#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SPATA31A6	389730	hgsc.bcm.edu	37	9	43627977	43627977	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr9:43627977delG	ENST00000332857.6	-	4	738	c.710delC	c.(709-711)ccafs	p.P237fs	SPATA31A6_ENST00000496386.1_5'UTR	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	237					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ACAGTGAGATGGAGTTATCAG	0.582																																					p.P237fs		.											.	.	.	0			c.711delA						.						1.0	1.0	1.0					9																	43627977		4	19	23	SO:0001589	frameshift_variant	389730	exon4			TGAGATGGAGTTA		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.710delC	9.37:g.43627977delG	ENSP00000329825:p.Pro237fs	114	0		126	21	NM_001145196		Frame_Shift_Del	DEL	ENST00000332857.6	37	CCDS47973.1																																																																																			.		0.582	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196	
SPATA31A2	642265	hgsc.bcm.edu	37	9	39887722	39887722	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr9:39887722delC	ENST00000456183.2	+	4	738	c.709delC	c.(709-711)ccafs	p.P237fs		NM_001040065.1	NP_001035154.1	Q5RGS2	S31A2_HUMAN	SPATA31 subfamily A, member 2	237					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ACTGATAACTCCATCTCACTG	0.582																																					p.T236fs		.											.	.	.	0			c.708delT						.						1.0	1.0	1.0					9																	39887722		21	39	60	SO:0001589	frameshift_variant	642265	exon4			ATAACTCCATCTC			9p13.1	2012-10-15	2012-10-12	2012-10-12	ENSG00000204848				32002	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A2"""	FAM75A2		20850414	Standard			Approved	OTTHUMG00000013563	uc004abm.3	Q5RGS2	OTTHUMG00000013563	ENST00000456183.2:c.709delC	9.37:g.39887722delC	ENSP00000406957:p.Pro237fs	119	0		114	15	NM_001040065		Frame_Shift_Del	DEL	ENST00000456183.2	37	CCDS43809.1																																																																																			.		0.582	SPATA31A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037739.1	NM_001040065	
SPATA31A1	647060	hgsc.bcm.edu	37	9	39358471	39358471	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr9:39358471delC	ENST00000377647.3	+	4	738	c.709delC	c.(709-711)ccafs	p.P237fs	SPATA31A1_ENST00000473440.1_3'UTR	NM_001085452.1	NP_001078921.1	Q5TZJ5	S31A1_HUMAN	SPATA31 subfamily A, member 1	237					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ACTGATAACTCCATCTCACTG	0.582																																					p.T236fs		.											.	.	.	0			c.708delT						.																																			SO:0001589	frameshift_variant	642265	exon4			ATAACTCCATCTC		CCDS43808.1	9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000204849	ENSG00000204849			23394	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 36"", ""family with sequence similarity 75, member A1"""	C9orf36, FAM75A1		20850414	Standard	XM_006716851		Approved	DKFZP434B204, C9orf36A, OTTHUMG00000013156		Q5TZJ5	OTTHUMG00000013156	ENST00000377647.3:c.709delC	9.37:g.39358471delC	ENSP00000366875:p.Pro237fs	95	0		108	11	NM_001040065		Frame_Shift_Del	DEL	ENST00000377647.3	37	CCDS43808.1																																																																																			.		0.582	SPATA31A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036910.1	NM_001085452	
MUC4	4585	hgsc.bcm.edu	37	3	195515367	195515414	+	In_Frame_Del	DEL	GGTGACAGGAAGAGGGGTGGTGTGACCTGTGGATACTGAGGAAGGGCT	GGTGACAGGAAGAGGGGTGGTGTGACCTGTGGATACTGAGGAAGGGCT	-	rs369312980|rs547775645|rs201510137|rs200193644|rs531942134|rs13060431|rs200400545|rs71180964|rs199583597|rs55868431|rs55803325|rs550428312|rs199702053|rs13065584	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	GGTGACAGGAAGAGGGGTGGTGTGACCTGTGGATACTGAGGAAGGGCT	GGTGACAGGAAGAGGGGTGGTGTGACCTGTGGATACTGAGGAAGGGCT	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:195515367_195515414delGGTGACAGGAAGAGGGGTGGTGTGACCTGTGGATACTGAGGAAGGGCT	ENST00000463781.3	-	2	3496_3543	c.3037_3084delAGCCCTTCCTCAGTATCCACAGGTCACACCACCCCTCTTCCTGTCACC	c.(3037-3084)agcccttcctcagtatccacaggtcacaccacccctcttcctgtcaccdel	p.SPSSVSTGHTTPLPVT1013del	MUC4_ENST00000475231.1_In_Frame_Del_p.SPSSVSTGHTTPLPVT1013del|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	448	Repeat.|Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S1013_T1028delSPSSVSTGHTTPLPVT(4)|p.S1013G(2)|p.T1022A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAAGAGGGGTGGTGTGACCTGTGGATACTGAGGAAGGGCTGGTGACAGGA	0.573																																					p.1013_1029del		.											.	.	.	8	Substitution - Missense(4)|Deletion - In frame(4)	stomach(6)|prostate(2)	c.3038_3085del						.																																			SO:0001651	inframe_deletion	4585	exon2			AGTGTCGGTGACA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3037_3084delAGCCCTTCCTCAGTATCCACAGGTCACACCACCCCTCTTCCTGTCACC	3.37:g.195515367_195515414delGGTGACAGGAAGAGGGGTGGTGTGACCTGTGGATACTGAGGAAGGGCT	ENSP00000417498:p.Ser1013_Thr1028del	52	0		67	0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	In_Frame_Del	DEL	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.573	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MAP3K15	389840	hgsc.bcm.edu	37	X	19378938	19378938	+	Frame_Shift_Del	DEL	A	A	-			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chrX:19378938delA	ENST00000338883.4	-	29	3870	c.3871delT	c.(3871-3873)tgcfs	p.C1291fs	PDHA1_ENST00000545074.1_3'UTR|MAP3K15_ENST00000469203.2_Frame_Shift_Del_p.C1123fs|MAP3K15_ENST00000518578.1_5'UTR|PDHA1_ENST00000422285.2_3'UTR|PDHA1_ENST00000379806.5_3'UTR|MAP3K15_ENST00000359173.3_Frame_Shift_Del_p.C726fs|PDHA1_ENST00000540249.1_3'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	1291							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					CAGAGTCTGCAGAGGAGACCA	0.493																																					p.C1291fs		.											.	.	.	0			c.3872delG						.						107.0	82.0	90.0					X																	19378938		2203	4300	6503	SO:0001589	frameshift_variant	389840	exon29			GTCTGCAGAGGAG	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.3871delT	X.37:g.19378938delA	ENSP00000345629:p.Cys1291fs	10	3		28	11	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Frame_Shift_Del	DEL	ENST00000338883.4	37																																																																																				.		0.493	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
GIGYF2	26058	hgsc.bcm.edu	37	2	233712228	233712230	+	In_Frame_Del	DEL	CAG	CAG	-	rs62640389|rs10555297|rs398061180|rs527464858|rs58340018	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	CAG	CAG	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:233712228_233712230delCAG	ENST00000409547.1	+	29	3942_3944	c.3631_3633delCAG	c.(3631-3633)cagdel	p.Q1216del	GIGYF2_ENST00000409480.1_In_Frame_Del_p.Q1238del|GIGYF2_ENST00000373563.4_In_Frame_Del_p.Q1216del|GIGYF2_ENST00000373566.3_In_Frame_Del_p.Q1238del|GIGYF2_ENST00000409451.3_In_Frame_Del_p.Q1237del|GIGYF2_ENST00000409196.3_In_Frame_Del_p.Q1210del	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	1216	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.Q1216delQ(2)|p.Q1237delQ(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		gcagctgccacagcagcagcagc	0.547																																					p.1231_1232del		.											.,9	.	288	3	Deletion - In frame(3)	breast(2)|ovary(1)	c.3693_3695del						.																																			SO:0001651	inframe_deletion	26058	exon29			CTGCCACAGCAGC	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.3631_3633delCAG	2.37:g.233712237_233712239delCAG	ENSP00000386537:p.Gln1216del	36	0		57	0	NM_001103147	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	In_Frame_Del	DEL	ENST00000409547.1	37	CCDS33401.1																																																																																			.		0.547	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
SPTBN4	57731	hgsc.bcm.edu	37	19	40993696	40993696	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:40993696G>T	ENST00000352632.3	+	3	348	c.262G>T	c.(262-264)Gac>Tac	p.D88Y	SPTBN4_ENST00000598249.1_Missense_Mutation_p.D88Y|SPTBN4_ENST00000344104.3_Missense_Mutation_p.D88Y|SPTBN4_ENST00000338932.3_Missense_Mutation_p.D88Y|SPTBN4_ENST00000595535.1_Missense_Mutation_p.D88Y			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	88	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCTCTATGTGGACCTCCGGGA	0.662																																					p.D88Y		.											.	.	.	0			c.G262T						.						39.0	40.0	39.0					19																	40993696		2203	4300	6503	SO:0001583	missense	57731	exon3			TATGTGGACCTCC	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.262G>T	19.37:g.40993696G>T	ENSP00000263373:p.Asp88Tyr	89	0		88	4	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644898	0.87859	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.70045	-0.45;-0.45;-0.45	4.28	4.28	0.50868	Calponin homology domain (5);	0.000000	0.64402	U	0.000018	D	0.88994	0.6589	H	0.99042	4.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.93538	0.6875	10	0.87932	D	0	.	15.6338	0.76933	0.0:0.0:1.0:0.0	.	88;88	Q9H254;Q71S06	SPTN4_HUMAN;.	Y	88	ENSP00000263373:D88Y;ENSP00000340345:D88Y;ENSP00000340741:D88Y	ENSP00000340345:D88Y	D	+	1	0	SPTBN4	45685536	1.000000	0.71417	0.923000	0.36655	0.986000	0.74619	9.603000	0.98315	2.215000	0.71742	0.591000	0.81541	GAC	.		0.662	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
NRXN1	9378	hgsc.bcm.edu	37	2	50723152	50723152	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:50723152C>T	ENST00000406316.2	-	15	4437	c.2961G>A	c.(2959-2961)caG>caA	p.Q987Q	NRXN1_ENST00000401669.2_Silent_p.Q987Q|NRXN1_ENST00000405472.3_Silent_p.Q979Q|NRXN1_ENST00000401710.1_De_novo_Start_OutOfFrame|NRXN1_ENST00000402717.3_Silent_p.Q979Q|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000406859.3_Silent_p.Q987Q|NRXN1_ENST00000404971.1_Silent_p.Q1027Q	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	987	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CGTTGTGCCACTGATTGTCAT	0.423																																					p.Q1027Q		.											.	.	.	0			c.G3081A						.						157.0	142.0	147.0					2																	50723152		2032	4197	6229	SO:0001819	synonymous_variant	9378	exon16			GTGCCACTGATTG	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2961G>A	2.37:g.50723152C>T		70	0		89	4	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1																																																																																			.		0.423	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
TMPRSS3	64699	hgsc.bcm.edu	37	21	43803308	43803308	+	Splice_Site	SNP	C	C	A	rs56283966	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr21:43803308C>A	ENST00000291532.3	-	8	1572		c.e8-1		TMPRSS3_ENST00000380399.1_Splice_Site|TMPRSS3_ENST00000433957.2_Splice_Site|TMPRSS3_ENST00000398405.1_Splice_Site|TMPRSS3_ENST00000398397.3_Splice_Site|TMPRSS3_ENST00000474596.1_Splice_Site	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3						cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)	p.?(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						TGACCACAGGCTATGGAGGGG	0.597																																					.		.											TMPRSS3,NS,carcinoma,0,2	TMPRSS3	0	2	Unknown(2)	ovary(2)	c.617-1G>T						.						79.0	63.0	68.0					21																	43803308		2203	4300	6503	SO:0001630	splice_region_variant	64699	exon9			CACAGGCTATGGA	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.617-1G>T	21.37:g.43803308C>A		32	2		34	2	NM_024022	D3DSJ6|Q5USC7|Q6ZMC3	Splice_Site	SNP	ENST00000291532.3	37	CCDS13686.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.494444	0.26774	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2366	0.89951	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMPRSS3	42676377	1.000000	0.71417	0.934000	0.37439	0.068000	0.16541	4.686000	0.61700	2.363000	0.80096	0.591000	0.81541	.	.		0.597	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1		Intron
ARMC12	221481	hgsc.bcm.edu	37	6	35715084	35715084	+	Missense_Mutation	SNP	C	C	T	rs372805979		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:35715084C>T	ENST00000373866.3	+	4	513	c.491C>T	c.(490-492)aCg>aTg	p.T164M	ARMC12_ENST00000288065.2_Missense_Mutation_p.T191M|ARMC12_ENST00000373869.3_Missense_Mutation_p.T164M			Q5T9G4	ARM12_HUMAN	armadillo repeat containing 12	164						nucleus (GO:0005634)		p.T191M(2)									ATCTGGGACACGGAACTGCAC	0.537																																					p.T191M		.											C6orf81,colon,carcinoma,-1,3	C6orf81	-1	2	Substitution - Missense(2)	ovary(1)|breast(1)	c.C572T						.	C	MET/THR	0,4406		0,0,2203	158.0	147.0	151.0		572	2.5	0.4	6		151	1,8599	1.2+/-3.3	0,1,4299	no	missense	C6orf81	NM_145028.3	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	191/368	35715084	1,13005	2203	4300	6503	SO:0001583	missense	221481	exon4			GGGACACGGAACT	AK058119	CCDS4809.1, CCDS69093.1, CCDS69094.1	6p21.31	2013-02-14	2011-12-14	2011-12-14	ENSG00000157343	ENSG00000157343		"""Armadillo repeat containing"""	21099	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 81"""	C6orf81			Standard	XM_005248920		Approved	FLJ25390	uc003ola.3	Q5T9G4	OTTHUMG00000014577	ENST00000373866.3:c.491C>T	6.37:g.35715084C>T	ENSP00000362973:p.Thr164Met	28	0		45	2	NM_145028	Q8NEB2|Q96LL8	Missense_Mutation	SNP	ENST00000373866.3	37		.	.	.	.	.	.	.	.	.	.	C	9.974	1.226347	0.22542	0.0	1.16E-4	ENSG00000157343	ENST00000373869;ENST00000288065;ENST00000373866	T;T;T	0.30714	1.52;1.52;1.52	4.3	2.46	0.29980	.	0.949125	0.08657	N	0.912980	T	0.04724	0.0128	N	0.03608	-0.345	0.09310	N	1	B;B	0.19445	0.005;0.036	B;B	0.11329	0.004;0.006	T	0.41142	-0.9525	10	0.49607	T	0.09	-4.933	7.1355	0.25525	0.0:0.7781:0.0:0.2219	.	164;191	Q5T9G4-3;Q5T9G4-2	.;.	M	164;191;164	ENSP00000362976:T164M;ENSP00000288065:T191M;ENSP00000362973:T164M	ENSP00000288065:T191M	T	+	2	0	C6orf81	35823062	0.100000	0.21855	0.394000	0.26270	0.794000	0.44872	0.757000	0.26433	0.254000	0.21573	0.462000	0.41574	ACG	.		0.537	ARMC12-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040311.2	NM_145028	
NTRK3	4916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	88690583	88690583	+	Silent	SNP	C	C	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr15:88690583C>A	ENST00000360948.2	-	5	608	c.447G>T	c.(445-447)acG>acT	p.T149T	NTRK3_ENST00000558676.1_Silent_p.T149T|NTRK3_ENST00000542733.2_Silent_p.T51T|NTRK3_ENST00000355254.2_Silent_p.T149T|NTRK3_ENST00000394480.2_Silent_p.T149T|NTRK3_ENST00000317501.3_Silent_p.T149T|NTRK3_ENST00000357724.2_Silent_p.T149T|NTRK3_ENST00000540489.2_Silent_p.T149T|NTRK3_ENST00000557856.1_Silent_p.T149T	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	149			T -> R (in a gastric adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GAAGACTCAGCGTCTGGAAGA	0.473			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.T149T		.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	NTRK3_ENST00000360948,caecum,carcinoma,-1,3	NTRK3_ENST00000360948	-1	0			c.G447T						.						82.0	68.0	73.0					15																	88690583		2201	4299	6500	SO:0001819	synonymous_variant	4916	exon6			ACTCAGCGTCTGG	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.447G>T	15.37:g.88690583C>A		23	0		32	12	NM_001243101	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	CCDS32322.1																																																																																			.		0.473	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
PCDHGA10	56106	hgsc.bcm.edu	37	5	140795103	140795103	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:140795103G>T	ENST00000398610.2	+	1	2361	c.2361G>T	c.(2359-2361)gaG>gaT	p.E787D	PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB7_ENST00000398594.2_5'Flank|PCDHGB1_ENST00000523390.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	787					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGCCAGGAGAGCTGTGAGA	0.468																																					p.E787D		.											.	.	.	0			c.G2361T						.						89.0	96.0	94.0					5																	140795103		2203	4300	6503	SO:0001583	missense	56106	exon1			CCAGGAGAGCTGT		CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.2361G>T	5.37:g.140795103G>T	ENSP00000381611:p.Glu787Asp	101	0		97	4	NM_032090	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	CCDS47292.1	.	.	.	.	.	.	.	.	.	.	g	8.336	0.827618	0.16749	.	.	ENSG00000253846	ENST00000398610	D	0.94687	-3.49	5.42	3.62	0.41486	.	.	.	.	.	D	0.91439	0.7298	M	0.64676	1.99	0.18873	N	0.999987	B;B	0.19331	0.035;0.005	B;B	0.23018	0.043;0.009	T	0.79752	-0.1671	9	0.20046	T	0.44	.	6.9595	0.24590	0.1543:0.3647:0.481:0.0	.	787;787	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	D	787	ENSP00000381611:E787D	ENSP00000381611:E787D	E	+	3	2	PCDHGA10	140775287	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	1.193000	0.32162	0.655000	0.30866	-0.140000	0.14226	GAG	.		0.468	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913	
KIF5A	3798	hgsc.bcm.edu;bcgsc.ca	37	12	57960966	57960966	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:57960966G>T	ENST00000455537.2	+	7	833	c.559G>T	c.(559-561)Ggg>Tgg	p.G187W	KIF5A_ENST00000286452.5_Missense_Mutation_p.G98W	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	187	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.|Microtubule-binding.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GATTGATGAAGGGAAATCAAA	0.498																																					p.G187W		.											.	.	.	0			c.G559T						.						165.0	155.0	158.0					12																	57960966		2203	4300	6503	SO:0001583	missense	3798	exon7			GATGAAGGGAAAT	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.559G>T	12.37:g.57960966G>T	ENSP00000408979:p.Gly187Trp	40	0		71	4	NM_004984	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.708846	0.89018	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	D;D	0.83992	-1.79;-1.79	4.48	4.48	0.54585	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.95604	0.8571	H	0.99842	4.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97791	1.0238	10	0.87932	D	0	.	16.4543	0.84008	0.0:0.0:1.0:0.0	.	98;187	B7Z2M7;Q12840	.;KIF5A_HUMAN	W	187;98	ENSP00000408979:G187W;ENSP00000286452:G98W	ENSP00000286452:G98W	G	+	1	0	KIF5A	56247233	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.077000	0.94016	2.481000	0.83766	0.453000	0.30009	GGG	.		0.498	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
FLJ42102	399923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	71118801	71118801	+	RNA	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr11:71118801G>A	ENST00000331301.4	-	0	152					NR_038862.1																						AGTCACAGATGAGGGGCACGC	0.607																																					.		.											.	.	.	0			.						.																																					0	.			ACAGATGAGGGGC																													11.37:g.71118801G>A		20	0		28	12	.		RNA	SNP	ENST00000331301.4	37																																																																																				.		0.607	AP002387.1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000342268.1		
RNF123	63891	hgsc.bcm.edu	37	3	49725198	49725198	+	5'Flank	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:49725198G>A	ENST00000327697.6	+	0	0				MST1_ENST00000449682.2_Missense_Mutation_p.P76L|MST1_ENST00000383728.3_Intron|RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000545762.1_Missense_Mutation_p.P62L|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_Intron	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.P62L(1)		NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GTCCATTAAGGGCCCACAGCG	0.637																																					p.P76L		.											MST1,trunk,malignant_melanoma,0,1	MST1	0	1	Substitution - Missense(1)	skin(1)	c.C227T						.						44.0	41.0	42.0					3																	49725198		2203	4300	6503	SO:0001631	upstream_gene_variant	4485	exon2			ATTAAGGGCCCAC	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49725198G>A	Exception_encountered	42	0		61	4	NM_020998	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	7.785	0.710389	0.15239	.	.	ENSG00000173531	ENST00000449682;ENST00000545762	D;D	0.88354	-2.37;-2.37	4.78	2.81	0.32909	.	0.419544	0.18118	N	0.151133	T	0.81800	0.4899	L	0.36672	1.1	0.09310	N	1	B;B	0.22346	0.068;0.045	B;B	0.24006	0.05;0.02	T	0.66889	-0.5809	10	0.21014	T	0.42	.	10.1763	0.42941	0.0:0.1256:0.6471:0.2272	.	62;76	B7Z538;G3XAK1	.;.	L	76;62	ENSP00000414287:P76L;ENSP00000437535:P62L	ENSP00000411117:P76L	P	-	2	0	MST1	49700202	0.943000	0.32029	0.037000	0.18230	0.730000	0.41778	3.902000	0.56310	1.342000	0.45619	0.591000	0.81541	CCC	.		0.637	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
CHST4	10164	hgsc.bcm.edu	37	16	71571735	71571735	+	Silent	SNP	C	C	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:71571735C>A	ENST00000338482.5	+	3	1498	c.1155C>A	c.(1153-1155)atC>atA	p.I385I	ZNF19_ENST00000568446.1_Intron|CHST4_ENST00000572450.1_Silent_p.I385I|CHST4_ENST00000539698.3_Silent_p.I385I|RP11-510M2.5_ENST00000568523.1_RNA			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	385					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						CTGAGCAAATCCACTAAGAGG	0.498											OREG0023923	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I385I		.											.	.	.	0			c.C1155A						.						42.0	43.0	43.0					16																	71571735		2179	4268	6447	SO:0001819	synonymous_variant	10164	exon2			GCAAATCCACTAA	AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.1155C>A	16.37:g.71571735C>A		37	0	1131	37	4	NM_001166395	Q8IV46|Q9Y5R3	Silent	SNP	ENST00000338482.5	37	CCDS10902.1																																																																																			.		0.498	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268992.4	NM_005769	
KNCN	148930	hgsc.bcm.edu	37	1	47013133	47013133	+	3'UTR	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:47013133C>T	ENST00000481882.2	-	0	955				KNCN_ENST00000396314.3_3'UTR|MKNK1-AS1_ENST00000602433.1_RNA|KNCN_ENST00000524908.1_5'UTR			A6PVL3	KNCN_HUMAN	kinocilin							apical plasma membrane (GO:0016324)|ciliary basal body (GO:0036064)|cuticular plate (GO:0032437)|integral component of membrane (GO:0016021)|kinocilium (GO:0060091)|neuronal cell body (GO:0043025)				central_nervous_system(1)|endometrium(1)|lung(1)|ovary(1)	4	Acute lymphoblastic leukemia(166;0.155)					GAAAGAAAGGCCAGGGCAGGA	0.552																																					.		.											.	.	.	0			.						.						35.0	37.0	36.0					1																	47013133		692	1591	2283	SO:0001624	3_prime_UTR_variant	148930	.			GAAAGGCCAGGGC	AK056573	CCDS44133.1	1p33	2014-02-12	2006-10-26		ENSG00000162456	ENSG00000162456			26488	protein-coding gene	gene with protein product		611455				15855039	Standard	NM_001097611		Approved	FLJ32011, KINO, L5	uc001cpy.2	A6PVL3	OTTHUMG00000007987	ENST00000481882.2:c.*269G>A	1.37:g.47013133C>T		46	0		69	4	.	A8MXE3	RNA	SNP	ENST00000481882.2	37																																																																																				.		0.552	KNCN-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000316334.2	NM_182516	
BRPF1	7862	hgsc.bcm.edu	37	3	9785550	9785550	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:9785550C>T	ENST00000457855.1	+	7	2593	c.2582C>T	c.(2581-2583)gCg>gTg	p.A861V	BRPF1_ENST00000302054.3_Missense_Mutation_p.A861V|BRPF1_ENST00000383829.2_Missense_Mutation_p.A867V|BRPF1_ENST00000433861.2_Missense_Mutation_p.A861V|BRPF1_ENST00000424362.1_Missense_Mutation_p.A860V			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	861	Required for RUNX1 and RUNX2 transcriptional activation.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.A867V(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					ACAGATAGTGCGGCAGAGGAG	0.612																																					p.A867V		.											BRPF1,colon,carcinoma,0,1	BRPF1	0	1	Substitution - Missense(1)	large_intestine(1)	c.C2600T						.						52.0	37.0	42.0					3																	9785550		2202	4298	6500	SO:0001583	missense	7862	exon8			ATAGTGCGGCAGA	M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.2582C>T	3.37:g.9785550C>T	ENSP00000410210:p.Ala861Val	26	0		40	2	NM_001003694	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Missense_Mutation	SNP	ENST00000457855.1	37	CCDS2575.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.651589	0.67472	.	.	ENSG00000156983	ENST00000433861;ENST00000424362;ENST00000383829;ENST00000302054;ENST00000457855	T;T;T;T;T	0.16897	2.33;2.32;3.71;2.31;2.31	6.17	6.17	0.99709	.	0.171884	0.53938	D	0.000053	T	0.16981	0.0408	L	0.55481	1.735	0.58432	D	0.999992	P;B;B;B	0.42161	0.772;0.164;0.164;0.102	B;B;B;B	0.26969	0.075;0.026;0.026;0.012	T	0.03852	-1.0998	10	0.29301	T	0.29	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	861;860;867;861	P55201-4;P55201-3;P55201-2;P55201	.;.;.;BRPF1_HUMAN	V	861;860;867;861;861	ENSP00000402485:A861V;ENSP00000398863:A860V;ENSP00000373340:A867V;ENSP00000306297:A861V;ENSP00000410210:A861V	ENSP00000306297:A861V	A	+	2	0	BRPF1	9760550	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	4.672000	0.61597	2.941000	0.99782	0.655000	0.94253	GCG	.		0.612	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338485.1	NM_001003694	
CAPN13	92291	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	31010106	31010106	+	Missense_Mutation	SNP	A	A	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:31010106A>T	ENST00000295055.8	-	2	262	c.86T>A	c.(85-87)cTg>cAg	p.L29Q	CAPN13_ENST00000465960.2_5'UTR|CAPN13_ENST00000534090.2_Missense_Mutation_p.L29Q	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	29					proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					GCCCATGCTCAGGCAGTGATC	0.512																																					p.L29Q		.											.	.	.	0			c.T86A						.						47.0	48.0	48.0					2																	31010106		1980	4161	6141	SO:0001583	missense	92291	exon2			ATGCTCAGGCAGT		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.86T>A	2.37:g.31010106A>T	ENSP00000295055:p.Leu29Gln	31	0		52	4	NM_144575	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	ENST00000295055.8	37	CCDS46252.1	.	.	.	.	.	.	.	.	.	.	A	13.42	2.232425	0.39498	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	T;T	0.19250	2.16;2.16	5.91	5.91	0.95273	Peptidase C2, calpain, catalytic domain (1);	0.151685	0.44902	D	0.000411	T	0.50973	0.1647	M	0.86953	2.85	0.20074	N	0.999932	D	0.89917	1.0	D	0.76575	0.988	T	0.54957	-0.8215	10	0.87932	D	0	.	12.743	0.57264	1.0:0.0:0.0:0.0	.	29	Q6MZZ7	CAN13_HUMAN	Q	29	ENSP00000295055:L29Q;ENSP00000431298:L29Q	ENSP00000295055:L29Q	L	-	2	0	CAPN13	30863610	0.994000	0.37717	0.427000	0.26684	0.003000	0.03518	4.746000	0.62133	2.266000	0.75297	0.533000	0.62120	CTG	.		0.512	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325101.2	NM_144575	
Unknown	0	hgsc.bcm.edu	37	6	58260148	58260148	+	IGR	SNP	T	T	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:58260148T>C								XXbac-BPGBPG55C20.2 (19959 upstream) : LINC00680 (12212 downstream)																							ATTAAAAATATTTACATTAAA	0.284																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	375513	.			AAAATATTTACAT																													6.37:g.58260148T>C		141	0		205	13	.		RNA	SNP		37																																																																																				.	0	0.284								
PODNL1	79883	hgsc.bcm.edu	37	19	14044766	14044766	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:14044766C>T	ENST00000339560.5	-	7	986	c.713G>A	c.(712-714)cGc>cAc	p.R238H	PODNL1_ENST00000538371.2_Missense_Mutation_p.R236H|PODNL1_ENST00000538517.2_Missense_Mutation_p.R147H|PODNL1_ENST00000254320.3_Missense_Mutation_p.R156H	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	238	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)		p.R238H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			TTGAGTCTGGCGGCTCAGGGC	0.592																																					p.R238H		.											PODNL1,colon,carcinoma,0,1	PODNL1	0	1	Substitution - Missense(1)	large_intestine(1)	c.G713A						.						46.0	45.0	45.0					19																	14044766		2203	4300	6503	SO:0001583	missense	79883	exon7			GTCTGGCGGCTCA	AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.713G>A	19.37:g.14044766C>T	ENSP00000345175:p.Arg238His	33	0		34	3	NM_024825	B7Z564|Q9H5G9	Missense_Mutation	SNP	ENST00000339560.5	37	CCDS12300.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.711549	0.48517	.	.	ENSG00000132000	ENST00000538371;ENST00000538517;ENST00000339560;ENST00000545071;ENST00000254320	T;T;T;T	0.57595	0.39;0.39;0.39;1.86	4.59	2.27	0.28462	.	0.161340	0.29286	N	0.012592	T	0.51024	0.1650	N	0.16016	0.355	0.22240	N	0.999266	D;D;B;B	0.76494	0.998;0.999;0.449;0.231	D;D;B;B	0.72338	0.931;0.977;0.119;0.041	T	0.44298	-0.9337	10	0.42905	T	0.14	.	10.1581	0.42836	0.3768:0.6231:0.0:0.0	.	236;156;147;238	F5H7F9;B7Z3M0;G3V1J6;Q6PEZ8	.;.;.;PONL1_HUMAN	H	236;147;238;88;156	ENSP00000442553:R236H;ENSP00000440080:R147H;ENSP00000345175:R238H;ENSP00000254320:R156H	ENSP00000254320:R156H	R	-	2	0	PODNL1	13905766	0.947000	0.32204	0.996000	0.52242	0.990000	0.78478	0.757000	0.26433	0.276000	0.22118	0.591000	0.81541	CGC	.		0.592	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457967.1	NM_024825	
TNFSF13B	10673	hgsc.bcm.edu	37	13	108955854	108955854	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr13:108955854A>G	ENST00000375887.4	+	5	825	c.647A>G	c.(646-648)aAg>aGg	p.K216R	RNA5SP39_ENST00000411245.1_RNA|TNFSF13B_ENST00000430559.1_Missense_Mutation_p.K197R|TNFSF13B_ENST00000479435.1_3'UTR	NM_006573.4	NP_006564.1	Q9Y275	TN13B_HUMAN	tumor necrosis factor (ligand) superfamily, member 13b	216					B cell costimulation (GO:0031296)|B cell homeostasis (GO:0001782)|cell proliferation (GO:0008283)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of germinal center formation (GO:0002636)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			large_intestine(1)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(23;0.000396)|all_neural(89;0.00256)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00902)|Lung SC(71;0.104)		all cancers(43;0.184)|BRCA - Breast invasive adenocarcinoma(86;0.19)		Belimumab(DB08879)	CAGAGGAAGAAGGTCCATGTC	0.383																																					p.K216R		.											.	.	.	0			c.A647G						.						161.0	143.0	149.0					13																	108955854		2203	4300	6503	SO:0001583	missense	10673	exon5			GGAAGAAGGTCCA	AF136293	CCDS9509.1, CCDS45067.1	13q32-q34	2008-05-14			ENSG00000102524	ENSG00000102524		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11929	protein-coding gene	gene with protein product		603969		TNFSF20		10331498, 10359578	Standard	NM_006573		Approved	BAFF, THANK, BLYS, TALL-1, TALL1, CD257	uc001vqr.3	Q9Y275	OTTHUMG00000017329	ENST00000375887.4:c.647A>G	13.37:g.108955854A>G	ENSP00000365048:p.Lys216Arg	82	0		92	4	NM_006573	E0ADT7|Q6FHD6|Q7Z5J2	Missense_Mutation	SNP	ENST00000375887.4	37	CCDS9509.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.208534	0.79240	.	.	ENSG00000102524	ENST00000430559;ENST00000375887	D;D	0.94897	-3.55;-3.55	6.16	6.16	0.99307	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.000000	0.85682	D	0.000000	D	0.95746	0.8616	L	0.48642	1.525	0.80722	D	1	D;D	0.64830	0.994;0.966	D;P	0.64595	0.927;0.874	D	0.95686	0.8736	10	0.52906	T	0.07	-28.0739	15.9872	0.80168	1.0:0.0:0.0:0.0	.	197;216	Q9Y275-2;Q9Y275	.;TN13B_HUMAN	R	197;216	ENSP00000389540:K197R;ENSP00000365048:K216R	ENSP00000365048:K216R	K	+	2	0	TNFSF13B	107753855	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.198000	0.77823	2.367000	0.80283	0.528000	0.53228	AAG	.		0.383	TNFSF13B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045739.3		
PKHD1L1	93035	hgsc.bcm.edu	37	8	110491815	110491815	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr8:110491815G>T	ENST00000378402.5	+	54	9229	c.9125G>T	c.(9124-9126)cGa>cTa	p.R3042L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3042	G8 2. {ECO:0000255|PROSITE- ProRule:PRU00817}.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CAATCATCACGAGAAAATAAT	0.318										HNSCC(38;0.096)																											p.R3042L		.											PKHD1L1,NS,carcinoma,+1,1	PKHD1L1	+1	0			c.G9125T						.						116.0	102.0	106.0					8																	110491815		1830	4081	5911	SO:0001583	missense	93035	exon54			CATCACGAGAAAA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9125G>T	8.37:g.110491815G>T	ENSP00000367655:p.Arg3042Leu	30	0		61	3	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595777	0.28445	.	.	ENSG00000205038	ENST00000378402	D	0.85339	-1.97	5.97	-11.9	0.00025	G8 domain (2);	1.636870	0.03460	N	0.212083	T	0.70211	0.3198	L	0.27053	0.805	0.09310	N	0.999999	B	0.12013	0.005	B	0.18561	0.022	T	0.55655	-0.8107	10	0.29301	T	0.29	.	6.7024	0.23232	0.2218:0.2744:0.4392:0.0646	.	3042	Q86WI1	PKHL1_HUMAN	L	3042	ENSP00000367655:R3042L	ENSP00000367655:R3042L	R	+	2	0	PKHD1L1	110560991	0.000000	0.05858	0.087000	0.20705	0.909000	0.53808	-2.749000	0.00793	-3.102000	0.00244	-1.731000	0.00696	CGA	.		0.318	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
ATP12A	479	hgsc.bcm.edu	37	13	25274914	25274914	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr13:25274914G>T	ENST00000381946.3	+	13	1902	c.1735G>T	c.(1735-1737)Gag>Tag	p.E579*	RNY1P7_ENST00000384743.1_RNA|ATP12A_ENST00000218548.6_Nonsense_Mutation_p.E585*			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	579					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GCCAGCAGACGAGTTTCCAGA	0.428																																					p.E585X	Pancreas(156;1582 1935 18898 22665 26498)	.											ATP12A,NS,carcinoma,0,1	ATP12A	0	0			c.G1753T						.						115.0	106.0	109.0					13																	25274914		2203	4300	6503	SO:0001587	stop_gained	479	exon13			GCAGACGAGTTTC	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1735G>T	13.37:g.25274914G>T	ENSP00000371372:p.Glu579*	46	0		39	2	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Nonsense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	G	37	6.248533	0.97412	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	.	.	.	6.17	-0.686	0.11324	.	0.411149	0.25810	N	0.028152	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	7.5371	0.27717	0.2286:0.1009:0.6705:0.0	.	.	.	.	X	585;579	.	ENSP00000218548:E585X	E	+	1	0	ATP12A	24172914	0.000000	0.05858	0.008000	0.14137	0.180000	0.23129	-0.281000	0.08456	-0.494000	0.06669	-0.302000	0.09304	GAG	.		0.428	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
XYLT1	64131	hgsc.bcm.edu	37	16	17228428	17228428	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:17228428G>A	ENST00000261381.6	-	9	2013	c.1929C>T	c.(1927-1929)agC>agT	p.S643S	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	643					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CGTCGCTCAGGCTGTGGATGC	0.622																																					p.S643S		.											.	.	.	0			c.C1929T						.						114.0	99.0	104.0					16																	17228428		2197	4300	6497	SO:0001819	synonymous_variant	64131	exon9			GCTCAGGCTGTGG	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1929C>T	16.37:g.17228428G>A		31	0		72	4	NM_022166	Q9H1B6	Silent	SNP	ENST00000261381.6	37	CCDS10569.1																																																																																			.		0.622	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
UGGT1	56886	hgsc.bcm.edu	37	2	128884954	128884954	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:128884954G>T	ENST00000259253.6	+	12	1201	c.1154G>T	c.(1153-1155)gGa>gTa	p.G385V	UGGT1_ENST00000375990.3_Missense_Mutation_p.G361V	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	385					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)	p.G385A(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GGAACTTTAGGATTACAACCT	0.323																																					p.G385V		.											UGGT1,NS,carcinoma,0,1	UGGT1	0	1	Substitution - Missense(1)	lung(1)	c.G1154T						.						73.0	75.0	75.0					2																	128884954		2203	4300	6503	SO:0001583	missense	56886	exon12			CTTTAGGATTACA	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.1154G>T	2.37:g.128884954G>T	ENSP00000259253:p.Gly385Val	67	0		85	4	NM_020120	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.649476	0.87958	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.61274	0.12;0.12	5.51	5.51	0.81932	.	0.101117	0.64402	D	0.000002	T	0.79873	0.4521	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	1.0;0.993	D;P	0.77004	0.989;0.794	T	0.78653	-0.2120	10	0.27785	T	0.31	.	19.0419	0.93004	0.0:0.0:1.0:0.0	.	361;385	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	V	361;385	ENSP00000365158:G361V;ENSP00000259253:G385V	ENSP00000259253:G385V	G	+	2	0	UGGT1	128601424	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.100000	0.94213	2.600000	0.87896	0.655000	0.94253	GGA	.		0.323	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120	
FBP1	2203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	97367846	97367846	+	Missense_Mutation	SNP	G	G	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr9:97367846G>C	ENST00000375326.4	-	6	914	c.718C>G	c.(718-720)Cct>Gct	p.P240A	FBP1_ENST00000415431.1_Missense_Mutation_p.P240A	NM_000507.3	NP_000498.2	P09467	F16P1_HUMAN	fructose-1,6-bisphosphatase 1	240					carbohydrate metabolic process (GO:0005975)|cellular response to drug (GO:0035690)|cellular response to magnesium ion (GO:0071286)|dephosphorylation (GO:0016311)|fructose 6-phosphate metabolic process (GO:0006002)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|negative regulation of cell growth (GO:0030308)|negative regulation of glycolytic process (GO:0045820)|negative regulation of Ras protein signal transduction (GO:0046580)|protein homotetramerization (GO:0051289)|regulation of gluconeogenesis (GO:0006111)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	AMP binding (GO:0016208)|fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|monosaccharide binding (GO:0048029)			kidney(1)|liver(1)|lung(1)	3		Acute lymphoblastic leukemia(62;0.136)			Adenosine monophosphate(DB00131)	GCCCCATAAGGAGCTGAATTA	0.458																																					p.P240A	Ovarian(142;590 2466 25593 44496)	.											.	.	.	0			c.C718G						.						45.0	43.0	44.0					9																	97367846		2203	4300	6503	SO:0001583	missense	2203	exon6			CATAAGGAGCTGA	M19922	CCDS6712.1	9q22.3	2012-08-13			ENSG00000165140	ENSG00000165140	3.1.3.11		3606	protein-coding gene	gene with protein product		611570		FBP		8387495	Standard	NM_000507		Approved		uc004auw.4	P09467	OTTHUMG00000020268	ENST00000375326.4:c.718C>G	9.37:g.97367846G>C	ENSP00000364475:p.Pro240Ala	54	0		62	26	NM_000507	O75571|Q53F94|Q96E46	Missense_Mutation	SNP	ENST00000375326.4	37	CCDS6712.1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.282095	0.40394	.	.	ENSG00000165140	ENST00000375326;ENST00000415431	T;T	0.71934	-0.61;-0.61	5.52	4.61	0.57282	.	0.044953	0.85682	N	0.000000	T	0.71221	0.3314	M	0.72118	2.19	0.80722	D	1	B	0.28258	0.205	B	0.28465	0.09	T	0.71269	-0.4643	10	0.54805	T	0.06	-18.8928	16.2663	0.82581	0.0:0.133:0.867:0.0	.	240	P09467	F16P1_HUMAN	A	240	ENSP00000364475:P240A;ENSP00000408025:P240A	ENSP00000364475:P240A	P	-	1	0	FBP1	96407667	1.000000	0.71417	0.233000	0.24025	0.002000	0.02628	7.786000	0.85741	1.298000	0.44778	-0.494000	0.04653	CCT	.		0.458	FBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053187.1	NM_000507	
LONP2	83752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	48333669	48333669	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:48333669C>T	ENST00000285737.4	+	10	1724	c.1631C>T	c.(1630-1632)cCc>cTc	p.P544L	LONP2_ENST00000535754.1_Missense_Mutation_p.P500L	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						ATTCAGATACCCCAGGTCACC	0.478																																					p.P544L		.											.	.	.	0			c.C1631T						.						118.0	116.0	117.0					16																	48333669		2200	4300	6500	SO:0001583	missense	83752	exon10			AGATACCCCAGGT	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.1631C>T	16.37:g.48333669C>T	ENSP00000285737:p.Pro544Leu	34	0		31	10	NM_031490		Missense_Mutation	SNP	ENST00000285737.4	37	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498908	0.85069	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754;ENST00000416006	T;T;T	0.39997	1.05;1.05;1.05	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.53481	0.1799	M	0.77712	2.385	0.80722	D	1	P;P	0.50443	0.919;0.935	B;P	0.45474	0.401;0.482	T	0.56529	-0.7964	10	0.42905	T	0.14	-19.5673	19.9699	0.97282	0.0:1.0:0.0:0.0	.	500;544	B7ZKL7;Q86WA8	.;LONP2_HUMAN	L	544;273;500;500	ENSP00000285737:P544L;ENSP00000445426:P500L;ENSP00000415983:P500L	ENSP00000285737:P544L	P	+	2	0	LONP2	46891170	1.000000	0.71417	0.993000	0.49108	0.967000	0.64934	7.719000	0.84751	2.730000	0.93505	0.591000	0.81541	CCC	.		0.478	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	
GPATCH1	55094	hgsc.bcm.edu;broad.mit.edu	37	19	33581730	33581730	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:33581730G>T	ENST00000170564.2	+	3	567	c.253G>T	c.(253-255)Gac>Tac	p.D85Y		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	85					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					GAACAGAGCAGACAAATCTGT	0.418																																					p.D85Y	Pancreas(67;88 1713 4567 18227)	.											.	.	.	0			c.G253T						.						122.0	103.0	109.0					19																	33581730		2203	4300	6503	SO:0001583	missense	55094	exon3			AGAGCAGACAAAT	AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.253G>T	19.37:g.33581730G>T	ENSP00000170564:p.Asp85Tyr	71	0		80	4	NM_018025	Q8IZV6|Q8N3B7|Q9NW94	Missense_Mutation	SNP	ENST00000170564.2	37	CCDS12428.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.721207	0.89205	.	.	ENSG00000076650	ENST00000170564	T	0.13420	2.59	5.95	5.95	0.96441	Domain of unknown function DUF1604 (1);	0.201929	0.51477	D	0.000081	T	0.36496	0.0969	M	0.64404	1.975	0.80722	D	1	D	0.55385	0.971	D	0.65323	0.934	T	0.00989	-1.1489	10	0.72032	D	0.01	-15.6781	19.3848	0.94553	0.0:0.0:1.0:0.0	.	85	Q9BRR8	GPTC1_HUMAN	Y	85	ENSP00000170564:D85Y	ENSP00000170564:D85Y	D	+	1	0	GPATCH1	38273570	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.822000	0.92013	2.829000	0.97493	0.655000	0.94253	GAC	.		0.418	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450834.1	NM_018025	
RARA	5914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38510560	38510560	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:38510560C>T	ENST00000254066.5	+	7	1269	c.814C>T	c.(814-816)Cgg>Tgg	p.R272W	RARA_ENST00000420042.1_3'UTR|RARA_ENST00000394089.2_Missense_Mutation_p.R272W|RARA_ENST00000425707.3_Missense_Mutation_p.R175W|RARA_ENST00000394086.3_Missense_Mutation_p.R288W|RARA_ENST00000394081.3_Missense_Mutation_p.R267W	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha	272	Ligand-binding.				apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CCAGATCCTGCGGATCTGCAC	0.647			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL																																p.R272W		.		Dom	yes		17	17q12	5914	"""retinoic acid receptor, alpha"""		L	RARA,colon,carcinoma,0,1	RARA	0	0			c.C814T						.						73.0	60.0	64.0					17																	38510560		2203	4300	6503	SO:0001583	missense	5914	exon7			ATCCTGCGGATCT	X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	ENST00000254066.5:c.814C>T	17.37:g.38510560C>T	ENSP00000254066:p.Arg272Trp	34	0		46	18	NM_000964	B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	Missense_Mutation	SNP	ENST00000254066.5	37	CCDS11366.1	.	.	.	.	.	.	.	.	.	.	C	13.68	2.310289	0.40895	.	.	ENSG00000131759	ENST00000254066;ENST00000425707;ENST00000394089;ENST00000394086;ENST00000394081;ENST00000319149;ENST00000420042	D;D;D;D;D	0.96554	-4.05;-4.05;-4.05;-4.05;-4.05	4.93	3.94	0.45596	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98441	0.9481	M	0.93550	3.43	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99342	1.0912	10	0.87932	D	0	.	13.543	0.61686	0.1574:0.8426:0.0:0.0	.	175;267;272	B8Y636;F1D8N9;P10276	.;.;RARA_HUMAN	W	272;175;272;288;267;265;159	ENSP00000254066:R272W;ENSP00000389993:R175W;ENSP00000377649:R272W;ENSP00000377648:R288W;ENSP00000377643:R267W	ENSP00000254066:R272W	R	+	1	2	RARA	35764086	0.986000	0.35501	1.000000	0.80357	0.996000	0.88848	0.830000	0.27462	1.266000	0.44231	0.591000	0.81541	CGG	.		0.647	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257136.2		
HMGB3	3149	hgsc.bcm.edu;bcgsc.ca	37	X	150156360	150156360	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chrX:150156360G>A	ENST00000325307.7	+	5	672	c.576G>A	c.(574-576)gaG>gaA	p.E192E	HMGB3_ENST00000448905.2_Silent_p.E192E	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	192	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)	p.E192E(1)		endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					aggaagaagaggaggaggagg	0.443																																					p.E192E		.											.	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G576A						.						50.0	48.0	49.0					X																	150156360		2202	4299	6501	SO:0001819	synonymous_variant	3149	exon5			AGAAGAGGAGGAG	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.576G>A	X.37:g.150156360G>A		37	0		43	4	NM_005342	O95556|Q6NS40	Silent	SNP	ENST00000325307.7	37	CCDS35428.1																																																																																			.		0.443	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060867.1	NM_005342	
ODF1	4956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	103564207	103564207	+	Silent	SNP	A	A	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr8:103564207A>G	ENST00000285402.3	+	1	408	c.252A>G	c.(250-252)cgA>cgG	p.R84R		NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	84					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			ACTGTCTGCGACCATCTCTCA	0.428																																					p.R84R		.											.	.	.	0			c.A252G						.						158.0	141.0	147.0					8																	103564207		2203	4300	6503	SO:0001819	synonymous_variant	4956	exon1			TCTGCGACCATCT	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.252A>G	8.37:g.103564207A>G		33	0		39	15	NM_024410	Q3SX72	Silent	SNP	ENST00000285402.3	37	CCDS6293.1																																																																																			.		0.428	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1		
RAD50	10111	hgsc.bcm.edu	37	5	131927041	131927041	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:131927041G>T	ENST00000265335.6	+	10	1965	c.1578G>T	c.(1576-1578)gaG>gaT	p.E526D	RAD50_ENST00000378823.3_Missense_Mutation_p.E387D			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	526					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.E387D(1)|p.E526D(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGAGATGGAGCAGTTAAACC	0.363								Homologous recombination																													p.E526D		.											RAD50_ENST00000265335,NS,carcinoma,0,2	RAD50_ENST00000265335	0	2	Substitution - Missense(2)	endometrium(2)	c.G1578T						.						116.0	103.0	107.0					5																	131927041		2203	4300	6503	SO:0001583	missense	10111	exon10			GATGGAGCAGTTA	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.1578G>T	5.37:g.131927041G>T	ENSP00000265335:p.Glu526Asp	29	0		41	2	NM_005732	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	37	CCDS34233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.12|12.12	1.841379|1.841379	0.32513|0.32513	.|.	.|.	ENSG00000113522|ENSG00000113522	ENST00000434288|ENST00000378823;ENST00000265335	.|T;T	.|0.04970	.|3.52;3.75	5.7|5.7	3.52|3.52	0.40303|0.40303	.|.	.|0.090737	.|0.85682	.|D	.|0.000000	T|T	0.06962|0.06962	0.0177|0.0177	L|L	0.53249|0.53249	1.67|1.67	0.50632|0.50632	D|D	0.999881|0.999881	.|B	.|0.24317	.|0.101	.|B	.|0.17098	.|0.017	T|T	0.20874|0.20874	-1.0262|-1.0262	5|10	.|0.15952	.|T	.|0.53	-19.619|-19.619	11.4923|11.4923	0.50387|0.50387	0.2263:0.0:0.7737:0.0|0.2263:0.0:0.7737:0.0	.|.	.|526	.|Q92878	.|RAD50_HUMAN	S|D	25|387;526	.|ENSP00000368100:E387D;ENSP00000265335:E526D	.|ENSP00000265335:E526D	A|E	+|+	1|3	0|2	RAD50|RAD50	131954940|131954940	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.688000|1.688000	0.37690|0.37690	1.341000|1.341000	0.45600|0.45600	0.655000|0.655000	0.94253|0.94253	GCA|GAG	.		0.363	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
VWA5B1	127731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	20672037	20672037	+	Missense_Mutation	SNP	C	C	A	rs563935139		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:20672037C>A	ENST00000375079.2	+	17	2911	c.2715C>A	c.(2713-2715)gaC>gaA	p.D905E	VWA5B1_ENST00000525343.1_3'UTR|VWA5B1_ENST00000289815.8_Missense_Mutation_p.D905E|VWA5B1_ENST00000375083.4_Missense_Mutation_p.D905E	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	905						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						TGCCTGTGGACGTGAGCAAGA	0.637																																					p.D905E		.											.	.	.	0			c.C2715A						.						44.0	39.0	40.0					1																	20672037		692	1591	2283	SO:0001583	missense	127731	exon17			TGTGGACGTGAGC	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.2715C>A	1.37:g.20672037C>A	ENSP00000364220:p.Asp905Glu	41	0		48	16	NM_001039500	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	ENST00000375079.2	37		.	.	.	.	.	.	.	.	.	.	C	17.53	3.413215	0.62511	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000375079	D;D;D	0.86562	-2.14;-2.14;-2.14	5.28	2.42	0.29668	.	0.059782	0.64402	D	0.000004	D	0.87285	0.6139	L	0.38175	1.15	0.80722	D	1	D;D;D	0.89917	0.994;1.0;0.987	P;D;P	0.87578	0.79;0.998;0.819	D	0.83479	0.0063	10	0.51188	T	0.08	-10.4624	4.8649	0.13604	0.0:0.5276:0.1458:0.3267	.	905;905;905	Q5TIE3;Q5TIE3-5;Q5TIE3-2	VW5B1_HUMAN;.;.	E	905	ENSP00000289815:D905E;ENSP00000364224:D905E;ENSP00000364220:D905E	ENSP00000289815:D905E	D	+	3	2	VWA5B1	20544624	0.068000	0.21057	0.364000	0.25888	0.978000	0.69477	0.179000	0.16840	0.242000	0.21303	-0.241000	0.12123	GAC	.		0.637	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
FER1L6	654463	hgsc.bcm.edu	37	8	124989720	124989720	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr8:124989720G>T	ENST00000522917.1	+	10	1140	c.934G>T	c.(934-936)Gaa>Taa	p.E312*	FER1L6_ENST00000399018.1_Nonsense_Mutation_p.E312*	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	312	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GATCTTCAAGGAAATGTTCCC	0.507																																					p.E312X		.											FER1L6,NS,lymphoid_neoplasm,0,1	FER1L6	0	0			c.G934T						.						160.0	164.0	163.0					8																	124989720		2069	4207	6276	SO:0001587	stop_gained	654463	exon10			TTCAAGGAAATGT	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.934G>T	8.37:g.124989720G>T	ENSP00000428280:p.Glu312*	51	0		35	2	NM_001039112		Nonsense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	G	42	9.180872	0.99092	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	.	.	.	5.53	5.53	0.82687	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	19.4728	0.94969	0.0:0.0:1.0:0.0	.	.	.	.	X	312	.	ENSP00000381982:E312X	E	+	1	0	FER1L6	125058901	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.608000	0.88229	0.561000	0.74099	GAA	.		0.507	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
KMT2E	55904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	104719314	104719314	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr7:104719314C>T	ENST00000311117.3	+	12	1697	c.1152C>T	c.(1150-1152)ttC>ttT	p.F384F	KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000257745.4_Silent_p.F384F|KMT2E_ENST00000334877.4_Silent_p.F384F|KMT2E_ENST00000476671.1_Silent_p.F384F	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	384	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TTGTGTTATTCTACTCTAAAT	0.413																																					p.F384F		.											.	.	.	0			c.C1152T						.						167.0	159.0	162.0					7																	104719314		2203	4300	6503	SO:0001819	synonymous_variant	55904	exon11			GTTATTCTACTCT	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.1152C>T	7.37:g.104719314C>T		69	0		71	33	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Silent	SNP	ENST00000311117.3	37	CCDS34723.1																																																																																			.		0.413	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
RUNX2	860	hgsc.bcm.edu	37	6	45390463	45390463	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:45390463G>A	ENST00000371438.1	+	2	550	c.192G>A	c.(190-192)caG>caA	p.Q64Q	RUNX2_ENST00000541979.1_Silent_p.Q132Q|RUNX2_ENST00000359524.5_Silent_p.Q50Q|RUNX2_ENST00000352853.5_Silent_p.Q132Q|RUNX2_ENST00000576263.1_Silent_p.Q64Q|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000371432.3_Silent_p.Q50Q|RUNX2_ENST00000371436.6_Silent_p.Q64Q|RUNX2_ENST00000465038.2_Silent_p.Q64Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	64	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcagcaacagcagc	0.736																																					p.Q64Q		.											RUNX2_ENST00000352853,NS,carcinoma,0,2	RUNX2_ENST00000352853	0	0			c.G192A						.						11.0	16.0	14.0					6																	45390463		1448	3096	4544	SO:0001819	synonymous_variant	860	exon3			GCAGCAGCAACAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.192G>A	6.37:g.45390463G>A		29	0		39	2	NM_001024630	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	37	CCDS43467.2																																																																																			.		0.736	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
KCNC2	3747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	75436135	75436135	+	3'UTR	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:75436135G>A	ENST00000549446.1	-	0	3347				KCNC2_ENST00000548513.1_Silent_p.V600V|KCNC2_ENST00000341669.3_Intron|RP11-81K13.1_ENST00000547040.1_RNA|RP11-81K13.1_ENST00000549762.1_RNA|KCNC2_ENST00000350228.2_Silent_p.V545V|KCNC2_ENST00000298972.1_Silent_p.V600V|KCNC2_ENST00000550433.1_Intron|RP11-81K13.1_ENST00000550049.1_RNA	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2						action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	AACCAGTAATGACAACCTCTT	0.408																																					p.V600V		.											.	.	.	0			c.C1800T						.						128.0	105.0	113.0					12																	75436135		2203	4300	6503	SO:0001624	3_prime_UTR_variant	3747	exon5			AGTAATGACAACC	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.*750C>T	12.37:g.75436135G>A		33	0		55	21	NM_139136	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Silent	SNP	ENST00000549446.1	37	CCDS9007.1																																																																																			.		0.408	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748	
THAP9	79725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	83839757	83839757	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr4:83839757T>C	ENST00000302236.5	+	5	2443	c.2392T>C	c.(2392-2394)Tat>Cat	p.Y798H	LIN54_ENST00000505905.1_Intron	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	798					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				AAGGGAATTGTATCTTCAACA	0.348																																					p.Y798H		.											.	.	.	0			c.T2392C						.						66.0	69.0	68.0					4																	83839757		2203	4299	6502	SO:0001583	missense	79725	exon5			GAATTGTATCTTC	AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.2392T>C	4.37:g.83839757T>C	ENSP00000305533:p.Tyr798His	17	0		20	7	NM_024672	B3KRE2|Q59AC9	Missense_Mutation	SNP	ENST00000302236.5	37	CCDS3598.1	.	.	.	.	.	.	.	.	.	.	T	8.817	0.936616	0.18206	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	D	0.90563	-2.69	3.82	2.63	0.31362	.	1.083990	0.07242	N	0.864441	D	0.83603	0.5290	N	0.22421	0.69	0.58432	D	0.99999	B	0.02656	0.0	B	0.04013	0.001	T	0.72207	-0.4360	10	0.39692	T	0.17	-5.1625	7.7679	0.28991	0.0:0.0987:0.0:0.9013	.	798	Q9H5L6	THAP9_HUMAN	H	798	ENSP00000305533:Y798H	ENSP00000305533:Y798H	Y	+	1	0	THAP9	84058781	0.232000	0.23762	0.367000	0.25926	0.607000	0.37147	1.420000	0.34804	0.810000	0.34279	-0.290000	0.09829	TAT	.		0.348	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672	
IKBIP	121457	hgsc.bcm.edu;bcgsc.ca	37	12	99020313	99020313	+	Intron	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:99020313C>T	ENST00000342502.2	-	2	709				IKBIP_ENST00000299157.4_Missense_Mutation_p.A177T|IKBIP_ENST00000393042.3_Intron|IKBIP_ENST00000420861.1_Intron	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein						response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						ATATGTTTTGCTTCTGATTTG	0.343																																					p.A177T		.											.	.	.	0			c.G529A						.						146.0	142.0	143.0					12																	99020313		2203	4300	6503	SO:0001627	intron_variant	121457	exon3			GTTTTGCTTCTGA	AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.297+7760G>A	12.37:g.99020313C>T		38	0		39	4	NM_153687	Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Missense_Mutation	SNP	ENST00000342502.2	37	CCDS9067.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.804800	0.31961	.	.	ENSG00000166130	ENST00000299157	T	0.44482	0.92	5.55	3.61	0.41365	.	0.976288	0.08447	N	0.944515	T	0.33440	0.0863	.	.	.	0.80722	D	1	B	0.22800	0.075	B	0.20184	0.028	T	0.02713	-1.1120	9	0.34782	T	0.22	-2.7545	9.2005	0.37256	0.1939:0.7284:0.0:0.0777	.	177	Q70UQ0-4	.	T	177	ENSP00000299157:A177T	ENSP00000299157:A177T	A	-	1	0	IKBIP	97544444	1.000000	0.71417	0.992000	0.48379	0.879000	0.50718	2.171000	0.42453	0.586000	0.29626	0.655000	0.94253	GCA	.		0.343	IKBIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000408003.2	NM_153687	
ZNF430	80264	hgsc.bcm.edu	37	19	21240159	21240159	+	Missense_Mutation	SNP	G	G	C	rs371234614		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:21240159G>C	ENST00000261560.5	+	5	1226	c.1045G>C	c.(1045-1047)Gaa>Caa	p.E349Q	AC012627.1_ENST00000578233.1_RNA	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	349					regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E349K(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						CAAATGTGAAGAATGTGGCAA	0.393																																					p.E349Q		.											ZNF430,pharynx,carcinoma,0,1	ZNF430	0	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G1045C						.						58.0	62.0	61.0					19																	21240159		2202	4290	6492	SO:0001583	missense	80264	exon5			TGTGAAGAATGTG	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.1045G>C	19.37:g.21240159G>C	ENSP00000261560:p.Glu349Gln	49	0		50	2	NM_025189	Q86V70	Missense_Mutation	SNP	ENST00000261560.5	37	CCDS32978.1	.	.	.	.	.	.	.	.	.	.	.	14.07	2.425013	0.43020	.	.	ENSG00000118620	ENST00000261560	T	0.07444	3.19	1.04	-0.843	0.10744	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09992	0.0245	N	0.11284	0.12	0.09310	N	1	P;D	0.71674	0.811;0.998	P;D	0.67382	0.481;0.951	T	0.37753	-0.9692	9	0.51188	T	0.08	.	7.7376	0.28823	0.0:0.2617:0.7383:0.0	.	348;349	Q2NKJ9;Q9H8G1	.;ZN430_HUMAN	Q	349	ENSP00000261560:E349Q	ENSP00000261560:E349Q	E	+	1	0	ZNF430	21031999	0.000000	0.05858	0.492000	0.27490	0.472000	0.32918	-0.010000	0.12743	0.452000	0.26830	0.455000	0.32223	GAA	.		0.393	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	NM_025189	
KCNN3	3782	hgsc.bcm.edu	37	1	154842238	154842238	+	Missense_Mutation	SNP	T	T	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:154842238T>A	ENST00000271915.4	-	1	518	c.203A>T	c.(202-204)cAg>cTg	p.Q68L	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	68	Gln-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ctgctgctgctgctgaagctg	0.701																																					p.Q68L		.											.	.	.	0			c.A203T						.						6.0	5.0	5.0					1																	154842238		1884	3756	5640	SO:0001583	missense	3782	exon1			TGCTGCTGCTGAA	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.203A>T	1.37:g.154842238T>A	ENSP00000271915:p.Gln68Leu	31	0		36	6	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	37	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	T	3.627	-0.076377	0.07184	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.53423	0.62	4.75	3.61	0.41365	.	1.830960	0.02893	N	0.134413	T	0.18800	0.0451	N	0.19112	0.55	0.80722	D	1	B;B	0.22003	0.035;0.063	B;B	0.19946	0.027;0.026	T	0.02398	-1.1165	10	0.32370	T	0.25	-15.1212	9.8148	0.40846	0.0:0.0:0.1734:0.8266	.	74;73	Q6JXY2;Q9UGI6	.;KCNN3_HUMAN	L	68;163	ENSP00000271915:Q68L	ENSP00000271915:Q68L	Q	-	2	0	KCNN3	153108862	0.937000	0.31787	1.000000	0.80357	0.980000	0.70556	0.184000	0.16939	0.836000	0.34901	0.460000	0.39030	CAG	.		0.701	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
PDE1B	5153	hgsc.bcm.edu;bcgsc.ca	37	12	54970441	54970441	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:54970441G>A	ENST00000243052.3	+	14	1899	c.1463G>A	c.(1462-1464)cGc>cAc	p.R488H	PDE1B_ENST00000550620.1_Missense_Mutation_p.R468H|PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000538346.1_Missense_Mutation_p.R447H|PPP1R1A_ENST00000547431.1_3'UTR	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	488	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	TGGGTCAAGCGCATTCAGGAG	0.562																																					p.R488H		.											.	.	.	0			c.G1463A						.						69.0	53.0	59.0					12																	54970441		2203	4300	6503	SO:0001583	missense	5153	exon14			TCAAGCGCATTCA	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.1463G>A	12.37:g.54970441G>A	ENSP00000243052:p.Arg488His	26	0		38	4	NM_000924	Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	37	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560928	0.27827	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	T;T;T	0.68025	-0.3;-0.3;-0.3	4.86	3.71	0.42584	.	0.498586	0.17707	N	0.164738	T	0.41696	0.1170	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12785	-1.0534	10	0.15499	T	0.54	.	8.8302	0.35080	0.9087:0.0:0.0913:0.0	.	468;488	Q01064-2;Q01064	.;PDE1B_HUMAN	H	488;447;468	ENSP00000243052:R488H;ENSP00000442559:R447H;ENSP00000448519:R468H	ENSP00000243052:R488H	R	+	2	0	PDE1B	53256708	1.000000	0.71417	1.000000	0.80357	0.553000	0.35397	4.045000	0.57368	0.817000	0.34445	-0.340000	0.08031	CGC	.		0.562	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1		
PIK3C3	5289	hgsc.bcm.edu	37	18	39629497	39629497	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr18:39629497G>T	ENST00000262039.4	+	21	2277	c.2191G>T	c.(2191-2193)Gga>Tga	p.G731*	PIK3C3_ENST00000593098.1_Nonsense_Mutation_p.G216*|PIK3C3_ENST00000587402.1_Nonsense_Mutation_p.G78*|PIK3C3_ENST00000589056.1_Nonsense_Mutation_p.G78*|PIK3C3_ENST00000398870.3_Nonsense_Mutation_p.G668*	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	731	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						TACTGCAGCTGGATATTGCGT	0.338										TSP Lung(28;0.18)																											p.G731X	NSCLC(37;552 1060 2683 16430 37914)	.											.	.	.	0			c.G2191T						.						112.0	104.0	107.0					18																	39629497		2203	4300	6503	SO:0001587	stop_gained	5289	exon21			GCAGCTGGATATT	Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.2191G>T	18.37:g.39629497G>T	ENSP00000262039:p.Gly731*	78	0		88	4	NM_002647	Q15134	Nonsense_Mutation	SNP	ENST00000262039.4	37	CCDS11920.1	.	.	.	.	.	.	.	.	.	.	G	40	8.491887	0.98834	.	.	ENSG00000078142	ENST00000262039;ENST00000398870	.	.	.	6.08	6.08	0.98989	.	0.047391	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4349	0.94788	0.0:0.0:1.0:0.0	.	.	.	.	X	731;668	.	.	G	+	1	0	PIK3C3	37883495	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.443000	0.97568	2.894000	0.99253	0.655000	0.94253	GGA	.		0.338	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255804.1	NM_002647	
LGI3	203190	hgsc.bcm.edu	37	8	22005731	22005731	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr8:22005731G>T	ENST00000306317.2	-	8	1878	c.1589C>A	c.(1588-1590)cCc>cAc	p.P530H	LGI3_ENST00000424267.2_Missense_Mutation_p.P506H	NM_139278.2	NP_644807.1	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	530					exocytosis (GO:0006887)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|extracellular region (GO:0005576)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	catalytic activity (GO:0003824)			endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	17				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		CTTGAAGCTGGGGGCCAGGAG	0.622																																					p.P530H		.											LGI3,NS,carcinoma,0,1	LGI3	0	0			c.C1589A						.						87.0	85.0	86.0					8																	22005731		2203	4300	6503	SO:0001583	missense	203190	exon8			AAGCTGGGGGCCA	AJ487518	CCDS6025.1	8p21.2	2008-07-28			ENSG00000168481	ENSG00000168481			18711	protein-coding gene	gene with protein product		608302				12023020, 18628660	Standard	NM_139278		Approved		uc003xav.3	Q8N145	OTTHUMG00000131599	ENST00000306317.2:c.1589C>A	8.37:g.22005731G>T	ENSP00000302297:p.Pro530His	29	0		29	2	NM_139278	A5PLP2|Q86TL4|Q8N296	Missense_Mutation	SNP	ENST00000306317.2	37	CCDS6025.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843633	0.71488	.	.	ENSG00000168481	ENST00000306317;ENST00000424267	T;T	0.80304	-1.36;-1.36	4.95	4.95	0.65309	.	0.065447	0.64402	D	0.000007	T	0.79299	0.4422	N	0.08118	0	0.42859	D	0.994101	D;D	0.76494	0.999;0.999	D;D	0.67900	0.954;0.917	D	0.84674	0.0713	10	0.87932	D	0	-38.309	15.6803	0.77364	0.0:0.0:1.0:0.0	.	506;530	A5PLP2;Q8N145	.;LGI3_HUMAN	H	530;506	ENSP00000302297:P530H;ENSP00000399121:P506H	ENSP00000302297:P530H	P	-	2	0	LGI3	22061676	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	9.465000	0.97660	2.246000	0.74042	0.561000	0.74099	CCC	.		0.622	LGI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254482.1		
IMPG2	50939	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	100951689	100951689	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:100951689G>T	ENST00000193391.7	-	15	3356	c.3169C>A	c.(3169-3171)Cag>Aag	p.Q1057K		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	1057	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	AAGTCAGGCTGTAGGTCACAG	0.493																																					p.Q1057K		.											.	.	.	0			c.C3169A						.						101.0	87.0	91.0					3																	100951689		2203	4300	6503	SO:0001583	missense	50939	exon15			CAGGCTGTAGGTC	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.3169C>A	3.37:g.100951689G>T	ENSP00000193391:p.Gln1057Lys	44	0		47	4	NM_016247	A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	37	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503357	0.85176	.	.	ENSG00000081148	ENST00000193391;ENST00000417518	T	0.24151	1.87	5.88	4.99	0.66335	Epidermal growth factor-like, type 3 (1);	0.162599	0.43110	N	0.000606	T	0.32734	0.0839	L	0.51422	1.61	0.38597	D	0.950565	B;B	0.31519	0.327;0.327	B;B	0.42653	0.394;0.394	T	0.27226	-1.0080	10	0.56958	D	0.05	-2.9547	11.8387	0.52342	0.0:0.1327:0.7294:0.1379	.	1057;1057	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	K	1057;17	ENSP00000193391:Q1057K	ENSP00000193391:Q1057K	Q	-	1	0	IMPG2	102434379	1.000000	0.71417	0.986000	0.45419	0.978000	0.69477	5.199000	0.65152	1.451000	0.47736	0.561000	0.74099	CAG	.		0.493	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3		
PFKP	5214	hgsc.bcm.edu	37	10	3149416	3149416	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr10:3149416G>A	ENST00000381125.4	+	8	861	c.785G>A	c.(784-786)cGg>cAg	p.R262Q	PFKP_ENST00000381075.2_Missense_Mutation_p.R254Q	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	262	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		AACCGTGCCCGGAAAAAAAGG	0.398																																					p.R262Q		.											PFKP_ENST00000381075,colon,carcinoma,0,2	PFKP_ENST00000381075	0	0			c.G785A						.						68.0	70.0	69.0					10																	3149416		2201	4300	6501	SO:0001583	missense	5214	exon8			GTGCCCGGAAAAA	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.785G>A	10.37:g.3149416G>A	ENSP00000370517:p.Arg262Gln	52	0		64	3	NM_002627	B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	ENST00000381125.4	37	CCDS7059.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.585861	0.46110	.	.	ENSG00000067057	ENST00000381125;ENST00000397834;ENST00000381075;ENST00000415005	T;T;T	0.78924	-1.22;-1.22;-1.22	5.26	3.35	0.38373	Phosphofructokinase domain (2);	0.621176	0.16171	N	0.226296	T	0.68274	0.2983	L	0.41824	1.3	0.48341	D	0.999631	B;B	0.23735	0.09;0.002	B;B	0.11329	0.006;0.001	T	0.64097	-0.6487	10	0.33141	T	0.24	.	12.7511	0.57308	0.1423:0.0:0.8577:0.0	.	254;262	Q5VSR7;Q01813	.;K6PP_HUMAN	Q	262;251;254;46	ENSP00000370517:R262Q;ENSP00000370465:R254Q;ENSP00000408858:R46Q	ENSP00000370465:R254Q	R	+	2	0	PFKP	3139416	0.994000	0.37717	0.896000	0.35187	0.979000	0.70002	2.246000	0.43142	1.329000	0.45376	0.655000	0.94253	CGG	.		0.398	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046454.1	NM_002627	
RIN2	54453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	19956130	19956130	+	Silent	SNP	C	C	T	rs368824899		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr20:19956130C>T	ENST00000255006.6	+	8	1757	c.1608C>T	c.(1606-1608)ttC>ttT	p.F536F	RIN2_ENST00000440354.2_Intron|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	487					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						GCAGCTCCTTCGTGCTGCCCA	0.607																																					p.F536F		.											RIN2_ENST00000255006,NS,carcinoma,0,2	RIN2_ENST00000255006	0	0			c.C1608T						.	C	,	0,4020		0,0,2010	85.0	96.0	92.0		1608,1461	-3.4	0.4	20		92	1,8321		0,1,4160	no	coding-synonymous,coding-synonymous	RIN2	NM_001242581.1,NM_018993.3	,	0,1,6170	TT,TC,CC		0.012,0.0,0.0081	,	536/945,487/896	19956130	1,12341	2010	4161	6171	SO:0001819	synonymous_variant	54453	exon8			CTCCTTCGTGCTG	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1608C>T	20.37:g.19956130C>T		28	0		47	20	NM_001242581	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000255006.6	37	CCDS56182.1																																																																																			.		0.607	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1		
HEXA	3073	hgsc.bcm.edu	37	15	72648952	72648952	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr15:72648952C>A	ENST00000268097.5	-	2	763	c.260G>T	c.(259-261)cGg>cTg	p.R87L	HEXA_ENST00000566304.1_Missense_Mutation_p.R98L|HEXA_ENST00000457859.2_5'UTR|HEXA_ENST00000567159.1_Missense_Mutation_p.R87L|RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000429918.2_5'UTR	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	87					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						CAGTGTATGCCGTTTCCCTAG	0.502																																					p.R87L		.											HEXA,NS,carcinoma,0,1	HEXA	0	0			c.G260T						.						196.0	141.0	160.0					15																	72648952		2199	4297	6496	SO:0001583	missense	3073	exon2			GTATGCCGTTTCC	M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.260G>T	15.37:g.72648952C>A	ENSP00000268097:p.Arg87Leu	18	0		27	2	NM_000520	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Missense_Mutation	SNP	ENST00000268097.5	37	CCDS10243.1	.	.	.	.	.	.	.	.	.	.	C	8.382	0.837857	0.16891	.	.	ENSG00000213614	ENST00000268097	D	0.88124	-2.34	4.4	-8.8	0.00817	Acetylhexosaminidase, subunit a/b (1);	2.461850	0.01263	N	0.009247	T	0.69115	0.3075	N	0.04746	-0.17	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.44360	-0.9333	10	0.23891	T	0.37	0.1947	7.4358	0.27154	0.2071:0.1537:0.0:0.6391	.	98;87	B4DVA7;P06865	.;HEXA_HUMAN	L	87	ENSP00000268097:R87L	ENSP00000268097:R87L	R	-	2	0	HEXA	70436006	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.169000	0.03120	-1.411000	0.02032	-0.244000	0.11960	CGG	.		0.502	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257317.2	NM_000520	
PDZD2	23037	hgsc.bcm.edu	37	5	32071524	32071524	+	Splice_Site	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:32071524G>A	ENST00000438447.1	+	16	2956	c.2568G>A	c.(2566-2568)aaG>aaA	p.K856K	PDZD2_ENST00000282493.3_Splice_Site_p.K856K			O15018	PDZD2_HUMAN	PDZ domain containing 2	856					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TTGCAAAAAAGGTGAGTCAAG	0.498																																					p.K856K		.											.	.	.	0			c.G2568A						.						132.0	131.0	131.0					5																	32071524		2203	4300	6503	SO:0001630	splice_region_variant	23037	exon15			AAAAAAGGTGAGT	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.2568+1G>A	5.37:g.32071524G>A		90	0		90	4	NM_178140	Q9BXD4	Silent	SNP	ENST00000438447.1	37	CCDS34137.1																																																																																			.		0.498	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		Silent
TTN	7273	hgsc.bcm.edu;bcgsc.ca	37	2	179529380	179529380	+	Intron	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:179529380C>T	ENST00000591111.1	-	153	34489				TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Splice_Site|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAAGATATACCTTCATCAGG	0.373																																					.		.											.	.	.	0			c.36202+1G>A						.						56.0	54.0	54.0					2																	179529380		876	1991	2867	SO:0001627	intron_variant	7273	exon168			GATATACCTTCAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34264+5564G>A	2.37:g.179529380C>T		75	0		86	4	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Splice_Site	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	.	34	5.361702	0.95877	.	.	ENSG00000155657	ENST00000541862;ENST00000392423;ENST00000425332	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7587	0.91842	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTN	179237625	0.014000	0.17966	0.990000	0.47175	0.974000	0.67602	0.447000	0.21710	2.597000	0.87782	0.650000	0.86243	.	.		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DMXL2	23312	hgsc.bcm.edu	37	15	51778485	51778485	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr15:51778485C>T	ENST00000251076.5	-	23	5554	c.5267G>A	c.(5266-5268)cGt>cAt	p.R1756H	DMXL2_ENST00000449909.3_Missense_Mutation_p.R1120H|RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.R1756H	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1756						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TTCATATAAACGGGCAATAAC	0.318																																					p.R1756H		.											.	.	.	0			c.G5267A						.						82.0	84.0	83.0					15																	51778485		2196	4293	6489	SO:0001583	missense	23312	exon23			TATAAACGGGCAA	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.5267G>A	15.37:g.51778485C>T	ENSP00000251076:p.Arg1756His	99	0		81	2	NM_001174116	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	34	5.316315	0.95655	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.71341	-0.56;-0.56;-0.56	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.89255	0.6663	H	0.94620	3.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.998	D	0.91606	0.5299	10	0.87932	D	0	.	19.7815	0.96417	0.0:1.0:0.0:0.0	.	1756;1120;1756	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	H	1756;1756;1120	ENSP00000251076:R1756H;ENSP00000441858:R1756H;ENSP00000400855:R1120H	ENSP00000251076:R1756H	R	-	2	0	DMXL2	49565777	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.614000	0.82996	2.746000	0.94184	0.655000	0.94253	CGT	.		0.318	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
TXNDC16	57544	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	52978009	52978009	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr14:52978009C>T	ENST00000281741.4	-	9	1076	c.705G>A	c.(703-705)ttG>ttA	p.L235L	TXNDC16_ENST00000554399.1_Intron	NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	235					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					TCAGTGTAGTCAATGGCTGTT	0.358																																					p.L235L		.											.	.	.	0			c.G705A						.						171.0	159.0	163.0					14																	52978009		2203	4300	6503	SO:0001819	synonymous_variant	57544	exon9			TGTAGTCAATGGC	AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.705G>A	14.37:g.52978009C>T		55	0		59	25	NM_020784	A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Silent	SNP	ENST00000281741.4	37	CCDS32083.1																																																																																			.		0.358	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411681.1	XM_051699	
ME1	4199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	83937111	83937111	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:83937111C>G	ENST00000369705.3	-	11	1334	c.1218G>C	c.(1216-1218)ttG>ttC	p.L406F	ME1_ENST00000543031.1_Missense_Mutation_p.L331F|ME1_ENST00000541327.1_Missense_Mutation_p.L240F	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	406					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)			NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		TTGGATTACTCAAAGCAAAAA	0.333																																					p.L406F		.											.	.	.	0			c.G1218C						.						82.0	78.0	79.0					6																	83937111		2203	4300	6503	SO:0001583	missense	4199	exon11			ATTACTCAAAGCA	X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.1218G>C	6.37:g.83937111C>G	ENSP00000358719:p.Leu406Phe	79	0		75	33	NM_002395	B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Missense_Mutation	SNP	ENST00000369705.3	37	CCDS34492.1	.	.	.	.	.	.	.	.	.	.	C	18.50	3.638308	0.67130	.	.	ENSG00000065833	ENST00000369705;ENST00000540036;ENST00000541327;ENST00000543031	T;T;T	0.47869	0.83;0.83;0.83	5.96	2.75	0.32379	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.66015	0.2747	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.67205	-0.5729	10	0.87932	D	0	-11.4314	2.275	0.04100	0.2055:0.4086:0.2346:0.1513	.	406	P48163	MAOX_HUMAN	F	406;66;240;331	ENSP00000358719:L406F;ENSP00000439912:L240F;ENSP00000446114:L331F	ENSP00000358719:L406F	L	-	3	2	ME1	83993830	0.991000	0.36638	1.000000	0.80357	0.996000	0.88848	0.181000	0.16880	0.832000	0.34804	0.555000	0.69702	TTG	.		0.333	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041350.1		
TMEM198	130612	hgsc.bcm.edu;ucsc.edu	37	2	220413803	220413803	+	Intron	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:220413803G>T	ENST00000344458.2	+	5	1327				MIR3132_ENST00000581997.1_RNA|RP11-256I23.1_ENST00000596829.1_RNA|TMEM198_ENST00000373883.3_Intron			Q66K66	TM198_HUMAN	transmembrane protein 198						multicellular organismal development (GO:0007275)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	16		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CAGGTGGGATGAGAGAGGGAG	0.592																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	100423039	.			TGGGATGAGAGAG	BC068567	CCDS33385.1	2q35	2011-12-06			ENSG00000188760	ENSG00000188760			33704	protein-coding gene	gene with protein product							Standard	NM_001005209		Approved	MGC99813, TMEM198A	uc002vmf.3	Q66K66	OTTHUMG00000059156	ENST00000344458.2:c.743-71G>T	2.37:g.220413803G>T		16	0		17	9	.		RNA	SNP	ENST00000344458.2	37	CCDS33385.1																																																																																			.		0.592	TMEM198-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131063.1	NM_001005209	
ITPR2	3709	hgsc.bcm.edu	37	12	26709212	26709212	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:26709212G>A	ENST00000381340.3	-	36	5334	c.4918C>T	c.(4918-4920)Cct>Tct	p.P1640S		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1640					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.P1640T(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CTTCCCTCAGGGAACAGCAGT	0.483																																					p.P1640S		.											ITPR2,NS,carcinoma,0,1	ITPR2	0	1	Substitution - Missense(1)	lung(1)	c.C4918T						.						168.0	164.0	165.0					12																	26709212		2016	4174	6190	SO:0001583	missense	3709	exon36			CCTCAGGGAACAG	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.4918C>T	12.37:g.26709212G>A	ENSP00000370744:p.Pro1640Ser	32	0		42	2	NM_002223	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.840153	0.91117	.	.	ENSG00000123104	ENST00000381340	D	0.92299	-3.01	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.92848	0.7725	M	0.79805	2.47	0.80722	D	1	P	0.35481	0.504	B	0.36666	0.23	D	0.93283	0.6662	10	0.62326	D	0.03	.	18.662	0.91474	0.0:0.0:1.0:0.0	.	1640	Q14571	ITPR2_HUMAN	S	1640	ENSP00000370744:P1640S	ENSP00000370744:P1640S	P	-	1	0	ITPR2	26600479	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	9.327000	0.96396	2.404000	0.81709	0.491000	0.48974	CCT	.		0.483	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
MTR	4548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	237049616	237049616	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:237049616C>G	ENST00000366577.5	+	27	3194	c.2800C>G	c.(2800-2802)Caa>Gaa	p.Q934E	MTR_ENST00000535889.1_Missense_Mutation_p.Q883E	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	934	AdoMet activation. {ECO:0000255|PROSITE- ProRule:PRU00346}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	ACCCTTAAGTCAAGCCAGAAA	0.408																																					p.Q934E		.											.	.	.	0			c.C2800G						.						103.0	97.0	99.0					1																	237049616		2203	4300	6503	SO:0001583	missense	4548	exon27			TTAAGTCAAGCCA	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.2800C>G	1.37:g.237049616C>G	ENSP00000355536:p.Gln934Glu	66	0		58	20	NM_000254	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	ENST00000366577.5	37	CCDS1614.1	.	.	.	.	.	.	.	.	.	.	C	6.614	0.481751	0.12581	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889;ENST00000366576	T;T;T	0.75704	-0.96;-0.96;-0.96	5.05	5.05	0.67936	Vitamin B12-dependent methionine synthase, activation domain (2);	0.279845	0.35772	N	0.002988	T	0.55016	0.1894	N	0.10874	0.06	0.37052	D	0.897656	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.55218	-0.8175	10	0.07644	T	0.81	-12.6925	17.5728	0.87940	0.0:1.0:0.0:0.0	.	934;883;934	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	E	788;934;883;488	ENSP00000355536:Q934E;ENSP00000441845:Q883E;ENSP00000355535:Q488E	ENSP00000355535:Q488E	Q	+	1	0	MTR	235116239	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.987000	0.49378	2.593000	0.87608	0.563000	0.77884	CAA	.		0.408	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254	
EBF2	64641	hgsc.bcm.edu	37	8	25716016	25716016	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr8:25716016G>T	ENST00000520164.1	-	14	1884	c.1347C>A	c.(1345-1347)taC>taA	p.Y449*	EBF2_ENST00000535548.1_Nonsense_Mutation_p.Y180*|EBF2_ENST00000408929.3_Nonsense_Mutation_p.Y301*	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	449					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y449*(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TGTTGCGGATGTACCCTTGGC	0.522																																					p.Y449X	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	.											EBF2,larynx,carcinoma,0,1	EBF2	0	1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)	c.C1347A						.						109.0	108.0	108.0					8																	25716016		2037	4197	6234	SO:0001587	stop_gained	64641	exon14			GCGGATGTACCCT	AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.1347C>A	8.37:g.25716016G>T	ENSP00000430241:p.Tyr449*	30	0		57	3	NM_022659	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Nonsense_Mutation	SNP	ENST00000520164.1	37	CCDS43726.1	.	.	.	.	.	.	.	.	.	.	G	39	7.420623	0.98272	.	.	ENSG00000221818	ENST00000520164;ENST00000408929;ENST00000535548	.	.	.	5.54	3.73	0.42828	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.732	11.1295	0.48339	0.1503:0.0:0.8497:0.0	.	.	.	.	X	449;301;180	.	ENSP00000386178:Y301X	Y	-	3	2	EBF2	25771933	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	2.027000	0.41078	1.343000	0.45638	0.655000	0.94253	TAC	.		0.522	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
IQSEC1	9922	hgsc.bcm.edu	37	3	12942851	12942851	+	Intron	SNP	C	C	G	rs397988742|rs56387830		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:12942851C>G	ENST00000273221.4	-	13	3064					NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1						actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGGGGGGTGGCCAGGGCTGGG	0.697																																					.		.											.,1	.	88	0			c.2976+1G>C						.						1.0	1.0	1.0					3																	12942851		180	413	593	SO:0001627	intron_variant	9922	exon15			GGGTGGCCAGGGC	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2847+1421G>C	3.37:g.12942851C>G		9	1		5	2	NM_001134382	O94863|Q96D85	Splice_Site	SNP	ENST00000273221.4	37	CCDS33703.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|-	0.001|0.001	-2.938040|-2.938040	0.00052|0.00052	.|.	.|.	ENSG00000144711|ENSG00000144711	ENST00000435445|ENST00000429247	.|T	.|0.43294	.|0.95	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.30230	.|0.0758	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999997|0.999997	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.27971	.|-1.0058	.|4	.|0.29301	.|T	.|0.29	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|P	-1|993	.|ENSP00000402299:A993P	.|ENSP00000402299:A993P	.|A	-|-	.|1	.|0	IQSEC1|IQSEC1	12917851|12917851	0.031000|0.031000	0.19500|0.19500	0.001000|0.001000	0.08648|0.08648	0.028000|0.028000	0.11728|0.11728	-0.760000|-0.760000	0.04756|0.04756	0.000000|0.000000	0.14550|0.14550	0.000000|0.000000	0.15137|0.15137	.|GCC	.		0.697	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869	
APPL1	26060	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	57283498	57283498	+	Missense_Mutation	SNP	T	T	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:57283498T>G	ENST00000288266.3	+	11	1121	c.974T>G	c.(973-975)aTa>aGa	p.I325R		NM_012096.2	NP_036228.1	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1	325	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Required for RAB5A binding.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|insulin receptor signaling pathway (GO:0008286)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of glucose import (GO:0046324)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|protein kinase B binding (GO:0043422)			breast(3)|endometrium(3)|kidney(3)|large_intestine(10)|liver(2)|lung(4)|prostate(2)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		GCCATGGACATAGACAACTGT	0.448																																					p.I325R		.											.	.	.	0			c.T974G						.						159.0	145.0	150.0					3																	57283498		2203	4300	6503	SO:0001583	missense	26060	exon11			TGGACATAGACAA	AB037849	CCDS2882.1	3p21.1-p14.3	2013-01-11			ENSG00000157500	ENSG00000157500		"""Pleckstrin homology (PH) domain containing"""	24035	protein-coding gene	gene with protein product		604299				10490823, 17030088	Standard	NM_012096		Approved	APPL	uc003dio.3	Q9UKG1	OTTHUMG00000133756	ENST00000288266.3:c.974T>G	3.37:g.57283498T>G	ENSP00000288266:p.Ile325Arg	60	0		97	6	NM_012096	Q9P2B9	Missense_Mutation	SNP	ENST00000288266.3	37	CCDS2882.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.988509	0.74589	.	.	ENSG00000157500	ENST00000288266	T	0.46819	0.86	6.06	6.06	0.98353	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.049528	0.85682	D	0.000000	T	0.47060	0.1425	L	0.53249	1.67	0.80722	D	1	B;P	0.38110	0.256;0.618	B;B	0.36335	0.112;0.222	T	0.51505	-0.8697	10	0.87932	D	0	.	16.6245	0.84952	0.0:0.0:0.0:1.0	.	308;325	B4DQX8;Q9UKG1	.;DP13A_HUMAN	R	325	ENSP00000288266:I325R	ENSP00000288266:I325R	I	+	2	0	APPL1	57258538	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.251000	0.72441	2.323000	0.78572	0.528000	0.53228	ATA	.		0.448	APPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258196.2	NM_012096	
SIRPD	128646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	1532442	1532442	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr20:1532442C>G	ENST00000381623.3	-	2	1505	c.316G>C	c.(316-318)Gaa>Caa	p.E106Q	SIRPD_ENST00000381621.1_Missense_Mutation_p.E106Q			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	106	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						AGAGAGATTTCACGGATGCGG	0.448																																					p.E106Q		.											.	.	.	0			c.G316C						.						152.0	149.0	150.0					20																	1532442		2203	4300	6503	SO:0001583	missense	128646	exon2			AGATTTCACGGAT	AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.316G>C	20.37:g.1532442C>G	ENSP00000371036:p.Glu106Gln	82	0		69	32	NM_178460	B3KS88|Q5TFQ6	Missense_Mutation	SNP	ENST00000381623.3	37	CCDS13018.1	.	.	.	.	.	.	.	.	.	.	.	10.64	1.407353	0.25378	.	.	ENSG00000125900	ENST00000381623;ENST00000381621	T;T	0.64803	-0.12;-0.12	4.03	-0.163	0.13363	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.047140	0.07611	U	0.925406	T	0.52821	0.1758	L	0.40543	1.245	0.09310	N	1	P	0.47841	0.901	B	0.43889	0.435	T	0.47471	-0.9115	10	0.62326	D	0.03	.	6.077	0.19921	0.0:0.5241:0.0:0.4759	.	106	Q9H106	SIRPD_HUMAN	Q	106	ENSP00000371036:E106Q;ENSP00000371034:E106Q	ENSP00000371034:E106Q	E	-	1	0	SIRPD	1480442	0.002000	0.14202	0.003000	0.11579	0.014000	0.08584	-0.818000	0.04467	0.124000	0.18369	0.558000	0.71614	GAA	.		0.448	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460	
DNASE1L3	1776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	58190532	58190532	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:58190532C>G	ENST00000394549.2	-	4	713	c.397G>C	c.(397-399)Gag>Cag	p.E133Q	DNASE1L3_ENST00000318316.3_Missense_Mutation_p.E133Q|DNASE1L3_ENST00000483681.1_Missense_Mutation_p.E133Q|DNASE1L3_ENST00000486455.1_Missense_Mutation_p.E103Q	NM_004944.3	NP_004935.1	Q13609	DNSL3_HUMAN	deoxyribonuclease I-like 3	133					apoptotic DNA fragmentation (GO:0006309)|developmental programmed cell death (GO:0010623)|DNA metabolic process (GO:0006259)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			breast(2)|large_intestine(4)|lung(6)	12				BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)		ACAAAGGGCTCCCTGGAAAAC	0.522																																					p.E133Q	Esophageal Squamous(96;1069 1424 4841 43466 52325)	.											.	.	.	0			c.G397C						.						128.0	115.0	119.0					3																	58190532		2203	4300	6503	SO:0001583	missense	1776	exon4			AGGGCTCCCTGGA	AF047354	CCDS2886.1, CCDS58836.1	3p14.3	2008-05-15			ENSG00000163687	ENSG00000163687			2959	protein-coding gene	gene with protein product	"""DNase gamma"""	602244				9205125, 9714828, 14646506	Standard	NM_004944		Approved	DNAS1L3, LSD	uc003djo.2	Q13609	OTTHUMG00000159153	ENST00000394549.2:c.397G>C	3.37:g.58190532C>G	ENSP00000378053:p.Glu133Gln	58	0		51	23	NM_004944	B2R8B1|B7Z707|O75803	Missense_Mutation	SNP	ENST00000394549.2	37	CCDS2886.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.374837	0.82573	.	.	ENSG00000163687	ENST00000486455;ENST00000450710;ENST00000318316;ENST00000483681;ENST00000477209;ENST00000394549;ENST00000461914	T;T;T;T;T;T	0.80653	-1.38;-1.4;-1.4;0.58;-1.4;0.58	5.81	5.81	0.92471	Endonuclease/exonuclease/phosphatase (2);	0.083012	0.51477	D	0.000100	D	0.91250	0.7242	M	0.85945	2.785	0.58432	D	0.999992	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.99;0.991;0.991	D	0.91782	0.5436	10	0.87932	D	0	.	20.0628	0.97684	0.0:1.0:0.0:0.0	.	103;133;133	B7Z707;E9PES0;Q13609	.;.;DNSL3_HUMAN	Q	103;133;133;133;7;133;133	ENSP00000419052:E103Q;ENSP00000316193:E133Q;ENSP00000417047:E133Q;ENSP00000417976:E7Q;ENSP00000378053:E133Q;ENSP00000418113:E133Q	ENSP00000316193:E133Q	E	-	1	0	DNASE1L3	58165572	1.000000	0.71417	1.000000	0.80357	0.443000	0.32047	7.628000	0.83189	2.745000	0.94114	0.655000	0.94253	GAG	.		0.522	DNASE1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353533.1	NM_004944	
LIPA	3988	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	90974598	90974598	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr10:90974598C>T	ENST00000336233.5	-	10	1509	c.1187G>A	c.(1186-1188)aGg>aAg	p.R396K	LIPA_ENST00000371837.1_Missense_Mutation_p.R340K|LIPA_ENST00000456827.1_Missense_Mutation_p.R396K			P38571	LICH_HUMAN	lipase A, lysosomal acid, cholesterol esterase	396					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cytokine production (GO:0001816)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|lung development (GO:0030324)|tissue remodeling (GO:0048771)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	lipase activity (GO:0016298)|sterol esterase activity (GO:0004771)			endometrium(1)|large_intestine(2)|lung(3)	6		Colorectal(252;0.0162)		GBM - Glioblastoma multiforme(2;0.00406)		CTGATATTTCCTCATTAGATT	0.388																																					p.R396K		.											.	.	.	0			c.G1187A						.						28.0	31.0	30.0					10																	90974598		2203	4300	6503	SO:0001583	missense	3988	exon10			TATTTCCTCATTA	M74775	CCDS7401.1, CCDS73160.1	10q23.2-q23.3	2012-07-13	2008-08-01		ENSG00000107798	ENSG00000107798	3.1.1.13		6617	protein-coding gene	gene with protein product	"""Wolman disease"""	613497				8432549	Standard	NM_000235		Approved	LAL, CESD	uc009xtq.3	P38571	OTTHUMG00000018716	ENST00000336233.5:c.1187G>A	10.37:g.90974598C>T	ENSP00000337354:p.Arg396Lys	68	0		69	4	NM_000235	B2RBH5|D3DR29|Q16529|Q53H21|Q5T074|Q5T771|Q96EJ0	Missense_Mutation	SNP	ENST00000336233.5	37	CCDS7401.1	.	.	.	.	.	.	.	.	.	.	C	3.198	-0.164435	0.06502	.	.	ENSG00000107798	ENST00000336233;ENST00000371837;ENST00000371829;ENST00000541980;ENST00000354621;ENST00000456827;ENST00000425287	T;T;T	0.72835	-0.31;-0.69;-0.31	4.93	-3.46	0.04767	.	0.433149	0.28895	N	0.013800	T	0.37433	0.1003	N	0.10618	0.005	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.10450	0.002;0.005;0.001	T	0.40961	-0.9535	10	0.02654	T	1	-9.9111	7.9931	0.30252	0.0:0.3241:0.1153:0.5605	.	398;340;396	E7EUT7;P38571-2;P38571	.;.;LICH_HUMAN	K	396;340;396;396;354;396;398	ENSP00000337354:R396K;ENSP00000360903:R340K;ENSP00000413019:R396K	ENSP00000337354:R396K	R	-	2	0	LIPA	90964578	0.087000	0.21565	0.852000	0.33557	0.721000	0.41392	-0.243000	0.08915	-0.537000	0.06290	-0.217000	0.12591	AGG	.		0.388	LIPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049308.1	NM_000235	
GUCY2C	2984	hgsc.bcm.edu	37	12	14849213	14849213	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:14849213G>A	ENST00000261170.3	-	1	306	c.170C>T	c.(169-171)gCg>gTg	p.A57V	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	57					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	CTCATTCACCGCATCTTCCAA	0.483																																					p.A57V		.											GUCY2C,NS,carcinoma,0,1	GUCY2C	0	0			c.C170T						.						91.0	84.0	87.0					12																	14849213		2203	4300	6503	SO:0001583	missense	2984	exon1			TTCACCGCATCTT		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.170C>T	12.37:g.14849213G>A	ENSP00000261170:p.Ala57Val	34	0		32	2	NM_004963	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.071638	0.36566	.	.	ENSG00000070019	ENST00000261170	D	0.91577	-2.87	5.56	2.55	0.30701	Extracellular ligand-binding receptor (1);	0.238205	0.41097	N	0.000950	D	0.82944	0.5147	L	0.41961	1.31	0.09310	N	1	P	0.36282	0.546	B	0.32149	0.141	T	0.70310	-0.4907	10	0.28530	T	0.3	.	7.5963	0.28050	0.2743:0.0:0.7257:0.0	.	57	P25092	GUC2C_HUMAN	V	57	ENSP00000261170:A57V	ENSP00000261170:A57V	A	-	2	0	GUCY2C	14740480	0.031000	0.19500	0.004000	0.12327	0.042000	0.13812	1.047000	0.30367	0.323000	0.23307	0.655000	0.94253	GCG	.		0.483	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
ANXA6	309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	150484839	150484839	+	Silent	SNP	G	G	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:150484839G>C	ENST00000354546.5	-	24	2033	c.1806C>G	c.(1804-1806)ctC>ctG	p.L602L	ANXA6_ENST00000377751.5_Silent_p.L259L|ANXA6_ENST00000523714.1_Silent_p.L570L|ANXA6_ENST00000521512.1_Silent_p.L389L|ANXA6_ENST00000356496.5_Silent_p.L596L	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	602					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CGGCAAAGAAGAGAGGCTTGT	0.493																																					p.L602L		.											.	.	.	0			c.C1806G						.						164.0	154.0	157.0					5																	150484839		1962	4158	6120	SO:0001819	synonymous_variant	309	exon24			AAAGAAGAGAGGC	J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.1806C>G	5.37:g.150484839G>C		51	0		30	11	NM_001155	B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Silent	SNP	ENST00000354546.5	37	CCDS47315.1																																																																																			.		0.493	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377668.2	NM_001155	
RNF103	7844	hgsc.bcm.edu;bcgsc.ca	37	2	86831626	86831626	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:86831626G>T	ENST00000237455.4	-	4	2366	c.1398C>A	c.(1396-1398)ctC>ctA	p.L466L	AC015971.2_ENST00000597638.1_RNA|AC015971.2_ENST00000426549.1_RNA|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000439077.1_RNA|RNF103-CHMP3_ENST00000604011.1_Intron|CHMP3_ENST00000439940.2_Intron|RNF103_ENST00000477307.1_5'Flank	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	466					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						TCGGGTGGAAGAGGTAGCTGG	0.448																																					p.L466L		.											.	.	.	0			c.C1398A						.						90.0	89.0	89.0					2																	86831626		2203	4300	6503	SO:0001819	synonymous_variant	7844	exon4			GTGGAAGAGGTAG	D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.1398C>A	2.37:g.86831626G>T		33	0		40	4	NM_005667	A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Silent	SNP	ENST00000237455.4	37	CCDS33237.1																																																																																			.		0.448	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330041.2	NM_005667	
SLC16A14	151473	hgsc.bcm.edu	37	2	230914527	230914527	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:230914527G>A	ENST00000295190.4	-	3	811	c.353C>T	c.(352-354)gCc>gTc	p.A118V		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		TGCAGCATAGGCACTCAACAC	0.468																																					p.A118V		.											.	.	.	0			c.C353T						.						100.0	98.0	99.0					2																	230914527		2203	4300	6503	SO:0001583	missense	151473	exon3			GCATAGGCACTCA	BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.353C>T	2.37:g.230914527G>A	ENSP00000295190:p.Ala118Val	75	0		87	4	NM_152527	A8KA08|Q53R92|Q96NI7	Missense_Mutation	SNP	ENST00000295190.4	37	CCDS2473.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.777101	0.90195	.	.	ENSG00000163053	ENST00000295190;ENST00000457406;ENST00000412034	D;D;D	0.83506	-1.73;-1.73;-1.73	4.8	4.8	0.61643	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.56097	D	0.000030	D	0.89283	0.6671	L	0.59912	1.85	0.58432	D	0.999998	B;D	0.67145	0.051;0.996	B;D	0.68353	0.063;0.957	D	0.90308	0.4335	10	0.72032	D	0.01	.	18.0841	0.89452	0.0:0.0:1.0:0.0	.	118;118	E7EMG7;Q7RTX9	.;MOT14_HUMAN	V	118	ENSP00000295190:A118V;ENSP00000400352:A118V;ENSP00000395775:A118V	ENSP00000295190:A118V	A	-	2	0	SLC16A14	230622771	1.000000	0.71417	0.998000	0.56505	0.816000	0.46133	8.084000	0.89516	2.490000	0.84030	0.655000	0.94253	GCC	.		0.468	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527	
DNA2	1763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	70206164	70206164	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr10:70206164G>A	ENST00000358410.3	-	7	996	c.946C>T	c.(946-948)Ctg>Ttg	p.L316L	DNA2_ENST00000399179.2_Silent_p.L316L|DNA2_ENST00000399180.2_Silent_p.L402L	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	316	Nuclease activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						AGAGTGTACAGAACAACCTGT	0.413																																					p.L316L		.											.	.	.	0			c.C946T						.						67.0	63.0	65.0					10																	70206164		1906	4123	6029	SO:0001819	synonymous_variant	1763	exon7			TGTACAGAACAAC	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.946C>T	10.37:g.70206164G>A		61	0		95	44	NM_001080449	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Silent	SNP	ENST00000358410.3	37																																																																																				.		0.413	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		
CUL7	9820	hgsc.bcm.edu	37	6	43007936	43007936	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:43007936G>T	ENST00000265348.3	-	22	4337	c.4252C>A	c.(4252-4254)Ctg>Atg	p.L1418M	CUL7_ENST00000535468.1_Missense_Mutation_p.L1502M			Q14999	CUL7_HUMAN	cullin 7	1418					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.L1418V(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GTGCCCCTCAGGTAGGAGGGC	0.577																																					p.L1502M		.											CUL7,NS,carcinoma,0,1	CUL7	0	1	Substitution - Missense(1)	lung(1)	c.C4504A						.						150.0	135.0	140.0					6																	43007936		2203	4300	6503	SO:0001583	missense	9820	exon22			CCCTCAGGTAGGA	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.4252C>A	6.37:g.43007936G>T	ENSP00000265348:p.Leu1418Met	27	0		50	2	NM_001168370	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037615	0.75617	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	D;D	0.84944	-1.92;-1.92	5.71	4.81	0.61882	Cullin, N-terminal (1);Cullin homology (2);	0.065979	0.64402	N	0.000008	D	0.88280	0.6394	L	0.55743	1.74	0.44424	D	0.997343	D;D;D;D	0.89917	0.998;0.998;0.999;1.0	P;D;D;D	0.91635	0.87;0.921;0.945;0.999	D	0.89839	0.4001	10	0.66056	D	0.02	-4.7184	15.6922	0.77464	0.0:0.0:0.862:0.138	.	1502;1418;1502;1418	F5H0L1;A8K9U1;B4DYZ0;Q14999	.;.;.;CUL7_HUMAN	M	1418;1502	ENSP00000265348:L1418M;ENSP00000438788:L1502M	ENSP00000265348:L1418M	L	-	1	2	CUL7	43115914	1.000000	0.71417	0.989000	0.46669	0.985000	0.73830	3.792000	0.55476	1.346000	0.45694	0.561000	0.74099	CTG	.		0.577	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
TXNDC2	84203	hgsc.bcm.edu	37	18	9886918	9886918	+	Missense_Mutation	SNP	A	A	G	rs142946305		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr18:9886918A>G	ENST00000306084.6	+	2	641	c.442A>G	c.(442-444)Aac>Gac	p.N148D	TXNDC2_ENST00000426718.3_3'UTR|TXNDC2_ENST00000357775.5_Missense_Mutation_p.N81D|TXNDC2_ENST00000536353.2_Missense_Mutation_p.N81D	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	148	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						CAAAGAGAGTAACATCCCCAA	0.557																																					p.N148D		.											TXNDC2_ENST00000306084,NS,carcinoma,0,4	TXNDC2_ENST00000306084	0	0			c.A442G						.	A	ASP/ASN,ASP/ASN	1,4405		0,1,2202	134.0	138.0	137.0		442,241	-6.2	0.0	18	dbSNP_134	137	0,8600		0,0,4300	yes	missense,missense	TXNDC2	NM_001098529.1,NM_032243.5	23,23	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign,benign	148/554,81/487	9886918	1,13005	2203	4300	6503	SO:0001583	missense	84203	exon2			GAGAGTAACATCC	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.442A>G	18.37:g.9886918A>G	ENSP00000304908:p.Asn148Asp	93	1		87	2	NM_001098529	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	ENST00000306084.6	37	CCDS42414.1	.	.	.	.	.	.	.	.	.	.	a	2.139	-0.397257	0.04899	2.27E-4	0.0	ENSG00000168454	ENST00000536353;ENST00000357775;ENST00000306084;ENST00000426718	T;T;T	0.16743	2.44;2.32;2.32	3.49	-6.25	0.02039	.	2.476990	0.01833	N	0.034859	T	0.06554	0.0168	N	0.01188	-0.97	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.33471	-0.9867	9	.	.	.	.	15.0384	0.71767	0.8494:0.0:0.1506:0.0	.	148	Q86VQ3	TXND2_HUMAN	D	81;81;148;148	ENSP00000437393:N81D;ENSP00000350419:N81D;ENSP00000304908:N148D	.	N	+	1	0	TXNDC2	9876918	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.078000	0.03413	-1.562000	0.01682	-1.345000	0.01243	AAC	0.000		0.557	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
GRB2	2885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	73317898	73317898	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:73317898C>T	ENST00000392562.1	-	5	1092	c.310G>A	c.(310-312)Gat>Aat	p.D104N	GRB2_ENST00000462266.1_5'UTR|GRB2_ENST00000316615.5_Missense_Mutation_p.D63N|GRB2_ENST00000392563.1_Missense_Mutation_p.D63N|GRB2_ENST00000578961.1_Intron|GRB2_ENST00000392564.1_Missense_Mutation_p.D104N|GRB2_ENST00000316804.5_Missense_Mutation_p.D104N			P62993	GRB2_HUMAN	growth factor receptor-bound protein 2	104	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				aging (GO:0007568)|anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to ionizing radiation (GO:0071479)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of MAPK cascade (GO:0043408)|signal transduction in response to DNA damage (GO:0042770)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Grb2-EGFR complex (GO:0070436)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|identical protein binding (GO:0042802)|insulin receptor substrate binding (GO:0043560)|neurotrophin TRKA receptor binding (GO:0005168)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	17	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	TGCTGCACATCGTTTCCAAAC	0.488																																					p.D104N		.											.	.	.	0			c.G310A						.						56.0	51.0	53.0					17																	73317898		2203	4300	6503	SO:0001583	missense	2885	exon5			GCACATCGTTTCC		CCDS11721.1, CCDS11722.1	17q24-q25	2013-02-14			ENSG00000177885	ENSG00000177885		"""SH2 domain containing"""	4566	protein-coding gene	gene with protein product		108355					Standard	NM_002086		Approved	NCKAP2	uc002jnx.4	P62993	OTTHUMG00000134332	ENST00000392562.1:c.310G>A	17.37:g.73317898C>T	ENSP00000376345:p.Asp104Asn	17	0		18	9	NM_002086	P29354|Q14450|Q63057|Q63059	Missense_Mutation	SNP	ENST00000392562.1	37	CCDS11721.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783316	0.49891	.	.	ENSG00000177885	ENST00000316804;ENST00000392562;ENST00000392564;ENST00000392563;ENST00000316615	D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-1.6;-1.6	5.95	4.99	0.66335	SH2 motif (5);	0.000000	0.85682	D	0.000000	T	0.82208	0.4987	N	0.25825	0.765	0.80722	D	1	B;B	0.24651	0.108;0.103	B;B	0.22880	0.018;0.042	T	0.77360	-0.2617	10	0.25106	T	0.35	-32.4949	15.136	0.72566	0.0:0.9327:0.0:0.0673	.	63;104	P62993-2;P62993	.;GRB2_HUMAN	N	104;104;104;63;63	ENSP00000339007:D104N;ENSP00000376345:D104N;ENSP00000376347:D104N;ENSP00000376346:D63N;ENSP00000317360:D63N	ENSP00000317360:D63N	D	-	1	0	GRB2	70829493	1.000000	0.71417	0.428000	0.26697	0.315000	0.28087	7.818000	0.86416	1.535000	0.49220	-0.136000	0.14681	GAT	.		0.488	GRB2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259476.1		
CTC-497E21.3	0	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	13031684	13031684	+	lincRNA	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr11:13031684C>T	ENST00000533002.1	-	0	0																											TGGCCAAGCTCAACCGGCGGC	0.701																																					p.L187L		.											.	.	.	0			c.C561T						.						5.0	6.0	6.0					11																	13031684		1992	3997	5989			644943	exon1			CAAGCTCAACCGG																													11.37:g.13031684C>T		66	0		65	28	NM_001080521		Silent	SNP	ENST00000533002.1	37																																																																																				.		0.701	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
TEK	7010	hgsc.bcm.edu	37	9	27158032	27158032	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr9:27158032G>T	ENST00000380036.4	+	2	698	c.256G>T	c.(256-258)Gtt>Ttt	p.V86F	TEK_ENST00000519097.1_Intron|TEK_ENST00000406359.4_Missense_Mutation_p.V86F	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	86	Ig-like C2-type 1.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	GGCTAAAAAAGTTGTTTGGAA	0.463																																					p.V86F		.											.	.	.	0			c.G256T						.						104.0	104.0	104.0					9																	27158032		2203	4300	6503	SO:0001583	missense	7010	exon2			AAAAAAGTTGTTT	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.256G>T	9.37:g.27158032G>T	ENSP00000369375:p.Val86Phe	63	0		99	4	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468116	0.84533	.	.	ENSG00000120156	ENST00000380036;ENST00000346448;ENST00000406359	T;T	0.76186	-0.9;-1.0	5.92	5.92	0.95590	Tyrosine-protein kinase, receptor Tie-2, Ig-like domain 1, N-terminal (1);Immunoglobulin-like fold (1);	0.000000	0.46145	D	0.000304	T	0.80352	0.4607	N	0.24115	0.695	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	0.991;1.0;0.998;1.0	T	0.81389	-0.0955	10	0.59425	D	0.04	.	20.3206	0.98668	0.0:0.0:1.0:0.0	.	119;86;86;86	Q59HG2;B5A953;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	F	86	ENSP00000369375:V86F;ENSP00000383977:V86F	ENSP00000343716:V86F	V	+	1	0	TEK	27148032	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	6.664000	0.74437	2.809000	0.96659	0.655000	0.94253	GTT	.		0.463	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
PCDHGA3	56112	hgsc.bcm.edu	37	5	140725547	140725547	+	Silent	SNP	C	C	T	rs544633115	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:140725547C>T	ENST00000253812.6	+	1	1947	c.1947C>T	c.(1945-1947)caC>caT	p.H649H	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	649	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H649H(1)		breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCAGGACCACGGCCAGCCCC	0.711													.|||	8	0.00159744	0.0053	0.0	5008	,	,		14827	0.0		0.001	False		,,,				2504	0.0				p.H649H		.											PCDHGA3_ENST00000253812,NS,carcinoma,0,1	PCDHGA3_ENST00000253812	0	1	Substitution - coding silent(1)	kidney(1)	c.C1947T						.						12.0	19.0	17.0					5																	140725547		2129	4231	6360	SO:0001819	synonymous_variant	56112	exon1			GGACCACGGCCAG	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1947C>T	5.37:g.140725547C>T		45	1		84	9	NM_032011	Q9Y5D4	Silent	SNP	ENST00000253812.6	37	CCDS47290.1																																																																																			.		0.711	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
AGL	178	hgsc.bcm.edu	37	1	100346961	100346961	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:100346961C>T	ENST00000294724.4	+	16	2593	c.2115C>T	c.(2113-2115)atC>atT	p.I705I	AGL_ENST00000370163.3_Silent_p.I705I|AGL_ENST00000361302.3_Silent_p.I689I|AGL_ENST00000370161.2_Silent_p.I689I|AGL_ENST00000361915.3_Silent_p.I705I|AGL_ENST00000370165.3_Silent_p.I705I|AGL_ENST00000361522.4_Silent_p.I688I	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	705					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)	p.I705I(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GGTGTGCTATCAGTAAACTTC	0.393																																					p.I705I		.											AGL,NS,carcinoma,0,1	AGL	0	1	Substitution - coding silent(1)	lung(1)	c.C2115T						.						111.0	112.0	112.0					1																	100346961		2203	4300	6503	SO:0001819	synonymous_variant	178	exon16			TGCTATCAGTAAA	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.2115C>T	1.37:g.100346961C>T		45	0		36	2	NM_000644	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Silent	SNP	ENST00000294724.4	37	CCDS759.1																																																																																			.		0.393	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
KIAA0907	22889	hgsc.bcm.edu	37	1	155896523	155896523	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:155896523C>T	ENST00000368321.3	-	6	648	c.625G>A	c.(625-627)Gca>Aca	p.A209T	KIAA0907_ENST00000368319.3_Missense_Mutation_p.A209T|KIAA0907_ENST00000482337.1_5'UTR|KIAA0907_ENST00000368320.3_Missense_Mutation_p.A209T|SCARNA4_ENST00000516999.1_RNA	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	209							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			GCGATGGGTGCTGGCTGGTGA	0.453																																					p.A209T		.											KIAA0907,NS,carcinoma,0,1	KIAA0907	0	0			c.G625A						.						161.0	143.0	149.0					1																	155896523		2203	4300	6503	SO:0001583	missense	22889	exon6			TGGGTGCTGGCTG	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.625G>A	1.37:g.155896523C>T	ENSP00000357304:p.Ala209Thr	67	0		75	3	NM_014949	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	ENST00000368321.3	37	CCDS30885.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321441	0.60634	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	.	.	.	5.64	5.64	0.86602	.	0.191174	0.49916	D	0.000139	T	0.37265	0.0997	L	0.41824	1.3	0.43729	D	0.996217	P;B;B;P	0.46859	0.885;0.112;0.095;0.571	B;B;B;B	0.39805	0.31;0.047;0.021;0.28	T	0.17228	-1.0376	9	0.17369	T	0.5	-13.1658	19.4873	0.95035	0.0:1.0:0.0:0.0	.	209;209;209;209	Q7Z7F0-4;Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;.;K0907_HUMAN	T	209	.	ENSP00000357302:A209T	A	-	1	0	KIAA0907	154163147	0.959000	0.32827	1.000000	0.80357	0.924000	0.55760	1.978000	0.40598	2.937000	0.99478	0.650000	0.86243	GCA	.		0.453	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949	
TM4SF4	7104	hgsc.bcm.edu	37	3	149216522	149216522	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:149216522G>T	ENST00000305354.4	+	4	1319	c.415G>T	c.(415-417)Gat>Tat	p.D139Y		NM_004617.3	NP_004608.1	P48230	T4S4_HUMAN	transmembrane 4 L six family member 4	139					tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)		p.D139Y(1)		large_intestine(3)|lung(4)|ovary(1)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TTATCTCAATGATGAGGCCTT	0.448																																					p.D139Y		.											TM4SF4,NS,carcinoma,0,1	TM4SF4	0	1	Substitution - Missense(1)	lung(1)	c.G415T						.						80.0	79.0	80.0					3																	149216522		1904	4126	6030	SO:0001583	missense	7104	exon4			CTCAATGATGAGG		CCDS46932.1	3q25	2005-03-21	2005-03-21		ENSG00000169903	ENSG00000169903			11856	protein-coding gene	gene with protein product		606567	"""transmembrane 4 superfamily member 4"""			7665614	Standard	NM_004617		Approved	il-TMP	uc003exd.2	P48230	OTTHUMG00000159619	ENST00000305354.4:c.415G>T	3.37:g.149216522G>T	ENSP00000305852:p.Asp139Tyr	51	0		41	2	NM_004617	B2RDA4	Missense_Mutation	SNP	ENST00000305354.4	37	CCDS46932.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978692	0.53720	.	.	ENSG00000169903	ENST00000305354	T	0.38401	1.14	5.9	3.16	0.36331	.	0.136777	0.64402	D	0.000002	T	0.55641	0.1933	M	0.77486	2.375	0.25526	N	0.987329	D	0.76494	0.999	D	0.71414	0.973	T	0.49041	-0.8980	10	0.66056	D	0.02	.	8.5154	0.33242	0.3534:0.0:0.6466:0.0	.	139	P48230	T4S4_HUMAN	Y	139	ENSP00000305852:D139Y	ENSP00000305852:D139Y	D	+	1	0	TM4SF4	150699212	0.732000	0.28121	0.003000	0.11579	0.129000	0.20672	1.324000	0.33712	0.406000	0.25560	0.650000	0.86243	GAT	.		0.448	TM4SF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356528.1		
SLC4A10	57282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	162807340	162807340	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:162807340G>A	ENST00000446997.1	+	19	2616	c.2523G>A	c.(2521-2523)agG>agA	p.R841R	SLC4A10_ENST00000272716.5_Silent_p.R811R|SLC4A10_ENST00000375514.5_Silent_p.R822R|SLC4A10_ENST00000421911.1_Silent_p.R841R|SLC4A10_ENST00000415876.2_Silent_p.R811R	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	841					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TCATCAACAGGAAAGAGCATA	0.323																																					p.R841R		.											.	.	.	0			c.G2523A						.						59.0	54.0	56.0					2																	162807340		1836	4093	5929	SO:0001819	synonymous_variant	57282	exon19			CAACAGGAAAGAG		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.2523G>A	2.37:g.162807340G>A		68	0		67	30	NM_001178015	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Silent	SNP	ENST00000446997.1	37	CCDS54411.1																																																																																			.		0.323	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
AKAP9	10142	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	91729135	91729135	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr7:91729135G>A	ENST00000359028.2	+	44	11085	c.10860G>A	c.(10858-10860)ctG>ctA	p.L3620L	AKAP9_ENST00000356239.3_Silent_p.L3616L|AKAP9_ENST00000358100.2_Silent_p.L3566L			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3620					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTATGAAGCTGGAAGAGCAGA	0.408			T	BRAF	papillary thyroid																																p.L3616L		.		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	.	.	0			c.G10848A						.						163.0	143.0	150.0					7																	91729135		2203	4300	6503	SO:0001819	synonymous_variant	10142	exon44			GAAGCTGGAAGAG	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.10860G>A	7.37:g.91729135G>A		29	0		40	4	NM_005751	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Silent	SNP	ENST00000359028.2	37																																																																																				.		0.408	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
FAM47E-STBD1	100631383	hgsc.bcm.edu	37	4	77230789	77230789	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr4:77230789C>T	ENST00000237642.6	+	2	1457	c.713C>T	c.(712-714)aCt>aTt	p.T238I	FAM47E_ENST00000515604.1_3'UTR|FAM47E-STBD1_ENST00000539752.1_Missense_Mutation_p.T89I	NM_003943.4	NP_003934.1			FAM47E-STBD1 readthrough									p.T238N(1)									GGAAGAAGCACTTTGGTGGAA	0.512																																					p.T238I		.											STBD1,NS,carcinoma,0,1	STBD1	0	1	Substitution - Missense(1)	endometrium(1)	c.C713T						.						96.0	79.0	85.0					4																	77230789		2203	4300	6503	SO:0001583	missense	8987	exon2			GAAGCACTTTGGT		CCDS58908.1	4q21.1	2013-04-23			ENSG00000118804	ENSG00000118804			44667	other	readthrough							Standard	NM_001242939		Approved				OTTHUMG00000160966	ENST00000237642.6:c.713C>T	4.37:g.77230789C>T	ENSP00000237642:p.Thr238Ile	25	0		47	2	NM_003943		Missense_Mutation	SNP	ENST00000237642.6	37	CCDS3578.1	.	.	.	.	.	.	.	.	.	.	C	2.843	-0.239969	0.05944	.	.	ENSG00000118804	ENST00000539752;ENST00000237642	.	.	.	4.78	-2.94	0.05581	.	1.090610	0.07115	N	0.842942	T	0.28466	0.0704	L	0.42245	1.32	0.09310	N	1	B	0.30068	0.267	B	0.23716	0.048	T	0.14504	-1.0470	9	0.42905	T	0.14	0.8279	3.8856	0.09097	0.1069:0.2593:0.4351:0.1987	.	238	O95210	STBD1_HUMAN	I	89;238	.	ENSP00000237642:T238I	T	+	2	0	STBD1	77449813	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.368000	0.02580	-1.037000	0.03283	-0.165000	0.13383	ACT	.		0.512	FAM47E-STBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252415.2		
MYO5B	4645	hgsc.bcm.edu	37	18	47405423	47405423	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr18:47405423C>G	ENST00000285039.7	-	24	3467	c.3168G>C	c.(3166-3168)atG>atC	p.M1056I	MYO5B_ENST00000587895.1_5'Flank|MYO5B_ENST00000324581.6_Missense_Mutation_p.M197I	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1056					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GTTCTTTCTTCATGAGATTTT	0.453																																					p.M1056I		.											.	.	.	0			c.G3168C						.						79.0	78.0	78.0					18																	47405423		1855	4101	5956	SO:0001583	missense	4645	exon24			TTTCTTCATGAGA	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.3168G>C	18.37:g.47405423C>G	ENSP00000285039:p.Met1056Ile	55	0		60	6	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	C	8.702	0.909898	0.17833	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.16324	2.35;2.35	5.28	4.4	0.53042	.	0.179711	0.50627	N	0.000110	T	0.10551	0.0258	N	0.14661	0.345	0.50039	D	0.999842	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09058	-1.0692	10	0.44086	T	0.13	.	10.8003	0.46485	0.1469:0.7115:0.1416:0.0	.	1056;197	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	I	1056;197	ENSP00000285039:M1056I;ENSP00000315531:M197I	ENSP00000285039:M1056I	M	-	3	0	MYO5B	45659421	1.000000	0.71417	0.998000	0.56505	0.363000	0.29612	3.368000	0.52357	1.194000	0.43101	0.563000	0.77884	ATG	.		0.453	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	13753419	13753419	+	Missense_Mutation	SNP	G	G	T	rs202232031		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:13753419G>T	ENST00000265104.4	-	63	10899	c.10795C>A	c.(10795-10797)Cgt>Agt	p.R3599S		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3599	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AAAGGGTAACGAGATGCCTTC	0.373									Kartagener syndrome																												p.R3599S		.											DNAH5,NS,malignant_melanoma,0,1	DNAH5	0	0			c.C10795A						.						117.0	107.0	110.0					5																	13753419		2203	4300	6503	SO:0001583	missense	1767	exon63	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GGTAACGAGATGC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.10795C>A	5.37:g.13753419G>T	ENSP00000265104:p.Arg3599Ser	35	0		57	4	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880544	0.91740	.	.	ENSG00000039139	ENST00000265104	T	0.68181	-0.31	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.82540	0.5059	M	0.79475	2.455	0.80722	D	1	D	0.71674	0.998	D	0.71414	0.973	T	0.80417	-0.1391	10	0.40728	T	0.16	.	20.3431	0.98773	0.0:0.0:1.0:0.0	.	3599	Q8TE73	DYH5_HUMAN	S	3599	ENSP00000265104:R3599S	ENSP00000265104:R3599S	R	-	1	0	DNAH5	13806419	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.201000	0.72124	2.880000	0.98712	0.650000	0.86243	CGT	.		0.373	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
LYST	1130	hgsc.bcm.edu	37	1	235972607	235972607	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:235972607C>T	ENST00000389794.3	-	5	1685	c.1511G>A	c.(1510-1512)tGt>tAt	p.C504Y	LYST_ENST00000536965.1_Missense_Mutation_p.C504Y|LYST_ENST00000389793.2_Missense_Mutation_p.C504Y			Q99698	LYST_HUMAN	lysosomal trafficking regulator	504					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AGAATATTCACATCGTCTGTG	0.378																																					p.C504Y		.											LYST,NS,carcinoma,0,1	LYST	0	0			c.G1511A						.						110.0	110.0	110.0					1																	235972607		2203	4300	6503	SO:0001583	missense	1130	exon5			TATTCACATCGTC	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.1511G>A	1.37:g.235972607C>T	ENSP00000374444:p.Cys504Tyr	30	0		31	2	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.585986	0.66105	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.14640	2.49;2.49;2.49	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.38081	0.1027	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.08700	-1.0709	10	0.87932	D	0	.	19.2976	0.94129	0.0:1.0:0.0:0.0	.	504;504	Q99698-3;Q99698	.;LYST_HUMAN	Y	504	ENSP00000374444:C504Y;ENSP00000374443:C504Y;ENSP00000438315:C504Y	ENSP00000374443:C504Y	C	-	2	0	LYST	234039230	1.000000	0.71417	0.537000	0.28052	0.970000	0.65996	7.487000	0.81328	2.547000	0.85894	0.650000	0.86243	TGT	.		0.378	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
RPGRIP1L	23322	hgsc.bcm.edu	37	16	53726057	53726057	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:53726057G>T	ENST00000379925.3	-	4	500	c.450C>A	c.(448-450)taC>taA	p.Y150*	RPGRIP1L_ENST00000564374.1_Nonsense_Mutation_p.Y150*|RPGRIP1L_ENST00000563746.1_Nonsense_Mutation_p.Y150*|RPGRIP1L_ENST00000262135.4_Nonsense_Mutation_p.Y150*	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	150					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)	p.Y150*(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				GTACATTATTGTATGGAGTTT	0.383																																					p.Y150X		.											RPGRIP1L,NS,carcinoma,0,1	RPGRIP1L	0	1	Substitution - Nonsense(1)	lung(1)	c.C450A						.						286.0	265.0	272.0					16																	53726057		2198	4300	6498	SO:0001587	stop_gained	23322	exon4			ATTATTGTATGGA		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.450C>A	16.37:g.53726057G>T	ENSP00000369257:p.Tyr150*	47	0		65	3	NM_001127897	A0PJ88|Q9Y2K8	Nonsense_Mutation	SNP	ENST00000379925.3	37	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.053673	0.36277	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	.	.	.	5.83	3.86	0.44501	.	0.121936	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.318	13.1266	0.59358	0.1154:0.0:0.8846:0.0	.	.	.	.	X	150	.	ENSP00000262135:Y150X	Y	-	3	2	RPGRIP1L	52283558	0.856000	0.29760	0.960000	0.40013	0.803000	0.45373	0.391000	0.20784	2.763000	0.94921	0.563000	0.77884	TAC	.		0.383	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
CREB3L1	90993	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	46321678	46321678	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr11:46321678C>A	ENST00000529193.1	+	2	746	c.295C>A	c.(295-297)Ccc>Acc	p.P99T	CREB3L1_ENST00000288400.3_Missense_Mutation_p.P99T			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	99					regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		GCCCCAGAGCCCCCTTGTGCC	0.627			T	FUS	myxofibrosarcoma																																p.P99T	Pancreas(3;159 194 19597 26278 47995)	.		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	.	.	.	0			c.C295A						.						35.0	37.0	37.0					11																	46321678		2051	4196	6247	SO:0001583	missense	90993	exon2			CAGAGCCCCCTTG		CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.295C>A	11.37:g.46321678C>A	ENSP00000434939:p.Pro99Thr	34	0		28	11	NM_052854	Q8N2D5|Q96CP0	Missense_Mutation	SNP	ENST00000529193.1	37	CCDS53620.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454129	0.84209	.	.	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000446415;ENST00000534787	T;T;T	0.43294	0.95;0.95;0.95	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000001	T	0.66509	0.2796	M	0.70595	2.14	0.50467	D	0.999872	D	0.89917	1.0	D	0.83275	0.996	T	0.68784	-0.5317	10	0.87932	D	0	-7.9176	19.5245	0.95199	0.0:1.0:0.0:0.0	.	99	Q96BA8	CR3L1_HUMAN	T	99;99;99;53	ENSP00000434939:P99T;ENSP00000288400:P99T;ENSP00000431677:P53T	ENSP00000288400:P99T	P	+	1	0	CREB3L1	46278254	1.000000	0.71417	0.997000	0.53966	0.738000	0.42128	6.557000	0.73937	2.608000	0.88229	0.655000	0.94253	CCC	.		0.627	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1	NM_052854	
POTEF	728378	hgsc.bcm.edu	37	2	130832762	130832762	+	Silent	SNP	T	T	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:130832762T>C	ENST00000409914.2	-	17	2682	c.2283A>G	c.(2281-2283)aaA>aaG	p.K761K	POTEF_ENST00000357462.5_Silent_p.K761K	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	761	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.K761K(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GGATGCCTCTTTTGCTCTGGG	0.582																																					p.K761K		.											POTEF,NS,carcinoma,0,1	POTEF	0	1	Substitution - coding silent(1)	prostate(1)	c.A2283G						.																																			SO:0001819	synonymous_variant	728378	exon17			GCCTCTTTTGCTC	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2283A>G	2.37:g.130832762T>C		63	2		54	3	NM_001099771	A6NC34	Silent	SNP	ENST00000409914.2	37	CCDS46409.1																																																																																			.		0.582	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
TMEM198	130612	hgsc.bcm.edu;ucsc.edu	37	2	220413845	220413845	+	Intron	SNP	G	G	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:220413845G>C	ENST00000344458.2	+	5	1327				MIR3132_ENST00000581997.1_RNA|RP11-256I23.1_ENST00000596829.1_RNA|TMEM198_ENST00000373883.3_Intron			Q66K66	TM198_HUMAN	transmembrane protein 198						multicellular organismal development (GO:0007275)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	16		Renal(207;0.0376)		Epithelial(149;6.49e-08)|all cancers(144;6.45e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		ACCGTCCTCTGAGCTCCTTCT	0.582																																					.		.											.	.	.	0			.						.						64.0	68.0	66.0					2																	220413845		2203	4299	6502	SO:0001627	intron_variant	100423039	.			TCCTCTGAGCTCC	BC068567	CCDS33385.1	2q35	2011-12-06			ENSG00000188760	ENSG00000188760			33704	protein-coding gene	gene with protein product							Standard	NM_001005209		Approved	MGC99813, TMEM198A	uc002vmf.3	Q66K66	OTTHUMG00000059156	ENST00000344458.2:c.743-29G>C	2.37:g.220413845G>C		27	0		23	12	.		RNA	SNP	ENST00000344458.2	37	CCDS33385.1																																																																																			.		0.582	TMEM198-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131063.1	NM_001005209	
HORMAD2	150280	hgsc.bcm.edu	37	22	30518061	30518061	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr22:30518061G>T	ENST00000336726.6	+	10	1032	c.677G>T	c.(676-678)gGc>gTc	p.G226V	HORMAD2_ENST00000403975.1_Missense_Mutation_p.G226V	NM_152510.2	NP_689723.1	Q8N7B1	HORM2_HUMAN	HORMA domain containing 2	226	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				meiotic nuclear division (GO:0007126)|meiotic sister chromatid cohesion (GO:0051177)	chromosome (GO:0005694)|nucleus (GO:0005634)				large_intestine(1)|lung(1)	2			Epithelial(10;0.125)			GTCTCCACTGGCTTTCATAGC	0.438																																					p.G226V		.											HORMAD2,colon,carcinoma,0,1	HORMAD2	0	0			c.G677T						.						58.0	54.0	56.0					22																	30518061		1880	4113	5993	SO:0001583	missense	150280	exon10			CCACTGGCTTTCA	AK098703	CCDS46683.1	22q12.2	2014-01-21			ENSG00000176635	ENSG00000176635			28383	protein-coding gene	gene with protein product						12477932	Standard	NM_152510		Approved	MGC26710, CT46.2	uc003agy.3	Q8N7B1	OTTHUMG00000150881	ENST00000336726.6:c.677G>T	22.37:g.30518061G>T	ENSP00000336984:p.Gly226Val	51	0		47	2	NM_152510	B5MEB2|Q8NHR2	Missense_Mutation	SNP	ENST00000336726.6	37	CCDS46683.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.537900	0.27475	.	.	ENSG00000176635	ENST00000336726;ENST00000403975	T;T	0.36520	1.25;1.25	4.86	2.6	0.31112	DNA-binding HORMA (4);	0.339673	0.31484	N	0.007575	T	0.33352	0.0860	M	0.64567	1.98	0.52501	D	0.999953	P	0.36789	0.57	B	0.37943	0.261	T	0.13818	-1.0495	10	0.44086	T	0.13	-12.6804	8.0812	0.30746	0.2649:0.0:0.7351:0.0	.	226	Q8N7B1	HORM2_HUMAN	V	226	ENSP00000336984:G226V;ENSP00000385055:G226V	ENSP00000336984:G226V	G	+	2	0	HORMAD2	28848061	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.316000	0.43761	1.245000	0.43885	0.591000	0.81541	GGC	.		0.438	HORMAD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320416.2	NM_152510	
CES5A	221223	hgsc.bcm.edu	37	16	55880742	55880742	+	Silent	SNP	C	C	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:55880742C>A	ENST00000290567.9	-	12	1555	c.1434G>T	c.(1432-1434)acG>acT	p.T478T	CES5A_ENST00000319165.9_Silent_p.T428T|CES5A_ENST00000518005.1_Silent_p.T372T|CES5A_ENST00000520435.1_Silent_p.T448T|CES5A_ENST00000541580.1_5'UTR|CES5A_ENST00000521992.1_Silent_p.T507T	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	478						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TCTCCTCCTCCGTGGCTCCTT	0.537																																					p.T507T		.											CES5A_ENST00000521992,NS,carcinoma,-1,2	CES5A_ENST00000521992	-1	0			c.G1521T						.						157.0	154.0	155.0					16																	55880742		2198	4300	6498	SO:0001819	synonymous_variant	221223	exon13			CTCCTCCGTGGCT	AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.1434G>T	16.37:g.55880742C>A		25	0		24	2	NM_001190158	B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Silent	SNP	ENST00000290567.9	37	CCDS45490.1																																																																																			.		0.537	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024	
ZNF516	9658	hgsc.bcm.edu	37	18	74090965	74090965	+	Splice_Site	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr18:74090965C>G	ENST00000443185.2	-	4	3422	c.3105G>C	c.(3103-3105)gcG>gcC	p.A1035A	ZNF516_ENST00000524431.2_5'UTR|RP11-504I13.3_ENST00000583287.1_RNA	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	1035					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GACGGGGGGGCGCCCCAGCCA	0.667																																					p.A1035A		.											.	.	.	0			c.G3105C						.						28.0	33.0	32.0					18																	74090965		1903	4088	5991	SO:0001630	splice_region_variant	9658	exon4			GGGGGGCGCCCCA	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.3105+1G>C	18.37:g.74090965C>G		47	0		48	5	NM_014643		Silent	SNP	ENST00000443185.2	37		.	.	.	.	.	.	.	.	.	.	c	0	-226.479313	0.00000	.	.	ENSG00000101493	ENST00000443185	.	.	.	2.98	-1.95	0.07548	.	.	.	.	.	.	.	.	N	0.14661	0.345	0.20074	N	0.999936	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.5201	0.00610	0.3591:0.1891:0.2525:0.1993	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF516	72219953	0.523000	0.26274	0.000000	0.03702	0.064000	0.16182	1.183000	0.32041	-0.202000	0.10268	-0.436000	0.05848	.	.		0.667	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	Silent
ESPNP	284729	hgsc.bcm.edu	37	1	17020257	17020257	+	RNA	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:17020257G>A	ENST00000492551.1	-	0	1938					NR_026567.1				espin pseudogene																		GCAGCGTGGAGATCTTGCTGC	0.736																																					.		.											.	.	.	0			.						.																																					284729	.			CGTGGAGATCTTG	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17020257G>A		20	0		19	6	.		RNA	SNP	ENST00000492551.1	37																																																																																				.		0.736	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000326311.1		
LDOC1L	84247	hgsc.bcm.edu	37	22	44893393	44893393	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr22:44893393G>T	ENST00000341255.3	-	2	553	c.44C>A	c.(43-45)gCa>gAa	p.A15E		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	15										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		CGGAGACGCTGCCAAGGCTGG	0.647																																					p.A15E		.											LDOC1L,caecum,carcinoma,0,1	LDOC1L	0	0			c.C44A						.						49.0	36.0	40.0					22																	44893393		2202	4299	6501	SO:0001583	missense	84247	exon2			GACGCTGCCAAGG	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.44C>A	22.37:g.44893393G>T	ENSP00000340434:p.Ala15Glu	32	0		48	2	NM_032287	Q6ZTR1	Missense_Mutation	SNP	ENST00000341255.3	37	CCDS33662.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.788577	0.70337	.	.	ENSG00000188636	ENST00000341255	T	0.26373	1.74	2.95	1.93	0.25924	.	.	.	.	.	T	0.12092	0.0294	N	0.08118	0	0.09310	N	1	B	0.23591	0.088	B	0.17433	0.018	T	0.20773	-1.0265	9	0.54805	T	0.06	-4.5019	6.0304	0.19677	0.1452:0.0:0.8548:0.0	.	15	Q6ICC9	LDOCL_HUMAN	E	15	ENSP00000340434:A15E	ENSP00000340434:A15E	A	-	2	0	LDOC1L	43272057	0.021000	0.18746	0.002000	0.10522	0.304000	0.27724	1.582000	0.36568	0.819000	0.34492	0.467000	0.42956	GCA	.		0.647	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287	
ZNF430	80264	hgsc.bcm.edu	37	19	21240049	21240049	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:21240049C>T	ENST00000261560.5	+	5	1116	c.935C>T	c.(934-936)aCt>aTt	p.T312I	AC012627.1_ENST00000578233.1_RNA	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	312					regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						AGAATTCATACTGGAGAGAAA	0.403																																					p.T312I		.											.	.	.	0			c.C935T						.						56.0	60.0	58.0					19																	21240049		2200	4298	6498	SO:0001583	missense	80264	exon5			TTCATACTGGAGA	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.935C>T	19.37:g.21240049C>T	ENSP00000261560:p.Thr312Ile	27	0		64	4	NM_025189	Q86V70	Missense_Mutation	SNP	ENST00000261560.5	37	CCDS32978.1	.	.	.	.	.	.	.	.	.	.	.	14.77	2.635118	0.47049	.	.	ENSG00000118620	ENST00000261560	T	0.25749	1.78	1.04	-1.9	0.07665	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40719	0.1128	M	0.66560	2.04	0.27024	N	0.964402	D;P	0.89917	1.0;0.599	D;B	0.85130	0.997;0.41	T	0.28554	-1.0040	9	0.72032	D	0.01	.	4.0856	0.09945	0.257:0.4881:0.2549:0.0	.	311;312	Q2NKJ9;Q9H8G1	.;ZN430_HUMAN	I	312	ENSP00000261560:T312I	ENSP00000261560:T312I	T	+	2	0	ZNF430	21031889	0.075000	0.21258	0.917000	0.36280	0.907000	0.53573	0.347000	0.20014	-0.521000	0.06426	-0.519000	0.04390	ACT	.		0.403	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	NM_025189	
ARID1A	8289	hgsc.bcm.edu	37	1	27106011	27106011	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:27106011C>T	ENST00000324856.7	+	20	5993	c.5622C>T	c.(5620-5622)tgC>tgT	p.C1874C	ARID1A_ENST00000540690.1_Silent_p.C202C|ARID1A_ENST00000457599.2_Silent_p.C1657C|ARID1A_ENST00000374152.2_Silent_p.C1491C	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1874					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ACGCACCCTGCCCACCAGCCC	0.617			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.C1874C		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	.	0			c.C5622T						.						64.0	70.0	68.0					1																	27106011		2203	4300	6503	SO:0001819	synonymous_variant	8289	exon20			ACCCTGCCCACCA	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5622C>T	1.37:g.27106011C>T		64	0		95	4	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Silent	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	3.371	-0.128462	0.06753	.	.	ENSG00000117713	ENST00000430799	.	.	.	4.74	0.51	0.16983	.	.	.	.	.	T	0.21962	0.0529	.	.	.	0.19575	N	0.999962	.	.	.	.	.	.	T	0.23404	-1.0189	4	.	.	.	-0.131	2.77	0.05332	0.1253:0.5357:0.1223:0.2168	.	.	.	.	S	771	.	.	P	+	1	0	ARID1A	26978598	0.247000	0.23920	0.540000	0.28089	0.948000	0.59901	0.588000	0.23924	0.319000	0.23209	0.491000	0.48974	CCC	.		0.617	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
KAT2A	2648	hgsc.bcm.edu	37	17	40266620	40266620	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:40266620G>T	ENST00000225916.5	-	14	2075	c.2022C>A	c.(2020-2022)atC>atA	p.I674I	DHX58_ENST00000251642.3_5'Flank	NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	674					cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GCTTCTTGATGATCTGAGGGA	0.622																																					p.I674I		.											KAT2A,NS,carcinoma,0,1	KAT2A	0	0			c.C2022A						.						74.0	69.0	71.0					17																	40266620		2203	4300	6503	SO:0001819	synonymous_variant	2648	exon14			CTTGATGATCTGA	AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.2022C>A	17.37:g.40266620G>T		26	0		22	2	NM_021078	Q8N1A2|Q9UCW1	Silent	SNP	ENST00000225916.5	37	CCDS11417.1																																																																																			.		0.622	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257458.1	NM_021078	
IFIT5	24138	hgsc.bcm.edu;broad.mit.edu	37	10	91177164	91177164	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr10:91177164G>A	ENST00000371795.4	+	2	421	c.208G>A	c.(208-210)Gcc>Acc	p.A70T	LIPA_ENST00000371837.1_5'Flank|IFIT5_ENST00000416601.1_Missense_Mutation_p.A70T	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	70					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						AAATAAAGACGCCCTTGAGTG	0.418																																					p.A70T		.											IFIT5,colon,carcinoma,0,1	IFIT5	0	0			c.G208A						.						68.0	67.0	67.0					10																	91177164		2203	4300	6503	SO:0001583	missense	24138	exon2			AAAGACGCCCTTG	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.208G>A	10.37:g.91177164G>A	ENSP00000360860:p.Ala70Thr	26	0		40	5	NM_012420	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Missense_Mutation	SNP	ENST00000371795.4	37	CCDS7403.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040895	0.75732	.	.	ENSG00000152778	ENST00000371795;ENST00000416601	D;D	0.99032	-5.35;-5.35	6.03	6.03	0.97812	.	0.049978	0.85682	D	0.000000	D	0.99495	0.9820	M	0.92649	3.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98718	1.0707	10	0.66056	D	0.02	-8.3813	19.545	0.95291	0.0:0.0:1.0:0.0	.	70;70	Q13325;B4DDV1	IFIT5_HUMAN;.	T	70	ENSP00000360860:A70T;ENSP00000414042:A70T	ENSP00000360860:A70T	A	+	1	0	IFIT5	91167144	1.000000	0.71417	0.990000	0.47175	0.460000	0.32559	6.167000	0.71902	2.861000	0.98227	0.655000	0.94253	GCC	.		0.418	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049303.1	NM_012420	
PDE6C	5146	hgsc.bcm.edu	37	10	95400207	95400207	+	Splice_Site	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr10:95400207G>T	ENST00000371447.3	+	13	1768	c.1630G>T	c.(1630-1632)Gtt>Ttt	p.V544F		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	544					phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	CTTCTTTTAGGTTCTTACCAG	0.423																																					p.V544F		.											PDE6C,NS,carcinoma,0,1	PDE6C	0	0			c.G1630T						.						130.0	118.0	122.0					10																	95400207		2203	4300	6503	SO:0001630	splice_region_variant	5146	exon13			TTTTAGGTTCTTA	U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.1630-1G>T	10.37:g.95400207G>T		52	0		72	3	NM_006204	A6NCR6|Q5VY29	Missense_Mutation	SNP	ENST00000371447.3	37	CCDS7429.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.510980	0.64522	.	.	ENSG00000095464	ENST00000371447	T	0.77877	-1.13	5.03	4.1	0.47936	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.115816	0.64402	D	0.000012	D	0.87962	0.6310	M	0.88105	2.93	0.58432	D	0.999996	D	0.71674	0.998	D	0.63381	0.914	D	0.89556	0.3803	9	.	.	.	.	14.0033	0.64446	0.0745:0.0:0.9255:0.0	.	544	P51160	PDE6C_HUMAN	F	544	ENSP00000360502:V544F	.	V	+	1	0	PDE6C	95390197	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	5.771000	0.68881	2.613000	0.88420	0.467000	0.42956	GTT	.		0.423	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049437.1	NM_006204	Missense_Mutation
DCT	1638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	95131418	95131418	+	Missense_Mutation	SNP	G	G	A	rs375600704		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr13:95131418G>A	ENST00000377028.5	-	1	505	c.92C>T	c.(91-93)aCg>aTg	p.T31M	DCT_ENST00000446125.1_Missense_Mutation_p.T31M	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	31					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		GCTGTCCACCGTCATGCAGAC	0.607																																					p.T31M		.											DCT_ENST00000446125,caecum,carcinoma,0,6	DCT_ENST00000446125	0	0			c.C92T						.	G	MET/THR,MET/THR	0,4406		0,0,2203	44.0	42.0	43.0		92,92	4.9	0.9	13		43	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DCT	NM_001129889.1,NM_001922.3	81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	31/553,31/520	95131418	1,13005	2203	4300	6503	SO:0001583	missense	1638	exon1			TCCACCGTCATGC	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.92C>T	13.37:g.95131418G>A	ENSP00000366227:p.Thr31Met	30	0		38	24	NM_001129889	Q09GT4	Missense_Mutation	SNP	ENST00000377028.5	37	CCDS9470.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.381740	0.61845	0.0	1.16E-4	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.99207	-5.56;-5.53	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.99515	0.9827	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98256	1.0496	10	0.87932	D	0	-13.991	18.0391	0.89314	0.0:0.0:1.0:0.0	.	31;31	Q09GT4;P40126	.;TYRP2_HUMAN	M	31	ENSP00000366227:T31M;ENSP00000392762:T31M	ENSP00000366227:T31M	T	-	2	0	DCT	93929419	1.000000	0.71417	0.925000	0.36789	0.223000	0.24884	9.229000	0.95273	2.248000	0.74166	0.555000	0.69702	ACG	.		0.607	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3		
LAMA4	3910	hgsc.bcm.edu	37	6	112463373	112463373	+	Missense_Mutation	SNP	G	G	T	rs375497091		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:112463373G>T	ENST00000230538.7	-	20	3012	c.2615C>A	c.(2614-2616)cCg>cAg	p.P872Q	LAMA4_ENST00000522006.1_Missense_Mutation_p.P865Q|LAMA4_ENST00000389463.4_Missense_Mutation_p.P865Q|LAMA4_ENST00000424408.2_Missense_Mutation_p.P865Q	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	872	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GGTCAGTTCCGGCCGCTTCAC	0.483																																					p.P872Q		.											LAMA4,NS,carcinoma,0,1	LAMA4	0	0			c.C2615A						.						118.0	117.0	117.0					6																	112463373		2203	4300	6503	SO:0001583	missense	3910	exon20			AGTTCCGGCCGCT		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.2615C>A	6.37:g.112463373G>T	ENSP00000230538:p.Pro872Gln	58	0		57	2	NM_001105206	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	G	10.16	1.273300	0.23221	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.13307	2.62;2.6;2.6;2.6	6.16	4.33	0.51752	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.365220	0.34879	N	0.003603	T	0.05868	0.0153	L	0.43152	1.355	0.80722	D	1	B;B	0.18610	0.017;0.029	B;B	0.17433	0.008;0.018	T	0.11275	-1.0594	10	0.31617	T	0.26	.	14.4397	0.67306	0.0:0.0:0.6155:0.3845	.	872;865	Q16363;Q16363-2	LAMA4_HUMAN;.	Q	872;865;865;865	ENSP00000230538:P872Q;ENSP00000429488:P865Q;ENSP00000374114:P865Q;ENSP00000416470:P865Q	ENSP00000230538:P872Q	P	-	2	0	LAMA4	112570066	0.787000	0.28750	0.046000	0.18839	0.004000	0.04260	2.976000	0.49289	0.859000	0.35456	0.650000	0.86243	CCG	.		0.483	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
RB1CC1	9821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	53554933	53554933	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr8:53554933C>G	ENST00000025008.5	-	18	4838	c.4315G>C	c.(4315-4317)Gag>Cag	p.E1439Q	RB1CC1_ENST00000435644.2_Missense_Mutation_p.E1439Q|RB1CC1_ENST00000539297.1_Missense_Mutation_p.E1439Q|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1439					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				ATGCTTGTCTCCATTGCTGAA	0.428																																					p.E1439Q	GBM(180;1701 2102 13475 42023 52570)	.											.	.	.	0			c.G4315C						.						140.0	132.0	135.0					8																	53554933		2203	4300	6503	SO:0001583	missense	9821	exon18			TTGTCTCCATTGC	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4315G>C	8.37:g.53554933C>G	ENSP00000025008:p.Glu1439Gln	32	0		31	16	NM_001083617	Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763807	0.89932	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.18016	2.24;2.24;2.24	5.75	5.75	0.90469	.	0.109559	0.64402	D	0.000010	T	0.24314	0.0589	L	0.36672	1.1	0.80722	D	1	P;P	0.44521	0.837;0.748	P;B	0.47827	0.558;0.355	T	0.00295	-1.1839	10	0.62326	D	0.03	-7.3385	18.9117	0.92489	0.0:1.0:0.0:0.0	.	1439;1439	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	Q	1439	ENSP00000025008:E1439Q;ENSP00000396067:E1439Q;ENSP00000445960:E1439Q	ENSP00000025008:E1439Q	E	-	1	0	RB1CC1	53717486	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.603000	0.74145	2.702000	0.92279	0.655000	0.94253	GAG	.		0.428	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
STAT2	6773	hgsc.bcm.edu	37	12	56743970	56743970	+	Silent	SNP	G	G	T	rs540221109		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:56743970G>T	ENST00000314128.4	-	13	1143	c.1120C>A	c.(1120-1122)Cgg>Agg	p.R374R	STAT2_ENST00000556539.1_5'Flank|STAT2_ENST00000418572.2_Silent_p.R370R|RNU7-40P_ENST00000516397.1_RNA|STAT2_ENST00000557235.1_Silent_p.R370R			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	374					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.R374W(1)		NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						TTGAACTTCCGGAAGCTGTTC	0.408																																					p.R374R		.											STAT2,NS,carcinoma,0,1	STAT2	0	1	Substitution - Missense(1)	kidney(1)	c.C1120A						.						77.0	81.0	79.0					12																	56743970		2203	4300	6503	SO:0001819	synonymous_variant	6773	exon13			ACTTCCGGAAGCT	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1120C>A	12.37:g.56743970G>T		29	0		56	3	NM_005419	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Silent	SNP	ENST00000314128.4	37	CCDS8917.1																																																																																			.		0.408	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410277.1	NM_005419	
RNF213	57674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	78325495	78325495	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:78325495A>G	ENST00000582970.1	+	32	10338	c.10195A>G	c.(10195-10197)Ata>Gta	p.I3399V	CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.I1472V|RNF213_ENST00000508628.2_Missense_Mutation_p.I3448V|CTD-2047H16.4_ENST00000572151.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3399					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GTATTCTGTTATAAATGAAAT	0.353																																					p.I3399V		.											.	.	.	0			c.A10195G						.						46.0	49.0	48.0					17																	78325495		2203	4299	6502	SO:0001583	missense	57674	exon32			TCTGTTATAAATG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10195A>G	17.37:g.78325495A>G	ENSP00000464087:p.Ile3399Val	109	0		139	60	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	A	4.417	0.077179	0.08485	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.16457	2.34	5.01	-2.45	0.06481	.	0.591173	0.17271	N	0.180393	T	0.08758	0.0217	L	0.33189	0.99	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.39683	-0.9602	10	0.11485	T	0.65	.	6.0835	0.19954	0.2047:0.3266:0.4688:0.0	.	1472	Q63HN8	RN213_HUMAN	V	3399;3448;1472	ENSP00000338218:I1472V	ENSP00000338218:I1472V	I	+	1	0	RNF213	75940090	0.294000	0.24380	0.001000	0.08648	0.346000	0.29079	0.838000	0.27572	-0.301000	0.08882	-0.408000	0.06270	ATA	.		0.353	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
EHMT1	79813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	9	140732875	140732875	+	IGR	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr9:140732875C>T	ENST00000460843.1	+	0	5095				MIR602_ENST00000384960.1_RNA	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		TCCCCCTTCTCACCCCCGCCT	0.572																																					.		.											.	.	.	0			.						.						96.0	101.0	100.0					9																	140732875		1568	3582	5150	SO:0001628	intergenic_variant	693187	.			CCTTCTCACCCCC	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995		9.37:g.140732875C>T		58	0		78	32	.	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	RNA	SNP	ENST00000460843.1	37	CCDS7050.2																																																																																			.		0.572	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757	
MYO5B	4645	hgsc.bcm.edu	37	18	47405425	47405425	+	Missense_Mutation	SNP	T	T	G	rs33910398|rs3841750|rs200219597|rs397841722	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr18:47405425T>G	ENST00000285039.7	-	24	3465	c.3166A>C	c.(3166-3168)Atg>Ctg	p.M1056L	MYO5B_ENST00000587895.1_5'Flank|MYO5B_ENST00000324581.6_Missense_Mutation_p.M197L	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1056					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.M1056L(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TCTTTCTTCATGAGATTTTCC	0.453																																					p.M1056L		.											MYO5B,NS,carcinoma,0,1	MYO5B	0	1	Substitution - Missense(1)	pancreas(1)	c.A3166C						.						78.0	77.0	77.0					18																	47405425		1851	4100	5951	SO:0001583	missense	4645	exon24			TCTTCATGAGATT	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.3166A>C	18.37:g.47405425T>G	ENSP00000285039:p.Met1056Leu	55	0		59	1	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	T	0.039	-1.291359	0.01375	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.10960	2.82;2.82	5.28	2.82	0.32997	.	0.179711	0.50627	D	0.000110	T	0.04182	0.0116	N	0.11154	0.105	0.45046	D	0.998067	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37820	-0.9689	10	0.02654	T	1	.	7.2702	0.26252	0.1289:0.072:0.0:0.7991	.	1056;197	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	L	1056;197	ENSP00000285039:M1056L;ENSP00000315531:M197L	ENSP00000285039:M1056L	M	-	1	0	MYO5B	45659423	0.911000	0.30947	0.910000	0.35882	0.248000	0.25809	0.029000	0.13666	0.305000	0.22832	-0.376000	0.06991	ATG	.		0.453	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
ZFP62	643836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	180277777	180277777	+	Missense_Mutation	SNP	G	G	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:180277777G>C	ENST00000502412.1	-	2	775	c.718C>G	c.(718-720)Ctg>Gtg	p.L240V	ZFP62_ENST00000506377.1_Intron|ZFP62_ENST00000359141.6_Missense_Mutation_p.L180V|ZFP62_ENST00000512132.1_Missense_Mutation_p.L207V	NM_001172638.1	NP_001166109.1	Q8NB50	ZFP62_HUMAN	ZFP62 zinc finger protein	240					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(2)|pancreas(1)	4	all_cancers(89;4.01e-05)|all_epithelial(37;4.69e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00469)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCTGGTCCAGAACAGAGCTA	0.468																																					p.L240V		.											.	.	.	0			c.C718G						.						18.0	18.0	18.0					5																	180277777		692	1591	2283	SO:0001583	missense	643836	exon2			GGTCCAGAACAGA	AK002206	CCDS47357.1, CCDS47357.2, CCDS54955.1	5q35.3	2013-01-08	2012-11-27			ENSG00000196670		"""Zinc fingers, C2H2-type"""	23241	protein-coding gene	gene with protein product		610281	"""zinc finger protein 62 homolog (mouse)"", ""zinc finger protein 62"""			8808410	Standard	NM_152283		Approved	FLJ34231, ZET, ZNF755	uc011dhf.2	Q8NB50		ENST00000502412.1:c.718C>G	5.37:g.180277777G>C	ENSP00000423820:p.Leu240Val	28	0		38	16	NM_001172638	B4DIP6|B4E0N3|B5MDX6|B7ZVZ2|B9EIP6|E9PFT8|J3QTA9	Missense_Mutation	SNP	ENST00000502412.1	37	CCDS54955.1	.	.	.	.	.	.	.	.	.	.	.	10.49	1.365951	0.24684	.	.	ENSG00000196670	ENST00000512132;ENST00000359141;ENST00000502412;ENST00000405851	T;T;T	0.52983	0.64;0.64;0.64	3.97	0.805	0.18703	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.65698	0.2716	M	0.87971	2.92	0.09310	N	0.999993	P	0.34997	0.479	P	0.53809	0.735	T	0.61312	-0.7088	9	0.72032	D	0.01	.	6.4817	0.22067	0.5745:0.0:0.4255:0.0	.	240	Q8NB50	ZFP62_HUMAN	V	207;180;240;34	ENSP00000426193:L207V;ENSP00000352053:L180V;ENSP00000423820:L240V	ENSP00000352053:L180V	L	-	1	2	ZFP62	180210383	0.018000	0.18449	0.939000	0.37840	0.948000	0.59901	0.172000	0.16704	0.147000	0.19030	0.542000	0.68232	CTG	.		0.468	ZFP62-002	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368386.2	NM_152283	
PCDH20	64881	hgsc.bcm.edu	37	13	61985616	61985616	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr13:61985616G>T	ENST00000409186.1	-	5	4721	c.2616C>A	c.(2614-2616)atC>atA	p.I872I	PCDH20_ENST00000409204.4_Silent_p.I872I			Q8N6Y1	PCD20_HUMAN	protocadherin 20	872					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GTTCTATTGAGATTTGTGGTT	0.393																																					p.I872I		.											.	.	.	0			c.C2616A						.						85.0	76.0	79.0					13																	61985616		2203	4300	6503	SO:0001819	synonymous_variant	64881	exon2			TATTGAGATTTGT	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.2616C>A	13.37:g.61985616G>T		33	0		51	4	NM_022843	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Silent	SNP	ENST00000409186.1	37	CCDS9442.2																																																																																			.		0.393	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
TXNDC2	84203	hgsc.bcm.edu	37	18	9886915	9886915	+	Missense_Mutation	SNP	A	A	G	rs376867565		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr18:9886915A>G	ENST00000306084.6	+	2	638	c.439A>G	c.(439-441)Agt>Ggt	p.S147G	TXNDC2_ENST00000426718.3_3'UTR|TXNDC2_ENST00000357775.5_Missense_Mutation_p.S80G|TXNDC2_ENST00000536353.2_Missense_Mutation_p.S80G	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	147	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						GCCCAAAGAGAGTAACATCCC	0.567																																					p.S147G		.											TXNDC2_ENST00000306084,NS,carcinoma,0,2	TXNDC2_ENST00000306084	0	0			c.A439G						.						135.0	138.0	137.0					18																	9886915		2203	4300	6503	SO:0001583	missense	84203	exon2			AAAGAGAGTAACA	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.439A>G	18.37:g.9886915A>G	ENSP00000304908:p.Ser147Gly	92	1		90	2	NM_001098529	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	ENST00000306084.6	37	CCDS42414.1	.	.	.	.	.	.	.	.	.	.	N	0.017	-1.495062	0.01009	.	.	ENSG00000168454	ENST00000536353;ENST00000357775;ENST00000306084;ENST00000426718	T;T;T	0.16897	2.31;3.18;3.18	3.49	-4.88	0.03113	.	4.221380	0.00834	N	0.001692	T	0.04724	0.0128	N	0.00960	-1.095	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27088	-1.0084	9	.	.	.	.	4.3477	0.11141	0.6098:0.1154:0.1581:0.1167	.	147	Q86VQ3	TXND2_HUMAN	G	80;80;147;147	ENSP00000437393:S80G;ENSP00000350419:S80G;ENSP00000304908:S147G	.	S	+	1	0	TXNDC2	9876915	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.131000	0.03238	-1.591000	0.01621	-0.288000	0.09946	AGT	.		0.567	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
OGFR	11054	hgsc.bcm.edu	37	20	61444660	61444660	+	Missense_Mutation	SNP	C	C	A	rs61743079		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr20:61444660C>A	ENST00000290291.6	+	7	1718	c.1693C>A	c.(1693-1695)Cgc>Agc	p.R565S	OGFR_ENST00000370461.1_Missense_Mutation_p.R513S	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	565	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCCAGGCCCCCGCCCGGCAGG	0.741																																					p.R565S		.											OGFR,NS,neuroblastoma,0,1	OGFR	0	0			c.C1693A						.						3.0	6.0	5.0					20																	61444660		1281	3014	4295	SO:0001583	missense	11054	exon7			GGCCCCCGCCCGG	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1693C>A	20.37:g.61444660C>A	ENSP00000290291:p.Arg565Ser	18	1		28	4	NM_007346	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	A	0.130	-1.114132	0.01799	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.54866	0.55;0.55	1.46	-2.91	0.05631	.	.	.	.	.	T	0.23649	0.0572	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.19031	-1.0318	9	0.11182	T	0.66	.	0.4172	0.00450	0.232:0.1649:0.1659:0.4372	rs61743079	565;548;565	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	S	565;545;400;513	ENSP00000290291:R565S;ENSP00000359491:R513S	ENSP00000290291:R565S	R	+	1	0	OGFR	60915105	0.000000	0.05858	0.002000	0.10522	0.017000	0.09413	-0.466000	0.06672	-1.870000	0.01139	-1.293000	0.01348	CGC	0.019		0.741	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
SLC25A26	115286	hgsc.bcm.edu;bcgsc.ca	37	3	66312519	66312519	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:66312519G>T	ENST00000413054.1	+	2	155	c.81G>T	c.(79-81)agG>agT	p.R27S	SLC25A26_ENST00000484768.1_3'UTR|SLC25A26_ENST00000336733.6_Missense_Mutation_p.R27S|SLC25A26_ENST00000354883.6_Missense_Mutation_p.R115S|SLC25A26_ENST00000536651.1_3'UTR			Q70HW3	SAMC_HUMAN	solute carrier family 25 (S-adenosylmethionine carrier), member 26	115					S-adenosyl-L-methionine transmembrane transport (GO:1901962)|S-adenosyl-L-methionine transport (GO:0015805)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	S-adenosyl-L-methionine transmembrane transporter activity (GO:0000095)			endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)|stomach(2)|urinary_tract(1)	8		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)		TTAAGCAGAGGGCACAGGTAT	0.333																																					p.R115S		.											.	.	.	0			c.G345T						.						70.0	67.0	68.0					3																	66312519		2203	4299	6502	SO:0001583	missense	115286	exon5			GCAGAGGGCACAG	AJ580932	CCDS54604.1, CCDS2905.2	3p14.2	2013-05-22	2012-03-29		ENSG00000144741	ENSG00000144741		"""Solute carriers"""	20661	protein-coding gene	gene with protein product		611037	"""solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 26"""			14674884	Standard	NM_173471		Approved		uc011bfq.2	Q70HW3	OTTHUMG00000149917	ENST00000413054.1:c.81G>T	3.37:g.66312519G>T	ENSP00000415304:p.Arg27Ser	64	0		70	4	NM_173471	A8K758|B3KRZ7|Q7Z786|Q96E68	Missense_Mutation	SNP	ENST00000413054.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	4.000648|4.000648	0.74818|0.74818	.|.	.|.	ENSG00000144741|ENSG00000144741	ENST00000413054|ENST00000354883;ENST00000336733	.|D;D	.|0.84370	.|-1.84;-1.84	5.2|5.2	3.38|3.38	0.38709|0.38709	.|Mitochondrial carrier domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92407|0.92407	0.7590|0.7590	M|M	0.93241|0.93241	3.395|3.395	0.80722|0.80722	D|D	1|1	.|D;D	.|0.61080	.|0.987;0.989	.|P;P	.|0.61722	.|0.828;0.893	D|D	0.92972|0.92972	0.6398|0.6398	5|10	.|0.87932	.|D	.|0	-3.8564|-3.8564	9.8059|9.8059	0.40792|0.40792	0.2204:0.0:0.7796:0.0|0.2204:0.0:0.7796:0.0	.|.	.|115;115	.|F8WAB8;Q70HW3	.|.;SAMC_HUMAN	V|S	52|115;27	.|ENSP00000346955:R115S;ENSP00000336801:R27S	.|ENSP00000336801:R27S	G|R	+|+	2|3	0|2	SLC25A26|SLC25A26	66395209|66395209	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	3.654000|3.654000	0.54453|0.54453	1.325000|1.325000	0.45301|0.45301	-0.258000|-0.258000	0.10820|0.10820	GGG|AGG	.		0.333	SLC25A26-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000313895.2	NM_173471	
FAM71B	153745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	156590618	156590618	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:156590618G>T	ENST00000302938.4	-	2	753	c.658C>A	c.(658-660)Cct>Act	p.P220T		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	220						nucleus (GO:0005634)		p.P220A(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACATCACAAGGCTTGTAGAGC	0.537																																					p.P220T		.											FAM71B,NS,carcinoma,0,1	FAM71B	0	1	Substitution - Missense(1)	lung(1)	c.C658A						.						110.0	109.0	109.0					5																	156590618		2203	4300	6503	SO:0001583	missense	153745	exon2			CACAAGGCTTGTA		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.658C>A	5.37:g.156590618G>T	ENSP00000305596:p.Pro220Thr	22	0		26	7	NM_130899	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	G	0.968	-0.701167	0.03255	.	.	ENSG00000170613	ENST00000302938	T	0.03524	3.9	3.96	-3.04	0.05412	.	2.437060	0.01627	N	0.023339	T	0.02767	0.0083	L	0.34521	1.04	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.40459	-0.9562	10	0.10902	T	0.67	5.8967	1.4698	0.02414	0.4578:0.1468:0.2463:0.1492	.	220	Q8TC56	FA71B_HUMAN	T	220	ENSP00000305596:P220T	ENSP00000305596:P220T	P	-	1	0	FAM71B	156523196	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.129000	0.10515	-0.734000	0.04843	-1.954000	0.00483	CCT	.		0.537	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899	
XKR3	150165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	17288751	17288751	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr22:17288751G>A	ENST00000331428.5	-	2	315	c.213C>T	c.(211-213)atC>atT	p.I71I		NM_175878.3	NP_787074.2	Q5GH77	XKR3_HUMAN	XK, Kell blood group complex subunit-related family, member 3	71						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TAATAAAGCTGATGGTAAATG	0.358																																					p.I71I		.											.	.	.	0			c.C213T						.						93.0	85.0	88.0					22																	17288751		1837	4081	5918	SO:0001819	synonymous_variant	150165	exon2			AAAGCTGATGGTA	AY989815	CCDS42975.1	22q11.1	2007-01-16	2006-01-12		ENSG00000172967	ENSG00000172967			28778	protein-coding gene	gene with protein product		611674	"""X Kell blood group precursor-related family, member 3"""			16431037	Standard	NM_175878		Approved	MGC57211, XTES	uc002zlv.3	Q5GH77	OTTHUMG00000143726	ENST00000331428.5:c.213C>T	22.37:g.17288751G>A		75	0		93	32	NM_175878	B2RPN1|Q52PG8|Q8N7E1	Silent	SNP	ENST00000331428.5	37	CCDS42975.1																																																																																			.		0.358	XKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289789.1	NM_175878	
TDRD10	126668	hgsc.bcm.edu	37	1	154493819	154493819	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:154493819G>T	ENST00000368480.3	+	6	318	c.233G>T	c.(232-234)gGc>gTc	p.G78V	TDRD10_ENST00000368482.4_Missense_Mutation_p.G78V			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	78	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GTAGATCTGGGCTCCATGCAG	0.512																																					p.G78V		.											.	.	.	0			c.G233T						.						127.0	133.0	131.0					1																	154493819		2203	4300	6503	SO:0001583	missense	126668	exon6			ATCTGGGCTCCAT	AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.233G>T	1.37:g.154493819G>T	ENSP00000357465:p.Gly78Val	44	0		37	3	NM_182499	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	ENST00000368480.3	37	CCDS41406.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.789899	0.70337	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	T;T	0.08102	3.13;3.13	3.79	2.77	0.32553	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.	.	.	.	T	0.06188	0.0160	N	0.12422	0.21	0.42933	D	0.994323	D;D	0.76494	0.999;0.999	D;D	0.71870	0.975;0.958	T	0.33111	-0.9881	9	0.54805	T	0.06	-2.7434	8.6088	0.33789	0.0:0.237:0.763:0.0	.	78;78	Q5VZ19;Q5VZ19-2	TDR10_HUMAN;.	V	78	ENSP00000357467:G78V;ENSP00000357465:G78V	ENSP00000357465:G78V	G	+	2	0	TDRD10	152760443	0.999000	0.42202	0.992000	0.48379	0.489000	0.33432	1.204000	0.32296	2.106000	0.64143	0.557000	0.71058	GGC	.		0.512	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499	
TENM3	55714	hgsc.bcm.edu	37	4	183714515	183714515	+	Silent	SNP	C	C	T	rs369647107		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr4:183714515C>T	ENST00000511685.1	+	26	6813	c.6690C>T	c.(6688-6690)gaC>gaT	p.D2230D	TENM3_ENST00000406950.2_Silent_p.D2230D			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2230					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ACCGTTATGACGGCCTGGGAA	0.458																																					p.D2230D		.											ODZ3,NS,carcinoma,0,1	ODZ3	0	0			c.C6690T						.	C		1,3787		0,1,1893	80.0	82.0	81.0		6690	-8.1	0.0	4		81	0,8246		0,0,4123	no	coding-synonymous	ODZ3	NM_001080477.1		0,1,6016	TT,TC,CC		0.0,0.0264,0.0083		2230/2700	183714515	1,12033	1894	4123	6017	SO:0001819	synonymous_variant	55714	exon25			TTATGACGGCCTG	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.6690C>T	4.37:g.183714515C>T		25	0		36	3	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	ENST00000511685.1	37	CCDS47165.1																																																																																			.		0.458	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
ZFP69	339559	hgsc.bcm.edu;bcgsc.ca	37	1	40945074	40945074	+	Missense_Mutation	SNP	G	G	A	rs370110368		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:40945074G>A	ENST00000372706.1	+	2	1047	c.41G>A	c.(40-42)aGc>aAc	p.S14N	ZFP69_ENST00000372705.3_Missense_Mutation_p.S14N			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	14	SCAN box.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ACCGAGGCCAGCACCTGGGTG	0.552																																					p.S14N		.											.	.	.	0			c.G41A						.	G	ASN/SER	0,4406		0,0,2203	73.0	72.0	72.0		41	1.8	0.6	1		72	1,8599		0,1,4299	no	missense	ZNF642	NM_198494.2	46	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	14/527	40945074	1,13005	2203	4300	6503	SO:0001583	missense	339559	exon2			AGGCCAGCACCTG	AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.41G>A	1.37:g.40945074G>A	ENSP00000361791:p.Ser14Asn	27	0		39	4	NM_198494	Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	ENST00000372706.1	37	CCDS30686.1	.	.	.	.	.	.	.	.	.	.	.	12.46	1.945308	0.34377	0.0	1.16E-4	ENSG00000187815	ENST00000372706;ENST00000372705	T;T	0.05513	3.43;3.43	3.69	1.81	0.25067	.	0.768823	0.11121	N	0.597477	T	0.07279	0.0184	M	0.63428	1.95	0.19775	N	0.999957	B	0.06786	0.001	B	0.04013	0.001	T	0.40590	-0.9555	10	0.21540	T	0.41	-9.0E-4	5.8515	0.18696	0.242:0.0:0.758:0.0	.	14	Q49AA0	ZN642_HUMAN	N	14	ENSP00000361791:S14N;ENSP00000361790:S14N	ENSP00000361790:S14N	S	+	2	0	ZNF642	40717661	0.991000	0.36638	0.621000	0.29145	0.922000	0.55478	1.765000	0.38481	0.542000	0.28846	-0.140000	0.14226	AGC	.		0.552	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019082.1	NM_198494	
LRRIQ3	127255	hgsc.bcm.edu;bcgsc.ca	37	1	74648427	74648427	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:74648427G>T	ENST00000395089.1	-	2	367	c.368C>A	c.(367-369)aCc>aAc	p.T123N	LRRIQ3_ENST00000370911.3_Missense_Mutation_p.T123N|LRRIQ3_ENST00000354431.4_Missense_Mutation_p.T123N|LRRIQ3_ENST00000370909.2_Intron			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	123										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						GGCAATGAGGGTTGGACAGGC	0.368																																					p.T123N		.											.	.	.	0			c.C368A						.						102.0	96.0	98.0					1																	74648427		2203	4300	6503	SO:0001583	missense	127255	exon3			ATGAGGGTTGGAC	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.368C>A	1.37:g.74648427G>T	ENSP00000378524:p.Thr123Asn	90	0		100	4	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	G	6.578	0.475006	0.12521	.	.	ENSG00000162620	ENST00000395089;ENST00000354431;ENST00000388972;ENST00000370911	T;T;T	0.12672	3.26;3.26;2.66	5.65	-6.14	0.02111	.	1.005240	0.08001	N	0.988834	T	0.00724	0.0024	N	0.01048	-1.04	0.18873	N	0.999988	B	0.02656	0.0	B	0.01281	0.0	T	0.46048	-0.9219	10	0.06494	T	0.89	.	7.6004	0.28073	0.0:0.3986:0.2132:0.3882	.	123	A6PVS8	LRIQ3_HUMAN	N	123	ENSP00000378524:T123N;ENSP00000346414:T123N;ENSP00000359948:T123N	ENSP00000346414:T123N	T	-	2	0	LRRIQ3	74421015	0.014000	0.17966	0.255000	0.24374	0.975000	0.68041	-0.189000	0.09629	-1.574000	0.01657	-1.072000	0.02254	ACC	.		0.368	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
C2orf42	54980	hgsc.bcm.edu	37	2	70392715	70392715	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:70392715C>T	ENST00000264434.2	-	7	1576	c.1197G>A	c.(1195-1197)ctG>ctA	p.L399L	C2orf42_ENST00000420306.1_Silent_p.L399L	NM_017880.1	NP_060350.1	Q9NWW7	CB042_HUMAN	chromosome 2 open reading frame 42	399										endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	12						TTCTTTGTTGCAGGGCATCAA	0.418																																					p.L399L		.											.	.	.	0			c.G1197A						.						95.0	98.0	97.0					2																	70392715		2203	4300	6503	SO:0001819	synonymous_variant	54980	exon7			TTGTTGCAGGGCA	AK000565	CCDS1899.1	2p14	2011-03-08			ENSG00000115998	ENSG00000115998			26056	protein-coding gene	gene with protein product						12477932	Standard	XM_005264389		Approved	FLJ20558	uc002sgh.3	Q9NWW7	OTTHUMG00000129642	ENST00000264434.2:c.1197G>A	2.37:g.70392715C>T		77	0		101	4	NM_017880	D6W5G3|Q9H629	Silent	SNP	ENST00000264434.2	37	CCDS1899.1																																																																																			.		0.418	C2orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251840.1	NM_017880	
MAML3	55534	hgsc.bcm.edu	37	4	140811120	140811120	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr4:140811120C>T	ENST00000509479.2	-	2	2326	c.1470G>A	c.(1468-1470)caG>caA	p.Q490Q	MAML3_ENST00000327122.5_Silent_p.Q334Q|MAML3_ENST00000398940.1_Silent_p.Q29Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgttgctgtt	0.547																																					p.Q490Q		.											MAML3_ENST00000509479,colon,carcinoma,0,2	MAML3_ENST00000509479	0	0			c.G1470A						.						16.0	20.0	19.0					4																	140811120		2194	4290	6484	SO:0001819	synonymous_variant	55534	exon2			CTGCTGCTGTTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1470G>A	4.37:g.140811120C>T		14	0		14	3	NM_018717		Silent	SNP	ENST00000509479.2	37	CCDS54805.1																																																																																			.		0.547	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
ERICH6	131831	hgsc.bcm.edu	37	3	150421519	150421519	+	Missense_Mutation	SNP	A	A	T	rs573303855	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:150421519A>T	ENST00000295910.6	-	1	219	c.167T>A	c.(166-168)gTg>gAg	p.V56E	RP11-103G8.2_ENST00000475393.1_RNA|RP11-103G8.2_ENST00000471093.1_RNA|FAM194A_ENST00000491361.1_Intron	NM_152394.3	NP_689607.2												p.V56E(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ctcctcctccaccacctcctc	0.607													A|||	41	0.0081869	0.0091	0.0144	5008	,	,		1681	0.0069		0.0089	False		,,,				2504	0.0031				p.V56E		.											FAM194A,NS,carcinoma,0,1	FAM194A	0	1	Substitution - Missense(1)	endometrium(1)	c.T167A						.						198.0	156.0	171.0					3																	150421519		2203	4299	6502	SO:0001583	missense	131831	exon1			TCCTCCACCACCT																												ENST00000295910.6:c.167T>A	3.37:g.150421519A>T	ENSP00000295910:p.Val56Glu	10	1		12	3	NM_152394		Missense_Mutation	SNP	ENST00000295910.6	37	CCDS3151.2	.	.	.	.	.	.	.	.	.	.	A	4.695	0.129296	0.08981	.	.	ENSG00000163645	ENST00000295910	T	0.13538	2.58	3.11	-4.8	0.03190	.	1.710190	0.03876	N	0.276462	T	0.04318	0.0119	N	0.08118	0	0.09310	N	0.999994	B	0.02656	0.0	B	0.01281	0.0	T	0.29181	-1.0020	10	0.02654	T	1	-0.1027	0.7864	0.01049	0.1614:0.2002:0.316:0.3224	.	56	Q7L0X2	F194A_HUMAN	E	56	ENSP00000295910:V56E	ENSP00000295910:V56E	V	-	2	0	FAM194A	151904209	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.158000	0.03153	-0.978000	0.03533	-0.472000	0.04984	GTG	.		0.607	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1		
NWD1	284434	hgsc.bcm.edu	37	19	16855309	16855309	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:16855309C>T	ENST00000552788.1	+	3	276	c.276C>T	c.(274-276)gaC>gaT	p.D92D	NWD1_ENST00000524140.2_Silent_p.D92D|NWD1_ENST00000523826.1_5'UTR|NWD1_ENST00000379808.3_Silent_p.D92D|NWD1_ENST00000339803.6_5'Flank|NWD1_ENST00000549814.1_Silent_p.D92D			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	92							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TATTGAGGGACCATCTGACTG	0.582																																					p.D92D		.											.	.	.	0			c.C276T						.																																			SO:0001819	synonymous_variant	284434	exon5			GAGGGACCATCTG	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.276C>T	19.37:g.16855309C>T		33	0		52	4	NM_001007525	C9J021|Q68CT3	Silent	SNP	ENST00000552788.1	37																																																																																				.		0.582	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
PCSK1	5122	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	95746636	95746636	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:95746636G>T	ENST00000311106.3	-	8	1174	c.937C>A	c.(937-939)Cag>Aag	p.Q313K	PCSK1_ENST00000508626.1_Missense_Mutation_p.Q266K|CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000513085.1_Intron	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	313	Peptidase S8.				cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTATCTCCCTGACGCCCCCCG	0.527																																					p.Q313K		.											.	.	.	0			c.C937A						.						193.0	177.0	182.0					5																	95746636		2203	4300	6503	SO:0001583	missense	5122	exon8			CTCCCTGACGCCC		CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.937C>A	5.37:g.95746636G>T	ENSP00000308024:p.Gln313Lys	53	0		65	4	NM_000439	B7Z8T7|E9PHA1|P78478|Q92532	Missense_Mutation	SNP	ENST00000311106.3	37	CCDS4081.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.754408	0.49362	.	.	ENSG00000175426	ENST00000311106;ENST00000508626	D;D	0.87179	-2.22;-2.22	5.62	5.62	0.85841	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.74390	0.3710	N	0.02830	-0.485	0.58432	D	0.999993	B	0.25850	0.136	B	0.26094	0.066	T	0.70479	-0.4860	10	0.23891	T	0.37	-14.7685	19.2542	0.93940	0.0:0.0:1.0:0.0	.	313	P29120	NEC1_HUMAN	K	313;266	ENSP00000308024:Q313K;ENSP00000421600:Q266K	ENSP00000308024:Q313K	Q	-	1	0	PCSK1	95772392	1.000000	0.71417	0.981000	0.43875	0.941000	0.58515	5.827000	0.69300	2.631000	0.89168	0.650000	0.86243	CAG	.		0.527	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242851.1	NM_000439	
F12	2161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176832069	176832069	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:176832069C>T	ENST00000253496.3	-	6	563	c.515G>A	c.(514-516)cGg>cAg	p.R172Q	F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	172	Fibronectin type-I. {ECO:0000255|PROSITE- ProRule:PRU00478}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	GCTGGCCAGCCGCTGGCAGTG	0.607									Hereditary Angioedema																												p.R172Q		.											.	.	.	0			c.G515A						.						26.0	27.0	27.0					5																	176832069		2203	4300	6503	SO:0001583	missense	2161	exon6	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	GCCAGCCGCTGGC	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.515G>A	5.37:g.176832069C>T	ENSP00000253496:p.Arg172Gln	26	0		29	7	NM_000505	P78339	Missense_Mutation	SNP	ENST00000253496.3	37	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	C	1.736	-0.492891	0.04322	.	.	ENSG00000131187	ENST00000253496	D	0.88741	-2.42	5.86	-11.7	0.00046	Fibronectin, type I (2);	1.705140	0.03267	N	0.184168	T	0.67382	0.2887	N	0.05383	-0.06	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.61272	-0.7096	10	0.13108	T	0.6	.	1.0401	0.01557	0.3898:0.2326:0.1762:0.2015	.	172	P00748	FA12_HUMAN	Q	172	ENSP00000253496:R172Q	ENSP00000253496:R172Q	R	-	2	0	F12	176764675	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.747000	0.01827	-3.490000	0.00153	-3.265000	0.00048	CGG	.		0.607	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
OR8K3	219473	hgsc.bcm.edu	37	11	56086520	56086520	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr11:56086520G>A	ENST00000312711.1	+	1	738	c.738G>A	c.(736-738)gtG>gtA	p.V246V		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					ACCTGACAGTGGTCATAGTGT	0.448																																					p.V246V		.											OR8K3,caecum,carcinoma,0,1	OR8K3	0	0			c.G738A						.						103.0	95.0	98.0					11																	56086520		2201	4296	6497	SO:0001819	synonymous_variant	219473	exon1			GACAGTGGTCATA	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.738G>A	11.37:g.56086520G>A		33	0		43	2	NM_001005202	Q6IFC4	Silent	SNP	ENST00000312711.1	37	CCDS31527.1																																																																																			.		0.448	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202	
WDR60	55112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	158704268	158704268	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr7:158704268C>T	ENST00000407559.3	+	12	1646	c.1488C>T	c.(1486-1488)ctC>ctT	p.L496L		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	496					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		TGCTTCGGCTCATTGACTTAG	0.343																																					p.L496L		.											.	.	.	0			c.C1488T						.						103.0	94.0	97.0					7																	158704268		1818	4081	5899	SO:0001819	synonymous_variant	55112	exon12			TCGGCTCATTGAC		CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.1488C>T	7.37:g.158704268C>T		51	0		76	30	NM_018051	Q9NW58	Silent	SNP	ENST00000407559.3	37	CCDS47757.1																																																																																			.		0.343	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	NM_018051	
KIR3DX1	90011	hgsc.bcm.edu	37	19	55044296	55044296	+	Splice_Site	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:55044296G>T	ENST00000335056.3	+	2	107	c.69G>T	c.(67-69)gcG>gcT	p.A23A				Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1	23	Ig-like C2-type 1.					extracellular region (GO:0005576)		p.A23A(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		GCCCACATGCGGGTGAGTCCT	0.473																																					.	Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)	.											KIR3DX1,NS,carcinoma,+1,1	KIR3DX1	+1	1	Substitution - coding silent(1)	lung(1)	.						.						95.0	95.0	95.0					19																	55044296		1940	4150	6090	SO:0001630	splice_region_variant	90011	.			ACATGCGGGTGAG	BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.70+1G>T	19.37:g.55044296G>T		17	0		24	2	.	B7WNL0|Q8N0S4	RNA	SNP	ENST00000335056.3	37																																																																																				.		0.473	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000140800.2	NR_026716	Silent
DCHS2	54798	hgsc.bcm.edu	37	4	155312413	155312413	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr4:155312413C>A	ENST00000357232.4	-	1	36	c.37G>T	c.(37-39)Gac>Tac	p.D13Y	DCHS2_ENST00000339452.1_Intron	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	13					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ttttctccgtcttcattctct	0.373																																					p.D13Y		.											DCHS2,right_upper_lobe,carcinoma,0,1	DCHS2	0	0			c.G37T						.						179.0	153.0	161.0					4																	155312413		2202	4299	6501	SO:0001583	missense	54798	exon1			CTCCGTCTTCATT	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.37G>T	4.37:g.155312413C>A	ENSP00000349768:p.Asp13Tyr	46	0		39	2	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	6.735	0.504325	0.12822	.	.	ENSG00000197410	ENST00000357232	T	0.56444	0.46	3.27	0.463	0.16700	.	3.135340	0.01445	U	0.015266	T	0.28300	0.0699	N	0.08118	0	0.09310	N	0.999999	P	0.46277	0.875	B	0.35353	0.201	T	0.26224	-1.0109	10	0.72032	D	0.01	.	2.5725	0.04798	0.232:0.5047:0.0:0.2633	.	13	Q6V1P9	PCD23_HUMAN	Y	13	ENSP00000349768:D13Y	ENSP00000349768:D13Y	D	-	1	0	DCHS2	155531863	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	-0.399000	0.07250	0.046000	0.15833	-0.293000	0.09583	GAC	.		0.373	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
SLC15A5	729025	hgsc.bcm.edu;bcgsc.ca	37	12	16369928	16369928	+	Missense_Mutation	SNP	C	C	T	rs532654837		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:16369928C>T	ENST00000344941.3	-	7	1381	c.1382G>A	c.(1381-1383)aGc>aAc	p.S461N		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	461					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						TCTGACATTGCTTGGAACAAA	0.388													C|||	1	0.000199681	0.0	0.0	5008	,	,		16865	0.0		0.0	False		,,,				2504	0.001				p.S461N		.											.	.	.	0			c.G1382A						.						75.0	62.0	66.0					12																	16369928		692	1591	2283	SO:0001583	missense	729025	exon7			ACATTGCTTGGAA			12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.1382G>A	12.37:g.16369928C>T	ENSP00000340402:p.Ser461Asn	47	0		61	4	NM_001170798		Missense_Mutation	SNP	ENST00000344941.3	37		.	.	.	.	.	.	.	.	.	.	C	5.494	0.276123	0.10403	.	.	ENSG00000188991	ENST00000344941	T	0.59083	0.29	4.94	3.05	0.35203	.	0.615588	0.18339	N	0.144254	T	0.45316	0.1336	L	0.27053	0.805	0.09310	N	1	.	.	.	.	.	.	T	0.33394	-0.9870	8	0.42905	T	0.14	.	7.5208	0.27626	0.0:0.6527:0.0:0.3473	.	.	.	.	N	461	ENSP00000340402:S461N	ENSP00000340402:S461N	S	-	2	0	SLC15A5	16261195	0.036000	0.19791	0.100000	0.21137	0.708000	0.40852	0.259000	0.18405	0.733000	0.32492	0.650000	0.86243	AGC	.		0.388	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000401119.2	XM_001129090	
VCPIP1	80124	hgsc.bcm.edu	37	8	67577658	67577658	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr8:67577658C>A	ENST00000310421.4	-	1	1794	c.1536G>T	c.(1534-1536)ttG>ttT	p.L512F	C8orf44_ENST00000521889.1_5'Flank|C8orf44-SGK3_ENST00000519289.1_5'Flank|C8orf44_ENST00000519561.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	512					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			CCAAATTGTTCAAGGGAAAGC	0.428																																					p.L512F	NSCLC(179;265 2915 6144 43644)	.											VCPIP1,NS,carcinoma,0,1	VCPIP1	0	0			c.G1536T						.						168.0	176.0	173.0					8																	67577658		2203	4300	6503	SO:0001583	missense	80124	exon1			ATTGTTCAAGGGA	AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.1536G>T	8.37:g.67577658C>A	ENSP00000309031:p.Leu512Phe	49	0		49	2	NM_025054	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	ENST00000310421.4	37	CCDS6192.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.418358	0.25552	.	.	ENSG00000175073	ENST00000310421	T	0.37058	1.22	5.29	4.4	0.53042	.	0.000000	0.64402	D	0.000001	T	0.44603	0.1301	L	0.48362	1.52	0.48975	D	0.999731	D	0.69078	0.997	P	0.60789	0.879	T	0.36866	-0.9730	10	0.52906	T	0.07	-4.8635	7.0782	0.25217	0.2958:0.6238:0.0:0.0804	.	512	Q96JH7	VCIP1_HUMAN	F	512	ENSP00000309031:L512F	ENSP00000309031:L512F	L	-	3	2	VCPIP1	67740212	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.637000	0.24659	1.190000	0.43042	0.655000	0.94253	TTG	.		0.428	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379227.1		
UFC1	51506	hgsc.bcm.edu	37	1	161123896	161123896	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:161123896C>T	ENST00000368003.5	+	1	355	c.109C>T	c.(109-111)Cag>Tag	p.Q37*	RP11-297K8.2_ENST00000420498.1_RNA|UFC1_ENST00000473766.1_3'UTR	NM_016406.3	NP_057490.2	Q9Y3C8	UFC1_HUMAN	ubiquitin-fold modifier conjugating enzyme 1	37					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	extracellular vesicular exosome (GO:0070062)	UFM1 conjugating enzyme activity (GO:0071568)			endometrium(1)|lung(9)	10	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GGAGGAATATCAGTCCCTTAT	0.532																																					p.Q37X		.											.	.	.	0			c.C109T						.						183.0	160.0	168.0					1																	161123896		2203	4300	6503	SO:0001587	stop_gained	51506	exon1			GAATATCAGTCCC	AF161504	CCDS1220.1	1q23.3	2008-02-05			ENSG00000143222	ENSG00000143222			26941	protein-coding gene	gene with protein product		610554				15071506, 11042152	Standard	NM_016406		Approved	HSPC155	uc001fyd.4	Q9Y3C8	OTTHUMG00000033155	ENST00000368003.5:c.109C>T	1.37:g.161123896C>T	ENSP00000356982:p.Gln37*	43	0		82	4	NM_016406	A8K9R1|D3DVF9|Q549X0|Q5VTX1|Q9BS96|Q9P009	Nonsense_Mutation	SNP	ENST00000368003.5	37	CCDS1220.1	.	.	.	.	.	.	.	.	.	.	C	38	6.715298	0.97784	.	.	ENSG00000143222	ENST00000368003	.	.	.	5.98	5.98	0.97165	.	0.068638	0.56097	D	0.000022	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.9977	19.289	0.94090	0.0:1.0:0.0:0.0	.	.	.	.	X	37	.	ENSP00000356982:Q37X	Q	+	1	0	UFC1	159390520	1.000000	0.71417	0.999000	0.59377	0.694000	0.40290	4.083000	0.57643	2.852000	0.98041	0.644000	0.83932	CAG	.		0.532	UFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080810.1	NM_016406	
ASB16	92591	hgsc.bcm.edu	37	17	42248325	42248325	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:42248325C>T	ENST00000293414.1	+	1	252	c.168C>T	c.(166-168)tgC>tgT	p.C56C		NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	56					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		ACCGTTCCTGCCGAGACCCAG	0.662																																					p.C56C		.											.	.	.	0			c.C168T						.						27.0	25.0	25.0					17																	42248325		2203	4300	6503	SO:0001819	synonymous_variant	92591	exon1			TTCCTGCCGAGAC	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.168C>T	17.37:g.42248325C>T		59	0		80	3	NM_080863	B2RBC0|Q8WXK0	Silent	SNP	ENST00000293414.1	37	CCDS11478.1																																																																																			.		0.662	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
TPTE2	93492	hgsc.bcm.edu	37	13	20056679	20056679	+	Missense_Mutation	SNP	T	T	G	rs200244531		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr13:20056679T>G	ENST00000400230.2	-	4	172	c.128A>C	c.(127-129)gAa>gCa	p.E43A	TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000382978.1_Missense_Mutation_p.E43A|TPTE2_ENST00000382975.4_Missense_Mutation_p.E43A|TPTE2_ENST00000457266.2_Missense_Mutation_p.E43A|TPTE2_ENST00000382977.4_Missense_Mutation_p.E43A|TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000400103.2_Missense_Mutation_p.E43A			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	43					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E43A(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		GGAAAGTCGTTCTAACATACT	0.313																																					p.E43A		.											TPTE2_ENST00000400230,NS,carcinoma,0,1	TPTE2_ENST00000400230	0	1	Substitution - Missense(1)	kidney(1)	c.A128C						.						52.0	51.0	51.0					13																	20056679		2201	4299	6500	SO:0001583	missense	93492	exon5			AGTCGTTCTAACA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.128A>C	13.37:g.20056679T>G	ENSP00000383089:p.Glu43Ala	57	0		78	4	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	2.387	-0.340821	0.05243	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94931	-3.56;-3.53;-3.47;-3.47;-3.56;-3.53	2.06	0.858	0.19030	.	0.878504	0.09602	U	0.780065	D	0.86159	0.5866	N	0.21448	0.665	0.09310	N	1	B;B	0.28850	0.225;0.0	B;B	0.19946	0.027;0.0	T	0.74598	-0.3612	9	.	.	.	-0.5937	3.8365	0.08896	0.0:0.192:0.0:0.808	.	43;43	A8MX64;Q6XPS3	.;TPTE2_HUMAN	A	43	ENSP00000372438:E43A;ENSP00000382974:E43A;ENSP00000383089:E43A;ENSP00000372437:E43A;ENSP00000372435:E43A;ENSP00000442218:E43A	.	E	-	2	0	TPTE2	18954679	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.422000	0.21296	0.241000	0.21283	0.383000	0.25322	GAA	.		0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
GSDMC	56169	hgsc.bcm.edu	37	8	130777904	130777904	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr8:130777904C>T	ENST00000276708.4	-	4	1421	c.540G>A	c.(538-540)ggG>ggA	p.G180G		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	180						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						GAGCAATTTTCCCTAAAATAT	0.438																																					p.G180G		.											GSDMC,NS,malignant_melanoma,0,2	GSDMC	0	0			c.G540A						.						116.0	116.0	116.0					8																	130777904		2203	4300	6503	SO:0001819	synonymous_variant	56169	exon4			AATTTTCCCTAAA	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.540G>A	8.37:g.130777904C>T		46	0		47	2	NM_031415	Q5XKF3|Q6P494	Silent	SNP	ENST00000276708.4	37	CCDS6360.1																																																																																			.		0.438	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380586.1		
GUSBP2	387036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	26892922	26892922	+	RNA	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:26892922G>A	ENST00000463434.1	-	0	70									glucuronidase, beta pseudogene 2																		GTCTAAGGCTGGTTTTACAGG	0.378																																					.		.											.	.	.	0			.						.																																					387036	.			AAGGCTGGTTTTA			6p21	2011-06-09	2011-06-09	2011-06-09	ENSG00000241549	ENSG00000241549			18792	pseudogene	pseudogene			"""spinal muscular atrophy candidate gene 3-like 2"", ""glucuronidase, beta-like 1"""	SMAC3L2, GUSBL1			Standard	NR_003504		Approved	bA239L20.5, bA239L20.1, SMA3-L, bGLU-Lp, SMAC3L	uc003nim.2		OTTHUMG00000014462		6.37:g.26892922G>A		232	0		285	101	.		RNA	SNP	ENST00000463434.1	37																																																																																				.		0.378	GUSBP2-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000314060.1		
LRRIQ1	84125	hgsc.bcm.edu;bcgsc.ca	37	12	85547524	85547524	+	Missense_Mutation	SNP	T	T	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:85547524T>A	ENST00000393217.2	+	22	4686	c.4625T>A	c.(4624-4626)aTt>aAt	p.I1542N		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1542										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GAAAAAAAAATTTCAGAAGAA	0.284																																					p.I1542N		.											LRRIQ1_ENST00000393217,caecum,carcinoma,0,1	LRRIQ1_ENST00000393217	0	0			c.T4625A						.						17.0	15.0	15.0					12																	85547524		1765	4034	5799	SO:0001583	missense	84125	exon22			AAAAAATTTCAGA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4625T>A	12.37:g.85547524T>A	ENSP00000376910:p.Ile1542Asn	58	0		74	5	NM_001079910	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	T	16.63	3.177568	0.57692	.	.	ENSG00000133640	ENST00000393217	T	0.62105	0.05	5.66	5.66	0.87406	.	.	.	.	.	T	0.69655	0.3135	L	0.27053	0.805	0.38326	D	0.943667	D	0.89917	1.0	D	0.87578	0.998	T	0.75994	-0.3121	9	0.87932	D	0	.	15.8939	0.79322	0.0:0.0:0.0:1.0	.	1542	Q96JM4	LRIQ1_HUMAN	N	1542	ENSP00000376910:I1542N	ENSP00000376910:I1542N	I	+	2	0	LRRIQ1	84071655	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.657000	0.67996	2.137000	0.66172	0.528000	0.53228	ATT	.		0.284	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
WDR90	197335	hgsc.bcm.edu	37	16	703802	703802	+	Splice_Site	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:703802C>T	ENST00000293879.4	+	13	1436	c.1436C>T	c.(1435-1437)aCg>aTg	p.T479M	WDR90_ENST00000549091.1_Splice_Site_p.T479M|LA16c-349E10.1_ENST00000573609.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90	479								p.T479M(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CACGGGAGGACGGTAACAGGG	0.627																																					p.T479M		.											WDR90,bladder,carcinoma,0,1	WDR90	0	1	Substitution - Missense(1)	urinary_tract(1)	c.C1436T						.						34.0	40.0	38.0					16																	703802		1988	4157	6145	SO:0001630	splice_region_variant	197335	exon13			GGAGGACGGTAAC	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.1437+1C>T	16.37:g.703802C>T		29	0		38	2	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.438148	0.43326	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.31247	1.53;1.5	4.74	3.79	0.43588	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.64402	U	0.000004	T	0.35508	0.0934	M	0.83692	2.655	0.80722	D	1	D;D;D	0.64830	0.969;0.994;0.958	B;B;B	0.40602	0.329;0.334;0.242	T	0.41179	-0.9523	10	0.46703	T	0.11	.	11.6224	0.51126	0.0:0.9116:0.0:0.0884	.	479;480;479	Q96KV7;C9JMK1;Q96KV7-3	WDR90_HUMAN;.;.	M	479	ENSP00000448122:T479M;ENSP00000293879:T479M	ENSP00000293879:T479M	T	+	2	0	WDR90	643803	0.864000	0.29904	0.998000	0.56505	0.906000	0.53458	1.844000	0.39269	0.986000	0.38683	0.561000	0.74099	ACG	.		0.627	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	Missense_Mutation
ADRA2A	150	hgsc.bcm.edu	37	10	112838890	112838890	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr10:112838890G>T	ENST00000280155.2	+	1	2101	c.1136G>T	c.(1135-1137)gGg>gTg	p.G379V		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	364					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CGCTGGCGCGGGCGGCAGAAC	0.726																																					p.G379V	Esophageal Squamous(173;605 2658 7278 49362)	.											ADRA2A,NS,carcinoma,+1,1	ADRA2A	+1	0			c.G1136T						.						75.0	63.0	67.0					10																	112838890		2202	4300	6502	SO:0001583	missense	150	exon1			GGCGCGGGCGGCA	AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.1136G>T	10.37:g.112838890G>T	ENSP00000280155:p.Gly379Val	9	0		9	2	NM_000681	B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Missense_Mutation	SNP	ENST00000280155.2	37	CCDS7569.2	.	.	.	.	.	.	.	.	.	.	G	11.33	1.607587	0.28623	.	.	ENSG00000150594	ENST00000280155	T	0.43688	0.94	3.53	3.53	0.40419	GPCR, rhodopsin-like superfamily (1);	0.710624	0.12830	U	0.435694	T	0.39682	0.1087	N	0.05230	-0.09	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.09640	-1.0665	10	0.11182	T	0.66	.	13.7658	0.62995	0.0:0.0:1.0:0.0	.	364	P08913	ADA2A_HUMAN	V	379	ENSP00000280155:G379V	ENSP00000280155:G379V	G	+	2	0	ADRA2A	112828880	0.997000	0.39634	1.000000	0.80357	0.936000	0.57629	1.049000	0.30392	1.932000	0.55993	0.462000	0.41574	GGG	.		0.726	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050372.2	NM_000681	
C1RL	51279	hgsc.bcm.edu	37	12	7261802	7261802	+	5'UTR	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:7261802G>T	ENST00000266542.4	-	0	67				C1RL_ENST00000545280.1_5'Flank|C1RL-AS1_ENST00000536679.1_RNA|C1RL-AS1_ENST00000435921.2_RNA|C1RL-AS1_ENST00000382215.3_RNA|C1RL-AS1_ENST00000541775.1_RNA|C1RL_ENST00000545337.1_5'UTR|C1RL_ENST00000544702.1_5'UTR	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like						complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TGGGACCTGCGAGAGAACTGG	0.547											OREG0021648	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	.	.	0			.						.						24.0	21.0	22.0					12																	7261802		2203	4300	6503	SO:0001623	5_prime_UTR_variant	51279	.			ACCTGCGAGAGAA	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.-26C>A	12.37:g.7261802G>T		21	0	640	25	5	.	Q53GX9	RNA	SNP	ENST00000266542.4	37	CCDS8573.1																																																																																			.		0.547	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398367.1	NM_016546	
NOS1	4842	hgsc.bcm.edu	37	12	117691478	117691478	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:117691478G>T	ENST00000338101.4	-	17	2719	c.2715C>A	c.(2713-2715)gaC>gaA	p.D905E	NOS1_ENST00000317775.6_Missense_Mutation_p.D871E|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.D871E(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TCTCAAAGTTGTCTCTGAGGT	0.557																																					p.D905E	Esophageal Squamous(162;1748 2599 51982 52956)	.											NOS1,NS,carcinoma,0,1	NOS1	0	1	Substitution - Missense(1)	breast(1)	c.C2715A						.						87.0	92.0	91.0					12																	117691478		2130	4245	6375	SO:0001583	missense	4842	exon18			AAAGTTGTCTCTG		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.2715C>A	12.37:g.117691478G>T	ENSP00000337459:p.Asp905Glu	28	0		27	2	NM_001204218		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036957	0.54896	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.58060	0.36;0.36	4.84	4.84	0.62591	Flavodoxin/nitric oxide synthase (2);	0.228724	0.45361	D	0.000372	T	0.55210	0.1906	M	0.73217	2.22	0.80722	D	1	P	0.36183	0.542	B	0.41135	0.348	T	0.54490	-0.8286	10	0.32370	T	0.25	-35.9197	12.5465	0.56203	0.0799:0.0:0.9201:0.0	.	871	P29475	NOS1_HUMAN	E	766;871;871;905	ENSP00000320758:D871E;ENSP00000337459:D905E	ENSP00000320758:D871E	D	-	3	2	NOS1	116175861	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.807000	0.55591	2.524000	0.85096	0.655000	0.94253	GAC	.		0.557	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
OSGIN1	29948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	83998838	83998838	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:83998838C>A	ENST00000343939.2	+	7	1292	c.909C>A	c.(907-909)ttC>ttA	p.F303L	OSGIN1_ENST00000361711.3_Missense_Mutation_p.F220L|OSGIN1_ENST00000393306.1_Missense_Mutation_p.F220L			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	303					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						GCCCCCTCTTCCAGGTGAGCG	0.677																																					p.F220L		.											.	.	.	0			c.C660A						.						51.0	59.0	56.0					16																	83998838		2200	4300	6500	SO:0001583	missense	29948	exon6			CCTCTTCCAGGTG	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.909C>A	16.37:g.83998838C>A	ENSP00000343376:p.Phe303Leu	31	0		33	15	NM_182981	Q52M33|Q86UQ1|Q96S88|Q9BZ70	Missense_Mutation	SNP	ENST00000343939.2	37		.	.	.	.	.	.	.	.	.	.	C	12.45	1.941417	0.34283	.	.	ENSG00000140961	ENST00000343939;ENST00000361711;ENST00000393306	T;T;T	0.21031	3.01;2.03;2.03	4.8	3.85	0.44370	.	0.101272	0.64402	D	0.000001	T	0.22360	0.0539	L	0.50333	1.59	0.80722	D	1	P	0.44195	0.828	B	0.43950	0.437	T	0.01587	-1.1318	10	0.62326	D	0.03	-1.62	8.6559	0.34062	0.0:0.8032:0.0:0.1968	.	303	Q9UJX0	OSGI1_HUMAN	L	303;220;220	ENSP00000343376:F303L;ENSP00000355374:F220L;ENSP00000376983:F220L	ENSP00000343376:F303L	F	+	3	2	OSGIN1	82556339	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	0.971000	0.29396	1.015000	0.39444	0.467000	0.42956	TTC	.		0.677	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	NM_013370	
MCM8	84515	hgsc.bcm.edu;ucsc.edu	37	20	5974195	5974195	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr20:5974195G>T	ENST00000378896.3	+	18	2661	c.2284G>T	c.(2284-2286)Gag>Tag	p.E762*	MCM8_ENST00000378883.1_Nonsense_Mutation_p.E715*|MCM8_ENST00000265187.4_Nonsense_Mutation_p.E746*|MCM8_ENST00000378886.2_Nonsense_Mutation_p.E802*	NM_001281520.1|NM_032485.4|NM_182802.1	NP_001268449.1|NP_115874.3|NP_877954.1	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	762					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)|G1/S transition of mitotic cell cycle (GO:0000082)|male gamete generation (GO:0048232)|mitotic cell cycle (GO:0000278)	MCM8-MCM9 complex (GO:0097362)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	23						CCTAGATTTTGAGCGATCCCA	0.363																																					p.E762X		.											.	.	.	0			c.G2284T						.						78.0	82.0	81.0					20																	5974195		2203	4300	6503	SO:0001587	stop_gained	84515	exon18			GATTTTGAGCGAT	AJ439063	CCDS13094.1, CCDS13095.1, CCDS63226.1, CCDS63227.1	20p12.3	2007-04-04	2007-04-04	2003-07-09	ENSG00000125885	ENSG00000125885			16147	protein-coding gene	gene with protein product	"""REC homolog (Drosophila)"""	608187	"""chromosome 20 open reading frame 154"""	C20orf154		12527764	Standard	NM_032485		Approved	MGC4816, MGC12866, MGC119522, MGC119523, dJ967N21.5, REC	uc002wmi.3	Q9UJA3	OTTHUMG00000031822	ENST00000378896.3:c.2284G>T	20.37:g.5974195G>T	ENSP00000368174:p.Glu762*	25	0		40	4	NM_032485	B2RBG7|D3DW08|E7EQU7|Q495R4|Q495R6|Q495R7|Q86US4|Q969I5	Nonsense_Mutation	SNP	ENST00000378896.3	37	CCDS13094.1	.	.	.	.	.	.	.	.	.	.	G	42	9.714443	0.99245	.	.	ENSG00000125885	ENST00000378896;ENST00000378883;ENST00000378886;ENST00000265187	.	.	.	5.82	5.82	0.92795	.	0.259681	0.43747	D	0.000526	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-13.4328	15.5745	0.76365	0.0:0.1371:0.8629:0.0	.	.	.	.	X	762;715;802;746	.	ENSP00000265187:E746X	E	+	1	0	MCM8	5922195	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.998000	0.70653	2.745000	0.94114	0.655000	0.94253	GAG	.		0.363	MCM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077900.1	NM_032485	
ANKLE2	23141	hgsc.bcm.edu	37	12	133331415	133331415	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:133331415G>T	ENST00000357997.5	-	2	575	c.486C>A	c.(484-486)ggC>ggA	p.G162G	ANKLE2_ENST00000337516.5_Silent_p.G162G|ANKLE2_ENST00000539605.1_Silent_p.G100G	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	162					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)	p.G162G(1)		NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		GAGGATTCAGGCCCACACTGT	0.542																																					p.G162G		.											ANKLE2,NS,carcinoma,0,1	ANKLE2	0	1	Substitution - coding silent(1)	endometrium(1)	c.C486A						.						69.0	70.0	70.0					12																	133331415		1926	4137	6063	SO:0001819	synonymous_variant	23141	exon2			ATTCAGGCCCACA	AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.486C>A	12.37:g.133331415G>T		48	0		65	3	NM_015114	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Silent	SNP	ENST00000357997.5	37	CCDS41869.1																																																																																			.		0.542	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397712.1		
MYO15A	51168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	18023111	18023111	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:18023111G>A	ENST00000205890.5	+	2	1335	c.997G>A	c.(997-999)Gag>Aag	p.E333K		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	333					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CGATGGGTACGAGGGCGAGGC	0.602																																					p.E333K		.											.	.	.	0			c.G997A						.						71.0	78.0	76.0					17																	18023111		2002	4165	6167	SO:0001583	missense	51168	exon2			GGGTACGAGGGCG	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.997G>A	17.37:g.18023111G>A	ENSP00000205890:p.Glu333Lys	74	0		120	51	NM_016239	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	G	11.95	1.792525	0.31685	.	.	ENSG00000091536	ENST00000205890	D	0.89270	-2.49	5.35	3.21	0.36854	.	.	.	.	.	T	0.75110	0.3805	N	0.19112	0.55	0.09310	N	0.999992	B	0.33494	0.414	B	0.17098	0.017	T	0.64698	-0.6346	9	0.38643	T	0.18	.	4.0566	0.09819	0.079:0.1476:0.5012:0.2722	.	333	Q9UKN7	MYO15_HUMAN	K	333	ENSP00000205890:E333K	ENSP00000205890:E333K	E	+	1	0	MYO15A	17963836	0.298000	0.24417	0.127000	0.21898	0.540000	0.34992	2.666000	0.46799	1.230000	0.43646	0.561000	0.74099	GAG	.		0.602	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
CEP250	11190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	20	34091510	34091510	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr20:34091510C>T	ENST00000397527.1	+	30	6033	c.5313C>T	c.(5311-5313)ctC>ctT	p.L1771L	CEP250_ENST00000342580.4_Silent_p.L1715L	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1771	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			AGACCAGCCTCCTCCTGTCCC	0.572																																					p.L1771L		.											.	.	.	0			c.C5313T						.						67.0	68.0	68.0					20																	34091510		2203	4300	6503	SO:0001819	synonymous_variant	11190	exon30			CAGCCTCCTCCTG	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.5313C>T	20.37:g.34091510C>T		10	0		10	5	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Silent	SNP	ENST00000397527.1	37	CCDS13255.1																																																																																			.		0.572	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
ABTB2	25841	hgsc.bcm.edu	37	11	34194737	34194737	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr11:34194737C>T	ENST00000435224.2	-	4	1786	c.1362G>A	c.(1360-1362)ctG>ctA	p.L454L	ABTB2_ENST00000298992.2_Silent_p.L268L|ABTB2_ENST00000530814.1_5'UTR	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	454					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				GACCAGGCAGCAGCAGCCGGG	0.687																																					p.L454L		.											.	.	.	0			c.G1362A						.						20.0	25.0	23.0					11																	34194737		2201	4292	6493	SO:0001819	synonymous_variant	25841	exon4			AGGCAGCAGCAGC	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.1362G>A	11.37:g.34194737C>T		89	0		77	4	NM_145804	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Silent	SNP	ENST00000435224.2	37	CCDS7890.2																																																																																			.		0.687	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388703.3	NM_145804	
RYR2	6262	hgsc.bcm.edu	37	1	237880647	237880647	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:237880647G>T	ENST00000366574.2	+	72	10790	c.10473G>T	c.(10471-10473)ctG>ctT	p.L3491L	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Silent_p.L3489L|RYR2_ENST00000542537.1_Silent_p.L3475L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3491					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCATTGCTCTGGCCAAAAATC	0.502																																					p.L3491L		.											RYR2,NS,carcinoma,0,1	RYR2	0	0			c.G10473T						.						71.0	76.0	74.0					1																	237880647		1927	4125	6052	SO:0001819	synonymous_variant	6262	exon72			TGCTCTGGCCAAA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10473G>T	1.37:g.237880647G>T		42	0		73	3	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	37	CCDS55691.1																																																																																			.		0.502	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
AGBL3	340351	hgsc.bcm.edu	37	7	134719110	134719110	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr7:134719110G>T	ENST00000436302.2	+	7	1021	c.768G>T	c.(766-768)tgG>tgT	p.W256C	AGBL3_ENST00000435976.2_Missense_Mutation_p.W256C|AGBL3_ENST00000458078.1_Missense_Mutation_p.W230C	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	256						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						ACATTGGCTGGCAGAGAATAG	0.443																																					p.W256C		.											AGBL3,colon,carcinoma,0,1	AGBL3	0	0			c.G768T						.						77.0	61.0	66.0					7																	134719110		692	1591	2283	SO:0001583	missense	340351	exon7			TGGCTGGCAGAGA	BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.768G>T	7.37:g.134719110G>T	ENSP00000388275:p.Trp256Cys	60	0		43	2	NM_178563	B7Z827|Q9H965	Missense_Mutation	SNP	ENST00000436302.2	37	CCDS47718.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.955703	0.73902	.	.	ENSG00000146856	ENST00000436302;ENST00000458078;ENST00000435976	T;T;T	0.31247	1.5;1.5;1.5	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.72382	0.3453	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84093	0.0391	10	0.87932	D	0	-9.8902	18.491	0.90848	0.0:0.0:1.0:0.0	.	256	Q8NEM8-4	.	C	256;230;256	ENSP00000388275:W256C;ENSP00000395969:W230C;ENSP00000401220:W256C	ENSP00000275763:W256C	W	+	3	0	AGBL3	134369650	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.294000	0.96088	2.446000	0.82766	0.557000	0.71058	TGG	.		0.443	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376655.1	NM_178563	
AK8	158067	hgsc.bcm.edu	37	9	135668080	135668080	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr9:135668080G>T	ENST00000298545.3	-	11	1583	c.1062C>A	c.(1060-1062)ggC>ggA	p.G354G	AK8_ENST00000477396.1_5'UTR	NM_152572.2	NP_689785.1	Q96MA6	KAD8_HUMAN	adenylate kinase 8	354	Adenylate kinase 2.				nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)	p.G354G(2)		NS(1)|kidney(2)|large_intestine(4)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(2)	23						CCCGCGGGACGCCGTGTAGCA	0.657																																					p.G354G		.											C9orf98_ENST00000298545,colon,carcinoma,0,2	C9orf98_ENST00000298545	0	2	Substitution - coding silent(2)	large_intestine(2)	c.C1062A						.						28.0	23.0	25.0					9																	135668080		2189	4280	6469	SO:0001819	synonymous_variant	158067	exon11			CGGGACGCCGTGT	AK093446	CCDS6954.1	9q34.13	2013-04-29	2010-12-07	2010-12-07	ENSG00000165695	ENSG00000165695	2.7.4.3	"""Adenylate kinases"""	26526	protein-coding gene	gene with protein product		615365	"""chromosome 9 open reading frame 98"""	C9orf98		21080915	Standard	NM_152572		Approved	FLJ32704	uc004cbu.1	Q96MA6	OTTHUMG00000021009	ENST00000298545.3:c.1062C>A	9.37:g.135668080G>T		45	0		68	3	NM_152572	A8K821|Q8N9W9	Silent	SNP	ENST00000298545.3	37	CCDS6954.1																																																																																			.		0.657	AK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055413.1	NM_152572	
RNF138	51444	hgsc.bcm.edu	37	18	29672848	29672848	+	Splice_Site	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr18:29672848G>T	ENST00000261593.3	+	2	567	c.109G>T	c.(109-111)Gtt>Ttt	p.V37F	RP11-53I6.3_ENST00000582233.1_RNA|RNF138_ENST00000257190.5_Splice_Site_p.V37F|RNF138_ENST00000585103.1_3'UTR|snoU13_ENST00000459168.1_RNA|RP11-53I6.2_ENST00000583184.1_RNA	NM_001191324.1|NM_016271.4	NP_001178253.2|NP_057355.2	Q8WVD3	RN138_HUMAN	ring finger protein 138, E3 ubiquitin protein ligase	37					protein ubiquitination (GO:0016567)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	ligase activity (GO:0016874)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.V37I(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						CTGTCAGCACGTGTGAGTAGA	0.701																																					p.V37F		.											RNF138,colon,carcinoma,0,1	RNF138	0	1	Substitution - Missense(1)	large_intestine(1)	c.G109T						.						33.0	28.0	30.0					18																	29672848		2202	4298	6500	SO:0001630	splice_region_variant	51444	exon1			CAGCACGTGTGAG	AF162680	CCDS11903.1, CCDS11904.1	18q12.1	2013-01-28	2012-02-23		ENSG00000134758	ENSG00000134758		"""RING-type (C3HC4) zinc fingers"""	17765	protein-coding gene	gene with protein product	"""nemo-like kinase associated ring finger protein"""		"""ring finger protein 138"""			22155992, 16714285	Standard	NM_016271		Approved	STRIN, NARF	uc021uip.2	Q8WVD3	OTTHUMG00000132265	ENST00000261593.3:c.110+1G>T	18.37:g.29672848G>T		39	0		50	2	NM_198128	B2RE17|Q9H8K2|Q9UF87|Q9UKI6	Missense_Mutation	SNP	ENST00000261593.3	37	CCDS11903.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.125986	0.56721	.	.	ENSG00000134758	ENST00000261593;ENST00000257190	D;T	0.86366	-2.11;-1.1	4.76	3.89	0.44902	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.241343	0.27379	N	0.019636	D	0.88209	0.6375	L	0.58925	1.835	0.26935	N	0.966385	P;D	0.62365	0.791;0.991	B;P	0.61722	0.146;0.893	T	0.78224	-0.2287	10	0.10902	T	0.67	-21.6844	8.7281	0.34483	0.1019:0.0:0.8981:0.0	.	37;37	Q8WVD3-2;Q8WVD3	.;RN138_HUMAN	F	37	ENSP00000261593:V37F;ENSP00000257190:V37F	ENSP00000257190:V37F	V	+	1	0	RNF138	27926846	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.390000	0.44416	1.235000	0.43724	0.561000	0.74099	GTT;GTC	.		0.701	RNF138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255352.2	NM_016271	Missense_Mutation
COL7A1	1294	hgsc.bcm.edu;broad.mit.edu	37	3	48625832	48625832	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:48625832C>T	ENST00000328333.8	-	20	2700	c.2593G>A	c.(2593-2595)Gag>Aag	p.E865K	COL7A1_ENST00000454817.1_Missense_Mutation_p.E865K	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	865	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GGCGGAGCCTCAGGCGCTGGA	0.701																																					p.E865K		.											.	.	.	0			c.G2593A						.						15.0	17.0	17.0					3																	48625832		2201	4297	6498	SO:0001583	missense	1294	exon20			GAGCCTCAGGCGC	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.2593G>A	3.37:g.48625832C>T	ENSP00000332371:p.Glu865Lys	9	0		16	5	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299134	0.60195	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.55052	0.54;0.54	4.94	4.94	0.65067	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.304822	0.22750	N	0.056096	T	0.49304	0.1549	L	0.53249	1.67	0.31049	N	0.715463	B	0.31318	0.319	B	0.27608	0.081	T	0.55309	-0.8161	10	0.37606	T	0.19	.	17.6105	0.88051	0.0:1.0:0.0:0.0	.	865	Q02388	CO7A1_HUMAN	K	865	ENSP00000332371:E865K;ENSP00000412569:E865K	ENSP00000332371:E865K	E	-	1	0	COL7A1	48600836	0.000000	0.05858	0.491000	0.27477	0.325000	0.28411	0.822000	0.27352	2.658000	0.90341	0.655000	0.94253	GAG	.		0.701	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
NBEAL1	65065	hgsc.bcm.edu;bcgsc.ca	37	2	204000456	204000456	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:204000456G>T	ENST00000449802.1	+	27	4116	c.3783G>T	c.(3781-3783)gtG>gtT	p.V1261V		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1261										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CACAGCAAGTGGGTTGGCAAG	0.338																																					p.V1261V		.											.	.	.	0			c.G3783T						.						52.0	43.0	46.0					2																	204000456		692	1591	2283	SO:0001819	synonymous_variant	65065	exon27			GCAAGTGGGTTGG	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.3783G>T	2.37:g.204000456G>T		100	0		91	4	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Silent	SNP	ENST00000449802.1	37	CCDS46495.1																																																																																			.		0.338	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
TNPO2	30000	hgsc.bcm.edu	37	19	12821525	12821525	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:12821525G>T	ENST00000592287.1	-	12	1288	c.1180C>A	c.(1180-1182)Cac>Aac	p.H394N	TNPO2_ENST00000356861.5_Missense_Mutation_p.H394N|TNPO2_ENST00000441499.1_Missense_Mutation_p.H394N|TNPO2_ENST00000450764.2_Missense_Mutation_p.H394N|TNPO2_ENST00000589956.1_5'Flank|TNPO2_ENST00000588216.1_Missense_Mutation_p.H394N|TNPO2_ENST00000425528.1_Missense_Mutation_p.H394N	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	394					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GGGAGTAGGTGGGGCAGCAGT	0.652																																					p.H394N		.											.	.	.	0			c.C1180A						.						47.0	53.0	51.0					19																	12821525		2098	4206	6304	SO:0001583	missense	30000	exon12			GTAGGTGGGGCAG	AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.1180C>A	19.37:g.12821525G>T	ENSP00000468434:p.His394Asn	67	0		85	4	NM_013433	O14655|Q6IN77	Missense_Mutation	SNP	ENST00000592287.1	37	CCDS45991.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.822448	0.50739	.	.	ENSG00000105576	ENST00000536114;ENST00000425528;ENST00000441499;ENST00000450764;ENST00000356861;ENST00000420511;ENST00000546320	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.18	5.18	0.71444	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.47783	0.1464	N	0.16656	0.425	0.58432	D	0.999999	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.004	T	0.35724	-0.9777	10	0.27082	T	0.32	-11.3387	17.4592	0.87615	0.0:0.0:1.0:0.0	.	558;394	Q4LE60;O14787	.;TNPO2_HUMAN	N	558;394;394;394;394;394;394	ENSP00000407182:H394N;ENSP00000389648:H394N;ENSP00000397379:H394N;ENSP00000349321:H394N	ENSP00000349321:H394N	H	-	1	0	TNPO2	12682525	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.476000	0.97823	2.406000	0.81754	0.561000	0.74099	CAC	.		0.652	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1	NM_013433	
IRAK2	3656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	10268072	10268072	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:10268072C>T	ENST00000256458.4	+	10	1317	c.1227C>T	c.(1225-1227)ctC>ctT	p.L409L		NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	409	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						CCGAGGTCCTCACGGGCATCC	0.537																																					p.L409L		.											.	.	.	0			c.C1227T						.						106.0	90.0	95.0					3																	10268072		2203	4297	6500	SO:0001819	synonymous_variant	3656	exon10			GGTCCTCACGGGC	AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.1227C>T	3.37:g.10268072C>T		36	0		53	26	NM_001570	B4DQZ6|Q08AG6|Q5K546	Silent	SNP	ENST00000256458.4	37	CCDS33697.1																																																																																			.		0.537	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339623.1		
RAD21L1	642636	hgsc.bcm.edu;bcgsc.ca	37	20	1223483	1223483	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr20:1223483G>T	ENST00000409241.1	+	9	1170	c.1077G>T	c.(1075-1077)ctG>ctT	p.L359L	RAD21L1_ENST00000402452.1_Silent_p.L359L|RAD21L1_ENST00000381882.2_Silent_p.L359L	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)	359					attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						ATGCTGAACTGAAAATGGTAA	0.363																																					p.L359L		.											.	.	.	0			c.G1077T						.						121.0	94.0	102.0					20																	1223483		692	1591	2283	SO:0001819	synonymous_variant	642636	exon9			TGAACTGAAAATG	AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.1077G>T	20.37:g.1223483G>T		70	0		75	4	NM_001136566	B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Silent	SNP	ENST00000409241.1	37	CCDS46568.1																																																																																			.		0.363	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334022.1		
ABCA10	10349	hgsc.bcm.edu	37	17	67212428	67212428	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:67212428G>T	ENST00000269081.4	-	8	1511	c.602C>A	c.(601-603)tCa>tAa	p.S201*	ABCA10_ENST00000416101.2_Nonsense_Mutation_p.S201*|ABCA10_ENST00000432313.2_Nonsense_Mutation_p.S201*	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	201					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					AATTGGGATTGATGTTATGAC	0.368																																					p.S201X		.											.	.	.	0			c.C602A						.						165.0	168.0	167.0					17																	67212428		2203	4300	6503	SO:0001587	stop_gained	10349	exon8			GGGATTGATGTTA	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.602C>A	17.37:g.67212428G>T	ENSP00000269081:p.Ser201*	54	0		98	5	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Nonsense_Mutation	SNP	ENST00000269081.4	37	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	G	39	7.435404	0.98282	.	.	ENSG00000154263	ENST00000269081;ENST00000416101;ENST00000432313	.	.	.	3.34	-6.69	0.01772	.	0.279785	0.18958	U	0.126480	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	5.2708	0.15624	0.506:0.0:0.3588:0.1353	.	.	.	.	X	201	.	ENSP00000269081:S201X	S	-	2	0	ABCA10	64724023	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.761000	0.04751	-1.164000	0.02790	-0.888000	0.02935	TCA	.		0.368	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
GXYLT1	283464	hgsc.bcm.edu	37	12	42523639	42523639	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:42523639G>T	ENST00000398675.3	-	2	468	c.236C>A	c.(235-237)tCt>tAt	p.S79Y	GXYLT1_ENST00000280876.6_Intron	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	79					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						GTAACACAGAGAGAAATCTTT	0.383																																					p.S79Y		.											GXYLT1,NS,carcinoma,0,1	GXYLT1	0	0			c.C236A						.						98.0	88.0	91.0					12																	42523639		1846	4095	5941	SO:0001583	missense	283464	exon2			CACAGAGAGAAAT	BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.236C>A	12.37:g.42523639G>T	ENSP00000381666:p.Ser79Tyr	31	0		32	2	NM_173601	B3KWJ2|Q8IXV1|Q96BH4	Missense_Mutation	SNP	ENST00000398675.3	37	CCDS41772.1	.	.	.	.	.	.	.	.	.	.	G	18.67	3.674154	0.67928	.	.	ENSG00000151233	ENST00000398675	.	.	.	5.31	3.41	0.39046	.	1.220290	0.06226	U	0.687662	T	0.50514	0.1620	L	0.27053	0.805	0.80722	D	1	B	0.32693	0.38	B	0.31016	0.123	T	0.21690	-1.0238	9	0.62326	D	0.03	.	15.6825	0.77381	0.0:0.26:0.74:0.0	.	79	Q4G148	GXLT1_HUMAN	Y	79	.	ENSP00000381666:S79Y	S	-	2	0	GXYLT1	40809906	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	5.421000	0.66447	0.678000	0.31325	0.591000	0.81541	TCT	.		0.383	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403778.1	XM_290597	
ARHGAP29	9411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94650575	94650575	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:94650575G>A	ENST00000260526.6	-	18	2144	c.1962C>T	c.(1960-1962)gtC>gtT	p.V654V	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	654					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CACAAATAATGACTAAATTTT	0.343																																					p.V654V		.											.	.	.	0			c.C1962T						.						59.0	62.0	61.0					1																	94650575		2203	4300	6503	SO:0001819	synonymous_variant	9411	exon18			AATAATGACTAAA		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.1962C>T	1.37:g.94650575G>A		64	0		91	39	NM_004815	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Silent	SNP	ENST00000260526.6	37	CCDS748.1																																																																																			.		0.343	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
GABBR1	2550	hgsc.bcm.edu	37	6	29572676	29572676	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:29572676G>T	ENST00000377034.4	-	21	2864	c.2529C>A	c.(2527-2529)ttC>ttA	p.F843L	GABBR1_ENST00000377012.4_Missense_Mutation_p.F726L|GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000377016.4_Missense_Mutation_p.F781L|GABBR1_ENST00000355973.3_Missense_Mutation_p.F726L	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	843					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.F843L(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TATAGGAGGAGAAAACTATGG	0.512																																					p.F843L		.											GABBR1,NS,carcinoma,0,1	GABBR1	0	1	Substitution - Missense(1)	lung(1)	c.C2529A						.						150.0	100.0	118.0					6																	29572676		1511	2709	4220	SO:0001583	missense	2550	exon21			GGAGGAGAAAACT	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2529C>A	6.37:g.29572676G>T	ENSP00000366233:p.Phe843Leu	34	0		48	2	NM_001470	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	37	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311864	0.60414	.	.	ENSG00000204681	ENST00000355973;ENST00000377016;ENST00000377012;ENST00000377034	D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12	5.16	1.98	0.26296	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.86611	0.5974	L	0.55481	1.735	0.80722	D	1	D;D;P	0.63046	0.992;0.992;0.619	D;D;P	0.76071	0.984;0.987;0.625	D	0.85673	0.1296	10	0.56958	D	0.05	-36.3274	7.8719	0.29571	0.329:0.0:0.671:0.0	.	781;843;726	Q9UBS5-3;Q9UBS5;Q5SUJ9	.;GABR1_HUMAN;.	L	726;781;726;843	ENSP00000348248:F726L;ENSP00000366215:F781L;ENSP00000366211:F726L;ENSP00000366233:F843L	ENSP00000348248:F726L	F	-	3	2	GABBR1	29680655	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.960000	0.63673	0.659000	0.30945	0.655000	0.94253	TTC	.		0.512	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
GBF1	8729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104121537	104121537	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr10:104121537G>A	ENST00000369983.3	+	14	1811	c.1551G>A	c.(1549-1551)atG>atA	p.M517I		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	517					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CTTATGAGATGAAGGAGATGG	0.473																																					p.M518I		.											.	.	.	0			c.G1554A						.						140.0	122.0	128.0					10																	104121537		2203	4300	6503	SO:0001583	missense	8729	exon14			TGAGATGAAGGAG	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.1551G>A	10.37:g.104121537G>A	ENSP00000359000:p.Met517Ile	26	0		41	13	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.726981	0.69074	.	.	ENSG00000107862	ENST00000369983	T	0.64438	-0.1	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.48732	0.1516	N	0.12887	0.27	0.80722	D	1	B;B;B	0.21753	0.06;0.038;0.01	B;B;B	0.17979	0.02;0.02;0.009	T	0.33727	-0.9857	10	0.31617	T	0.26	-21.7474	20.8794	0.99867	0.0:0.0:1.0:0.0	.	517;517;517	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	I	517	ENSP00000359000:M517I	ENSP00000359000:M517I	M	+	3	0	GBF1	104111527	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.832000	0.99423	2.941000	0.99782	0.655000	0.94253	ATG	.		0.473	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
SPTY2D1	144108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	18636621	18636621	+	Missense_Mutation	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr11:18636621C>G	ENST00000336349.5	-	3	1435	c.1200G>C	c.(1198-1200)caG>caC	p.Q400H	SPTY2D1_ENST00000543776.1_5'Flank	NM_194285.2	NP_919261.2	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)	400	Ser-rich.									breast(4)|cervix(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|skin(1)|stomach(1)	30						AGCTGCCATTCTGGCGCCTAG	0.597																																					p.Q400H		.											.	.	.	0			c.G1200C						.						58.0	58.0	58.0					11																	18636621		2199	4293	6492	SO:0001583	missense	144108	exon3			GCCATTCTGGCGC	BX647798	CCDS31441.1	11p15.1	2005-10-28			ENSG00000179119	ENSG00000179119			26818	protein-coding gene	gene with protein product							Standard	NM_194285		Approved	FLJ39441, DKFZp686I068	uc001moy.3	Q68D10	OTTHUMG00000167733	ENST00000336349.5:c.1200G>C	11.37:g.18636621C>G	ENSP00000337991:p.Gln400His	27	0		30	12	NM_194285	Q6AWA5|Q6MZI5|Q7Z390|Q7Z470|Q86VG8|Q8N3E7|Q8N417|Q8N8I3	Missense_Mutation	SNP	ENST00000336349.5	37	CCDS31441.1	.	.	.	.	.	.	.	.	.	.	C	10.34	1.321985	0.23994	.	.	ENSG00000179119	ENST00000336349	T	0.26957	1.7	5.43	0.13	0.14746	.	0.277370	0.36234	N	0.002713	T	0.12178	0.0296	N	0.14661	0.345	0.25673	N	0.985871	B	0.19583	0.037	B	0.12156	0.007	T	0.19647	-1.0299	10	0.34782	T	0.22	-11.9817	7.751	0.28896	0.0:0.5422:0.115:0.3428	.	400	Q68D10	SPT2_HUMAN	H	400	ENSP00000337991:Q400H	ENSP00000337991:Q400H	Q	-	3	2	SPTY2D1	18593197	0.000000	0.05858	0.999000	0.59377	0.483000	0.33249	-1.966000	0.01509	0.133000	0.18654	0.563000	0.77884	CAG	.		0.597	SPTY2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395941.1	NM_194285	
FAM73A	374986	hgsc.bcm.edu;bcgsc.ca	37	1	78338699	78338699	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:78338699G>T	ENST00000370791.3	+	15	1606	c.1574G>T	c.(1573-1575)gGa>gTa	p.G525V	FAM73A_ENST00000443751.2_Missense_Mutation_p.G488V	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	525						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		ATCCCAGATGGATTTTTTGCC	0.383																																					p.G526V		.											.	.	.	0			c.G1577T						.						222.0	212.0	215.0					1																	78338699		2203	4300	6503	SO:0001583	missense	374986	exon15			CAGATGGATTTTT		CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.1574G>T	1.37:g.78338699G>T	ENSP00000359827:p.Gly525Val	97	0		98	4	NM_001270384	Q6MZG0	Missense_Mutation	SNP	ENST00000370791.3	37	CCDS681.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.518279	0.85495	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	T;T	0.61158	0.13;0.13	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.77232	0.4100	M	0.86268	2.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.78583	-0.2148	10	0.59425	D	0.04	-17.5265	20.0693	0.97712	0.0:0.0:1.0:0.0	.	488;526;525	F8W7S1;B7ZLZ8;Q8NAN2	.;.;FA73A_HUMAN	V	525;488	ENSP00000359827:G525V;ENSP00000393675:G488V	ENSP00000359827:G525V	G	+	2	0	FAM73A	78111287	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.248000	0.95456	2.758000	0.94735	0.563000	0.77884	GGA	.		0.383	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	
SP100	6672	hgsc.bcm.edu	37	2	231314943	231314943	+	Missense_Mutation	SNP	C	C	A	rs368340530		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:231314943C>A	ENST00000264052.5	+	8	1148	c.793C>A	c.(793-795)Ccc>Acc	p.P265T	SP100_ENST00000409824.1_Missense_Mutation_p.P240T|SP100_ENST00000427101.2_Missense_Mutation_p.P240T|SP100_ENST00000340126.4_Missense_Mutation_p.P265T|SP100_ENST00000341950.4_Missense_Mutation_p.P265T|SP100_ENST00000409341.1_Missense_Mutation_p.P265T|SP100_ENST00000409112.1_Missense_Mutation_p.P265T|SP100_ENST00000409897.1_Missense_Mutation_p.P230T	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	265					cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.P265S(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AAGGGAGATGCCCTGCCCGTT	0.448																																					p.P265T		.											SP100_ENST00000340126,mouth,carcinoma,0,2	SP100_ENST00000340126	0	2	Substitution - Missense(2)	upper_aerodigestive_tract(2)	c.C793A						.						232.0	212.0	219.0					2																	231314943		2203	4300	6503	SO:0001583	missense	6672	exon8			GAGATGCCCTGCC	AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.793C>A	2.37:g.231314943C>A	ENSP00000264052:p.Pro265Thr	29	0		38	2	NM_001206702	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	ENST00000264052.5	37	CCDS2477.1	.	.	.	.	.	.	.	.	.	.	C	12.31	1.899486	0.33535	.	.	ENSG00000067066	ENST00000264052;ENST00000427101;ENST00000409824;ENST00000409341;ENST00000409112;ENST00000340126;ENST00000341950;ENST00000409897	T;T;T;T;T;T;T;T	0.80304	2.29;2.2;2.2;2.19;-1.36;0.21;2.17;2.19	3.75	0.868	0.19090	.	0.517604	0.14630	N	0.307868	T	0.74207	0.3686	N	0.24115	0.695	0.09310	N	1	D;P;D;D;D;D;P;D	0.76494	0.999;0.94;0.999;0.982;0.999;0.969;0.94;0.999	D;B;D;P;D;P;P;D	0.70716	0.961;0.331;0.915;0.743;0.97;0.558;0.561;0.961	T	0.63651	-0.6589	10	0.07175	T	0.84	.	3.5775	0.07940	0.0:0.5439:0.2115:0.2446	.	240;265;230;265;265;265;240;265	F8WFE2;B4E2B9;B8ZZD8;P23497-4;P23497;E7EUA7;E9PHV6;P23497-2	.;.;.;.;SP100_HUMAN;.;.;.	T	265;240;240;265;265;265;265;230	ENSP00000264052:P265T;ENSP00000399389:P240T;ENSP00000387311:P240T;ENSP00000386404:P265T;ENSP00000386427:P265T;ENSP00000343023:P265T;ENSP00000342729:P265T;ENSP00000386998:P230T	ENSP00000264052:P265T	P	+	1	0	SP100	231023187	0.000000	0.05858	0.003000	0.11579	0.035000	0.12851	0.230000	0.17852	0.167000	0.19631	0.557000	0.71058	CCC	.		0.448	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113	
MYL7	58498	hgsc.bcm.edu	37	7	44179935	44179935	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr7:44179935C>T	ENST00000223364.3	-	4	311	c.285G>A	c.(283-285)ggG>ggA	p.G95G	MYL7_ENST00000434895.1_5'UTR|MYL7_ENST00000458240.1_Silent_p.G68G	NM_021223.2	NP_067046.1	Q01449	MLRA_HUMAN	myosin, light chain 7, regulatory	95						A band (GO:0031672)|dendritic spine (GO:0043197)|myosin complex (GO:0016459)	calcium ion binding (GO:0005509)	p.G95G(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	12						TGAGCTTCTCCCCAAAGAGCG	0.637																																					p.G95G		.											MYL7,trunk,malignant_melanoma,0,1	MYL7	0	1	Substitution - coding silent(1)	skin(1)	c.G285A						.						124.0	104.0	111.0					7																	44179935		2203	4300	6503	SO:0001819	synonymous_variant	58498	exon4			CTTCTCCCCAAAG	M94547	CCDS5478.1	7p21-p11.2	2013-01-10	2006-09-29		ENSG00000106631	ENSG00000106631		"""Myosins / Light chain"", ""EF-hand domain containing"""	21719	protein-coding gene	gene with protein product		613993	"""myosin, light polypeptide 7, regulatory"""			8207020	Standard	NM_021223		Approved	MYLC2A, MYL2A	uc003tkg.3	Q01449	OTTHUMG00000023125	ENST00000223364.3:c.285G>A	7.37:g.44179935C>T		37	0		36	2	NM_021223	B2R4L3	Silent	SNP	ENST00000223364.3	37	CCDS5478.1																																																																																			.		0.637	MYL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059446.4	NM_021223	
LPCAT1	79888	hgsc.bcm.edu	37	5	1489863	1489863	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr5:1489863G>T	ENST00000283415.3	-	4	736	c.604C>A	c.(604-606)Cag>Aag	p.Q202K		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	202					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)	p.Q202E(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TGCATTACCTGTGGCCACTTT	0.532																																					p.Q202K		.											LPCAT1,colon,carcinoma,0,1	LPCAT1	0	1	Substitution - Missense(1)	large_intestine(1)	c.C604A						.						185.0	176.0	179.0					5																	1489863		2203	4300	6503	SO:0001583	missense	79888	exon4			TTACCTGTGGCCA	BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.604C>A	5.37:g.1489863G>T	ENSP00000283415:p.Gln202Lys	41	0		39	2	NM_024830	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	ENST00000283415.3	37	CCDS3864.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550670	0.65311	.	.	ENSG00000153395	ENST00000283415	D	0.93076	-3.16	4.19	4.19	0.49359	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.94631	0.8269	M	0.78344	2.41	0.80722	D	1	P	0.46987	0.888	P	0.48952	0.596	D	0.94944	0.8094	10	0.49607	T	0.09	-17.2479	16.8802	0.86061	0.0:0.0:1.0:0.0	.	202	Q8NF37	PCAT1_HUMAN	K	202	ENSP00000283415:Q202K	ENSP00000283415:Q202K	Q	-	1	0	LPCAT1	1542863	1.000000	0.71417	0.883000	0.34634	0.047000	0.14425	8.497000	0.90488	2.050000	0.60909	0.561000	0.74099	CAG	.		0.532	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304032.1	NM_024830	
PCNXL2	80003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	233270846	233270846	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:233270846G>A	ENST00000258229.9	-	21	3984	c.3750C>T	c.(3748-3750)ttC>ttT	p.F1250F	PCNXL2_ENST00000488780.2_Silent_p.F383F|PCNXL2_ENST00000520463.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1250						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				AGATGACAGTGAAGCTCAAGT	0.393																																					p.F1250F		.											.	.	.	0			c.C3750T						.						81.0	80.0	80.0					1																	233270846		1864	4108	5972	SO:0001819	synonymous_variant	80003	exon21			GACAGTGAAGCTC	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.3750C>T	1.37:g.233270846G>A		77	0		100	40	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Silent	SNP	ENST00000258229.9	37	CCDS44335.1																																																																																			.		0.393	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
NKD1	85407	hgsc.bcm.edu	37	16	50664815	50664815	+	Missense_Mutation	SNP	C	C	T	rs200257763		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:50664815C>T	ENST00000268459.3	+	8	913	c.689C>T	c.(688-690)cCg>cTg	p.P230L		NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	230					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P230L(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		CAGCGAGCCCCGCTCAGGTAT	0.592																																					p.P230L		.											NKD1,colon,carcinoma,0,1	NKD1	0	1	Substitution - Missense(1)	large_intestine(1)	c.C689T						.	C	LEU/PRO	1,4351		0,1,2175	36.0	30.0	32.0		689	3.7	0.8	16		32	0,8582		0,0,4291	yes	missense	NKD1	NM_033119.4	98	0,1,6466	TT,TC,CC		0.0,0.023,0.0077	benign	230/471	50664815	1,12933	2176	4291	6467	SO:0001583	missense	85407	exon8			GAGCCCCGCTCAG	AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.689C>T	16.37:g.50664815C>T	ENSP00000268459:p.Pro230Leu	20	0		29	2	NM_033119	B2RC39|Q8WZ08	Missense_Mutation	SNP	ENST00000268459.3	37	CCDS10743.1	.	.	.	.	.	.	.	.	.	.	C	7.412	0.634896	0.14322	2.3E-4	0.0	ENSG00000140807	ENST00000268459	T	0.61859	0.07	4.69	3.72	0.42706	.	0.320500	0.34531	N	0.003897	T	0.40297	0.1111	L	0.31294	0.92	0.44454	D	0.997382	B	0.06786	0.001	B	0.06405	0.002	T	0.14117	-1.0484	10	0.12430	T	0.62	-5.2668	9.9061	0.41377	0.0:0.9011:0.0:0.0989	.	230	Q969G9	NKD1_HUMAN	L	230	ENSP00000268459:P230L	ENSP00000268459:P230L	P	+	2	0	NKD1	49222316	0.996000	0.38824	0.765000	0.31456	0.761000	0.43186	3.404000	0.52623	0.917000	0.36895	0.467000	0.42956	CCG	.		0.592	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256873.1		
IGF1R	3480	hgsc.bcm.edu	37	15	99460004	99460004	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr15:99460004C>T	ENST00000268035.6	+	10	2711	c.2100C>T	c.(2098-2100)tgC>tgT	p.C700C	IGF1R_ENST00000558762.1_Silent_p.C700C	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	700	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GGCCTTGCTGCGCCTGCCCCA	0.552																																					p.C700C		.											.	.	.	0			c.C2100T						.						70.0	69.0	69.0					15																	99460004		2197	4297	6494	SO:0001819	synonymous_variant	3480	exon10			TTGCTGCGCCTGC	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2100C>T	15.37:g.99460004C>T		66	0		59	3	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Silent	SNP	ENST00000268035.6	37	CCDS10378.1																																																																																			.		0.552	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
EDN2	1907	hgsc.bcm.edu;bcgsc.ca	37	1	41949743	41949743	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:41949743C>T	ENST00000372587.4	-	2	265	c.196G>A	c.(196-198)Gac>Aac	p.D66N	EDN2_ENST00000490783.1_5'UTR	NM_001956.3	NP_001947.1	P20800	EDN2_HUMAN	endothelin 2	66					artery smooth muscle contraction (GO:0014824)|calcium-mediated signaling (GO:0019722)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|energy homeostasis (GO:0097009)|hormonal regulation of the force of heart contraction (GO:0003058)|inositol phosphate-mediated signaling (GO:0048016)|lung alveolus development (GO:0048286)|macrophage activation (GO:0042116)|macrophage chemotaxis (GO:0048246)|neutrophil chemotaxis (GO:0030593)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of heart rate (GO:0010460)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of the force of heart contraction by chemical signal (GO:0003099)|prostaglandin biosynthetic process (GO:0001516)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|temperature homeostasis (GO:0001659)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)			endometrium(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CAGATGATGTCCAAGTGGCAG	0.612																																					p.D66N		.											.	.	.	0			c.G196A						.						51.0	39.0	43.0					1																	41949743		2203	4299	6502	SO:0001583	missense	1907	exon2			TGATGTCCAAGTG	M65199	CCDS462.1	1p34	2013-02-26			ENSG00000127129	ENSG00000127129		"""Endogenous ligands"""	3177	protein-coding gene	gene with protein product		131241					Standard	NM_001956		Approved	ET2	uc009vwh.3	P20800	OTTHUMG00000006362	ENST00000372587.4:c.196G>A	1.37:g.41949743C>T	ENSP00000361668:p.Asp66Asn	51	0		68	4	NM_001956	Q5T1R3	Missense_Mutation	SNP	ENST00000372587.4	37	CCDS462.1	.	.	.	.	.	.	.	.	.	.	C	36	5.634336	0.96682	.	.	ENSG00000127129	ENST00000372587	D	0.98178	-4.77	5.75	5.75	0.90469	Endothelin-like toxin (2);	0.000000	0.85682	D	0.000000	D	0.99039	0.9671	M	0.85197	2.74	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.99782	1.1028	10	0.72032	D	0.01	-30.5015	18.5059	0.90897	0.0:1.0:0.0:0.0	.	66	P20800	EDN2_HUMAN	N	66	ENSP00000361668:D66N	ENSP00000361668:D66N	D	-	1	0	EDN2	41722330	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.203000	0.77864	2.714000	0.92807	0.561000	0.74099	GAC	.		0.612	EDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000016983.1	NM_001956	
KRTAP4-2	85291	hgsc.bcm.edu	37	17	39334273	39334273	+	Silent	SNP	C	C	G	rs201015994	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:39334273C>G	ENST00000377726.2	-	1	187	c.144G>C	c.(142-144)ccG>ccC	p.P48P		NM_033062.3	NP_149051	Q9BYR5	KRA42_HUMAN	keratin associated protein 4-2	48	20 X 5 AA repeats OF C-C-[GRQVS]-[SPT]- [VSTQ].					keratin filament (GO:0045095)		p.P165P(1)|p.P48P(1)		kidney(2)|lung(4)|upper_aerodigestive_tract(1)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GGCAGCACTGCGGTCTGCAGC	0.672													C|||	7	0.00139776	0.0045	0.0	5008	,	,		16922	0.0		0.001	False		,,,				2504	0.0				p.P48P		.											KRTAP4-2_ENST00000458321,NS,carcinoma,0,2	KRTAP4-2_ENST00000458321	0	2	Substitution - coding silent(2)	kidney(2)	c.G144C						.						35.0	42.0	40.0					17																	39334273		2202	4290	6492	SO:0001819	synonymous_variant	85291	exon1			GCACTGCGGTCTG	AJ406934	CCDS11384.1	17q21.2	2013-06-25			ENSG00000244537	ENSG00000244537		"""Keratin associated proteins"""	18900	protein-coding gene	gene with protein product						11279113	Standard	NM_033062		Approved	KAP4.2	uc002hwd.3	Q9BYR5	OTTHUMG00000133437	ENST00000377726.2:c.144G>C	17.37:g.39334273C>G		62	0		93	5	NM_033062	A0JP64	Silent	SNP	ENST00000377726.2	37	CCDS11384.1																																																																																			0.001		0.672	KRTAP4-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257305.1		
NHLRC1	378884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	18122100	18122100	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:18122100G>A	ENST00000340650.3	-	1	751	c.738C>T	c.(736-738)ttC>ttT	p.F246F		NM_198586.2	NP_940988.2	Q6VVB1	NHLC1_HUMAN	NHL repeat containing E3 ubiquitin protein ligase 1	246					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|positive regulation of protein ubiquitination (GO:0031398)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(2)	11	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			CCCCTTCCGCGAAGTCGACGT	0.602																																					p.F246F		.											.	.	.	0			c.C738T						.						41.0	45.0	44.0					6																	18122100		2203	4300	6503	SO:0001819	synonymous_variant	378884	exon1			TTCCGCGAAGTCG	AY324849	CCDS4542.1	6p22.3	2014-01-28	2013-12-12		ENSG00000187566	ENSG00000187566			21576	protein-coding gene	gene with protein product	"""epilepsy, progressive myoclonus type 2B"""	608072	"""NHL repeat containing 1"""			12958597	Standard	NM_198586		Approved	bA204B7.2, EPM2B, malin	uc003ncl.1	Q6VVB1	OTTHUMG00000014315	ENST00000340650.3:c.738C>T	6.37:g.18122100G>A		43	0		56	13	NM_198586	Q3SYB1|Q5VUK7|Q6IMH1	Silent	SNP	ENST00000340650.3	37	CCDS4542.1																																																																																			.		0.602	NHLRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039958.1		
MATN1	4146	hgsc.bcm.edu;ucsc.edu	37	1	31192246	31192246	+	Intron	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:31192246G>T	ENST00000373765.4	-	3	477				MATN1-AS1_ENST00000414532.2_RNA|MATN1-AS1_ENST00000454613.1_RNA|MATN1_ENST00000477320.1_5'Flank|MATN1-AS1_ENST00000414763.1_RNA	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein						extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		TTGGCCACCAGATGGCAGCCG	0.697											OREG0013305	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	100129196	.			CCACCAGATGGCA	M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.442-442C>A	1.37:g.31192246G>T		41	0	822	42	4	.	B2R7E3|Q5TBB9	RNA	SNP	ENST00000373765.4	37	CCDS336.1																																																																																			.		0.697	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010458.1	NM_002379	
HEATR6	63897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	58148096	58148096	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:58148096C>T	ENST00000184956.6	-	6	788	c.772G>A	c.(772-774)Gaa>Aaa	p.E258K	HEATR6_ENST00000585976.1_Missense_Mutation_p.E258K	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	258							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			GCTCCAAGTTCATCAGTCTGT	0.403																																					p.E258K		.											HEATR6,NS,carcinoma,0,1	HEATR6	0	0			c.G772A						.						208.0	180.0	190.0					17																	58148096		2203	4300	6503	SO:0001583	missense	63897	exon6			CAAGTTCATCAGT	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.772G>A	17.37:g.58148096C>T	ENSP00000184956:p.Glu258Lys	42	0		54	17	NM_022070	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	37	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.082266	0.36758	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.44083	0.93	5.2	1.42	0.22433	Armadillo-type fold (1);	0.289846	0.38492	N	0.001676	T	0.30634	0.0771	L	0.50333	1.59	0.29443	N	0.859025	B;B	0.28713	0.002;0.22	B;B	0.25140	0.002;0.058	T	0.18178	-1.0345	10	0.20046	T	0.44	-3.3738	8.6638	0.34108	0.0:0.3448:0.5491:0.1061	.	105;258	E7ESB9;Q6AI08	.;HEAT6_HUMAN	K	258;105	ENSP00000184956:E258K	ENSP00000184956:E258K	E	-	1	0	HEATR6	55502878	0.995000	0.38212	0.911000	0.35937	0.959000	0.62525	1.445000	0.35079	0.615000	0.30124	-0.355000	0.07637	GAA	.		0.403	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
DST	667	hgsc.bcm.edu	37	6	56342186	56342186	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:56342186G>T	ENST00000361203.3	-	86	20679	c.20672C>A	c.(20671-20673)aCc>aAc	p.T6891N	DST_ENST00000446842.2_Missense_Mutation_p.T6676N|DST_ENST00000244364.6_Missense_Mutation_p.T4588N|DST_ENST00000312431.6_3'UTR|DST_ENST00000370754.5_Missense_Mutation_p.T7180N|DST_ENST00000370769.4_Missense_Mutation_p.T7002N|DST_ENST00000370788.2_Missense_Mutation_p.T4805N|DST_ENST00000421834.2_Missense_Mutation_p.T4914N			Q03001	DYST_HUMAN	dystonin	6889					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTGCTTAATGGTAGTGATGGA	0.463																																					p.T4588N		.											DST_ENST00000370769,NS,carcinoma,0,2	DST_ENST00000370769	0	0			c.C13763A						.						159.0	165.0	163.0					6																	56342186		1955	4163	6118	SO:0001583	missense	667	exon72			TTAATGGTAGTGA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.20672C>A	6.37:g.56342186G>T	ENSP00000354508:p.Thr6891Asn	53	0		75	3	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	G	23.0	4.362968	0.82353	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.58	5.58	0.84498	.	0.000000	0.52532	D	0.000076	T	0.63954	0.2555	M	0.77616	2.38	0.33723	D	0.617296	D;D;D;D;P	0.89917	1.0;1.0;1.0;1.0;0.675	D;D;D;D;B	0.97110	0.999;1.0;0.999;0.986;0.43	T	0.56456	-0.7976	9	0.23302	T	0.38	.	19.9348	0.97133	0.0:0.0:1.0:0.0	.	4914;7002;7180;7000;4588	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	N	4588;7180;7002;4914;6676;4805;6891	ENSP00000244364:T4588N;ENSP00000359790:T7180N;ENSP00000359805:T7002N;ENSP00000400883:T4914N;ENSP00000393645:T6676N;ENSP00000359824:T4805N;ENSP00000354508:T6891N	ENSP00000244364:T4588N	T	-	2	0	DST	56450145	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.813000	0.99286	2.789000	0.95967	0.591000	0.81541	ACC	.		0.463	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
SKA2	348235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	57232319	57232319	+	Intron	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:57232319G>T	ENST00000330137.7	-	1	139				SKA2_ENST00000578105.1_Intron|SKA2_ENST00000581068.1_Intron|SKA2_ENST00000437036.2_Silent_p.L42L|SKA2_ENST00000583380.1_Intron|SKA2_ENST00000580541.1_Silent_p.L42L|SKA2_ENST00000583927.1_Intron|PRR11_ENST00000262293.4_5'Flank	NM_182620.3	NP_872426.1	Q8WVK7	SKA2_HUMAN	spindle and kinetochore associated complex subunit 2						cell division (GO:0051301)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|spindle microtubule (GO:0005876)	microtubule binding (GO:0008017)	p.L42L(2)		lung(4)	4						CCCCTTACCCGAGGCGGTTTA	0.612																																					p.L42L		.											.	.	.	2	Substitution - coding silent(2)	lung(2)	c.C126A						.						62.0	68.0	66.0					17																	57232319		1900	4094	5994	SO:0001627	intron_variant	348235	exon1			TTACCCGAGGCGG	BC017873	CCDS45747.1, CCDS45748.1	17q23.2	2013-01-17	2009-08-19	2009-08-19	ENSG00000182628	ENSG00000182628			28006	protein-coding gene	gene with protein product			"""family with sequence similarity 33, member A"""	FAM33A		17093495, 19289083, 18583474	Standard	NM_182620		Approved	FLJ12758	uc010dde.1	Q8WVK7		ENST00000330137.7:c.33+172C>A	17.37:g.57232319G>T		81	0		100	42	NM_001100595	A6NIL3|B3KPL3|E9PCB8	Silent	SNP	ENST00000330137.7	37	CCDS45747.1																																																																																			.		0.612	SKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445939.1	NM_182620	
RGS11	8786	hgsc.bcm.edu	37	16	320814	320814	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:320814G>A	ENST00000397770.3	-	14	1013	c.996C>T	c.(994-996)ttC>ttT	p.F332F	ARHGDIG_ENST00000464609.1_Intron|RGS11_ENST00000316163.5_Silent_p.F311F|RGS11_ENST00000359740.5_Silent_p.F321F			O94810	RGS11_HUMAN	regulator of G-protein signaling 11	332	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)	8		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				ATGCCTCCCAGAAGCTGAGGT	0.652																																					p.F332F		.											.	.	.	0			c.C996T						.						22.0	19.0	20.0					16																	320814		2202	4298	6500	SO:0001819	synonymous_variant	8786	exon14			CTCCCAGAAGCTG	AF035153	CCDS10403.1, CCDS42088.1, CCDS66884.1	16p13.3	2008-07-28	2007-08-14		ENSG00000076344	ENSG00000076344		"""Regulators of G-protein signaling"""	9993	protein-coding gene	gene with protein product		603895	"""regulator of G-protein signalling 11"""			9789084	Standard	NM_001286486		Approved		uc002cgj.1	O94810	OTTHUMG00000064893	ENST00000397770.3:c.996C>T	16.37:g.320814G>A		7	0		16	8	NM_183337	O75883|Q4TT71|Q4TT72	Silent	SNP	ENST00000397770.3	37	CCDS42088.1																																																																																			.		0.652	RGS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139325.2		
PADI6	353238	broad.mit.edu	37	1	17725151	17725154	+	RNA	DEL	CCCC	CCCC	-	rs563924649		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:17725151_17725154delCCCC	ENST00000434762.2	+	0	1740							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TGCTCCcccgcccccccccccacc	0.564																																					.													.	PADI6	51	0			.						.			150,8,13,59		73,3,1,0,2,1,0,5,1,29							0.0		dbSNP_129	1	179,12,77,190		87,0,0,5,6,0,0,38,1,92	no	intron	PADI6	NM_207421.3		160,3,1,5,8,1,0,43,2,121	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		58.5153,34.7826,52.1802				329,20,90,249						353238	.			CCCCCGCCCCCCC	AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17725155_17725158delCCCC		8	0		12	2	.	Q330K5|Q70SX3	RNA	DEL	ENST00000434762.2	37																																																																																				.		0.564	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4	NM_207421	
NUTM2B-AS1	101060691	broad.mit.edu	37	10	81443134	81443135	+	RNA	DEL	AC	AC	-	rs566408956	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr10:81443134_81443135delAC	ENST00000600376.1	-	0	54				RP11-119F19.2_ENST00000596088.1_RNA																							GACCTGCTAAACACGTATGAGC	0.564														14	0.00279553	0.0106	0.0	5008	,	,		20498	0.0		0.0	False		,,,				2504	0.0				.													.	.	.	0			.						.																																					0	.			TGCTAAACACGTA																													10.37:g.81443136_81443137delAC		4	0		9	3	.		RNA	DEL	ENST00000600376.1	37																																																																																				.		0.564	RP11-119F19.2-004	KNOWN	basic	antisense	antisense	OTTHUMT00000461766.1		
KRT8	3856	broad.mit.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																					p.S59A													KRT8,NS,carcinoma,0,5	KRT8	41	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)	c.T175G						.						12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	3856	exon2			TGCGGGAACCGGG	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	80	1		83	3	NM_001256282	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	.		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
DHX37	57647	broad.mit.edu	37	12	125437072	125437072	+	Missense_Mutation	SNP	T	T	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:125437072T>C	ENST00000308736.2	-	21	2838	c.2740A>G	c.(2740-2742)Atg>Gtg	p.M914V	DHX37_ENST00000544745.1_Missense_Mutation_p.M701V	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	914							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GGCGGCTGCATCTTGGGATCC	0.657																																					p.M914V													.	DHX37	114	0			c.A2740G						.						74.0	64.0	68.0					12																	125437072		2203	4300	6503	SO:0001583	missense	57647	exon21			GCTGCATCTTGGG	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2740A>G	12.37:g.125437072T>C	ENSP00000311135:p.Met914Val	26	0		25	3	NM_032656	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.497995	0.85069	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.03004	4.15;4.08	5.13	5.13	0.70059	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.12987	0.0315	M	0.74881	2.28	0.80722	D	1	P;D	0.53885	0.949;0.963	P;P	0.53593	0.73;0.695	T	0.00411	-1.1756	10	0.72032	D	0.01	-44.4367	14.9399	0.70986	0.0:0.0:0.0:1.0	.	701;914	F5H3Y4;Q8IY37	.;DHX37_HUMAN	V	914;701	ENSP00000311135:M914V;ENSP00000439009:M701V	ENSP00000311135:M914V	M	-	1	0	DHX37	124003025	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.268000	0.78473	1.928000	0.55862	0.379000	0.24179	ATG	.		0.657	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
OTX2	5015	broad.mit.edu	37	14	57280005	57280005	+	5'Flank	DEL	T	T	-	rs375495685		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr14:57280005delT	ENST00000555006.1	-	0	0				OTX2-AS1_ENST00000534909.2_RNA|OTX2_ENST00000554559.1_5'Flank|OTX2-AS1_ENST00000554725.1_RNA|OTX2-AS1_ENST00000554358.1_RNA|OTX2-AS1_ENST00000554428.1_RNA|OTX2_ENST00000339475.5_5'Flank			P32243	OTX2_HUMAN	orthodenticle homeobox 2						axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					GGGGGGGGGGTGAAAGACTTT	0.483																																					.													.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			GGGGGGTGAAAGA	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338		14.37:g.57280005delT	Exception_encountered	5	0		7	4	.	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	RNA	DEL	ENST00000555006.1	37	CCDS41960.1																																																																																			.		0.483	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.	
GOLGA6L4	643707	broad.mit.edu	37	15	82934831	82934831	+	Missense_Mutation	SNP	A	A	T	rs565687563	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr15:82934831A>T	ENST00000559949.1	-	6	808	c.749T>A	c.(748-750)cTa>cAa	p.L250Q	RP13-996F3.5_ENST00000560844.1_5'UTR																NS(1)	1						CTGTTCACGTAGCCTCTCCTC	0.562													.|||	18	0.00359425	0.0121	0.0029	5008	,	,		27624	0.0		0.0	False		,,,				2504	0.0				.													.	.	.	0			.						.																																			SO:0001583	missense	0	.			TCACGTAGCCTCT																												ENST00000559949.1:c.749T>A	15.37:g.82934831A>T	ENSP00000453573:p.Leu250Gln	100	1		126	6	.		Missense_Mutation	SNP	ENST00000559949.1	37		.	.	.	.	.	.	.	.	.	.	.	2.667	-0.278499	0.05679	.	.	ENSG00000215749	ENST00000426571	.	.	.	.	.	.	.	.	.	.	.	T	0.48943	0.1528	.	.	.	.	.	.	D	0.69078	0.997	D	0.74674	0.984	T	0.54043	-0.8352	5	0.11794	T	0.64	.	4.4978	0.11848	0.9993:0.0:7.0E-4:0.0	.	236	E7ES67	.	Q	236	.	ENSP00000405228:L236Q	L	-	2	0	AC126339.1	80731886	0.000000	0.05858	0.129000	0.21949	0.129000	0.20672	-2.611000	0.00885	0.056000	0.16144	0.055000	0.15244	CTA	.		0.562	RP13-996F3.5-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000419268.1		
PKD1L2	114780	broad.mit.edu	37	16	81155069	81155069	+	RNA	DEL	A	A	-	rs557576474		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:81155069delA	ENST00000534142.1	-	0	1000				PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000525539.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						actccatctcaaaaaaaaaaa	0.527																																					.													.	PKD1L2	361	0			.						.																																					114780	.			CATCTCAAAAAAA	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81155069delA		4	0		6	2	.	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	DEL	ENST00000534142.1	37																																																																																				.		0.527	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	polymorphic_pseudogene	OTTHUMT00000387969.1		
PPL	5493	broad.mit.edu	37	16	4953901	4953901	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr16:4953901G>T	ENST00000345988.2	-	3	392	c.303C>A	c.(301-303)gaC>gaA	p.D101E	PPL_ENST00000590782.2_Missense_Mutation_p.D101E	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	101					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CGGCGATCATGTCCCCCTGTG	0.617																																					p.D101E													PPL,head_neck,malignant_melanoma,-2,1	PPL	168	0			c.C303A						.						102.0	90.0	94.0					16																	4953901		2197	4300	6497	SO:0001583	missense	5493	exon3			GATCATGTCCCCC	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.303C>A	16.37:g.4953901G>T	ENSP00000340510:p.Asp101Glu	62	0		59	3	NM_002705	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	G	4.665	0.123643	0.08931	.	.	ENSG00000118898	ENST00000345988	T	0.33654	1.4	5.19	4.02	0.46733	.	0.058760	0.64402	D	0.000002	T	0.40619	0.1124	L	0.31804	0.96	0.36592	D	0.874153	D	0.76494	0.999	D	0.78314	0.991	T	0.19289	-1.0310	10	0.02654	T	1	.	13.6575	0.62346	0.1346:0.0:0.8654:0.0	.	101	O60437	PEPL_HUMAN	E	101	ENSP00000340510:D101E	ENSP00000340510:D101E	D	-	3	2	PPL	4893902	1.000000	0.71417	1.000000	0.80357	0.273000	0.26683	3.126000	0.50477	2.406000	0.81754	0.591000	0.81541	GAC	.		0.617	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
LOC101927755	101927755	broad.mit.edu	37	17	58066651	58066651	+	lincRNA	SNP	C	C	T	rs376360537		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:58066651C>T	ENST00000586209.1	+	0	158																											ACTGGTAAAGCTGTTTAAGAG	0.333																																					.													.	.	.	0			.						.																																					0	.			GTAAAGCTGTTTA																													17.37:g.58066651C>T		53	1		64	4	.		RNA	SNP	ENST00000586209.1	37																																																																																				.		0.333	RP11-178C3.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000449162.1		
STXBP2	6813	broad.mit.edu	37	19	7702047	7702048	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:7702047_7702048delGG	ENST00000221283.5	+	1	43_44	c.12_13delGG	c.(10-15)tcggggfs	p.G5fs	STXBP2_ENST00000414284.2_Frame_Shift_Del_p.G5fs|STXBP2_ENST00000441779.2_Frame_Shift_Del_p.G5fs|CTD-3214H19.4_ENST00000595866.1_Intron|CTD-3214H19.6_ENST00000601797.1_RNA	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	5					leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						TGGCGCCCTCGGGGCTGAAGGC	0.767																																					p.4_5del													.	STXBP2	63	0			c.12_13del						.																																			SO:0001589	frameshift_variant	6813	exon1			GCCCTCGGGGCTG	U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.12_13delGG	19.37:g.7702049_7702050delGG	ENSP00000221283:p.Gly5fs	6	0		12	8	NM_006949	B4E175|E7EQD5|Q9BU65	Frame_Shift_Del	DEL	ENST00000221283.5	37	CCDS12181.1																																																																																			.		0.767	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460963.1	NM_006949	
OLFM2	93145	broad.mit.edu	37	19	10047006	10047006	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:10047006delG	ENST00000264833.4	-	1	222	c.37delC	c.(37-39)ctgfs	p.L14fs		NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	14					protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)				breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						GAGCACAGCAGCAGCAGCAGC	0.796																																					p.L13fs													.	OLFM2	42	0			c.37delC						.						1.0	1.0	1.0					19																	10047006		774	1884	2658	SO:0001589	frameshift_variant	93145	exon1			ACAGCAGCAGCAG	AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.37delC	19.37:g.10047006delG	ENSP00000264833:p.Leu14fs	7	0		6	2	NM_058164	Q6IMJ3|Q96FC2	Frame_Shift_Del	DEL	ENST00000264833.4	37	CCDS12221.1																																																																																			.		0.796	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451119.1		
TDRD12	91646	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	33306507	33306507	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:33306507G>A	ENST00000444215.2	+	26	3615	c.3295G>A	c.(3295-3297)Gaa>Aaa	p.E1099K				Q587J7	TDR12_HUMAN	tudor domain containing 12	1099					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					AGCTTGTGAAGAAAGCCTAAG	0.393																																					.													.	.	.	0			.						.																																			SO:0001583	missense	91646	.			TGTGAAGAAAGCC	AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.3295G>A	19.37:g.33306507G>A	ENSP00000416248:p.Glu1099Lys	78	0		88	39	.		Missense_Mutation	SNP	ENST00000444215.2	37		.	.	.	.	.	.	.	.	.	.	G	14.02	2.411595	0.42817	.	.	ENSG00000173809	ENST00000444215	T	0.23147	1.92	5.59	5.59	0.84812	.	0.453330	0.18798	N	0.130870	T	0.16896	0.0406	.	.	.	0.34213	D	0.674547	B	0.12013	0.005	B	0.09377	0.004	T	0.17684	-1.0361	9	0.21014	T	0.42	-2.4385	11.0353	0.47797	0.1176:0.0:0.8824:0.0	.	1099	Q587J7	TDR12_HUMAN	K	1099	ENSP00000416248:E1099K	ENSP00000416248:E1099K	E	+	1	0	TDRD12	37998347	0.491000	0.26019	0.163000	0.22734	0.262000	0.26303	1.481000	0.35476	2.644000	0.89710	0.561000	0.74099	GAA	.		0.393	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000435933.1	NM_001015890	
C19orf68	374920	broad.mit.edu	37	19	48697909	48697909	+	Splice_Site	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:48697909G>T	ENST00000328759.7	+	4	620		c.e4-1		ZNF114_ENST00000597695.1_Intron|CARD8_ENST00000600800.1_Intron			Q86XI8	CS068_HUMAN	chromosome 19 open reading frame 68						hematopoietic progenitor cell differentiation (GO:0002244)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)											CCCGCCCGCAGGTGAAGCTGG	0.667																																					.													.	.	.	0			.						.																																			SO:0001630	splice_region_variant	374920	.			CCCGCAGGTGAAG	BC043386	CCDS74411.1	19q13.32	2008-08-06			ENSG00000185453	ENSG00000185453			34495	protein-coding gene	gene with protein product						12477932	Standard	NM_199341		Approved	LOC374920	uc002pic.3	Q86XI8		ENST00000328759.7:c.589-1G>T	19.37:g.48697909G>T		26	0		27	3	.		Splice_Site	SNP	ENST00000328759.7	37		.	.	.	.	.	.	.	.	.	.	.	18.37	3.608089	0.66558	.	.	ENSG00000185453	ENST00000328759	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6093	0.68504	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C19orf68	53389721	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.538000	0.67193	2.132000	0.65825	0.552000	0.68991	.	.		0.667	C19orf68-001	KNOWN	non_canonical_other|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000465598.1	XM_001713770	Intron
ALMS1P	200420	broad.mit.edu	37	2	73901980	73901980	+	RNA	SNP	G	G	A	rs200040304	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:73901980G>A	ENST00000450720.1	+	0	933					NR_003683.2		Q96L16	ALM1L_HUMAN	Alstrom syndrome 1 pseudogene						endosomal transport (GO:0016197)|regulation of stress fiber assembly (GO:0051492)												CTTCCTGGCTGTCCAGAAGAA	0.478													.|||	32	0.00638978	0.0113	0.0216	5008	,	,		20054	0.0		0.002	False		,,,				2504	0.0				.													.	.	.	0			.						.						216.0	170.0	184.0					2																	73901980		692	1591	2283			0	.			CTGGCTGTCCAGA	BC014492		2p13.2	2008-01-31	2008-01-31	2008-01-31	ENSG00000163016	ENSG00000163016			29586	pseudogene	pseudogene			"""Alstrom syndrome 1-like"""	ALMS1L		12477932	Standard	NR_003683		Approved		uc010yrl.2	Q96L16	OTTHUMG00000152773		2.37:g.73901980G>A		76	1		106	5	.		RNA	SNP	ENST00000450720.1	37																																																																																				G|0.999;A|0.001		0.478	ALMS1P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000339824.1	NR_003683	
IFT52	51098	broad.mit.edu	37	20	42264632	42264632	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr20:42264632G>A	ENST00000373030.3	+	11	1120	c.990G>A	c.(988-990)ccG>ccA	p.P330P	IFT52_ENST00000373039.4_Silent_p.P330P	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	330					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TTGAGACGCCGCTGCCAACCC	0.532																																					p.P330P													.	IFT52	40	0			c.G990A						.						88.0	82.0	84.0					20																	42264632		2203	4300	6503	SO:0001819	synonymous_variant	51098	exon11			GACGCCGCTGCCA	AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.990G>A	20.37:g.42264632G>A		31	0		32	3	NM_016004	B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Silent	SNP	ENST00000373030.3	37	CCDS33470.1																																																																																			.		0.532	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079317.1	NM_016004	
ASCC2	84164	broad.mit.edu	37	22	30212002	30212002	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr22:30212002A>G	ENST00000397771.2	-	7	779	c.602T>C	c.(601-603)aTc>aCc	p.I201T	ASCC2_ENST00000542393.1_Missense_Mutation_p.I125T|ASCC2_ENST00000307790.3_Missense_Mutation_p.I201T|ASCC2_ENST00000478812.1_5'UTR			Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit 2	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					endometrium(3)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			TACCTGAAGGATGGTAGGCAG	0.512																																					p.I201T													.	ASCC2	53	0			c.T602C						.						126.0	105.0	112.0					22																	30212002		2203	4300	6503	SO:0001583	missense	84164	exon6			TGAAGGATGGTAG	AY013289	CCDS13869.1, CCDS56226.1	22q12.1	2004-07-27			ENSG00000100325	ENSG00000100325			24103	protein-coding gene	gene with protein product	"""ASC 1 complex subunit P100"""	614216				12077347, 9847074	Standard	NM_032204		Approved	ASC1p100, FLJ21588, DKFZp586O0223	uc003agr.3	Q9H1I8	OTTHUMG00000067658	ENST00000397771.2:c.602T>C	22.37:g.30212002A>G	ENSP00000380877:p.Ile201Thr	59	0		74	3	NM_032204	B7Z8E0|F5H6J9|Q4TT54|Q8TAZ0|Q9H711|Q9H9D6	Missense_Mutation	SNP	ENST00000397771.2	37	CCDS13869.1	.	.	.	.	.	.	.	.	.	.	A	17.37	3.373588	0.61624	.	.	ENSG00000100325	ENST00000307790;ENST00000397771;ENST00000542393;ENST00000431535	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	5.73	5.73	0.89815	.	0.189923	0.48767	D	0.000161	T	0.31888	0.0811	L	0.43152	1.355	0.48975	D	0.999734	B;B	0.21688	0.046;0.059	B;B	0.29862	0.108;0.05	T	0.06463	-1.0825	10	0.46703	T	0.11	-21.1305	15.2025	0.73150	1.0:0.0:0.0:0.0	.	125;201	F5H6J9;Q9H1I8	.;ASCC2_HUMAN	T	201;201;125;201	ENSP00000305502:I201T;ENSP00000380877:I201T;ENSP00000437570:I125T;ENSP00000412382:I201T	ENSP00000305502:I201T	I	-	2	0	ASCC2	28542002	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	8.698000	0.91311	2.185000	0.69588	0.460000	0.39030	ATC	.		0.512	ASCC2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322127.1	NM_032204	
SMC1B	27127	broad.mit.edu	37	22	45795219	45795219	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr22:45795219A>G	ENST00000357450.4	-	6	868	c.869T>C	c.(868-870)cTt>cCt	p.L290P	SMC1B_ENST00000404354.3_Missense_Mutation_p.L290P	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	290					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		CTGATTTAAAAGGGTTTCAAC	0.323																																					p.L290P													.	SMC1B	215	0			c.T869C						.						110.0	94.0	99.0					22																	45795219		1808	4064	5872	SO:0001583	missense	27127	exon6			TTTAAAAGGGTTT	AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.869T>C	22.37:g.45795219A>G	ENSP00000350036:p.Leu290Pro	74	0		83	3	NM_148674	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	ENST00000357450.4	37	CCDS43027.1	.	.	.	.	.	.	.	.	.	.	A	12.02	1.811676	0.32053	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	T;T	0.79845	-1.31;3.24	5.7	5.7	0.88788	RecF/RecN/SMC (1);	0.682217	0.13035	N	0.418970	T	0.77961	0.4209	L	0.34521	1.04	0.41635	D	0.989045	P;P;B	0.36599	0.502;0.56;0.451	P;B;B	0.46419	0.516;0.3;0.306	T	0.75431	-0.3320	10	0.48119	T	0.1	.	8.0929	0.30811	0.8453:0.0:0.1547:0.0	.	290;290;290	Q8NDV3;Q8NDV3-2;Q8NDV3-3	SMC1B_HUMAN;.;.	P	290	ENSP00000350036:L290P;ENSP00000385902:L290P	ENSP00000350036:L290P	L	-	2	0	SMC1B	44173883	0.809000	0.29036	1.000000	0.80357	0.922000	0.55478	3.841000	0.55850	2.175000	0.68902	0.533000	0.62120	CTT	.		0.323	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674	
CCK	885	broad.mit.edu	37	3	42304951	42304951	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:42304951G>T	ENST00000396169.2	-	4	1077	c.172C>A	c.(172-174)Ctg>Atg	p.L58M	CCK_ENST00000334681.5_Missense_Mutation_p.L58M|CCK_ENST00000434608.1_Missense_Mutation_p.L58M	NM_000729.4	NP_000720.1	P06307	CCKN_HUMAN	cholecystokinin	58					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axonogenesis (GO:0007409)|behavioral fear response (GO:0001662)|eating behavior (GO:0042755)|negative regulation of appetite (GO:0032099)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein oligomerization (GO:0032461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|release of cytochrome c from mitochondria (GO:0001836)|signal transduction (GO:0007165)	axon (GO:0030424)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|terminal bouton (GO:0043195)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6		Ovarian(412;0.0728)		KIRC - Kidney renal clear cell carcinoma(284;0.219)		AGGGCGCCCAGGTGCGCTCGG	0.667																																					p.L58M													.	CCK	15	0			c.C172A						.						64.0	75.0	71.0					3																	42304951		2201	4300	6501	SO:0001583	missense	885	exon4			CGCCCAGGTGCGC		CCDS2696.1	3p22.1	2013-02-25			ENSG00000187094	ENSG00000187094		"""Endogenous ligands"""	1569	protein-coding gene	gene with protein product	"""prepro-cholecystokinin"", ""cholecystokinin triacontatriapeptide"""	118440				3856870	Standard	NM_001174138		Approved		uc021wwk.1	P06307	OTTHUMG00000131796	ENST00000396169.2:c.172C>A	3.37:g.42304951G>T	ENSP00000379472:p.Leu58Met	26	0		37	3	NM_000729		Missense_Mutation	SNP	ENST00000396169.2	37	CCDS2696.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.924684	0.73213	.	.	ENSG00000187094	ENST00000396169;ENST00000334681;ENST00000434608	T;T;T	0.26518	1.73;1.73;1.73	5.36	4.47	0.54385	Gastrin/cholecystokinin peptide hormone (1);	0.253635	0.39834	N	0.001255	T	0.49898	0.1584	M	0.86178	2.8	0.39087	D	0.961014	D;D	0.89917	1.0;0.998	D;D	0.79784	0.993;0.977	T	0.55724	-0.8096	10	0.62326	D	0.03	-32.5924	7.5888	0.28008	0.0845:0.0:0.6603:0.2553	.	58;58	B7Z6Q9;P06307	.;CCKN_HUMAN	M	58	ENSP00000379472:L58M;ENSP00000335657:L58M;ENSP00000409124:L58M	ENSP00000335657:L58M	L	-	1	2	CCK	42279955	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.831000	0.48144	2.675000	0.91044	0.655000	0.94253	CTG	.		0.667	CCK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343380.1	NM_000729	
RP1-167F1.2	0	broad.mit.edu	37	6	19614330	19614331	+	RNA	DEL	AT	AT	-	rs139949355|rs57714797		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:19614330_19614331delAT	ENST00000432171.2	-	0	366																											AGGTAGataaataaatatatat	0.322																																					.													.	.	.	0			.						.																																					0	.			AGATAAATAAATA																													6.37:g.19614330_19614331delAT		9	0		15	2	.		RNA	DEL	ENST00000432171.2	37																																																																																				.		0.322	RP1-167F1.2-001	KNOWN	basic	antisense	antisense	OTTHUMT00000039973.2		
PRSS3P2	154754	broad.mit.edu	37	7	142482292	142482292	+	RNA	SNP	A	A	C	rs371485584		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr7:142482292A>C	ENST00000603901.1	+	0	672					NR_001296.3		Q8NHM4	TRY6_HUMAN	protease, serine, 3 pseudogene 2						endothelial cell migration (GO:0043542)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)										CCCAGAAGAGAAGGCCTGGAG	0.527																																					.													PRSS2,NS,carcinoma,0,3	.	.	0			.						.																																					0	.			GAAGAGAAGGCCT			7q34	2012-03-06			ENSG00000250606	ENSG00000275896			43788	pseudogene	pseudogene	"""trypsinogen C"""						Standard	NR_001296		Approved	TRY6	uc011ksq.2	Q8NHM4	OTTHUMG00000158904		7.37:g.142482292A>C		16	0		42	7	.		RNA	SNP	ENST00000603901.1	37																																																																																				.		0.527	PRSS3P2-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000470000.1	NR_001296	
CYP4F59P	100132340	broad.mit.edu	37	9	43029805	43029805	+	lincRNA	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr9:43029805C>G	ENST00000453998.1	-	0	565									cytochrome P450, family 4, subfamily F, polypeptide 59, pseudogene																		TGGGCAGAACCACAGCCTGAT	0.532																																					.													.	.	.	0			.						.																																					0	.			CAGAACCACAGCC			9p12	2013-07-25			ENSG00000233244			"""Cytochrome P450s"""	39947	pseudogene	pseudogene							Standard	NG_031982		Approved	CYP4F-se14[6:8]			OTTHUMG00000013290		9.37:g.43029805C>G		45	1		64	5	.		RNA	SNP	ENST00000453998.1	37																																																																																				.		0.532	CYP4F59P-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000037070.1		
LINC00092	100188953	broad.mit.edu	37	9	98782939	98782939	+	lincRNA	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr9:98782939G>A	ENST00000412122.2	-	0	800					NR_024129.1				long intergenic non-protein coding RNA 92																		AGCTGCAGATGATGGAATGCC	0.547																																					.													.	.	.	0			.						.																																					0	.			GCAGATGATGGAA	BC043559		9q22.32	2012-10-12	2011-08-11	2011-08-11	ENSG00000225194	ENSG00000225194		"""Long non-coding RNAs"""	31408	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 92"""	NCRNA00092			Standard	NR_024129		Approved	bA346B7.1	uc004avx.4		OTTHUMG00000020288		9.37:g.98782939G>A		10	0		8	3	.		RNA	SNP	ENST00000412122.2	37																																																																																				.		0.547	LINC00092-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000053246.2		
ESX1	80712	broad.mit.edu	37	X	103495187	103495187	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chrX:103495187C>A	ENST00000372588.4	-	4	1026	c.943G>T	c.(943-945)Ggg>Tgg	p.G315W		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	315	15 X 9 AA tandem repeats of P-P-x-x-P-x- P-P-x.				labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						ATGGGCGGCCCGGTTGGCACA	0.786																																					p.G315W	Pancreas(200;1705 2227 25194 28471 45274)												.	ESX1	57	0			c.G943T						.						3.0	4.0	4.0					X																	103495187		1182	2667	3849	SO:0001583	missense	80712	exon4			GCGGCCCGGTTGG	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.943G>T	X.37:g.103495187C>A	ENSP00000361669:p.Gly315Trp	11	0		12	3	NM_153448	B0QYU3|Q7Z6K7	Missense_Mutation	SNP	ENST00000372588.4	37	CCDS14516.1	.	.	.	.	.	.	.	.	.	.	c	12.32	1.903780	0.33628	.	.	ENSG00000123576	ENST00000372588	T	0.73469	-0.75	2.92	1.99	0.26369	.	.	.	.	.	T	0.81847	0.4909	M	0.62723	1.935	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.69266	-0.5190	9	0.87932	D	0	.	8.4433	0.32828	0.235:0.765:0.0:0.0	.	315	Q8N693	ESX1_HUMAN	W	315	ENSP00000361669:G315W	ENSP00000361669:G315W	G	-	1	0	ESX1	103381843	0.000000	0.05858	0.013000	0.15412	0.089000	0.18198	-0.357000	0.07651	0.228000	0.21019	0.479000	0.44913	GGG	.		0.786	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057763.2	NM_153448	
WDR44	54521	broad.mit.edu	37	X	117480529	117480529	+	Silent	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chrX:117480529C>T	ENST00000254029.3	+	1	458	c.63C>T	c.(61-63)ggC>ggT	p.G21G	WDR44_ENST00000371825.3_Silent_p.G21G|WDR44_ENST00000493448.1_3'UTR|WDR44_ENST00000371822.5_Silent_p.G21G	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	21	Binding activity.					endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						ACCTAGGGGGCGGCTACCCCG	0.642																																					p.G21G													.	WDR44	188	0			c.C63T						.						45.0	43.0	43.0					X																	117480529		2203	4300	6503	SO:0001819	synonymous_variant	54521	exon1			AGGGGGCGGCTAC	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.63C>T	X.37:g.117480529C>T		154	0		205	4	NM_001184965	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Silent	SNP	ENST00000254029.3	37	CCDS14572.1																																																																																			.		0.642	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045	
FAM131C	348487	ucsc.edu	37	1	16385007	16385007	+	Silent	SNP	C	C	T	rs2019769	byFrequency	TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:16385007C>T	ENST00000375662.4	-	7	951	c.768G>A	c.(766-768)ggG>ggA	p.G256G	FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C	256	Pro-rich.									large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GGGGGTGGGTCCCACCCTCGG	0.721																																					p.G256G													.	FAM131C	21	0			c.G768A						.						3.0	3.0	3.0					1																	16385007		1442	3239	4681	SO:0001819	synonymous_variant	348487	exon7			GTGGGTCCCACCC		CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.768G>A	1.37:g.16385007C>T		65	0		83	10	NM_182623	Q5T5Q5|Q8N3X3|Q8N9P9	Silent	SNP	ENST00000375662.4	37	CCDS41270.1																																																																																			C|1.000;|0.000		0.721	FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026319.1	NM_182623	
TET3	200424	ucsc.edu	37	2	74274265	74274265	+	Silent	SNP	T	T	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:74274265T>C	ENST00000409262.3	+	1	816	c.816T>C	c.(814-816)ccT>ccC	p.P272P		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	272					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCTCATGGCCTGTGGTTCCTC	0.582																																					p.P272P													.	TET3	101	0			c.T816C						.						66.0	68.0	67.0					2																	74274265		1996	4171	6167	SO:0001819	synonymous_variant	200424	exon1			ATGGCCTGTGGTT		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.816T>C	2.37:g.74274265T>C		29	0		38	4	NM_144993	A6NEI3|Q86Z24|Q8TBM9	Silent	SNP	ENST00000409262.3	37	CCDS46339.1																																																																																			.		0.582	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
PRSS1	5644	ucsc.edu	37	7	142459667	142459667	+	Silent	SNP	G	G	A	rs142476093		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr7:142459667G>A	ENST00000311737.7	+	3	249	c.243G>A	c.(241-243)ctG>ctA	p.L81L	PRSS1_ENST00000486171.1_Silent_p.L95L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	81	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TCGAAGTCCTGGAGGGGAATG	0.542																																					p.L81L													.	PRSS1	68	0			c.G243A						.						213.0	200.0	204.0					7																	142459667		2203	4300	6503	SO:0001819	synonymous_variant	5644	exon3			AGTCCTGGAGGGG	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.243G>A	7.37:g.142459667G>A		49	1		98	12	NM_002769	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	ENST00000311737.7	37	CCDS5872.1																																																																																			C|0.000;G|1.000		0.542	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
ZNF511	118472	ucsc.edu;bcgsc.ca	37	10	135123330	135123330	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr10:135123330C>T	ENST00000359035.3	+	3	281	c.278C>T	c.(277-279)gCc>gTc	p.A93V	TUBGCP2_ENST00000417178.2_5'Flank|TUBGCP2_ENST00000470829.1_5'Flank|ZNF511_ENST00000463816.2_Intron|ZNF511_ENST00000368554.4_Missense_Mutation_p.A28V|ZNF511_ENST00000361518.5_Missense_Mutation_p.A93V|TUBGCP2_ENST00000368563.2_5'Flank			Q8NB15	ZN511_HUMAN	zinc finger protein 511	93					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)		GTGTTCGATGCCCTGGACGAC	0.632																																					p.A93V													.	ZNF511	17	0			c.C278T						.						109.0	84.0	92.0					10																	135123330		2203	4300	6503	SO:0001583	missense	118472	exon3			TCGATGCCCTGGA	AK091711	CCDS7677.1	10q26.3	2010-04-12			ENSG00000198546	ENSG00000198546		"""Zinc fingers, C2H2-type"""	28445	protein-coding gene	gene with protein product						12477932	Standard	NM_145806		Approved	MGC30006	uc001lmj.1	Q8NB15	OTTHUMG00000019317	ENST00000359035.3:c.278C>T	10.37:g.135123330C>T	ENSP00000351929:p.Ala93Val	23	0		31	4	NM_145806	A8K8L5|Q8WUP1|Q96BV2	Missense_Mutation	SNP	ENST00000359035.3	37		.	.	.	.	.	.	.	.	.	.	C	11.93	1.785039	0.31593	.	.	ENSG00000198546	ENST00000361518;ENST00000359035;ENST00000368554	D;D;D	0.88664	-2.41;-2.41;-2.41	5.2	1.25	0.21368	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.540286	0.20648	N	0.088276	T	0.79009	0.4374	L	0.27053	0.805	0.09310	N	1	B;B;B	0.22146	0.065;0.001;0.006	B;B;B	0.19391	0.025;0.004;0.011	T	0.66135	-0.5999	10	0.44086	T	0.13	-26.669	6.7365	0.23413	0.0:0.6427:0.1347:0.2226	.	93;28;93	Q8NB15;E1U340;Q8NB15-2	ZN511_HUMAN;.;.	V	93;93;28	ENSP00000355251:A93V;ENSP00000351929:A93V;ENSP00000357542:A28V	ENSP00000351929:A93V	A	+	2	0	ZNF511	134973320	0.000000	0.05858	0.000000	0.03702	0.458000	0.32498	0.567000	0.23608	0.040000	0.15660	-0.133000	0.14855	GCC	.		0.632	ZNF511-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000051143.1	NM_145806	
LAMA1	284217	ucsc.edu	37	18	7037680	7037680	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr18:7037680G>A	ENST00000389658.3	-	12	1727	c.1634C>T	c.(1633-1635)gCa>gTa	p.A545V		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	545	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CCCGCCTAGTGCATCTTGCTG	0.522																																					p.A545V													.	LAMA1	458	0			c.C1634T						.						100.0	84.0	89.0					18																	7037680		2203	4300	6503	SO:0001583	missense	284217	exon12			CCTAGTGCATCTT	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1634C>T	18.37:g.7037680G>A	ENSP00000374309:p.Ala545Val	27	0		40	4	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	G	6.350	0.432656	0.12045	.	.	ENSG00000101680	ENST00000389658	T	0.17528	2.27	5.43	-10.8	0.00216	Laminin B type IV (1);	0.820505	0.10972	N	0.613729	T	0.06600	0.0169	L	0.33485	1.01	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27536	-1.0071	10	0.11182	T	0.66	.	3.0389	0.06132	0.4428:0.0675:0.2607:0.2291	.	545	P25391	LAMA1_HUMAN	V	545	ENSP00000374309:A545V	ENSP00000374309:A545V	A	-	2	0	LAMA1	7027680	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.070000	0.03440	-1.943000	0.01039	-1.036000	0.02392	GCA	.		0.522	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
NOTCH3	4854	ucsc.edu	37	19	15290252	15290252	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:15290252G>T	ENST00000263388.2	-	21	3458	c.3383C>A	c.(3382-3384)tCc>tAc	p.S1128Y		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1128	EGF-like 29; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GCAGGGCTGGGAGGCACACTC	0.607																																					p.S1128Y													.	NOTCH3	340	0			c.C3383A						.						106.0	90.0	95.0					19																	15290252		2203	4300	6503	SO:0001583	missense	4854	exon21			GGCTGGGAGGCAC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3383C>A	19.37:g.15290252G>T	ENSP00000263388:p.Ser1128Tyr	38	0		42	4	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299586	0.81136	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.88354	-2.37	4.45	4.45	0.53987	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.94545	0.8243	M	0.92077	3.27	0.80722	D	1	D;B	0.56035	0.974;0.356	P;B	0.57371	0.819;0.398	D	0.94949	0.8098	9	0.41790	T	0.15	.	15.8684	0.79084	0.0:0.0:1.0:0.0	.	1079;1128	Q59FL3;Q9UM47	.;NOTC3_HUMAN	Y	1128;1078	ENSP00000263388:S1128Y	ENSP00000263388:S1128Y	S	-	2	0	NOTCH3	15151252	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.298000	0.51818	2.017000	0.59298	0.561000	0.74099	TCC	.		0.607	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
H6PD	9563	bcgsc.ca	37	1	9305083	9305083	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:9305083G>T	ENST00000377403.2	+	2	392	c.90G>T	c.(88-90)ctG>ctT	p.L30L	H6PD_ENST00000602477.1_Silent_p.L41L	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	30	Glucose 1-dehydrogenase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		CCATAATCCTGCTGGGAGCAA	0.567																																					p.L30L													.	H6PD	71	0			c.G90T						.						61.0	61.0	61.0					1																	9305083		2203	4300	6503	SO:0001819	synonymous_variant	9563	exon2			AATCCTGCTGGGA	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.90G>T	1.37:g.9305083G>T		18	0		18	3	NM_004285	Q4TT33|Q66I35|Q68DT3	Silent	SNP	ENST00000377403.2	37	CCDS101.1																																																																																			.		0.567	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285	
ETV3L	440695	bcgsc.ca	37	1	157062558	157062558	+	Silent	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr1:157062558G>T	ENST00000454449.2	-	5	1253	c.969C>A	c.(967-969)ggC>ggA	p.G323G		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	323					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				TGGGATCCAGGCCTCCCTTTG	0.607																																					p.G323G													.	ETV3L	73	0			c.C969A						.						69.0	67.0	68.0					1																	157062558		2203	4300	6503	SO:0001819	synonymous_variant	440695	exon5			ATCCAGGCCTCCC	AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.969C>A	1.37:g.157062558G>T		51	0		54	4	NM_001004341		Silent	SNP	ENST00000454449.2	37	CCDS30893.1																																																																																			.		0.607	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099024.2	NM_001004341	
ABCB11	8647	bcgsc.ca	37	2	169792945	169792945	+	Splice_Site	SNP	T	T	C			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr2:169792945T>C	ENST00000263817.6	-	22	2735		c.e22-2			NM_003742.2	NP_003733.2	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 11						bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|canalicular bile acid transport (GO:0015722)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|bile acid-exporting ATPase activity (GO:0015432)|canalicular bile acid transmembrane transporter activity (GO:0015126)|sodium-exporting ATPase activity, phosphorylative mechanism (GO:0008554)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(16)|lung(26)|ovary(3)|stomach(1)	57					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Chlorpromazine(DB00477)|Cimetidine(DB00501)|Clofazimine(DB00845)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Digoxin(DB00390)|Doxorubicin(DB00997)|Ethinyl Estradiol(DB00977)|Fluorescein(DB00693)|Fusidic Acid(DB02703)|Glyburide(DB01016)|Ketoconazole(DB01026)|Novobiocin(DB01051)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Ponatinib(DB08901)|Pravastatin(DB00175)|Progesterone(DB00396)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Tamoxifen(DB00675)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	GCCGGCAGCCTGCAAACCAAA	0.443																																					.													.	ABCB11	136	0			c.2611-2A>G	GRCh37	CS081857	ABCB11	S		.						70.0	70.0	70.0					2																	169792945		1944	4137	6081	SO:0001630	splice_region_variant	8647	exon23			GCAGCCTGCAAAC	AF091582	CCDS46444.1	2q24	2012-03-14			ENSG00000073734	ENSG00000073734		"""ATP binding cassette transporters / subfamily B"""	42	protein-coding gene	gene with protein product	"""ABC member 16, MDR/TAP subfamily"""	603201	"""progressive familial intrahepatic cholestasis 2"", ""bile salt export pump"""	BSEP, PFIC2		9806540	Standard	NM_003742		Approved	ABC16, SPGP, PFIC-2, PGY4	uc002ueo.1	O95342	OTTHUMG00000154039	ENST00000263817.6:c.2611-2A>G	2.37:g.169792945T>C		48	0		55	4	NM_003742	Q53TL2|Q9UNB2	Splice_Site	SNP	ENST00000263817.6	37	CCDS46444.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.380120	0.82682	.	.	ENSG00000073734	ENST00000263817	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6231	0.76824	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCB11	169501191	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.698000	0.84413	2.096000	0.63516	0.459000	0.35465	.	.		0.443	ABCB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333616.2	NM_003742	Intron
AADAC	13	bcgsc.ca	37	3	151545859	151545859	+	Missense_Mutation	SNP	C	C	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr3:151545859C>A	ENST00000232892.7	+	5	1225	c.1099C>A	c.(1099-1101)Cat>Aat	p.H367N	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	367					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			GACTCATAACCATGTTGAGGA	0.398																																					p.H367N	Ovarian(30;839 841 2699 32801 46334)												.	AADAC	49	0			c.C1099A						.						99.0	97.0	97.0					3																	151545859		2203	4299	6502	SO:0001583	missense	13	exon5			CATAACCATGTTG	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.1099C>A	3.37:g.151545859C>A	ENSP00000232892:p.His367Asn	45	0		58	4	NM_001086	A8K3L3|D3DNJ6|Q8N1A9	Missense_Mutation	SNP	ENST00000232892.7	37	CCDS33877.1	.	.	.	.	.	.	.	.	.	.	C	14.73	2.622932	0.46840	.	.	ENSG00000114771	ENST00000232892	T	0.10960	2.82	4.79	3.92	0.45320	Alpha/beta hydrolase fold-3 (1);	0.048768	0.85682	N	0.000000	T	0.30008	0.0751	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.02333	-1.1175	10	0.87932	D	0	-26.8869	12.7395	0.57243	0.0:0.9197:0.0:0.0803	.	367	P22760	AAAD_HUMAN	N	367	ENSP00000232892:H367N	ENSP00000232892:H367N	H	+	1	0	AADAC	153028549	1.000000	0.71417	0.237000	0.24090	0.244000	0.25665	5.245000	0.65405	1.002000	0.39104	0.591000	0.81541	CAT	.		0.398	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086	
FAM65B	9750	bcgsc.ca	37	6	24836027	24836027	+	Silent	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr6:24836027G>A	ENST00000259698.4	-	16	2350	c.2175C>T	c.(2173-2175)acC>acT	p.T725T	FAM65B_ENST00000538035.1_Silent_p.T704T	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	725					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						CTGCCACACTGGTCCCAACTC	0.557																																					p.T725T													.	FAM65B	134	0			c.C2175T						.						111.0	96.0	101.0					6																	24836027		692	1591	2283	SO:0001819	synonymous_variant	9750	exon16			CACACTGGTCCCA	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.2175C>T	6.37:g.24836027G>A		48	0		69	4	NM_014722	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Silent	SNP	ENST00000259698.4	37	CCDS47383.1																																																																																			.		0.557	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2		
KIF20B	9585	bcgsc.ca	37	10	91470854	91470854	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr10:91470854G>T	ENST00000371728.3	+	6	692	c.627G>T	c.(625-627)gaG>gaT	p.E209D	KIF20B_ENST00000394289.2_Missense_Mutation_p.E209D|KIF20B_ENST00000416354.1_Missense_Mutation_p.E209D|KIF20B_ENST00000260753.4_Missense_Mutation_p.E209D	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	209	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						CAGAACAAGAGAAAGAAGAAA	0.299																																					p.E209D													.	KIF20B	191	0			c.G627T						.						66.0	73.0	71.0					10																	91470854		2203	4300	6503	SO:0001583	missense	9585	exon6			ACAAGAGAAAGAA	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.627G>T	10.37:g.91470854G>T	ENSP00000360793:p.Glu209Asp	142	0		160	5	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	G	19.69	3.874923	0.72180	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728;ENST00000439656	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.39	3.54	0.40534	Kinesin, motor domain (4);	0.132703	0.34268	N	0.004111	T	0.34424	0.0897	N	0.16656	0.425	0.30627	N	0.757853	D;P	0.56521	0.976;0.904	P;P	0.60012	0.867;0.754	T	0.25467	-1.0131	10	0.19147	T	0.46	-15.2753	3.2016	0.06651	0.1503:0.138:0.5692:0.1425	.	209;209	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	D	209	ENSP00000260753:E209D;ENSP00000411545:E209D;ENSP00000377830:E209D;ENSP00000360793:E209D	ENSP00000260753:E209D	E	+	3	2	KIF20B	91460834	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.690000	0.47001	0.651000	0.30788	0.655000	0.94253	GAG	.		0.299	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
RBMS2	5939	bcgsc.ca	37	12	56982715	56982715	+	Splice_Site	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr12:56982715G>T	ENST00000262031.5	+	13	1238		c.e13-1		RBMS2_ENST00000550726.1_Splice_Site|RBMS2_ENST00000552247.2_Splice_Site|RNU6-343P_ENST00000364709.1_RNA|RBMS2_ENST00000542360.1_Splice_Site	NM_002898.3	NP_002889.1	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting protein 2						RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(3)|skin(2)|urinary_tract(1)	18						CTATGGCACAGGAGAGCAGCG	0.552																																					.													.	RBMS2	29	0			c.1144-1G>T						.						140.0	123.0	129.0					12																	56982715		2203	4300	6503	SO:0001630	splice_region_variant	5939	exon13			GGCACAGGAGAGC	D28483	CCDS8923.1	12q13.13	2013-02-12			ENSG00000076067	ENSG00000076067		"""RNA binding motif (RRM) containing"""	9909	protein-coding gene	gene with protein product		602387				8041632	Standard	NM_002898		Approved	SCR3	uc001sln.2	Q15434	OTTHUMG00000170488	ENST00000262031.5:c.1144-1G>T	12.37:g.56982715G>T		46	0		48	4	NM_002898		Splice_Site	SNP	ENST00000262031.5	37	CCDS8923.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893579	0.33442	.	.	ENSG00000076067	ENST00000262031;ENST00000552247;ENST00000550726;ENST00000542360	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7701	0.88489	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBMS2	55268982	1.000000	0.71417	1.000000	0.80357	0.169000	0.22640	7.516000	0.81772	2.583000	0.87209	0.561000	0.74099	.	.		0.552	RBMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409366.2	NM_002898	Intron
RPSAP53	400141	bcgsc.ca	37	13	67841448	67841448	+	IGR	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr13:67841448C>T								PCDH9 (36980 upstream) : LINC00364 (105070 downstream)																							GGCTGGCGGTCAGCCCTGGGG	0.522																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	400141	.			GGCGGTCAGCCCT																													13.37:g.67841448C>T		41	0		41	20	.		RNA	SNP		37																																																																																				.	0	0.522								
RPSAP53	400141	bcgsc.ca	37	13	67841585	67841585	+	IGR	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr13:67841585C>G								PCDH9 (37117 upstream) : LINC00364 (104933 downstream)																							GCATGGCCCTCTGGCCAGTAT	0.527																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	400141	.			GGCCCTCTGGCCA																													13.37:g.67841585C>G		27	0		30	12	.		RNA	SNP		37																																																																																				.	0	0.527								
FAM155A	728215	bcgsc.ca	37	13	108518801	108518801	+	Missense_Mutation	SNP	G	G	T	rs143077563		TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr13:108518801G>T	ENST00000375915.2	-	1	282	c.144C>A	c.(142-144)ttC>ttA	p.F48L		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	48						integral component of membrane (GO:0016021)		p.F48F(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						GCAGGACTGTGAAAAACAAGA	0.577																																					p.F48L													FAM155A,arm,malignant_melanoma,0,1	FAM155A	82	1	Substitution - coding silent(1)	skin(1)	c.C144A						.						121.0	130.0	127.0					13																	108518801		2203	4300	6503	SO:0001583	missense	728215	exon1			GACTGTGAAAAAC	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.144C>A	13.37:g.108518801G>T	ENSP00000365080:p.Phe48Leu	43	0		51	4	NM_001080396	B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	37	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.815948	0.50527	.	.	ENSG00000204442	ENST00000375915	.	.	.	5.13	5.13	0.70059	.	0.126864	0.52532	D	0.000063	T	0.42426	0.1202	N	0.03608	-0.345	0.47153	D	0.999334	B	0.21309	0.054	B	0.34346	0.18	T	0.42732	-0.9434	9	0.44086	T	0.13	.	17.5822	0.87971	0.0:0.0:1.0:0.0	.	48	B1AL88	F155A_HUMAN	L	48	.	ENSP00000365080:F48L	F	-	3	2	FAM155A	107316802	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.078000	0.64425	2.390000	0.81377	0.650000	0.86243	TTC	.		0.577	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396	
NID2	22795	bcgsc.ca	37	14	52535520	52535520	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr14:52535520G>T	ENST00000216286.5	-	1	192	c.193C>A	c.(193-195)Ctg>Atg	p.L65M	NID2_ENST00000541773.1_Missense_Mutation_p.L12M	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	65					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TAGAAGTGCAGGGGATTCGCC	0.617																																					p.L65M													.	NID2	201	0			c.C193A						.						106.0	91.0	96.0					14																	52535520		2203	4300	6503	SO:0001583	missense	22795	exon1			AGTGCAGGGGATT	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.193C>A	14.37:g.52535520G>T	ENSP00000216286:p.Leu65Met	49	0		61	4	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302979	0.40795	.	.	ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	T;T	0.29917	1.55;1.55	4.81	1.9	0.25705	.	0.228562	0.37715	N	0.001970	T	0.44180	0.1281	L	0.59436	1.845	0.29755	N	0.83604	D;P;B	0.89917	1.0;0.926;0.199	D;B;B	0.91635	0.999;0.283;0.097	T	0.35276	-0.9795	10	0.51188	T	0.08	.	5.5617	0.17148	0.177:0.0:0.6647:0.1583	.	12;67;65	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	M	65;65;12;67	ENSP00000216286:L65M;ENSP00000443730:L12M	ENSP00000216286:L65M	L	-	1	2	NID2	51605270	0.954000	0.32549	0.596000	0.28811	0.451000	0.32288	1.835000	0.39181	0.102000	0.17638	-0.391000	0.06502	CTG	.		0.617	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
RPL5P3	400385	bcgsc.ca	37	15	71355572	71355572	+	IGR	SNP	C	C	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr15:71355572C>G								LRRC49 (13158 upstream) : THSD4 (33718 downstream)																							GGCTTCTTTTCATAGACTGGA	0.408																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	400385	.			TCTTTTCATAGAC																													15.37:g.71355572C>G		20	0		20	10	.		RNA	SNP		37																																																																																				.	0	0.408								
PRC1	9055	bcgsc.ca	37	15	91517385	91517385	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr15:91517385G>T	ENST00000361188.5	-	11	2653	c.1442C>A	c.(1441-1443)aCa>aAa	p.T481K	PRC1_ENST00000361919.3_Missense_Mutation_p.T481K|PRC1_ENST00000442656.2_Missense_Mutation_p.T440K|PRC1-AS1_ENST00000554388.1_RNA|PRC1-AS1_ENST00000556200.1_RNA|PRC1_ENST00000394249.3_Missense_Mutation_p.T481K					protein regulator of cytokinesis 1											endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					TTTGCCCGGTGTATTGGGAGC	0.532																																					p.T481K													.	PRC1	51	0			c.C1442A						.						226.0	185.0	199.0					15																	91517385		2198	4298	6496	SO:0001583	missense	9055	exon11			CCCGGTGTATTGG	AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.1442C>A	15.37:g.91517385G>T	ENSP00000354679:p.Thr481Lys	45	0		59	4	NM_199413		Missense_Mutation	SNP	ENST00000361188.5	37	CCDS45352.1	.	.	.	.	.	.	.	.	.	.	G	7.014	0.557359	0.13436	.	.	ENSG00000198901	ENST00000394249;ENST00000361919;ENST00000361188;ENST00000555455;ENST00000442656	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.64	2.65	0.31530	.	0.138509	0.64402	N	0.000004	T	0.30103	0.0754	L	0.40543	1.245	0.28229	N	0.926186	B;B;B;B	0.11235	0.001;0.001;0.003;0.004	B;B;B;B	0.25506	0.011;0.036;0.036;0.061	T	0.18713	-1.0328	10	0.26408	T	0.33	.	5.7557	0.18172	0.0675:0.1199:0.5511:0.2616	.	440;481;451;481	O43663-3;F8W9B5;O43663-2;O43663	.;.;.;PRC1_HUMAN	K	481;481;481;84;440	ENSP00000377793:T481K;ENSP00000354618:T481K;ENSP00000354679:T481K;ENSP00000409549:T440K	ENSP00000354679:T481K	T	-	2	0	PRC1	89318389	1.000000	0.71417	0.013000	0.15412	0.042000	0.13812	3.904000	0.56325	0.419000	0.25927	0.650000	0.86243	ACA	.		0.532	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	NM_003981	
NARF	26502	bcgsc.ca	37	17	80443387	80443387	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr17:80443387A>G	ENST00000309794.11	+	10	1184	c.986A>G	c.(985-987)cAa>cGa	p.Q329R	NARF_ENST00000345415.7_Missense_Mutation_p.Q281R|NARF-IT1_ENST00000584012.1_RNA|NARF_ENST00000457415.3_Missense_Mutation_p.Q375R|NARF_ENST00000390006.4_Missense_Mutation_p.Q270R	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	329						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			AAAGACTTCCAAGAGGTCACC	0.418																																					p.Q329R													.	NARF	51	0			c.A986G						.						117.0	114.0	115.0					17																	80443387		2203	4300	6503	SO:0001583	missense	26502	exon10			ACTTCCAAGAGGT	BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.986A>G	17.37:g.80443387A>G	ENSP00000309899:p.Gln329Arg	36	0		62	4	NM_012336	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	ENST00000309794.11	37	CCDS32777.1	.	.	.	.	.	.	.	.	.	.	.	10.96	1.499326	0.26861	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415	T;T;T	0.40225	1.04;1.04;1.04	5.32	3.09	0.35607	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.162163	0.56097	N	0.000028	T	0.24084	0.0583	N	0.16743	0.435	0.80722	D	1	B;B;B;B	0.27450	0.041;0.127;0.179;0.062	B;B;B;B	0.37451	0.041;0.162;0.25;0.133	T	0.06734	-1.0810	10	0.07990	T	0.79	-23.7705	4.327	0.11045	0.6284:0.0:0.2336:0.138	.	375;281;376;329	Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;NARF_HUMAN	R	270;376;329;281	ENSP00000374656:Q270R;ENSP00000309899:Q329R;ENSP00000283996:Q281R	ENSP00000309899:Q329R	Q	+	2	0	NARF	78036676	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.722000	0.61958	0.336000	0.23639	0.459000	0.35465	CAA	.		0.418	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443573.2	NM_031968	
EPN1	29924	bcgsc.ca	37	19	56200706	56200706	+	Missense_Mutation	SNP	C	C	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr19:56200706C>T	ENST00000270460.6	+	5	958	c.647C>T	c.(646-648)gCc>gTc	p.A216V	EPN1_ENST00000411543.2_Intron|EPN1_ENST00000591743.1_3'UTR|EPN1_ENST00000085079.7_Intron	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	216					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		CTCCAGCTGGCCCTTAGTTTG	0.682																																					p.A216V													.	EPN1	98	0			c.C647T						.						46.0	45.0	45.0					19																	56200706		692	1591	2283	SO:0001583	missense	29924	exon5			AGCTGGCCCTTAG	AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.647C>T	19.37:g.56200706C>T	ENSP00000270460:p.Ala216Val	43	0		57	5	NM_001130072	Q86ST3|Q9HA18	Missense_Mutation	SNP	ENST00000270460.6	37	CCDS46199.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598142	0.87055	.	.	ENSG00000063245	ENST00000270460;ENST00000544375	T	0.40476	1.03	4.73	2.49	0.30216	Ubiquitin interacting motif (3);	0.184821	0.45867	D	0.000336	T	0.52629	0.1746	M	0.68317	2.08	0.80722	D	1	B;D	0.55172	0.166;0.97	B;P	0.58660	0.198;0.843	T	0.53704	-0.8401	10	0.56958	D	0.05	.	8.593	0.33699	0.0:0.7552:0.157:0.0879	.	177;216	B4DU91;Q9Y6I3	.;EPN1_HUMAN	V	216;177	ENSP00000270460:A216V	ENSP00000270460:A216V	A	+	2	0	EPN1	60892518	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.590000	0.53979	1.073000	0.40885	0.462000	0.41574	GCC	.		0.682	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453610.1	NM_013333	
Unknown	0	bcgsc.ca	37	20	6195679	6195679	+	IGR	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr20:6195679G>A								FERMT1 (91488 upstream) : AL109618.1 (13761 downstream)																							AAGAGATGGAGGGCGAGGAGG	0.388																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GATGGAGGGCGAG																													20.37:g.6195679G>A		53	0		68	21	.		RNA	SNP		37																																																																																				.	0	0.388								
FRG1B	284802	bcgsc.ca	37	20	29628278	29628278	+	Missense_Mutation	SNP	G	G	A			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr20:29628278G>A	ENST00000278882.3	+	6	660	c.280G>A	c.(280-282)Gca>Aca	p.A94T	FRG1B_ENST00000358464.4_Missense_Mutation_p.A94T|FRG1B_ENST00000439954.2_Missense_Mutation_p.A99T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	94										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ATGCAATGAAGCAGGGGACAT	0.373																																					.													FRG1B,NS,carcinoma,0,2	FRG1B	181	0			.						.																																			SO:0001583	missense	284802	.			AATGAAGCAGGGG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.280G>A	20.37:g.29628278G>A	ENSP00000278882:p.Ala94Thr	426	8		585	26	.	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	9.994	1.231660	0.22626	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.44083	0.93	2.08	2.08	0.27032	Actin cross-linking (1);	0.286587	0.39083	N	0.001478	T	0.22898	0.0553	.	.	.	0.21290	N	0.99973	B;B	0.12630	0.0;0.006	B;B	0.12156	0.002;0.007	T	0.15407	-1.0438	9	0.16420	T	0.52	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	99;94	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	T	94;99;94	ENSP00000408863:A99T	ENSP00000278882:A94T	A	+	1	0	FRG1B	28241939	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.196000	0.58407	1.475000	0.48197	0.423000	0.28283	GCA	.		0.373	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRG1B	284802	bcgsc.ca	37	20	29628299	29628299	+	Missense_Mutation	SNP	A	A	G			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr20:29628299A>G	ENST00000278882.3	+	6	681	c.301A>G	c.(301-303)Agt>Ggt	p.S101G	FRG1B_ENST00000358464.4_Missense_Mutation_p.S101G|FRG1B_ENST00000439954.2_Missense_Mutation_p.S106G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	101										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AGAAGCAAAAAGTAAAACAGC	0.363																																					.													FRG1B,bladder,carcinoma,-1,16	FRG1B	181	0			.						.																																			SO:0001583	missense	284802	.			GCAAAAAGTAAAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.301A>G	20.37:g.29628299A>G	ENSP00000278882:p.Ser101Gly	278	3		414	16	.	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	16.61	3.170807	0.57584	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.50001	0.76	2.08	2.08	0.27032	Actin cross-linking (1);	0.125588	0.64402	D	0.000001	T	0.38719	0.1051	.	.	.	0.42178	D	0.991671	B;P	0.36483	0.147;0.555	B;B	0.37731	0.138;0.257	T	0.38178	-0.9673	9	0.62326	D	0.03	.	8.0833	0.30758	1.0:0.0:0.0:0.0	.	106;101	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	G	101;106;101	ENSP00000408863:S106G	ENSP00000278882:S101G	S	+	1	0	FRG1B	28241960	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.085000	0.89518	1.208000	0.43306	0.347000	0.21830	AGT	.		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
DNAH11	8701	hgsc.bcm.edu;bcgsc.ca	37	7	21678582	21678582	+	Missense_Mutation	SNP	G	G	T			TCGA-ZH-A8Y6-01A-11D-A417-09	TCGA-ZH-A8Y6-10A-01D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ce462b65-84ae-4dfb-91ec-54f5e6e3b86d	1ccf932f-0579-49a6-88c9-8221b3199710	g.chr7:21678582G>T	ENST00000409508.3	+	28	4874	c.4843G>T	c.(4843-4845)Gct>Tct	p.A1615S	DNAH11_ENST00000328843.6_Missense_Mutation_p.A1620S	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1620	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AAAAGCTCTCGCTGAATACCT	0.393									Kartagener syndrome																												.		.											.	.	.	0			.						.						163.0	160.0	161.0					7																	21678582		1861	4093	5954	SO:0001583	missense	8701	p.A1620S	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GCTCTCGCTGAAT	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.4843G>T	7.37:g.21678582G>T	ENSP00000475939:p.Ala1615Ser	54	0		50	4	.	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	G	4.301	0.055040	0.08291	.	.	ENSG00000105877	ENST00000328843	T	0.59906	0.23	5.78	-1.86	0.07760	Dynein heavy chain, domain-2 (1);	0.275476	0.40302	N	0.001126	T	0.27866	0.0686	.	.	.	0.23585	N	0.997357	B	0.16396	0.017	B	0.20955	0.032	T	0.26121	-1.0112	9	0.07644	T	0.81	.	6.2056	0.20600	0.3011:0.0:0.5032:0.1957	.	1620	Q96DT5	DYH11_HUMAN	S	1620	ENSP00000330671:A1620S	ENSP00000330671:A1620S	A	+	1	0	DNAH11	21645107	0.326000	0.24669	0.004000	0.12327	0.320000	0.28249	0.739000	0.26173	-0.708000	0.05015	-2.201000	0.00304	GCT	.		0.393	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
