#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SPATA31A5	727905	hgsc.bcm.edu	37	9	41506533	41506537	+	Frame_Shift_Del	DEL	CAACA	CAACA	-			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	CAACA	CAACA	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr9:41506533_41506537delCAACA	ENST00000377621.1	+	4	3834_3838	c.3805_3809delCAACA	c.(3805-3810)caacaafs	p.QQ1269fs	RP11-100J16.5_ENST00000429787.2_RNA	NM_001113541.1	NP_001107013.1	Q5VU36	S31A5_HUMAN	SPATA31 subfamily A, member 5	1269					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGCCAGCAGTCAACAAGCCACTCTC	0.512																																					p.1268_1270del		.											.	.	.	0			c.3804_3808del						.																																			SO:0001589	frameshift_variant	26165	exon4			AGCAGTCAACAAG			9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000233788				32005	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A5"""	FAM75A5		20850414	Standard	NM_001113541		Approved	OTTHUMG00000013204	uc004abu.4	Q5VU36	OTTHUMG00000013204	ENST00000377621.1:c.3805_3809delCAACA	9.37:g.41506533_41506537delCAACA	ENSP00000366847:p.Gln1269fs	127	0		58	0	NM_015667		Frame_Shift_Del	DEL	ENST00000377621.1	37	CCDS47970.1																																																																																			.		0.512	SPATA31A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036962.1	NM_001113541	
BMS1P5	399761	hgsc.bcm.edu	37	10	48944619	48944620	+	RNA	INS	-	-	CTATAAGCATCAGTAC			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr10:48944619_48944620insCTATAAGCATCAGTAC	ENST00000449800.1	-	0	496_497					NR_003611.2				BMS1 pseudogene 5																		AAAGCTGGCATCTATAAGCATC	0.45																																					.		.											.	.	.	0			.						.																																					728053	.			CTGGCATCTATAA			10q11.22	2013-05-22	2007-03-20	2007-03-20	ENSG00000204164				23653	pseudogene	pseudogene			"""BMS1L pseudogene 5"""	BMS1LP5			Standard	NR_003611		Approved	bA508M1.1, OTTHUMG00000018157			OTTHUMG00000018157		10.37:g.48944619_48944620insCTATAAGCATCAGTAC		384	3		213	4	.		RNA	INS	ENST00000449800.1	37																																																																																				.		0.450	BMS1P5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000047906.1		
SPATA31A4	642629	hgsc.bcm.edu	37	9	41321495	41321499	+	Frame_Shift_Del	DEL	TGTTG	TGTTG	-			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	TGTTG	TGTTG	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr9:41321495_41321499delTGTTG	ENST00000429767.1	-	4	3833_3837	c.3805_3809delCAACA	c.(3805-3810)caacaafs	p.QQ1269fs	SPATA31A4_ENST00000603746.1_5'Flank|RP11-95K23.3_ENST00000440883.1_RNA			Q4VX67	S31A4_HUMAN	SPATA31 subfamily A, member 4	1269					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GAGAGTGGCTTGTTGACTGCTGGCT	0.512																																					p.1283_1284del		.											.	.	.	0			c.3848_3852del						.																																			SO:0001589	frameshift_variant	642629	exon4			GTGGCTTGTTGAC			9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000234214				32004	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A4"""	FAM75A4		20850414	Standard			Approved	OTTHUMG00000066731	uc004abt.4	Q4VX67	OTTHUMG00000066731	ENST00000429767.1:c.3805_3809delCAACA	9.37:g.41321495_41321499delTGTTG	ENSP00000411237:p.Gln1269fs	136	0		67	0	NM_001242613		Frame_Shift_Del	DEL	ENST00000429767.1	37																																																																																				.		0.512	SPATA31A4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001242613	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	32613960	32613960	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:32613960T>C	ENST00000421745.2	+	4	922	c.788T>C	c.(787-789)tTa>tCa	p.L263S		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	263					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TCTTACCTCTTACCTAGTGCA	0.448																																					p.L263S	Pancreas(94;175 1509 16028 18060 45422)	.											.	.	.	0			c.T788C						.						114.0	91.0	98.0					2																	32613960		2203	4300	6503	SO:0001583	missense	57448	exon4			ACCTCTTACCTAG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.788T>C	2.37:g.32613960T>C	ENSP00000393596:p.Leu263Ser	164	0		81	27	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	T	19.20	3.781889	0.70222	.	.	ENSG00000115760	ENST00000421745	T	0.77229	-1.08	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000006	D	0.82811	0.5118	L	0.34521	1.04	0.54753	D	0.999986	D	0.71674	0.998	D	0.78314	0.991	D	0.84961	0.0877	10	0.87932	D	0	.	16.0588	0.80822	0.0:0.0:0.0:1.0	.	263	Q9NR09	BIRC6_HUMAN	S	263	ENSP00000393596:L263S	ENSP00000393596:L263S	L	+	2	0	BIRC6	32467464	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.991000	0.88244	2.192000	0.70111	0.528000	0.53228	TTA	.		0.448	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
MOCOS	55034	hgsc.bcm.edu	37	18	33831179	33831179	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr18:33831179C>T	ENST00000261326.5	+	11	2118	c.2097C>T	c.(2095-2097)ggC>ggT	p.G699G		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						CATTTTTTGGCCGTCCTTGTC	0.348																																					p.G699G		.											.	.	.	0			c.C2097T						.						106.0	97.0	100.0					18																	33831179		2203	4300	6503	SO:0001819	synonymous_variant	55034	exon11			TTTTGGCCGTCCT	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.2097C>T	18.37:g.33831179C>T		141	0		96	4	NM_017947		Silent	SNP	ENST00000261326.5	37	CCDS11919.1																																																																																			.		0.348	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
DDX59	83479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	200635799	200635799	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr1:200635799T>C	ENST00000331314.6	-	2	283	c.70A>G	c.(70-72)Ata>Gta	p.I24V	DDX59_ENST00000447706.2_Missense_Mutation_p.I24V|DDX59_ENST00000367348.3_Missense_Mutation_p.I24V|RP11-92G12.3_ENST00000568695.1_lincRNA	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	24						cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						GGTTTAATTATCTTAGCCACA	0.388																																					p.I24V		.											.	.	.	0			c.A70G						.						166.0	164.0	165.0					1																	200635799		2203	4300	6503	SO:0001583	missense	83479	exon2			TAATTATCTTAGC	BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.70A>G	1.37:g.200635799T>C	ENSP00000330460:p.Ile24Val	26	0		51	25	NM_001031725	Q6PJL2|Q8IVW3|Q9H0W3	Missense_Mutation	SNP	ENST00000331314.6	37	CCDS30964.1	.	.	.	.	.	.	.	.	.	.	T	12.62	1.992429	0.35131	.	.	ENSG00000118197	ENST00000447706;ENST00000367348;ENST00000331314;ENST00000436897	T;T;T;T	0.42513	1.58;1.58;1.95;0.97	5.06	5.06	0.68205	.	0.178459	0.48286	D	0.000198	T	0.25457	0.0619	N	0.08118	0	0.24640	N	0.993578	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.22800	-1.0206	10	0.59425	D	0.04	-15.2841	13.4456	0.61138	0.0:0.0:0.0:1.0	.	24;24	B7Z5N6;Q5T1V6	.;DDX59_HUMAN	V	24	ENSP00000394367:I24V;ENSP00000356317:I24V;ENSP00000330460:I24V;ENSP00000391312:I24V	ENSP00000330460:I24V	I	-	1	0	DDX59	198902422	1.000000	0.71417	0.728000	0.30774	0.304000	0.27724	6.852000	0.75430	1.919000	0.55581	0.454000	0.30748	ATA	.		0.388	DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086883.2	NM_001031725.4	
BIN1	274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	127821523	127821523	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:127821523C>T	ENST00000316724.5	-	8	1095	c.684G>A	c.(682-684)ccG>ccA	p.P228P	BIN1_ENST00000357970.3_Silent_p.P228P|BIN1_ENST00000346226.3_Silent_p.P197P|BIN1_ENST00000393040.3_Silent_p.P197P|BIN1_ENST00000466111.1_5'UTR|BIN1_ENST00000393041.3_Silent_p.P197P|BIN1_ENST00000351659.3_Silent_p.P228P|BIN1_ENST00000376113.2_Silent_p.P197P|BIN1_ENST00000352848.3_Silent_p.P197P|BIN1_ENST00000348750.4_Silent_p.P197P|BIN1_ENST00000259238.4_Silent_p.P197P|BIN1_ENST00000409400.1_Silent_p.P197P	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1	228	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		TCCACAGGGACGGCAGCTCCT	0.647																																					p.P228P		.											BIN1_ENST00000259238,NS,carcinoma,0,2	BIN1_ENST00000259238	0	0			c.G684A						.						88.0	80.0	83.0					2																	127821523		2203	4300	6503	SO:0001819	synonymous_variant	274	exon8			CAGGGACGGCAGC	U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.684G>A	2.37:g.127821523C>T		99	0		73	18	NM_139345	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Silent	SNP	ENST00000316724.5	37	CCDS2138.1																																																																																			.		0.647	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254298.2	NM_139343	
TRIP11	9321	hgsc.bcm.edu	37	14	92469882	92469882	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr14:92469882G>T	ENST00000267622.4	-	11	4811	c.4438C>A	c.(4438-4440)Caa>Aaa	p.Q1480K		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1480					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TGTAACGCTTGATATTCTGTT	0.378			T	PDGFRB	AML																																p.Q1480K	Ovarian(84;609 1888 9852 42686)	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	.	.	0			c.C4438A						.						234.0	229.0	230.0					14																	92469882		2203	4300	6503	SO:0001583	missense	9321	exon11			ACGCTTGATATTC	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.4438C>A	14.37:g.92469882G>T	ENSP00000267622:p.Gln1480Lys	145	0		90	4	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	37	CCDS9899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.508|3.508	-0.100469|-0.100469	0.06967|0.06967	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	T|.	0.04049|.	3.72|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.056959|.	0.64402|.	D|.	0.000002|.	T|.	0.42607|.	0.1210|.	L|L	0.34521|0.34521	1.04|1.04	0.31314|0.31314	N|N	0.686823|0.686823	B;P|.	0.35575|.	0.228;0.51|.	B;B|.	0.36567|.	0.121;0.228|.	T|.	0.46456|.	-0.9190|.	10|.	0.31617|.	T|.	0.26|.	.|.	9.8219|9.8219	0.40887|0.40887	0.0716:0.0:0.7894:0.1389|0.0716:0.0:0.7894:0.1389	.|.	1216;1480|.	F5H1Z0;Q15643|.	.;TRIPB_HUMAN|.	K|X	1480;1216|1195	ENSP00000267622:Q1480K|.	ENSP00000267622:Q1480K|.	Q|S	-|-	1|2	0|0	TRIP11|TRIP11	91539635|91539635	1.000000|1.000000	0.71417|0.71417	0.380000|0.380000	0.26093|0.26093	0.089000|0.089000	0.18198|0.18198	2.597000|2.597000	0.46214|0.46214	2.684000|2.684000	0.91462|0.91462	0.313000|0.313000	0.20887|0.20887	CAA|TCA	.		0.378	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
SLC3A2	6520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62655849	62655849	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:62655849T>C	ENST00000377890.2	+	12	1745	c.1577T>C	c.(1576-1578)cTg>cCg	p.L526P	SLC3A2_ENST00000377889.2_Missense_Mutation_p.L464P|SLC3A2_ENST00000536981.1_Missense_Mutation_p.L71P|SLC3A2_ENST00000535296.1_Missense_Mutation_p.L495P|SLC3A2_ENST00000377891.2_Missense_Mutation_p.L527P|SLC3A2_ENST00000377892.1_Missense_Mutation_p.L557P|SLC3A2_ENST00000538682.1_3'UTR|SLC3A2_ENST00000338663.7_Missense_Mutation_p.L425P	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	526					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						TTCCGGCGGCTGAGTGACCAG	0.587																																					p.L527P		.											.	.	.	0			c.T1580C						.						52.0	50.0	51.0					11																	62655849		2201	4298	6499	SO:0001583	missense	6520	exon12			GGCGGCTGAGTGA		CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.1577T>C	11.37:g.62655849T>C	ENSP00000367122:p.Leu526Pro	89	0		52	18	NM_001012662	Q13543	Missense_Mutation	SNP	ENST00000377890.2	37	CCDS8039.2	.	.	.	.	.	.	.	.	.	.	T	18.19	3.568040	0.65651	.	.	ENSG00000168003	ENST00000377892;ENST00000377891;ENST00000377890;ENST00000542007;ENST00000377889;ENST00000535296;ENST00000338663;ENST00000422606;ENST00000536981	D;D;D;D;D;D;D	0.99820	-5.74;-5.78;-5.8;-5.74;-5.74;-5.75;-6.93	4.67	4.67	0.58626	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.255214	0.31936	N	0.006838	D	0.99840	0.9927	M	0.92691	3.335	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.96787	0.9579	10	0.87932	D	0	-11.3887	12.1217	0.53895	0.0:0.0:0.0:1.0	.	464;495;526;425;557	P08195-3;F5GZS6;P08195;P08195-2;P08195-4	.;.;4F2_HUMAN;.;.	P	557;527;526;527;464;495;425;407;71	ENSP00000367124:L557P;ENSP00000367123:L527P;ENSP00000367122:L526P;ENSP00000367121:L464P;ENSP00000444236:L495P;ENSP00000340815:L425P;ENSP00000444439:L71P	ENSP00000340815:L425P	L	+	2	0	SLC3A2	62412425	1.000000	0.71417	0.993000	0.49108	0.805000	0.45488	6.308000	0.72820	1.762000	0.52044	0.248000	0.18094	CTG	.		0.587	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157306.1	NM_001012661	
MAGED1	9500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	51639969	51639969	+	Silent	SNP	A	A	G			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chrX:51639969A>G	ENST00000375722.1	+	4	1470	c.1218A>G	c.(1216-1218)ctA>ctG	p.L406L	MAGED1_ENST00000326587.7_Silent_p.L406L|MAGED1_ENST00000375772.3_Silent_p.L406L|MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000375695.2_Silent_p.L462L			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	406	22 X 6 AA tandem repeats of W-[PQ]-X-P-X- X.|Pro-rich.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					ACTGGCCGCTACCACCCGACT	0.637										Multiple Myeloma(10;0.10)																											p.L462L		.											.	.	.	0			c.A1386G						.						29.0	19.0	22.0					X																	51639969		2199	4293	6492	SO:0001819	synonymous_variant	9500	exon5			GCCGCTACCACCC	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1218A>G	X.37:g.51639969A>G		85	0		60	20	NM_001005333	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Silent	SNP	ENST00000375722.1	37	CCDS14337.1																																																																																			.		0.637	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332	
ZDHHC20	253832	hgsc.bcm.edu	37	13	21965800	21965800	+	Intron	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr13:21965800G>T	ENST00000400590.3	-	8	926				ZDHHC20_ENST00000382466.3_Intron|ZDHHC20_ENST00000494731.1_Intron|ZDHHC20_ENST00000320220.9_Intron|ZDHHC20_ENST00000415724.1_Intron|ZDHHC20_ENST00000542645.1_Intron			Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20						protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		TTCTTCTCTAGATTTCATATT	0.363																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	650794	.			TCTCTAGATTTCA	AK090979	CCDS45017.1, CCDS73551.1	13q12.11	2008-10-21			ENSG00000180776	ENSG00000180776		"""Zinc fingers, DHHC-type"""	20749	protein-coding gene	gene with protein product							Standard	NM_153251		Approved	FLJ25952	uc001uoa.2	Q5W0Z9	OTTHUMG00000017410	ENST00000400590.3:c.727+60C>A	13.37:g.21965800G>T		102	0		63	4	.	A8MTV9|C9JG20|I6L9D4|Q2TB82|Q6NVU8	RNA	SNP	ENST00000400590.3	37																																																																																				.		0.363	ZDHHC20-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000045994.1	NM_153251	
PDZD2	23037	hgsc.bcm.edu	37	5	32077650	32077650	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr5:32077650C>T	ENST00000438447.1	+	19	4008	c.3620C>T	c.(3619-3621)gCc>gTc	p.A1207V	PDZD2_ENST00000282493.3_Missense_Mutation_p.A1207V			O15018	PDZD2_HUMAN	PDZ domain containing 2	1207					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CATCTGGATGCCAGCCACCTC	0.493																																					p.A1207V		.											PDZD2,NS,carcinoma,0,1	PDZD2	0	0			c.C3620T						.						107.0	103.0	104.0					5																	32077650		2203	4300	6503	SO:0001583	missense	23037	exon18			TGGATGCCAGCCA	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3620C>T	5.37:g.32077650C>T	ENSP00000402033:p.Ala1207Val	56	0		32	2	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.784284	0.31593	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.06371	3.31;3.31	4.98	3.19	0.36642	.	0.972277	0.08394	N	0.952434	T	0.06690	0.0171	L	0.44542	1.39	0.09310	N	1	B;B	0.20368	0.044;0.01	B;B	0.15484	0.013;0.012	T	0.47275	-0.9130	10	0.14656	T	0.56	.	8.6779	0.34189	0.0:0.7626:0.1522:0.0852	.	1033;1207	B4E3P2;O15018	.;PDZD2_HUMAN	V	1207;1012;1207	ENSP00000402033:A1207V;ENSP00000282493:A1207V	ENSP00000282493:A1207V	A	+	2	0	PDZD2	32113407	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	1.061000	0.30542	0.509000	0.28195	-1.147000	0.01851	GCC	.		0.493	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
SDHAP1	255812	hgsc.bcm.edu;broad.mit.edu	37	3	195690096	195690096	+	RNA	SNP	T	T	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr3:195690096T>C	ENST00000427841.1	-	0	2325					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		AATGTACTCCTTCTTCCCCAG	0.458																																					.	Ovarian(67;1158 1227 12109 20189 43170)	.											.	.	.	0			.						.																																					255812	.			TACTCCTTCTTCC	BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195690096T>C		70	0		29	11	.		RNA	SNP	ENST00000427841.1	37																																																																																				.		0.458	SDHAP1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000341367.1		
FMN2	56776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	240370270	240370270	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr1:240370270G>T	ENST00000319653.9	+	5	2388	c.2158G>T	c.(2158-2160)Gat>Tat	p.D720Y		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	720					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AGCCTCAGGCGATGTCTGTCT	0.517																																					p.D720Y		.											.	.	.	0			c.G2158T						.						70.0	68.0	68.0					1																	240370270		2203	4300	6503	SO:0001583	missense	56776	exon5			TCAGGCGATGTCT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2158G>T	1.37:g.240370270G>T	ENSP00000318884:p.Asp720Tyr	54	0		65	16	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	9.522	1.108566	0.20714	.	.	ENSG00000155816	ENST00000447095;ENST00000319653	T	0.32272	1.46	5.06	4.15	0.48705	.	0.637295	0.14913	N	0.291104	T	0.40595	0.1123	L	0.47716	1.5	0.48087	D	0.999582	D	0.55385	0.971	P	0.52672	0.706	T	0.31308	-0.9948	10	0.87932	D	0	.	13.4601	0.61223	0.0752:0.0:0.9248:0.0	.	720	Q9NZ56	FMN2_HUMAN	Y	157;720	ENSP00000318884:D720Y	ENSP00000318884:D720Y	D	+	1	0	FMN2	238436893	0.010000	0.17322	0.003000	0.11579	0.001000	0.01503	1.726000	0.38085	1.374000	0.46228	0.655000	0.94253	GAT	.		0.517	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
KIT	3815	hgsc.bcm.edu	37	4	55597561	55597561	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr4:55597561G>A	ENST00000288135.5	+	15	2306	c.2209G>A	c.(2209-2211)Gac>Aac	p.D737N		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	737	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> N (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D737N(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AACCAAGGCCGACAAAAGGAG	0.403		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D737N		.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,carcinoma,0,2	KIT	0	1	Substitution - Missense(1)	large_intestine(1)	c.G2209A						.						119.0	112.0	114.0					4																	55597561		2203	4300	6503	SO:0001583	missense	3815	exon15	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	AAGGCCGACAAAA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2209G>A	4.37:g.55597561G>A	ENSP00000288135:p.Asp737Asn	105	1		42	2	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732125	0.69189	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	T;T	0.78595	-1.19;-1.19	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.182364	0.38111	N	0.001817	T	0.81531	0.4842	L	0.37561	1.115	0.58432	D	0.999997	P;D	0.56521	0.928;0.976	P;P	0.57679	0.448;0.825	T	0.80634	-0.1295	10	0.44086	T	0.13	.	19.8043	0.96521	0.0:0.0:1.0:0.0	.	733;737	P10721-2;P10721	.;KIT_HUMAN	N	737;733	ENSP00000288135:D737N;ENSP00000390987:D733N	ENSP00000288135:D737N	D	+	1	0	KIT	55292318	1.000000	0.71417	0.827000	0.32855	0.030000	0.12068	7.090000	0.76916	2.683000	0.91414	0.655000	0.94253	GAC	.		0.403	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
MUC4	4585	hgsc.bcm.edu	37	3	195509579	195509579	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr3:195509579C>T	ENST00000463781.3	-	2	9331	c.8872G>A	c.(8872-8874)Gcc>Acc	p.A2958T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2958T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGAGGTGGCGTGACCTGTG	0.592																																					p.A2958T		.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4_ENST00000463781	0	0			c.G8872A						.																																			SO:0001583	missense	4585	exon2			AGGTGGCGTGACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8872G>A	3.37:g.195509579C>T	ENSP00000417498:p.Ala2958Thr	93	2		51	4	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	3.910	-0.020251	0.07634	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.38;1.37	.	.	.	.	.	.	.	.	T	0.17704	0.0425	N	0.19112	0.55	0.09310	N	1	P	0.50710	0.938	B	0.39379	0.298	T	0.14117	-1.0484	7	.	.	.	.	4.6129	0.12411	0.0:0.5198:0.0:0.4802	.	2830	E7ESK3	.	T	2958	ENSP00000417498:A2958T;ENSP00000420243:A2958T	.	A	-	1	0	MUC4	196994358	0.001000	0.12720	0.003000	0.11579	0.000000	0.00434	-0.021000	0.12504	-0.437000	0.07243	0.000000	0.15137	GCC	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
ZNF653	115950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11594920	11594920	+	Missense_Mutation	SNP	G	G	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr19:11594920G>C	ENST00000293771.5	-	8	1743	c.1607C>G	c.(1606-1608)tCc>tGc	p.S536C	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	536					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						CCTCTTGAAGGACTTGCCGCA	0.647																																					p.S536C	Pancreas(83;980 1446 4542 6441 43352)	.											.	.	.	0			c.C1607G						.						47.0	38.0	41.0					19																	11594920		2190	4268	6458	SO:0001583	missense	115950	exon8			TTGAAGGACTTGC	AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1607C>G	19.37:g.11594920G>C	ENSP00000293771:p.Ser536Cys	68	0		45	18	NM_138783	Q96AS7	Missense_Mutation	SNP	ENST00000293771.5	37	CCDS12261.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402466	0.83230	.	.	ENSG00000161914	ENST00000293771	T	0.19806	2.12	4.58	4.58	0.56647	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.43875	0.1267	L	0.60957	1.885	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.42464	-0.9450	10	0.87932	D	0	-33.505	16.5255	0.84330	0.0:0.0:1.0:0.0	.	536	Q96CK0	ZN653_HUMAN	C	536	ENSP00000293771:S536C	ENSP00000293771:S536C	S	-	2	0	ZNF653	11455920	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.539000	0.82063	2.275000	0.75901	0.313000	0.20887	TCC	.		0.647	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458836.2	NM_138783	
FBXO24	26261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	100198331	100198331	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr7:100198331G>A	ENST00000241071.6	+	10	1874	c.1552G>A	c.(1552-1554)Gcc>Acc	p.A518T	FBXO24_ENST00000360609.2_3'UTR|PCOLCE-AS1_ENST00000442166.2_RNA|PCOLCE_ENST00000223061.5_5'Flank|PCOLCE-AS1_ENST00000544873.1_RNA|PCOLCE-AS1_ENST00000446022.1_RNA|FBXO24_ENST00000468962.1_Missense_Mutation_p.A506T|FBXO24_ENST00000427939.2_Missense_Mutation_p.A556T	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	518					protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					GATGGCCCAGGCCTGCGAGGA	0.677																																					p.A556T		.											.	.	.	0			c.G1666A						.						54.0	50.0	51.0					7																	100198331		2203	4300	6503	SO:0001583	missense	26261	exon10			GCCCAGGCCTGCG	AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.1552G>A	7.37:g.100198331G>A	ENSP00000241071:p.Ala518Thr	49	0		32	15	NM_012172	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	37	CCDS5698.1	.	.	.	.	.	.	.	.	.	.	g	10.97	1.501945	0.26949	.	.	ENSG00000106336	ENST00000241071;ENST00000468962;ENST00000427939	T;T;T	0.17691	2.28;2.29;2.26	4.31	4.31	0.51392	.	0.000000	0.41500	D	0.000873	T	0.10337	0.0253	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.25719	0.132;0.132;0.132;0.132	B;B;B;B	0.22152	0.021;0.038;0.021;0.021	T	0.09400	-1.0676	10	0.66056	D	0.02	-15.6761	10.2567	0.43401	0.0:0.2013:0.7987:0.0	.	506;556;518;518	B4DY42;B4DX91;A4D2D3;O75426	.;.;.;FBX24_HUMAN	T	518;506;556	ENSP00000241071:A518T;ENSP00000420239:A506T;ENSP00000416558:A556T	ENSP00000241071:A518T	A	+	1	0	FBXO24	100036267	1.000000	0.71417	0.981000	0.43875	0.313000	0.28021	5.019000	0.64060	2.234000	0.73211	0.454000	0.30748	GCC	.		0.677	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1		
GALNT5	11227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	158157491	158157491	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:158157491A>G	ENST00000259056.4	+	7	2904	c.2419A>G	c.(2419-2421)Att>Gtt	p.I807V	GALNT5_ENST00000463418.1_3'UTR|RN7SKP281_ENST00000410472.1_RNA	NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	807	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						AAGGGCTCCCATTGTGAGAGC	0.398																																					p.I807V		.											.	.	.	0			c.A2419G						.						80.0	78.0	79.0					2																	158157491		2203	4300	6503	SO:0001583	missense	11227	exon7			GCTCCCATTGTGA	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.2419A>G	2.37:g.158157491A>G	ENSP00000259056:p.Ile807Val	78	0		64	35	NM_014568	A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	37	CCDS2203.1	.	.	.	.	.	.	.	.	.	.	A	8.125	0.781751	0.16120	.	.	ENSG00000136542	ENST00000259056	T	0.69175	-0.38	5.76	-3.51	0.04696	Ricin B-related lectin (1);Ricin B lectin (1);	0.586637	0.16010	N	0.233856	T	0.37598	0.1009	N	0.05124	-0.11	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	10	0.29301	T	0.29	.	9.6646	0.39977	0.1983:0.4814:0.3203:0.0	.	807	Q7Z7M9	GALT5_HUMAN	V	807	ENSP00000259056:I807V	ENSP00000259056:I807V	I	+	1	0	GALNT5	157865737	0.000000	0.05858	0.951000	0.38953	0.984000	0.73092	-0.126000	0.10563	-0.312000	0.08741	0.460000	0.39030	ATT	.		0.398	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568	
CUX1	1523	hgsc.bcm.edu	37	7	101845271	101845271	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr7:101845271C>T	ENST00000292535.7	+	18	2732	c.2694C>T	c.(2692-2694)acC>acT	p.T898T	CUX1_ENST00000560541.1_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Silent_p.T740T|CUX1_ENST00000546411.2_Silent_p.T796T|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Silent_p.T909T|CUX1_ENST00000549414.2_Silent_p.T876T|CUX1_ENST00000550008.2_Silent_p.T842T	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	898					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						TGAGTCTGACCGGGGCCAGCC	0.672																																					p.T909T		.											CUX1,colon,carcinoma,0,1	CUX1	0	0			c.C2727T						.						91.0	87.0	88.0					7																	101845271		2203	4300	6503	SO:0001819	synonymous_variant	1523	exon18			TCTGACCGGGGCC	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2694C>T	7.37:g.101845271C>T		110	0		70	2	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	ENST00000292535.7	37	CCDS5721.1																																																																																			.		0.672	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
PXDN	7837	hgsc.bcm.edu	37	2	1658220	1658220	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:1658220G>A	ENST00000252804.4	-	15	1948	c.1898C>T	c.(1897-1899)gCg>gTg	p.A633V		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	633					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.A633V(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GTCAACAGTCGCAATCGCTTC	0.458																																					p.A633V		.											PXDN,NS,NS,0,1	PXDN	0	1	Substitution - Missense(1)	pancreas(1)	c.C1898T						.						115.0	114.0	115.0					2																	1658220		2023	4178	6201	SO:0001583	missense	7837	exon15			ACAGTCGCAATCG	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1898C>T	2.37:g.1658220G>A	ENSP00000252804:p.Ala633Val	72	0		37	2	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.30|10.30	1.313235|1.313235	0.23908|0.23908	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000252804|ENST00000433670	T|.	0.61392|.	0.11|.	5.53|5.53	4.64|4.64	0.57946|0.57946	.|.	0.180309|.	0.51477|.	D|.	0.000100|.	T|.	0.40791|.	0.1131|.	N|N	0.14661|0.14661	0.345|0.345	0.46701|0.46701	D|D	0.999161|0.999161	D;P|.	0.54964|.	0.969;0.516|.	P;B|.	0.48063|.	0.565;0.18|.	T|.	0.24119|.	-1.0169|.	10|.	0.29301|.	T|.	0.29|.	-34.2735|-34.2735	12.5302|12.5302	0.56111|0.56111	0.0:0.127:0.741:0.132|0.0:0.127:0.741:0.132	.|.	633;633|.	Q92626-2;Q92626|.	.;PXDN_HUMAN|.	V|X	633|629	ENSP00000252804:A633V|.	ENSP00000252804:A633V|.	A|R	-|-	2|1	0|2	PXDN|PXDN	1637227|1637227	1.000000|1.000000	0.71417|0.71417	0.152000|0.152000	0.22495|0.22495	0.100000|0.100000	0.18952|0.18952	3.625000|3.625000	0.54238|0.54238	1.313000|1.313000	0.45069|0.45069	0.579000|0.579000	0.79373|0.79373	GCG|CGA	.		0.458	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
IL1F10	84639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	113831950	113831950	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:113831950A>G	ENST00000393197.2	+	2	498	c.77A>G	c.(76-78)cAg>cGg	p.Q26R	IL1F10_ENST00000341010.2_Missense_Mutation_p.Q26R|IL1F10_ENST00000337569.3_Intron	NM_032556.5	NP_115945.4	Q8WWZ1	IL1FA_HUMAN	interleukin 1 family, member 10 (theta)	26						extracellular space (GO:0005615)				endometrium(1)|lung(6)|ovary(1)	8						AGAGATGGCCAGCTGCTGGTG	0.537																																					p.Q26R		.											.	.	.	0			c.A77G						.						111.0	99.0	103.0					2																	113831950		2203	4300	6503	SO:0001583	missense	84639	exon3			ATGGCCAGCTGCT	AY026753	CCDS2112.1	2q13	2011-07-14			ENSG00000136697	ENSG00000136697		"""Interleukins and interleukin receptors"""	15552	protein-coding gene	gene with protein product	"""FIL1- theta"", ""interleukin-1 receptor antagonist FKSG75"""	615296				11747621, 11991723, 11991722	Standard	NM_173161		Approved	FKSG75, IL-1HY2, IL-1F10, IL1-theta, MGC11983, MGC119832, MGC119833	uc002tiu.3	Q8WWZ1	OTTHUMG00000131339	ENST00000393197.2:c.77A>G	2.37:g.113831950A>G	ENSP00000376893:p.Gln26Arg	40	0		36	10	NM_173161	Q53SR9|Q56AT8|Q7RTZ5|Q969H5|Q9BYX1	Missense_Mutation	SNP	ENST00000393197.2	37	CCDS2112.1	.	.	.	.	.	.	.	.	.	.	a	11.52	1.664261	0.29604	.	.	ENSG00000136697	ENST00000341010;ENST00000393197	T;T	0.10005	2.92;2.92	4.61	3.46	0.39613	.	4.095920	0.01165	N	0.006720	T	0.19327	0.0464	M	0.77103	2.36	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.31888	-0.9927	10	0.54805	T	0.06	-15.1639	7.2355	0.26067	0.895:0.0:0.105:0.0	.	26	Q8WWZ1	IL1FA_HUMAN	R	26	ENSP00000341794:Q26R;ENSP00000376893:Q26R	ENSP00000341794:Q26R	Q	+	2	0	IL1F10	113548421	0.989000	0.36119	0.999000	0.59377	0.510000	0.34073	1.148000	0.31614	0.873000	0.35799	0.529000	0.55759	CAG	.		0.537	IL1F10-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330725.1	NM_173161	
HEPHL1	341208	hgsc.bcm.edu	37	11	93834378	93834378	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:93834378G>T	ENST00000315765.9	+	14	2460	c.2452G>T	c.(2452-2454)Gag>Tag	p.E818*		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	818	Plastocyanin-like 5.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GATTCATGCTGAGGTGGGCAA	0.433																																					p.E818X		.											.	.	.	0			c.G2452T						.						145.0	137.0	140.0					11																	93834378		1898	4113	6011	SO:0001587	stop_gained	341208	exon14			CATGCTGAGGTGG	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2452G>T	11.37:g.93834378G>T	ENSP00000313699:p.Glu818*	81	0		47	4	NM_001098672	Q3C1W7	Nonsense_Mutation	SNP	ENST00000315765.9	37	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	G	37	6.516699	0.97629	.	.	ENSG00000181333	ENST00000315765	.	.	.	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	19.5157	0.95162	0.0:0.0:1.0:0.0	.	.	.	.	X	818	.	ENSP00000313699:E818X	E	+	1	0	HEPHL1	93474026	1.000000	0.71417	0.965000	0.40720	0.269000	0.26545	7.017000	0.76399	2.604000	0.88044	0.557000	0.71058	GAG	.		0.433	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	
PTPN12	5782	hgsc.bcm.edu	37	7	77230111	77230111	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr7:77230111G>T	ENST00000248594.6	+	8	955	c.683G>T	c.(682-684)tGt>tTt	p.C228F	PTPN12_ENST00000435495.2_Missense_Mutation_p.C98F|PTPN12_ENST00000415482.2_Missense_Mutation_p.C109F	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	228	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						GTTCCTATTTGTATTCATTGC	0.308																																					p.C228F		.											PTPN12,NS,carcinoma,0,1	PTPN12	0	0			c.G683T						.						78.0	72.0	74.0					7																	77230111		2203	4300	6503	SO:0001583	missense	5782	exon8			CTATTTGTATTCA		CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.683G>T	7.37:g.77230111G>T	ENSP00000248594:p.Cys228Phe	70	0		36	2	NM_002835	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	37	CCDS5592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.6|23.6	4.437093|4.437093	0.83885|0.83885	.|.	.|.	ENSG00000127947|ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000543073;ENST00000435495|ENST00000522115	D;D;D|.	0.83335|.	-1.71;-1.71;-1.71|.	5.17|5.17	5.17|5.17	0.71159|0.71159	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83422|0.83422	0.5251|0.5251	M|M	0.86651|0.86651	2.83|2.83	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.85667|0.85667	0.1292|0.1292	10|5	0.87932|.	D|.	0|.	.|.	18.67|18.67	0.91507|0.91507	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	228|.	Q05209|.	PTN12_HUMAN|.	F|L	228;109;109;98|167	ENSP00000248594:C228F;ENSP00000392429:C109F;ENSP00000397991:C98F|.	ENSP00000248594:C228F|.	C|V	+|+	2|1	0|0	PTPN12|PTPN12	77068047|77068047	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.807000|9.807000	0.99171|0.99171	2.422000|2.422000	0.82143|0.82143	0.557000|0.557000	0.71058|0.71058	TGT|GTA	.		0.308	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3		
ITGB1	3688	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	10	33211229	33211229	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr10:33211229C>T	ENST00000396033.2	-	9	1219	c.1084G>A	c.(1084-1086)Gca>Aca	p.A362T	ITGB1_ENST00000423113.1_Missense_Mutation_p.A362T|ITGB1_ENST00000302278.3_Missense_Mutation_p.A362T|ITGB1_ENST00000374956.4_Missense_Mutation_p.A362T	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	362	VWFA.				axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	CTAGAATTTGCAGATAATGTT	0.328																																					p.A362T		.											.	.	.	0			c.G1084A						.						174.0	159.0	164.0					10																	33211229		2203	4300	6503	SO:0001583	missense	3688	exon9			AATTTGCAGATAA	BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.1084G>A	10.37:g.33211229C>T	ENSP00000379350:p.Ala362Thr	71	0		40	4	NM_002211	A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Missense_Mutation	SNP	ENST00000396033.2	37	CCDS7174.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.386352	0.42308	.	.	ENSG00000150093	ENST00000396033;ENST00000423113;ENST00000302278;ENST00000374956	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.84	3.97	0.46021	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.214881	0.48286	D	0.000183	T	0.49898	0.1584	L	0.31752	0.955	0.30704	N	0.75003	B;B;B;B;B	0.17038	0.008;0.01;0.004;0.009;0.02	B;B;B;B;B	0.17722	0.009;0.015;0.019;0.009;0.014	T	0.47649	-0.9101	10	0.30078	T	0.28	.	14.2044	0.65725	0.5545:0.4455:0.0:0.0	.	362;362;362;362;362	P05556-2;P05556;P05556-5;P05556-3;P05556-4	.;ITB1_HUMAN;.;.;.	T	362	ENSP00000379350:A362T;ENSP00000388694:A362T;ENSP00000303351:A362T;ENSP00000364094:A362T	ENSP00000303351:A362T	A	-	1	0	ITGB1	33251235	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.503000	0.35715	0.808000	0.34231	-0.953000	0.02652	GCA	.		0.328	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1	NM_002211	
GUSBP4	375513	hgsc.bcm.edu	37	6	58256176	58256176	+	IGR	SNP	T	T	C	rs202232967		TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr6:58256176T>C								XXbac-BPGBPG55C20.2 (15987 upstream) : LINC00680 (16184 downstream)																							atcATCACaataaataaataa	0.373																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	375513	.			TCACAATAAATAA																													6.37:g.58256176T>C		37	0		26	11	.		RNA	SNP		37																																																																																				.	0	0.373								
ATP1A3	478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42489123	42489123	+	Missense_Mutation	SNP	G	G	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr19:42489123G>C	ENST00000302102.5	-	8	1090	c.940C>G	c.(940-942)Ctc>Gtc	p.L314V	ATP1A3_ENST00000543770.1_Missense_Mutation_p.L325V|ATP1A3_ENST00000545399.1_Missense_Mutation_p.L327V|ATP1A3_ENST00000602133.1_Missense_Mutation_p.L284V	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	314					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						ATGCCGATGAGGAAGATGACA	0.602																																					p.L327V		.											.	.	.	0			c.C979G						.						115.0	87.0	96.0					19																	42489123		2203	4300	6503	SO:0001583	missense	478	exon8			CGATGAGGAAGAT		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.940C>G	19.37:g.42489123G>C	ENSP00000302397:p.Leu314Val	61	0		33	10	NM_001256214	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	37	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293342	0.80914	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67	4.47	4.47	0.54385	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.93641	0.7969	L	0.55743	1.74	0.80722	D	1	P;D;D;D	0.76494	0.469;0.999;0.999;0.999	B;D;D;D	0.91635	0.324;0.998;0.999;0.999	D	0.94161	0.7414	10	0.66056	D	0.02	.	15.0147	0.71576	0.0:0.0:1.0:0.0	.	327;325;314;314	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	V	314;314;327;284;58;325	ENSP00000302397:L314V;ENSP00000411503:L314V;ENSP00000444688:L327V;ENSP00000437577:L325V	ENSP00000302397:L314V	L	-	1	0	ATP1A3	47180963	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.643000	0.98464	2.230000	0.72887	0.491000	0.48974	CTC	.		0.602	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
FZD5	7855	hgsc.bcm.edu	37	2	208632294	208632294	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:208632294G>T	ENST00000295417.3	-	2	1723	c.1170C>A	c.(1168-1170)tgC>tgA	p.C390*		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	390					angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		TGCCCACGTAGCAGATGCCGG	0.672																																					p.C390X		.											.	.	.	0			c.C1170A						.						41.0	42.0	41.0					2																	208632294		2203	4299	6502	SO:0001587	stop_gained	7855	exon2			CACGTAGCAGATG	U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.1170C>A	2.37:g.208632294G>T	ENSP00000354607:p.Cys390*	47	0		45	4	NM_003468	A8K2X1|B2RCZ1|Q53R22	Nonsense_Mutation	SNP	ENST00000295417.3	37	CCDS33366.1	.	.	.	.	.	.	.	.	.	.	G	42	9.560430	0.99205	.	.	ENSG00000163251	ENST00000295417	.	.	.	5.29	4.4	0.53042	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2686	0.66138	0.073:0.0:0.927:0.0	.	.	.	.	X	390	.	ENSP00000354607:C390X	C	-	3	2	FZD5	208340539	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.106000	0.57804	1.193000	0.43086	0.555000	0.69702	TGC	.		0.672	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337060.1	NM_003468	
HNRNPA2B1	3181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	26237321	26237321	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr7:26237321A>G	ENST00000354667.4	-	3	242	c.74T>C	c.(73-75)aTt>aCt	p.I25T	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.I13T	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	25	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						TAAGCCACCAATAAAGAGCTT	0.343			T	ETV1	prostate																																p.I25T		.		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	.	.	.	0			c.T74C						.						74.0	71.0	72.0					7																	26237321		2203	4300	6503	SO:0001583	missense	3181	exon3			CCACCAATAAAGA	D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.74T>C	7.37:g.26237321A>G	ENSP00000346694:p.Ile25Thr	154	0		66	41	NM_031243	A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	ENST00000354667.4	37	CCDS43557.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.736135	0.89482	.	.	ENSG00000122566	ENST00000354667;ENST00000356674;ENST00000409814	T;T	0.09163	3.01;3.01	5.95	5.95	0.96441	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000002	T	0.43853	0.1266	M	0.92555	3.32	0.48901	D	0.99972	D;D	0.71674	0.998;0.995	D;D	0.74348	0.958;0.983	T	0.56275	-0.8006	10	0.87932	D	0	.	16.4069	0.83677	1.0:0.0:0.0:0.0	.	13;25	P22626-2;P22626	.;ROA2_HUMAN	T	25;13;13	ENSP00000346694:I25T;ENSP00000349101:I13T	ENSP00000346694:I25T	I	-	2	0	HNRNPA2B1	26203846	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.253000	0.95501	2.272000	0.75746	0.460000	0.39030	ATT	.		0.343	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137	
SIGLEC10	89790	hgsc.bcm.edu;broad.mit.edu	37	19	51918507	51918507	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr19:51918507C>T	ENST00000339313.5	-	7	1374	c.1258G>A	c.(1258-1260)Gaa>Aaa	p.E420K	SIGLEC10_ENST00000442846.3_Missense_Mutation_p.E272K|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.E420K|SIGLEC10_ENST00000432469.2_Missense_Mutation_p.E337K|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000439889.2_Missense_Mutation_p.E362K|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.E420K|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.E330K|SIGLEC10_ENST00000436984.2_Missense_Mutation_p.E372K|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000441969.3_Missense_Mutation_p.E362K			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	420	Ig-like C2-type 3.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		AACTCTCCTTCGTGCTCCACT	0.667																																					p.E420K		.											SIGLEC12_ENST00000439889,NS,malignant_melanoma,0,2	SIGLEC12_ENST00000439889	0	0			c.G1258A						.						64.0	59.0	61.0					19																	51918507		2203	4300	6503	SO:0001583	missense	89790	exon7			CTCCTTCGTGCTC	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.1258G>A	19.37:g.51918507C>T	ENSP00000345243:p.Glu420Lys	110	1		71	5	NM_001171157	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	ENST00000339313.5	37	CCDS12832.1	.	.	.	.	.	.	.	.	.	.	.	11.96	1.794757	0.31777	.	.	ENSG00000142512	ENST00000353836;ENST00000432469;ENST00000442846;ENST00000356298;ENST00000441969;ENST00000525998;ENST00000439889;ENST00000436984;ENST00000339313	T;T;T;T;T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73;2.73;2.73;2.73;2.73	4.71	3.66	0.41972	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.568449	0.16991	N	0.191294	T	0.28764	0.0713	M	0.80616	2.505	0.27787	N	0.942959	D;P;P;D;P;D;D;P	0.65815	0.977;0.852;0.781;0.995;0.741;0.965;0.984;0.899	P;P;P;P;B;P;P;B	0.52710	0.647;0.538;0.529;0.707;0.394;0.49;0.68;0.347	T	0.11251	-1.0595	10	0.52906	T	0.07	.	10.8635	0.46839	0.0:0.8083:0.1917:0.0	.	372;330;420;272;420;362;362;420	C9JM10;E9PL79;B7ZL04;C9JJ33;Q96LC7-2;Q96LC7-6;Q96LC7-3;Q96LC7	.;.;.;.;.;.;.;SIG10_HUMAN	K	420;337;272;420;362;330;362;372;420	ENSP00000342389:E420K;ENSP00000396742:E337K;ENSP00000395475:E272K;ENSP00000348646:E420K;ENSP00000408387:E362K;ENSP00000431444:E330K;ENSP00000389132:E362K;ENSP00000414324:E372K;ENSP00000345243:E420K	ENSP00000345243:E420K	E	-	1	0	SIGLEC10	56610319	0.011000	0.17503	0.334000	0.25495	0.080000	0.17528	0.487000	0.22356	0.966000	0.38159	0.462000	0.41574	GAA	.		0.667	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
UTP6	55813	hgsc.bcm.edu;bcgsc.ca	37	17	30192441	30192441	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr17:30192441G>T	ENST00000261708.4	-	18	1717	c.1580C>A	c.(1579-1581)gCg>gAg	p.A527E		NM_018428.2	NP_060898.2	Q9NYH9	UTP6_HUMAN	UTP6, small subunit (SSU) processome component, homolog (yeast)	527					rRNA processing (GO:0006364)	nucleolus (GO:0005730)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)	21		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				TCTTATGTTCGCCATATTGCA	0.358																																					p.A527E		.											.	.	.	0			c.C1580A						.						105.0	102.0	103.0					17																	30192441		2203	4300	6503	SO:0001583	missense	55813	exon18			ATGTTCGCCATAT	AF116631	CCDS11269.1	17q11.2	2010-06-24	2006-05-16	2006-05-16	ENSG00000108651	ENSG00000108651			18279	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated antigen 66"""		"""chromosome 17 open reading frame 40"""	C17orf40		10843809, 16138909	Standard	NM_018428		Approved	HCA66	uc002hgr.3	Q9NYH9	OTTHUMG00000132815	ENST00000261708.4:c.1580C>A	17.37:g.30192441G>T	ENSP00000261708:p.Ala527Glu	104	0		61	4	NM_018428	Q8IX96|Q96BL2|Q9NQ91	Missense_Mutation	SNP	ENST00000261708.4	37	CCDS11269.1	.	.	.	.	.	.	.	.	.	.	g	1.536	-0.542943	0.04053	.	.	ENSG00000108651	ENST00000261708	T	0.28069	1.63	5.17	-8.29	0.01009	Tetratricopeptide-like helical (1);	1.253210	0.05283	N	0.519758	T	0.09862	0.0242	N	0.04959	-0.14	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.29610	-1.0006	10	0.02654	T	1	2.5893	6.592	0.22651	0.5877:0.0:0.1353:0.277	.	527;527	B3KQ21;Q9NYH9	.;UTP6_HUMAN	E	527	ENSP00000261708:A527E	ENSP00000261708:A527E	A	-	2	0	UTP6	27216554	0.000000	0.05858	0.043000	0.18650	0.901000	0.52897	-0.731000	0.04909	-1.759000	0.01313	-0.317000	0.08691	GCG	.		0.358	UTP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256265.2	NM_018428	
ITGA9	3680	hgsc.bcm.edu;bcgsc.ca	37	3	37565093	37565093	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr3:37565093G>T	ENST00000264741.5	+	12	1574	c.1318G>T	c.(1318-1320)Ggc>Tgc	p.G440C	ITGA9_ENST00000422441.1_Missense_Mutation_p.G440C	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	440					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		GGATGGAAATGGCTATCCTGG	0.393																																					p.G440C		.											.	.	.	0			c.G1318T						.						120.0	110.0	113.0					3																	37565093		2203	4300	6503	SO:0001583	missense	3680	exon12			GGAAATGGCTATC	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.1318G>T	3.37:g.37565093G>T	ENSP00000264741:p.Gly440Cys	131	0		68	4	NM_002207	Q14638	Missense_Mutation	SNP	ENST00000264741.5	37	CCDS2669.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217912	0.79352	.	.	ENSG00000144668	ENST00000422441;ENST00000264741	D;D	0.84442	-1.85;-1.85	5.97	4.17	0.49024	.	0.110157	0.64402	D	0.000008	D	0.93370	0.7886	M	0.92555	3.32	0.80722	D	1	D;D	0.89917	0.99;1.0	D;D	0.76575	0.981;0.988	D	0.93733	0.7043	10	0.87932	D	0	.	11.9102	0.52735	0.0655:0.1228:0.8117:0.0	.	440;440	Q13797;E9PDS3	ITA9_HUMAN;.	C	440	ENSP00000397258:G440C;ENSP00000264741:G440C	ENSP00000264741:G440C	G	+	1	0	ITGA9	37540097	1.000000	0.71417	0.990000	0.47175	0.998000	0.95712	5.775000	0.68915	0.846000	0.35142	0.655000	0.94253	GGC	.		0.393	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
ASH2L	9070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	37996519	37996519	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr8:37996519C>A	ENST00000343823.6	+	16	2126	c.1817C>A	c.(1816-1818)aCc>aAc	p.T606N	ASH2L_ENST00000250635.7_Missense_Mutation_p.T479N|ASH2L_ENST00000428278.2_Missense_Mutation_p.T512N|ASH2L_ENST00000545394.1_Missense_Mutation_p.T467N|ASH2L_ENST00000521652.1_Missense_Mutation_p.T479N	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	606					cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				GTAGAGCACACCCTGGCTGAC	0.572																																					p.T606N		.											.	.	.	0			c.C1817A						.						67.0	56.0	59.0					8																	37996519		2203	4300	6503	SO:0001583	missense	9070	exon16			AGCACACCCTGGC	AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.1817C>A	8.37:g.37996519C>A	ENSP00000340896:p.Thr606Asn	61	0		32	11	NM_004674	A8K7C3|D3DSW9|O60659|O60660|Q96B62	Missense_Mutation	SNP	ENST00000343823.6	37	CCDS6101.1	.	.	.	.	.	.	.	.	.	.	C	35	5.497600	0.96355	.	.	ENSG00000129691	ENST00000343823;ENST00000250635;ENST00000545394;ENST00000428278;ENST00000521652	T;T;T;T;T	0.80824	-0.27;-1.42;-1.21;-1.23;-1.42	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.87849	0.6281	L	0.51422	1.61	0.80722	D	1	D;D	0.71674	0.962;0.998	P;D	0.76071	0.719;0.987	D	0.85961	0.1470	10	0.44086	T	0.13	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	479;606	Q9UBL3-2;Q9UBL3	.;ASH2L_HUMAN	N	606;479;467;512;479	ENSP00000340896:T606N;ENSP00000250635:T479N;ENSP00000443606:T467N;ENSP00000395310:T512N;ENSP00000430259:T479N	ENSP00000250635:T479N	T	+	2	0	ASH2L	38115676	1.000000	0.71417	0.988000	0.46212	0.957000	0.61999	5.825000	0.69286	2.832000	0.97577	0.655000	0.94253	ACC	.		0.572	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376749.4	NM_004674	
SCN5A	6331	hgsc.bcm.edu	37	3	38592470	38592470	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr3:38592470C>T	ENST00000333535.4	-	28	5542	c.5393G>A	c.(5392-5394)tGg>tAg	p.W1798*	SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000414099.2_Nonsense_Mutation_p.W1780*|SCN5A_ENST00000443581.1_Nonsense_Mutation_p.W1797*|SCN5A_ENST00000425664.1_Nonsense_Mutation_p.W1780*|SCN5A_ENST00000450102.2_Nonsense_Mutation_p.W1744*|SCN5A_ENST00000451551.2_Nonsense_Mutation_p.W1744*|SCN5A_ENST00000413689.1_Nonsense_Mutation_p.W1798*|SCN5A_ENST00000423572.2_Nonsense_Mutation_p.W1797*|SCN5A_ENST00000455624.2_Nonsense_Mutation_p.W1765*|SCN5A_ENST00000449557.2_Nonsense_Mutation_p.W1744*			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1798					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	AAATTTCTCCCAGATCTCATA	0.527																																					p.W1798X		.											SCN5A_ENST00000413689,right_upper_lobe,carcinoma,0,6	SCN5A_ENST00000413689	0	0			c.G5393A						.						50.0	57.0	54.0					3																	38592470		2192	4297	6489	SO:0001587	stop_gained	6331	exon28			TTCTCCCAGATCT	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5393G>A	3.37:g.38592470C>T	ENSP00000328968:p.Trp1798*	79	0		49	2	NM_198056	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Nonsense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	43	10.126006	0.99342	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	.	.	.	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.0868	0.89460	0.0:1.0:0.0:0.0	.	.	.	.	X	1780;1797;1798;1744;1797;1780;1798;1765;1744;1744	.	ENSP00000328968:W1798X	W	-	2	0	SCN5A	38567474	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.651000	0.83577	2.504000	0.84457	0.563000	0.77884	TGG	.		0.527	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
PBRM1	55193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	52678790	52678790	+	Nonsense_Mutation	SNP	T	T	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr3:52678790T>A	ENST00000296302.7	-	8	830	c.829A>T	c.(829-831)Aaa>Taa	p.K277*	PBRM1_ENST00000356770.4_Nonsense_Mutation_p.K277*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.K277*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.K277*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.K277*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.K277*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.K277*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.K277*			Q86U86	PB1_HUMAN	polybromo 1	277					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		aatatttttttaattGAATTT	0.353			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.K277X		.		Rec	yes		3	3p21	55193	polybromo 1		E	PBRM1_ENST00000356770,colon,carcinoma,0,3	PBRM1_ENST00000356770	0	0			c.A829T						.						38.0	39.0	38.0					3																	52678790		2201	4299	6500	SO:0001587	stop_gained	55193	exon9			TTTTTTTAATTGA	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.829A>T	3.37:g.52678790T>A	ENSP00000296302:p.Lys277*	252	0		86	49	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	T	37	6.594177	0.97692	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.663	14.1918	0.65644	0.0:0.0:0.0:1.0	.	.	.	.	X	277;277;277;277;277;277;277;277;277;221	.	ENSP00000296302:K277X	K	-	1	0	PBRM1	52653830	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.354000	0.73036	2.167000	0.68274	0.460000	0.39030	AAA	.		0.353	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
DRC7	84229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	57762447	57762447	+	Missense_Mutation	SNP	A	A	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr16:57762447A>T	ENST00000360716.3	+	17	2563	c.2342A>T	c.(2341-2343)aAg>aTg	p.K781M	CCDC135_ENST00000394337.4_Missense_Mutation_p.K781M|CCDC135_ENST00000336825.8_Missense_Mutation_p.K716M			Q8IY82	CC135_HUMAN		781					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						AGCGACTTCAAGCAGCGGCTC	0.612																																					p.K781M		.											.	.	.	0			c.A2342T						.						40.0	39.0	39.0					16																	57762447		2195	4297	6492	SO:0001583	missense	84229	exon16			ACTTCAAGCAGCG																												ENST00000360716.3:c.2342A>T	16.37:g.57762447A>T	ENSP00000353942:p.Lys781Met	64	0		27	18	NM_032269	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	37	CCDS10787.1	.	.	.	.	.	.	.	.	.	.	a	20.2	3.943590	0.73672	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.55413	0.52;0.52;0.52	5.15	4.04	0.47022	.	0.107337	0.64402	D	0.000009	T	0.73814	0.3635	M	0.86502	2.82	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.76599	-0.2900	10	0.87932	D	0	-44.2152	10.987	0.47528	0.8429:0.1571:0.0:0.0	.	716;781	Q8IY82-2;Q8IY82	.;CC135_HUMAN	M	781;716;781	ENSP00000377869:K781M;ENSP00000338938:K716M;ENSP00000353942:K781M	ENSP00000338938:K716M	K	+	2	0	CCDC135	56319948	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.799000	0.75160	0.773000	0.33404	0.402000	0.26972	AAG	.		0.612	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2		
ZNF345	25850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	37367894	37367894	+	Missense_Mutation	SNP	A	A	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr19:37367894A>T	ENST00000529555.1	+	2	950	c.162A>T	c.(160-162)agA>agT	p.R54S	ZNF345_ENST00000589046.1_Missense_Mutation_p.R54S|ZNF345_ENST00000420450.1_Missense_Mutation_p.R54S|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000432005.2_Intron			Q14585	ZN345_HUMAN	zinc finger protein 345	54					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGCATCAGAGAATTCATACTG	0.393																																					p.R54S		.											.	.	.	0			c.A162T						.						112.0	116.0	115.0					19																	37367894		2203	4300	6503	SO:0001583	missense	25850	exon4			TCAGAGAATTCAT	X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.162A>T	19.37:g.37367894A>T	ENSP00000431202:p.Arg54Ser	105	0		73	25	NM_001242476		Missense_Mutation	SNP	ENST00000529555.1	37	CCDS12497.1	.	.	.	.	.	.	.	.	.	.	A	8.795	0.931410	0.18131	.	.	ENSG00000251247	ENST00000532141;ENST00000420450;ENST00000529555;ENST00000331800	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	4.37	2.13	0.27403	.	.	.	.	.	T	0.17152	0.0412	L	0.38953	1.18	0.21627	N	0.999611	B	0.22909	0.077	B	0.23574	0.047	T	0.32025	-0.9922	9	0.52906	T	0.07	.	1.3769	0.02222	0.5318:0.1882:0.0991:0.1808	.	54	Q14585	ZN345_HUMAN	S	54	ENSP00000431289:R54S;ENSP00000431216:R54S;ENSP00000431202:R54S;ENSP00000331120:R54S	ENSP00000331120:R54S	R	+	3	2	ZNF345	42059734	0.000000	0.05858	0.818000	0.32626	0.987000	0.75469	-0.295000	0.08298	0.237000	0.21200	0.533000	0.62120	AGA	.		0.393	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388258.1		
SNPH	9751	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	1277062	1277062	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr20:1277062G>T	ENST00000381873.3	+	3	283	c.47G>T	c.(46-48)cGc>cTc	p.R16L	RAD21L1_ENST00000402452.1_3'UTR|SNPH_ENST00000381867.1_Missense_Mutation_p.R60L	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	16					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)			endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GCTGGATCACGCAGGTGAGTC	0.637																																					p.R16L		.											.	.	.	0			c.G47T						.						72.0	59.0	63.0					20																	1277062		2203	4300	6503	SO:0001583	missense	9751	exon3			GATCACGCAGGTG		CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.47G>T	20.37:g.1277062G>T	ENSP00000371297:p.Arg16Leu	111	0		79	7	NM_014723	Q8IYI3	Missense_Mutation	SNP	ENST00000381873.3	37	CCDS13012.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180178	0.78564	.	.	ENSG00000101298	ENST00000381873;ENST00000381867	.	.	.	4.29	4.29	0.51040	.	0.000000	0.64402	D	0.000011	T	0.61689	0.2367	L	0.40543	1.245	0.33121	D	0.541796	D;D	0.67145	0.996;0.996	P;P	0.62885	0.908;0.908	T	0.72323	-0.4328	9	0.72032	D	0.01	-22.2865	15.446	0.75232	0.0:0.0:1.0:0.0	.	60;16	O15079-2;O15079	.;SNPH_HUMAN	L	16;60	.	ENSP00000371291:R60L	R	+	2	0	SNPH	1225062	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	5.126000	0.64721	2.363000	0.80096	0.561000	0.74099	CGC	.		0.637	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145240.2	NM_014723	
SSRP1	6749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57100235	57100235	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:57100235C>A	ENST00000278412.2	-	6	898	c.632G>T	c.(631-633)cGt>cTt	p.R211L		NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	211					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						ATAACGACCACGAGGAGTCAG	0.527																																					p.R211L	Colon(89;1000 1340 6884 23013 41819)	.											.	.	.	0			c.G632T						.						88.0	84.0	85.0					11																	57100235		2201	4296	6497	SO:0001583	missense	6749	exon6			CGACCACGAGGAG	M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.632G>T	11.37:g.57100235C>A	ENSP00000278412:p.Arg211Leu	57	0		42	18	NM_003146	Q5BJG8	Missense_Mutation	SNP	ENST00000278412.2	37	CCDS7952.1	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165936	0.57476	.	.	ENSG00000149136	ENST00000278412;ENST00000526696;ENST00000529002	T;T;T	0.61158	0.13;0.13;0.13	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.83473	0.5262	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86649	0.1897	10	0.87932	D	0	-5.8096	20.0291	0.97531	0.0:1.0:0.0:0.0	.	211	Q08945	SSRP1_HUMAN	L	211;114;114	ENSP00000278412:R211L;ENSP00000431154:R114L;ENSP00000434546:R114L	ENSP00000278412:R211L	R	-	2	0	SSRP1	56856811	1.000000	0.71417	0.954000	0.39281	0.076000	0.17211	5.367000	0.66127	2.838000	0.97847	0.561000	0.74099	CGT	.		0.527	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392460.1	NM_003146	
ITGA7	3679	hgsc.bcm.edu	37	12	56090083	56090083	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr12:56090083C>T	ENST00000555728.1	-	14	2031	c.2003G>A	c.(2002-2004)aGc>aAc	p.S668N	ITGA7_ENST00000257879.6_Missense_Mutation_p.S624N|ITGA7_ENST00000394230.2_Missense_Mutation_p.S628N|ITGA7_ENST00000452168.2_Missense_Mutation_p.S531N|ITGA7_ENST00000257880.7_Missense_Mutation_p.S668N|ITGA7_ENST00000553804.1_Missense_Mutation_p.S628N|ITGA7_ENST00000394229.2_Missense_Mutation_p.S624N|ITGA7_ENST00000347027.6_Missense_Mutation_p.S618N			Q13683	ITA7_HUMAN	integrin, alpha 7	668					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)	p.S624I(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CCGCTGGGTGCTGGGCTGGTG	0.647																																					p.S628N		.											ITGA7,colon,carcinoma,0,1	ITGA7	0	1	Substitution - Missense(1)	large_intestine(1)	c.G1883A						.						14.0	15.0	15.0					12																	56090083		2198	4294	6492	SO:0001583	missense	3679	exon13			TGGGTGCTGGGCT		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.2003G>A	12.37:g.56090083C>T	ENSP00000452387:p.Ser668Asn	97	0		47	2	NM_001144996	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	ENST00000555728.1	37		.	.	.	.	.	.	.	.	.	.	C	12.59	1.982840	0.34942	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000555728	T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.31	4.4	0.53042	Integrin alpha-2 (1);	0.124970	0.53938	D	0.000044	T	0.30823	0.0777	N	0.19112	0.55	0.36938	D	0.892223	B;B;B;B	0.19200	0.034;0.022;0.017;0.033	B;B;B;B	0.28011	0.029;0.085;0.051;0.045	T	0.20840	-1.0263	10	0.17832	T	0.49	.	9.2165	0.37351	0.0:0.9026:0.0:0.0974	.	531;668;628;687	Q13683-13;Q13683;Q13683-3;Q4LE35	.;ITA7_HUMAN;.;.	N	628;624;618;531;668;628;624;668	ENSP00000452120:S628N;ENSP00000257879:S624N;ENSP00000343009:S618N;ENSP00000393844:S531N;ENSP00000257880:S668N;ENSP00000377777:S628N;ENSP00000377776:S624N;ENSP00000452387:S668N	ENSP00000257879:S624N	S	-	2	0	ITGA7	54376350	0.960000	0.32886	1.000000	0.80357	0.995000	0.86356	1.338000	0.33873	2.660000	0.90430	0.561000	0.74099	AGC	.		0.647	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
SSBP2	23635	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	80724478	80724478	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr5:80724478T>C	ENST00000320672.4	-	16	1192	c.982A>G	c.(982-984)Agt>Ggt	p.S328G	SSBP2_ENST00000510060.1_5'UTR|SSBP2_ENST00000514493.1_Missense_Mutation_p.S298G|SSBP2_ENST00000509053.1_Intron|SSBP2_ENST00000505980.1_Missense_Mutation_p.S308G|SSBP2_ENST00000515395.1_Missense_Mutation_p.S306G	NM_001256732.1|NM_001256733.1|NM_012446.3	NP_001243661.1|NP_001243662.1|NP_036578.2	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2	328					regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)		SSBP2/JAK2(4)	central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		GGTTGATTACTCAGGCTCATA	0.363																																					p.S336G		.											.	.	.	0			c.A1006G						.						78.0	79.0	78.0					5																	80724478		2203	4299	6502	SO:0001583	missense	23635	exon16			GATTACTCAGGCT	AF077048	CCDS4056.1, CCDS58960.1, CCDS58961.1, CCDS58962.1, CCDS58963.1, CCDS75268.1	5q14.1	2012-05-25	2001-11-28		ENSG00000145687	ENSG00000145687			15831	protein-coding gene	gene with protein product		607389	"""single-stranded DNA-binding protein 2"""			11230166, 11042152	Standard	NM_001256732		Approved	HSPC116	uc003khp.4	P81877	OTTHUMG00000119039	ENST00000320672.4:c.982A>G	5.37:g.80724478T>C	ENSP00000322977:p.Ser328Gly	160	0		79	6	NM_001256732	B2R5W1|B7Z1J2|B7Z2L9|B7Z665|D6RH18|E9PB74|E9PDA8|Q8N2Q2|Q9BWW6|Q9Y4T7	Missense_Mutation	SNP	ENST00000320672.4	37	CCDS4056.1	.	.	.	.	.	.	.	.	.	.	T	18.38	3.610688	0.66558	.	.	ENSG00000145687	ENST00000320672;ENST00000514493;ENST00000380182;ENST00000504985;ENST00000512923;ENST00000505980;ENST00000515395	.	.	.	5.65	5.65	0.86999	.	0.076218	0.85682	D	0.000000	T	0.57504	0.2058	L	0.52573	1.65	0.52501	D	0.999954	P;P;P;P;P	0.43477	0.599;0.462;0.599;0.62;0.808	B;P;B;B;P	0.45712	0.422;0.491;0.422;0.383;0.479	T	0.52939	-0.8508	9	0.18710	T	0.47	-14.1851	16.175	0.81844	0.0:0.0:0.0:1.0	.	306;308;281;306;328	E9PB74;B7Z1J2;A6ND70;B7Z665;P81877	.;.;.;.;SSBP2_HUMAN	G	328;298;281;242;231;308;306	.	ENSP00000322977:S328G	S	-	1	0	SSBP2	80760234	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.626000	0.83164	2.274000	0.75844	0.528000	0.53228	AGT	.		0.363	SSBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239249.1	NM_012446	
PCDHB8	56128	hgsc.bcm.edu	37	5	140559572	140559572	+	Missense_Mutation	SNP	T	T	C	rs17844504		TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr5:140559572T>C	ENST00000239444.2	+	1	2202	c.1957T>C	c.(1957-1959)Tgc>Cgc	p.C653R	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	653	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.C653R(1)		NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGAGCCTCCGTGCTCGGCCAC	0.711																																					p.C653R		.											PCDHB8,NS,malignant_melanoma,0,1	PCDHB8	0	1	Substitution - Missense(1)	NS(1)	c.T1957C						.						22.0	25.0	24.0					5																	140559572		2150	4208	6358	SO:0001583	missense	56128	exon1			CCTCCGTGCTCGG	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1957T>C	5.37:g.140559572T>C	ENSP00000239444:p.Cys653Arg	84	1		74	3	NM_019120	B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.657243	0.00779	.	.	ENSG00000120322	ENST00000239444	T	0.45276	0.9	4.22	3.33	0.38152	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.08044	0.0201	N	0.00096	-2.155	0.36249	D	0.853792	B	0.02656	0.0	B	0.01281	0.0	T	0.25882	-1.0119	9	0.05833	T	0.94	.	8.1883	0.31352	0.1644:0.7506:0.0:0.085	rs17844504	653	Q9UN66	PCDB8_HUMAN	R	653	ENSP00000239444:C653R	ENSP00000239444:C653R	C	+	1	0	PCDHB8	140539756	0.000000	0.05858	0.047000	0.18901	0.446000	0.32137	0.734000	0.26101	0.243000	0.21327	-0.711000	0.03637	TGC	.		0.711	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
ROS1	6098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	117663599	117663599	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr6:117663599G>A	ENST00000368508.3	-	28	4831	c.4633C>T	c.(4633-4635)Cca>Tca	p.P1545S	ROS1_ENST00000368507.3_Missense_Mutation_p.P1539S|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1545	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TCTTTTCCTGGTGGTAAATGT	0.338			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.P1545S		.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	.	.	0			c.C4633T						.						117.0	125.0	122.0					6																	117663599		2202	4299	6501	SO:0001583	missense	6098	exon28			TTCCTGGTGGTAA	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.4633C>T	6.37:g.117663599G>A	ENSP00000357494:p.Pro1545Ser	197	0		121	41	NM_002944	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	G	11.18	1.563863	0.27915	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.56611	0.45;0.45	5.32	1.1	0.20463	.	0.734048	0.12130	N	0.496815	T	0.08670	0.0215	N	0.08118	0	0.42889	D	0.994192	B	0.17667	0.023	B	0.12156	0.007	T	0.36915	-0.9728	10	0.06757	T	0.87	.	3.9581	0.09399	0.0871:0.2742:0.4766:0.162	.	1545	P08922	ROS1_HUMAN	S	1545;1539	ENSP00000357494:P1545S;ENSP00000357493:P1539S	ENSP00000357493:P1539S	P	-	1	0	ROS1	117770292	0.077000	0.21312	0.983000	0.44433	0.890000	0.51754	0.088000	0.14979	0.276000	0.22118	0.561000	0.74099	CCA	.		0.338	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
CD1D	912	hgsc.bcm.edu	37	1	158152690	158152690	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr1:158152690C>T	ENST00000368171.3	+	5	1129	c.630C>T	c.(628-630)tcC>tcT	p.S210S		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	210	Ig-like.				antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					CCTGGCTGTCCCGTGGCCCCA	0.567																																					p.S210S		.											.	.	.	0			c.C630T						.						76.0	79.0	78.0					1																	158152690		2203	4300	6503	SO:0001819	synonymous_variant	912	exon5			GCTGTCCCGTGGC	BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.630C>T	1.37:g.158152690C>T		99	0		89	4	NM_001766	D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Silent	SNP	ENST00000368171.3	37	CCDS1173.1																																																																																			.		0.567	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	NM_001766	
C10orf105	414152	hgsc.bcm.edu	37	10	73468897	73468897	+	IGR	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr10:73468897C>T	ENST00000441508.2	-	0	4837				CDH23_ENST00000224721.6_Missense_Mutation_p.A1055V	NM_001164375.2	NP_001157847.1	Q8TEF2	CJ105_HUMAN	chromosome 10 open reading frame 105							integral component of membrane (GO:0016021)											TACCGCGATGCCGTTGTGAGA	0.632																																					p.A1050V		.											CDH23,NS,carcinoma,0,1	CDH23	0	0			c.C3149T						.						94.0	115.0	108.0					10																	73468897		2144	4249	6393	SO:0001628	intergenic_variant	64072	exon26			GCGATGCCGTTGT	AK074172	CCDS44430.1	10q22.1	2012-06-01			ENSG00000214688	ENSG00000214688			20304	protein-coding gene	gene with protein product							Standard	NM_001164375		Approved	FLJ00245	uc001jsa.2	Q8TEF2	OTTHUMG00000018427		10.37:g.73468897C>T		94	0		32	2	NM_022124		Missense_Mutation	SNP	ENST00000441508.2	37	CCDS44430.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240816	0.79912	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000224721;ENST00000442677	.	.	.	4.97	2.91	0.33838	Cadherin (4);Cadherin-like (1);	0.080498	0.47852	D	0.000217	T	0.48768	0.1518	L	0.27053	0.805	0.80722	D	1	P;B	0.49862	0.929;0.196	P;B	0.50825	0.651;0.165	T	0.57277	-0.7839	9	0.87932	D	0	.	13.8212	0.63322	0.0:0.6192:0.3808:0.0	.	1050;1050	Q6P152;Q9H251	.;CAD23_HUMAN	V	1055;1050;1050;1053;567	.	ENSP00000224721:A1055V	A	+	2	0	CDH23	73138903	1.000000	0.71417	0.280000	0.24747	0.470000	0.32858	5.912000	0.69948	2.313000	0.78055	0.650000	0.86243	GCC	.		0.632	C10orf105-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048551.2	NM_001164375	
RNF112	7732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	19319066	19319066	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr17:19319066A>G	ENST00000461366.1	+	14	1689	c.1474A>G	c.(1474-1476)Acc>Gcc	p.T492A	CTB-187M2.2_ENST00000579897.1_RNA	NM_007148.4	NP_009079.2	Q9ULX5	RN112_HUMAN	ring finger protein 112	492						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|urinary_tract(1)	12						CCTGCCAGACACCATGCGGAA	0.597																																					p.T492A		.											.	.	.	0			c.A1474G						.						32.0	33.0	33.0					17																	19319066		2019	4171	6190	SO:0001583	missense	7732	exon14			CCAGACACCATGC	AF054587	CCDS58529.1	17p11.2	2013-01-16	2008-06-13	2008-06-13	ENSG00000128482	ENSG00000128482		"""RING-type (C3HC4) zinc fingers"""	12968	protein-coding gene	gene with protein product		601237	"""zinc finger protein 179"""	ZNF179		8660987, 9806830	Standard	NM_007148		Approved	BFP	uc010vyw.2	Q9ULX5	OTTHUMG00000059601	ENST00000461366.1:c.1474A>G	17.37:g.19319066A>G	ENSP00000454919:p.Thr492Ala	55	0		27	9	NM_007148	O60633|Q7Z5V9	Missense_Mutation	SNP	ENST00000461366.1	37	CCDS58529.1																																																																																			.		0.597	RNF112-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132549.4	NM_007148	
IPO5	3843	hgsc.bcm.edu	37	13	98671935	98671935	+	Silent	SNP	C	C	A	rs145166442		TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr13:98671935C>A	ENST00000490680.1	+	24	3002	c.2937C>A	c.(2935-2937)atC>atA	p.I979I	IPO5_ENST00000539640.1_Silent_p.I854I|IPO5_ENST00000261574.5_Silent_p.I997I			O00410	IPO5_HUMAN	importin 5	979					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)	p.I997I(1)		breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						TAGGGAAAATCATGAAGTTCA	0.433																																					p.I997I		.											IPO5,arm,malignant_melanoma,0,1	IPO5	0	1	Substitution - coding silent(1)	skin(1)	c.C2991A						.						127.0	118.0	121.0					13																	98671935		2203	4300	6503	SO:0001819	synonymous_variant	3843	exon27			GAAAATCATGAAG	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.2937C>A	13.37:g.98671935C>A		76	0		37	2	NM_002271	B4DZA0|O15257|Q5T578|Q86XC7	Silent	SNP	ENST00000490680.1	37		.	.	.	.	.	.	.	.	.	.	C	9.555	1.116908	0.20795	.	.	ENSG00000065150	ENST00000469360	.	.	.	5.95	-11.6	0.00059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.5349	0.811	0.01093	0.2845:0.2226:0.2945:0.1984	.	.	.	.	X	981	.	.	S	+	2	0	IPO5	97469936	0.188000	0.23250	0.100000	0.21137	0.991000	0.79684	-0.408000	0.07169	-2.368000	0.00604	-0.133000	0.14855	TCA	.		0.433	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	NM_002271	
SUPT7L	9913	hgsc.bcm.edu	37	2	27878277	27878277	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:27878277G>A	ENST00000337768.5	-	5	1506	c.937C>T	c.(937-939)Cgc>Tgc	p.R313C	SUPT7L_ENST00000405491.1_Missense_Mutation_p.R311C|SUPT7L_ENST00000404798.2_Missense_Mutation_p.R178C|SUPT7L_ENST00000464789.2_Missense_Mutation_p.R311C|SUPT7L_ENST00000406540.1_Missense_Mutation_p.R311C	NM_001282729.1|NM_014860.1	NP_001269658.1|NP_055675.1	O94864	ST65G_HUMAN	suppressor of Ty 7 (S. cerevisiae)-like	313					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|maintenance of protein location in nucleus (GO:0051457)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)					GATGGGAAGCGTTCGCTCTGA	0.498																																					p.R313C		.											SUPT7L,NS,carcinoma,0,1	SUPT7L	0	0			c.C937T						.						94.0	96.0	95.0					2																	27878277		1970	4146	6116	SO:0001583	missense	9913	exon5			GGAAGCGTTCGCT	AF197954	CCDS42667.1, CCDS62885.1, CCDS62886.1	2p23.3	2008-02-05			ENSG00000119760	ENSG00000119760			30632	protein-coding gene	gene with protein product		612762				9872452, 11564863	Standard	NM_001282732		Approved	STAF65, gamma, KIAA0764, SPT7L	uc002rli.1	O94864	OTTHUMG00000151947	ENST00000337768.5:c.937C>T	2.37:g.27878277G>A	ENSP00000336750:p.Arg313Cys	66	0		47	2	NM_014860	B4E3W3|Q6IB21|Q9H2T6	Missense_Mutation	SNP	ENST00000337768.5	37	CCDS42667.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.157571	0.78114	.	.	ENSG00000119760	ENST00000337768;ENST00000406540;ENST00000405491;ENST00000464789;ENST00000404798	.	.	.	6.17	5.27	0.74061	.	0.046437	0.85682	D	0.000000	T	0.48277	0.1491	L	0.27053	0.805	0.80722	D	1	D;D;D	0.63880	0.988;0.993;0.988	P;P;P	0.48795	0.513;0.59;0.513	T	0.50972	-0.8764	9	0.72032	D	0.01	-22.2916	14.595	0.68397	0.0:0.0:0.7375:0.2625	.	178;311;313	B4E3W3;O94864-2;O94864	.;.;ST65G_HUMAN	C	313;311;311;311;178	.	ENSP00000336750:R313C	R	-	1	0	SUPT7L	27731781	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.245000	0.43133	2.941000	0.99782	0.655000	0.94253	CGC	.		0.498	SUPT7L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324568.1	NM_014860	
MT-ND1	4535	hgsc.bcm.edu	37	M	577	577	+	5'Flank	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chrM:577G>A	ENST00000361390.2	+	0	0				MT-TF_ENST00000387314.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ACACCCCCCACAGTTTATGTA	0.478																																					.		.											.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			CCCACAGTTTATG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.577G>A	Exception_encountered	235	0		200	22	.	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																				.		0.478	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
MRVI1	10335	hgsc.bcm.edu;ucsc.edu	37	11	10597537	10597537	+	3'UTR	SNP	C	C	T	rs554502344	byFrequency	TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:10597537C>T	ENST00000436272.1	-	0	3078				MRVI1_ENST00000558540.1_3'UTR|MRVI1_ENST00000552103.1_3'UTR|MRVI1_ENST00000421747.1_3'UTR|MRVI1-AS1_ENST00000529829.1_RNA|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000547195.1_3'UTR|MRVI1_ENST00000545852.1_3'UTR|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000424001.1_3'UTR|MRVI1_ENST00000423302.2_3'UTR			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog						blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CCTCCTCCCCCGTGCCCCGCT	0.498													C|||	5	0.000998403	0.003	0.0	5008	,	,		14212	0.0		0.0	False		,,,				2504	0.001				.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	10335	.			CTCCCCCGTGCCC	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.*342G>A	11.37:g.10597537C>T		98	0		41	9	.	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	RNA	SNP	ENST00000436272.1	37																																																																																				.		0.498	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,carcinoma,0,1131	PIK3CA_ENST00000263967	0	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A						.						61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290	exon10			ATCACTGAGCAGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	221	0		127	40	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	.		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
HDX	139324	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	83723901	83723901	+	Missense_Mutation	SNP	A	A	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chrX:83723901A>C	ENST00000297977.5	-	3	941	c.830T>G	c.(829-831)aTt>aGt	p.I277S	HDX_ENST00000506585.2_Missense_Mutation_p.I219S|HDX_ENST00000373177.2_Missense_Mutation_p.I277S	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	277						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TCCTCCCAGAATTCTCTGGGG	0.458																																					p.I277S	Pancreas(53;231 1169 36156 43751 51139)	.											.	.	.	0			c.T830G						.						95.0	90.0	92.0					X																	83723901		2203	4300	6503	SO:0001583	missense	139324	exon3			CCCAGAATTCTCT	BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.830T>G	X.37:g.83723901A>C	ENSP00000297977:p.Ile277Ser	105	0		62	5	NM_144657	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	ENST00000297977.5	37	CCDS35342.1	.	.	.	.	.	.	.	.	.	.	A	13.04	2.117602	0.37339	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585	T;T;T	0.35048	1.36;1.33;1.36	5.45	5.45	0.79879	.	0.197053	0.43919	D	0.000513	T	0.34687	0.0906	L	0.58101	1.795	0.37809	D	0.927982	P	0.35433	0.501	B	0.35470	0.203	T	0.42965	-0.9420	10	0.66056	D	0.02	-25.5735	9.3357	0.38049	0.9188:0.0:0.0812:0.0	.	277	Q7Z353	HDX_HUMAN	S	277;219;277	ENSP00000297977:I277S;ENSP00000362272:I219S;ENSP00000423670:I277S	ENSP00000297977:I277S	I	-	2	0	HDX	83610557	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.964000	0.56780	1.930000	0.55929	0.417000	0.27973	ATT	.		0.458	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	NM_144657	
SLPI	6590	hgsc.bcm.edu	37	20	43882219	43882219	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr20:43882219G>T	ENST00000338380.2	-	2	261	c.241C>A	c.(241-243)Cca>Aca	p.P81T		NM_003064.2	NP_003055.1	P03973	SLPI_HUMAN	secretory leukocyte peptidase inhibitor	81	Trypsin inhibitory domain.				negative regulation of protein binding (GO:0032091)|negative regulation of viral genome replication (GO:0045071)	extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.P81T(1)		lung(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				TGCTTACTTGGGTTTGGGGTG	0.557																																					p.P81T	GBM(64;162 1089 31780 33427 34538)	.											SLPI,NS,carcinoma,0,1	SLPI	0	1	Substitution - Missense(1)	lung(1)	c.C241A						.						86.0	70.0	75.0					20																	43882219		2203	4300	6503	SO:0001583	missense	6590	exon2			TACTTGGGTTTGG	X04502	CCDS13347.1	20q13.12	2013-01-21	2005-08-17		ENSG00000124107	ENSG00000124107		"""WAP four-disulfide core domain containing"""	11092	protein-coding gene	gene with protein product	"""antileukoproteinase"""	107285	"""secretory leukocyte protease inhibitor (antileukoproteinase)"""			3640338, 12206714	Standard	NM_003064		Approved	HUSI-I, ALK1, ALP, BLPI, HUSI, WAP4, WFDC4	uc002xnm.1	P03973	OTTHUMG00000033075	ENST00000338380.2:c.241C>A	20.37:g.43882219G>T	ENSP00000342082:p.Pro81Thr	59	0		43	2	NM_003064	B2R5H8|P07757	Missense_Mutation	SNP	ENST00000338380.2	37	CCDS13347.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651358	0.29336	.	.	ENSG00000124107	ENST00000338380	T	0.21734	1.99	5.05	-0.622	0.11560	.	0.758631	0.10826	N	0.629845	T	0.31295	0.0792	M	0.91249	3.19	0.09310	N	1	B	0.27853	0.191	B	0.29267	0.1	T	0.38222	-0.9671	10	0.72032	D	0.01	.	7.6203	0.28181	0.5135:0.0:0.4865:0.0	.	81	P03973	SLPI_HUMAN	T	81	ENSP00000342082:P81T	ENSP00000342082:P81T	P	-	1	0	SLPI	43315633	0.000000	0.05858	0.010000	0.14722	0.001000	0.01503	-0.545000	0.06069	-0.033000	0.13736	-0.367000	0.07326	CCA	.		0.557	SLPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080494.3		
RBMX	27316	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	135956307	135956307	+	Silent	SNP	T	T	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chrX:135956307T>C	ENST00000320676.7	-	9	1324	c.1170A>G	c.(1168-1170)agA>agG	p.R390R	RBMX_ENST00000431446.3_Intron|RBMX_ENST00000562646.1_3'UTR|RBMX_ENST00000496459.2_5'Flank|RBMX_ENST00000570135.1_Silent_p.R255R|RBMX_ENST00000565438.1_Silent_p.R262R	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	390	Necessary for RNA-binding.				cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R390S(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GTTTCTAGTATCTGCTTCTGC	0.463																																					p.R390R		.											.	.	.	1	Substitution - Missense(1)	endometrium(1)	c.A1170G						.						40.0	41.0	41.0					X																	135956307		2177	4214	6391	SO:0001819	synonymous_variant	27316	exon9			CTAGTATCTGCTT		CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.1170A>G	X.37:g.135956307T>C		171	0		104	31	NM_002139	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Silent	SNP	ENST00000320676.7	37	CCDS14661.1																																																																																			.		0.463	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240791	39240791	+	Silent	SNP	C	C	T	rs553572799	byFrequency	TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr17:39240791C>T	ENST00000391417.4	+	1	333	c.333C>T	c.(331-333)cgC>cgT	p.R111R		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	136	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cctgctgccgccccagctgct	0.662																																					p.R111R		.											KRTAP4-9_ENST00000377734,NS,carcinoma,0,2	KRTAP4-9_ENST00000377734	0	2	Unknown(1)|Deletion - In frame(1)	NS(2)	c.C333T						.																																			SO:0001819	synonymous_variant	100132476	exon1			CTGCCGCCCCAGC	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.333C>T	17.37:g.39240791C>T		53	1		37	3	NM_033061	A0AVM6|A8MQ08|A8MTL4	Silent	SNP	ENST00000391417.4	37	CCDS45673.1																																																																																			.		0.662	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
KCNH3	23416	hgsc.bcm.edu	37	12	49948260	49948260	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr12:49948260G>T	ENST00000257981.6	+	11	2319	c.2059G>T	c.(2059-2061)Gag>Tag	p.E687*		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	687					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.E687K(1)		NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						GCTGTACCCCGAGTTTGCCCC	0.632																																					p.E687X		.											KCNH3,rectum,carcinoma,0,1	KCNH3	0	1	Substitution - Missense(1)	large_intestine(1)	c.G2059T						.						61.0	60.0	60.0					12																	49948260		2203	4300	6503	SO:0001587	stop_gained	23416	exon11			TACCCCGAGTTTG	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.2059G>T	12.37:g.49948260G>T	ENSP00000257981:p.Glu687*	74	0		47	2	NM_012284	Q9UQ06	Nonsense_Mutation	SNP	ENST00000257981.6	37	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	G	41	8.752464	0.98939	.	.	ENSG00000135519	ENST00000257981	.	.	.	4.81	4.81	0.61882	.	0.000000	0.47455	D	0.000230	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.1975	0.82042	0.0:0.0:1.0:0.0	.	.	.	.	X	687	.	ENSP00000257981:E687X	E	+	1	0	KCNH3	48234527	1.000000	0.71417	0.999000	0.59377	0.920000	0.55202	9.789000	0.99068	2.628000	0.89032	0.563000	0.77884	GAG	.		0.632	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284	
MAST3	23031	hgsc.bcm.edu	37	19	18234175	18234175	+	Missense_Mutation	SNP	G	G	A	rs573739665		TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr19:18234175G>A	ENST00000262811.6	+	6	461	c.461G>A	c.(460-462)cGc>cAc	p.R154H	MAST3_ENST00000608648.1_3'UTR	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	154							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						CCCCGCTCTCGCAGTCTCAGG	0.687													G|||	1	0.000199681	0.0	0.0	5008	,	,		15952	0.0		0.001	False		,,,				2504	0.0				p.R154H		.											MAST3,NS,carcinoma,0,1	MAST3	0	0			c.G461A						.						15.0	16.0	16.0					19																	18234175		1884	4096	5980	SO:0001583	missense	23031	exon6			GCTCTCGCAGTCT	AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.461G>A	19.37:g.18234175G>A	ENSP00000262811:p.Arg154His	24	0		29	2	NM_015016	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	37	CCDS46014.1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446090	0.63178	.	.	ENSG00000099308	ENST00000262811	T	0.47528	0.84	4.69	4.69	0.59074	Microtubule-associated serine/threonine-protein kinase, domain (1);	.	.	.	.	T	0.76104	0.3941	M	0.92412	3.305	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	T	0.83144	-0.0107	9	0.72032	D	0.01	-22.6098	16.9486	0.86237	0.0:0.0:1.0:0.0	.	154	O60307	MAST3_HUMAN	H	154	ENSP00000262811:R154H	ENSP00000262811:R154H	R	+	2	0	MAST3	18095175	1.000000	0.71417	0.992000	0.48379	0.021000	0.10359	9.336000	0.96533	2.324000	0.78689	0.484000	0.47621	CGC	.		0.687	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150	
OR52E8	390079	hgsc.bcm.edu	37	11	5878458	5878458	+	Silent	SNP	G	G	A	rs549924845	byFrequency	TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:5878458G>A	ENST00000537935.1	-	1	506	c.475C>T	c.(475-477)Ctg>Ttg	p.L159L	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCATGTACAGGCTCCTCAGG	0.507													G|||	10	0.00199681	0.0068	0.0	5008	,	,		18808	0.0		0.0	False		,,,				2504	0.001				p.L159L		.											OR52E8,NS,carcinoma,0,1	OR52E8	0	0			c.C475T						.						135.0	147.0	143.0					11																	5878458		2154	4296	6450	SO:0001819	synonymous_variant	390079	exon1			TGTACAGGCTCCT	BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.475C>T	11.37:g.5878458G>A		50	0		29	2	NM_001005168	B9EH38	Silent	SNP	ENST00000537935.1	37	CCDS31400.1																																																																																			.		0.507	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401145.1	NM_001005168	
FAM153C	653316	hgsc.bcm.edu	37	5	177434138	177434138	+	Intron	SNP	G	G	A	rs144285503		TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr5:177434138G>A	ENST00000507848.1	+	1	89				FAM153C_ENST00000398106.2_5'Flank			Q494X1	F153C_HUMAN	family with sequence similarity 153, member C											kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			attgggggttggatcgcggat	0.547																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	653316	.			GGGGTTGGATCGC	BC101338		5q35.3	2008-01-09				ENSG00000204677			33936	protein-coding gene	gene with protein product							Standard	NR_038353		Approved	NY-REN-7-like	uc011dge.2	Q494X1		ENST00000507848.1:c.-113+77G>A	5.37:g.177434138G>A		10	0		16	4	.	A4IF33|B2RUV5|B7ZW12	RNA	SNP	ENST00000507848.1	37																																																																																				.		0.547	FAM153C-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000373556.1	NM_001079527	
ADH6	130	hgsc.bcm.edu;ucsc.edu	37	4	100125185	100125185	+	IGR	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr4:100125185C>T	ENST00000237653.7	-	0	1691				RP11-696N14.1_ENST00000506160.1_RNA|ADH6_ENST00000394897.1_3'UTR|RP11-696N14.1_ENST00000506454.1_RNA|ADH6_ENST00000407820.2_3'UTR|RP11-696N14.1_ENST00000500358.2_RNA|ADH6_ENST00000394899.2_3'UTR	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)						ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	cttggtgacactgggttacGT	0.423																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	130	.			GTGACACTGGGTT	AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024		4.37:g.100125185C>T		24	0		26	12	.	B3KS45|Q58F53	RNA	SNP	ENST00000237653.7	37	CCDS3647.1																																																																																			.		0.423	ADH6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253665.1	NM_000672	
MBD5	55777	hgsc.bcm.edu;bcgsc.ca	37	2	149247273	149247273	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:149247273G>T	ENST00000407073.1	+	12	4370	c.3373G>T	c.(3373-3375)Gcc>Tcc	p.A1125S	MBD5_ENST00000404807.1_Missense_Mutation_p.A1358S	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1125					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TGCCATGAGTGCCTTCACTGC	0.507																																					p.A1125S		.											.	.	.	0			c.G3373T						.						109.0	106.0	107.0					2																	149247273		2203	4300	6503	SO:0001583	missense	55777	exon12			ATGAGTGCCTTCA	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3373G>T	2.37:g.149247273G>T	ENSP00000386049:p.Ala1125Ser	62	0		61	4	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	37	CCDS33302.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.367770	0.42003	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	T;T	0.20069	2.1;2.1	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000009	T	0.35537	0.0935	N	0.24115	0.695	0.58432	D	0.999998	D;D	0.76494	0.996;0.999	D;D	0.80764	0.99;0.994	T	0.15009	-1.0452	10	0.87932	D	0	-5.0109	19.4137	0.94687	0.0:0.0:1.0:0.0	.	1358;1125	E9PHH0;Q9P267	.;MBD5_HUMAN	S	1125;1358	ENSP00000386049:A1125S;ENSP00000384672:A1358S	ENSP00000384672:A1358S	A	+	1	0	MBD5	148963743	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.811000	0.91954	2.826000	0.97356	0.563000	0.77884	GCC	.		0.507	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
DNAH7	56171	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	196759763	196759763	+	Silent	SNP	T	T	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:196759763T>C	ENST00000312428.6	-	30	4933	c.4833A>G	c.(4831-4833)ccA>ccG	p.P1611P		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1611	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTCCTCCAAATGGTTCTCCAA	0.323																																					p.P1611P		.											.	.	.	0			c.A4833G						.						95.0	87.0	89.0					2																	196759763		1847	4101	5948	SO:0001819	synonymous_variant	56171	exon30			TCCAAATGGTTCT	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.4833A>G	2.37:g.196759763T>C		157	0		124	10	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	CCDS42794.1																																																																																			.		0.323	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
RPRD1B	58490	hgsc.bcm.edu	37	20	36687879	36687879	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr20:36687879G>T	ENST00000373433.4	+	5	1014	c.612G>T	c.(610-612)ctG>ctT	p.L204L		NM_021215.3	NP_067038.1	Q9NQG5	RPR1B_HUMAN	regulation of nuclear pre-mRNA domain containing 1B	204					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle process (GO:0010564)|transcription, DNA-templated (GO:0006351)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)	p.Q206fs*19(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)	12						TTGCTTCTCTGCCCCAGGAAG	0.443																																					p.L204L		.											.,1	.	25	1	Insertion - Frameshift(1)	large_intestine(1)	c.G612T						.						111.0	100.0	104.0					20																	36687879		2203	4300	6503	SO:0001819	synonymous_variant	58490	exon5			TTCTCTGCCCCAG	AL109823	CCDS13301.1	20q11.21-q12	2012-02-09	2008-08-15	2008-07-28	ENSG00000101413	ENSG00000101413			16209	protein-coding gene	gene with protein product		614694	"""chromosome 20 open reading frame 77"""	C20orf77		22231121	Standard	NM_021215		Approved	dJ1057B20.2, DKFZp434P0735, CREPT, FLJ44520, NET60	uc002xho.4	Q9NQG5	OTTHUMG00000032434	ENST00000373433.4:c.612G>T	20.37:g.36687879G>T		88	0		47	2	NM_021215	Q1WDE7|Q6PKF4	Silent	SNP	ENST00000373433.4	37	CCDS13301.1																																																																																			.		0.443	RPRD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079142.2	NM_021215	
GUCY2D	3000	hgsc.bcm.edu	37	17	7917239	7917239	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr17:7917239C>A	ENST00000254854.4	+	12	2455	c.2305C>A	c.(2305-2307)Ccc>Acc	p.P769T		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	769	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				ACTGTGTCGGCCCTTGGTGTC	0.627																																					p.P769T		.											GUCY2D_ENST00000254854,NS,haematopoietic_neoplasm,0,1	GUCY2D_ENST00000254854	0	0			c.C2305A						.						82.0	83.0	83.0					17																	7917239		2203	4300	6503	SO:0001583	missense	3000	exon12			TGTCGGCCCTTGG	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.2305C>A	17.37:g.7917239C>A	ENSP00000254854:p.Pro769Thr	38	0		22	2	NM_000180	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	37	CCDS11127.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707140	0.89018	.	.	ENSG00000132518	ENST00000254854	D	0.86366	-2.11	5.44	5.44	0.79542	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000074	D	0.94771	0.8312	M	0.90650	3.135	0.53688	D	0.99997	D	0.76494	0.999	D	0.75484	0.986	D	0.95258	0.8366	10	0.87932	D	0	.	18.2031	0.89846	0.0:1.0:0.0:0.0	.	769	Q02846	GUC2D_HUMAN	T	769	ENSP00000254854:P769T	ENSP00000254854:P769T	P	+	1	0	GUCY2D	7857964	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.244000	0.78228	2.837000	0.97791	0.655000	0.94253	CCC	.		0.627	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
EXOSC4	54512	hgsc.bcm.edu	37	8	145133719	145133719	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr8:145133719G>T	ENST00000316052.5	+	1	191	c.88G>T	c.(88-90)Ggc>Tgc	p.G30C	EXOSC4_ENST00000525936.1_Missense_Mutation_p.G30C|CTD-3065J16.9_ENST00000524499.1_RNA	NM_019037.2	NP_061910.1	Q9NPD3	EXOS4_HUMAN	exosome component 4	30					defense response to virus (GO:0051607)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)			lung(4)|prostate(1)|upper_aerodigestive_tract(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.48e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGCGCGGATGGGCGTGTTCGC	0.731																																					p.G30C		.											EXOSC4,colon,carcinoma,0,1	EXOSC4	0	0			c.G88T						.						22.0	21.0	21.0					8																	145133719		2194	4291	6485	SO:0001583	missense	54512	exon1			CGGATGGGCGTGT	AF281133	CCDS6414.1	8q24.3	2004-03-26			ENSG00000178896	ENSG00000178896			18189	protein-coding gene	gene with protein product	"""exosome component Rrp41"""	606491				11110791	Standard	NM_019037		Approved	hRrp41p, FLJ20591, Rrp41p, RRP41, RRP41A, Ski6p, SKI6, p12A	uc003zau.3	Q9NPD3	OTTHUMG00000165437	ENST00000316052.5:c.88G>T	8.37:g.145133719G>T	ENSP00000315476:p.Gly30Cys	22	0		17	3	NM_019037		Missense_Mutation	SNP	ENST00000316052.5	37	CCDS6414.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.871837	0.91587	.	.	ENSG00000178896	ENST00000316052;ENST00000525936	T;T	0.72835	-0.69;-0.69	4.84	4.84	0.62591	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.067947	0.64402	D	0.000013	D	0.89815	0.6824	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93179	0.6573	10	0.87932	D	0	-23.9413	13.4418	0.61117	0.0:0.0:1.0:0.0	.	30	Q9NPD3	EXOS4_HUMAN	C	30	ENSP00000315476:G30C;ENSP00000432661:G30C	ENSP00000315476:G30C	G	+	1	0	EXOSC4	145205707	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.288000	0.65651	2.237000	0.73441	0.563000	0.77884	GGC	.		0.731	EXOSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384065.1	NM_019037	
PRKG1	5592	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	54040674	54040674	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr10:54040674G>A	ENST00000401604.2	+	13	1678	c.1484G>A	c.(1483-1485)cGa>cAa	p.R495Q	PRKG1-AS1_ENST00000426785.2_RNA|PRKG1_ENST00000373975.2_Missense_Mutation_p.R213Q|PRKG1_ENST00000373980.4_Missense_Mutation_p.R510Q|PRKG1-AS1_ENST00000452247.2_RNA|PRKG1_ENST00000373985.1_Missense_Mutation_p.R483Q			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	495	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CTAGATCACCGAGGTTATGCC	0.383																																					p.R510Q		.											.	.	.	0			c.G1529A						.						118.0	101.0	107.0					10																	54040674		2203	4300	6503	SO:0001583	missense	5592	exon13			ATCACCGAGGTTA		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.1484G>A	10.37:g.54040674G>A	ENSP00000384200:p.Arg495Gln	90	0		56	5	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	37	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025845	0.35701	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000332193;ENST00000373975	T;T;T	0.07800	3.16;3.16;3.16	5.56	4.66	0.58398	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.03783	0.0107	N	0.16602	0.42	0.53005	D	0.999961	B;B;B	0.32829	0.016;0.132;0.386	B;B;B	0.20184	0.017;0.016;0.028	T	0.23940	-1.0174	10	0.02654	T	1	-7.9179	10.4615	0.44583	0.1499:0.0:0.8501:0.0	.	213;510;495	B3KSF3;Q13976-2;Q13976	.;.;KGP1_HUMAN	Q	495;483;510;213;107	ENSP00000384200:R495Q;ENSP00000363097:R483Q;ENSP00000363092:R510Q	ENSP00000327642:R213Q	R	+	2	0	PRKG1	53710680	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	6.777000	0.75028	1.362000	0.46000	-0.150000	0.13652	CGA	.		0.383	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PER1	5187	hgsc.bcm.edu	37	17	8046029	8046029	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr17:8046029C>T	ENST00000317276.4	-	20	3434	c.3197G>A	c.(3196-3198)gGc>gAc	p.G1066D	PER1_ENST00000581082.1_Missense_Mutation_p.G1043D|PER1_ENST00000578089.1_5'Flank	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	1066	Ser-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						AGAGCCCAAGCCAGAGCCCAA	0.652			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.G1066D		.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	PER1,NS,carcinoma,0,1	PER1	0	0			c.G3197A						.						49.0	58.0	55.0					17																	8046029		2203	4300	6503	SO:0001583	missense	5187	exon20			CCCAAGCCAGAGC	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.3197G>A	17.37:g.8046029C>T	ENSP00000314420:p.Gly1066Asp	135	0		68	3	NM_002616	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	37	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761003	0.69763	.	.	ENSG00000179094	ENST00000317276	T	0.14144	2.53	4.88	2.8	0.32819	Period circadian-like, C-terminal (1);	0.193384	0.44483	D	0.000451	T	0.17619	0.0423	M	0.66297	2.02	0.80722	D	1	P	0.45672	0.864	P	0.48368	0.575	T	0.02444	-1.1158	10	0.39692	T	0.17	-6.6059	3.6404	0.08165	0.176:0.5645:0.1698:0.0897	.	1066	O15534	PER1_HUMAN	D	1066	ENSP00000314420:G1066D	ENSP00000314420:G1066D	G	-	2	0	PER1	7986754	0.911000	0.30947	0.934000	0.37439	0.925000	0.55904	1.974000	0.40559	0.718000	0.32166	0.591000	0.81541	GGC	.		0.652	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
TRPM8	79054	hgsc.bcm.edu	37	2	234869591	234869591	+	Missense_Mutation	SNP	G	G	T	rs200884995		TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:234869591G>T	ENST00000324695.4	+	12	1574	c.1534G>T	c.(1534-1536)Gcc>Tcc	p.A512S	TRPM8_ENST00000433712.2_Missense_Mutation_p.A200S	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	512					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.A512T(1)		breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	TCTGCAGATCGCCAAGAATTC	0.507																																					p.A512S		.											TRPM8,colon,carcinoma,0,1	TRPM8	0	1	Substitution - Missense(1)	large_intestine(1)	c.G1534T						.						115.0	98.0	103.0					2																	234869591		2203	4300	6503	SO:0001583	missense	79054	exon12			CAGATCGCCAAGA	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.1534G>T	2.37:g.234869591G>T	ENSP00000323926:p.Ala512Ser	90	0		56	3	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	ENST00000324695.4	37	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.565320	0.86439	.	.	ENSG00000144481	ENST00000324695;ENST00000433712	T;T	0.58652	0.32;0.38	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000003	T	0.69269	0.3092	L	0.43152	1.355	0.48511	D	0.999669	D;D	0.71674	0.993;0.998	D;P	0.69479	0.964;0.897	T	0.64550	-0.6381	10	0.33940	T	0.23	-29.8559	18.6269	0.91344	0.0:0.0:1.0:0.0	.	200;512	A0AVG2;Q7Z2W7	.;TRPM8_HUMAN	S	512;200	ENSP00000323926:A512S;ENSP00000404423:A200S	ENSP00000323926:A512S	A	+	1	0	TRPM8	234534330	1.000000	0.71417	0.971000	0.41717	0.987000	0.75469	6.673000	0.74482	2.735000	0.93741	0.655000	0.94253	GCC	.		0.507	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
OTOP1	133060	hgsc.bcm.edu	37	4	4199570	4199570	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr4:4199570C>T	ENST00000296358.4	-	5	1015	c.991G>A	c.(991-993)Gta>Ata	p.V331I		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	331					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.V331I(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ATCAGGTATACCACCACCACA	0.572																																					p.V331I		.											OTOP1,trunk,malignant_melanoma,0,1	OTOP1	0	1	Substitution - Missense(1)	skin(1)	c.G991A						.						49.0	47.0	48.0					4																	4199570		2203	4300	6503	SO:0001583	missense	133060	exon5			GGTATACCACCAC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.991G>A	4.37:g.4199570C>T	ENSP00000296358:p.Val331Ile	54	2		33	2	NM_177998	A1L476	Missense_Mutation	SNP	ENST00000296358.4	37	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	C	7.519	0.656369	0.14580	.	.	ENSG00000163982	ENST00000296358	T	0.21361	2.01	4.8	1.97	0.26223	.	0.342268	0.29537	N	0.011880	T	0.14399	0.0348	L	0.35487	1.065	0.52099	D	0.999941	P	0.39551	0.678	B	0.40702	0.338	T	0.09773	-1.0659	10	0.19590	T	0.45	.	7.313	0.26485	0.0:0.704:0.1403:0.1557	.	331	Q7RTM1	OTOP1_HUMAN	I	331	ENSP00000296358:V331I	ENSP00000296358:V331I	V	-	1	0	OTOP1	4250471	0.827000	0.29292	0.080000	0.20451	0.014000	0.08584	1.617000	0.36943	0.511000	0.28236	0.404000	0.27445	GTA	.		0.572	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
UNC13C	440279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	54305275	54305275	+	Missense_Mutation	SNP	T	T	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr15:54305275T>A	ENST00000260323.11	+	1	175	c.175T>A	c.(175-177)Ttt>Att	p.F59I	UNC13C_ENST00000545554.1_Missense_Mutation_p.F59I|UNC13C_ENST00000537900.1_Missense_Mutation_p.F59I	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	59					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TTCTTACACTTTTAAAAGCAC	0.408																																					p.F59I		.											.	.	.	0			c.T175A						.						87.0	89.0	88.0					15																	54305275		1836	4070	5906	SO:0001583	missense	440279	exon1			TACACTTTTAAAA	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.175T>A	15.37:g.54305275T>A	ENSP00000260323:p.Phe59Ile	178	0		114	38	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	T	6.157	0.397104	0.11638	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.77098	-1.07;-1.07;-1.07	5.01	0.261	0.15592	.	.	.	.	.	T	0.50803	0.1637	N	0.03608	-0.345	0.21473	N	0.999678	B	0.02656	0.0	B	0.01281	0.0	T	0.37596	-0.9699	9	0.42905	T	0.14	.	4.2231	0.10567	0.1517:0.3368:0.0:0.5115	.	59	Q8NB66	UN13C_HUMAN	I	59	ENSP00000260323:F59I;ENSP00000438156:F59I;ENSP00000442569:F59I	ENSP00000260323:F59I	F	+	1	0	UNC13C	52092567	0.397000	0.25270	0.635000	0.29338	0.042000	0.13812	0.429000	0.21412	0.008000	0.14787	0.533000	0.62120	TTT	.		0.408	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
CNTN6	27255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	1427411	1427411	+	Silent	SNP	C	C	T	rs369348874	byFrequency	TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr3:1427411C>T	ENST00000446702.2	+	20	3261	c.2634C>T	c.(2632-2634)tcC>tcT	p.S878S	CNTN6_ENST00000539053.1_Silent_p.S806S|CNTN6_ENST00000350110.2_Silent_p.S878S			Q9UQ52	CNTN6_HUMAN	contactin 6	878	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		ACTTTGCTTCCGTAAGAGCTT	0.443													T|||	2	0.000399361	0.0008	0.0	5008	,	,		18227	0.0		0.001	False		,,,				2504	0.0				p.S878S		.											.	.	.	0			c.C2634T						.	T		5,4401	825.8+/-416.5	0,5,2198	176.0	177.0	177.0		2634	-11.5	0.5	3		177	1,8599	819.1+/-406.8	0,1,4299	no	coding-synonymous	CNTN6	NM_014461.2		0,6,6497	TT,TC,CC		0.0116,0.1135,0.0461		878/1029	1427411	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	27255	exon20			TGCTTCCGTAAGA	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2634C>T	3.37:g.1427411C>T		132	0		56	6	NM_014461	Q2KHM2	Silent	SNP	ENST00000446702.2	37	CCDS2557.1																																																																																			.		0.443	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
GAD1	2571	hgsc.bcm.edu	37	2	171702544	171702544	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:171702544G>T	ENST00000358196.3	+	10	1523	c.973G>T	c.(973-975)Gag>Tag	p.E325*		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	325					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						AGCTGATTTTGAGGCAAAAAT	0.363																																					p.E325X		.											GAD1,bladder,carcinoma,0,1	GAD1	0	0			c.G973T						.						61.0	65.0	64.0					2																	171702544		2203	4300	6503	SO:0001587	stop_gained	2571	exon10			GATTTTGAGGCAA		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.973G>T	2.37:g.171702544G>T	ENSP00000350928:p.Glu325*	110	0		72	4	NM_000817	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Nonsense_Mutation	SNP	ENST00000358196.3	37	CCDS2239.1	.	.	.	.	.	.	.	.	.	.	G	41	9.143566	0.99080	.	.	ENSG00000128683	ENST00000358196	.	.	.	5.91	5.02	0.67125	.	0.091999	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.9597	17.1455	0.86765	0.0:0.1264:0.8735:0.0	.	.	.	.	X	325	.	ENSP00000350928:E325X	E	+	1	0	GAD1	171410790	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	7.546000	0.82137	1.489000	0.48450	0.655000	0.94253	GAG	.		0.363	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
NOL9	79707	hgsc.bcm.edu	37	1	6610487	6610487	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr1:6610487G>T	ENST00000377705.5	-	2	617	c.585C>A	c.(583-585)gcC>gcA	p.A195A		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	195					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		GCAAATTCCGGGCTTCCCTTT	0.418																																					p.A195A		.											NOL9,NS,carcinoma,0,1	NOL9	0	0			c.C585A						.						124.0	126.0	125.0					1																	6610487		2203	4300	6503	SO:0001819	synonymous_variant	79707	exon2			ATTCCGGGCTTCC	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.585C>A	1.37:g.6610487G>T		101	0		35	2	NM_024654	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Silent	SNP	ENST00000377705.5	37	CCDS80.1																																																																																			.		0.418	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
MAP10	54627	hgsc.bcm.edu;bcgsc.ca	37	1	232941560	232941560	+	Missense_Mutation	SNP	C	C	A	rs3766498		TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr1:232941560C>A	ENST00000418460.1	+	1	918	c.791C>A	c.(790-792)cCt>cAt	p.P264H		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	122					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										CAGCTGCCCCCTGGGCGCCCG	0.731																																					p.P264H		.											.	.	.	0			c.C791A						.						6.0	8.0	7.0					1																	232941560		1844	3995	5839	SO:0001583	missense	54627	exon1			TGCCCCCTGGGCG	AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.791C>A	1.37:g.232941560C>A	ENSP00000403208:p.Pro264His	19	0		26	7	NM_019090	A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	ENST00000418460.1	37	CCDS44334.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.958392	0.74016	.	.	ENSG00000212916	ENST00000418460	.	.	.	5.25	3.33	0.38152	.	1.030910	0.07794	U	0.955327	T	0.59676	0.2211	M	0.67953	2.075	0.24345	N	0.99494	D	0.76494	0.999	D	0.68483	0.958	T	0.37407	-0.9707	9	0.87932	D	0	-8.5412	6.3897	0.21579	0.1297:0.6632:0.0:0.2071	.	122	Q9P2G4	K1383_HUMAN	H	264	.	ENSP00000403208:P264H	P	+	2	0	KIAA1383	231008183	0.002000	0.14202	0.212000	0.23672	0.966000	0.64601	1.473000	0.35387	0.664000	0.31047	0.555000	0.69702	CCT	.		0.731	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092317.3	NM_019090	
LRRC49	54839	hgsc.bcm.edu	37	15	71341747	71341747	+	Splice_Site	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr15:71341747G>T	ENST00000260382.5	+	16	2117		c.e16-1		LRRC49_ENST00000436542.2_Splice_Site|LRRC49_ENST00000560158.2_Splice_Site|LRRC49_ENST00000544974.2_Splice_Site|LRRC49_ENST00000560691.1_Splice_Site|LRRC49_ENST00000560369.1_Splice_Site|LRRC49_ENST00000443425.2_Splice_Site	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49							cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.?(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						TTTTTTAACAGGAAATAAAGG	0.294																																					.		.											LRRC49,NS,carcinoma,0,1	LRRC49	0	1	Unknown(1)	lung(1)	c.1873-1G>T						.						27.0	30.0	29.0					15																	71341747		2170	4288	6458	SO:0001630	splice_region_variant	54839	exon16			TTAACAGGAAATA		CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1858-1G>T	15.37:g.71341747G>T		105	0		48	2	NM_001199017	B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Splice_Site	SNP	ENST00000260382.5	37	CCDS32282.1	.	.	.	.	.	.	.	.	.	.	g	15.99	2.995626	0.54147	.	.	ENSG00000137821	ENST00000544974;ENST00000260382;ENST00000443425;ENST00000436542	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6149	0.76756	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRRC49	69128801	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	6.439000	0.73430	2.547000	0.85894	0.655000	0.94253	.	.		0.294	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417209.3	NM_017691	Intron
CDH9	1007	hgsc.bcm.edu	37	5	26885928	26885928	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr5:26885928G>T	ENST00000231021.4	-	11	1849	c.1677C>A	c.(1675-1677)aaC>aaA	p.N559K		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	559	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TGCTCATTTTGTTGCGACTGT	0.383																																					p.N559K	Melanoma(8;187 585 15745 40864 52829)	.											CDH9,NS,carcinoma,-2,1	CDH9	-2	0			c.C1677A						.						67.0	64.0	65.0					5																	26885928		2203	4300	6503	SO:0001583	missense	1007	exon11			CATTTTGTTGCGA	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1677C>A	5.37:g.26885928G>T	ENSP00000231021:p.Asn559Lys	111	0		66	3	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205944	0.39003	.	.	ENSG00000113100	ENST00000231021	T	0.50277	0.75	5.79	3.76	0.43208	Cadherin (4);Cadherin-like (1);	0.552842	0.20688	N	0.087511	T	0.17109	0.0411	N	0.01874	-0.695	0.30805	N	0.739436	B;B	0.11235	0.004;0.001	B;B	0.23275	0.045;0.027	T	0.18085	-1.0348	9	.	.	.	.	3.7311	0.08493	0.1963:0.2371:0.5666:0.0	.	152;559	B4DFP0;Q9ULB4	.;CADH9_HUMAN	K	559	ENSP00000231021:N559K	.	N	-	3	2	CDH9	26921685	0.013000	0.17824	1.000000	0.80357	0.995000	0.86356	0.743000	0.26231	2.740000	0.93945	0.563000	0.77884	AAC	.		0.383	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
DCBLD1	285761	hgsc.bcm.edu	37	6	117861861	117861861	+	Missense_Mutation	SNP	C	C	T	rs150272298		TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr6:117861861C>T	ENST00000338728.5	+	10	1252	c.1132C>T	c.(1132-1134)Cca>Tca	p.P378S	DCBLD1_ENST00000368503.4_Intron|DCBLD1_ENST00000534777.1_3'UTR|DCBLD1_ENST00000296955.8_Missense_Mutation_p.P378S|GOPC_ENST00000467125.1_Intron			Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	378	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		CTTTCGGGACCCAGTGCAAAA	0.443																																					p.P378S		.											.	.	.	0			c.C1132T						.						125.0	125.0	125.0					6																	117861861		2203	4300	6503	SO:0001583	missense	285761	exon10			CGGGACCCAGTGC	AK055462	CCDS34522.1	6q22.31	2003-06-20			ENSG00000164465	ENSG00000164465			21479	protein-coding gene	gene with protein product							Standard	NM_173674		Approved	MGC46341, dJ94G16.1	uc003pxs.3	Q8N8Z6	OTTHUMG00000015455	ENST00000338728.5:c.1132C>T	6.37:g.117861861C>T	ENSP00000342422:p.Pro378Ser	130	0		97	4	NM_173674	Q5H992|Q8IYK5|Q8N7L9|Q96NH2	Missense_Mutation	SNP	ENST00000338728.5	37		.	.	.	.	.	.	.	.	.	.	C	12.18	1.860560	0.32884	.	.	ENSG00000164465	ENST00000296955;ENST00000392504;ENST00000338728	D;D	0.99014	-5.33;-5.33	4.54	3.67	0.42095	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.458938	0.20375	N	0.093570	D	0.93115	0.7808	L	0.41573	1.285	0.80722	D	1	B;B	0.18461	0.009;0.028	B;B	0.18263	0.012;0.021	D	0.89507	0.3768	10	0.08179	T	0.78	-12.86	6.3244	0.21234	0.3043:0.6024:0.0:0.0933	.	378;378	Q8N8Z6-2;Q8N8Z6	.;DCBD1_HUMAN	S	378;33;378	ENSP00000296955:P378S;ENSP00000342422:P378S	ENSP00000296955:P378S	P	+	1	0	DCBLD1	117968554	0.789000	0.28775	0.998000	0.56505	0.986000	0.74619	0.245000	0.18142	1.137000	0.42214	0.561000	0.74099	CCA	.		0.443	DCBLD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000041979.2	NM_173674	
EIF4G2	1982	hgsc.bcm.edu	37	11	10822519	10822519	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:10822519G>T	ENST00000526148.1	-	15	2039	c.1529C>A	c.(1528-1530)cCt>cAt	p.P510H	EIF4G2_ENST00000396525.2_Missense_Mutation_p.P472H|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000339995.5_Missense_Mutation_p.P510H|EIF4G2_ENST00000525681.1_Missense_Mutation_p.P510H|RP11-685M7.5_ENST00000532365.1_RNA	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CTGTCCCAGAGGTGGTGTTTG	0.418																																					p.P510H		.											.	.	.	0			c.C1529A						.						220.0	206.0	210.0					11																	10822519		2201	4294	6495	SO:0001583	missense	1982	exon15			CCCAGAGGTGGTG	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.1529C>A	11.37:g.10822519G>T	ENSP00000433664:p.Pro510His	101	0		76	4	NM_001172705		Missense_Mutation	SNP	ENST00000526148.1	37	CCDS31428.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734256	0.69189	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000531180	T;T;T;T;T	0.49432	2.2;2.2;2.2;2.19;0.78	5.92	5.92	0.95590	.	0.047697	0.85682	D	0.000000	T	0.61837	0.2379	L	0.52573	1.65	0.44268	D	0.997127	D;B;D	0.76494	0.996;0.144;0.999	P;B;P	0.59703	0.794;0.035;0.862	T	0.55451	-0.8139	9	0.38643	T	0.18	-6.1138	20.3206	0.98668	0.0:0.0:1.0:0.0	.	472;510;583	P78344-2;P78344;B4DZF2	.;IF4G2_HUMAN;.	H	510;510;510;472;583;15	ENSP00000433664:P510H;ENSP00000433371:P510H;ENSP00000340281:P510H;ENSP00000379778:P472H;ENSP00000433561:P15H	ENSP00000340281:P510H	P	-	2	0	EIF4G2	10779095	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.565000	0.82337	2.809000	0.96659	0.655000	0.94253	CCT	.		0.418	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
FREM3	166752	hgsc.bcm.edu	37	4	144619386	144619386	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr4:144619386G>A	ENST00000329798.5	-	1	2442	c.2443C>T	c.(2443-2445)Cca>Tca	p.P815S	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	815					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						AATGTGCCTGGCACGCTATTG	0.507																																					p.P815S		.											FREM3,colon,carcinoma,0,1	FREM3	0	0			c.C2443T						.						169.0	137.0	147.0					4																	144619386		692	1591	2283	SO:0001583	missense	166752	exon1			TGCCTGGCACGCT	BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.2443C>T	4.37:g.144619386G>A	ENSP00000332886:p.Pro815Ser	107	0		64	3	NM_001168235		Missense_Mutation	SNP	ENST00000329798.5	37	CCDS54808.1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.466817	0.01053	.	.	ENSG00000183090	ENST00000329798	T	0.49139	0.79	4.01	-0.0565	0.13805	.	0.875809	0.10033	N	0.724467	T	0.29389	0.0732	L	0.39514	1.22	0.09310	N	1	.	.	.	.	.	.	T	0.24941	-1.0146	8	0.09590	T	0.72	0.6855	1.5699	0.02612	0.2655:0.1432:0.4448:0.1465	.	.	.	.	S	815	ENSP00000332886:P815S	ENSP00000332886:P815S	P	-	1	0	FREM3	144838836	0.000000	0.05858	0.000000	0.03702	0.649000	0.38597	-0.109000	0.10840	-0.277000	0.09193	0.655000	0.94253	CCA	.		0.507	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365391.1	XM_094074	
DPH2	1802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	44437356	44437356	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr1:44437356G>T	ENST00000255108.3	+	4	954	c.782G>T	c.(781-783)gGt>gTt	p.G261V	DPH2_ENST00000412950.2_Missense_Mutation_p.G126V|ATP6V0B_ENST00000472174.2_5'Flank|DPH2_ENST00000529729.1_3'UTR|DPH2_ENST00000396758.2_Intron	NM_001384.4	NP_001375.2	Q9BQC3	DPH2_HUMAN	DPH2 homolog (S. cerevisiae)	261					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)	cytoplasm (GO:0005737)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(2)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				CAGGATGAGGGTGCCCGGGCT	0.627																																					p.G261V		.											.	.	.	0			c.G782T						.						51.0	56.0	54.0					1																	44437356		2203	4300	6503	SO:0001583	missense	1802	exon4			ATGAGGGTGCCCG	AF053003	CCDS504.1, CCDS41314.1	1p34	2008-02-05	2005-06-03	2005-06-03	ENSG00000132768	ENSG00000132768			3004	protein-coding gene	gene with protein product		603456	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae)"", ""DPH2-like 2 (S. cerevisiae)"""	DPH2L2		9782084, 15485916	Standard	XM_005270559		Approved		uc001ckz.3	Q9BQC3	OTTHUMG00000008295	ENST00000255108.3:c.782G>T	1.37:g.44437356G>T	ENSP00000255108:p.Gly261Val	33	0		20	6	NM_001384	A8MVC9|B2RDE3|B4DNI8|O60623	Missense_Mutation	SNP	ENST00000255108.3	37	CCDS504.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.824530	0.32237	.	.	ENSG00000132768	ENST00000255108;ENST00000412950;ENST00000459879	T;T;T	0.41758	0.99;0.99;0.99	4.61	4.61	0.57282	.	0.965292	0.08666	N	0.911699	T	0.33059	0.0850	N	0.20845	0.615	0.39980	D	0.974906	P;P	0.36354	0.549;0.549	B;B	0.39805	0.31;0.31	T	0.03673	-1.1014	10	0.14252	T	0.57	-0.7144	13.6565	0.62341	0.0:0.2032:0.7968:0.0	.	126;261	B4DNI8;Q9BQC3	.;DPH2_HUMAN	V	261;126;34	ENSP00000255108:G261V;ENSP00000413862:G126V;ENSP00000432162:G34V	ENSP00000255108:G261V	G	+	2	0	DPH2	44209943	0.968000	0.33430	0.227000	0.23927	0.217000	0.24651	2.345000	0.44018	2.381000	0.81170	0.552000	0.68991	GGT	.		0.627	DPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022832.1	NM_001384	
BEST2	54831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12865559	12865559	+	Silent	SNP	G	G	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr19:12865559G>C	ENST00000549706.1	+	4	765	c.441G>C	c.(439-441)gtG>gtC	p.V147V	BEST2_ENST00000553030.1_Silent_p.V147V|BEST2_ENST00000042931.1_Silent_p.V147V			Q8NFU1	BEST2_HUMAN	bestrophin 2	147					chloride transmembrane transport (GO:1902476)|membrane depolarization (GO:0051899)|sensory perception of smell (GO:0007608)	chloride channel complex (GO:0034707)|cilium (GO:0005929)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	12						GCACCGCGGTGTTCAAGCGCT	0.687																																					p.V147V		.											.	.	.	0			c.G441C						.						20.0	21.0	21.0					19																	12865559		2167	4278	6445	SO:0001819	synonymous_variant	54831	exon3			CGCGGTGTTCAAG	AF440756	CCDS42506.1	19p13.13	2014-08-12	2006-10-18	2006-10-18	ENSG00000039987	ENSG00000039987		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17107	protein-coding gene	gene with protein product		607335	"""vitelliform macular dystrophy 2-like 1"""	VMD2L1		12032738, 16912113	Standard	NM_017682		Approved	FLJ20132	uc002mux.3	Q8NFU1	OTTHUMG00000169293	ENST00000549706.1:c.441G>C	19.37:g.12865559G>C		66	0		58	21	NM_017682	Q53YQ8|Q9NXP0	Silent	SNP	ENST00000549706.1	37	CCDS42506.1																																																																																			.		0.687	BEST2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403343.1	NM_017682	
PHLPP1	23239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	60562326	60562326	+	Missense_Mutation	SNP	G	G	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr18:60562326G>C	ENST00000262719.5	+	5	2383	c.2149G>C	c.(2149-2151)Gca>Cca	p.A717P	PHLPP1_ENST00000400316.4_Missense_Mutation_p.A205P			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	717					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						TCCAACCCTGGCAGAGCTGAA	0.493																																					p.A717P		.											.	.	.	0			c.G2149C						.						69.0	65.0	66.0					18																	60562326		1901	4125	6026	SO:0001583	missense	23239	exon5			ACCCTGGCAGAGC	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2149G>C	18.37:g.60562326G>C	ENSP00000262719:p.Ala717Pro	124	0		38	24	NM_194449	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	37	CCDS45881.2	.	.	.	.	.	.	.	.	.	.	G	24.8	4.568095	0.86439	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.57907	0.37;0.37	5.81	1.42	0.22433	.	.	.	.	.	T	0.46658	0.1404	L	0.51422	1.61	0.29022	N	0.886231	P	0.42584	0.784	B	0.42522	0.39	T	0.41142	-0.9525	9	0.52906	T	0.07	-1.0864	7.6353	0.28264	0.6052:0.0:0.3948:0.0	.	717	O60346	PHLP1_HUMAN	P	205;717	ENSP00000383170:A205P;ENSP00000262719:A717P	ENSP00000262719:A717P	A	+	1	0	PHLPP1	58713306	1.000000	0.71417	0.895000	0.35142	0.976000	0.68499	2.872000	0.48467	0.249000	0.21456	0.655000	0.94253	GCA	.		0.493	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449	
NYAP2	57624	hgsc.bcm.edu	37	2	226378131	226378131	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:226378131G>A	ENST00000272907.6	+	3	679	c.266G>A	c.(265-267)gGc>gAc	p.G89D	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	89					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												AGTTACGTGGGCAAACATTTC	0.498																																					p.G89D		.											KIAA1486,rectum,carcinoma,0,1	KIAA1486	0	0			c.G266A						.						78.0	82.0	80.0					2																	226378131		2049	4188	6237	SO:0001583	missense	57624	exon3			ACGTGGGCAAACA	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.266G>A	2.37:g.226378131G>A	ENSP00000272907:p.Gly89Asp	40	0		27	2	NM_020864	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567097	0.86439	.	.	ENSG00000144460	ENST00000272907	T	0.31247	1.5	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.32224	0.0822	M	0.61703	1.905	0.80722	D	1	P	0.38827	0.649	B	0.38428	0.273	T	0.06180	-1.0841	10	0.34782	T	0.22	-29.9756	12.5326	0.56124	0.0762:0.0:0.9238:0.0	.	89	Q9P242	K1486_HUMAN	D	89	ENSP00000272907:G89D	ENSP00000272907:G89D	G	+	2	0	KIAA1486	226086375	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.409000	0.80053	2.532000	0.85374	0.563000	0.77884	GGC	.		0.498	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
BTRC	8945	hgsc.bcm.edu	37	10	103281468	103281468	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr10:103281468G>A	ENST00000370187.3	+	5	515	c.397G>A	c.(397-399)Gaa>Aaa	p.E133K	BTRC_ENST00000408038.2_Missense_Mutation_p.E97K|BTRC_ENST00000393441.4_Missense_Mutation_p.E92K	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	133	Homodimerization domain D.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.E133K(1)		endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CTATGAAAAGGAAAAGGAACT	0.408																																					p.E133K		.											BTRC,NS,carcinoma,0,1	BTRC	0	1	Substitution - Missense(1)	lung(1)	c.G397A						.						121.0	110.0	114.0					10																	103281468		2203	4300	6503	SO:0001583	missense	8945	exon5			GAAAAGGAAAAGG	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.397G>A	10.37:g.103281468G>A	ENSP00000359206:p.Glu133Lys	122	0		36	2	NM_033637	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	37	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753323	0.89753	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038;ENST00000370183	T;T;T	0.61742	0.23;0.24;0.08	5.6	5.6	0.85130	.	0.152135	0.45867	D	0.000340	T	0.59224	0.2178	L	0.57536	1.79	0.54753	D	0.999981	B;B;B	0.14805	0.006;0.011;0.003	B;B;B	0.17433	0.008;0.018;0.009	T	0.55885	-0.8070	10	0.59425	D	0.04	-6.5964	20.0343	0.97551	0.0:0.0:1.0:0.0	.	107;97;133	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	K	133;92;97;115	ENSP00000359206:E133K;ENSP00000377088:E92K;ENSP00000385339:E97K	ENSP00000359202:E115K	E	+	1	0	BTRC	103271458	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.810000	0.99221	2.803000	0.96430	0.650000	0.86243	GAA	.		0.408	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
SLC20A2	6575	hgsc.bcm.edu	37	8	42287686	42287686	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr8:42287686C>T	ENST00000342228.3	-	9	1974	c.1605G>A	c.(1603-1605)tgG>tgA	p.W535*	SLC20A2_ENST00000520179.1_Nonsense_Mutation_p.W535*|SLC20A2_ENST00000520262.1_Nonsense_Mutation_p.W535*	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	535					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)	p.W535*(1)		breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			AAAACAGCAGCCAGACGGGTG	0.537																																					p.W535X		.											SLC20A2,NS,carcinoma,0,1	SLC20A2	0	1	Substitution - Nonsense(1)	endometrium(1)	c.G1605A						.						83.0	75.0	77.0					8																	42287686		2203	4300	6503	SO:0001587	stop_gained	6575	exon9			CAGCAGCCAGACG		CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.1605G>A	8.37:g.42287686C>T	ENSP00000340465:p.Trp535*	123	0		69	3	NM_001257181		Nonsense_Mutation	SNP	ENST00000342228.3	37	CCDS6132.1	.	.	.	.	.	.	.	.	.	.	C	41	9.010572	0.99035	.	.	ENSG00000168575	ENST00000342228;ENST00000520262;ENST00000520179	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4643	17.3708	0.87377	0.0:1.0:0.0:0.0	.	.	.	.	X	535	.	ENSP00000340465:W535X	W	-	3	0	SLC20A2	42406843	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	7.818000	0.86416	2.709000	0.92574	0.561000	0.74099	TGG	.		0.537	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1		
NPAP1	23742	hgsc.bcm.edu	37	15	24924482	24924482	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr15:24924482G>A	ENST00000329468.2	+	1	3942	c.3468G>A	c.(3466-3468)ccG>ccA	p.P1156P		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	1156					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.P1156P(1)									TCCAACTTCCGTAAGAGCACC	0.423																																					p.P1156P		.											C15orf2,NS,carcinoma,0,1	C15orf2	0	1	Substitution - coding silent(1)	lung(1)	c.G3468A						.						70.0	62.0	64.0					15																	24924482		2202	4298	6500	SO:0001819	synonymous_variant	23742	exon1			ACTTCCGTAAGAG	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.3468G>A	15.37:g.24924482G>A		58	0		44	2	NM_018958		Silent	SNP	ENST00000329468.2	37	CCDS10015.1																																																																																			.		0.423	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
PNLDC1	154197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	160240039	160240039	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr6:160240039G>T	ENST00000610273.1	+	17	1457	c.1286G>T	c.(1285-1287)aGg>aTg	p.R429M	PNLDC1_ENST00000392167.3_Missense_Mutation_p.R440M	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	429						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AGCGTCAAAAGGTGGCCTGGG	0.473																																					p.R429M		.											.	.	.	0			c.G1286T						.						103.0	105.0	105.0					6																	160240039		2203	4300	6503	SO:0001583	missense	154197	exon17			TCAAAAGGTGGCC	AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1286G>T	6.37:g.160240039G>T	ENSP00000476448:p.Arg429Met	50	0		22	9	NM_173516	Q5TAP7|Q8N7X5	Missense_Mutation	SNP	ENST00000610273.1	37	CCDS5271.1	.	.	.	.	.	.	.	.	.	.	G	9.582	1.123932	0.20959	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	4.57	2.79	0.32731	.	0.477404	0.19030	N	0.124570	T	0.20170	0.0485	N	0.24115	0.695	0.32180	N	0.580422	P;D	0.57257	0.955;0.979	P;P	0.50231	0.614;0.635	T	0.04191	-1.0970	9	0.48119	T	0.1	.	9.0643	0.36453	0.1701:0.0:0.8299:0.0	.	440;429	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	M	429;440	.	ENSP00000275275:R429M	R	+	2	0	PNLDC1	160160029	0.670000	0.27512	0.985000	0.45067	0.143000	0.21401	0.724000	0.25954	0.553000	0.29044	-0.379000	0.06801	AGG	.		0.473	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516	
ZNF253	56242	hgsc.bcm.edu	37	19	20002885	20002885	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr19:20002885G>T	ENST00000589717.1	+	4	921	c.829G>T	c.(829-831)Gtt>Ttt	p.V277F	CTC-559E9.8_ENST00000585571.1_RNA|AC011477.1_ENST00000578823.1_RNA|ZNF253_ENST00000355650.4_Missense_Mutation_p.V201F	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	277				Missing (in Ref. 1; AAC26844). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ACATAAGATAGTTCATACTGG	0.398																																					p.V277F		.											ZNF492,NS,carcinoma,0,4	ZNF492	0	0			c.G829T						.						53.0	57.0	55.0					19																	20002885		2170	4281	6451	SO:0001583	missense	56242	exon4			AAGATAGTTCATA	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.829G>T	19.37:g.20002885G>T	ENSP00000468720:p.Val277Phe	64	0		45	2	NM_021047	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	ENST00000589717.1	37	CCDS42532.1	.	.	.	.	.	.	.	.	.	.	g	8.839	0.941752	0.18281	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.876	-1.75	0.08031	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39091	0.1065	M	0.65498	2.005	0.24401	N	0.994705	B	0.19583	0.037	B	0.18263	0.021	T	0.30937	-0.9961	7	.	.	.	.	4.7478	0.13045	0.463:0.0:0.537:0.0	.	277	O75346	ZN253_HUMAN	F	277	.	.	V	+	1	0	ZNF253	19863885	0.000000	0.05858	0.190000	0.23270	0.190000	0.23558	-0.026000	0.12392	-0.722000	0.04922	-0.708000	0.03648	GTT	.		0.398	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460802.1	NM_021047	
KLHL29	114818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	23862089	23862089	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:23862089G>A	ENST00000486442.1	+	4	1083	c.366G>A	c.(364-366)caG>caA	p.Q122Q		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	122										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						CTATCAATCAGTCCACACCCT	0.582																																					p.Q122Q		.											.	.	.	0			c.G366A						.						104.0	97.0	99.0					2																	23862089		692	1591	2283	SO:0001819	synonymous_variant	114818	exon4			CAATCAGTCCACA		CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.366G>A	2.37:g.23862089G>A		57	0		26	11	NM_052920	Q8N388|Q96BF0|Q96PW7	Silent	SNP	ENST00000486442.1	37	CCDS54335.1																																																																																			.		0.582	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324315.3	NM_052920	
KIF1B	23095	broad.mit.edu	37	1	10331564	10331564	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr1:10331564G>T	ENST00000377086.1	+	8	927	c.725G>T	c.(724-726)aGt>aTt	p.S242I	KIF1B_ENST00000377093.4_Missense_Mutation_p.S242I|KIF1B_ENST00000263934.6_Missense_Mutation_p.S242I|KIF1B_ENST00000377083.1_Missense_Mutation_p.S242I|KIF1B_ENST00000377081.1_Missense_Mutation_p.S242I			O60333	KIF1B_HUMAN	kinesin family member 1B	242	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TATCAGGTCAGTAAAATCAGC	0.363																																					p.S242I													.	KIF1B	242	0			c.G725T						.						175.0	181.0	179.0					1																	10331564		2203	4300	6503	SO:0001583	missense	23095	exon8			AGGTCAGTAAAAT	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.725G>T	1.37:g.10331564G>T	ENSP00000366290:p.Ser242Ile	155	0		65	3	NM_183416	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	32	5.182836	0.94885	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43	5.82	5.82	0.92795	Kinesin, motor domain (4);Kinesin, motor region, conserved site (1);	0.046698	0.85682	D	0.000000	D	0.93762	0.8006	H	0.96748	3.875	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;0.998;0.996;0.996;1.0;0.999;0.997	D;D;D;D;D;D;D	0.79108	0.991;0.992;0.96;0.977;0.989;0.961;0.986	D	0.95121	0.8246	10	0.87932	D	0	.	20.1661	0.98151	0.0:0.0:1.0:0.0	.	242;242;242;242;242;242;242	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	I	242	ENSP00000263934:S242I;ENSP00000366297:S242I;ENSP00000366290:S242I;ENSP00000366287:S242I;ENSP00000366284:S242I	ENSP00000263934:S242I	S	+	2	0	KIF1B	10254151	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.771000	0.98977	2.773000	0.95371	0.585000	0.79938	AGT	.		0.363	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
ST3GAL3	6487	broad.mit.edu	37	1	44303969	44303969	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr1:44303969G>T	ENST00000361392.4	+	5	465	c.288G>T	c.(286-288)acG>acT	p.T96T	ST3GAL3_ENST00000461375.1_3'UTR|ST3GAL3_ENST00000372367.1_Silent_p.T95T|ST3GAL3_ENST00000372372.2_Silent_p.T134T|ST3GAL3_ENST00000372366.1_Silent_p.T95T|ST3GAL3_ENST00000372375.2_Silent_p.T150T|ST3GAL3_ENST00000372368.2_Silent_p.T150T|ST3GAL3_ENST00000353126.3_Silent_p.T96T|ST3GAL3_ENST00000372365.1_Silent_p.T96T|ST3GAL3_ENST00000351035.3_Silent_p.T134T|ST3GAL3_ENST00000262915.3_Silent_p.T165T|ST3GAL3_ENST00000531993.1_Silent_p.T80T|ST3GAL3_ENST00000533933.1_Silent_p.T96T|ST3GAL3_ENST00000347631.2_Silent_p.T111T|ST3GAL3_ENST00000361746.4_Silent_p.T165T|ST3GAL3_ENST00000332628.6_Intron|ST3GAL3_ENST00000361400.4_Silent_p.T80T|ST3GAL3_ENST00000531451.1_Silent_p.T80T|ST3GAL3_ENST00000330208.2_Silent_p.T96T|ST3GAL3_ENST00000372369.1_Silent_p.T96T|ST3GAL3_ENST00000372377.4_Silent_p.T96T|ST3GAL3_ENST00000531816.1_Silent_p.T80T|ST3GAL3_ENST00000361812.4_Silent_p.T111T|ST3GAL3_ENST00000545417.1_Silent_p.T111T|ST3GAL3_ENST00000372374.2_Intron|ST3GAL3_ENST00000528371.1_Silent_p.T80T|ST3GAL3_ENST00000335430.6_Silent_p.T80T|ST3GAL3_ENST00000372362.2_Silent_p.T96T	NM_001270459.1|NM_006279.3|NM_174964.2	NP_001257388.1|NP_006270.1|NP_777624.1	Q11203	SIAT6_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 3	96					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(3)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				CCTTGATGACGGCCATCTTCC	0.542																																					p.T165T													ST3GAL3,NS,carcinoma,+1,1	ST3GAL3	56	0			c.G495T						.						184.0	168.0	173.0					1																	44303969		2203	4300	6503	SO:0001819	synonymous_variant	6487	exon6			GATGACGGCCATC	L23768	CCDS492.1, CCDS493.1, CCDS494.1, CCDS495.1, CCDS496.1, CCDS497.1, CCDS498.1, CCDS499.1, CCDS500.1, CCDS53310.1, CCDS57988.1, CCDS57989.1, CCDS57990.1, CCDS57991.1, CCDS57992.1, CCDS57993.1, CCDS57994.1	1p34.1	2014-01-31	2005-02-07	2005-02-07	ENSG00000126091	ENSG00000126091	2.4.99.6	"""Sialyltransferases"""	10866	protein-coding gene	gene with protein product	"""ST3Gal III"""	606494	"""sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)"", ""mental retardation, non-syndromic, autosomal recessive, 12"""	SIAT6, MRT12		8333853, 21907012	Standard	NM_174963		Approved		uc001cjz.4	Q11203	OTTHUMG00000007561	ENST00000361392.4:c.288G>T	1.37:g.44303969G>T		55	0		60	3	NM_174963	A9Z1W2|D3DPX8|Q5T4W9|Q5T4X0|Q5T4X7|Q5T4X8|Q5T4X9|Q5T4Y0|Q5T4Y2|Q5T4Y3|Q5T4Y4|Q86UR6|Q86UR7|Q86UR8|Q86UR9|Q86US0|Q86US1|Q86US2|Q8IX41|Q8IX42|Q8IX43|Q8IX44|Q8IX45|Q8IX46|Q8IX47|Q8IX48|Q8IX49|Q8IX50|Q8IX51|Q8IX52|Q8IX53|Q8IX54|Q8IX55|Q8IX56|Q8IX57|Q8IX58	Silent	SNP	ENST00000361392.4	37	CCDS492.1																																																																																			.		0.542	ST3GAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019964.1	NM_174963	
CUZD1	50624	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	124594545	124594545	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr10:124594545G>A	ENST00000368904.1	-	9	2008	c.1059C>T	c.(1057-1059)atC>atT	p.I353I	CUZD1_ENST00000545804.1_Silent_p.I353I|CUZD1_ENST00000392790.1_Silent_p.I353I					CUB and zona pellucida-like domains 1											NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|stomach(1)	39		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		TCTGACGGGTGATCACTTCAG	0.343																																					p.I353I													.	CUZD1	82	0			c.C1059T						.						114.0	110.0	111.0					10																	124594545		2203	4300	6503	SO:0001819	synonymous_variant	50624	exon7			ACGGGTGATCACT	AF305835	CCDS7631.1	10q26.13	2003-11-18			ENSG00000138161	ENSG00000138161			17937	protein-coding gene	gene with protein product						10542259	Standard	NM_022034		Approved	ERG-1, UO-44		Q86UP6	OTTHUMG00000019195	ENST00000368904.1:c.1059C>T	10.37:g.124594545G>A		89	0		60	24	NM_022034		Silent	SNP	ENST00000368904.1	37	CCDS7631.1																																																																																			.		0.343	CUZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050829.2	NM_022034	
PRKCQ	5588	broad.mit.edu	37	10	6527117	6527117	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr10:6527117T>C	ENST00000263125.5	-	10	1114	c.1015A>G	c.(1015-1017)Aga>Gga	p.R339G	PRKCQ_ENST00000397176.2_Missense_Mutation_p.R339G|PRKCQ_ENST00000539722.1_Missense_Mutation_p.R214G	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	339					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	CAGCTACCTCTTTTTCCCGGT	0.443																																					p.R339G	Ovarian(50;572 1126 10530 25349 30594)												.	PRKCQ	113	0			c.A1015G						.						186.0	180.0	182.0					10																	6527117		2203	4300	6503	SO:0001583	missense	5588	exon10			TACCTCTTTTTCC	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1015A>G	10.37:g.6527117T>C	ENSP00000263125:p.Arg339Gly	113	0		62	3	NM_006257	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	37	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	.	1.918	-0.448976	0.04572	.	.	ENSG00000065675	ENST00000263125;ENST00000397176;ENST00000539722	T;T;T	0.68765	-0.35;-0.29;-0.35	5.22	2.87	0.33458	.	0.495001	0.24705	N	0.036269	T	0.49898	0.1584	N	0.19112	0.55	0.25513	N	0.987442	B;B;B;B	0.12630	0.004;0.0;0.0;0.006	B;B;B;B	0.14023	0.008;0.0;0.0;0.01	T	0.26849	-1.0091	10	0.27785	T	0.31	.	13.1288	0.59369	0.0:0.0:0.2721:0.7279	.	214;111;339;339	B4DF52;Q5JUN8;Q04759-2;Q04759	.;.;.;KPCT_HUMAN	G	339;339;214	ENSP00000263125:R339G;ENSP00000380361:R339G;ENSP00000441752:R214G	ENSP00000263125:R339G	R	-	1	2	PRKCQ	6567123	0.997000	0.39634	0.377000	0.26055	0.006000	0.05464	2.538000	0.45710	0.058000	0.16222	-1.255000	0.01485	AGA	.		0.443	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257	
MKI67	4288	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	129913724	129913724	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr10:129913724G>T	ENST00000368654.3	-	7	1323	c.948C>A	c.(946-948)aaC>aaA	p.N316K	MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	316					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CCTTCCCCTTGTTCTGGTCAA	0.557																																					p.N316K													.	MKI67	363	0			c.C948A						.						76.0	80.0	78.0					10																	129913724		2203	4300	6503	SO:0001583	missense	4288	exon7			CCCCTTGTTCTGG	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.948C>A	10.37:g.129913724G>T	ENSP00000357643:p.Asn316Lys	61	1		41	20	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	g	1.345	-0.592914	0.03771	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.01228	5.14	3.17	-6.34	0.01982	.	3.199670	0.00674	N	0.000654	T	0.00967	0.0032	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45071	-0.9286	10	0.87932	D	0	.	3.3413	0.07119	0.2535:0.323:0.3295:0.094	.	316	P46013	KI67_HUMAN	K	316	ENSP00000357643:N316K	ENSP00000357643:N316K	N	-	3	2	MKI67	129803714	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.251000	0.00266	-3.519000	0.00148	-1.865000	0.00557	AAC	.		0.557	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
FOXRED1	55572	broad.mit.edu	37	11	126139308	126139308	+	Intron	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:126139308G>T	ENST00000263578.5	+	1	159				FOXRED1_ENST00000532125.1_Missense_Mutation_p.G14V|SRPR_ENST00000332118.6_5'Flank|FOXRED1_ENST00000534011.1_Intron|SRPR_ENST00000530680.1_5'Flank|FOXRED1_ENST00000442061.2_Intron|SRPR_ENST00000532259.1_5'Flank	NM_017547.3	NP_060017.1	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing 1							integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		CTTGGGGAAGGGGGTTAGCTT	0.572																																					.													.	FOXRED1	38	0			.						.																																			SO:0001627	intron_variant	55572	.			GGGAAGGGGGTTA		CCDS8471.1	11q24.2	2006-02-03			ENSG00000110074	ENSG00000110074			26927	protein-coding gene	gene with protein product		613622				10497265	Standard	NM_017547		Approved	H17	uc001qdi.3	Q96CU9	OTTHUMG00000165827	ENST00000263578.5:c.85+122G>T	11.37:g.126139308G>T		19	0		8	4	.	B3KN84|B4DHU2|Q71MG0|Q9BU39|Q9UKY9	Missense_Mutation	SNP	ENST00000263578.5	37	CCDS8471.1	.	.	.	.	.	.	.	.	.	.	G	9.813	1.183788	0.21870	.	.	ENSG00000110074	ENST00000532125	T	0.58940	0.3	3.64	0.966	0.19667	.	.	.	.	.	T	0.51856	0.1699	.	.	.	0.19300	N	0.999976	P	0.44429	0.835	P	0.46850	0.529	T	0.39742	-0.9599	8	0.45353	T	0.12	.	5.4461	0.16535	0.3714:0.0:0.6286:0.0	.	14	Q96CU9-3	.	V	14	ENSP00000434178:G14V	ENSP00000434178:G14V	G	+	2	0	FOXRED1	125644518	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	-0.484000	0.06528	0.233000	0.21120	0.491000	0.48974	GGG	.		0.572	FOXRED1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386434.1	NM_017547	
MUC5B	727897	broad.mit.edu;bcgsc.ca	37	11	1269861	1269861	+	Silent	SNP	A	A	G			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:1269861A>G	ENST00000529681.1	+	31	11809	c.11751A>G	c.(11749-11751)acA>acG	p.T3917T	MUC5B_ENST00000447027.1_Silent_p.T3920T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3917	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACACCCCCACAGTGCTGACCA	0.627																																					p.T3917T													.	MUC5B	473	0			c.A11751G						.						60.0	71.0	68.0					11																	1269861		1979	4124	6103	SO:0001819	synonymous_variant	727897	exon31			CCCCACAGTGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11751A>G	11.37:g.1269861A>G		186	0		124	48	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.		0.627	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
TRIM68	55128	broad.mit.edu	37	11	4626749	4626749	+	De_novo_Start_InFrame	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:4626749C>T	ENST00000300747.5	-	0	275					NM_018073.6	NP_060543.5	Q6AZZ1	TRI68_HUMAN	tripartite motif containing 68						protein autoubiquitination (GO:0051865)|regulation of androgen receptor signaling pathway (GO:0060765)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|histone acetyltransferase binding (GO:0035035)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		CCTTCTCACACCCTCCTCAGA	0.468																																					.													.	TRIM68	53	0			.						.						61.0	50.0	54.0					11																	4626749		2201	4298	6499			55128	.			CTCACACCCTCCT	AF360739	CCDS31356.1	11p15.4	2013-01-09	2011-01-25	2004-11-17		ENSG00000167333		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21161	protein-coding gene	gene with protein product		613184	"""ring finger protein 137"", ""tripartite motif-containing 68"""	RNF137		11597395	Standard	NM_018073		Approved	SS-56, FLJ10369	uc001lzf.2	Q6AZZ1			11.37:g.4626749C>T		16	0		11	4	.	A6NI19|A8K551|B3KPM5|B4DVK4|Q8WZ70|Q96LE5|Q96PF7|Q9H9C2|Q9NW18	Translation_Start_Site	SNP	ENST00000300747.5	37	CCDS31356.1																																																																																			.		0.468	TRIM68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385948.1	NM_018073	
OR5L2	26338	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55595251	55595251	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:55595251G>A	ENST00000378397.1	+	1	557	c.557G>A	c.(556-558)aGt>aAt	p.S186N		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				CCTCTCCTAAGTCTTGCTTGC	0.458										HNSCC(27;0.073)																											p.S186N													OR5L2,NS,carcinoma,+1,1	OR5L2	135	0			c.G557A						.						244.0	220.0	228.0					11																	55595251		2200	4296	6496	SO:0001583	missense	26338	exon1			TCCTAAGTCTTGC	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.557G>A	11.37:g.55595251G>A	ENSP00000367650:p.Ser186Asn	86	0		36	15	NM_001004739	Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	37	CCDS31511.1	.	.	.	.	.	.	.	.	.	.	.	5.651	0.304720	0.10678	.	.	ENSG00000205030	ENST00000378397	T	0.00130	8.69	5.24	0.981	0.19756	GPCR, rhodopsin-like superfamily (1);	0.353680	0.24693	N	0.036362	T	0.00109	0.0003	L	0.31294	0.92	0.09310	N	1	B	0.18013	0.025	B	0.21151	0.033	T	0.22556	-1.0213	10	0.49607	T	0.09	-7.0474	8.0132	0.30365	0.2953:0.2167:0.488:0.0	.	186	Q8NGL0	OR5L2_HUMAN	N	186	ENSP00000367650:S186N	ENSP00000367650:S186N	S	+	2	0	OR5L2	55351827	0.000000	0.05858	0.440000	0.26846	0.179000	0.23085	-1.401000	0.02502	0.315000	0.23110	0.632000	0.83419	AGT	.		0.458	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739	
RPS3	6188	broad.mit.edu;bcgsc.ca	37	11	75113481	75113481	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:75113481C>T	ENST00000531188.1	+	4	403	c.341C>T	c.(340-342)gCt>gTt	p.A114V	RPS3_ENST00000529285.1_3'UTR|RPS3_ENST00000530164.1_Missense_Mutation_p.A114V|SNORD15B_ENST00000384714.1_RNA|RPS3_ENST00000526608.1_Missense_Mutation_p.A102V|SNORD15A_ENST00000384214.1_RNA|RPS3_ENST00000278572.6_Missense_Mutation_p.A130V|RPS3_ENST00000524851.1_Missense_Mutation_p.A114V|RPS3_ENST00000534440.1_Intron|RPS3_ENST00000527446.1_Missense_Mutation_p.A114V	NM_001005.4|NM_001260506.1|NM_001260507.1	NP_000996.2|NP_001247435.1|NP_001247436.1	P23396	RS3_HUMAN	ribosomal protein S3	114					cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic translation (GO:0002181)|DNA catabolic process, endonucleolytic (GO:0000737)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of DNA repair (GO:0045738)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of DNA N-glycosylase activity (GO:1902546)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ruffle membrane (GO:0032587)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|enzyme binding (GO:0019899)|iron-sulfur cluster binding (GO:0051536)|mRNA binding (GO:0003729)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						GGAGGGCTTGCTGTGCGGAGG	0.453																																					p.A130V													.	RPS3	20	0			c.C389T						.						101.0	94.0	96.0					11																	75113481		2200	4293	6493	SO:0001583	missense	6188	exon4			GGCTTGCTGTGCG		CCDS8236.1, CCDS58161.1	11q13.3-q13.5	2011-04-05				ENSG00000149273		"""S ribosomal proteins"""	10420	protein-coding gene	gene with protein product	"""IMR-90 ribosomal protein S3"", ""40S ribosomal protein S3"""	600454				1712897, 7789996	Standard	NM_001005		Approved	FLJ26283, FLJ27450, MGC87870, S3	uc031qcs.1	P23396		ENST00000531188.1:c.341C>T	11.37:g.75113481C>T	ENSP00000434643:p.Ala114Val	62	0		36	4	NM_001260506	B2R7N5|J3KN86|Q498B5|Q8NI95	Missense_Mutation	SNP	ENST00000531188.1	37	CCDS8236.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490470	0.84962	.	.	ENSG00000149273	ENST00000531188;ENST00000530164;ENST00000530689;ENST00000278572;ENST00000527446;ENST00000526608;ENST00000524851	.	.	.	5.17	5.17	0.71159	Ribosomal protein S3, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.73016	0.3533	M	0.80028	2.48	0.80722	D	1	B	0.20988	0.05	B	0.32864	0.154	T	0.73795	-0.3870	9	0.87932	D	0	-17.0918	16.2237	0.82280	0.0:1.0:0.0:0.0	.	114	P23396	RS3_HUMAN	V	114;114;114;130;114;102;114	.	ENSP00000278572:A130V	A	+	2	0	RPS3	74791129	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	7.651000	0.83577	2.692000	0.91855	0.655000	0.94253	GCT	.		0.453	RPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384158.2	NM_001005	
KCNJ5	3762	broad.mit.edu	37	11	128781861	128781861	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr11:128781861G>T	ENST00000338350.4	+	3	1045	c.693G>T	c.(691-693)gaG>gaT	p.E231D	KCNJ5_ENST00000533599.1_Missense_Mutation_p.E231D|KCNJ5_ENST00000529694.1_Missense_Mutation_p.E231D			P48544	KCNJ5_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 5	231					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			NS(1)|breast(1)|endometrium(4)|large_intestine(4)|liver(2)|lung(9)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glyburide(DB01016)	ACATCGTGGAGGCCTCCATCC	0.597																																					p.E231D	Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)												.	KCNJ5	560	0			c.G693T						.						83.0	87.0	85.0					11																	128781861		2201	4297	6498	SO:0001583	missense	3762	exon2			CGTGGAGGCCTCC	D50134	CCDS8479.1	11q24	2014-09-17				ENSG00000120457		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6266	protein-coding gene	gene with protein product		600734				16382105	Standard	NM_000890		Approved	Kir3.4, CIR, KATP1, GIRK4, LQT13	uc001qet.3	P48544		ENST00000338350.4:c.693G>T	11.37:g.128781861G>T	ENSP00000339960:p.Glu231Asp	48	2		37	4	NM_000890	B2R744|Q6DK13|Q6DK14|Q92807	Missense_Mutation	SNP	ENST00000338350.4	37	CCDS8479.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.455298	0.63401	.	.	ENSG00000120457	ENST00000529694;ENST00000338350;ENST00000533599	D;D;D	0.92249	-3.0;-3.0;-3.0	5.46	3.59	0.41128	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.89382	0.6699	L	0.42487	1.325	0.42256	D	0.991993	B	0.28350	0.208	B	0.38225	0.268	D	0.85352	0.1102	10	0.49607	T	0.09	.	9.2706	0.37668	0.2198:0.0:0.7802:0.0	.	231	P48544	IRK5_HUMAN	D	231	ENSP00000433295:E231D;ENSP00000339960:E231D;ENSP00000434266:E231D	ENSP00000339960:E231D	E	+	3	2	KCNJ5	128287071	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.507000	0.45442	0.669000	0.31146	0.561000	0.74099	GAG	.		0.597	KCNJ5-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386239.1	NM_000890	
AC026369.1	0	broad.mit.edu	37	12	147969	147969	+	IGR	DEL	T	T	-	rs199686077	byFrequency	TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr12:147969delT	ENST00000594563.1	+	0	129				FAM138D_ENST00000320165.5_lincRNA																							acaatggaagtttatttctca	0.408													|||unknown(NO_COVERAGE)	1693	0.338059	0.3638	0.3487	5008	,	,		33777	0.2589		0.3668	False		,,,				2504	0.3476				.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TGGAAGTTTATTT																													12.37:g.147969delT		12	0		12	3	.		RNA	DEL	ENST00000594563.1	37																																																																																				T|0.500;-|0.500		0.408	AC026369.1-201	NOVEL	basic|appris_principal	protein_coding	protein_coding			
TTC6	319089	broad.mit.edu	37	14	38310791	38310791	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr14:38310791T>C	ENST00000476979.1	+	12	1629	c.1342T>C	c.(1342-1344)Ttt>Ctt	p.F448L	TTC6_ENST00000382320.3_3'UTR|TTC6_ENST00000553443.1_Missense_Mutation_p.F1814L|TTC6_ENST00000267368.7_Missense_Mutation_p.F448L			Q86TZ1	TTC6_HUMAN	tetratricopeptide repeat domain 6	448										central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	14	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;1.59e-06)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0543)|all cancers(34;0.108)|BRCA - Breast invasive adenocarcinoma(188;0.156)|LUSC - Lung squamous cell carcinoma(13;0.176)	GBM - Glioblastoma multiforme(112;0.00551)		AAGCTGTCCCTTTTGGGCTGC	0.308																																					.													.	.	.	0			.						.						41.0	40.0	40.0					14																	38310791		2203	4292	6495	SO:0001583	missense	319089	.			TGTCCCTTTTGGG	BC014342		14q13.1	2013-01-10			ENSG00000139865	ENSG00000139865		"""Tetratricopeptide (TTC) repeat domain containing"""	19739	protein-coding gene	gene with protein product			"""non-protein coding RNA 291"", ""chromosome 14 open reading frame 25"""	NCRNA00291, C14orf25			Standard	XM_006709976		Approved		uc001wuj.3	Q86TZ1	OTTHUMG00000157369	ENST00000476979.1:c.1342T>C	14.37:g.38310791T>C	ENSP00000417788:p.Phe448Leu	200	0		128	3	.	Q3SY88|Q96CE6	Missense_Mutation	SNP	ENST00000476979.1	37		.	.	.	.	.	.	.	.	.	.	T	4.217	0.039136	0.08148	.	.	ENSG00000139865	ENST00000553443;ENST00000476979;ENST00000267368	T;T;T	0.52057	0.68;0.68;0.68	5.36	0.436	0.16549	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	1.077740	0.07079	N	0.836757	T	0.23806	0.0576	N	0.04746	-0.17	0.29568	N	0.850155	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.34502	-0.9826	9	0.11485	T	0.65	-8.9241	8.1167	0.30946	0.0:0.3229:0.0:0.6771	.	1814;448	G3V3A5;Q86TZ1	.;TTC6_HUMAN	L	1814;448;448	ENSP00000451131:F1814L;ENSP00000417788:F448L;ENSP00000267368:F448L	ENSP00000267368:F448L	F	+	1	0	TTC6	37380542	0.100000	0.21855	0.001000	0.08648	0.562000	0.35680	1.401000	0.34589	-0.091000	0.12440	-0.264000	0.10439	TTT	.		0.308	TTC6-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000348621.2	XM_002343299	
SHF	90525	broad.mit.edu	37	15	45479775	45479775	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr15:45479775delG	ENST00000560734.1	-	1	375	c.375delC	c.(373-375)cccfs	p.P125fs	RP11-519G16.2_ENST00000560034.1_RNA|SHF_ENST00000561091.1_5'Flank|SHF_ENST00000560540.1_Frame_Shift_Del_p.P125fs|SHF_ENST00000318390.6_Intron|SHF_ENST00000560471.1_Frame_Shift_Del_p.P125fs|SHF_ENST00000290894.8_Intron					Src homology 2 domain containing F											endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(2)	12		all_cancers(109;8.13e-11)|all_epithelial(112;6.29e-09)|Lung NSC(122;3.57e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.1e-16)|GBM - Glioblastoma multiforme(94;5.98e-06)		GCGTGGGTCCGGGGGCGACAG	0.756																																					.													.	SHF	27	0			.						.																																			SO:0001589	frameshift_variant	90525	.			GGGTCCGGGGGCG	BC007586	CCDS10120.2, CCDS73721.1	15q21.1	2013-02-14			ENSG00000138606	ENSG00000138606		"""SH2 domain containing"""	25116	protein-coding gene	gene with protein product						11095946	Standard	NM_138356		Approved		uc001zuy.3	Q7M4L6	OTTHUMG00000131353	ENST00000560734.1:c.375delC	15.37:g.45479775delG	ENSP00000453168:p.Pro125fs	4	0		5	1	.		Frame_Shift_Del	DEL	ENST00000560734.1	37																																																																																				.		0.756	SHF-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000416338.1	NM_138356	
LOC81691	81691	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	20843488	20843488	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr16:20843488T>C	ENST00000261377.6	+	12	1378	c.1169T>C	c.(1168-1170)cTa>cCa	p.L390P	AC004381.6_ENST00000564274.1_Missense_Mutation_p.L390P|ERI2_ENST00000564349.1_Intron|AC004381.6_ENST00000348433.6_Missense_Mutation_p.L390P	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2																					ATTGCAGAACTAAATCTAGAA	0.348																																					p.L390P													.	LOC81691	41	0			c.T1169C						.						101.0	91.0	94.0					16																	20843488		2201	4300	6501	SO:0001583	missense	0	exon12			CAGAACTAAATCT																												ENST00000261377.6:c.1169T>C	16.37:g.20843488T>C	ENSP00000261377:p.Leu390Pro	144	0		75	9	NM_030941		Missense_Mutation	SNP	ENST00000261377.6	37	CCDS10591.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.416955	0.62511	.	.	ENSG00000005189	ENST00000348433;ENST00000261377	T;T	0.35048	1.33;1.73	4.51	4.51	0.55191	.	0.913552	0.09241	N	0.829146	T	0.50769	0.1635	L	0.55481	1.735	0.53005	D	0.999966	D;B	0.60575	0.988;0.03	P;B	0.60415	0.874;0.03	T	0.29792	-1.0000	10	0.44086	T	0.13	-1.558	10.1422	0.42742	0.0:0.0:0.0:1.0	.	390;390	Q96IC2-2;Q96IC2	.;REXON_HUMAN	P	390	ENSP00000261378:L390P;ENSP00000261377:L390P	ENSP00000261377:L390P	L	+	2	0	AC004381.6	20750989	0.933000	0.31639	0.998000	0.56505	0.894000	0.52154	2.043000	0.41231	1.893000	0.54813	0.454000	0.30748	CTA	.		0.348	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254418.2		
FBRS	64319	broad.mit.edu	37	16	30671270	30671270	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr16:30671270delC	ENST00000356166.6	+	1	1519	c.431delC	c.(430-432)gccfs	p.A144fs	FBRS_ENST00000568722.1_5'UTR			Q9HAH7	FBRS_HUMAN	fibrosin	0										ovary(1)	1			Colorectal(24;0.103)			TTCGCCATCGCCAGCTTCGCC	0.662																																					.													.	.	.	0			.						.																																			SO:0001589	frameshift_variant	64319	.			CCATCGCCAGCTT	AK021680		16p11.2	2008-02-05	2007-04-18	2007-04-18	ENSG00000156860	ENSG00000156860			20442	protein-coding gene	gene with protein product		608601	"""fibrosin 1"""	FBS1		7892239, 9809749	Standard	NM_001105079		Approved	FBS, FLJ11618	uc002dzd.4	Q9HAH7	OTTHUMG00000132390	ENST00000356166.6:c.431delC	16.37:g.30671270delC	ENSP00000348489:p.Ala144fs	8	0		6	1	.	B4DP86|Q96CI9|Q9H9X4	Frame_Shift_Del	DEL	ENST00000356166.6	37																																																																																				.		0.662	FBRS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000255520.4	NM_022452	
ANKRD36	375248	broad.mit.edu;bcgsc.ca	37	2	97911242	97911242	+	Missense_Mutation	SNP	G	G	C			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr2:97911242G>C	ENST00000461153.2	+	71	5162	c.4918G>C	c.(4918-4920)Gat>Cat	p.D1640H	ANKRD36_ENST00000420699.2_Missense_Mutation_p.D1640H|ANKRD36_ENST00000357042.4_5'Flank			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1640										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						TGCTCGATGTGATCATGATCA	0.423																																					p.D1640H													.	ANKRD36	170	0			c.G4918C						.						107.0	70.0	81.0					2																	97911242		692	1591	2283	SO:0001583	missense	375248	exon71			CGATGTGATCATG	BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.4918G>C	2.37:g.97911242G>C	ENSP00000419530:p.Asp1640His	286	0		247	38	NM_001164315	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	ENST00000461153.2	37	CCDS54379.1	.	.	.	.	.	.	.	.	.	.	.	7.605	0.673682	0.14841	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.21734	1.99;1.99	1.4	1.4	0.22301	.	.	.	.	.	T	0.42539	0.1207	M	0.79614	2.46	0.45035	D	0.998052	D;D	0.89917	0.998;1.0	D;D	0.85130	0.965;0.997	T	0.42120	-0.9470	9	0.87932	D	0	.	8.7525	0.34626	0.0:0.0:1.0:0.0	.	1640;464	A6QL64;A6QL64-3	AN36A_HUMAN;.	H	1640;1640;907	ENSP00000419530:D1640H;ENSP00000391950:D1640H	ENSP00000391950:D1640H	D	+	1	0	ANKRD36	97274960	0.996000	0.38824	0.439000	0.26833	0.121000	0.20230	3.856000	0.55964	1.081000	0.41110	0.184000	0.17185	GAT	.		0.423	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339154.5		
CD93	22918	broad.mit.edu	37	20	23066789	23066791	+	In_Frame_Del	DEL	AGC	AGC	-			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr20:23066789_23066791delAGC	ENST00000246006.4	-	1	186_188	c.39_41delGCT	c.(37-42)ctgctc>ctc	p.13_14LL>L		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	13					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CTGGGTcaggagcagcagcagca	0.709																																					p.13_14del													.	CD93	84	0			c.39_41del						.			4,187,3873		0,0,4,17,153,1858						-10.7	0.0			6	5,391,7426		0,0,5,22,347,3537	no	codingComplex	CD93	NM_012072.3		0,0,9,39,500,5395	A1A1,A1A2,A1R,A2A2,A2R,RR		5.0626,4.6998,4.9386				9,578,11299				SO:0001651	inframe_deletion	22918	exon1			GTCAGGAGCAGCA	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.39_41delGCT	20.37:g.23066798_23066800delAGC	ENSP00000246006:p.Leu15del	8	0		5	2	NM_012072	O00274	In_Frame_Del	DEL	ENST00000246006.4	37	CCDS13149.1																																																																																			.		0.709	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
UFD1L	7353	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	19455397	19455397	+	Splice_Site	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr22:19455397C>T	ENST00000263202.10	-	5	550	c.421G>A	c.(421-423)Gta>Ata	p.V141I	UFD1L_ENST00000399523.1_Splice_Site_p.V141I|UFD1L_ENST00000484101.1_5'UTR|UFD1L_ENST00000360834.4_Splice_Site_p.V130I	NM_001035247.2|NM_005659.6	NP_001030324.2|NP_005650.2	Q92890	UFD1_HUMAN	ubiquitin fusion degradation 1 like (yeast)	141					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			large_intestine(3)|upper_aerodigestive_tract(1)	4	Colorectal(54;0.0993)					AAAAGATACACGGCTTTGGGG	0.502																																					p.V141I													.	UFD1L	25	0			c.G421A						.						123.0	124.0	123.0					22																	19455397		2203	4300	6503	SO:0001630	splice_region_variant	7353	exon5			GATACACGGCTTT	AJ239058	CCDS13761.1, CCDS33600.1, CCDS33600.2	22q11.2	2014-05-02	2005-10-10		ENSG00000070010	ENSG00000070010			12520	protein-coding gene	gene with protein product		601754	"""ubiquitin fusion degradation 1-like"""			9063746	Standard	NM_005659		Approved	UFD1	uc002zpm.2	Q92890	OTTHUMG00000150130	ENST00000263202.10:c.422+1G>A	22.37:g.19455397C>T		100	0		61	21	NM_001035247	A8MW31|Q9Y5N0	Splice_Site	SNP	ENST00000263202.10	37	CCDS13761.1	.	.	.	.	.	.	.	.	.	.	C	36	5.783191	0.96937	.	.	ENSG00000070010	ENST00000263202;ENST00000360834;ENST00000399523;ENST00000399525;ENST00000447868;ENST00000421968	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	4.67	4.67	0.58626	.	0.053759	0.64402	D	0.000001	T	0.67813	0.2933	M	0.70903	2.155	0.80722	D	1	D;D;D	0.69078	0.985;0.971;0.997	D;D;D	0.72075	0.945;0.945;0.976	T	0.68481	-0.5397	10	0.45353	T	0.12	.	18.1188	0.89565	0.0:1.0:0.0:0.0	.	141;141;141	B4E3I3;A8MW31;Q92890	.;.;UFD1_HUMAN	I	141;130;141;177;45;130	ENSP00000263202:V141I;ENSP00000354079:V130I;ENSP00000382439:V141I;ENSP00000402136:V45I;ENSP00000406680:V130I	ENSP00000263202:V141I	V	-	1	0	UFD1L	17835397	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.302000	0.78861	2.582000	0.87167	0.555000	0.69702	GTA	.		0.502	UFD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316460.6		Missense_Mutation
PCLO	27445	broad.mit.edu	37	7	82545128	82545128	+	Silent	SNP	T	T	G			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr7:82545128T>G	ENST00000333891.9	-	7	12511	c.12174A>C	c.(12172-12174)ggA>ggC	p.G4058G	PCLO_ENST00000423517.2_Silent_p.G4058G|PCLO_ENST00000437081.1_Silent_p.G778G	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATGCCGCTGTTCCTTTGGTGA	0.433																																					p.G4058G													.	PCLO	1506	0			c.A12174C						.						98.0	88.0	91.0					7																	82545128		1955	4155	6110	SO:0001819	synonymous_variant	27445	exon7			CGCTGTTCCTTTG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12174A>C	7.37:g.82545128T>G		57	0		33	3	NM_014510		Silent	SNP	ENST00000333891.9	37	CCDS47630.1																																																																																			.		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
NOTCH1	4851	broad.mit.edu	37	9	139399225	139399225	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr9:139399225C>T	ENST00000277541.6	-	26	4993	c.4918G>A	c.(4918-4920)Gca>Aca	p.A1640T		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1640					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A1641fs*2(2)|p.E1637_Q1648del(1)|p.A1641T(1)		breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GCGTCAGGTGCGGCCCAGCCC	0.716			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.A1640T				Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	NOTCH1,NS,lymphoid_neoplasm,0,1	NOTCH1	1980	4	Deletion - Frameshift(2)|Substitution - Missense(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(4)	c.G4918A						.						6.0	8.0	7.0					9																	139399225		1926	4034	5960	SO:0001583	missense	4851	exon26			CAGGTGCGGCCCA	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.4918G>A	9.37:g.139399225C>T	ENSP00000277541:p.Ala1640Thr	53	0		26	3	NM_017617	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	4.038	0.004695	0.07866	.	.	ENSG00000148400	ENST00000277541	D	0.81659	-1.52	4.37	-1.74	0.08056	.	0.372399	0.28600	N	0.014774	T	0.52500	0.1738	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43653	-0.9378	10	0.13853	T	0.58	.	10.1181	0.42603	0.0:0.4361:0.0:0.5639	.	1640	P46531	NOTC1_HUMAN	T	1640	ENSP00000277541:A1640T	ENSP00000277541:A1640T	A	-	1	0	NOTCH1	138519046	0.001000	0.12720	0.014000	0.15608	0.152000	0.21847	0.981000	0.29526	-0.220000	0.09988	0.579000	0.79373	GCA	.		0.716	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
MIR450A1	554214	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	133674225	133674225	+	RNA	SNP	A	A	G			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chrX:133674225A>G	ENST00000362262.1	-	0	91				MIR450B_ENST00000401182.1_RNA|MIR450A2_ENST00000385022.1_RNA|MIR542_ENST00000385050.1_RNA	NR_029962.1				microRNA 450a-1																		atacaAAACTATGGATGCAAA	0.274																																					.													.	.	.	0			.						.						69.0	54.0	59.0					X																	133674225		1565	3581	5146			0	.			AAAACTATGGATG			Xq26.3	2011-09-12	2007-10-23	2008-12-18	ENSG00000199132	ENSG00000199132		"""ncRNAs / Micro RNAs"""	28008	non-coding RNA	RNA, micro			"""microRNA 450"", ""microRNA 450-1"""	MIRN450, MIRN450-1, MIRN450A1			Standard	NR_029962		Approved	hsa-mir-450, hsa-mir-450-1, hsa-mir-450a-1	uc011mvl.2				X.37:g.133674225A>G		121	1		109	36	.		RNA	SNP	ENST00000362262.1	37																																																																																				.		0.274	MIR450A1-201	KNOWN	basic	miRNA	miRNA		NR_029962	
TRAFD1	10906	ucsc.edu;bcgsc.ca	37	12	112583461	112583461	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr12:112583461C>T	ENST00000257604.5	+	7	1539	c.922C>T	c.(922-924)Cat>Tat	p.H308Y	TRAFD1_ENST00000412615.2_Missense_Mutation_p.H308Y	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	308					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						GCTGATTGACCATCAGGTGTG	0.438																																					p.H308Y													.	TRAFD1	42	0			c.C922T						.						229.0	209.0	216.0					12																	112583461		2203	4300	6503	SO:0001583	missense	10906	exon7			ATTGACCATCAGG	AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.922C>T	12.37:g.112583461C>T	ENSP00000257604:p.His308Tyr	88	1		41	4	NM_001143906	A8K5L6|B4DI89	Missense_Mutation	SNP	ENST00000257604.5	37	CCDS9160.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878797	0.72294	.	.	ENSG00000135148	ENST00000412615;ENST00000257604;ENST00000548277	T;T	0.73575	-0.76;-0.76	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	D	0.87434	0.6176	M	0.79475	2.455	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.87626	0.2513	10	0.87932	D	0	-22.5341	20.0471	0.97613	0.0:1.0:0.0:0.0	.	308	O14545	TRAD1_HUMAN	Y	308;308;102	ENSP00000396526:H308Y;ENSP00000257604:H308Y	ENSP00000257604:H308Y	H	+	1	0	TRAFD1	111067844	1.000000	0.71417	1.000000	0.80357	0.394000	0.30568	6.088000	0.71371	2.838000	0.97847	0.591000	0.81541	CAT	.		0.438	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405214.1	NM_006700	
MSN	4478	ucsc.edu;bcgsc.ca	37	X	64949502	64949502	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chrX:64949502C>A	ENST00000360270.5	+	4	567	c.395C>A	c.(394-396)tCt>tAt	p.S132Y		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	132	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						GCTGTCCAGTCTAAGTATGGC	0.542			T	ALK	ALCL																																p.S132Y				Dom	yes		X	Xq11.2-q12	4478	moesin		L	.	MSN	89	0			c.C395A						.						81.0	58.0	66.0					X																	64949502		2203	4300	6503	SO:0001583	missense	4478	exon4			TCCAGTCTAAGTA	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.395C>A	X.37:g.64949502C>A	ENSP00000353408:p.Ser132Tyr	67	0		28	4	NM_002444		Missense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854168	0.91355	.	.	ENSG00000147065	ENST00000360270	T	0.77750	-1.12	5.85	5.85	0.93711	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.166863	0.56097	D	0.000034	D	0.87002	0.6069	M	0.86268	2.805	0.80722	D	1	D	0.56968	0.978	P	0.54590	0.756	D	0.89051	0.3455	10	0.87932	D	0	.	17.5998	0.88023	0.0:1.0:0.0:0.0	.	132	P26038	MOES_HUMAN	Y	132	ENSP00000353408:S132Y	ENSP00000353408:S132Y	S	+	2	0	MSN	64866227	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	7.734000	0.84928	2.484000	0.83849	0.529000	0.55759	TCT	.		0.542	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
UBE4B	10277	bcgsc.ca	37	1	10192481	10192481	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr1:10192481G>T	ENST00000253251.8	+	14	2418	c.1579G>T	c.(1579-1581)Gct>Tct	p.A527S	UBE4B_ENST00000377157.3_Missense_Mutation_p.A411S|UBE4B_ENST00000475795.1_3'UTR|UBE4B_ENST00000343090.6_Missense_Mutation_p.A656S					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		AACCCGTGAGGCTGCTCTCAG	0.373																																					p.A656S													.	UBE4B	233	0			c.G1966T						.						74.0	75.0	75.0					1																	10192481		2203	4300	6503	SO:0001583	missense	10277	exon15			CGTGAGGCTGCTC	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.1579G>T	1.37:g.10192481G>T	ENSP00000253251:p.Ala527Ser	132	0		53	4	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	37	CCDS110.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452801	0.43531	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.43294	0.95;0.95;0.95	5.72	5.72	0.89469	Ubiquitin conjugation factor E4, core (1);	0.172021	0.50627	D	0.000108	T	0.38692	0.1050	L	0.42245	1.32	0.53005	D	0.999964	B;B	0.22909	0.077;0.01	B;B	0.22152	0.038;0.007	T	0.16928	-1.0386	10	0.15952	T	0.53	-18.8049	19.88	0.96892	0.0:0.0:1.0:0.0	.	656;527	O95155;O95155-2	UBE4B_HUMAN;.	S	527;411;656	ENSP00000253251:A527S;ENSP00000366362:A411S;ENSP00000343001:A656S	ENSP00000253251:A527S	A	+	1	0	UBE4B	10115068	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	6.259000	0.72494	2.703000	0.92315	0.655000	0.94253	GCT	.		0.373	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
PGD	5226	bcgsc.ca	37	1	10471520	10471520	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr1:10471520G>T	ENST00000270776.8	+	7	603	c.565G>T	c.(565-567)Ggg>Tgg	p.G189W	PGD_ENST00000541529.1_Missense_Mutation_p.G167W|PGD_ENST00000538557.1_Missense_Mutation_p.G176W	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	189					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	GGTGCACAACGGGATAGAGTA	0.577																																					p.G189W													.	PGD	39	0			c.G565T						.						141.0	107.0	118.0					1																	10471520		2203	4300	6503	SO:0001583	missense	5226	exon7			CACAACGGGATAG	BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.565G>T	1.37:g.10471520G>T	ENSP00000270776:p.Gly189Trp	67	0		26	3	NM_002631	A8K2Y9|B4DQJ8|Q9BWD8	Missense_Mutation	SNP	ENST00000270776.8	37	CCDS113.1	.	.	.	.	.	.	.	.	.	.	g	27.4	4.826243	0.90955	.	.	ENSG00000142657	ENST00000541529;ENST00000543846;ENST00000270776;ENST00000538557	T;T;T	0.73897	-0.79;-0.79;-0.79	4.85	4.85	0.62838	6-phosphogluconate dehydrogenase, C-terminal (1);Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	D	0.91998	0.7465	H	0.98466	4.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.95261	0.8369	10	0.87932	D	0	-18.5896	18.3696	0.90402	0.0:0.0:1.0:0.0	.	167;189;189	F5H7U0;A8K2Y9;P52209	.;.;6PGD_HUMAN	W	167;135;189;176	ENSP00000442285:G167W;ENSP00000270776:G189W;ENSP00000437822:G176W	ENSP00000270776:G189W	G	+	1	0	PGD	10394107	1.000000	0.71417	0.993000	0.49108	0.962000	0.63368	9.643000	0.98464	2.401000	0.81631	0.574000	0.79327	GGG	.		0.577	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005398.1	NM_002631	
QARS	5859	bcgsc.ca	37	3	49137444	49137444	+	Silent	SNP	A	A	G			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr3:49137444A>G	ENST00000306125.6	-	14	1582	c.1245T>C	c.(1243-1245)ccT>ccC	p.P415P	QARS_ENST00000470225.1_5'Flank|QARS_ENST00000414533.1_Silent_p.P404P			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	415					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	GATAGGCTACAGGGTCCATCT	0.587																																					p.P415P													.	QARS	55	0			c.T1245C						.						165.0	151.0	156.0					3																	49137444		2203	4300	6503	SO:0001819	synonymous_variant	5859	exon14			GGCTACAGGGTCC	X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1245T>C	3.37:g.49137444A>G		48	0		17	3	NM_005051	B4DWJ2	Silent	SNP	ENST00000306125.6	37	CCDS2788.1																																																																																			.		0.587	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051	
TRIM42	287015	bcgsc.ca	37	3	140407354	140407354	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr3:140407354C>T	ENST00000286349.3	+	3	2021	c.1830C>T	c.(1828-1830)taC>taT	p.Y610Y		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	610	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TTGTTATCTACCAGACTCTGG	0.542																																					p.Y610Y													.	TRIM42	143	0			c.C1830T						.						82.0	82.0	82.0					3																	140407354		2203	4300	6503	SO:0001819	synonymous_variant	287015	exon3			TATCTACCAGACT	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1830C>T	3.37:g.140407354C>T		49	0		32	3	NM_152616	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	37	CCDS3113.1																																																																																			.		0.542	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
SPEF2	79925	bcgsc.ca	37	5	35789374	35789374	+	Intron	SNP	C	C	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr5:35789374C>A	ENST00000356031.3	+	31	4601				CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000303129.4_Missense_Mutation_p.L73I|SPEF2_ENST00000440995.2_Intron	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2						axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CATGAATGTCCTTAGCATTCT	0.393																																					.													.	SPEF2	324	0			.						.																																			SO:0001627	intron_variant	79925	.			AATGTCCTTAGCA	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4448-3068C>A	5.37:g.35789374C>A		91	0		48	4	.	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127674	0.77549	.	.	ENSG00000152582	ENST00000303129	T	0.53640	0.61	6.17	6.17	0.99709	.	.	.	.	.	T	0.63058	0.2479	.	.	.	0.25823	N	0.984262	D	0.76494	0.999	D	0.64042	0.921	T	0.55623	-0.8112	8	0.22109	T	0.4	.	18.6524	0.91435	0.0:1.0:0.0:0.0	.	73	Q9C093-4	.	I	73	ENSP00000303843:L73I	ENSP00000303843:L73I	L	+	1	0	SPEF2	35825131	1.000000	0.71417	0.854000	0.33618	0.958000	0.62258	4.850000	0.62889	2.941000	0.99782	0.655000	0.94253	CTT	.		0.393	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
Unknown	0	bcgsc.ca	37	9	68437765	68437765	+	IGR	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr9:68437765G>A								MIR4477B (22377 upstream) : CR786580.2 (74580 downstream)																							GGAGGACTAGGGCCCTCATCA	0.269																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GACTAGGGCCCTC																													9.37:g.68437765G>A		287	6		162	11	.		RNA	SNP		37																																																																																				.	0	0.269								
COG1	9382	bcgsc.ca	37	17	71192846	71192846	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr17:71192846G>A	ENST00000299886.4	+	2	596	c.516G>A	c.(514-516)cgG>cgA	p.R172R	RP11-143K11.5_ENST00000580671.1_RNA	NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	172					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			TCCTCTCCCGGTTTCCTATAC	0.597																																					p.R172R													.	COG1	46	0			c.G516A						.						67.0	65.0	66.0					17																	71192846		2203	4300	6503	SO:0001819	synonymous_variant	9382	exon2			CTCCCGGTTTCCT		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.516G>A	17.37:g.71192846G>A		55	0		18	3	NM_018714	Q9NPV9|Q9P2G6	Silent	SNP	ENST00000299886.4	37	CCDS11692.1																																																																																			.		0.597	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1		
MLLT10P1	140678	bcgsc.ca	37	20	29637962	29637962	+	RNA	SNP	G	G	A			TCGA-ZH-A8Y1-01A-11D-A417-09	TCGA-ZH-A8Y1-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b4732670-b6da-4653-a356-486d91842583	c8778726-9a87-4c5a-beb9-607a1fdee593	g.chr20:29637962G>A	ENST00000408392.1	+	0	139																											AGAGGTATGTGCAGAGACTTC	0.413																																					.													.	.	.	0			.						.																																					140678	.			GTATGTGCAGAGA																													20.37:g.29637962G>A		295	3		192	8	.		RNA	SNP	ENST00000408392.1	37																																																																																				.		0.413	AL441988.1-201	NOVEL	basic	miRNA	miRNA			
