300	6503	SO:0001583	missense	165721	exon3			CGCCAGCTGTCAC		CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.215G>A	3.37:g.128181874C>T	ENSP00000417418:p.Ser72Asn	53	0		31	3	NM_153330	B3KWV7	Missense_Mutation	SNP	ENST00000469083.1	37	CCDS3048.1	.	.	.	.	.	.	.	.	.	.	C	6.765	0.509961	0.12883	.	.	ENSG00000179407	ENST00000469083;ENST00000319153	T;T	0.73363	-0.74;-0.74	4.12	2.19	0.27852	Heat shock protein DnaJ, N-terminal (2);	0.467337	0.24604	N	0.037107	T	0.59770	0.2218	L	0.36672	1.1	0.09310	N	0.999998	B	0.17038	0.02	B	0.14578	0.011	T	0.54410	-0.8298	10	0.72032	D	0.01	.	5.1524	0.15017	0.0:0.6364:0.1807:0.1829	.	72	Q8NHS0	DNJB8_HUMAN	N	72	ENSP00000417418:S72N;ENSP00000316053:S72N	ENSP00000316053:S72N	S	-	2	0	DNAJB8	129664564	0.102000	0.21896	0.116000	0.21606	0.005000	0.04900	0.616000	0.24344	0.791000	0.33826	0.561000	0.74099	AGC	.		0.592	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356933.1	NM_153330	
PCDH7	5099	broad.mit.edu	37	4	30724013	30724013	+	Frame_Shift_Del	DEL	G	G	-			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr4:30724013delG	ENST00000361762.2	+	1	1977	c.969delG	c.(967-969)ccgfs	p.P323fs	PCDH7_ENST00000543491.1_Frame_Shift_Del_p.P323fs	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	323	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						ACAGCGCCCCGGGGACCCCCA	0.667																																					p.P323fs													.	PCDH7	215	0			c.969delG						.						16.0	20.0	19.0					4																	30724013		2181	4276	6457	SO:0001589	frameshift_variant	5099	exon1			CGCCCCGGGGACC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.969delG	4.37:g.30724013delG	ENSP00000355243:p.Pro323fs	15	0		6	2	NM_032457	O60246|O60247|Q4W5C4	Frame_Shift_Del	DEL	ENST00000361762.2	37	CCDS33971.1																																																																																			.		0.667	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
HLA-F	3134	broad.mit.edu	37	6	29706824	29706824	+	IGR	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr6:29706824G>T	ENST00000440587.2	+	0	1622				HLA-F-AS1_ENST00000458236.1_RNA			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						attcacgatagccaagacaac	0.388																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ACGATAGCCAAGA	AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156		6.37:g.29706824G>T		10	0		4	2	.	Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	RNA	SNP	ENST00000440587.2	37																																																																																				.		0.388	HLA-F-204	KNOWN	basic	protein_coding	protein_coding		NM_018950	
CYP21A1P	1590	broad.mit.edu	37	6	31975463	31975463	+	5'Flank	SNP	T	T	C	rs370433041	byFrequency	TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr6:31975463T>C	ENST00000594256.1	-	0	0				CYP21A1P_ENST00000342991.6_RNA																							GCAGCGACTGTAGGAGGAGCT	0.657													C|||	271	0.0541134	0.1324	0.0303	5008	,	,		12708	0.0288		0.0268	False		,,,				2504	0.0194				.													.	CYP21A2	42	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			CGACTGTAGGAGG																													6.37:g.31975463T>C	Exception_encountered	111	0		51	5	.		RNA	SNP	ENST00000594256.1	37																																																																																				.		0.657	AL645922.1-201	NOVEL	basic|appris_principal	protein_coding	protein_coding			
TNRC18	84629	broad.mit.edu	37	7	5352833	5352833	+	Silent	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr7:5352833G>A	ENST00000430969.1	-	27	8037	c.7689C>T	c.(7687-7689)agC>agT	p.S2563S	TNRC18_ENST00000399537.4_Silent_p.S2563S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2563	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		tgccactactgctgctgctgc	0.672																																					p.S2563S													.	TNRC18	311	0			c.C7689T						.						3.0	5.0	4.0					7																	5352833		1128	2739	3867	SO:0001819	synonymous_variant	84629	exon27			ACTACTGCTGCTG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7689C>T	7.37:g.5352833G>A		65	0		41	3	NM_001080495	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.904535	0.00512	.	.	ENSG00000182095	ENST00000328270	.	.	.	4.38	1.45	0.22620	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.8385	0.08905	0.1403:0.149:0.519:0.1916	.	.	.	.	X	377	.	.	Q	-	1	0	TNRC18	5319359	0.004000	0.15560	0.014000	0.15608	0.007000	0.05969	-0.229000	0.09098	-0.173000	0.10761	-1.164000	0.01763	CAG	.		0.672	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
FER1L6	654463	broad.mit.edu	37	8	124989685	124989685	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr8:124989685C>T	ENST00000522917.1	+	10	1105	c.899C>T	c.(898-900)gCt>gTt	p.A300V	FER1L6_ENST00000399018.1_Missense_Mutation_p.A300V	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	300	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AAGAACTGTGCTGATCCTGTG	0.502																																					p.A300V													.	FER1L6	268	0			c.C899T						.						161.0	159.0	160.0					8																	124989685		2060	4208	6268	SO:0001583	missense	654463	exon10			ACTGTGCTGATCC	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.899C>T	8.37:g.124989685C>T	ENSP00000428280:p.Ala300Val	40	0		43	3	NM_001039112		Missense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.651592	0.67472	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.69040	-0.37;-0.37	5.53	5.53	0.82687	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000004	T	0.74520	0.3727	L	0.33339	1.005	0.52501	D	0.999952	D	0.76494	0.999	D	0.76575	0.988	T	0.70414	-0.4878	10	0.27785	T	0.31	.	19.4728	0.94969	0.0:1.0:0.0:0.0	.	300	Q2WGJ9	FR1L6_HUMAN	V	300	ENSP00000428280:A300V;ENSP00000381982:A300V	ENSP00000381982:A300V	A	+	2	0	FER1L6	125058866	0.991000	0.36638	0.957000	0.39632	0.995000	0.86356	2.997000	0.49457	2.608000	0.88229	0.561000	0.74099	GCT	.		0.502	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
C1orf111	284680	ucsc.edu;bcgsc.ca	37	1	162343888	162343888	+	Missense_Mutation	SNP	G	G	T	rs527533868		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:162343888G>T	ENST00000367935.5	-	3	815	c.736C>A	c.(736-738)Cct>Act	p.P246T	RP11-565P22.6_ENST00000431696.1_Intron	NM_182581.3	NP_872387.2	Q5T0L3	CA111_HUMAN	chromosome 1 open reading frame 111	246										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11	all_hematologic(112;0.15)		BRCA - Breast invasive adenocarcinoma(70;0.0938)			TGTTCAGCAGGACTATTGAAG	0.547																																					p.P246T													.	C1orf111	26	0			c.C736A						.						158.0	166.0	163.0					1																	162343888		2203	4300	6503	SO:0001583	missense	284680	exon3			CAGCAGGACTATT	BC032957	CCDS1238.1	1q23.3	2008-02-05			ENSG00000171722	ENSG00000171722			27648	protein-coding gene	gene with protein product						12477932	Standard	NM_182581		Approved		uc001gbx.2	Q5T0L3	OTTHUMG00000031375	ENST00000367935.5:c.736C>A	1.37:g.162343888G>T	ENSP00000356912:p.Pro246Thr	34	0		23	4	NM_182581	Q6X961|Q8NEC3	Missense_Mutation	SNP	ENST00000367935.5	37	CCDS1238.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995794	0.74703	.	.	ENSG00000171722	ENST00000367935	T	0.51071	0.72	4.99	1.89	0.25635	.	0.773311	0.11637	N	0.544193	T	0.11750	0.0286	N	0.24115	0.695	0.23665	N	0.99717	B	0.33612	0.419	B	0.33121	0.158	T	0.17107	-1.0380	9	0.16420	T	0.52	-23.891	5.7427	0.18102	0.1796:0.1587:0.6616:0.0	.	246	Q5T0L3	CA111_HUMAN	T	246	ENSP00000356912:P246T	ENSP00000356912:P246T	P	-	1	0	C1orf111	160610512	0.002000	0.14202	0.007000	0.13788	0.917000	0.54804	0.901000	0.28445	0.502000	0.28037	0.655000	0.94253	CCT	.		0.547	C1orf111-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076791.2	NM_182581	
TBC1D8	11138	ucsc.edu	37	2	101646196	101646196	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:101646196C>T	ENST00000376840.4	-	12	1933	c.1934G>A	c.(1933-1935)gGt>gAt	p.G645D	TBC1D8_ENST00000409318.1_Missense_Mutation_p.G660D			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	645	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						TGGGAGATGACCCTTGATGAG	0.567																																					p.G645D													.	TBC1D8	169	0			c.G1934A						.						81.0	87.0	85.0					2																	101646196		2043	4199	6242	SO:0001583	missense	11138	exon12			AGATGACCCTTGA	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.1934G>A	2.37:g.101646196C>T	ENSP00000366036:p.Gly645Asp	27	1		17	4	NM_001102426	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	ENST00000376840.4	37	CCDS46375.1	.	.	.	.	.	.	.	.	.	.	C	5.054	0.195650	0.09599	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.10573	2.86;2.86	5.54	4.32	0.51571	Rab-GAP/TBC domain (5);	0.363501	0.26418	N	0.024489	T	0.01870	0.0059	N	0.00106	-2.12	0.38926	D	0.957846	B	0.02656	0.0	B	0.04013	0.001	T	0.37150	-0.9718	10	0.02654	T	1	-16.2226	10.0172	0.42022	0.0:0.0892:0.0:0.9108	.	645	O95759	TBCD8_HUMAN	D	645;660	ENSP00000366036:G645D;ENSP00000386856:G660D	ENSP00000366036:G645D	G	-	2	0	TBC1D8	101012628	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	5.071000	0.64382	0.835000	0.34877	-0.345000	0.07892	GGT	.		0.567	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063	
GFM1	85476	ucsc.edu;bcgsc.ca	37	3	158364712	158364712	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr3:158364712C>T	ENST00000486715.1	+	4	905	c.548C>T	c.(547-549)cCa>cTa	p.P183L	GFM1_ENST00000264263.5_Missense_Mutation_p.P183L|GFM1_ENST00000478576.1_Missense_Mutation_p.P183L	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GGCTCCAACCCAGCCAGGGCC	0.443																																					p.P183L													.	GFM1	83	0			c.C548T						.						61.0	62.0	61.0					3																	158364712		2203	4300	6503	SO:0001583	missense	85476	exon4			CCAACCCAGCCAG	AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.548C>T	3.37:g.158364712C>T	ENSP00000419038:p.Pro183Leu	37	0		31	4	NM_024996		Missense_Mutation	SNP	ENST00000486715.1	37	CCDS33885.1	.	.	.	.	.	.	.	.	.	.	C	33	5.263527	0.95399	.	.	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263	T;T;T	0.65178	-0.14;-0.14;-0.14	5.9	5.9	0.94986	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.81861	0.4912	M	0.83483	2.645	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.992	D;D;D	0.72075	0.958;0.976;0.943	T	0.82291	-0.0530	10	0.56958	D	0.05	-4.1663	20.2789	0.98501	0.0:1.0:0.0:0.0	.	183;183;183	Q96RP9-2;Q96RP9;C9IZ01	.;EFGM_HUMAN;.	L	183	ENSP00000419038:P183L;ENSP00000418755:P183L;ENSP00000264263:P183L	ENSP00000264263:P183L	P	+	2	0	GFM1	159847406	1.000000	0.71417	0.969000	0.41365	0.854000	0.48673	7.426000	0.80270	2.788000	0.95919	0.650000	0.86243	CCA	.		0.443	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352271.1	NM_024996	
ATN1	1822	ucsc.edu	37	12	7045885	7045885	+	Silent	SNP	A	A	G	rs370414886|rs201442555		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr12:7045885A>G	ENST00000356654.4	+	5	1692	c.1455A>G	c.(1453-1455)caA>caG	p.Q485Q	ATN1_ENST00000396684.2_Silent_p.Q485Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	485	Poly-Gln.		Missing. {ECO:0000269|PubMed:7485154, ECO:0000269|PubMed:7842016, ECO:0000269|PubMed:8965642}.		cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						ACCACcagcaacagcaacagc	0.627																																					p.Q485Q													.	ATN1	95	0			c.A1455G						.						79.0	94.0	89.0					12																	7045885		2203	4300	6503	SO:0001819	synonymous_variant	1822	exon5			CCAGCAACAGCAA	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1455A>G	12.37:g.7045885A>G		74	7		46	8	NM_001007026	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																			.		0.627	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
NCOR2	9612	ucsc.edu	37	12	124839411	124839411	+	Silent	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr12:124839411C>T	ENST00000405201.1	-	25	3456	c.3456G>A	c.(3454-3456)ctG>ctA	p.L1152L	NCOR2_ENST00000404121.2_Silent_p.L713L|NCOR2_ENST00000404621.1_Silent_p.L1142L|NCOR2_ENST00000429285.2_Silent_p.L1142L|NCOR2_ENST00000356219.3_Silent_p.L1159L|NCOR2_ENST00000397355.1_Silent_p.L1143L			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1160					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TGGGCAGGGGCAGCCCCATGG	0.677																																					p.L1152L													.	NCOR2	475	0			c.G3456A						.						44.0	50.0	48.0					12																	124839411		1956	4141	6097	SO:0001819	synonymous_variant	9612	exon27			CAGGGGCAGCCCC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.3456G>A	12.37:g.124839411C>T		35	0		33	4	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.677	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
HEATR3	55027	ucsc.edu;bcgsc.ca	37	16	50118142	50118142	+	Silent	SNP	T	T	C			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr16:50118142T>C	ENST00000299192.7	+	9	1421	c.1230T>C	c.(1228-1230)tcT>tcC	p.S410S	HEATR3_ENST00000285767.4_Silent_p.S324S|HEATR3_ENST00000564942.1_3'UTR	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	410										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						AGCTGTTTTCTCCCCTCTGCC	0.493																																					p.S410S													.	HEATR3	59	0			c.T1230C						.						132.0	124.0	126.0					16																	50118142		2198	4300	6498	SO:0001819	synonymous_variant	55027	exon9			GTTTTCTCCCCTC	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.1230T>C	16.37:g.50118142T>C		62	0		35	4	NM_182922	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Silent	SNP	ENST00000299192.7	37	CCDS10739.1																																																																																			.		0.493	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	
MARK4	57787	ucsc.edu	37	19	45774944	45774944	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:45774944C>T	ENST00000262891.4	+	8	1095	c.764C>T	c.(763-765)cCc>cTc	p.P255L	MARK4_ENST00000300843.4_Missense_Mutation_p.P255L	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	255	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GGCTCCCTGCCCTTCGACGGG	0.672																																					p.P255L													.	MARK4	132	0			c.C764T						.						49.0	53.0	52.0					19																	45774944		2203	4300	6503	SO:0001583	missense	57787	exon8			CCCTGCCCTTCGA	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.764C>T	19.37:g.45774944C>T	ENSP00000262891:p.Pro255Leu	44	0		34	4	NM_001199867	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	ENST00000262891.4	37	CCDS56097.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690820	0.88735	.	.	ENSG00000007047	ENST00000262893;ENST00000262891;ENST00000300843	T;T	0.37584	1.19;1.19	4.37	4.37	0.52481	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.62551	0.2437	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.69359	-0.5166	10	0.87932	D	0	.	14.4482	0.67367	0.0:1.0:0.0:0.0	.	121;255;255	Q8N2N5;Q96L34;Q96L34-2	.;MARK4_HUMAN;.	L	285;255;255	ENSP00000262891:P255L;ENSP00000300843:P255L	ENSP00000262891:P255L	P	+	2	0	MARK4	50466784	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.601000	0.82783	2.273000	0.75805	0.561000	0.74099	CCC	.		0.672	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417	
ABCD1	215	ucsc.edu	37	X	153006141	153006141	+	Missense_Mutation	SNP	T	T	A	rs79383557		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chrX:153006141T>A	ENST00000218104.3	+	7	2147	c.1748T>A	c.(1747-1749)gTg>gAg	p.V583E	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	583	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGGACGTCGTGCACCTGCAC	0.652																																					p.V583E													.	ABCD1	59	0			c.T1748A						.																																			SO:0001583	missense	215	exon7			ACGTCGTGCACCT	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1748T>A	X.37:g.153006141T>A	ENSP00000218104:p.Val583Glu	22	3		39	10	NM_000033	Q6GTZ2	Missense_Mutation	SNP	ENST00000218104.3	37	CCDS14728.1	.	.	.	.	.	.	.	.	.	.	T	19.50	3.838612	0.71373	.	.	ENSG00000101986	ENST00000218104	D	0.94862	-3.54	4.76	4.76	0.60689	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000001	D	0.97983	0.9336	H	0.96430	3.82	0.09310	P	1.0	D	0.89917	1.0	D	0.87578	0.998	D	0.99914	1.1216	9	0.87932	D	0	-23.5369	12.377	0.55285	0.0:0.0:0.0:1.0	.	583	P33897	ABCD1_HUMAN	E	583	ENSP00000218104:V583E	ENSP00000218104:V583E	V	+	2	0	ABCD1	152659335	1.000000	0.71417	0.280000	0.24747	0.546000	0.35178	7.508000	0.81686	1.764000	0.52075	0.350000	0.21858	GTG	.		0.652	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033	
ADH5P2	343296	bcgsc.ca	37	1	79986906	79986906	+	IGR	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:79986906G>A								RP4-726F1.1 (196358 upstream) : RP11-339A11.2 (593721 downstream)																							TTGCCACACTGACACCTATAC	0.502																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	343296	.			CACACTGACACCT																													1.37:g.79986906G>A		21	0		15	3	.		RNA	SNP		37																																																																																				.	0	0.502								
KIAA0040	9674	bcgsc.ca	37	1	175129933	175129933	+	Missense_Mutation	SNP	T	T	C	rs150137790		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:175129933T>C	ENST00000423313.1	-	4	753	c.217A>G	c.(217-219)Aag>Gag	p.K73E	KIAA0040_ENST00000567124.1_5'Flank|KIAA0040_ENST00000444639.1_Missense_Mutation_p.K73E|KIAA0040_ENST00000545251.2_Missense_Mutation_p.K73E	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	tccttcttcttcttcttcttc	0.502																																					p.K73E													KIAA0040,colon,carcinoma,0,1	KIAA0040	2	0			c.A217G						.						107.0	90.0	95.0					1																	175129933		692	1591	2283	SO:0001583	missense	9674	exon3			TCTTCTTCTTCTT	D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.217A>G	1.37:g.175129933T>C	ENSP00000462172:p.Lys73Glu	28	0		25	5	NM_001162895	A8K9H6|Q2NKQ0	Missense_Mutation	SNP	ENST00000423313.1	37																																																																																				.		0.502	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000084420.3	NM_014656	
ACTN2	88	bcgsc.ca	37	1	236912525	236912525	+	Silent	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr1:236912525G>A	ENST00000366578.4	+	14	1783	c.1617G>A	c.(1615-1617)ctG>ctA	p.L539L	ACTN2_ENST00000546208.1_Silent_p.L33L|ACTN2_ENST00000542672.1_Silent_p.L539L	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	539					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TGGAGGATCTGCAAGATATGT	0.443																																					p.L539L													.	ACTN2	191	0			c.G1617A						.						116.0	105.0	109.0					1																	236912525		2203	4300	6503	SO:0001819	synonymous_variant	88	exon14			GGATCTGCAAGAT	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1617G>A	1.37:g.236912525G>A		31	0		20	3	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Silent	SNP	ENST00000366578.4	37	CCDS1613.1																																																																																			.		0.443	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
ARHGEF4	50649	bcgsc.ca	37	2	131672961	131672961	+	5'Flank	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:131672961G>T	ENST00000326016.5	+	0	0				ARHGEF4_ENST00000525839.1_5'Flank|ARHGEF4_ENST00000392953.3_5'Flank|ARHGEF4_ENST00000409359.1_Missense_Mutation_p.R151I|ARHGEF4_ENST00000428230.2_5'Flank	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4						apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CTCGCACCAAGAGCTGCTGAT	0.537																																					.													.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	50649	.			CACCAAGAGCTGC	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657		2.37:g.131672961G>T	Exception_encountered	53	0		51	4	.	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	37	CCDS2165.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.797599	0.31777	.	.	ENSG00000136002	ENST00000409359	T	0.45276	0.9	4.65	1.21	0.21127	.	.	.	.	.	T	0.30885	0.0779	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24048	-1.0171	5	.	.	.	.	5.9868	0.19438	0.6608:0.0:0.3392:0.0	.	.	.	.	I	151	ENSP00000386794:R151I	.	R	+	2	0	ARHGEF4	131389431	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.069000	0.11542	-0.036000	0.13669	0.478000	0.44815	AGA	.		0.537	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
GLB1L	79411	bcgsc.ca	37	2	220102658	220102658	+	Silent	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr2:220102658G>T	ENST00000295759.7	-	15	1676	c.1363C>A	c.(1363-1365)Cga>Aga	p.R455R	GLB1L_ENST00000497855.1_5'UTR|GLB1L_ENST00000356283.3_Silent_p.R365R|GLB1L_ENST00000392089.2_Silent_p.R455R|GLB1L_ENST00000409640.1_Silent_p.R365R			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	455					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCATATTTCGCTCCACAACA	0.483																																					p.R455R													.	GLB1L	52	0			c.C1363A						.						91.0	86.0	88.0					2																	220102658		2203	4300	6503	SO:0001819	synonymous_variant	79411	exon15			TATTTCGCTCCAC		CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.1363C>A	2.37:g.220102658G>T		44	0		43	4	NM_024506	Q96DR0	Silent	SNP	ENST00000295759.7	37	CCDS2437.1																																																																																			.		0.483	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256822.2	NM_024506	
NR2C2	7182	bcgsc.ca	37	3	15062263	15062263	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr3:15062263G>T	ENST00000425241.1	+	5	742	c.380G>T	c.(379-381)cGt>cTt	p.R127L	NR2C2_ENST00000323373.6_Missense_Mutation_p.R146L|NR2C2_ENST00000406272.2_Missense_Mutation_p.R127L|NR2C2_ENST00000393102.3_Missense_Mutation_p.R127L			P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	127					cell differentiation (GO:0030154)|gene expression (GO:0010467)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GTTTCAGGCCGTCACTATGGG	0.433																																					p.R146L													.	NR2C2	44	0			c.G437T						.						108.0	112.0	110.0					3																	15062263		2203	4300	6503	SO:0001583	missense	7182	exon6			CAGGCCGTCACTA	L27586	CCDS2621.1, CCDS74905.1	3p25	2013-01-16			ENSG00000177463	ENSG00000177463		"""Nuclear hormone receptors"""	7972	protein-coding gene	gene with protein product		601426		TR4		8661150, 8016112	Standard	XM_005265428		Approved	TAK1, TR2R1, hTAK1	uc003bzi.3	P49116	OTTHUMG00000129839	ENST00000425241.1:c.380G>T	3.37:g.15062263G>T	ENSP00000388387:p.Arg127Leu	68	0		30	3	NM_003298	A8K3H5|B6ZGT8|P55092	Missense_Mutation	SNP	ENST00000425241.1	37		.	.	.	.	.	.	.	.	.	.	G	22.6	4.314589	0.81358	.	.	ENSG00000177463	ENST00000425241;ENST00000323373;ENST00000393102;ENST00000437120;ENST00000406272	D;D;D;D;D	0.96913	-4.17;-4.17;-4.17;-4.17;-4.17	5.46	3.67	0.42095	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.046228	0.85682	D	0.000000	D	0.97111	0.9056	L	0.56396	1.775	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.995	D	0.96810	0.9596	10	0.87932	D	0	.	11.5165	0.50524	0.068:0.1255:0.8065:0.0	.	127;146	P49116;F2YGU2	NR2C2_HUMAN;.	L	127;146;127;146;127	ENSP00000388387:R127L;ENSP00000320447:R146L;ENSP00000376814:R127L;ENSP00000401807:R146L;ENSP00000384463:R127L	ENSP00000320447:R146L	R	+	2	0	NR2C2	15037267	1.000000	0.71417	0.967000	0.41034	0.987000	0.75469	9.681000	0.98653	0.790000	0.33803	0.467000	0.42956	CGT	.		0.433	NR2C2-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000340729.1	NM_003298	
SLC30A5	64924	bcgsc.ca	37	5	68423847	68423847	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr5:68423847G>T	ENST00000396591.3	+	15	2625	c.2015G>T	c.(2014-2016)gGa>gTa	p.G672V	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	672					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		AAAATTGAAGGATTAATATCA	0.368																																					p.G672V													.	SLC30A5	54	0			c.G2015T						.						157.0	162.0	160.0					5																	68423847		2203	4300	6503	SO:0001583	missense	64924	exon15			TTGAAGGATTAAT	AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.2015G>T	5.37:g.68423847G>T	ENSP00000379836:p.Gly672Val	68	0		23	3	NM_022902	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	ENST00000396591.3	37	CCDS3996.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.237304	0.79800	.	.	ENSG00000145740	ENST00000396591;ENST00000438236	T	0.70282	-0.47	5.27	4.4	0.53042	.	0.045357	0.85682	D	0.000000	D	0.88485	0.6449	H	0.95884	3.735	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.91737	0.5401	10	0.87932	D	0	.	13.5333	0.61633	0.0754:0.0:0.9246:0.0	.	672	Q8TAD4	ZNT5_HUMAN	V	672;267	ENSP00000379836:G672V	ENSP00000379836:G672V	G	+	2	0	SLC30A5	68459603	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.411000	0.97342	1.458000	0.47871	0.491000	0.48974	GGA	.		0.368	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254017.2		
HLA-DQA1	3117	bcgsc.ca	37	6	32609758	32609758	+	Missense_Mutation	SNP	A	A	G			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr6:32609758A>G	ENST00000343139.5	+	3	443	c.341A>G	c.(340-342)gAg>gGg	p.E114G	HLA-DQA1_ENST00000395363.1_Missense_Mutation_p.E114G|HLA-DQA1_ENST00000374949.2_Missense_Mutation_p.E114G	NM_002122.3	NP_002113.2	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ alpha 1	113	Alpha-1.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			NS(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						GAGGTTCCTGAGGTCACAGTG	0.507																																					p.E114G													.	HLA-DQA1	52	0			c.A341G						.						118.0	87.0	98.0					6																	32609758		1510	2709	4219	SO:0001583	missense	3117	exon3			TTCCTGAGGTCAC		CCDS4752.1	6p21.3	2013-01-11			ENSG00000196735	ENSG00000196735		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4942	protein-coding gene	gene with protein product		146880		HLA-DQA			Standard	NM_002122		Approved	CELIAC1	uc003obr.3	P01909	OTTHUMG00000031106	ENST00000343139.5:c.341A>G	6.37:g.32609758A>G	ENSP00000339398:p.Glu114Gly	39	0		25	3	NM_002122	O19630|O19706|P01907|P01908|P04225|P04226|P05536|P79553|Q06751|Q29876|Q29994|Q2Q6Y6|Q2Q6Y7|Q2Q6Y8|Q2WCM3|Q30064|Q30067|Q30068|Q30070|Q30071|Q30072|Q30073|Q30086|Q30101|Q5Y7D5|Q5Y7F5|Q6ICU6|Q6PR46|Q6QDB1|Q860W2|Q860W4|Q9BD37|Q9TPM3|Q9UM31	Missense_Mutation	SNP	ENST00000343139.5	37	CCDS4752.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	12.99|12.99	2.103112|2.103112	0.37145|0.37145	.|.	.|.	ENSG00000196735|ENSG00000196735	ENST00000343139;ENST00000395364;ENST00000395363;ENST00000496318;ENST00000374949|ENST00000486548	T;T;T;T|.	0.00617|.	6.19;6.19;6.19;6.19|.	4.1|4.1	4.1|4.1	0.47936|0.47936	.|.	0.333784|.	0.29040|.	U|.	0.013334|.	T|T	0.60222|0.60222	0.2252|0.2252	H|H	0.95260|0.95260	3.645|3.645	0.24121|0.24121	N|N	0.995809|0.995809	D;D|.	0.76494|.	0.999;0.977|.	D;P|.	0.83275|.	0.996;0.874|.	T|T	0.60895|0.60895	-0.7172|-0.7172	10|5	0.87932|.	D|.	0|.	.|.	7.0408|7.0408	0.25019|0.25019	0.798:0.0:0.0:0.202|0.798:0.0:0.0:0.202	.|.	120;114|.	Q59F33;G4XQK2|.	.;.|.	G|G	114|87	ENSP00000339398:E114G;ENSP00000378767:E114G;ENSP00000437302:E114G;ENSP00000364087:E114G|.	ENSP00000339398:E114G|.	E|R	+|+	2|1	0|2	HLA-DQA1|HLA-DQA1	32717736|32717736	0.998000|0.998000	0.40836|0.40836	0.927000|0.927000	0.36925|0.36925	0.105000|0.105000	0.19272|0.19272	2.032000|2.032000	0.41127|0.41127	1.859000|1.859000	0.53934|0.53934	0.533000|0.533000	0.62120|0.62120	GAG|AGG	.		0.507	HLA-DQA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076176.3	NM_002122	
GPNMB	10457	bcgsc.ca	37	7	23306191	23306191	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr7:23306191G>T	ENST00000381990.2	+	7	1271	c.1110G>T	c.(1108-1110)caG>caT	p.Q370H	GPNMB_ENST00000539136.1_Missense_Mutation_p.Q259H|GPNMB_ENST00000258733.4_Missense_Mutation_p.Q358H|GPNMB_ENST00000453162.2_Missense_Mutation_p.Q312H	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	370					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			AAAACTGCCAGATTAACAGAT	0.473																																					p.Q370H													.	GPNMB	88	0			c.G1110T						.						89.0	78.0	82.0					7																	23306191		2203	4300	6503	SO:0001583	missense	10457	exon7			CTGCCAGATTAAC	X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.1110G>T	7.37:g.23306191G>T	ENSP00000371420:p.Gln370His	64	0		58	4	NM_001005340	A4D155|Q6UVX1|Q8N1A1	Missense_Mutation	SNP	ENST00000381990.2	37	CCDS34610.1	.	.	.	.	.	.	.	.	.	.	G	0.228	-1.023131	0.02061	.	.	ENSG00000136235	ENST00000258733;ENST00000435486;ENST00000381990;ENST00000425903;ENST00000539136;ENST00000453162	T;T;T;T	0.14266	2.53;2.53;2.52;2.52	5.89	0.722	0.18225	PKD/Chitinase domain (1);	1.125920	0.06485	N	0.733587	T	0.07188	0.0182	N	0.11560	0.145	0.09310	N	1	B;B;B;B	0.16166	0.013;0.003;0.016;0.004	B;B;B;B	0.18263	0.021;0.006;0.014;0.002	T	0.44314	-0.9336	10	0.15066	T	0.55	-0.0039	7.1017	0.25340	0.1413:0.0:0.2888:0.5699	.	259;312;370;358	F6SKP1;F5GY20;Q14956;Q14956-2	.;.;GPNMB_HUMAN;.	H	358;405;370;253;259;312	ENSP00000258733:Q358H;ENSP00000371420:Q370H;ENSP00000445266:Q259H;ENSP00000405586:Q312H	ENSP00000258733:Q358H	Q	+	3	2	GPNMB	23272716	0.944000	0.32072	0.017000	0.16124	0.059000	0.15707	0.112000	0.15479	-0.138000	0.11434	0.650000	0.86243	CAG	.		0.473	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340	
LOC101927721	101927721	bcgsc.ca	37	7	100944306	100944306	+	RNA	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr7:100944306C>T	ENST00000429254.1	+	0	511																											ttttgaacaacaacataaaga	0.368																																					.													.	.	.	0			.						.																																					0	.			GAACAACAACATA																													7.37:g.100944306C>T		16	0		19	4	.		RNA	SNP	ENST00000429254.1	37																																																																																				.		0.368	RP11-132A1.3-001	KNOWN	basic|exp_conf	antisense	antisense	OTTHUMT00000347487.1		
SH2B2	10603	bcgsc.ca	37	7	101960825	101960825	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr7:101960825G>T	ENST00000536178.1	+	9	1585	c.1540G>T	c.(1540-1542)Ggc>Tgc	p.G514C	SH2B2_ENST00000306803.8_Missense_Mutation_p.G474C			O14492	SH2B2_HUMAN	SH2B adaptor protein 2	475	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191, ECO:0000305}.				actin cytoskeleton organization (GO:0030036)|antigen receptor-mediated signaling pathway (GO:0050851)|B-1 B cell homeostasis (GO:0001922)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cytokine-mediated signaling pathway (GO:0019221)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|regulation of JAK-STAT cascade (GO:0046425)|regulation of metabolic process (GO:0019222)|regulation of Ras protein signal transduction (GO:0046578)|signal transduction (GO:0007165)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stress fiber (GO:0001725)	JAK pathway signal transduction adaptor activity (GO:0008269)|SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	9						GAACGGCCACGGCCAGTGTCA	0.647																																					.													.	SH2B2	22	0			.						.						66.0	73.0	71.0					7																	101960825		2174	4266	6440	SO:0001583	missense	10603	.			GGCCACGGCCAGT	AB000520		7q22.1	2013-02-14			ENSG00000160999	ENSG00000160999		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	17381	protein-coding gene	gene with protein product	"""adaptor protein with pleckstrin homology and src"""	605300				9233773	Standard	XM_005276976		Approved	APS	uc011kko.2	O14492	OTTHUMG00000150652	ENST00000536178.1:c.1540G>T	7.37:g.101960825G>T	ENSP00000440273:p.Gly514Cys	41	0		39	4	.	A6ND74	Missense_Mutation	SNP	ENST00000536178.1	37		.	.	.	.	.	.	.	.	.	.	.	26.0	4.699693	0.88830	.	.	ENSG00000160999	ENST00000536178;ENST00000306803	T;T	0.58797	0.31;0.31	4.57	4.57	0.56435	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.82545	0.5060	H	0.94542	3.55	0.47737	D	0.999501	D	0.89917	1.0	D	0.97110	1.0	D	0.87847	0.2655	9	0.87932	D	0	-41.7132	16.8866	0.86077	0.0:0.0:1.0:0.0	.	475	O14492	SH2B2_HUMAN	C	514;474	ENSP00000440273:G514C;ENSP00000304701:G474C	ENSP00000304701:G474C	G	+	1	0	SH2B2	101747545	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.152000	0.94680	2.531000	0.85337	0.655000	0.94253	GGC	.		0.647	SH2B2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_020979	
LRRC43	254050	bcgsc.ca	37	12	122685442	122685442	+	Silent	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr12:122685442G>T	ENST00000339777.4	+	10	1798	c.1770G>T	c.(1768-1770)gtG>gtT	p.V590V	B3GNT4_ENST00000546192.1_5'Flank|LRRC43_ENST00000537733.1_3'UTR|LRRC43_ENST00000425921.1_Silent_p.V405V|B3GNT4_ENST00000324189.4_5'Flank	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	590										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		ACTTCGGCGTGGTCCGCACAT	0.687																																					p.V590V													LRRC43_ENST00000339777,colon,carcinoma,0,2	LRRC43	105	0			c.G1770T						.						32.0	38.0	36.0					12																	122685442		2089	4209	6298	SO:0001819	synonymous_variant	254050	exon10			CGGCGTGGTCCGC	AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1770G>T	12.37:g.122685442G>T		67	0		51	4	NM_001098519	Q6ZVT9	Silent	SNP	ENST00000339777.4	37	CCDS45001.1																																																																																			.		0.687	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	NM_152759	
TARDBPP2	440142	bcgsc.ca	37	13	60849942	60849942	+	IGR	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr13:60849942G>T								LINC00434 (60862 upstream) : TDRD3 (120648 downstream)																							GAACCAGTCAGGCCCATCGGG	0.502																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	440142	.			CAGTCAGGCCCAT																													13.37:g.60849942G>T		106	0		67	4	.		RNA	SNP		37																																																																																				.	0	0.502								
MYCBP2	23077	bcgsc.ca	37	13	77818052	77818052	+	Missense_Mutation	SNP	C	C	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr13:77818052C>T	ENST00000544440.2	-	16	2319	c.2302G>A	c.(2302-2304)Gct>Act	p.A768T	MYCBP2_ENST00000357337.6_Missense_Mutation_p.A768T|MYCBP2_ENST00000407578.2_Missense_Mutation_p.A806T|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CCACACACAGCACAACCAGAT	0.393																																					p.A806T													.	MYCBP2	1029	0			c.G2416A						.						110.0	97.0	101.0					13																	77818052		2203	4300	6503	SO:0001583	missense	23077	exon16			ACACAGCACAACC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.2302G>A	13.37:g.77818052C>T	ENSP00000444596:p.Ala768Thr	62	0		48	4	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	37		.	.	.	.	.	.	.	.	.	.	C	16.12	3.033227	0.54896	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.28069	1.63;1.63;1.63	5.57	5.57	0.84162	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (1);	0.069365	0.64402	D	0.000012	T	0.23965	0.0580	N	0.20986	0.625	0.41388	D	0.987593	B	0.27823	0.19	B	0.27608	0.081	T	0.05835	-1.0861	10	0.15952	T	0.53	.	19.5546	0.95338	0.0:1.0:0.0:0.0	.	768	O75592	MYCB2_HUMAN	T	768;806;768	ENSP00000349892:A768T;ENSP00000384288:A806T;ENSP00000444596:A768T	ENSP00000349892:A768T	A	-	1	0	MYCBP2	76716053	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.893000	0.63199	2.622000	0.88805	0.655000	0.94253	GCT	.		0.393	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
RFWD3	55159	bcgsc.ca	37	16	74685875	74685875	+	Missense_Mutation	SNP	C	C	T	rs375666291		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr16:74685875C>T	ENST00000361070.4	-	3	761	c.664G>A	c.(664-666)Gca>Aca	p.A222T	RFWD3_ENST00000571750.1_Missense_Mutation_p.A222T	NM_018124.3	NP_060594.3	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	222					DNA repair (GO:0006281)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	26						CCATACTCTGCAGAGCTGTCA	0.468																																					p.A222T													.	RFWD3	49	0			c.G664A						.	C	THR/ALA	0,4396		0,0,2198	116.0	112.0	113.0		664	-2.5	0.7	16		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	RFWD3	NM_018124.3	58	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	benign	222/775	74685875	1,12995	2198	4300	6498	SO:0001583	missense	55159	exon3			ACTCTGCAGAGCT	AK001382	CCDS32486.1	16q22.3	2013-01-09						"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	25539	protein-coding gene	gene with protein product		614151				21504906	Standard	XM_005256021		Approved	FLJ10520, RNF201	uc002fda.3	Q6PCD5		ENST00000361070.4:c.664G>A	16.37:g.74685875C>T	ENSP00000354361:p.Ala222Thr	66	0		45	4	NM_018124	A8K585|B2RE35|D3DUJ8|Q5XKR3|Q9H9Q3|Q9NVT4	Missense_Mutation	SNP	ENST00000361070.4	37	CCDS32486.1	.	.	.	.	.	.	.	.	.	.	C	2.391	-0.339794	0.05243	0.0	1.16E-4	ENSG00000168411	ENST00000361070	T	0.18016	2.24	5.93	-2.46	0.06461	.	1.697160	0.02996	N	0.147526	T	0.06142	0.0159	N	0.02391	-0.57	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31166	-0.9953	10	0.11794	T	0.64	-11.562	6.1385	0.20247	0.1177:0.417:0.0:0.4653	.	222	Q6PCD5	RFWD3_HUMAN	T	222	ENSP00000354361:A222T	ENSP00000354361:A222T	A	-	1	0	RFWD3	73243376	0.000000	0.05858	0.714000	0.30535	0.141000	0.21300	-0.512000	0.06313	-0.176000	0.10707	-0.827000	0.03088	GCA	.		0.468	RFWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436506.2	NM_018124	
NLRP1	22861	bcgsc.ca	37	17	5462653	5462653	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr17:5462653G>T	ENST00000572272.1	-	4	1362	c.1363C>A	c.(1363-1365)Ctg>Atg	p.L455M	NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000354411.3_Missense_Mutation_p.L455M|NLRP1_ENST00000269280.4_Missense_Mutation_p.L455M|NLRP1_ENST00000262467.5_Missense_Mutation_p.L455M|NLRP1_ENST00000345221.3_Missense_Mutation_p.L455M|NLRP1_ENST00000577119.1_Missense_Mutation_p.L455M			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	455	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GCCGTGATCAGGAAGGATGCC	0.587																																					p.L455M													.	NLRP1	358	0			c.C1363A						.						41.0	42.0	41.0					17																	5462653		2203	4300	6503	SO:0001583	missense	22861	exon4			TGATCAGGAAGGA	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.1363C>A	17.37:g.5462653G>T	ENSP00000460475:p.Leu455Met	32	0		18	3	NM_033007	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.522400	0.44866	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221	D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04	4.45	0.0635	0.14349	NACHT nucleoside triphosphatase (1);	0.306880	0.18203	N	0.148447	D	0.89181	0.6642	M	0.82823	2.61	0.09310	N	1	D;D;D;D;D	0.76494	0.999;0.999;0.995;0.999;0.999	D;D;D;D;D	0.68943	0.935;0.935;0.936;0.935;0.961	T	0.78568	-0.2154	10	0.51188	T	0.08	.	3.4608	0.07532	0.2964:0.0:0.5263:0.1773	.	455;455;455;455;455	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;NALP1_HUMAN;.;.	M	455	ENSP00000442029:L455M;ENSP00000262467:L455M;ENSP00000269280:L455M;ENSP00000346390:L455M;ENSP00000324366:L455M	ENSP00000262467:L455M	L	-	1	2	NLRP1	5403377	0.396000	0.25262	0.000000	0.03702	0.025000	0.11179	0.292000	0.19011	-0.016000	0.14127	0.650000	0.86243	CTG	.		0.587	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
RPS3AP49	400652	bcgsc.ca	37	18	57817534	57817534	+	lincRNA	SNP	C	C	T	rs548124561		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr18:57817534C>T	ENST00000588794.1	+	0	346																											CTGCTGGGGACGAGACAGGTG	0.413																																					.													.	.	.	0			.						.																																					400652	.			TGGGGACGAGACA																													18.37:g.57817534C>T		43	0		40	4	.		RNA	SNP	ENST00000588794.1	37																																																																																				.		0.413	RP11-795H16.3-001	KNOWN	basic|exp_conf	lincRNA	lincRNA	OTTHUMT00000449080.1		
MCEMP1	199675	bcgsc.ca	37	19	7741979	7741979	+	Missense_Mutation	SNP	G	G	T			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:7741979G>T	ENST00000333598.3	+	1	466	c.12G>T	c.(10-12)gaG>gaT	p.E4D	C19orf59_ENST00000597445.1_5'UTR|CTD-3214H19.16_ENST00000597959.1_5'Flank	NM_174918.2	NP_777578.2	Q8IX19	MCEM1_HUMAN		4						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)|stomach(1)	5						TGGAAGTGGAGGAAATCTACA	0.552																																					p.E4D													.	C19orf59	15	0			c.G12T						.						47.0	34.0	39.0					19																	7741979		2202	4300	6502	SO:0001583	missense	199675	exon1			AGTGGAGGAAATC																												ENST00000333598.3:c.12G>T	19.37:g.7741979G>T	ENSP00000329920:p.Glu4Asp	68	0		56	4	NM_174918	Q8IX20	Missense_Mutation	SNP	ENST00000333598.3	37	CCDS12183.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010662	0.54361	.	.	ENSG00000183019	ENST00000333598	T	0.27720	1.65	3.93	1.77	0.24775	.	1.533070	0.04590	N	0.396510	T	0.33265	0.0857	N	0.24115	0.695	0.09310	N	1	D	0.61697	0.99	P	0.57324	0.818	T	0.20140	-1.0284	10	0.39692	T	0.17	-0.332	4.4813	0.11767	0.1146:0.0:0.6638:0.2216	.	4	Q8IX19	MCEM1_HUMAN	D	4	ENSP00000329920:E4D	ENSP00000329920:E4D	E	+	3	2	C19orf59	7647979	0.001000	0.12720	0.007000	0.13788	0.078000	0.17371	0.061000	0.14366	0.595000	0.29777	0.555000	0.69702	GAG	.		0.552	C19orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461248.1		
ANO8	57719	bcgsc.ca	37	19	17435833	17435833	+	Silent	SNP	A	A	G			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:17435833A>G	ENST00000159087.4	-	17	3182	c.3024T>C	c.(3022-3024)ccT>ccC	p.P1008P		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	1008					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						GGGCAGGGGGAGGCCGGGTGG	0.642																																					p.P1008P													ANO8,caecum,carcinoma,0,1	ANO8	67	0			c.T3024C						.						59.0	76.0	71.0					19																	17435833		2203	4299	6502	SO:0001819	synonymous_variant	57719	exon17			AGGGGGAGGCCGG	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.3024T>C	19.37:g.17435833A>G		64	3		50	7	NM_020959	A6NIJ0	Silent	SNP	ENST00000159087.4	37	CCDS32949.1																																																																																			.		0.642	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462943.1	XM_050644	
SIGLEC1	6614	bcgsc.ca	37	20	3687244	3687244	+	Silent	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr20:3687244G>A	ENST00000344754.4	-	2	158	c.159C>T	c.(157-159)gaC>gaT	p.D53D	SIGLEC1_ENST00000202578.4_Silent_p.D53D	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	53	Ig-like V-type.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CCGTGATGCCGTCGGGCACCT	0.672																																					p.D53D													SIGLEC1,NS,neuroblastoma,-2,1	SIGLEC1	210	0			c.C159T						.						24.0	20.0	21.0					20																	3687244		2203	4299	6502	SO:0001819	synonymous_variant	6614	exon2			GATGCCGTCGGGC	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.159C>T	20.37:g.3687244G>A		60	0		52	4	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	ENST00000344754.4	37	CCDS13060.1																																																																																			.		0.672	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
DIAPH2	1730	bcgsc.ca	37	X	96212895	96212895	+	Silent	SNP	G	G	A			TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chrX:96212895G>A	ENST00000324765.8	+	16	2030	c.1683G>A	c.(1681-1683)ggG>ggA	p.G561G	DIAPH2_ENST00000373061.3_Silent_p.G561G|DIAPH2_ENST00000373049.4_Silent_p.G561G|DIAPH2_ENST00000373054.4_Silent_p.G557G|DIAPH2_ENST00000355827.4_Silent_p.G561G			O60879	DIAP2_HUMAN	diaphanous-related formin 2	561	FH1.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						CAGGTGTAGGGCCGCCTCCAC	0.542																																					p.G561G													.	DIAPH2	148	0			c.G1683A						.						38.0	35.0	36.0					X																	96212895		2203	4300	6503	SO:0001819	synonymous_variant	1730	exon16			TGTAGGGCCGCCT	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.1683G>A	X.37:g.96212895G>A		77	0		49	4	NM_007309	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Silent	SNP	ENST00000324765.8	37	CCDS14467.1																																																																																			.		0.542	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309	
DMKN	93099	bcgsc.ca	37	19	36002411	36002412	+	Missense_Mutation	DNP	TG	TG	CA	rs56743379|rs111543270|rs199498909		TCGA-YR-A95A-01A-12D-A417-09	TCGA-YR-A95A-10A-01D-A41A-09	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7134f2af-ddbf-48d5-862c-d3bc9e0fc833	820fc180-08c0-4786-9144-171d24ad2266	g.chr19:36002411_36002412TG>CA	ENST00000339686.3	-	5	995_996	c.819_820CA>TG	c.(817-822)agCAgt>agTGgt	p.S274G	DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000440396.1_Missense_Mutation_p.S274G|DMKN_ENST00000424570.2_Missense_Mutation_p.S274G|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000418261.1_Missense_Mutation_p.S274G|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.S274G|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000451297.2_Missense_Mutation_p.S274G|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000458071.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	274	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.S274_S290del(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			ctgctgccactgctgctgccac	0.653																																					p.S274G													.	DMKN	116	1	Deletion - In frame(1)	ovary(1)	c.C819T						.																																			SO:0001583	missense	93099	exon5			GCCACTGCTGCTG	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.819_820delinsCA	19.37:g.36002411_36002412delinsCA	ENSP00000342012:p.Ser274Gly	66	0		50	5	NM_001126058	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	DNP	ENST00000339686.3	37	CCDS12463.1																																																																																			.		0.653	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
