#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SIRPB1	10326	hgsc.bcm.edu	37	20	1552407	1552408	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:1552407_1552408insC	ENST00000381605.4	-	3	773_774	c.709_710insG	c.(709-711)gacfs	p.D237fs	SIRPB1_ENST00000262929.5_Intron|RP4-576H24.4_ENST00000564763.1_Intron|SIRPB1_ENST00000381603.3_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	237	Ig-like C1-type 1.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.D237fs*11(1)		central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						ACGAAGAGGGTCCCCCTGCAAG	0.609																																					p.D237fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.710_711insG	20						.																																			1500408	SO:0001589	frameshift_variant	10326	exon3			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.710dupG	20.37:g.1552412_1552412dupC	ENSP00000371018:p.Asp237fs		1500407	NM_006065	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Frame_Shift_Ins	INS	ENST00000381605.4	37	CCDS13019.1																																																																																				0.609	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
ATF6	22926	hgsc.bcm.edu	37	1	161736152	161736153	+	Start_Codon_Ins	INS	-	-	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:161736152_161736153insG	ENST00000367942.3	+	0	69_70				RP11-474I16.8_ENST00000431097.2_RNA	NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.E3fs*14(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	ACTTGTGAAATGGGGGAGCCGG	0.569																																					p.M1fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2_3insG	1						.																																			160002777	SO:0001582	initiator_codon_variant	22926	exon1			AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.7dupG	1.37:g.161736157_161736157dupG			160002776	NM_007348	O15139|Q5VW62|Q6IPB5|Q9UEC9	Frame_Shift_Ins	INS	ENST00000367942.3	37	CCDS1235.1																																																																																				0.569	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060304.2	NM_007348	
MUC17	140453	hgsc.bcm.edu	37	7	100685895	100685895	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:100685895C>A	ENST00000306151.4	+	3	11262	c.11198C>A	c.(11197-11199)tCa>tAa	p.S3733*		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3733	Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S3733*(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGCCATTTCATCTTCTGCA	0.507																																					p.S3733X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C11198A	7						.						228.0	211.0	217.0					7																	100685895		2203	4300	6503	100472615	SO:0001587	stop_gained	140453	exon3			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11198C>A	7.37:g.100685895C>A	ENSP00000302716:p.Ser3733*		100472615	NM_001040105	O14761|Q685J2|Q8TDH7	Nonsense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	51	17.681126	0.99891	.	.	ENSG00000169876	ENST00000306151	.	.	.	1.9	1.9	0.25705	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.2468	0.26127	0.0:1.0:0.0:0.0	.	.	.	.	X	3733	.	ENSP00000302716:S3733X	S	+	2	0	MUC17	100472615	0.000000	0.05858	0.006000	0.13384	0.027000	0.11550	0.655000	0.24933	1.071000	0.40834	0.423000	0.28283	TCA		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
ORC5	5001	hgsc.bcm.edu	37	7	103824453	103824453	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:103824453C>T	ENST00000297431.4	-	8	904	c.762G>A	c.(760-762)tgG>tgA	p.W254*	ORC5_ENST00000545943.1_Nonsense_Mutation_p.W122*|ORC5_ENST00000447452.2_Nonsense_Mutation_p.W254*	NM_002553.3	NP_002544.1	O43913	ORC5_HUMAN	origin recognition complex, subunit 5	254					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)	p.W254*(1)		kidney(1)|large_intestine(2)|lung(9)|pancreas(1)|upper_aerodigestive_tract(1)	14						CAATATTTCTCCACAGTTTGC	0.308																																					p.W254X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G762A	7						.						138.0	147.0	144.0					7																	103824453		2203	4300	6503	103611689	SO:0001587	stop_gained	5001	exon8				CCDS5734.1, CCDS47681.1	7q22.1	2014-06-13	2010-10-12	2010-10-12	ENSG00000164815	ENSG00000164815			8491	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 117"""	602331	"""origin recognition complex, subunit 5 (yeast homolog)-like"", ""origin recognition complex, subunit 5-like (yeast)"", ""origin recognition complex, subunit 5 homolog (yeast)"""	ORC5L		9417919, 9829972	Standard	NM_002553		Approved	Orc5p, ORC5T, PPP1R117	uc003vcb.3	O43913	OTTHUMG00000157275	ENST00000297431.4:c.762G>A	7.37:g.103824453C>T	ENSP00000297431:p.Trp254*		103611689	NM_181747	A4D0P8|O60590|O95268	Nonsense_Mutation	SNP	ENST00000297431.4	37	CCDS5734.1	.	.	.	.	.	.	.	.	.	.	C	37	6.211570	0.97380	.	.	ENSG00000164815	ENST00000297431;ENST00000545943;ENST00000447452	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8604	0.96781	0.0:1.0:0.0:0.0	.	.	.	.	X	254;122;254	.	ENSP00000297431:W254X	W	-	3	0	ORC5	103611689	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.794000	0.75135	2.699000	0.92147	0.650000	0.86243	TGG		0.308	ORC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348286.1	NM_002553	
SRPK2	6733	hgsc.bcm.edu	37	7	104783644	104783644	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:104783644T>C	ENST00000393651.3	-	10	1034	c.947A>G	c.(946-948)aAc>aGc	p.N316S	SRPK2_ENST00000357311.3_Missense_Mutation_p.N305S|SRPK2_ENST00000489828.1_Missense_Mutation_p.N305S	NM_182692.1	NP_872634.1			SRSF protein kinase 2									p.N305S(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						TGAGGTGATGTTTTCTTCTAT	0.468																																					p.N305S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A914G	7						.						137.0	121.0	126.0					7																	104783644		2203	4300	6503	104570880	SO:0001583	missense	6733	exon9			U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.947A>G	7.37:g.104783644T>C	ENSP00000377262:p.Asn316Ser		104570880	NM_182691		Missense_Mutation	SNP	ENST00000393651.3	37	CCDS34724.1	.	.	.	.	.	.	.	.	.	.	T	8.958	0.969921	0.18659	.	.	ENSG00000135250	ENST00000393651;ENST00000357311;ENST00000489828	T;T;T	0.25250	1.81;1.81;1.81	5.57	5.57	0.84162	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.191354	0.45867	D	0.000330	T	0.12944	0.0314	N	0.11000	0.08	0.36071	D	0.842115	B;B	0.28933	0.228;0.063	B;B	0.30855	0.121;0.018	T	0.15983	-1.0418	10	0.07325	T	0.83	-24.5104	11.687	0.51492	0.0:0.0:0.1478:0.8522	.	316;305	P78362-2;P78362	.;SRPK2_HUMAN	S	316;305;305	ENSP00000377262:N316S;ENSP00000349863:N305S;ENSP00000419791:N305S	ENSP00000349863:N305S	N	-	2	0	SRPK2	104570880	0.969000	0.33509	0.996000	0.52242	0.987000	0.75469	0.740000	0.26188	2.120000	0.65058	0.454000	0.30748	AAC		0.468	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348723.1	NM_182691	
GPER1	2852	hgsc.bcm.edu	37	7	1131729	1131729	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:1131729G>A	ENST00000297469.3	+	2	1056	c.365G>A	c.(364-366)cGg>cAg	p.R122Q	GPER1_ENST00000397088.3_Missense_Mutation_p.R122Q|C7orf50_ENST00000397098.3_Intron|C7orf50_ENST00000488073.1_Intron|C7orf50_ENST00000397100.2_Intron|GPER1_ENST00000397092.1_Missense_Mutation_p.R122Q|GPER1_ENST00000401670.1_Missense_Mutation_p.R122Q|C7orf50_ENST00000357429.6_Intron	NM_001505.2	NP_001496.1	Q99527	GPER1_HUMAN	G protein-coupled estrogen receptor 1	122					apoptotic chromosome condensation (GO:0030263)|cell cycle (GO:0007049)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucose stimulus (GO:0071333)|cellular response to mineralocorticoid stimulus (GO:0071389)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytosolic calcium ion homeostasis (GO:0051480)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA metabolic process (GO:0051053)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte activation (GO:0002695)|negative regulation of lipid biosynthetic process (GO:0051055)|neuronal action potential (GO:0019228)|nuclear fragmentation involved in apoptotic nuclear change (GO:0030264)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of gene expression (GO:0010628)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of insulin secretion (GO:0032024)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vasodilation (GO:0045909)|steroid hormone mediated signaling pathway (GO:0043401)	axon (GO:0030424)|axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine head (GO:0044327)|dendritic spine membrane (GO:0032591)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|keratin filament (GO:0045095)|mitochondrial membrane (GO:0031966)|neuronal postsynaptic density (GO:0097481)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	chromatin binding (GO:0003682)|estrogen receptor activity (GO:0030284)|G-protein coupled receptor activity (GO:0004930)|mineralocorticoid receptor activity (GO:0017082)|steroid binding (GO:0005496)	p.R122Q(1)									CTGCACGAGCGGTACTACGAC	0.577																																					p.R122Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G365A	7						.						168.0	123.0	138.0					7																	1131729		2203	4300	6503	1098255	SO:0001583	missense	2852	exon2			U63917	CCDS5322.1	7p22	2013-08-14	2007-07-03	2013-08-14	ENSG00000164850	ENSG00000164850			4485	protein-coding gene	gene with protein product		601805	"""G protein-coupled receptor 30"""	CMKRL2, GPR30, GPER		9479505, 17655271	Standard	NM_001098201		Approved	FEG-1, GPCR-Br, LERGU, LERGU2, DRY12, LyGPR, CEPR	uc003skb.2	Q99527	OTTHUMG00000023680	ENST00000297469.3:c.365G>A	7.37:g.1131729G>A	ENSP00000297469:p.Arg122Gln		1098255	NM_001505	A8K6C5|B5BUJ1|O00143|O43494|Q13631|Q6FHL1|Q96F42|Q99981	Missense_Mutation	SNP	ENST00000297469.3	37	CCDS5322.1	.	.	.	.	.	.	.	.	.	.	G	0.377	-0.930706	0.02359	.	.	ENSG00000164850	ENST00000401670;ENST00000397092;ENST00000297469;ENST00000397088;ENST00000508834	T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65	5.48	3.08	0.35506	GPCR, rhodopsin-like superfamily (1);	0.326037	0.31279	N	0.007926	T	0.45816	0.1361	N	0.12746	0.255	0.21256	N	0.999746	B	0.02656	0.0	B	0.01281	0.0	T	0.23119	-1.0197	10	0.08837	T	0.75	-11.4582	8.7274	0.34478	0.8385:0.0:0.1615:0.0	.	122	Q99527	GPER_HUMAN	Q	122	ENSP00000385151:R122Q;ENSP00000380281:R122Q;ENSP00000297469:R122Q;ENSP00000380277:R122Q	ENSP00000297469:R122Q	R	+	2	0	GPER	1098255	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.602000	0.61098	0.372000	0.24591	-0.255000	0.11280	CGG		0.577	GPER1-030	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060001.1	NM_001039966	
LAMB1	3912	hgsc.bcm.edu	37	7	107616142	107616142	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:107616142A>G	ENST00000222399.6	-	10	1411	c.1181T>C	c.(1180-1182)tTc>tCc	p.F394S	LAMB1_ENST00000393561.1_Missense_Mutation_p.F418S|LAMB1_ENST00000393560.1_Missense_Mutation_p.F394S	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	394	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)	p.F394S(1)		NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						ACGTTCACAGAAATTAGGATC	0.483																																					p.F394S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1181C	7						.						136.0	134.0	134.0					7																	107616142		2203	4300	6503	107403378	SO:0001583	missense	3912	exon10			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.1181T>C	7.37:g.107616142A>G	ENSP00000222399:p.Phe394Ser		107403378	NM_002291	Q14D91	Missense_Mutation	SNP	ENST00000222399.6	37	CCDS5750.1	.	.	.	.	.	.	.	.	.	.	A	16.84	3.233990	0.58886	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.36157	1.52;1.52;1.27	5.23	4.06	0.47325	EGF-like, laminin (3);	.	.	.	.	T	0.15089	0.0364	N	0.01048	-1.04	0.29947	N	0.820582	B;B;B	0.18461	0.028;0.0;0.007	B;B;B	0.23716	0.048;0.001;0.018	T	0.13845	-1.0494	9	0.45353	T	0.12	.	11.1734	0.48584	0.9278:0.0:0.0721:0.0	.	394;394;418	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	S	418;394;394	ENSP00000377191:F418S;ENSP00000222399:F394S;ENSP00000377190:F394S	ENSP00000222399:F394S	F	-	2	0	LAMB1	107403378	1.000000	0.71417	0.765000	0.31456	0.923000	0.55619	7.237000	0.78164	0.991000	0.38814	0.533000	0.62120	TTC		0.483	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
CAPZA2	830	hgsc.bcm.edu	37	7	116557896	116557896	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:116557896T>G	ENST00000361183.3	+	10	975	c.836T>G	c.(835-837)aTt>aGt	p.I279S	CAPZA2_ENST00000458284.2_3'UTR	NM_006136.2	NP_006127.1	P47755	CAZA2_HUMAN	capping protein (actin filament) muscle Z-line, alpha 2	279					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|WASH complex (GO:0071203)		p.I279S(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	13	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)			AGCTACAAGATTGGCAAAGAG	0.383																																					p.I279S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T836G	7						.						123.0	108.0	113.0					7																	116557896		2203	4300	6503	116345132	SO:0001583	missense	830	exon10				CCDS5768.1	7q31.2-q31.3	2008-07-18			ENSG00000198898	ENSG00000198898			1490	protein-coding gene	gene with protein product	"""F-actin capping protein alpha-2 subunit"""	601571					Standard	NM_006136		Approved	CAPZ, CAPPA2	uc003vil.3	P47755	OTTHUMG00000023185	ENST00000361183.3:c.836T>G	7.37:g.116557896T>G	ENSP00000354947:p.Ile279Ser		116345132	NM_006136	B4DG50	Missense_Mutation	SNP	ENST00000361183.3	37	CCDS5768.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.965629	0.74131	.	.	ENSG00000198898	ENST00000361183	.	.	.	5.79	5.79	0.91817	.	0.048342	0.85682	D	0.000000	D	0.84106	0.5399	M	0.87758	2.905	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	D	0.87040	0.2140	9	0.87932	D	0	-21.7082	16.1304	0.81428	0.0:0.0:0.0:1.0	.	279	P47755	CAZA2_HUMAN	S	279	.	ENSP00000354947:I279S	I	+	2	0	CAPZA2	116345132	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.914000	0.87478	2.202000	0.70862	0.482000	0.46254	ATT		0.383	CAPZA2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059506.4	NM_006136	
AHCYL2	23382	hgsc.bcm.edu	37	7	129037102	129037102	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:129037102C>T	ENST00000325006.3	+	5	814	c.760C>T	c.(760-762)Cga>Tga	p.R254*	AHCYL2_ENST00000446212.1_Nonsense_Mutation_p.R152*|AHCYL2_ENST00000490911.1_Nonsense_Mutation_p.R151*|AHCYL2_ENST00000446544.2_Nonsense_Mutation_p.R253*|AHCYL2_ENST00000474594.1_Nonsense_Mutation_p.R151*|AHCYL2_ENST00000472554.1_3'UTR|AHCYL2_ENST00000531335.2_Nonsense_Mutation_p.R173*	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	254					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)	p.R254*(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						GGCCCAGTGCCGATGGGCTGC	0.493																																					p.R254X	Pancreas(160;1736 1964 29875 40941 45605)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C760T	7						.						98.0	96.0	97.0					7																	129037102		2203	4300	6503	128824338	SO:0001587	stop_gained	23382	exon5			AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.760C>T	7.37:g.129037102C>T	ENSP00000315931:p.Arg254*		128824338	NM_015328	B4DIZ5|D9N155|O94917	Nonsense_Mutation	SNP	ENST00000325006.3	37	CCDS5812.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.677424	0.68042	.	.	ENSG00000158467	ENST00000325006;ENST00000446544;ENST00000531335;ENST00000474594;ENST00000446212;ENST00000490911;ENST00000466993	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.4317	13.6824	0.62493	0.1549:0.8451:0.0:0.0	.	.	.	.	X	254;253;173;151;152;151;152	.	ENSP00000315931:R254X	R	+	1	2	AHCYL2	128824338	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.944000	0.29043	2.631000	0.89168	0.650000	0.86243	CGA		0.493	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354065.1		
NRF1	4899	hgsc.bcm.edu	37	7	129367175	129367175	+	Nonsense_Mutation	SNP	G	G	T	rs368702964		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:129367175G>T	ENST00000393232.1	+	10	1435	c.1318G>T	c.(1318-1320)Gga>Tga	p.G440*	NRF1_ENST00000393230.2_Nonsense_Mutation_p.G440*|NRF1_ENST00000539636.1_Nonsense_Mutation_p.G279*|NRF1_ENST00000223190.4_Nonsense_Mutation_p.G440*|NRF1_ENST00000353868.4_Nonsense_Mutation_p.G374*|NRF1_ENST00000393231.3_Nonsense_Mutation_p.G440*|NRF1_ENST00000311967.2_Nonsense_Mutation_p.G440*	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	440	Required for transcriptional activation.				cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.G440*(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						AGCAGCCGTCGGAGCACTTAC	0.522																																					p.G440X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1318T	7						.						61.0	59.0	60.0					7																	129367175		2203	4300	6503	129154411	SO:0001587	stop_gained	4899	exon10			L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.1318G>T	7.37:g.129367175G>T	ENSP00000376924:p.Gly440*		129154411	NM_005011	A8K4C6|B4DDV6|Q15305|Q96AN2	Nonsense_Mutation	SNP	ENST00000393232.1	37	CCDS5813.2	.	.	.	.	.	.	.	.	.	.	G	38	6.837554	0.97877	.	.	ENSG00000106459	ENST00000393232;ENST00000353868;ENST00000539636;ENST00000223190;ENST00000311967;ENST00000393230;ENST00000393231	.	.	.	6.04	5.16	0.70880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-7.167	14.4571	0.67423	0.07:0.0:0.93:0.0	.	.	.	.	X	440;374;279;440;440;440;440	.	ENSP00000223190:G440X	G	+	1	0	NRF1	129154411	1.000000	0.71417	0.965000	0.40720	0.929000	0.56500	9.151000	0.94674	1.573000	0.49748	-0.258000	0.10820	GGA		0.522	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289813.1	NM_001040110	
KLRG2	346689	hgsc.bcm.edu	37	7	139164427	139164427	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:139164427G>A	ENST00000340940.4	-	3	1020	c.951C>T	c.(949-951)agC>agT	p.S317S	KLRG2_ENST00000393039.2_Intron	NM_198508.2	NP_940910.1	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G, member 2	317	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.S317S(1)		central_nervous_system(1)|large_intestine(2)|lung(3)	6	Melanoma(164;0.233)					AGAAAGCCTGGCTGGCTTCCC	0.597																																					p.S317S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C951T	7						.						80.0	78.0	78.0					7																	139164427		2203	4300	6503	138814967	SO:0001819	synonymous_variant	346689	exon3			AK126174	CCDS5854.1	7q34	2011-08-30			ENSG00000188883	ENSG00000188883		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	24778	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member B"""						Standard	XM_005250311		Approved	FLJ44186, CLEC15B	uc003vvb.3	A4D1S0	OTTHUMG00000157705	ENST00000340940.4:c.951C>T	7.37:g.139164427G>A			138814967	NM_198508	Q2NL79|Q6ZTV6	Silent	SNP	ENST00000340940.4	37	CCDS5854.1																																																																																				0.597	KLRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349433.1	NM_198508	
BRAF	673	hgsc.bcm.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	A	T	rs121913377|rs113488022|rs121913227|rs397516897		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:140453136A>T	ENST00000288602.6	-	15	1859	c.1799T>A	c.(1798-1800)gTg>gAg	p.V600E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	600	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:12068308}.|V -> E (in CRC; also found in sarcoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis; loss of regulation by PMRT5). {ECO:0000269|PubMed:12068308, ECO:0000269|PubMed:12198537, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24455489}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V600E(15453)|p.V600K(252)|p.V600R(44)|p.V600D(16)|p.V600A(12)|p.V600_K601>E(12)|p.V600G(11)|p.T599_R603>I(2)|p.V600Q(2)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insDFGLAT(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	TCGAGATTTCACTGTAGCTAG	0.368	V600D(K029AX_SKIN)|V600D(WM115_SKIN)|V600D(WM2664_SKIN)|V600E(8505C_THYROID)|V600E(A101D_SKIN)|V600E(A2058_SKIN)|V600E(A375_SKIN)|V600E(A673_BONE)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(BCPAP_THYROID)|V600E(BHT101_THYROID)|V600E(BT474_BREAST)|V600E(C32_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(COLO205_LARGE_INTESTINE)|V600E(COLO679_SKIN)|V600E(COLO741_SKIN)|V600E(COLO783_SKIN)|V600E(COLO800_SKIN)|V600E(COLO818_SKIN)|V600E(COLO829_SKIN)|V600E(COLO849_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(DU4475_BREAST)|V600E(ES2_OVARY)|V600E(G361_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(HS294T_SKIN)|V600E(HS695T_SKIN)|V600E(HS939T_SKIN)|V600E(IGR1_SKIN)|V600E(IGR37_SKIN)|V600E(IGR39_SKIN)|V600E(K029AX_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(LOXIMVI_SKIN)|V600E(MALME3M_SKIN)|V600E(MELHO_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(RKO_LARGE_INTESTINE)|V600E(RPMI7951_SKIN)|V600E(RVH421_SKIN)|V600E(SH4_SKIN)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(SKHEP1_LIVER)|V600E(SKMEL24_SKIN)|V600E(SKMEL28_SKIN)|V600E(SKMEL5_SKIN)|V600E(SW1417_LARGE_INTESTINE)|V600E(UACC257_SKIN)|V600E(UACC62_SKIN)|V600E(WM793_SKIN)|V600E(WM88_SKIN)|V600E(WM983B_SKIN)	61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.V600E	Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	BRAF,pituitary,NS,Substitution - Missense,0	.	15808	Substitution - Missense(15790)|Complex - deletion inframe(17)|Insertion - In frame(1)	thyroid(7476)|skin(3822)|large_intestine(3288)|NS(360)|haematopoietic_and_lymphoid_tissue(336)|ovary(211)|lung(58)|eye(57)|central_nervous_system(53)|soft_tissue(30)|biliary_tract(18)|liver(17)|prostate(13)|breast(10)|upper_aerodigestive_tract(9)|endometrium(8)|pancreas(8)|testis(7)|small_intestine(7)|genital_tract(4)|stomach(4)|bone(3)|autonomic_ganglia(2)|oesophagus(2)|urinary_tract(2)|adrenal_gland(2)|pituitary(1)	c.T1799A	7						.						112.0	104.0	107.0					7																	140453136		2203	4300	6503	140099605	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1799T>A	7.37:g.140453136A>T	ENSP00000288602:p.Val600Glu		140099605	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.0|24.0	4.486113|4.486113	0.84854|0.84854	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.81739|.	-1.53|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61565|.	0.2357|.	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	D|.	0.55385|.	0.971|.	D|.	0.66351|.	0.943|.	T|.	0.58160|.	-0.7685|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	600|.	P15056|.	BRAF_HUMAN|.	E|R	600|208	ENSP00000288602:V600E|.	ENSP00000288602:V600E|.	V|X	-|-	2|1	0|0	BRAF|BRAF	140099605|140099605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.197000|9.197000	0.94985|0.94985	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	GTG|TGA		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
TAS2R5	54429	hgsc.bcm.edu	37	7	141490325	141490325	+	Missense_Mutation	SNP	G	G	A	rs147887777		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:141490325G>A	ENST00000247883.4	+	1	309	c.164G>A	c.(163-165)cGa>cAa	p.R55Q		NM_018980.2	NP_061853.1	Q9NYW4	TA2R5_HUMAN	taste receptor, type 2, member 5	55					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.R55Q(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9	Melanoma(164;0.0171)					GCTGGCTGCCGATTTCTCCTG	0.468													g|||	1	0.000199681	0.0	0.0014	5008	,	,		19581	0.0		0.0	False		,,,				2504	0.0				p.R55Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G164A	7						.	G	GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	112.0	107.0	109.0		164	1.7	0.0	7	dbSNP_134	109	17,8583	12.6+/-44.7	0,17,4283	yes	missense	TAS2R5	NM_018980.2	43	0,20,6483	AA,AG,GG		0.1977,0.0681,0.1538	probably-damaging	55/300	141490325	20,12986	2203	4300	6503	141136794	SO:0001583	missense	54429	exon1			AF227132	CCDS5869.1	7q31.3-q32	2012-08-22			ENSG00000127366	ENSG00000127366		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14912	protein-coding gene	gene with protein product		605062					Standard	NM_018980		Approved	T2R5	uc003vwr.1	Q9NYW4	OTTHUMG00000157632	ENST00000247883.4:c.164G>A	7.37:g.141490325G>A	ENSP00000247883:p.Arg55Gln		141136794	NM_018980	Q645W0|Q75MV7	Missense_Mutation	SNP	ENST00000247883.4	37	CCDS5869.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	12.07	1.828778	0.32329	6.81E-4	0.001977	ENSG00000127366	ENST00000247883	T	0.37058	1.22	4.46	1.67	0.24075	.	.	.	.	.	T	0.57989	0.2091	M	0.84683	2.71	0.09310	N	1	D	0.76494	0.999	D	0.70716	0.97	T	0.45249	-0.9274	9	0.87932	D	0	.	6.4583	0.21942	0.3113:0.0:0.6887:0.0	.	55	Q9NYW4	TA2R5_HUMAN	Q	55	ENSP00000247883:R55Q	ENSP00000247883:R55Q	R	+	2	0	TAS2R5	141136794	0.130000	0.22417	0.009000	0.14445	0.033000	0.12548	1.820000	0.39032	0.162000	0.19483	0.561000	0.74099	CGA		0.468	TAS2R5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349283.1		
FAM131B	9715	hgsc.bcm.edu	37	7	143056110	143056110	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:143056110T>C	ENST00000409408.1	-	4	1900	c.192A>G	c.(190-192)tcA>tcG	p.S64S	FAM131B_ENST00000409222.3_Silent_p.S64S|FAM131B_ENST00000409346.1_Silent_p.S64S|FAM131B_ENST00000443739.2_Silent_p.S92S|FAM131B_ENST00000409578.1_Silent_p.S80S			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	64								p.S92S(1)|p.S64S(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					TCATGCTCCGTGAGATCCCTA	0.587																																					p.S92S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A276G	7						.						67.0	51.0	57.0					7																	143056110		2203	4300	6503	142766232	SO:0001819	synonymous_variant	9715	exon5			BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.192A>G	7.37:g.143056110T>C			142766232	NM_001031690	A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Silent	SNP	ENST00000409408.1	37	CCDS5882.1																																																																																				0.587	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328057.1	NM_014690	
CUL1	8454	hgsc.bcm.edu	37	7	148484130	148484130	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:148484130A>C	ENST00000325222.4	+	13	1676	c.1397A>C	c.(1396-1398)tAt>tCt	p.Y466S	CUL1_ENST00000602748.1_Missense_Mutation_p.Y466S|CUL1_ENST00000409469.1_Missense_Mutation_p.Y466S	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	466					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)		p.Y466S(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			CAGAAGTTCTATGCGAAGATG	0.473																																					p.Y466S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1397C	7						.						117.0	111.0	113.0					7																	148484130		2203	4300	6503	148115063	SO:0001583	missense	8454	exon13			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1397A>C	7.37:g.148484130A>C	ENSP00000326804:p.Tyr466Ser		148115063	NM_003592	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	ENST00000325222.4	37	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.985082	0.93044	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	D;D	0.87179	-2.22;-2.22	5.57	5.57	0.84162	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.95990	0.8694	H	0.97564	4.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97546	1.0089	10	0.87932	D	0	-20.2655	15.742	0.77905	1.0:0.0:0.0:0.0	.	393;466	E7EWR0;Q13616	.;CUL1_HUMAN	S	466;466;424;393	ENSP00000387160:Y466S;ENSP00000326804:Y466S	ENSP00000326804:Y466S	Y	+	2	0	CUL1	148115063	1.000000	0.71417	0.917000	0.36280	0.950000	0.60333	8.962000	0.93254	2.126000	0.65437	0.533000	0.62120	TAT		0.473	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
CUL1	8454	hgsc.bcm.edu	37	7	148494915	148494915	+	Silent	SNP	G	G	A	rs145563536		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:148494915G>A	ENST00000325222.4	+	18	2190	c.1911G>A	c.(1909-1911)gcG>gcA	p.A637A	CUL1_ENST00000602748.1_Silent_p.A637A|CUL1_ENST00000409469.1_Silent_p.A637A	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	637					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)		p.A637A(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			ACATTTTGGCGCAAGTTTTAC	0.373																																					p.A637A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1911A	7						.	G		0,4406		0,0,2203	97.0	97.0	97.0		1911	-9.8	0.6	7	dbSNP_134	97	2,8598		0,2,4298	no	coding-synonymous	CUL1	NM_003592.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		637/777	148494915	2,13004	2203	4300	6503	148125848	SO:0001819	synonymous_variant	8454	exon18			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1911G>A	7.37:g.148494915G>A			148125848	NM_003592	D3DWG3|O60719|Q08AL6|Q8IYW1	Silent	SNP	ENST00000325222.4	37	CCDS34772.1																																																																																				0.373	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
KMT2C	58508	hgsc.bcm.edu	37	7	151859569	151859569	+	Missense_Mutation	SNP	G	G	A	rs138747124		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:151859569G>A	ENST00000262189.6	-	43	11311	c.11093C>T	c.(11092-11094)aCg>aTg	p.T3698M	KMT2C_ENST00000355193.2_Missense_Mutation_p.T3698M	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3698			T -> S (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A3700fs*26(2)|p.T3698M(2)									ATTTGCATACGTCTGTTGATT	0.468																																					p.T3698M												MLL3,large_intestine,colon,Substitution - Missense,-1	.	4	Substitution - Missense(2)|Insertion - Frameshift(2)	large_intestine(2)|breast(2)	c.C11093T	7						.	G	MET/THR	3,4403	6.2+/-15.9	0,3,2200	242.0	245.0	244.0		11093	3.7	0.0	7	dbSNP_134	244	0,8600		0,0,4300	yes	missense	MLL3	NM_170606.2	81	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging	3698/4912	151859569	3,13003	2203	4300	6503	151490502	SO:0001583	missense	58508	exon43			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11093C>T	7.37:g.151859569G>A	ENSP00000262189:p.Thr3698Met		151490502	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417134	0.25552	6.81E-4	0.0	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877	D;D;D	0.88896	-1.77;-1.75;-2.44	5.51	3.71	0.42584	.	0.507408	0.16272	U	0.221726	T	0.78685	0.4322	L	0.34521	1.04	0.09310	N	0.999999	P;B;B	0.44309	0.832;0.079;0.079	B;B;B	0.32805	0.153;0.014;0.014	T	0.70824	-0.4767	10	0.66056	D	0.02	.	6.3582	0.21412	0.0698:0.132:0.6612:0.137	.	3698;2759;3698	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	M	3698;3698;284	ENSP00000262189:T3698M;ENSP00000347325:T3698M;ENSP00000410411:T284M	ENSP00000262189:T3698M	T	-	2	0	MLL3	151490502	0.025000	0.19082	0.000000	0.03702	0.009000	0.06853	1.008000	0.29872	0.693000	0.31634	0.650000	0.86243	ACG		0.468	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
NOM1	64434	hgsc.bcm.edu	37	7	156759046	156759046	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:156759046T>C	ENST00000275820.3	+	8	2131	c.2116T>C	c.(2116-2118)Ttc>Ctc	p.F706L		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	706	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.F706L(1)		endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		TTACAATCCCTTCTATGCTTT	0.428																																					p.F706L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2116C	7						.						173.0	147.0	156.0					7																	156759046		2203	4300	6503	156451807	SO:0001583	missense	64434	exon8			AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.2116T>C	7.37:g.156759046T>C	ENSP00000275820:p.Phe706Leu		156451807	NM_138400	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.279774	0.80692	.	.	ENSG00000146909	ENST00000275820	T	0.31247	1.5	5.1	5.1	0.69264	Initiation factor eIF-4 gamma, MA3 (3);	0.102478	0.64402	D	0.000003	T	0.47673	0.1458	M	0.90425	3.115	0.80722	D	1	B	0.28419	0.211	B	0.35039	0.194	T	0.55503	-0.8131	10	0.66056	D	0.02	-20.1319	14.8596	0.70369	0.0:0.0:0.0:1.0	.	706	Q5C9Z4	NOM1_HUMAN	L	706	ENSP00000275820:F706L	ENSP00000275820:F706L	F	+	1	0	NOM1	156451807	1.000000	0.71417	0.971000	0.41717	0.978000	0.69477	7.703000	0.84585	1.911000	0.55334	0.533000	0.62120	TTC		0.428	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
NOM1	64434	hgsc.bcm.edu	37	7	156759670	156759670	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:156759670A>G	ENST00000275820.3	+	9	2197	c.2182A>G	c.(2182-2184)Agc>Ggc	p.S728G		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	728	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S728G(1)		endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		TTTCCAGTTCAGCATATGGGA	0.368																																					p.S728G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2182G	7						.						116.0	113.0	114.0					7																	156759670		2203	4300	6503	156452431	SO:0001583	missense	64434	exon9			AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.2182A>G	7.37:g.156759670A>G	ENSP00000275820:p.Ser728Gly		156452431	NM_138400	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	.	.	.	.	.	.	.	.	.	.	A	18.42	3.620433	0.66787	.	.	ENSG00000146909	ENST00000275820	T	0.20738	2.05	5.27	5.27	0.74061	Initiation factor eIF-4 gamma, MA3 (3);	0.039358	0.85682	D	0.000000	T	0.34629	0.0904	M	0.86651	2.83	0.80722	D	1	B	0.21688	0.059	B	0.26517	0.07	T	0.23833	-1.0177	10	0.52906	T	0.07	-28.0289	15.178	0.72931	1.0:0.0:0.0:0.0	.	728	Q5C9Z4	NOM1_HUMAN	G	728	ENSP00000275820:S728G	ENSP00000275820:S728G	S	+	1	0	NOM1	156452431	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.126000	0.57937	1.970000	0.57323	0.533000	0.62120	AGC		0.368	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
PRKAR1B	5575	hgsc.bcm.edu	37	7	720204	720204	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:720204A>G	ENST00000406797.1	-	3	511	c.337T>C	c.(337-339)Tac>Cac	p.Y113H	PRKAR1B_ENST00000360274.4_Missense_Mutation_p.Y113H|PRKAR1B_ENST00000544935.1_Missense_Mutation_p.Y113H|PRKAR1B_ENST00000403562.1_Missense_Mutation_p.Y113H|PRKAR1B_ENST00000537384.1_Missense_Mutation_p.Y113H	NM_001164761.1	NP_001158233.1	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, beta	113	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)	p.Y113H(1)		endometrium(4)|large_intestine(1)|liver(1)|lung(10)|prostate(1)	17		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		TTCCTGACGTAGGACACGGCG	0.697																																					p.Y113H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T337C	7						.						40.0	37.0	38.0					7																	720204		2203	4300	6503	686730	SO:0001583	missense	5575	exon3			M65066	CCDS34579.1	7p22.3	2013-09-19			ENSG00000188191	ENSG00000188191	2.7.11.1		9390	protein-coding gene	gene with protein product		176911				1358799, 3479018	Standard	NM_002735		Approved		uc003siw.2	P31321	OTTHUMG00000151411	ENST00000406797.1:c.337T>C	7.37:g.720204A>G	ENSP00000385749:p.Tyr113His		686730	NM_001164759	Q8N422	Missense_Mutation	SNP	ENST00000406797.1	37	CCDS34579.1	.	.	.	.	.	.	.	.	.	.	A	16.57	3.161051	0.57368	.	.	ENSG00000188191	ENST00000537384;ENST00000544935;ENST00000406797;ENST00000403562;ENST00000360274;ENST00000430040;ENST00000414568;ENST00000417852	D;D;D;D;D;D;D;D	0.93189	-2.09;-2.09;-2.09;-2.09;-2.09;-3.1;-1.92;-3.18	4.91	4.91	0.64330	Cyclic nucleotide-binding-like (1);	0.000000	0.64402	U	0.000007	D	0.95411	0.8510	M	0.86420	2.815	0.80722	D	1	P	0.39424	0.673	P	0.47573	0.55	D	0.95497	0.8574	10	0.51188	T	0.08	-12.0525	14.5239	0.67873	1.0:0.0:0.0:0.0	.	113	P31321	KAP1_HUMAN	H	113;113;113;113;113;113;58;113	ENSP00000440449:Y113H;ENSP00000444487:Y113H;ENSP00000385749:Y113H;ENSP00000385349:Y113H;ENSP00000353415:Y113H;ENSP00000402648:Y113H;ENSP00000394633:Y58H;ENSP00000406670:Y113H	ENSP00000353415:Y113H	Y	-	1	0	PRKAR1B	686730	1.000000	0.71417	0.989000	0.46669	0.100000	0.18952	8.463000	0.90377	1.841000	0.53522	0.459000	0.35465	TAC		0.697	PRKAR1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322525.1		
SDK1	221935	hgsc.bcm.edu	37	7	4281545	4281545	+	Splice_Site	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:4281545G>T	ENST00000404826.2	+	43	6390	c.6251G>T	c.(6250-6252)aGg>aTg	p.R2084M	SDK1_ENST00000389531.3_Splice_Site_p.R2064M|SDK1_ENST00000466611.1_3'UTR	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	2084					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R2084M(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AACGGGACCAGGTAGGCAGGC	0.647																																					p.R2084M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6251T	7						.						65.0	56.0	59.0					7																	4281545		2203	4300	6503	4248071	SO:0001630	splice_region_variant	221935	exon43			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.6251+1G>T	7.37:g.4281545G>T			4248071	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449969	0.63290	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.69806	-0.42;-0.43	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.82967	0.5152	M	0.80183	2.485	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.998	D	0.85273	0.1057	10	0.87932	D	0	.	17.3858	0.87415	0.0:0.0:1.0:0.0	.	2064;144;571;2084	F8W6X9;Q7Z5N4-2;F2Z3E9;Q7Z5N4	.;.;.;SDK1_HUMAN	M	2084;332;2064	ENSP00000385899:R2084M;ENSP00000374182:R2064M	ENSP00000374182:R2064M	R	+	2	0	SDK1	4248071	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	8.744000	0.91596	2.528000	0.85240	0.650000	0.86243	AGG		0.647	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	Missense_Mutation
GPNMB	10457	hgsc.bcm.edu	37	7	23309739	23309739	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:23309739G>A	ENST00000381990.2	+	9	1571	c.1410G>A	c.(1408-1410)ctG>ctA	p.L470L	GPNMB_ENST00000258733.4_Silent_p.L458L|GPNMB_ENST00000539136.1_Silent_p.L359L|GPNMB_ENST00000453162.2_Silent_p.L412L	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	470					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)	p.L470L(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			ACCTCACCCTGGGGGATGACA	0.502																																					p.L470L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1410A	7						.						159.0	124.0	136.0					7																	23309739		2203	4300	6503	23276264	SO:0001819	synonymous_variant	10457	exon9			X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.1410G>A	7.37:g.23309739G>A			23276264	NM_001005340	A4D155|Q6UVX1|Q8N1A1	Silent	SNP	ENST00000381990.2	37	CCDS34610.1																																																																																				0.502	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340	
NPY	4852	hgsc.bcm.edu	37	7	24324984	24324984	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:24324984C>T	ENST00000407573.1	+	3	415	c.125C>T	c.(124-126)gCg>gTg	p.A42V	NPY_ENST00000242152.2_Missense_Mutation_p.A42V|NPY_ENST00000405982.1_Missense_Mutation_p.A42V			P01303	NPY_HUMAN	neuropeptide Y	42					adult feeding behavior (GO:0008343)|behavior (GO:0007610)|blood circulation (GO:0008015)|calcium ion transport (GO:0006816)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of appetite (GO:0032100)|regulation of blood pressure (GO:0008217)|synaptic transmission (GO:0007268)	cell (GO:0005623)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)	p.A42V(1)		breast(1)|kidney(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	9						GACGCACCAGCGGAGGACATG	0.682																																					p.A42V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C125T	7						.						82.0	62.0	69.0					7																	24324984		2203	4300	6503	24291509	SO:0001583	missense	4852	exon2			K01911	CCDS5387.1	7p15.3	2013-02-26			ENSG00000122585	ENSG00000122585		"""Endogenous ligands"""	7955	protein-coding gene	gene with protein product	"""prepro-neuropeptide Y"""	162640					Standard	NM_000905		Approved	PYY4	uc003sww.2	P01303	OTTHUMG00000022973	ENST00000407573.1:c.125C>T	7.37:g.24324984C>T	ENSP00000384364:p.Ala42Val		24291509	NM_000905		Missense_Mutation	SNP	ENST00000407573.1	37	CCDS5387.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480203	0.84747	.	.	ENSG00000122585	ENST00000242152;ENST00000407573;ENST00000405982	T;T;T	0.42131	0.98;0.98;0.98	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.39733	0.1089	.	.	.	0.80722	D	1	P	0.47841	0.901	B	0.37888	0.26	T	0.29549	-1.0008	9	0.45353	T	0.12	-11.1598	20.1986	0.98248	0.0:1.0:0.0:0.0	.	42	P01303	NPY_HUMAN	V	42	ENSP00000242152:A42V;ENSP00000384364:A42V;ENSP00000385282:A42V	ENSP00000242152:A42V	A	+	2	0	NPY	24291509	1.000000	0.71417	0.923000	0.36655	0.679000	0.39708	7.783000	0.85696	2.781000	0.95711	0.650000	0.86243	GCG		0.682	NPY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326748.1	NM_000905	
PPP1R17	10842	hgsc.bcm.edu	37	7	31746882	31746882	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:31746882C>A	ENST00000342032.3	+	5	1081	c.453C>A	c.(451-453)gaC>gaA	p.D151E	PPP1R17_ENST00000498609.1_3'UTR|PPP1R17_ENST00000409146.3_Missense_Mutation_p.D100E	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	151					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)	p.D151E(1)									AGGATGGTGACAAGATAGCTA	0.428																																					p.D151E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C453A	7						.						131.0	112.0	118.0					7																	31746882		2203	4300	6503	31713407	SO:0001583	missense	10842	exon5			AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.453C>A	7.37:g.31746882C>A	ENSP00000340125:p.Asp151Glu		31713407	NM_006658	B4DE58|Q9UDQ0	Missense_Mutation	SNP	ENST00000342032.3	37	CCDS5436.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625776	0.28889	.	.	ENSG00000106341	ENST00000342032;ENST00000409146	T;T	0.31247	1.5;1.52	5.86	0.782	0.18567	.	0.130424	0.52532	D	0.000063	T	0.16642	0.0400	L	0.39898	1.24	0.33923	D	0.641086	B;B	0.21753	0.06;0.015	B;B	0.20184	0.028;0.015	T	0.09552	-1.0669	10	0.15952	T	0.53	-10.6131	1.3059	0.02088	0.1518:0.4483:0.1473:0.2526	.	100;151	B4DE58;O96001	.;PPR17_HUMAN	E	151;100	ENSP00000340125:D151E;ENSP00000386459:D100E	ENSP00000340125:D151E	D	+	3	2	C7orf16	31713407	0.996000	0.38824	1.000000	0.80357	0.995000	0.86356	0.054000	0.14205	0.493000	0.27837	-0.145000	0.13849	GAC		0.428	PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250498.1	NM_006658	
YKT6	10652	hgsc.bcm.edu	37	7	44247007	44247007	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:44247007G>A	ENST00000223369.2	+	4	396	c.309G>A	c.(307-309)aaG>aaA	p.K103K	YKT6_ENST00000496112.1_Silent_p.K103K|YKT6_ENST00000447123.1_3'UTR	NM_006555.3	NP_006546.1	O15498	YKT6_HUMAN	YKT6 v-SNARE homolog (S. cerevisiae)	103	Longin. {ECO:0000255|PROSITE- ProRule:PRU00231}.				ER to Golgi vesicle-mediated transport (GO:0006888)|metabolic process (GO:0008152)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle docking involved in exocytosis (GO:0006904)|vesicle targeting (GO:0006903)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|SNARE complex (GO:0031201)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|SNAP receptor activity (GO:0005484)	p.K103K(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7						AATTCTCCAAGCAAGTCGACA	0.517																																					p.K103K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G309A	7						.						99.0	81.0	87.0					7																	44247007		2203	4300	6503	44213532	SO:0001819	synonymous_variant	10652	exon4			BC007319	CCDS5482.1	7p13	2006-07-07			ENSG00000106636	ENSG00000106636			16959	protein-coding gene	gene with protein product	"""R-SNARE"""	606209				15479160, 15544955	Standard	NM_006555		Approved		uc003tkm.3	O15498	OTTHUMG00000129089	ENST00000223369.2:c.309G>A	7.37:g.44247007G>A			44213532	NM_006555	B4DR94|Q53F01|Q6FGU9|Q6IB15	Silent	SNP	ENST00000223369.2	37	CCDS5482.1																																																																																				0.517	YKT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251125.2	NM_006555	
PKD1L1	168507	hgsc.bcm.edu	37	7	47840391	47840391	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:47840391T>C	ENST00000289672.2	-	54	8099	c.8049A>G	c.(8047-8049)acA>acG	p.T2683T	C7orf69_ENST00000418326.2_Intron|C7orf69_ENST00000258776.4_Intron	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2683					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.T2683T(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GGAAGGCGTCTGTGAAGGTGC	0.562																																					p.T2683T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A8049G	7						.						84.0	87.0	86.0					7																	47840391		2203	4300	6503	47806916	SO:0001819	synonymous_variant	168507	exon54			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.8049A>G	7.37:g.47840391T>C			47806916	NM_138295	Q6UWK1	Silent	SNP	ENST00000289672.2	37	CCDS34633.1																																																																																				0.562	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
CLIP2	7461	hgsc.bcm.edu	37	7	73752920	73752920	+	Silent	SNP	C	C	T	rs554341269		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:73752920C>T	ENST00000395060.1	+	2	264	c.264C>T	c.(262-264)aaC>aaT	p.N88N	CLIP2_ENST00000361545.5_Silent_p.N88N|CLIP2_ENST00000223398.6_Silent_p.N88N			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	88						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)		p.N88N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						TGTGGGTGAACGGCGTGAAGC	0.687													C|||	1	0.000199681	0.0	0.0	5008	,	,		13822	0.001		0.0	False		,,,				2504	0.0				p.N88N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C264T	7						.						64.0	48.0	53.0					7																	73752920		2186	4281	6467	73390856	SO:0001819	synonymous_variant	7461	exon3			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.264C>T	7.37:g.73752920C>T			73390856	NM_003388	O14527|O43611	Silent	SNP	ENST00000395060.1	37	CCDS5569.1																																																																																				0.687	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
SEMA3E	9723	hgsc.bcm.edu	37	7	83029486	83029486	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:83029486A>G	ENST00000307792.3	-	11	1691	c.1224T>C	c.(1222-1224)caT>caC	p.H408H	SEMA3E_ENST00000427262.1_Silent_p.H348H	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	408	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.H408H(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				ACATTAGTGGATGACTTCTTG	0.413																																					p.H408H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1224C	7						.						209.0	190.0	196.0					7																	83029486		2203	4300	6503	82867422	SO:0001819	synonymous_variant	9723	exon11			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1224T>C	7.37:g.83029486A>G			82867422	NM_012431	B4E1P1|Q75M94|Q75M97	Silent	SNP	ENST00000307792.3	37	CCDS34674.1																																																																																				0.413	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
SRI	6717	hgsc.bcm.edu	37	7	87838694	87838694	+	Silent	SNP	G	G	A	rs183967956	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:87838694G>A	ENST00000265729.2	-	6	523	c.471C>T	c.(469-471)gaC>gaT	p.D157D	SRI_ENST00000490437.1_Silent_p.D114D|SRI_ENST00000419179.1_Silent_p.D117D|SRI_ENST00000394641.3_Silent_p.D142D|SRI_ENST00000431660.1_Silent_p.D142D	NM_003130.3	NP_003121.1	P30626	SORCN_HUMAN	sorcin	157	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				action potential (GO:0001508)|calcium ion transport (GO:0006816)|cytoplasmic sequestering of transcription factor (GO:0042994)|heart development (GO:0007507)|intracellular sequestering of iron ion (GO:0006880)|muscle organ development (GO:0007517)|negative regulation of heart rate (GO:0010459)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|proteolysis (GO:0006508)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart contraction (GO:0008016)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of relaxation of muscle (GO:1901077)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of striated muscle contraction (GO:0006942)|signal transduction (GO:0007165)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|ion channel binding (GO:0044325)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)	p.D157D(1)		large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(14;0.00202)					CGATGTAGTCGTCGAAGGTGA	0.433													G|||	3	0.000599042	0.0008	0.0029	5008	,	,		13614	0.0		0.0	False		,,,				2504	0.0				p.D157D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C471T	7						.						183.0	152.0	162.0					7																	87838694		2203	4300	6503	87676630	SO:0001819	synonymous_variant	6717	exon6			M32886	CCDS5612.1, CCDS47638.1, CCDS59063.1	7q21.1	2014-09-17			ENSG00000075142	ENSG00000075142		"""EF-hand domain containing"""	11292	protein-coding gene	gene with protein product		182520				2901906	Standard	NM_001256891		Approved		uc003ujq.2	P30626	OTTHUMG00000157267	ENST00000265729.2:c.471C>T	7.37:g.87838694G>A			87676630	NM_003130	A8MTH6|B4DKK2|D6W5Q0	Silent	SNP	ENST00000265729.2	37	CCDS5612.1																																																																																				0.433	SRI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253680.1	NM_003130	
KRIT1	889	hgsc.bcm.edu	37	7	91855862	91855862	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:91855862A>G	ENST00000340022.2	-	11	2142	c.1124T>C	c.(1123-1125)cTa>cCa	p.L375P	KRIT1_ENST00000394505.2_Missense_Mutation_p.L375P|KRIT1_ENST00000412043.2_Missense_Mutation_p.L375P|KRIT1_ENST00000394503.2_Missense_Mutation_p.L327P|KRIT1_ENST00000394507.1_Missense_Mutation_p.L375P	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	375					angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)	p.L375P(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGGGTGGTTTAGGAGAATCTG	0.343																																					p.L375P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1124C	7						.						113.0	113.0	113.0					7																	91855862		2203	4300	6503	91693798	SO:0001583	missense	889	exon11			AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.1124T>C	7.37:g.91855862A>G	ENSP00000344668:p.Leu375Pro		91693798	NM_194455	A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Missense_Mutation	SNP	ENST00000340022.2	37	CCDS5624.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.613128	0.87258	.	.	ENSG00000001631	ENST00000394507;ENST00000340022;ENST00000412043;ENST00000394505;ENST00000394503;ENST00000415227;ENST00000445516	D;D;D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47;-2.47;-2.47	5.66	5.66	0.87406	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.96756	0.8941	H	0.97918	4.105	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.97110	0.998;1.0;0.998	D	0.98312	1.0524	10	0.87932	D	0	3.129	15.8975	0.79346	1.0:0.0:0.0:0.0	.	375;327;375	A4D1F7;A6NNU0;O00522	.;.;KRIT1_HUMAN	P	375;375;375;375;327;375;137	ENSP00000378015:L375P;ENSP00000344668:L375P;ENSP00000410909:L375P;ENSP00000378013:L375P;ENSP00000378011:L327P;ENSP00000404084:L137P	ENSP00000344668:L375P	L	-	2	0	KRIT1	91693798	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.078000	0.94023	2.155000	0.67459	0.377000	0.23210	CTA		0.343	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253910.1		
COL1A2	1278	hgsc.bcm.edu	37	7	94049906	94049906	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:94049906G>T	ENST00000297268.6	+	37	2712	c.2241G>T	c.(2239-2241)aaG>aaT	p.K747N		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	747			Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.K747N(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	AAGGGCCTAAGGGTGAAAACG	0.527										HNSCC(75;0.22)																											p.K747N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2241T	7						.						60.0	56.0	57.0					7																	94049906		2203	4300	6503	93887842	SO:0001583	missense	1278	exon37			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2241G>T	7.37:g.94049906G>T	ENSP00000297268:p.Lys747Asn		93887842	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.501313	0.64298	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93307	-3.2	5.66	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.96420	0.8832	M	0.82923	2.615	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.96260	0.9190	10	0.87932	D	0	.	13.1107	0.59270	0.126:0.0:0.874:0.0	.	747	P08123	CO1A2_HUMAN	N	747;748	ENSP00000297268:K747N	ENSP00000297268:K747N	K	+	3	2	COL1A2	93887842	1.000000	0.71417	1.000000	0.80357	0.471000	0.32888	2.013000	0.40942	2.840000	0.97914	0.655000	0.94253	AAG		0.527	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
TMEM130	222865	hgsc.bcm.edu	37	7	98446238	98446238	+	Missense_Mutation	SNP	G	G	A	rs142570247		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:98446238G>A	ENST00000416379.2	-	7	1091	c.1087C>T	c.(1087-1089)Cgg>Tgg	p.R363W	TMEM130_ENST00000339375.4_Missense_Mutation_p.R363W|TMEM130_ENST00000345589.4_Missense_Mutation_p.R261W|TMEM130_ENST00000546258.1_Missense_Mutation_p.R344W|TMEM130_ENST00000474857.1_5'Flank|TMEM130_ENST00000450876.1_Missense_Mutation_p.R279W			Q8N3G9	TM130_HUMAN	transmembrane protein 130	363						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.R363W(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	25	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GTGGCATTCCGCAGGGTCATG	0.517																																					p.R261W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C781T	7						.	G	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	165.0	144.0	151.0		1087,781,1087	-3.0	0.4	7	dbSNP_134	151	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	TMEM130	NM_001134450.1,NM_001134451.1,NM_152913.2	101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	363/436,261/322,363/424	98446238	1,13005	2203	4300	6503	98284174	SO:0001583	missense	222865	exon6				CCDS5658.1, CCDS47649.1, CCDS47650.1	7q22.1	2006-03-09			ENSG00000166448	ENSG00000166448			25429	protein-coding gene	gene with protein product						12975309	Standard	NM_152913		Approved	DKFZp761L1417, FLJ42643	uc003upo.3	Q8N3G9	OTTHUMG00000154419	ENST00000416379.2:c.1087C>T	7.37:g.98446238G>A	ENSP00000413163:p.Arg363Trp		98284174	NM_001134451	A4D266|B7Z364|Q8IY46|Q8N0W9|Q8N3R2	Missense_Mutation	SNP	ENST00000416379.2	37	CCDS47650.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.301995	0.60195	0.0	1.16E-4	ENSG00000166448	ENST00000416379;ENST00000339375;ENST00000450876;ENST00000345589;ENST00000546258	T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45	5.15	-2.95	0.05564	.	0.145914	0.42964	D	0.000627	T	0.23766	0.0575	L	0.43152	1.355	0.21184	N	0.999762	P;P;D;P	0.89917	0.529;0.529;1.0;0.529	B;B;D;B	0.68483	0.126;0.126;0.958;0.126	T	0.06607	-1.0817	10	0.51188	T	0.08	-18.659	7.9082	0.29774	0.1033:0.0:0.1847:0.712	.	363;344;363;261	Q8N3G9-2;B7Z2F1;Q8N3G9;Q8N3G9-3	.;.;TM130_HUMAN;.	W	363;363;279;261;344	ENSP00000413163:R363W;ENSP00000341256:R363W;ENSP00000390200:R279W;ENSP00000330262:R261W;ENSP00000445869:R344W	ENSP00000341256:R363W	R	-	1	2	TMEM130	98284174	0.119000	0.22226	0.385000	0.26158	0.990000	0.78478	0.093000	0.15086	-0.112000	0.11979	0.561000	0.74099	CGG		0.517	TMEM130-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380713.1	NM_152913	
GAL3ST4	79690	hgsc.bcm.edu	37	7	99758175	99758175	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:99758175G>A	ENST00000360039.4	-	4	1229	c.837C>T	c.(835-837)ttC>ttT	p.F279F	C7orf43_ENST00000419841.1_5'Flank|GAL3ST4_ENST00000411994.1_Missense_Mutation_p.S178L|GAL3ST4_ENST00000426974.2_Silent_p.F217F|C7orf43_ENST00000457641.1_5'Flank|GAL3ST4_ENST00000413800.1_Silent_p.F279F|GAL3ST4_ENST00000423751.1_Missense_Mutation_p.S178L|C7orf43_ENST00000316937.3_5'Flank	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	279					cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)	p.F279F(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACCCCAAATCGAAAGAGGCAG	0.532																																					p.F279F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C837T	7						.						100.0	96.0	97.0					7																	99758175		2203	4300	6503	99596111	SO:0001819	synonymous_variant	79690	exon4			AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.837C>T	7.37:g.99758175G>A			99596111	NM_024637	A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Silent	SNP	ENST00000360039.4	37	CCDS5688.1	.	.	.	.	.	.	.	.	.	.	G	3.752	-0.051401	0.07407	.	.	ENSG00000197093	ENST00000423751;ENST00000411994	.	.	.	4.28	1.84	0.25277	.	.	.	.	.	T	0.45796	0.1360	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.39563	-0.9608	5	0.87932	D	0	0.057	10.0157	0.42014	0.0:0.0:0.55:0.45	.	.	.	.	L	178	.	ENSP00000414733:S178L	S	-	2	0	GAL3ST4	99596111	0.000000	0.05858	0.006000	0.13384	0.493000	0.33554	-0.072000	0.11486	0.196000	0.20367	-0.535000	0.04281	TCG		0.532	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337495.2	NM_024637	
ESYT2	57488	hgsc.bcm.edu	37	7	158536321	158536321	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr7:158536321G>T	ENST00000251527.5	-	16	1839	c.1774C>A	c.(1774-1776)Ctc>Atc	p.L592I	ESYT2_ENST00000435514.2_Missense_Mutation_p.L27I	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	620	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)	p.L592I(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						AGCTGGCTGAGGGGGACCTTC	0.552																																					p.L592I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1774A	7						.						86.0	69.0	75.0					7																	158536321		2203	4300	6503	158229082	SO:0001583	missense	57488	exon16			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.1774C>A	7.37:g.158536321G>T	ENSP00000251527:p.Leu592Ile		158229082	NM_020728	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	ENST00000251527.5	37	CCDS34791.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735698	0.89482	.	.	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000435514;ENST00000377650;ENST00000429474	T;T;T	0.42900	0.96;0.96;0.96	5.28	5.28	0.74379	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.69637	0.3133	M	0.84511	2.7	0.53688	D	0.999979	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.988	T	0.75300	-0.3366	10	0.87932	D	0	-4.9448	17.8955	0.88886	0.0:0.0:1.0:0.0	.	592;620	A0FGR8-2;A0FGR8	.;ESYT2_HUMAN	I	592;641;583;27;27;416	ENSP00000251527:L592I;ENSP00000275418:L583I;ENSP00000411488:L27I	ENSP00000251527:L592I	L	-	1	0	ESYT2	158229082	1.000000	0.71417	0.960000	0.40013	0.907000	0.53573	6.218000	0.72224	2.470000	0.83445	0.557000	0.71058	CTC		0.552	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322647.1	NM_020728	
CST9	128822	hgsc.bcm.edu	37	20	23584163	23584163	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:23584163C>A	ENST00000376971.3	-	2	475	c.464G>T	c.(463-465)aGg>aTg	p.R155M		NM_001008693.2	NP_001008693.2	Q5W186	CST9_HUMAN	cystatin 9 (testatin)	155						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.R155M(1)		central_nervous_system(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Colorectal(13;0.0993)					CCCTTTGTCCCTCGGAATGGC	0.572																																					p.R155M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G464T	20						.						123.0	84.0	97.0					20																	23584163		2203	4300	6503	23532163	SO:0001583	missense	128822	exon2			AF494536	CCDS33450.1	20p11.21	2012-08-14			ENSG00000173335	ENSG00000173335			13261	protein-coding gene	gene with protein product						20565543	Standard	NM_001008693		Approved	CLM, CTES7A	uc002wtl.3	Q5W186	OTTHUMG00000032076	ENST00000376971.3:c.464G>T	20.37:g.23584163C>A	ENSP00000366170:p.Arg155Met		23532163	NM_001008693	B2RP76|Q8TD53	Missense_Mutation	SNP	ENST00000376971.3	37	CCDS33450.1	.	.	.	.	.	.	.	.	.	.	C	5.358	0.251285	0.10130	.	.	ENSG00000173335	ENST00000376971	T	0.24151	1.87	1.61	-1.59	0.08453	.	.	.	.	.	T	0.09642	0.0237	N	0.08118	0	0.09310	N	1	B	0.33583	0.418	B	0.23018	0.043	T	0.17319	-1.0373	9	0.66056	D	0.02	.	5.0217	0.14365	0.0:0.4037:0.0:0.5963	.	155	Q5W186	CST9_HUMAN	M	155	ENSP00000366170:R155M	ENSP00000366170:R155M	R	-	2	0	CST9	23532163	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.351000	0.07711	-0.521000	0.06426	0.561000	0.74099	AGG		0.572	CST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078341.1	NM_001008693.1	
SYNDIG1	79953	hgsc.bcm.edu	37	20	24524119	24524119	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:24524119C>T	ENST00000376862.3	+	2	1019	c.386C>T	c.(385-387)cCg>cTg	p.P129L		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	129					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)	p.P129L(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						CTCGAGTACCCGGATGGGAAG	0.607																																					p.P129L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C386T	20						.						81.0	84.0	83.0					20																	24524119		2203	4300	6503	24472119	SO:0001583	missense	79953	exon2			AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.386C>T	20.37:g.24524119C>T	ENSP00000366058:p.Pro129Leu		24472119	NM_024893	Q6IA30|Q9H514	Missense_Mutation	SNP	ENST00000376862.3	37	CCDS13164.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.330865	0.60853	.	.	ENSG00000101463	ENST00000376862	D	0.90444	-2.67	5.47	5.47	0.80525	.	0.138225	0.51477	D	0.000099	D	0.86485	0.5944	M	0.62723	1.935	0.80722	D	1	D	0.54772	0.968	B	0.28385	0.089	D	0.89436	0.3720	10	0.87932	D	0	-33.8773	16.8193	0.85741	0.0:1.0:0.0:0.0	.	129	Q9H7V2	SYNG1_HUMAN	L	129	ENSP00000366058:P129L	ENSP00000366058:P129L	P	+	2	0	SYNDIG1	24472119	0.989000	0.36119	0.975000	0.42487	0.689000	0.40095	7.082000	0.76851	2.582000	0.87167	0.561000	0.74099	CCG		0.607	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078376.1	NM_024893	
LZTS3	9762	hgsc.bcm.edu	37	20	3146762	3146762	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:3146762C>T	ENST00000329152.3	-	2	2101	c.704G>A	c.(703-705)aGc>aAc	p.S235N	LZTS3_ENST00000360342.3_Missense_Mutation_p.S235N|LZTS3_ENST00000337576.5_Missense_Mutation_p.S235N			O60299	LZTS3_HUMAN		235						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)		p.S235N(1)									CAGGTGCTGGCTGTAGCTGGA	0.637																																					p.S235N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G704A	20						.						66.0	53.0	57.0					20																	3146762		2203	4300	6503	3094762	SO:0001583	missense	9762	exon2																														ENST00000329152.3:c.704G>A	20.37:g.3146762C>T	ENSP00000332123:p.Ser235Asn		3094762	NM_014731	A2A2Q7|D3DVX6|Q8IXX8	Missense_Mutation	SNP	ENST00000329152.3	37	CCDS13049.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029619	0.75504	.	.	ENSG00000088899	ENST00000329152;ENST00000360342;ENST00000337576	T;T;T	0.36520	1.32;1.25;1.25	5.26	5.26	0.73747	.	0.089039	0.85682	D	0.000000	T	0.51041	0.1651	M	0.69823	2.125	0.54753	D	0.999988	P;P	0.50528	0.936;0.895	P;B	0.50192	0.634;0.431	T	0.54576	-0.8273	10	0.52906	T	0.07	-23.1477	18.8648	0.92287	0.0:1.0:0.0:0.0	.	235;235	O60299-2;O60299	.;PRIP1_HUMAN	N	235	ENSP00000332123:S235N;ENSP00000353496:S235N;ENSP00000338166:S235N	ENSP00000332123:S235N	S	-	2	0	RP5-1187M17.10	3094762	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.747000	0.85070	2.450000	0.82876	0.561000	0.74099	AGC		0.637	LZTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077715.2		
ACSS1	84532	hgsc.bcm.edu	37	20	25011504	25011504	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:25011504C>T	ENST00000323482.4	-	3	601	c.522G>A	c.(520-522)gtG>gtA	p.V174V	ACSS1_ENST00000542618.1_Silent_p.V53V|ACSS1_ENST00000537502.1_Silent_p.V91V|ACSS1_ENST00000432802.2_Silent_p.V174V	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	174					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)	p.V174V(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCAATGGGGACACGGGCATGT	0.607																																					p.V174V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G522A	20						.						96.0	75.0	82.0					20																	25011504		2203	4300	6503	24959504	SO:0001819	synonymous_variant	84532	exon3				CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.522G>A	20.37:g.25011504C>T			24959504	NM_032501	B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	Silent	SNP	ENST00000323482.4	37	CCDS13167.1																																																																																				0.607	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078386.2	NM_032501	
CDK5RAP1	51654	hgsc.bcm.edu	37	20	31967304	31967304	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:31967304C>T	ENST00000357886.4	-	9	1265	c.1112G>A	c.(1111-1113)cGt>cAt	p.R371H	CDK5RAP1_ENST00000477105.1_5'UTR|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.R357H|CDK5RAP1_ENST00000473997.1_Missense_Mutation_p.R267H|CDK5RAP1_ENST00000339269.5_Intron|CDK5RAP1_ENST00000544843.1_Missense_Mutation_p.R357H			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	371					brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)	p.R357H(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						AGAGGTAAAACGGATCCTCAT	0.468																																					p.R267H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G800A	20						.						76.0	77.0	77.0					20																	31967304		2203	4300	6503	31430965	SO:0001583	missense	51654	exon8			AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.1112G>A	20.37:g.31967304C>T	ENSP00000350558:p.Arg371His		31430965	NM_016082	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	ENST00000357886.4	37		.	.	.	.	.	.	.	.	.	.	C	32	5.137725	0.94517	.	.	ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000452723;ENST00000544843	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.69	5.69	0.88448	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	T	0.70011	0.3175	H	0.98738	4.315	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.82868	-0.0244	10	0.87932	D	0	-12.6877	17.3028	0.87187	0.0:1.0:0.0:0.0	.	371;357;357;357;267	Q96SZ6;Q675N5;Q53H36;Q96SZ6-3;Q96SZ6-2	CK5P1_HUMAN;.;.;.;.	H	357;371;267;357	ENSP00000217372:R357H;ENSP00000350558:R371H;ENSP00000408133:R267H;ENSP00000439034:R357H	ENSP00000217372:R357H	R	-	2	0	CDK5RAP1	31430965	1.000000	0.71417	0.967000	0.41034	0.805000	0.45488	7.549000	0.82163	2.676000	0.91093	0.561000	0.74099	CGT		0.468	CDK5RAP1-011	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078697.1	NM_016408	
FAM83C	128876	hgsc.bcm.edu	37	20	33875029	33875029	+	Missense_Mutation	SNP	C	C	T	rs377103295		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:33875029C>T	ENST00000374408.3	-	4	1649	c.1553G>A	c.(1552-1554)cGa>cAa	p.R518Q	EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374450.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA|EIF6_ENST00000374436.3_5'Flank|EIF6_ENST00000374443.3_5'Flank	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	518								p.R518Q(1)		central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			TCCCACTTCTCGGGCTCTGGG	0.642																																					p.R518Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1553A	20						.	C	GLN/ARG	0,4240		0,0,2120	45.0	46.0	46.0		1553	2.0	1.0	20		46	1,8365		0,1,4182	no	missense	FAM83C	NM_178468.4	43	0,1,6302	TT,TC,CC		0.012,0.0,0.0079	benign	518/748	33875029	1,12605	2120	4183	6303	33338443	SO:0001583	missense	128876	exon4			AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.1553G>A	20.37:g.33875029C>T	ENSP00000363529:p.Arg518Gln		33338443	NM_178468	Q14D67|Q5JWN6|Q8N276	Missense_Mutation	SNP	ENST00000374408.3	37	CCDS13251.1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.400408	0.25291	0.0	1.2E-4	ENSG00000125998	ENST00000374408	T	0.08458	3.09	4.14	2.03	0.26663	.	.	.	.	.	T	0.04634	0.0126	N	0.16567	0.415	0.09310	N	0.999999	B	0.14438	0.01	B	0.09377	0.004	T	0.41179	-0.9523	9	0.25751	T	0.34	-16.1375	4.913	0.13831	0.0:0.6599:0.2208:0.1194	.	518	Q9BQN1	FA83C_HUMAN	Q	518	ENSP00000363529:R518Q	ENSP00000363529:R518Q	R	-	2	0	FAM83C	33338443	0.900000	0.30661	0.989000	0.46669	0.750000	0.42670	0.023000	0.13533	1.096000	0.41439	0.561000	0.74099	CGA		0.642	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3		
CDC25B	994	hgsc.bcm.edu	37	20	3785493	3785493	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:3785493G>T	ENST00000245960.5	+	16	2325	c.1628G>T	c.(1627-1629)cGg>cTg	p.R543L	CDC25B_ENST00000344256.6_Missense_Mutation_p.R479L|CDC25B_ENST00000340833.4_Missense_Mutation_p.R502L|CDC25B_ENST00000467519.1_3'UTR|CDC25B_ENST00000439880.2_Missense_Mutation_p.R529L|CDC25B_ENST00000379598.5_Missense_Mutation_p.R452L	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	543					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.R543L(1)|p.R564L(1)		NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						CAGGACTACCGGCCCATGAAC	0.622																																					p.R529L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1586T	20						.						92.0	89.0	90.0					20																	3785493		2203	4300	6503	3733493	SO:0001583	missense	994	exon16				CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.1628G>T	20.37:g.3785493G>T	ENSP00000245960:p.Arg543Leu		3733493	NM_004358	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	ENST00000245960.5	37	CCDS13067.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520668	0.85495	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880;ENST00000340833	T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62	5.11	5.11	0.69529	Rhodanese-like (2);	0.000000	0.64402	D	0.000001	T	0.53981	0.1830	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;1.0;1.0;0.999	T	0.47522	-0.9111	10	0.27785	T	0.31	-9.7085	16.4067	0.83677	0.0:0.0:1.0:0.0	.	452;465;479;431;502;529;543	B4DQZ3;B4DRC3;B4DIG0;B3KS38;P30305-3;P30305-2;P30305	.;.;.;.;.;.;MPIP2_HUMAN	L	479;452;543;529;502	ENSP00000339125:R479L;ENSP00000368918:R452L;ENSP00000245960:R543L;ENSP00000405972:R529L;ENSP00000339170:R502L	ENSP00000245960:R543L	R	+	2	0	CDC25B	3733493	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.794000	0.91867	2.532000	0.85374	0.563000	0.77884	CGG		0.622	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077779.2	NM_021874	
RALGAPB	57148	hgsc.bcm.edu	37	20	37117117	37117117	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:37117117T>C	ENST00000262879.6	+	2	326	c.42T>C	c.(40-42)aaT>aaC	p.N14N	RALGAPB_ENST00000397038.1_5'UTR|RALGAPB_ENST00000397042.3_Silent_p.N14N|RALGAPB_ENST00000537204.1_Silent_p.N14N|RALGAPB_ENST00000397040.1_Silent_p.N14N			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	14					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.N14N(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TGATTCAGAATGATCAAGGCC	0.488																																					p.N14N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T42C	20						.						212.0	183.0	193.0					20																	37117117		2203	4300	6503	36550531	SO:0001819	synonymous_variant	57148	exon2			AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.42T>C	20.37:g.37117117T>C			36550531	NM_020336	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Silent	SNP	ENST00000262879.6	37	CCDS13305.1																																																																																				0.488	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336	
GTSF1L	149699	hgsc.bcm.edu	37	20	42355069	42355069	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:42355069T>C	ENST00000373003.1	-	1	569	c.266A>G	c.(265-267)gAt>gGt	p.D89G	GTSF1L_ENST00000373005.2_Missense_Mutation_p.D89G	NM_001008901.1|NM_176791.3	NP_001008901.1|NP_789761.1	Q9H1H1	GTSFL_HUMAN	gametocyte specific factor 1-like	89							metal ion binding (GO:0046872)	p.D89G(1)		endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CTGGGTGTCATCGTTCTGCTC	0.517																																					p.D89G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A266G	20						.						134.0	113.0	120.0					20																	42355069		2203	4300	6503	41788483	SO:0001583	missense	149699	exon1			AK058060	CCDS13323.1, CCDS33471.1	20q13.12	2007-11-27	2007-11-27	2007-11-27	ENSG00000124196	ENSG00000124196			16198	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 65"", ""family with sequence similarity 112, member A"""	C20orf65, FAM112A			Standard	NM_176791		Approved	dJ1028D15.4	uc002xld.3	Q9H1H1	OTTHUMG00000032510	ENST00000373003.1:c.266A>G	20.37:g.42355069T>C	ENSP00000362094:p.Asp89Gly		41788483	NM_001008901	Q5JWH5	Missense_Mutation	SNP	ENST00000373003.1	37	CCDS13323.1	.	.	.	.	.	.	.	.	.	.	T	4.374	0.068912	0.08436	.	.	ENSG00000124196	ENST00000373003;ENST00000373005	T;T	0.43688	0.94;0.95	3.68	-1.08	0.09936	.	2.388520	0.02250	N	0.066497	T	0.16769	0.0403	N	0.01576	-0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12091	-1.0561	10	0.22706	T	0.39	-8.3104	5.098	0.14745	0.0:0.5719:0.2102:0.2179	.	89;89	Q9H1H1;Q5JWH5	GTSFL_HUMAN;.	G	89	ENSP00000362094:D89G;ENSP00000362096:D89G	ENSP00000362094:D89G	D	-	2	0	GTSF1L	41788483	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.357000	0.07651	-0.185000	0.10550	-0.874000	0.02982	GAT		0.517	GTSF1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079313.1	NM_176791	
MMP9	4318	hgsc.bcm.edu	37	20	44638533	44638533	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:44638533G>A	ENST00000372330.3	+	2	186	c.167G>A	c.(166-168)cGg>cAg	p.R56Q		NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	56					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R56Q(1)		breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	GGTTACACTCGGGTGGCAGAG	0.592																																					p.R56Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G167A	20						.						56.0	42.0	47.0					20																	44638533		2151	4116	6267	44071940	SO:0001583	missense	4318	exon2				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.167G>A	20.37:g.44638533G>A	ENSP00000361405:p.Arg56Gln		44071940	NM_004994	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	ENST00000372330.3	37	CCDS13390.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854236	0.32791	.	.	ENSG00000100985	ENST00000372330	T	0.35789	1.29	4.18	-4.83	0.03161	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.963375	0.08629	N	0.917281	T	0.10380	0.0254	N	0.01874	-0.695	0.09310	N	1	B	0.18310	0.027	B	0.10450	0.005	T	0.36841	-0.9731	10	0.08599	T	0.76	.	6.9641	0.24613	0.2923:0.4129:0.2948:0.0	.	56	P14780	MMP9_HUMAN	Q	56	ENSP00000361405:R56Q	ENSP00000361405:R56Q	R	+	2	0	MMP9	44071940	0.000000	0.05858	0.000000	0.03702	0.178000	0.23041	-0.900000	0.04097	-0.605000	0.05753	0.462000	0.41574	CGG		0.592	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1		
ANKEF1	63926	hgsc.bcm.edu	37	20	10036251	10036251	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:10036251T>C	ENST00000378380.3	+	10	2603	c.2274T>C	c.(2272-2274)ccT>ccC	p.P758P	SNAP25-AS1_ENST00000421143.2_RNA|SNAP25-AS1_ENST00000603542.1_RNA|ANKEF1_ENST00000378392.1_Silent_p.P758P|ANKEF1_ENST00000488991.1_3'UTR|AL109754.1_ENST00000408554.2_RNA	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	758							calcium ion binding (GO:0005509)	p.P758P(1)									TTATGATGCCTTTTCAGAAGA	0.478																																					p.P758P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2274C	20						.						107.0	99.0	101.0					20																	10036251		2203	4300	6503	9984251	SO:0001819	synonymous_variant	63926	exon10			AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.2274T>C	20.37:g.10036251T>C			9984251	NM_198798	B3KUQ0|Q9H6Y9	Silent	SNP	ENST00000378380.3	37	CCDS13108.1																																																																																				0.478	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077968.2	NM_022096	
SLC2A10	81031	hgsc.bcm.edu	37	20	45354319	45354319	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr20:45354319G>A	ENST00000359271.2	+	2	894	c.644G>A	c.(643-645)cGg>cAg	p.R215Q		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	215					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)	p.R215Q(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				GGGAGGCCACGGTACTCCTTT	0.632																																					p.R215Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G644A	20						.						59.0	56.0	57.0					20																	45354319		2203	4299	6502	44787726	SO:0001583	missense	81031	exon2			AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.644G>A	20.37:g.45354319G>A	ENSP00000352216:p.Arg215Gln		44787726	NM_030777	A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	37	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.413100	0.01145	.	.	ENSG00000197496	ENST00000359271	T	0.81247	-1.47	6.0	1.36	0.22044	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	3.305020	0.01147	N	0.006337	T	0.57475	0.2056	N	0.02169	-0.655	0.09310	N	1	B	0.17852	0.024	B	0.12837	0.008	T	0.54886	-0.8226	10	0.10377	T	0.69	.	8.032	0.30470	0.5323:0.0:0.4676:0.0	.	215	O95528	GTR10_HUMAN	Q	215	ENSP00000352216:R215Q	ENSP00000352216:R215Q	R	+	2	0	SLC2A10	44787726	0.000000	0.05858	0.003000	0.11579	0.253000	0.25986	0.070000	0.14573	0.420000	0.25954	-0.192000	0.12808	CGG		0.632	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2		
EIF5	1983	hgsc.bcm.edu	37	14	103806123	103806123	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:103806123A>G	ENST00000216554.3	+	10	1730	c.1054A>G	c.(1054-1056)Atc>Gtc	p.I352V	EIF5_ENST00000558506.1_Missense_Mutation_p.I352V|SNORA28_ENST00000606769.1_RNA|EIF5_ENST00000392715.2_Missense_Mutation_p.I352V	NM_001969.4	NP_001960.2	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	352	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.I352V(1)		breast(3)|kidney(2)|large_intestine(3)|lung(5)|pancreas(2)|skin(2)|upper_aerodigestive_tract(1)	18		Melanoma(154;0.155)	Epithelial(46;0.182)			AGAGGTCATCATCAGCTGGTC	0.443																																					p.I352V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1054G	14						.						63.0	56.0	58.0					14																	103806123		2203	4300	6503	102875876	SO:0001583	missense	1983	exon9			U49436	CCDS9980.1	14q32.32	2006-05-11				ENSG00000100664			3299	protein-coding gene	gene with protein product		601710				8663286	Standard	NM_001969		Approved		uc001ymq.4	P55010		ENST00000216554.3:c.1054A>G	14.37:g.103806123A>G	ENSP00000216554:p.Ile352Val		102875876	NM_183004	Q53XB3|Q9H5N2|Q9UG48	Missense_Mutation	SNP	ENST00000216554.3	37	CCDS9980.1	.	.	.	.	.	.	.	.	.	.	.	13.79	2.341767	0.41498	.	.	ENSG00000100664	ENST00000216554;ENST00000392715	D;D	0.82433	-1.61;-1.61	5.89	5.89	0.94794	eIF4-gamma/eIF5/eIF2-epsilon (3);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.255345	0.41500	D	0.000866	T	0.72087	0.3417	L	0.31420	0.93	0.40475	D	0.980386	B	0.09022	0.002	B	0.19148	0.024	T	0.67241	-0.5720	10	0.34782	T	0.22	-1.7492	7.2738	0.26273	0.7055:0.1596:0.0:0.1349	.	352	P55010	IF5_HUMAN	V	352	ENSP00000216554:I352V;ENSP00000376477:I352V	ENSP00000216554:I352V	I	+	1	0	EIF5	102875876	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.219000	0.42899	2.245000	0.73994	0.455000	0.32223	ATC		0.443	EIF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415329.2	NM_001969	
SALL2	6297	hgsc.bcm.edu	37	14	21991799	21991799	+	Missense_Mutation	SNP	C	C	T	rs538393267		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:21991799C>T	ENST00000327430.3	-	2	2357	c.2063G>A	c.(2062-2064)cGg>cAg	p.R688Q	AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000317492.5_Intron|SALL2_ENST00000450879.2_Missense_Mutation_p.R551Q|SALL2_ENST00000538754.1_Intron	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	688					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R688Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		ATTCTGTGCCCGGGCAGCTGG	0.592													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20448	0.0		0.0	False		,,,				2504	0.0				p.R688Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2063A	14						.						55.0	55.0	55.0					14																	21991799		2203	4300	6503	21061639	SO:0001583	missense	6297	exon2			AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.2063G>A	14.37:g.21991799C>T	ENSP00000333537:p.Arg688Gln		21061639	NM_005407	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	ENST00000327430.3	37	CCDS32045.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.94|16.94	3.259683|3.259683	0.59321|0.59321	.|.	.|.	ENSG00000165821|ENSG00000165821	ENST00000546363|ENST00000327430;ENST00000450879	.|T;T	.|0.04970	.|3.6;3.52	4.76|4.76	3.88|3.88	0.44766|0.44766	.|.	.|0.000000	.|0.35838	.|N	.|0.002944	T|T	0.04092|0.04092	0.0114|0.0114	L|L	0.31752|0.31752	0.955|0.955	0.47621|0.47621	D|D	0.999472|0.999472	.|P;P;B;B	.|0.36438	.|0.553;0.553;0.326;0.326	.|B;B;B;B	.|0.23574	.|0.047;0.047;0.032;0.032	T|T	0.45833|0.45833	-0.9234|-0.9234	5|10	.|0.72032	.|D	.|0.01	-40.9305|-40.9305	7.1635|7.1635	0.25677|0.25677	0.0:0.8031:0.0:0.1969|0.0:0.8031:0.0:0.1969	.|.	.|551;551;449;688	.|B4DK65;E7EW59;B4DFD9;Q9Y467	.|.;.;.;SALL2_HUMAN	R|Q	547|688;551	.|ENSP00000333537:R688Q;ENSP00000396773:R551Q	.|ENSP00000333537:R688Q	G|R	-|-	1|2	0|0	SALL2|SALL2	21061639|21061639	0.195000|0.195000	0.23338|0.23338	1.000000|1.000000	0.80357|0.80357	0.945000|0.945000	0.59286|0.59286	2.608000|2.608000	0.46308|0.46308	1.233000|1.233000	0.43693|0.43693	-0.251000|-0.251000	0.11542|0.11542	GGG|CGG		0.592	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401242.1	NM_005407	
SLC7A8	23428	hgsc.bcm.edu	37	14	23612381	23612381	+	Missense_Mutation	SNP	G	G	A	rs540015976		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:23612381G>A	ENST00000316902.7	-	4	1266	c.541C>T	c.(541-543)Cgg>Tgg	p.R181W	SLC7A8_ENST00000469263.1_Missense_Mutation_p.R181W|SLC7A8_ENST00000532568.1_5'UTR|SLC7A8_ENST00000529705.2_Missense_Mutation_p.R76W|SLC7A8_ENST00000453702.1_5'UTR|SLC7A8_ENST00000422941.2_Missense_Mutation_p.A8V	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	181					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)	p.R181W(1)		autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	GTGGCCCACCGCACACTGGAA	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		19596	0.0		0.0	False		,,,				2504	0.001				p.R181W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C541T	14						.						99.0	95.0	96.0					14																	23612381		2203	4300	6503	22682221	SO:0001583	missense	23428	exon4			Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.541C>T	14.37:g.23612381G>A	ENSP00000320378:p.Arg181Trp		22682221	NM_012244	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000316902.7	37	CCDS9590.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.5|24.5	4.534604|4.534604	0.85812|0.85812	.|.	.|.	ENSG00000092068|ENSG00000092068	ENST00000422941|ENST00000316902;ENST00000469263;ENST00000529705	D|D;D;D	0.86627|0.91124	-2.15|-2.79;-2.79;-2.79	5.75|5.75	5.75|5.75	0.90469|0.90469	.|Amino acid permease domain (1);	.|0.053072	.|0.64402	.|D	.|0.000001	D|D	0.96629|0.96629	0.8900|0.8900	M|M	0.92555|0.92555	3.32|3.32	0.32120|0.32120	N|N	0.588095|0.588095	B|D;D;D	0.26363|0.89917	0.147|1.0;1.0;1.0	B|D;D;D	0.18871|0.97110	0.023|1.0;1.0;1.0	D|D	0.96563|0.96563	0.9417|0.9417	9|10	0.22109|0.62326	T|D	0.4|0.03	.|.	19.1016|19.1016	0.93276|0.93276	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	8|76;181;181	B4DTV6|B4DKT4;E9PLV9;Q9UHI5	.|.;.;LAT2_HUMAN	V|W	8|181;181;76	ENSP00000416398:A8V|ENSP00000320378:R181W;ENSP00000435114:R181W;ENSP00000434345:R76W	ENSP00000416398:A8V|ENSP00000320378:R181W	A|R	-|-	2|1	0|2	SLC7A8|SLC7A8	22682221|22682221	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.796000|3.796000	0.55507|0.55507	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	GCG|CGG		0.532	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3		
ADCY4	196883	hgsc.bcm.edu	37	14	24791317	24791317	+	Silent	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:24791317A>C	ENST00000310677.4	-	21	2654	c.2541T>G	c.(2539-2541)ccT>ccG	p.P847P	ADCY4_ENST00000554068.2_Silent_p.P847P|ADCY4_ENST00000418030.2_Silent_p.P847P	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	847					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.P847P(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		CCACGTGTGCAGGGAGCACGT	0.607																																					p.P847P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2541G	14						.						135.0	118.0	123.0					14																	24791317		2203	4300	6503	23861157	SO:0001819	synonymous_variant	196883	exon21			AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.2541T>G	14.37:g.24791317A>C			23861157	NM_001198592	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Silent	SNP	ENST00000310677.4	37	CCDS9627.1																																																																																				0.607	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
CBLN3	643866	hgsc.bcm.edu	37	14	24898088	24898088	+	Missense_Mutation	SNP	C	C	T	rs375332763		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:24898088C>T	ENST00000267406.6	-	1	643	c.173G>A	c.(172-174)gGg>gAg	p.G58E	CBLN3_ENST00000555436.1_Intron|KHNYN_ENST00000553935.1_5'Flank|KHNYN_ENST00000251343.5_5'Flank|KHNYN_ENST00000556842.1_5'Flank	NM_001039771.2	NP_001034860.1	Q6UW01	CBLN3_HUMAN	cerebellin 3 precursor	58						cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)		p.G58V(1)		central_nervous_system(1)|lung(3)	4				GBM - Glioblastoma multiforme(265;0.00159)		TCCCCCGGGCCCCCCTGCAGC	0.726																																					p.G58E												LOC643866,central_nervous_system,brain,Substitution - coding silent,+1	.	1	Substitution - Missense(1)	lung(1)	c.G173A	14						.						11.0	13.0	12.0					14																	24898088		2200	4286	6486	23967928	SO:0001583	missense	643866	exon1			AY359070	CCDS32057.1	14q12	2006-12-13				ENSG00000139899			20146	protein-coding gene	gene with protein product		612978				12975309	Standard	NM_001039771		Approved		uc001wpg.4	Q6UW01		ENST00000267406.6:c.173G>A	14.37:g.24898088C>T	ENSP00000267406:p.Gly58Glu		23967928	NM_001039771		Missense_Mutation	SNP	ENST00000267406.6	37	CCDS32057.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745131	0.49151	.	.	ENSG00000139899	ENST00000267406	D	0.83506	-1.73	5.7	4.8	0.61643	.	0.138683	0.34338	N	0.004059	D	0.87136	0.6102	L	0.46157	1.445	0.42425	D	0.992656	D	0.76494	0.999	D	0.69142	0.962	D	0.87957	0.2727	10	0.62326	D	0.03	-17.4938	12.9955	0.58644	0.0:0.689:0.311:0.0	.	58	Q6UW01	CBLN3_HUMAN	E	58	ENSP00000267406:G58E	ENSP00000267406:G58E	G	-	2	0	CBLN3	23967928	0.027000	0.19231	0.761000	0.31378	0.505000	0.33919	1.439000	0.35013	1.381000	0.46364	0.563000	0.77884	GGG		0.726	CBLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412943.1	XM_115232	
G2E3	55632	hgsc.bcm.edu	37	14	31056011	31056011	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:31056011A>G	ENST00000206595.6	+	3	279	c.125A>G	c.(124-126)tAc>tGc	p.Y42C	G2E3_ENST00000553504.1_Missense_Mutation_p.Y72C|G2E3_ENST00000438909.2_5'UTR|G2E3_ENST00000544007.1_3'UTR	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	42					apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Y42C(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						ACTGTACATTACTACTGTTTG	0.308																																					p.Y42C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A125G	14						.						24.0	25.0	25.0					14																	31056011		2200	4259	6459	30125762	SO:0001583	missense	55632	exon3			AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.125A>G	14.37:g.31056011A>G	ENSP00000206595:p.Tyr42Cys		30125762	NM_017769	Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Missense_Mutation	SNP	ENST00000206595.6	37	CCDS9638.1	.	.	.	.	.	.	.	.	.	.	A	18.69	3.677136	0.68042	.	.	ENSG00000092140	ENST00000206595;ENST00000550944;ENST00000553504;ENST00000554714;ENST00000547532;ENST00000555429	T;T;T;T;T;D	0.90504	-0.52;-0.52;-0.52;-0.52;-0.52;-2.68	5.77	5.77	0.91146	.	0.112214	0.64402	D	0.000006	D	0.95201	0.8444	M	0.76838	2.35	0.50039	D	0.999844	D	0.89917	1.0	D	0.87578	0.998	D	0.95557	0.8626	10	0.72032	D	0.01	-10.2662	16.0624	0.80847	1.0:0.0:0.0:0.0	.	42	Q7L622	G2E3_HUMAN	C	42;42;72;42;42;42	ENSP00000206595:Y42C;ENSP00000448745:Y42C;ENSP00000451653:Y72C;ENSP00000451147:Y42C;ENSP00000446615:Y42C;ENSP00000452275:Y42C	ENSP00000206595:Y42C	Y	+	2	0	G2E3	30125762	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.157000	0.64911	2.330000	0.79161	0.477000	0.44152	TAC		0.308	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276613.2	NM_017769	
SOS2	6655	hgsc.bcm.edu	37	14	50616759	50616759	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:50616759C>T	ENST00000216373.5	-	14	2625	c.2351G>A	c.(2350-2352)cGt>cAt	p.R784H	SOS2_ENST00000543680.1_Missense_Mutation_p.R751H	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	784	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R784H(2)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					TGTCAGCTGACGTGCAATTTC	0.353																																					p.R784H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2351A	14						.						167.0	154.0	159.0					14																	50616759		2203	4300	6503	49686509	SO:0001583	missense	6655	exon14			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.2351G>A	14.37:g.50616759C>T	ENSP00000216373:p.Arg784His		49686509	NM_006939	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	37	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	C	33	5.199439	0.94997	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.34072	1.38;1.38	5.52	5.52	0.82312	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.72518	0.3470	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80806	-0.1218	10	0.87932	D	0	.	19.4316	0.94772	0.0:1.0:0.0:0.0	.	751;784	B7ZKT6;Q07890	.;SOS2_HUMAN	H	784;751	ENSP00000216373:R784H;ENSP00000445328:R751H	ENSP00000216373:R784H	R	-	2	0	SOS2	49686509	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.606000	0.88127	0.655000	0.94253	CGT		0.353	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
FERMT2	10979	hgsc.bcm.edu	37	14	53339539	53339539	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:53339539T>C	ENST00000395631.2	-	10	1467	c.1251A>G	c.(1249-1251)ccA>ccG	p.P417P	FERMT2_ENST00000553373.1_Silent_p.P417P|FERMT2_ENST00000341590.3_Silent_p.P417P|FERMT2_ENST00000399304.3_Silent_p.P417P|FERMT2_ENST00000343279.4_Silent_p.P417P			Q96AC1	FERM2_HUMAN	fermitin family member 2	417	FERM.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|focal adhesion assembly (GO:0048041)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|protein localization to membrane (GO:0072657)|regulation of cell shape (GO:0008360)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)	p.P417P(1)	ERO1L/FERMT2(2)	NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Breast(41;0.0342)					TCTGATGAGCTGGTGTGCCAC	0.463																																					p.P417P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1251G	14						.						185.0	156.0	166.0					14																	53339539		2203	4300	6503	52409289	SO:0001819	synonymous_variant	10979	exon10			Z24725	CCDS9713.1, CCDS45107.1, CCDS45108.1	14q22.1	2013-01-10	2010-06-24	2007-12-14	ENSG00000073712	ENSG00000073712		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15767	protein-coding gene	gene with protein product	"""kindlin-2"""	607746	"""pleckstrin homology domain containing, family C (with FERM domain) member 1"", ""fermitin family homolog 2 (Drosophila)"""	PLEKHC1		8175911, 12697302	Standard	NM_006832		Approved	mig-2, KIND2, UNC112B	uc001xac.3	Q96AC1	OTTHUMG00000140309	ENST00000395631.2:c.1251A>G	14.37:g.53339539T>C			52409289	NM_001134999	B5TJY2|Q14840|Q86TY7	Silent	SNP	ENST00000395631.2	37	CCDS9713.1																																																																																				0.463	FERMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276907.2	NM_006832	
KTN1	3895	hgsc.bcm.edu	37	14	56122843	56122843	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:56122843T>G	ENST00000395314.3	+	29	2953	c.2885T>G	c.(2884-2886)cTg>cGg	p.L962R	KTN1_ENST00000395309.3_Missense_Mutation_p.L962R|KTN1_ENST00000554507.1_Missense_Mutation_p.L257R|KTN1_ENST00000438792.2_Missense_Mutation_p.L962R|KTN1_ENST00000413890.2_Missense_Mutation_p.L939R|KTN1_ENST00000416613.1_Missense_Mutation_p.L962R|KTN1_ENST00000395311.1_Missense_Mutation_p.L939R|KTN1_ENST00000395308.1_Missense_Mutation_p.L939R	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	962					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.L962R(2)		breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						AAAACACAGCTGTTACAGGTG	0.299			T	RET	papillary thryoid																																p.L962R			Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T2885G	14						.						62.0	65.0	64.0					14																	56122843		2203	4299	6502	55192596	SO:0001583	missense	3895	exon29				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.2885T>G	14.37:g.56122843T>G	ENSP00000378725:p.Leu962Arg		55192596	NM_004986	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	T	7.640	0.680616	0.14907	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613;ENST00000554507	T;T;T;T;T;T;T;T	0.32988	1.44;1.45;1.43;1.45;1.44;1.44;1.45;1.43	5.37	4.2	0.49525	.	0.158428	0.29853	N	0.011025	T	0.36082	0.0954	L	0.47716	1.5	0.23401	N	0.997759	P;P;D;P;P	0.56521	0.722;0.906;0.976;0.536;0.722	B;P;P;P;P	0.55713	0.413;0.578;0.782;0.481;0.517	T	0.12967	-1.0527	10	0.18710	T	0.47	-2.5493	9.4037	0.38449	0.4327:0.0:0.0:0.5673	.	962;257;962;939;962	B4DZ88;G3V4Y7;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;.;KTN1_HUMAN	R	939;962;962;962;939;939;962;257	ENSP00000394992:L939R;ENSP00000378720:L962R;ENSP00000391964:L962R;ENSP00000378725:L962R;ENSP00000378719:L939R;ENSP00000378722:L939R;ENSP00000388807:L962R;ENSP00000452073:L257R	ENSP00000378719:L939R	L	+	2	0	KTN1	55192596	0.998000	0.40836	0.993000	0.49108	0.993000	0.82548	1.863000	0.39459	0.950000	0.37743	0.528000	0.53228	CTG		0.299	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
SPTB	6710	hgsc.bcm.edu	37	14	65267582	65267582	+	Silent	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:65267582G>T	ENST00000389721.5	-	7	800	c.768C>A	c.(766-768)gtC>gtA	p.V256V	SPTB_ENST00000389722.3_Silent_p.V256V|SPTB_ENST00000389720.3_Silent_p.V256V|SPTB_ENST00000556626.1_Silent_p.V256V|SPTB_ENST00000542895.1_Silent_p.V256V	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	256	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)	p.V256V(1)		breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TTTCCGTAAAGACATCTGTTA	0.488											OREG0022735	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V256V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C768A	14						.						92.0	86.0	88.0					14																	65267582		2203	4300	6503	64337335	SO:0001819	synonymous_variant	6710	exon7				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.768C>A	14.37:g.65267582G>T		1082	64337335	NM_001024858	Q15510|Q15519	Silent	SNP	ENST00000389721.5	37	CCDS32100.1																																																																																				0.488	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
SLC8A3	6547	hgsc.bcm.edu	37	14	70633516	70633516	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:70633516T>C	ENST00000381269.2	-	2	2377	c.1624A>G	c.(1624-1626)Agt>Ggt	p.S542G	SLC8A3_ENST00000528359.1_Missense_Mutation_p.S542G|SLC8A3_ENST00000356921.2_Missense_Mutation_p.S542G|SLC8A3_ENST00000534137.1_Missense_Mutation_p.S542G|SLC8A3_ENST00000357887.3_Missense_Mutation_p.S542G	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	542	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)	p.S542G(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		ATACTCTCACTGACATGAATA	0.522																																					p.S542G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1624G	14						.						77.0	74.0	75.0					14																	70633516		2203	4300	6503	69703269	SO:0001583	missense	6547	exon2			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1624A>G	14.37:g.70633516T>C	ENSP00000370669:p.Ser542Gly		69703269	NM_033262	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.171908	0.57584	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.69	5.69	0.88448	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.59266	0.2181	M	0.82193	2.58	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.994;0.996;0.981;0.993	T	0.61520	-0.7046	10	0.40728	T	0.16	.	15.9438	0.79779	0.0:0.0:0.0:1.0	.	542;542;542;542	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	G	542	ENSP00000349392:S542G;ENSP00000370669:S542G;ENSP00000350560:S542G;ENSP00000436688:S542G;ENSP00000433531:S542G	ENSP00000349392:S542G	S	-	1	0	SLC8A3	69703269	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.159000	0.67721	0.528000	0.53228	AGT		0.522	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
TMED10	10972	hgsc.bcm.edu	37	14	75643116	75643116	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:75643116C>T	ENST00000303575.4	-	1	218	c.167G>A	c.(166-168)gGc>gAc	p.G56D		NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	56	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.|Required for interaction with STX17.				beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)	p.G56D(1)		endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		CTCGTACGCGCCAGTCACTAG	0.642																																					p.G56D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G167A	14						.						72.0	72.0	72.0					14																	75643116		2203	4300	6503	74712869	SO:0001583	missense	10972	exon1			AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.167G>A	14.37:g.75643116C>T	ENSP00000303145:p.Gly56Asp		74712869	NM_006827	B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Missense_Mutation	SNP	ENST00000303575.4	37	CCDS9840.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.926120	0.92319	.	.	ENSG00000170348	ENST00000303575	T	0.22336	1.96	5.15	5.15	0.70609	GOLD (2);	0.000000	0.85682	D	0.000000	T	0.57066	0.2028	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.67795	-0.5578	10	0.66056	D	0.02	-7.2097	15.6604	0.77182	0.0:1.0:0.0:0.0	.	56	P49755	TMEDA_HUMAN	D	56	ENSP00000303145:G56D	ENSP00000303145:G56D	G	-	2	0	TMED10	74712869	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.709000	0.61867	2.683000	0.91414	0.455000	0.32223	GGC		0.642	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415034.1	NM_006827	
NRXN3	9369	hgsc.bcm.edu	37	14	79432658	79432658	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:79432658T>C	ENST00000554719.1	+	9	2058	c.1567T>C	c.(1567-1569)Ttc>Ctc	p.F523L	NRXN3_ENST00000335750.5_Missense_Mutation_p.F523L	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	114					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.F523L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CATGCACCTCTTCTTCCAGTT	0.488																																					p.F523L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1567C	14						.						192.0	151.0	165.0					14																	79432658		2203	4300	6503	78502411	SO:0001583	missense	9369	exon9			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1567T>C	14.37:g.79432658T>C	ENSP00000451648:p.Phe523Leu		78502411	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000554719.1	37	CCDS9870.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.330949	0.81690	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.78246	-1.16;-1.16	5.73	5.73	0.89815	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.000000	0.85682	D	0.000000	D	0.87947	0.6306	.	.	.	0.58432	D	0.999999	D;D	0.76494	0.999;0.998	D;D	0.77004	0.989;0.959	D	0.88263	0.2924	8	.	.	.	.	16.3265	0.82983	0.0:0.0:0.0:1.0	.	896;523	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	L	896;885;523;523	ENSP00000451648:F523L;ENSP00000338349:F523L	.	F	+	1	0	NRXN3	78502411	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.313000	0.78055	0.455000	0.32223	TTC		0.488	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
C14orf159	80017	hgsc.bcm.edu	37	14	91642345	91642345	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:91642345G>C	ENST00000523771.1	+	7	1263	c.660G>C	c.(658-660)gaG>gaC	p.E220D	C14orf159_ENST00000520328.1_Missense_Mutation_p.E208D|C14orf159_ENST00000523816.1_Missense_Mutation_p.E220D|C14orf159_ENST00000412671.2_Missense_Mutation_p.E225D|C14orf159_ENST00000525393.2_Missense_Mutation_p.E96D|C14orf159_ENST00000518868.1_Missense_Mutation_p.E225D|C14orf159_ENST00000256324.10_Missense_Mutation_p.E225D|C14orf159_ENST00000522322.1_Missense_Mutation_p.E220D|C14orf159_ENST00000521077.2_Missense_Mutation_p.E225D|C14orf159_ENST00000428926.2_Missense_Mutation_p.E220D			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	220						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		CCCCAGGGGAGGTTCCAGTGT	0.532																																					p.E225D												.	.	0			c.G675C	14						.						95.0	78.0	84.0					14																	91642345		2203	4300	6503	90712098	SO:0001583	missense	80017	exon7			AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.660G>C	14.37:g.91642345G>C	ENSP00000429655:p.Glu220Asp		90712098	NM_001102368	B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Missense_Mutation	SNP	ENST00000523771.1	37	CCDS32141.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.649356	0.00785	.	.	ENSG00000133943	ENST00000520328;ENST00000256324;ENST00000521077;ENST00000518868;ENST00000523816;ENST00000517518;ENST00000525393;ENST00000428926;ENST00000522322;ENST00000523771;ENST00000412671	T;T;T;T;T;T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42;1.42;1.42;1.42;1.42;1.42	4.72	-9.43	0.00607	.	0.284857	0.37906	N	0.001883	T	0.07188	0.0182	N	0.03050	-0.425	0.09310	N	1	B;B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.06405	0.001;0.002;0.001;0.0;0.0;0.0	T	0.15378	-1.0439	10	0.02654	T	1	.	10.4284	0.44391	0.0:0.5323:0.2113:0.2564	.	220;96;225;208;225;225	Q7Z3D6;Q8NB88;B3KVU6;Q7Z3D6-5;Q7Z3D6-2;Q7Z3D6-3	CN159_HUMAN;.;.;.;.;.	D	208;225;225;225;220;225;96;220;220;220;225	ENSP00000429453:E208D;ENSP00000256324:E225D;ENSP00000430137:E225D;ENSP00000428263:E225D;ENSP00000428974:E220D;ENSP00000428652:E225D;ENSP00000435459:E96D;ENSP00000404343:E220D;ENSP00000427953:E220D;ENSP00000429655:E220D;ENSP00000404196:E225D	ENSP00000256324:E225D	E	+	3	2	C14orf159	90712098	0.006000	0.16342	0.000000	0.03702	0.287000	0.27160	-2.049000	0.01405	-2.516000	0.00500	-0.521000	0.04368	GAG		0.532	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381273.1	NM_024952	
CATSPERB	79820	hgsc.bcm.edu	37	14	92074724	92074724	+	Missense_Mutation	SNP	T	T	C	rs374427455		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:92074724T>C	ENST00000256343.3	-	22	2779	c.2623A>G	c.(2623-2625)Atg>Gtg	p.M875V		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	875					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)		p.M875V(1)		NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				GCAATTCCCATATTAGATGGA	0.308																																					p.M875V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2623G	14						.	T	VAL/MET	0,4406		0,0,2203	96.0	100.0	98.0		2623	1.5	1.0	14		98	1,8599	1.2+/-3.3	0,1,4299	no	missense	CATSPERB	NM_024764.2	21	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging	875/1117	92074724	1,13005	2203	4300	6503	91144477	SO:0001583	missense	79820	exon22			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.2623A>G	14.37:g.92074724T>C	ENSP00000256343:p.Met875Val		91144477	NM_024764	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	37	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	T	11.83	1.756740	0.31137	0.0	1.16E-4	ENSG00000133962	ENST00000256343	T	0.48836	0.8	5.58	1.54	0.23209	.	0.377447	0.25628	N	0.029369	T	0.37625	0.1010	L	0.61218	1.895	0.21822	N	0.999526	B	0.20671	0.047	B	0.21151	0.033	T	0.35126	-0.9801	10	0.56958	D	0.05	-16.5294	2.4403	0.04492	0.1408:0.0825:0.2917:0.485	.	875	Q9H7T0	CTSRB_HUMAN	V	875	ENSP00000256343:M875V	ENSP00000256343:M875V	M	-	1	0	CATSPERB	91144477	0.048000	0.20356	0.994000	0.49952	0.994000	0.84299	0.000000	0.12993	0.925000	0.37094	0.528000	0.53228	ATG		0.308	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	
UNC79	57578	hgsc.bcm.edu	37	14	94004395	94004395	+	Missense_Mutation	SNP	C	C	T	rs377687253		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:94004395C>T	ENST00000393151.2	+	12	1183	c.1183C>T	c.(1183-1185)Cgt>Tgt	p.R395C	UNC79_ENST00000256339.4_Missense_Mutation_p.R218C|UNC79_ENST00000555664.1_Missense_Mutation_p.R395C|UNC79_ENST00000553484.1_Missense_Mutation_p.R395C			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	395					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R218C(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GTGCTGTGGTCGTCACGGAAA	0.507																																					p.R218C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C652T	14						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	79.0	74.0	76.0		652	5.6	1.0	14		76	0,8600		0,0,4300	no	missense	UNC79	NM_020818.3	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	218/2459	94004395	1,13005	2203	4300	6503	93074148	SO:0001583	missense	57578	exon12			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1183C>T	14.37:g.94004395C>T	ENSP00000376858:p.Arg395Cys		93074148	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	C	25.1	4.598322	0.87055	2.27E-4	0.0	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.34774	0.0909	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.992	T	0.00998	-1.1486	10	0.44086	T	0.13	-17.1717	19.9698	0.97280	0.0:1.0:0.0:0.0	.	395;395	C9JQL1;Q9P2D8	.;UNC79_HUMAN	C	218;395;395;395;395	ENSP00000256339:R218C;ENSP00000450868:R395C;ENSP00000451360:R395C;ENSP00000376858:R395C	ENSP00000256339:R218C	R	+	1	0	KIAA1409	93074148	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.559000	0.82265	2.786000	0.95864	0.561000	0.74099	CGT		0.507	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
TCL1A	8115	hgsc.bcm.edu	37	14	96178092	96178092	+	Nonstop_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:96178092T>C	ENST00000402399.1	-	3	474	c.345A>G	c.(343-345)tgA>tgG	p.*115W	TCL1A_ENST00000554012.1_Splice_Site_p.*115W|TCL1A_ENST00000555202.1_Nonstop_Mutation_p.*115W|RP11-164H13.1_ENST00000547644.2_RNA|RP11-164H13.1_ENST00000553445.1_RNA|TCL1A_ENST00000556450.1_Splice_Site_p.*115W	NM_021966.2	NP_068801.1	P56279	TCL1A_HUMAN	T-cell leukemia/lymphoma 1A	0					multicellular organismal development (GO:0007275)|stem cell maintenance (GO:0019827)	cell cortex (GO:0005938)|endoplasmic reticulum (GO:0005783)|pronucleus (GO:0045120)		p.*115W(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		TCACCATACATCAGTCATCTG	0.562			T	TRA@	T-CLL																																p.X115W	Ovarian(96;1068 2019 35393 39316)		Dom	yes		14	14q32.1	8115	T-cell leukemia/lymphoma 1A		L	.	.	1	Nonstop extension(1)	large_intestine(1)	c.A345G	14						.						122.0	86.0	98.0					14																	96178092		2203	4300	6503	95247845	SO:0001578	stop_lost	8115	exon3			X82240	CCDS9941.1	14q32.1	2008-07-03				ENSG00000100721			11648	protein-coding gene	gene with protein product		186960				2783489, 7809072	Standard	NM_021966		Approved	TCL1	uc001yfb.4	P56279		ENST00000402399.1:c.345A>G	14.37:g.96178092T>C	ENSP00000385036:p.*115Cysext*15		95247845	NM_021966	Q6IBK7	Missense_Mutation	SNP	ENST00000402399.1	37	CCDS9941.1	.	.	.	.	.	.	.	.	.	.	T	3.680	-0.065805	0.07273	.	.	ENSG00000100721	ENST00000554012;ENST00000402399;ENST00000556450;ENST00000555202	.	.	.	3.24	-6.47	0.01902	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.082	0.01644	0.2815:0.1566:0.1163:0.4456	.	.	.	.	W	115	.	.	X	-	3	0	TCL1A	95247845	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.287000	0.00259	-1.740000	0.01345	-0.456000	0.05471	TGA		0.562	TCL1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413246.1		
PAPOLA	10914	hgsc.bcm.edu	37	14	97022553	97022553	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:97022553G>A	ENST00000216277.8	+	19	2027	c.1807G>A	c.(1807-1809)Gcc>Acc	p.A603T	PAPOLA_ENST00000392990.2_Missense_Mutation_p.A603T	NM_032632.4	NP_116021.2	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	603	Ser/Thr-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|RNA polyadenylation (GO:0043631)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)	p.A603T(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		CACACAACCAGCCATTTCTCC	0.418																																					p.A603T	NSCLC(19;254 734 11908 35501 39234)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1807A	14						.						160.0	145.0	150.0					14																	97022553		2203	4300	6503	96092306	SO:0001583	missense	10914	exon19			X76770	CCDS9946.1, CCDS58334.1, CCDS58335.1	14q32.1-q32.2	2008-02-08				ENSG00000090060	2.7.7.19		14981	protein-coding gene	gene with protein product		605553				8302877, 10429366	Standard	NM_032632		Approved	PAP	uc001yfq.3	P51003		ENST00000216277.8:c.1807G>A	14.37:g.97022553G>A	ENSP00000216277:p.Ala603Thr		96092306	NM_032632	Q86SX4|Q86TV0|Q8IYF5|Q9BVU2	Missense_Mutation	SNP	ENST00000216277.8	37	CCDS9946.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292314	0.59976	.	.	ENSG00000090060	ENST00000216277;ENST00000546064;ENST00000392990;ENST00000555626	.	.	.	6.01	6.01	0.97437	.	0.117507	0.64402	D	0.000017	T	0.57592	0.2064	L	0.43152	1.355	0.58432	D	0.999995	B;B;B	0.23377	0.084;0.051;0.051	B;B;B	0.16289	0.015;0.01;0.007	T	0.49293	-0.8955	9	0.28530	T	0.3	.	20.5073	0.99209	0.0:0.0:1.0:0.0	.	619;619;603	F5H5I8;B4DYF4;P51003	.;.;PAPOA_HUMAN	T	603;619;603;353	.	ENSP00000216277:A603T	A	+	1	0	PAPOLA	96092306	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.947000	0.63583	2.855000	0.98099	0.585000	0.79938	GCC		0.418	PAPOLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413411.2		
CDCA4	55038	hgsc.bcm.edu	37	14	105477737	105477737	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr14:105477737A>G	ENST00000336219.3	-	2	685	c.530T>C	c.(529-531)aTg>aCg	p.M177T	CDCA4_ENST00000392590.3_Missense_Mutation_p.M177T	NM_017955.3	NP_060425.2	Q9BXL8	CDCA4_HUMAN	cell division cycle associated 4	177						nucleus (GO:0005634)		p.M177T(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.142)		CAGCTCTTCCATGCAGCTGGG	0.562																																					p.M177T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T530C	14						.						82.0	78.0	79.0					14																	105477737		2203	4300	6503	104548782	SO:0001583	missense	55038	exon2			BG354577	CCDS9996.1	14q32.33	2014-02-14			ENSG00000170779	ENSG00000170779			14625	protein-coding gene	gene with protein product	"""hematopoietic progenitor protein"""	612270				12188893	Standard	NM_145701		Approved	FLJ20764, Hepp	uc001yqb.2	Q9BXL8	OTTHUMG00000170767	ENST00000336219.3:c.530T>C	14.37:g.105477737A>G	ENSP00000337226:p.Met177Thr		104548782	NM_017955	Q8TB18|Q9NWK7	Missense_Mutation	SNP	ENST00000336219.3	37	CCDS9996.1	.	.	.	.	.	.	.	.	.	.	A	7.797	0.712780	0.15306	.	.	ENSG00000170779	ENST00000336219;ENST00000392590	T;T	0.41400	1.0;1.0	4.62	0.815	0.18763	.	0.463268	0.22660	N	0.057219	T	0.20129	0.0484	N	0.08118	0	0.21105	N	0.999788	B	0.23185	0.081	B	0.18263	0.021	T	0.17745	-1.0359	10	0.66056	D	0.02	-5.6632	7.7169	0.28710	0.7228:0.0:0.2772:0.0	.	177	Q9BXL8	CDCA4_HUMAN	T	177	ENSP00000337226:M177T;ENSP00000376369:M177T	ENSP00000337226:M177T	M	-	2	0	CDCA4	104548782	1.000000	0.71417	0.482000	0.27366	0.279000	0.26890	3.397000	0.52572	0.218000	0.20820	-0.417000	0.06048	ATG		0.562	CDCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410311.1	NM_145701	
PPIL2	23759	hgsc.bcm.edu	37	22	22035646	22035646	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr22:22035646T>C	ENST00000335025.8	+	7	445	c.354T>C	c.(352-354)gcT>gcC	p.A118A	PPIL2_ENST00000412327.1_Silent_p.A118A|PPIL2_ENST00000456792.2_Silent_p.A97A|PPIL2_ENST00000492445.2_Silent_p.A118A|PPIL2_ENST00000398831.3_Silent_p.A118A|PPIL2_ENST00000406385.1_Silent_p.A118A					peptidylprolyl isomerase (cyclophilin)-like 2									p.A118A(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					ACATCGTGGCTGTGAGGACGA	0.582																																					p.A118A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T354C	22						.						161.0	115.0	131.0					22																	22035646		2203	4300	6503	20365646	SO:0001819	synonymous_variant	23759	exon7				CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	ENST00000335025.8:c.354T>C	22.37:g.22035646T>C			20365646	NM_148176		Silent	SNP	ENST00000335025.8	37	CCDS13793.1																																																																																				0.582	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075028.4		
RSPH14	27156	hgsc.bcm.edu	37	22	23482535	23482535	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr22:23482535G>T	ENST00000216036.4	-	2	269	c.73C>A	c.(73-75)Cat>Aat	p.H25N	RTDR1_ENST00000406876.1_Missense_Mutation_p.H25N	NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		25								p.H25N(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		AGGGCCCGATGGCCATAGGCA	0.562																																					p.H25N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C73A	22						.						130.0	105.0	114.0					22																	23482535		2203	4300	6503	21812535	SO:0001583	missense	27156	exon2																														ENST00000216036.4:c.73C>A	22.37:g.23482535G>T	ENSP00000216036:p.His25Asn		21812535	NM_014433		Missense_Mutation	SNP	ENST00000216036.4	37	CCDS13803.1	.	.	.	.	.	.	.	.	.	.	G	1.563	-0.536064	0.04082	.	.	ENSG00000100218	ENST00000216036;ENST00000406876	T;T	0.50277	0.87;0.75	4.91	0.191	0.15130	Armadillo-like helical (1);	1.025130	0.07709	N	0.941707	T	0.23492	0.0568	N	0.14661	0.345	0.09310	N	1	P;B	0.35527	0.507;0.022	B;B	0.30495	0.116;0.017	T	0.15037	-1.0451	10	0.17832	T	0.49	-1.1188	4.3951	0.11358	0.3697:0.3127:0.3176:0.0	.	46;25	B7Z5X4;Q9UHP6	.;RTDR1_HUMAN	N	25	ENSP00000216036:H25N;ENSP00000385567:H25N	ENSP00000216036:H25N	H	-	1	0	RTDR1	21812535	0.048000	0.20356	0.679000	0.29978	0.563000	0.35712	0.241000	0.18065	0.352000	0.24053	-0.367000	0.07326	CAT		0.562	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319049.1		
BCR	613	hgsc.bcm.edu	37	22	23610614	23610614	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr22:23610614A>G	ENST00000305877.8	+	5	2523	c.1772A>G	c.(1771-1773)tAc>tGc	p.Y591C	BCR_ENST00000359540.3_Missense_Mutation_p.Y591C	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	591	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Y591C(1)	BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CTGGGTGTGTACCGGGCCTTC	0.577			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																p.Y591C			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1772G	22						.						69.0	61.0	64.0					22																	23610614		2203	4300	6503	21940614	SO:0001583	missense	613	exon5				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.1772A>G	22.37:g.23610614A>G	ENSP00000303507:p.Tyr591Cys		21940614	NM_021574	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	ENST00000305877.8	37	CCDS13806.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.645961	0.87958	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;T	0.72505	-0.66;-0.66	5.49	5.49	0.81192	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.88665	0.6498	H	0.95470	3.675	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.91922	0.5548	10	0.87932	D	0	.	15.079	0.72099	1.0:0.0:0.0:0.0	.	180;591;591	B4E065;P11274-2;P11274	.;.;BCR_HUMAN	C	591;591;256	ENSP00000303507:Y591C;ENSP00000352535:Y591C	ENSP00000303507:Y591C	Y	+	2	0	BCR	21940614	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.054000	0.93866	2.228000	0.72767	0.533000	0.62120	TAC		0.577	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075819.1	NM_004327	
SEC14L4	284904	hgsc.bcm.edu	37	22	30891942	30891942	+	Silent	SNP	C	C	T	rs182513302	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr22:30891942C>T	ENST00000255858.7	-	3	230	c.147G>A	c.(145-147)ctG>ctA	p.L49L	SEC14L4_ENST00000381982.3_Silent_p.L49L|SEC14L4_ENST00000540456.1_Missense_Mutation_p.C18Y|SEC14L4_ENST00000392772.2_5'UTR	NM_001161368.1|NM_174977.3	NP_001154840.1|NP_777637.1	Q9UDX3	S14L4_HUMAN	SEC14-like 4 (S. cerevisiae)	49						integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.L49L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|pancreas(1)|skin(1)	21					Vitamin E(DB00163)	CGGATTTCTGCAGGTCAAAGT	0.493																																					p.L49L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G147A	22						.						81.0	63.0	69.0					22																	30891942		2203	4300	6503	29221942	SO:0001819	synonymous_variant	284904	exon3			AY158085	CCDS13878.1, CCDS54517.1	22q12.1	2003-03-10			ENSG00000133488	ENSG00000133488			20627	protein-coding gene	gene with protein product		612825					Standard	NM_174977		Approved	TAP3, dJ130H16.5	uc003aid.2	Q9UDX3	OTTHUMG00000151258	ENST00000255858.7:c.147G>A	22.37:g.30891942C>T			29221942	NM_001161368	A5D6W7|A6NCV4	Silent	SNP	ENST00000255858.7	37	CCDS13878.1	.	.	.	.	.	.	.	.	.	.	c	13.17	2.158576	0.38119	.	.	ENSG00000133488	ENST00000540456	T	0.69435	-0.4	4.66	1.29	0.21616	.	.	.	.	.	T	0.52208	0.1720	.	.	.	0.80722	D	1	B	0.11235	0.004	B	0.11329	0.006	T	0.46005	-0.9222	8	0.62326	D	0.03	6.9224	5.1797	0.15154	0.1691:0.6505:0.0:0.1804	.	18	G3V1L4	.	Y	18	ENSP00000440848:C18Y	ENSP00000440848:C18Y	C	-	2	0	SEC14L4	29221942	0.480000	0.25933	0.999000	0.59377	0.922000	0.55478	-0.377000	0.07456	0.246000	0.21394	-0.140000	0.14226	TGC		0.493	SEC14L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321946.1	NM_174977	
TCN2	6948	hgsc.bcm.edu	37	22	31013374	31013374	+	Missense_Mutation	SNP	C	C	T	rs117458738	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr22:31013374C>T	ENST00000215838.3	+	7	1492	c.998C>T	c.(997-999)aCg>aTg	p.T333M	TCN2_ENST00000405742.3_Missense_Mutation_p.T329M|TCN2_ENST00000407817.3_Missense_Mutation_p.T306M			P20062	TCO2_HUMAN	transcobalamin II	333					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)	p.T333M(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|prostate(2)|urinary_tract(1)	22					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATCAGTGTCACGCTGCAGGTG	0.562													C|||	35	0.00698882	0.0	0.0	5008	,	,		17688	0.0347		0.0	False		,,,				2504	0.0				p.T306M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C917T	22						.	C	MET/THR,MET/THR	0,4406		0,0,2203	139.0	105.0	116.0		998,917	-2.8	0.0	22	dbSNP_132	116	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	TCN2	NM_000355.3,NM_001184726.1	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	333/428,306/401	31013374	1,13005	2203	4300	6503	29343374	SO:0001583	missense	6948	exon7				CCDS13881.1, CCDS54519.1	22q12.2	2014-09-17	2010-05-11		ENSG00000185339	ENSG00000185339			11653	protein-coding gene	gene with protein product	"""macrocytic anemia"""	613441	"""transcobalamin II; macrocytic anemia"""			1708393, 7742531	Standard	NM_000355		Approved	D22S676, D22S750, TC2	uc003aip.2	P20062	OTTHUMG00000151095	ENST00000215838.3:c.998C>T	22.37:g.31013374C>T	ENSP00000215838:p.Thr333Met		29343374	NM_001184726	Q96FD4|Q9BVI8|Q9UCI5|Q9UCI6|Q9UDM0	Missense_Mutation	SNP	ENST00000215838.3	37	CCDS13881.1	20	0.009157509157509158	0	0.0	0	0.0	20	0.03496503496503497	0	0.0	C	8.220	0.802298	0.16397	0.0	1.16E-4	ENSG00000185339	ENST00000215838;ENST00000405742;ENST00000407817	T;T;T	0.37584	1.19;1.19;1.21	4.55	-2.81	0.05805	.	1.894480	0.01925	N	0.040834	T	0.07908	0.0198	N	0.20685	0.6	0.09310	N	1	B;B;B	0.30851	0.052;0.297;0.297	B;B;B	0.12156	0.004;0.007;0.007	T	0.14559	-1.0468	10	0.42905	T	0.14	-0.062	8.8416	0.35146	0.0:0.4113:0.0:0.5887	.	306;329;333	Q96FD4;B5MBX2;P20062	.;.;TCO2_HUMAN	M	333;329;306	ENSP00000215838:T333M;ENSP00000385914:T329M;ENSP00000384914:T306M	ENSP00000215838:T333M	T	+	2	0	TCN2	29343374	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.441000	0.02409	-0.508000	0.06540	-0.143000	0.13931	ACG		0.562	TCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321282.2	NM_000355	
L3MBTL2	83746	hgsc.bcm.edu	37	22	41622725	41622725	+	Missense_Mutation	SNP	G	G	A	rs555547448		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr22:41622725G>A	ENST00000216237.5	+	13	1722	c.1564G>A	c.(1564-1566)Gct>Act	p.A522T		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	522					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.A522T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GTCGAAAGCCGCTCCATCGAG	0.567													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20322	0.0		0.0	False		,,,				2504	0.0				p.A522T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1564A	22						.						79.0	69.0	72.0					22																	41622725		2203	4300	6503	39952671	SO:0001583	missense	83746	exon13			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1564G>A	22.37:g.41622725G>A	ENSP00000216237:p.Ala522Thr		39952671	NM_031488	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	37	CCDS14011.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372921	0.82573	.	.	ENSG00000100395	ENST00000216237	T	0.50813	0.73	4.95	4.95	0.65309	.	0.094256	0.64402	D	0.000001	T	0.68522	0.3010	M	0.86268	2.805	0.80722	D	1	D;D	0.71674	0.965;0.998	B;P	0.56865	0.403;0.808	T	0.75121	-0.3429	10	0.87932	D	0	.	18.3698	0.90403	0.0:0.0:1.0:0.0	.	522;522	Q969R5-3;Q969R5	.;LMBL2_HUMAN	T	522	ENSP00000216237:A522T	ENSP00000216237:A522T	A	+	1	0	L3MBTL2	39952671	1.000000	0.71417	0.864000	0.33941	0.114000	0.19823	9.382000	0.97209	2.735000	0.93741	0.655000	0.94253	GCT		0.567	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	NM_031488	
PPARA	5465	hgsc.bcm.edu	37	22	46594486	46594486	+	Missense_Mutation	SNP	C	C	T	rs561580529		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr22:46594486C>T	ENST00000396000.2	+	3	471	c.206C>T	c.(205-207)aCg>aTg	p.T69M	PPARA_ENST00000402126.1_Missense_Mutation_p.T69M|PPARA_ENST00000434345.2_Missense_Mutation_p.T69M|PPARA_ENST00000262735.5_Missense_Mutation_p.T69M|PPARA_ENST00000407236.1_Missense_Mutation_p.T69M			Q07869	PPARA_HUMAN	peroxisome proliferator-activated receptor alpha	69					behavioral response to nicotine (GO:0035095)|cellular lipid metabolic process (GO:0044255)|circadian regulation of gene expression (GO:0032922)|enamel mineralization (GO:0070166)|epidermis development (GO:0008544)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|negative regulation of appetite (GO:0032099)|negative regulation of blood pressure (GO:0045776)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of glycolytic process (GO:0045820)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular ketone metabolic process by positive regulation of transcription from RNA polymerase II promoter (GO:0072366)|regulation of circadian rhythm (GO:0042752)|regulation of glycolytic by positive regulation of transcription from RNA polymerase II promoter (GO:0072363)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|lipid binding (GO:0008289)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.T69M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	15		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Indomethacin(DB00328)	TCGGTCATCACGGGTAAGTGT	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		13532	0.0		0.0	False		,,,				2504	0.001				p.T69M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C206T	22						.						59.0	63.0	62.0					22																	46594486		2203	4300	6503	44973150	SO:0001583	missense	5465	exon4			L02932	CCDS33669.1	22q12-q13.1	2013-01-16	2006-10-17		ENSG00000186951	ENSG00000186951		"""Nuclear hormone receptors"""	9232	protein-coding gene	gene with protein product		170998	"""peroxisome proliferative activated receptor, alpha"""	PPAR		7684926, 10591208	Standard	XM_005261655		Approved	hPPAR, NR1C1	uc003bgx.1	Q07869	OTTHUMG00000150443	ENST00000396000.2:c.206C>T	22.37:g.46594486C>T	ENSP00000379322:p.Thr69Met		44973150	NM_005036	B0G0X3|Q16241|Q6I9S0|Q92486|Q92689|Q9Y3N1	Missense_Mutation	SNP	ENST00000396000.2	37	CCDS33669.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669406	0.29693	.	.	ENSG00000186951	ENST00000415785;ENST00000396000;ENST00000262735;ENST00000420804;ENST00000407236;ENST00000402126;ENST00000434345	D;D;D;D;D;D	0.97186	-3.32;-3.32;-4.28;-3.32;-3.32;-3.16	5.7	3.58	0.41010	.	0.450136	0.26072	N	0.026512	D	0.95089	0.8409	M	0.65975	2.015	0.34779	D	0.73449	D;D	0.58268	0.982;0.982	B;B	0.43701	0.428;0.428	D	0.93963	0.7242	10	0.33940	T	0.23	.	8.0291	0.30454	0.1551:0.7622:0.0:0.0827	.	69;69	F1D8S4;Q07869	.;PPARA_HUMAN	M	69	ENSP00000379322:T69M;ENSP00000262735:T69M;ENSP00000414752:T69M;ENSP00000385523:T69M;ENSP00000385246:T69M;ENSP00000408149:T69M	ENSP00000262735:T69M	T	+	2	0	PPARA	44973150	0.996000	0.38824	0.752000	0.31206	0.026000	0.11368	1.876000	0.39588	0.720000	0.32209	-0.127000	0.14921	ACG		0.413	PPARA-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318129.3	NM_001001928	
PKDREJ	10343	hgsc.bcm.edu	37	22	46656103	46656103	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr22:46656103G>A	ENST00000253255.5	-	1	3116	c.3117C>T	c.(3115-3117)agC>agT	p.S1039S		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1039					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)	p.S1039S(1)		NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		GGGCACTCTGGCTGGCAAATG	0.582																																					p.S1039S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3117T	22						.						97.0	81.0	87.0					22																	46656103		2203	4300	6503	45034767	SO:0001819	synonymous_variant	10343	exon1			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.3117C>T	22.37:g.46656103G>A			45034767	NM_006071	B1AJY3|O95850	Silent	SNP	ENST00000253255.5	37	CCDS14073.1																																																																																				0.582	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
TBC1D22A	25771	hgsc.bcm.edu	37	22	47507446	47507446	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr22:47507446G>A	ENST00000337137.4	+	12	1538	c.1372G>A	c.(1372-1374)Gct>Act	p.A458T	TBC1D22A_ENST00000407381.3_Missense_Mutation_p.A399T|TBC1D22A_ENST00000355704.3_Missense_Mutation_p.A380T|TBC1D22A_ENST00000406733.1_Missense_Mutation_p.A411T	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	458							protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)	p.A458T(1)		breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		GTACGTGTGCGCTGCTTTTCT	0.373																																					p.A458T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1372A	22						.						119.0	116.0	117.0					22																	47507446		2203	4300	6503	45886110	SO:0001583	missense	25771	exon12			AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.1372G>A	22.37:g.47507446G>A	ENSP00000336724:p.Ala458Thr		45886110	NM_014346	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	ENST00000337137.4	37	CCDS14078.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037052	0.93630	.	.	ENSG00000054611	ENST00000337137;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	5.3	5.3	0.74995	Rab-GAP/TBC domain (3);	0.000000	0.85682	D	0.000000	T	0.60209	0.2251	M	0.91090	3.175	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.79784	0.918;0.988;0.993;0.918	T	0.69525	-0.5122	10	0.66056	D	0.02	.	16.4417	0.83903	0.0:0.0:1.0:0.0	.	458;380;399;458	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	T	458;399;380;411	ENSP00000336724:A458T;ENSP00000384036:A399T;ENSP00000347932:A380T;ENSP00000385634:A411T	ENSP00000336724:A458T	A	+	1	0	TBC1D22A	45886110	1.000000	0.71417	0.848000	0.33437	0.898000	0.52572	8.354000	0.90080	2.462000	0.83206	0.655000	0.94253	GCT		0.373	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317600.3	NM_014346	
KANK2	25959	hgsc.bcm.edu	37	19	11286619	11286619	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:11286619T>G	ENST00000586659.1	-	8	2121	c.1807A>C	c.(1807-1809)Aag>Cag	p.K603Q	KANK2_ENST00000432929.2_Missense_Mutation_p.K611Q|KANK2_ENST00000355150.5_Missense_Mutation_p.K603Q|KANK2_ENST00000589359.1_Missense_Mutation_p.K611Q|KANK2_ENST00000589894.1_Missense_Mutation_p.K603Q			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	603					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)		p.K603Q(1)		endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TCCAGGTACTTTTCCAGGGCC	0.637																																					p.K603Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1807C	19						.						142.0	121.0	128.0					19																	11286619		2203	4300	6503	11147619	SO:0001583	missense	25959	exon8			AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1807A>C	19.37:g.11286619T>G	ENSP00000465650:p.Lys603Gln		11147619	NM_001136191	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation	SNP	ENST00000586659.1	37	CCDS12255.1	.	.	.	.	.	.	.	.	.	.	T	14.06	2.421762	0.43020	.	.	ENSG00000197256	ENST00000432929;ENST00000355150	T;T	0.68331	-0.32;-0.32	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.70596	0.3242	L	0.39898	1.24	0.31519	N	0.662665	D;D	0.71674	0.991;0.998	P;D	0.64776	0.831;0.929	T	0.68815	-0.5309	10	0.16420	T	0.52	-38.2979	13.6173	0.62118	0.0:0.0:0.0:1.0	.	603;611	Q63ZY3;Q63ZY3-2	KANK2_HUMAN;.	Q	611;603	ENSP00000395650:K611Q;ENSP00000347276:K603Q	ENSP00000347276:K603Q	K	-	1	0	KANK2	11147619	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	4.189000	0.58358	1.921000	0.55644	0.459000	0.35465	AAG		0.637	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453066.2	NM_015493	
SWSAP1	126074	hgsc.bcm.edu	37	19	11486473	11486473	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:11486473G>A	ENST00000312423.2	+	2	530	c.471G>A	c.(469-471)ctG>ctA	p.L157L	CTD-2342J14.6_ENST00000590399.1_RNA	NM_175871.3	NP_787067.2	Q6NVH7	SWAP1_HUMAN	SWIM-type zinc finger 7 associated protein 1	157					ATP catabolic process (GO:0006200)|double-strand break repair via homologous recombination (GO:0000724)|protein stabilization (GO:0050821)	nucleus (GO:0005634)|Shu complex (GO:0097196)	ATPase activity (GO:0016887)|single-stranded DNA binding (GO:0003697)	p.L157L(1)									ACCTGGCACTGCTCCAGCGGT	0.677																																					p.L157L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G471A	19						.						66.0	61.0	63.0					19																	11486473		2203	4300	6503	11347473	SO:0001819	synonymous_variant	126074	exon2			AK092438	CCDS12259.1	19p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000173928	ENSG00000173928			26638	protein-coding gene	gene with protein product	"""zinc finger, SWIM-type containing 7 associated protein 1"", ""SWS1-associated protein 1"""	614536	"""chromosome 19 open reading frame 39"""	C19orf39		21965664	Standard	NM_175871		Approved	FLJ35119, ZSWIM7AP1, SWS1AP1	uc002mrg.1	Q6NVH7		ENST00000312423.2:c.471G>A	19.37:g.11486473G>A			11347473	NM_175871	Q8NAM1	Silent	SNP	ENST00000312423.2	37	CCDS12259.1																																																																																				0.677	SWSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458789.1	NM_175871	
NACC1	112939	hgsc.bcm.edu	37	19	13249059	13249059	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:13249059T>G	ENST00000292431.4	+	6	1549	c.1423T>G	c.(1423-1425)Tgg>Ggg	p.W475G	CTC-250I14.3_ENST00000591825.1_RNA	NM_052876.3	NP_443108.1	Q96RE7	NACC1_HUMAN	nucleus accumbens associated 1, BEN and BTB (POZ) domain containing	475					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear body (GO:0016604)|nucleus (GO:0005634)		p.W475G(1)		endometrium(3)|large_intestine(2)|lung(3)|skin(1)	9						GCGCAAGAGCTGGATGCCCAA	0.592																																					p.W475G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1423G	19						.						191.0	159.0	170.0					19																	13249059		2203	4300	6503	13110059	SO:0001583	missense	112939	exon6			AF395817	CCDS12294.1	19p13.13	2013-01-09	2008-10-03	2008-10-03		ENSG00000160877		"""BEN domain containing"", ""BTB/POZ domain containing"""	20967	protein-coding gene	gene with protein product	"""nucleus accumbens associated 1"", ""BEN domain containing 8"""	610672	"""BTB (POZ) domain containing 14B"""	BTBD14B		12477932	Standard	NM_052876		Approved	NAC1, NAC-1, BEND8, BTBD30	uc002mwm.4	Q96RE7		ENST00000292431.4:c.1423T>G	19.37:g.13249059T>G	ENSP00000292431:p.Trp475Gly		13110059	NM_052876		Missense_Mutation	SNP	ENST00000292431.4	37	CCDS12294.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.261516	0.80358	.	.	ENSG00000160877	ENST00000292431	T	0.79247	-1.25	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.81945	0.4930	L	0.36672	1.1	0.51482	D	0.999923	D	0.89917	1.0	D	0.91635	0.999	D	0.83744	0.0205	10	0.87932	D	0	.	12.1482	0.54036	0.0:0.0:0.0:1.0	.	475	Q96RE7	NACC1_HUMAN	G	475	ENSP00000292431:W475G	ENSP00000292431:W475G	W	+	1	0	NACC1	13110059	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.824000	0.86668	1.779000	0.52309	0.454000	0.30748	TGG		0.592	NACC1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452879.1	NM_052876	
IL27RA	9466	hgsc.bcm.edu	37	19	14159987	14159987	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:14159987G>A	ENST00000263379.2	+	10	1388	c.1263G>A	c.(1261-1263)acG>acA	p.T421T		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	421	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)	p.T421T(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						TGGGGCCAACGCTTTGGCGAC	0.632											OREG0025303	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T421T	Colon(164;1849 1896 4443 37792 47834)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1263A	19						.						47.0	51.0	49.0					19																	14159987		2203	4300	6503	14020987	SO:0001819	synonymous_variant	9466	exon10			AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.1263G>A	19.37:g.14159987G>A		693	14020987	NM_004843	A0N0L1|O60624	Silent	SNP	ENST00000263379.2	37	CCDS12303.1																																																																																				0.632	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1	NM_004843	
CELF5	60680	hgsc.bcm.edu	37	19	3293431	3293431	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:3293431G>T	ENST00000292672.2	+	12	1482	c.1445G>T	c.(1444-1446)gGa>gTa	p.G482V	CELF5_ENST00000541430.2_3'UTR	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	482					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.G482V(1)		kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						AAAGACCCGGGACACCCCTAC	0.687																																					p.G482V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1445T	19						.						67.0	62.0	64.0					19																	3293431		2203	4300	6503	3244431	SO:0001583	missense	60680	exon12			AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.1445G>T	19.37:g.3293431G>T	ENSP00000292672:p.Gly482Val		3244431	NM_021938	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Missense_Mutation	SNP	ENST00000292672.2	37	CCDS12106.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468550	0.43839	.	.	ENSG00000161082	ENST00000292672	T	0.16457	2.34	4.73	3.67	0.42095	.	0.160941	0.53938	D	0.000049	T	0.11110	0.0271	L	0.35854	1.095	0.80722	D	1	B	0.29955	0.263	B	0.23275	0.045	T	0.09640	-1.0665	10	0.87932	D	0	-6.0157	4.7692	0.13148	0.1658:0.2008:0.6334:0.0	.	482	Q8N6W0	CELF5_HUMAN	V	482	ENSP00000292672:G482V	ENSP00000292672:G482V	G	+	2	0	CELF5	3244431	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.141000	0.42168	2.333000	0.79357	0.561000	0.74099	GGA		0.687	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1	NM_021938	
SLC5A5	6528	hgsc.bcm.edu	37	19	17994505	17994505	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:17994505A>G	ENST00000222248.3	+	11	1605	c.1258A>G	c.(1258-1260)Atg>Gtg	p.M420V		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	420					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)	p.M420V(1)		NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CTTCACCGTCATGGGAGTCAT	0.667																																					p.M420V	Melanoma(65;1008 1708 7910 46650)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1258G	19						.						42.0	45.0	44.0					19																	17994505		2201	4298	6499	17855505	SO:0001583	missense	6528	exon11				CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1258A>G	19.37:g.17994505A>G	ENSP00000222248:p.Met420Val		17855505	NM_000453	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518285	0.64634	.	.	ENSG00000105641	ENST00000222248	D	0.87103	-2.21	4.69	4.69	0.59074	.	0.042487	0.85682	D	0.000000	T	0.75752	0.3892	N	0.16790	0.44	0.51012	D	0.999905	B	0.11235	0.004	B	0.19946	0.027	T	0.68538	-0.5382	10	0.11182	T	0.66	.	12.1059	0.53811	1.0:0.0:0.0:0.0	.	420	Q92911	SC5A5_HUMAN	V	420	ENSP00000222248:M420V	ENSP00000222248:M420V	M	+	1	0	SLC5A5	17855505	1.000000	0.71417	0.994000	0.49952	0.832000	0.47134	5.629000	0.67798	1.744000	0.51775	0.413000	0.27773	ATG		0.667	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
ANKRD27	84079	hgsc.bcm.edu	37	19	33095327	33095327	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:33095327C>T	ENST00000306065.4	-	25	2655	c.2497G>A	c.(2497-2499)Ggg>Agg	p.G833R		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	833					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.G833R(1)		breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					ATGGAGGCCCCGTGCTGGAAA	0.493																																					p.G833R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2497A	19						.						55.0	40.0	45.0					19																	33095327		2203	4300	6503	37787167	SO:0001583	missense	84079	exon25			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2497G>A	19.37:g.33095327C>T	ENSP00000304292:p.Gly833Arg		37787167	NM_032139	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	37	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926420	0.73327	.	.	ENSG00000105186	ENST00000306065	T	0.78924	-1.22	5.48	5.48	0.80851	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000017	D	0.88202	0.6373	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.88752	0.3251	10	0.62326	D	0.03	-31.7045	18.9221	0.92529	0.0:1.0:0.0:0.0	.	833	Q96NW4	ANR27_HUMAN	R	833	ENSP00000304292:G833R	ENSP00000304292:G833R	G	-	1	0	ANKRD27	37787167	0.994000	0.37717	0.962000	0.40283	0.565000	0.35776	4.535000	0.60629	2.556000	0.86216	0.563000	0.77884	GGG		0.493	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
SLC7A10	56301	hgsc.bcm.edu	37	19	33701478	33701478	+	Silent	SNP	C	C	T	rs150600610	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:33701478C>T	ENST00000253188.4	-	9	1304	c.1158G>A	c.(1156-1158)acG>acA	p.T386T	CTD-2540B15.13_ENST00000609744.1_RNA	NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	386					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)	p.T386T(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					AGTTGATGAGCGTGTACGTGT	0.657													C|||	32	0.00638978	0.0008	0.0058	5008	,	,		15294	0.001		0.0149	False		,,,				2504	0.0112				p.T386T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1158A	19						.	C		19,4385	27.2+/-55.0	0,19,2183	125.0	75.0	92.0		1158	-10.8	0.4	19	dbSNP_134	92	145,8455	71.6+/-134.2	2,141,4157	no	coding-synonymous	SLC7A10	NM_019849.2		2,160,6340	TT,TC,CC		1.686,0.4314,1.2612		386/524	33701478	164,12840	2202	4300	6502	38393318	SO:0001819	synonymous_variant	56301	exon9			AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.1158G>A	19.37:g.33701478C>T			38393318	NM_019849	B2RE84	Silent	SNP	ENST00000253188.4	37	CCDS12431.1																																																																																				0.657	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849	
APLP1	333	hgsc.bcm.edu	37	19	36370039	36370039	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:36370039G>A	ENST00000221891.4	+	16	1969	c.1777G>A	c.(1777-1779)Gga>Aga	p.G593R	RN7SL402P_ENST00000465059.1_RNA|APLP1_ENST00000537454.2_Missense_Mutation_p.G553R|APLP1_ENST00000586861.1_Missense_Mutation_p.G586R	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	592					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)	p.G593R(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGGAGCGGGCGGAGGCTCCCT	0.642																																					p.G593R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1777A	19						.						54.0	53.0	54.0					19																	36370039		2203	4300	6503	41061879	SO:0001583	missense	333	exon16			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1777G>A	19.37:g.36370039G>A	ENSP00000221891:p.Gly593Arg		41061879	NM_001024807	O00113|Q96A92	Missense_Mutation	SNP	ENST00000221891.4	37	CCDS32997.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.853268	0.71719	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.94330	-3.28;-3.4	5.38	5.38	0.77491	.	0.391749	0.18765	N	0.131764	D	0.92120	0.7502	N	0.14661	0.345	0.38764	D	0.954403	D;D;D;D	0.76494	0.996;0.998;0.999;0.998	P;P;P;P	0.61003	0.572;0.806;0.882;0.7	D	0.92858	0.6303	10	0.46703	T	0.11	-24.2286	14.6403	0.68720	0.0:0.0:1.0:0.0	.	586;553;593;592	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	R	553;593	ENSP00000441501:G553R;ENSP00000221891:G593R	ENSP00000221891:G593R	G	+	1	0	APLP1	41061879	0.999000	0.42202	0.842000	0.33263	0.700000	0.40528	3.413000	0.52686	2.508000	0.84585	0.655000	0.94253	GGA		0.642	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
ALKBH6	84964	hgsc.bcm.edu	37	19	36505133	36505133	+	5'Flank	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:36505133C>A	ENST00000252984.7	-	0	0				AC002116.7_ENST00000586962.1_RNA|ALKBH6_ENST00000486389.1_5'UTR|AC002116.8_ENST00000473572.2_RNA|ALKBH6_ENST00000495116.2_5'Flank|ALKBH6_ENST00000378875.3_Start_Codon_SNP_p.M1I|ALKBH6_ENST00000485128.1_5'UTR			Q3KRA9	ALKB6_HUMAN	alkB, alkylation repair homolog 6 (E. coli)							cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)	p.M1I(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)	9	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CCCTCCCAGCCATTTCCGCCC	0.587																																					p.M1I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3T	19						.						90.0	66.0	74.0					19																	36505133		2203	4300	6503	41196973	SO:0001631	upstream_gene_variant	84964	exon1			BM713594	CCDS12485.2, CCDS74342.1	19q13.12	2008-02-05			ENSG00000239382	ENSG00000239382		"""Alkylation repair homologs"""	28243	protein-coding gene	gene with protein product		613304				8889548	Standard	NM_032878		Approved	MGC15677	uc002ocv.1	Q3KRA9	OTTHUMG00000048137		19.37:g.36505133C>A	Exception_encountered		41196973	NM_198867	A5LGM8|A6NLP1|A8MU96	Missense_Mutation	SNP	ENST00000252984.7	37		.	.	.	.	.	.	.	.	.	.	C	16.09	3.025810	0.54683	.	.	ENSG00000239382	ENST00000378875	.	.	.	4.05	1.93	0.25924	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24012	-1.0172	7	0.38643	T	0.18	.	6.0899	0.19989	0.0:0.6845:0.0:0.3155	.	1	Q3KRA9-2	.	I	1	.	ENSP00000368152:M1I	M	-	3	0	ALKBH6	41196973	0.056000	0.20664	0.837000	0.33122	0.584000	0.36387	-0.462000	0.06704	0.673000	0.31224	0.591000	0.81541	ATG		0.587	ALKBH6-004	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000109531.4	NM_032878	
ACTN4	81	hgsc.bcm.edu	37	19	39195585	39195585	+	Missense_Mutation	SNP	G	G	A	rs375921941		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:39195585G>A	ENST00000252699.2	+	4	485	c.409G>A	c.(409-411)Ggc>Agc	p.G137S	ACTN4_ENST00000390009.3_Intron|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	137	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.G137S(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GATTGTGGACGGCAACGCAAA	0.592																																					p.G137S	Colon(168;199 1940 10254 46213 46384)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G409A	19						.	G	SER/GLY	2,4404	4.2+/-10.8	0,2,2201	144.0	112.0	123.0		409	4.9	1.0	19		123	0,8600		0,0,4300	no	missense	ACTN4	NM_004924.4	56	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging	137/912	39195585	2,13004	2203	4300	6503	43887425	SO:0001583	missense	81	exon4			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.409G>A	19.37:g.39195585G>A	ENSP00000252699:p.Gly137Ser		43887425	NM_004924	A4K467|D6PXK4|O76048	Missense_Mutation	SNP	ENST00000252699.2	37	CCDS12518.1	.	.	.	.	.	.	.	.	.	.	G	32	5.152455	0.94645	4.54E-4	0.0	ENSG00000130402	ENST00000252699;ENST00000445727	D	0.97888	-4.59	4.89	4.89	0.63831	Actinin-type, actin-binding, conserved site (1);Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.98463	0.9488	M	0.76433	2.335	0.80722	D	1	D;D	0.76494	0.981;0.999	P;D	0.70227	0.838;0.968	D	0.98953	1.0795	10	0.59425	D	0.04	.	17.3261	0.87248	0.0:0.0:1.0:0.0	.	137;137	E7EV83;O43707	.;ACTN4_HUMAN	S	137	ENSP00000252699:G137S	ENSP00000252699:G137S	G	+	1	0	ACTN4	43887425	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	9.452000	0.97615	2.703000	0.92315	0.561000	0.74099	GGC		0.592	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268091.1		
SUPT5H	6829	hgsc.bcm.edu	37	19	39950545	39950545	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:39950545G>A	ENST00000599117.1	+	11	936	c.569G>A	c.(568-570)cGg>cAg	p.R190Q	SUPT5H_ENST00000432763.2_Missense_Mutation_p.R190Q|SUPT5H_ENST00000402194.2_Missense_Mutation_p.R186Q|SUPT5H_ENST00000598725.1_Missense_Mutation_p.R190Q|SUPT5H_ENST00000359191.6_Missense_Mutation_p.R186Q			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	190	Interaction with SUPT4H1.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)	p.R190Q(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGGGAGGAACGGGCCACGGCC	0.532																																					p.R190Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G569A	19						.						94.0	83.0	87.0					19																	39950545		2203	4300	6503	44642385	SO:0001583	missense	6829	exon9			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.569G>A	19.37:g.39950545G>A	ENSP00000470252:p.Arg190Gln		44642385	NM_003169	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	37	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706531	0.89018	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.16	5.16	0.70880	Transcription antitermination protein, NusG, N-terminal (1);	0.061993	0.64402	D	0.000009	T	0.53562	0.1804	L	0.36672	1.1	0.80722	D	1	B;B	0.17038	0.02;0.008	B;B	0.18263	0.012;0.021	T	0.46871	-0.9160	8	.	.	.	-18.2121	17.807	0.88604	0.0:0.0:1.0:0.0	.	186;190	O00267-2;O00267	.;SPT5H_HUMAN	Q	190;186;168;190	.	.	R	+	2	0	SUPT5H	44642385	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	7.451000	0.80668	2.595000	0.87683	0.655000	0.94253	CGG		0.532	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
TEX101	83639	hgsc.bcm.edu	37	19	43922405	43922405	+	Silent	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:43922405C>A	ENST00000598265.1	+	6	772	c.606C>A	c.(604-606)ccC>ccA	p.P202P	TEX101_ENST00000602198.1_Silent_p.P220P|TEX101_ENST00000601707.1_3'UTR|TEX101_ENST00000253435.7_Silent_p.P220P	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	202	UPAR/Ly6.					acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.P220P(1)		large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				CAGTAGGACCCATGTTTGTGA	0.517																																					p.P220P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C660A	19						.						122.0	114.0	116.0					19																	43922405		2203	4300	6503	48614245	SO:0001819	synonymous_variant	83639	exon9			AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.606C>A	19.37:g.43922405C>A			48614245	NM_031451	Q7L5R2|Q9BPY7	Silent	SNP	ENST00000598265.1	37	CCDS59393.1																																																																																				0.517	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000463176.1	NM_031451	
PVRL2	5819	hgsc.bcm.edu	37	19	45375165	45375165	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:45375165G>A	ENST00000252483.5	+	3	534	c.534G>A	c.(532-534)acG>acA	p.T178T	PVRL2_ENST00000252485.4_Silent_p.T178T	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)	178	Ig-like C2-type 1.				acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)	p.T178T(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		AGGACCCTACGACAGTGGCCC	0.632																																					p.T178T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G534A	19						.						39.0	36.0	37.0					19																	45375165		2203	4300	6503	50067005	SO:0001819	synonymous_variant	5819	exon3			X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.534G>A	19.37:g.45375165G>A			50067005	NM_002856	A8K5L5|O75455|Q6IBI6|Q96J29	Silent	SNP	ENST00000252483.5	37	CCDS42576.1																																																																																				0.632	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453231.1	NM_002856	
DMWD	1762	hgsc.bcm.edu	37	19	46294287	46294287	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:46294287C>T	ENST00000270223.6	-	2	545	c.500G>A	c.(499-501)tGc>tAc	p.C167Y	DMWD_ENST00000601370.1_5'UTR|DMWD_ENST00000377735.3_Missense_Mutation_p.C167Y	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	167								p.C167Y(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		GAAATCGTGGCAGGTGGGCTG	0.537																																					p.C167Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G500A	19						.						152.0	155.0	154.0					19																	46294287		2203	4300	6503	50986127	SO:0001583	missense	1762	exon2			L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.500G>A	19.37:g.46294287C>T	ENSP00000270223:p.Cys167Tyr		50986127	NM_004943		Missense_Mutation	SNP	ENST00000270223.6	37	CCDS33054.1	.	.	.	.	.	.	.	.	.	.	c	16.99	3.273153	0.59649	.	.	ENSG00000185800	ENST00000377735;ENST00000270223	T;T	0.32988	1.43;1.43	4.44	3.41	0.39046	WD40 repeat-like-containing domain (1);	0.066917	0.64402	D	0.000018	T	0.23249	0.0562	L	0.32530	0.975	0.54753	D	0.999988	B;B	0.32573	0.376;0.259	B;B	0.33392	0.163;0.078	T	0.07927	-1.0747	10	0.59425	D	0.04	-32.0699	10.1352	0.42701	0.0:0.9012:0.0:0.0988	.	167;167	G5E9A7;Q09019	.;DMWD_HUMAN	Y	167	ENSP00000366964:C167Y;ENSP00000270223:C167Y	ENSP00000270223:C167Y	C	-	2	0	DMWD	50986127	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.406000	0.66357	1.230000	0.43646	0.561000	0.74099	TGC		0.537	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402063.1	NM_004943	
DMWD	1762	hgsc.bcm.edu	37	19	46295620	46295620	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:46295620C>T	ENST00000270223.6	-	1	440	c.395G>A	c.(394-396)cGt>cAt	p.R132H	DMWD_ENST00000601370.1_5'UTR|DMWD_ENST00000377735.3_Missense_Mutation_p.R132H	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	132								p.R132H(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		ATAGAGCTCACGGCCCAAGTT	0.716																																					p.R132H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G395A	19						.						27.0	29.0	28.0					19																	46295620		2196	4290	6486	50987460	SO:0001583	missense	1762	exon1			L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.395G>A	19.37:g.46295620C>T	ENSP00000270223:p.Arg132His		50987460	NM_004943		Missense_Mutation	SNP	ENST00000270223.6	37	CCDS33054.1	.	.	.	.	.	.	.	.	.	.	c	20.5	3.998873	0.74818	.	.	ENSG00000185800	ENST00000377735;ENST00000270223	T;T	0.46451	0.87;0.87	2.62	2.62	0.31277	.	0.079368	0.45606	D	0.000347	T	0.51770	0.1694	L	0.46157	1.445	0.47094	D	0.999317	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.98	T	0.51116	-0.8746	10	0.52906	T	0.07	-20.9893	8.9512	0.35790	0.0:1.0:0.0:0.0	.	132;132	G5E9A7;Q09019	.;DMWD_HUMAN	H	132	ENSP00000366964:R132H;ENSP00000270223:R132H	ENSP00000270223:R132H	R	-	2	0	DMWD	50987460	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	6.034000	0.70933	1.789000	0.52484	0.449000	0.29647	CGT		0.716	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402063.1	NM_004943	
TEAD2	8463	hgsc.bcm.edu	37	19	49850460	49850460	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:49850460A>G	ENST00000311227.2	-	9	986	c.896T>C	c.(895-897)cTg>cCg	p.L299P	TEAD2_ENST00000598397.1_5'Flank|TEAD2_ENST00000598810.1_Missense_Mutation_p.L303P|TEAD2_ENST00000539846.1_Missense_Mutation_p.L171P|TEAD2_ENST00000377214.4_Missense_Mutation_p.L302P|TEAD2_ENST00000593945.1_Missense_Mutation_p.L303P|TEAD2_ENST00000601519.1_Missense_Mutation_p.L302P	NM_001256659.1|NM_003598.1	NP_001243588.1|NP_003589.1	Q15562	TEAD2_HUMAN	TEA domain family member 2	299	Transcriptional activation. {ECO:0000255}.				gene expression (GO:0010467)|hippo signaling (GO:0035329)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L299P(1)		central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	29		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		GAACTTGACCAGGAAGAAGGC	0.547																																					p.L299P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T896C	19						.						121.0	133.0	129.0					19																	49850460		2203	4300	6503	54542272	SO:0001583	missense	8463	exon9			X94440	CCDS12761.1, CCDS58670.1, CCDS58671.1, CCDS59406.1	19q13.3	2008-07-22							11715	protein-coding gene	gene with protein product		601729				9889009, 8702974	Standard	NM_003598		Approved	TEF-4, ETF, TEF4	uc031rls.1	Q15562		ENST00000311227.2:c.896T>C	19.37:g.49850460A>G	ENSP00000310701:p.Leu299Pro		54542272	NM_003598	B4DTJ6|M0R1T9|Q8NA25|Q96IG3	Missense_Mutation	SNP	ENST00000311227.2	37	CCDS12761.1	.	.	.	.	.	.	.	.	.	.	A	18.75	3.690722	0.68271	.	.	ENSG00000074219	ENST00000311227;ENST00000377214;ENST00000539846	T;T;T	0.35236	1.32;1.32;1.32	4.84	4.84	0.62591	.	0.000000	0.47455	D	0.000222	T	0.61974	0.2390	M	0.82433	2.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.68150	-0.5485	10	0.87932	D	0	-14.9299	12.6924	0.56982	1.0:0.0:0.0:0.0	.	171;299;302	B4DTJ6;Q15562;Q8NA25	.;TEAD2_HUMAN;.	P	299;302;171	ENSP00000310701:L299P;ENSP00000366419:L302P;ENSP00000437928:L171P	ENSP00000310701:L299P	L	-	2	0	TEAD2	54542272	1.000000	0.71417	1.000000	0.80357	0.745000	0.42441	9.179000	0.94861	1.965000	0.57142	0.533000	0.62120	CTG		0.547	TEAD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465465.1	NM_003598	
SCAF1	58506	hgsc.bcm.edu	37	19	50157984	50157984	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:50157984C>A	ENST00000360565.3	+	9	3599	c.3475C>A	c.(3475-3477)Cct>Act	p.P1159T		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1159					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)	p.P1159T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		GGGTCTGCCCCCTGGCCCCTC	0.672																																					p.P1159T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3475A	19						.						80.0	73.0	76.0					19																	50157984		2203	4300	6503	54849796	SO:0001583	missense	58506	exon9			AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3475C>A	19.37:g.50157984C>A	ENSP00000353769:p.Pro1159Thr		54849796	NM_021228	Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	ENST00000360565.3	37	CCDS33074.1	.	.	.	.	.	.	.	.	.	.	c	15.03	2.713121	0.48517	.	.	ENSG00000126461	ENST00000360565	T	0.35789	1.29	5.22	4.19	0.49359	.	0.098581	0.40728	N	0.001024	T	0.26774	0.0655	N	0.24115	0.695	0.35118	D	0.766823	P	0.51933	0.949	P	0.46275	0.51	T	0.29119	-1.0022	10	0.29301	T	0.29	-12.1936	9.1085	0.36712	0.0:0.8323:0.0:0.1677	.	1159	Q9H7N4	SFR19_HUMAN	T	1159	ENSP00000353769:P1159T	ENSP00000353769:P1159T	P	+	1	0	SCAF1	54849796	0.021000	0.18746	1.000000	0.80357	0.998000	0.95712	0.813000	0.27225	1.441000	0.47550	0.651000	0.88453	CCT		0.672	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	NM_021228	
KLK5	25818	hgsc.bcm.edu	37	19	51446969	51446969	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:51446969G>A	ENST00000336334.3	-	6	1152	c.800C>T	c.(799-801)gCc>gTc	p.A267V	KLK5_ENST00000391809.2_Missense_Mutation_p.A267V|KLK5_ENST00000593428.1_Missense_Mutation_p.A267V	NM_012427.4	NP_036559	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5	267	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis development (GO:0008544)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	epidermal lamellar body (GO:0097209)|extracellular space (GO:0005615)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A267V(1)		NS(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		GTTGGGCCGGGCACAAGGGTA	0.597																																					p.A267V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C800T	19						.						115.0	101.0	106.0					19																	51446969		2203	4300	6503	56138781	SO:0001583	missense	25818	exon6			AF135028	CCDS12810.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167754		"""Kallikreins"""	6366	protein-coding gene	gene with protein product		605643	"""kallikrein 5"""			10514489, 10608802, 1680072, 4, 16800723, 17012259	Standard	NM_012427		Approved	SCTE, KLK-L2	uc002puf.3	Q9Y337		ENST00000336334.3:c.800C>T	19.37:g.51446969G>A	ENSP00000337733:p.Ala267Val		56138781	NM_001077492	Q53ZR3|Q9HBG8	Missense_Mutation	SNP	ENST00000336334.3	37	CCDS12810.1	.	.	.	.	.	.	.	.	.	.	g	7.651	0.682943	0.14907	.	.	ENSG00000167754	ENST00000336334;ENST00000391809	D;D	0.93906	-3.31;-3.31	3.81	-2.32	0.06745	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.648092	0.11646	N	0.543331	D	0.91112	0.7202	M	0.85777	2.775	0.28892	N	0.893792	P	0.35944	0.529	B	0.28232	0.087	D	0.84263	0.0484	10	0.62326	D	0.03	.	9.4589	0.38772	0.1003:0.5108:0.3889:0.0	.	267	Q9Y337	KLK5_HUMAN	V	267	ENSP00000337733:A267V;ENSP00000375685:A267V	ENSP00000337733:A267V	A	-	2	0	KLK5	56138781	0.879000	0.30193	0.001000	0.08648	0.001000	0.01503	1.143000	0.31553	-0.397000	0.07691	-0.502000	0.04539	GCC		0.597	KLK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465057.1	NM_012427	
SIGLEC8	27181	hgsc.bcm.edu	37	19	51961255	51961255	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:51961255T>C	ENST00000321424.3	-	1	453	c.387A>G	c.(385-387)ggA>ggG	p.G129G	SIGLEC8_ENST00000597352.1_5'Flank|SIGLEC8_ENST00000430817.1_Silent_p.G129G|SIGLEC8_ENST00000340550.5_Silent_p.G129G	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	129					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.G129G(1)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		ATTTCATGCTTCCTCTCTCTA	0.502																																					p.G129G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A387G	19						.						127.0	127.0	127.0					19																	51961255		2203	4300	6503	56653067	SO:0001819	synonymous_variant	27181	exon1			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.387A>G	19.37:g.51961255T>C			56653067	NM_014442	Q7Z728	Silent	SNP	ENST00000321424.3	37	CCDS33086.1																																																																																				0.502	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
HAS1	3036	hgsc.bcm.edu	37	19	52217159	52217159	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:52217159G>A	ENST00000222115.1	-	5	1292	c.1258C>T	c.(1258-1260)Ctg>Ttg	p.L420L	HAS1_ENST00000594621.1_3'UTR|HAS1_ENST00000540069.2_Silent_p.L419L|HAS1_ENST00000601714.1_Silent_p.L427L	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	420					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.L420L(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AACAGACGCAGCACAGTGGCC	0.697																																					p.L420L	NSCLC(132;636 2450 45807 47979)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1258T	19						.						39.0	36.0	37.0					19																	52217159		2194	4298	6492	56908971	SO:0001819	synonymous_variant	3036	exon5			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1258C>T	19.37:g.52217159G>A			56908971	NM_001523	Q14470|Q9NS49	Silent	SNP	ENST00000222115.1	37	CCDS12838.1																																																																																				0.697	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
HAS1	3036	hgsc.bcm.edu	37	19	52222475	52222475	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:52222475G>A	ENST00000222115.1	-	2	720	c.686C>T	c.(685-687)tCg>tTg	p.S229L	HAS1_ENST00000594621.1_Missense_Mutation_p.S83L|HAS1_ENST00000540069.2_Missense_Mutation_p.S228L|HAS1_ENST00000601714.1_Missense_Mutation_p.S236L	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	229					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.S229L(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GTAGTCCACCGAATCTCCGAG	0.607																																					p.S229L	NSCLC(132;636 2450 45807 47979)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C686T	19						.						45.0	39.0	41.0					19																	52222475		2199	4295	6494	56914287	SO:0001583	missense	3036	exon2			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.686C>T	19.37:g.52222475G>A	ENSP00000222115:p.Ser229Leu		56914287	NM_001523	Q14470|Q9NS49	Missense_Mutation	SNP	ENST00000222115.1	37	CCDS12838.1	.	.	.	.	.	.	.	.	.	.	.	20.5	4.003248	0.74932	.	.	ENSG00000105509	ENST00000540069;ENST00000222115;ENST00000376737;ENST00000376738	T;T	0.60797	0.16;0.16	3.97	3.97	0.46021	.	0.000000	0.64402	D	0.000002	T	0.73171	0.3553	M	0.70903	2.155	0.53688	D	0.999973	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72982	0.964;0.979;0.979	T	0.77560	-0.2542	10	0.87932	D	0	-16.1244	13.8994	0.63794	0.0:0.0:1.0:0.0	.	228;229;228	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	L	228;229;83;83	ENSP00000445021:S228L;ENSP00000222115:S229L	ENSP00000222115:S229L	S	-	2	0	HAS1	56914287	0.913000	0.31002	0.997000	0.53966	0.855000	0.48748	3.840000	0.55843	1.932000	0.55993	0.423000	0.28283	TCG		0.607	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
ZNF432	9668	hgsc.bcm.edu	37	19	52537423	52537423	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:52537423A>G	ENST00000594154.1	-	5	1721	c.1509T>C	c.(1507-1509)caT>caC	p.H503H	ZNF432_ENST00000221315.5_Silent_p.H503H			O94892	ZN432_HUMAN	zinc finger protein 432	503					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H503H(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		GAGTTCGCTGATGTAACATCA	0.433																																					p.H503H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1509C	19						.						82.0	73.0	76.0					19																	52537423		2203	4300	6503	57229235	SO:0001819	synonymous_variant	9668	exon5			AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.1509T>C	19.37:g.52537423A>G			57229235	NM_014650		Silent	SNP	ENST00000594154.1	37	CCDS12848.1																																																																																				0.433	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462410.1	NM_014650	
PPP2R1A	5518	hgsc.bcm.edu	37	19	52714554	52714554	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:52714554G>A	ENST00000322088.6	+	4	370	c.312G>A	c.(310-312)gtG>gtA	p.V104V	PPP2R1A_ENST00000444322.2_Silent_p.V49V|PPP2R1A_ENST00000462990.1_5'UTR|PPP2R1A_ENST00000473455.2_3'UTR	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	104	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.|SV40 small T antigen binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.V104V(1)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		AGACAGTGGTGCGGGACAAGG	0.642			Mis		clear cell ovarian carcinoma																																p.V104V			Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G312A	19						.						46.0	48.0	47.0					19																	52714554		2203	4300	6503	57406366	SO:0001819	synonymous_variant	5518	exon4				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.312G>A	19.37:g.52714554G>A			57406366	NM_014225	Q13773|Q6ICQ3|Q96DH3	Silent	SNP	ENST00000322088.6	37	CCDS12849.1																																																																																				0.642	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
ZNF677	342926	hgsc.bcm.edu	37	19	53741648	53741648	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:53741648T>C	ENST00000598513.1	-	5	482	c.332A>G	c.(331-333)gAc>gGc	p.D111G	CTD-2245F17.6_ENST00000596041.1_RNA|ZNF677_ENST00000333952.4_Missense_Mutation_p.D111G	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	111					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D111G(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TACATCATAGTCCCACAGGCT	0.358																																					p.D111G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A332G	19						.						120.0	113.0	115.0					19																	53741648		2203	4300	6503	58433460	SO:0001583	missense	342926	exon5			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.332A>G	19.37:g.53741648T>C	ENSP00000469391:p.Asp111Gly		58433460	NM_182609		Missense_Mutation	SNP	ENST00000598513.1	37	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	T	2.237	-0.374638	0.05034	.	.	ENSG00000197928	ENST00000416063;ENST00000333952	T	0.07021	3.23	2.29	-2.48	0.06423	.	1.859940	0.03467	N	0.213127	T	0.03136	0.0092	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41698	-0.9494	10	0.15952	T	0.53	.	7.257	0.26181	0.0:0.4605:0.0:0.5395	.	111	Q86XU0	ZN677_HUMAN	G	111	ENSP00000334394:D111G	ENSP00000334394:D111G	D	-	2	0	ZNF677	58433460	0.005000	0.15991	0.000000	0.03702	0.016000	0.09150	0.407000	0.21049	-0.584000	0.05913	-0.242000	0.12053	GAC		0.358	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609	
PRKCG	5582	hgsc.bcm.edu	37	19	54385816	54385816	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:54385816G>A	ENST00000263431.3	+	1	350	c.68G>A	c.(67-69)gGg>gAg	p.G23E	PRKCG_ENST00000536044.1_Missense_Mutation_p.G23E|PRKCG_ENST00000540413.1_Missense_Mutation_p.G23E|PRKCG_ENST00000542049.1_5'Flank	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	23					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)	p.G23E(1)		large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	TGCAGAAAGGGGGCCCTGAGG	0.627																																					p.G23E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G68A	19						.						66.0	74.0	71.0					19																	54385816		2203	4300	6503	59077628	SO:0001583	missense	5582	exon1			M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.68G>A	19.37:g.54385816G>A	ENSP00000263431:p.Gly23Glu		59077628	NM_002739	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	37	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221137	0.79464	.	.	ENSG00000126583	ENST00000536044;ENST00000540413;ENST00000263431;ENST00000419486	D;D;D	0.95001	-3.58;-3.58;-3.58	4.08	4.08	0.47627	.	.	.	.	.	D	0.96793	0.8953	M	0.77820	2.39	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.997;0.998	D;D;D;D	0.81914	0.991;0.995;0.98;0.973	D	0.97357	0.9967	9	0.87932	D	0	.	14.1554	0.65415	0.0:0.0:1.0:0.0	.	23;23;23;23	F5H5C4;B7Z870;B7Z3W6;P05129	.;.;.;KPCG_HUMAN	E	23;23;23;46	ENSP00000440541:G23E;ENSP00000443493:G23E;ENSP00000263431:G23E	ENSP00000263431:G23E	G	+	2	0	PRKCG	59077628	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.851000	0.92205	1.996000	0.58369	0.491000	0.48974	GGG		0.627	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
LILRB4	11006	hgsc.bcm.edu	37	19	55175451	55175451	+	Missense_Mutation	SNP	G	G	A	rs370306475		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:55175451G>A	ENST00000391736.1	+	5	625	c.310G>A	c.(310-312)Gta>Ata	p.V104I	LILRB4_ENST00000430952.2_Missense_Mutation_p.V104I|LILRB4_ENST00000391734.3_Missense_Mutation_p.V104I|LILRB4_ENST00000270452.2_Missense_Mutation_p.V104I|LILRB4_ENST00000391733.3_Missense_Mutation_p.V104I	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	104	Ig-like C2-type 1.				immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)	p.V104I(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		TCGCAGCCCTGTAGGCTGGTC	0.597																																					p.V104I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G310A	19						.	G	ILE/VAL,ILE/VAL	0,4406		0,0,2203	200.0	176.0	184.0		310,310	-4.9	0.0	19		184	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LILRB4	NM_006847.3,NM_001081438.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	104/449,104/448	55175451	1,13005	2203	4300	6503	59867263	SO:0001583	missense	11006	exon3			U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.310G>A	19.37:g.55175451G>A	ENSP00000375616:p.Val104Ile		59867263	NM_006847	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	37	CCDS12902.1	.	.	.	.	.	.	.	.	.	.	G	0.196	-1.048903	0.01981	0.0	1.16E-4	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.12774	2.65;2.65;2.65;2.65;2.65;2.65	2.43	-4.87	0.03123	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.05135	0.0137	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.30592	-0.9973	9	0.48119	T	0.1	.	2.3419	0.04262	0.1546:0.1355:0.443:0.267	.	104;104;104;104;104	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6	.;.;.;.;LIRB4_HUMAN	I	104	ENSP00000375616:V104I;ENSP00000270452:V104I;ENSP00000408995:V104I;ENSP00000375614:V104I;ENSP00000375613:V104I;ENSP00000401962:V104I	ENSP00000270452:V104I	V	+	1	0	LILRB4	59867263	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.260000	0.02858	-2.704000	0.00397	-1.972000	0.00464	GTA		0.597	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3		
SLC25A23	79085	hgsc.bcm.edu	37	19	6452332	6452332	+	Silent	SNP	G	G	T	rs148491192		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:6452332G>T	ENST00000301454.4	-	8	1168	c.1062C>A	c.(1060-1062)gcC>gcA	p.A354A	SLC25A23_ENST00000334510.5_Silent_p.A354A|SLC25A23_ENST00000414491.2_Intron	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	354					adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)	p.A354A(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						CCTCGTAGACGGCCAGGTCGA	0.662																																					p.A354A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1062A	19						.						45.0	36.0	39.0					19																	6452332		2203	4300	6503	6403332	SO:0001819	synonymous_variant	79085	exon8			AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.1062C>A	19.37:g.6452332G>T			6403332	NM_024103	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Silent	SNP	ENST00000301454.4	37	CCDS32882.1																																																																																				0.662	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1	NM_024103	
ZSCAN22	342945	hgsc.bcm.edu	37	19	58849786	58849786	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr19:58849786A>G	ENST00000329665.4	+	3	717	c.570A>G	c.(568-570)tcA>tcG	p.S190S		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	190					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S190S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		CTGGACTATCAGGGGAGATCT	0.532																																					p.S190S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A570G	19						.						112.0	110.0	110.0					19																	58849786		2203	4300	6503	63541598	SO:0001819	synonymous_variant	342945	exon3			M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.570A>G	19.37:g.58849786A>G			63541598	NM_181846	Q15922|Q7Z3L8	Silent	SNP	ENST00000329665.4	37	CCDS12975.1																																																																																				0.532	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466765.1	NM_181846	
COL14A1	7373	hgsc.bcm.edu	37	8	121309798	121309798	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:121309798A>G	ENST00000297848.3	+	35	4555	c.4285A>G	c.(4285-4287)Aca>Gca	p.T1429A	COL14A1_ENST00000309791.4_Missense_Mutation_p.T1429A|COL14A1_ENST00000247781.3_Missense_Mutation_p.T1334A	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.T1429A(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			ATGGGCCAATACAGACAAATG	0.284																																					p.T1429A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4285G	8						.						69.0	65.0	66.0					8																	121309798		2203	4299	6502	121378979	SO:0001583	missense	7373	exon35				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4285A>G	8.37:g.121309798A>G	ENSP00000297848:p.Thr1429Ala		121378979	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	A	9.855	1.194699	0.22037	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	T;T;T	0.02032	4.49;4.49;4.49	5.61	0.305	0.15801	Concanavalin A-like lectin/glucanase (1);	0.566036	0.19528	N	0.112106	T	0.01523	0.0049	N	0.08118	0	0.28102	N	0.931376	B	0.06786	0.001	B	0.04013	0.001	T	0.40478	-0.9561	10	0.56958	D	0.05	.	11.9573	0.52988	0.3334:0.601:0.0656:0.0	.	1429	Q05707	COEA1_HUMAN	A	1429;1429;1334	ENSP00000311809:T1429A;ENSP00000297848:T1429A;ENSP00000247781:T1334A	ENSP00000247781:T1334A	T	+	1	0	COL14A1	121378979	1.000000	0.71417	0.054000	0.19295	0.455000	0.32408	2.180000	0.42537	-0.165000	0.10908	-0.313000	0.08912	ACA		0.284	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
ZHX2	22882	hgsc.bcm.edu	37	8	123966118	123966118	+	Missense_Mutation	SNP	G	G	A	rs148101741	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:123966118G>A	ENST00000314393.4	+	3	3203	c.2368G>A	c.(2368-2370)Gtt>Att	p.V790I		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	790					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.V790I(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GGAGTCGAGCGTTGTGGATTA	0.602													G|||	6	0.00119808	0.0008	0.0058	5008	,	,		21034	0.001		0.0	False		,,,				2504	0.0				p.V790I	Esophageal Squamous(94;1056 1388 11767 13799 49639)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2368A	8						.	G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	114.0	98.0	104.0		2368	3.9	0.0	8	dbSNP_134	104	0,8600		0,0,4300	yes	missense	ZHX2	NM_014943.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	790/838	123966118	1,13005	2203	4300	6503	124035299	SO:0001583	missense	22882	exon3			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2368G>A	8.37:g.123966118G>A	ENSP00000314709:p.Val790Ile		124035299	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	5	0.0022893772893772895	1	0.0020325203252032522	4	0.011049723756906077	0	0.0	0	0.0	G	4.875	0.162564	0.09287	2.27E-4	0.0	ENSG00000178764	ENST00000314393	T	0.17370	2.28	6.04	3.89	0.44902	.	0.357633	0.22308	N	0.061772	T	0.04452	0.0122	N	0.03608	-0.345	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.31447	-0.9943	10	0.33141	T	0.24	-7.2949	5.6221	0.17463	0.2588:0.1353:0.6059:0.0	.	790	Q9Y6X8	ZHX2_HUMAN	I	790	ENSP00000314709:V790I	ENSP00000314709:V790I	V	+	1	0	ZHX2	124035299	0.928000	0.31464	0.028000	0.17463	0.694000	0.40290	2.472000	0.45136	0.635000	0.30488	0.561000	0.74099	GTT		0.602	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
MTSS1	9788	hgsc.bcm.edu	37	8	125575041	125575041	+	Silent	SNP	C	C	T	rs138654761		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:125575041C>T	ENST00000518547.1	-	10	1490	c.1017G>A	c.(1015-1017)ccG>ccA	p.P339P	NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000395508.2_Silent_p.P73P|MTSS1_ENST00000325064.5_Silent_p.P343P|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000354184.4_Silent_p.P139P|MTSS1_ENST00000378017.3_Silent_p.P339P|MTSS1_ENST00000524090.1_Silent_p.P229P|MTSS1_ENST00000431961.2_Silent_p.P139P	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	339	Ser-rich.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)	p.P339P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GGGCCTCTGGCGGCATGGGGG	0.607																																					p.P339P	Esophageal Squamous(160;622 1893 3862 8546 12509)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1017A	8						.						53.0	52.0	52.0					8																	125575041		2203	4300	6503	125644222	SO:0001819	synonymous_variant	9788	exon10			AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1017G>A	8.37:g.125575041C>T			125644222	NM_014751	J3KNK6|Q8TCA2|Q96RX2	Silent	SNP	ENST00000518547.1	37	CCDS6353.1	.	.	.	.	.	.	.	.	.	.	C	0.300	-0.974257	0.02215	.	.	ENSG00000170873	ENST00000519168;ENST00000523179	.	.	.	5.6	-4.76	0.03229	.	.	.	.	.	T	0.54175	0.1842	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55692	-0.8101	4	.	.	.	-19.0814	10.9589	0.47374	0.0954:0.2067:0.0:0.6979	.	.	.	.	T	87;187	.	.	A	-	1	0	MTSS1	125644222	0.254000	0.23992	0.789000	0.31954	0.051000	0.14879	-0.556000	0.05992	-0.737000	0.04824	-0.759000	0.03464	GCC		0.607	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	
KIAA0196	9897	hgsc.bcm.edu	37	8	126051126	126051126	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:126051126T>C	ENST00000318410.7	-	25	3379	c.3030A>G	c.(3028-3030)ttA>ttG	p.L1010L	KIAA0196-AS1_ENST00000519140.1_RNA|KIAA0196_ENST00000517845.1_Silent_p.L862L	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	1010					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.L1010L(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TGATTTCATATAAAAGTGTGT	0.443																																					p.L1010L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3030G	8						.						141.0	142.0	142.0					8																	126051126		2203	4300	6503	126120308	SO:0001819	synonymous_variant	9897	exon25				CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.3030A>G	8.37:g.126051126T>C			126120308	NM_014846	A8K4R7|Q3KQX5|Q8TBQ2	Silent	SNP	ENST00000318410.7	37	CCDS6355.1	.	.	.	.	.	.	.	.	.	.	T	9.360	1.067806	0.20067	.	.	ENSG00000164961	ENST00000523273	.	.	.	5.92	-10.7	0.00240	.	.	.	.	.	T	0.56307	0.1976	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67643	-0.5618	4	.	.	.	-10.582	13.7014	0.62611	0.0:0.6258:0.1471:0.2271	.	.	.	.	C	627	.	.	Y	-	2	0	KIAA0196	126120308	0.014000	0.17966	0.120000	0.21714	0.993000	0.82548	-0.751000	0.04803	-1.882000	0.01122	0.459000	0.35465	TAT		0.443	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
ADCY8	114	hgsc.bcm.edu	37	8	131826373	131826373	+	Missense_Mutation	SNP	C	C	T	rs183246609		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:131826373C>T	ENST00000286355.5	-	14	4947	c.2855G>A	c.(2854-2856)cGg>cAg	p.R952Q	ADCY8_ENST00000377928.3_Missense_Mutation_p.R821Q	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	952					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.R952Q(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TAAGATATTCCGGAGCATGTT	0.547										HNSCC(32;0.087)			C|||	1	0.000199681	0.0	0.0	5008	,	,		17782	0.0		0.001	False		,,,				2504	0.0				p.R952Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2855A	8						.						223.0	166.0	186.0					8																	131826373		2203	4300	6503	131895555	SO:0001583	missense	114	exon14			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2855G>A	8.37:g.131826373C>T	ENSP00000286355:p.Arg952Gln		131895555	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	20.3	3.974563	0.74246	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.77877	-1.13;-1.13	5.87	5.87	0.94306	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.058532	0.64402	D	0.000003	T	0.62233	0.2411	N	0.08118	0	0.33910	D	0.63963	P;P	0.46912	0.886;0.627	B;B	0.40659	0.336;0.087	T	0.70121	-0.4959	10	0.30078	T	0.28	.	17.7375	0.88397	0.0:1.0:0.0:0.0	.	821;952	E7EVL1;P40145	.;ADCY8_HUMAN	Q	952;821	ENSP00000286355:R952Q;ENSP00000367161:R821Q	ENSP00000286355:R952Q	R	-	2	0	ADCY8	131895555	0.963000	0.33076	1.000000	0.80357	0.998000	0.95712	3.777000	0.55364	2.941000	0.99782	0.655000	0.94253	CGG		0.547	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
ARHGEF10	9639	hgsc.bcm.edu	37	8	1808343	1808343	+	Silent	SNP	C	C	T	rs147914724	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:1808343C>T	ENST00000398564.1	+	4	546	c.546C>T	c.(544-546)gaC>gaT	p.D182D	ARHGEF10_ENST00000398560.1_Silent_p.D182D|ARHGEF10_ENST00000349830.3_Silent_p.D158D|ARHGEF10_ENST00000520359.1_Silent_p.D158D|ARHGEF10_ENST00000518288.1_Silent_p.D182D|ARHGEF10_ENST00000262112.6_Silent_p.D182D			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	182					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D182D(1)		endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		CGTCCCTGGACGAAGAAGGTA	0.657													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17485	0.0		0.0	False		,,,				2504	0.001				p.D158D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C474T	8						.	C		14,4392	21.2+/-45.6	0,14,2189	80.0	72.0	74.0		474	-10.6	0.0	8	dbSNP_134	74	0,8600		0,0,4300	no	coding-synonymous	ARHGEF10	NM_014629.2		0,14,6489	TT,TC,CC		0.0,0.3177,0.1076		158/1345	1808343	14,12992	2203	4300	6503	1795750	SO:0001819	synonymous_variant	9639	exon4			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.546C>T	8.37:g.1808343C>T			1795750	NM_014629	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Silent	SNP	ENST00000398564.1	37																																																																																					0.657	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding			
CNOT7	29883	hgsc.bcm.edu	37	8	17094735	17094735	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:17094735C>T	ENST00000361272.4	-	4	757	c.459G>A	c.(457-459)tgG>tgA	p.W153*	CNOT7_ENST00000523917.1_Nonsense_Mutation_p.W153*	NM_013354.5	NP_037486.2	Q9UIV1	CNOT7_HUMAN	CCR4-NOT transcription complex, subunit 7	153					carbohydrate metabolic process (GO:0005975)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of cell proliferation (GO:0008285)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.W153C(1)|p.W153*(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)	11				Colorectal(111;0.0523)|COAD - Colon adenocarcinoma(73;0.209)		GAAATGACAACCATTTGACCC	0.388																																					p.W153X												.	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|endometrium(1)	c.G459A	8						.						141.0	132.0	135.0					8																	17094735		2203	4300	6503	17139106	SO:0001587	stop_gained	29883	exon4			L46722	CCDS6000.2, CCDS55202.1	8p22-p21.3	2008-08-07			ENSG00000198791	ENSG00000198791			14101	protein-coding gene	gene with protein product	"""BTG1 binding factor 1"""	604913		CAF1		10637334, 1538749, 17264152	Standard	XM_005273481		Approved		uc003wxg.1	Q9UIV1	OTTHUMG00000096971	ENST00000361272.4:c.459G>A	8.37:g.17094735C>T	ENSP00000355279:p.Trp153*		17139106	NM_013354	A8MZM5|B3KMP1|B3KN35|D3DSP6|G3V108|Q7Z530	Nonsense_Mutation	SNP	ENST00000361272.4	37	CCDS6000.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.573239|6.573239	0.97676|0.97676	.|.	.|.	ENSG00000198791|ENSG00000198791	ENST00000519918|ENST00000361272;ENST00000523917	.|.	.|.	.|.	4.82|4.82	4.82|4.82	0.62117|0.62117	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.46328|.	0.1387|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37820|.	-0.9689|.	3|.	.|0.02654	.|T	.|1	-5.2392|-5.2392	18.7947|18.7947	0.91990|0.91990	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	133|153	.|.	.|ENSP00000355279:W153X	G|W	-|-	2|3	0|0	CNOT7|CNOT7	17139106|17139106	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.487000|7.487000	0.81328|0.81328	2.606000|2.606000	0.88127|0.88127	0.650000|0.650000	0.86243|0.86243	GGT|TGG		0.388	CNOT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214038.1	NM_013354	
SLC39A14	23516	hgsc.bcm.edu	37	8	22273742	22273742	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:22273742G>T	ENST00000381237.1	+	7	1215	c.1096G>T	c.(1096-1098)Ggc>Tgc	p.G366C	SLC39A14_ENST00000240095.6_Missense_Mutation_p.G366C|SLC39A14_ENST00000289952.5_Missense_Mutation_p.G366C|SLC39A14_ENST00000359741.5_Missense_Mutation_p.G366C	NM_001128431.2	NP_001121903.1	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter), member 14	366					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ferrous iron transmembrane transporter activity (GO:0015093)|zinc ion transmembrane transporter activity (GO:0005385)	p.G366C(1)		NS(1)|endometrium(4)|large_intestine(2)|lung(4)|prostate(1)	12				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		AGTTTTCCAAGGCATCAGCAC	0.572																																					p.G366C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1096T	8						.						114.0	102.0	106.0					8																	22273742		2203	4300	6503	22329687	SO:0001583	missense	23516	exon7			D31887	CCDS6030.1, CCDS47822.1, CCDS47823.1	8p21.2	2013-05-22			ENSG00000104635	ENSG00000104635		"""Solute carriers"""	20858	protein-coding gene	gene with protein product		608736	"""solute carrier family 39 (metal ion transporter), member 14"""			12659941	Standard	NM_015359		Approved	KIAA0062, NET34, ZIP14	uc011kzh.2	Q15043	OTTHUMG00000097791	ENST00000381237.1:c.1096G>T	8.37:g.22273742G>T	ENSP00000370635:p.Gly366Cys		22329687	NM_001135153	A6NH98|B4DIW3|B6EU88|D3DSR4|Q6ZME8|Q96BB3	Missense_Mutation	SNP	ENST00000381237.1	37	CCDS47823.1	.	.	.	.	.	.	.	.	.	.	G	33	5.276071	0.95459	.	.	ENSG00000104635	ENST00000359741;ENST00000240095;ENST00000381237;ENST00000289952;ENST00000517370	T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.81054	0.4743	M	0.93939	3.475	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84940	0.0865	10	0.87932	D	0	-33.0579	19.2492	0.93917	0.0:0.0:1.0:0.0	.	366;366;366	Q15043-2;Q15043;B6EU88	.;S39AE_HUMAN;.	C	366;366;366;366;189	ENSP00000352779:G366C;ENSP00000240095:G366C;ENSP00000370635:G366C;ENSP00000289952:G366C;ENSP00000427981:G189C	ENSP00000240095:G366C	G	+	1	0	SLC39A14	22329687	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.701000	0.98710	2.840000	0.97914	0.655000	0.94253	GGC		0.572	SLC39A14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215039.2	XM_046677	
DOCK5	80005	hgsc.bcm.edu	37	8	25154059	25154059	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:25154059T>C	ENST00000276440.7	+	7	545	c.501T>C	c.(499-501)gaT>gaC	p.D167D	DOCK5_ENST00000481100.1_Silent_p.D167D	NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	167					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.D167D(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TGGTGCGAGATGACAATGGGA	0.512																																					p.D167D	Pancreas(145;34 1887 3271 10937 30165)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T501C	8						.						121.0	98.0	106.0					8																	25154059		2203	4300	6503	25209976	SO:0001819	synonymous_variant	80005	exon7				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.501T>C	8.37:g.25154059T>C			25209976	NM_024940	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Silent	SNP	ENST00000276440.7	37	CCDS6047.1																																																																																				0.512	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
EXTL3	2137	hgsc.bcm.edu	37	8	28600688	28600688	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:28600688T>C	ENST00000220562.4	+	6	3409	c.2507T>C	c.(2506-2508)aTg>aCg	p.M836T	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Missense_Mutation_p.M452T	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	836					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.M836T(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		GACATTGCCATGAACTTCCTT	0.507																																					p.M836T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2507C	8						.						231.0	195.0	207.0					8																	28600688		2203	4300	6503	28656607	SO:0001583	missense	2137	exon6			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.2507T>C	8.37:g.28600688T>C	ENSP00000220562:p.Met836Thr		28656607	NM_001440	D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	37	CCDS6070.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.043897	0.75732	.	.	ENSG00000012232	ENST00000523149;ENST00000220562;ENST00000521532;ENST00000517738	D;D;D;D	0.91407	-2.84;-2.84;-2.84;-2.84	4.89	4.89	0.63831	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.96651	0.8907	H	0.95224	3.64	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97835	1.0265	10	0.87932	D	0	-38.7624	14.7101	0.69225	0.0:0.0:0.0:1.0	.	836	O43909	EXTL3_HUMAN	T	452;836;134;82	ENSP00000428691:M452T;ENSP00000220562:M836T;ENSP00000431013:M134T;ENSP00000430652:M82T	ENSP00000220562:M836T	M	+	2	0	EXTL3	28656607	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.791000	0.85805	2.057000	0.61298	0.528000	0.53228	ATG		0.507	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
ANK1	286	hgsc.bcm.edu	37	8	41566442	41566442	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:41566442C>T	ENST00000347528.4	-	17	1935	c.1852G>A	c.(1852-1854)Gcc>Acc	p.A618T	ANK1_ENST00000265709.8_Missense_Mutation_p.A651T|ANK1_ENST00000289734.7_Missense_Mutation_p.A618T|ANK1_ENST00000379758.2_Missense_Mutation_p.A618T|ANK1_ENST00000396945.1_Missense_Mutation_p.A618T|ANK1_ENST00000352337.4_Missense_Mutation_p.A618T|ANK1_ENST00000396942.1_Missense_Mutation_p.A618T	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	618	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.A618T(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			AGACTACGGGCCACCTCCACC	0.612																																					p.A618T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1852A	8						.						83.0	74.0	77.0					8																	41566442		2203	4300	6503	41685599	SO:0001583	missense	286	exon17			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1852G>A	8.37:g.41566442C>T	ENSP00000339620:p.Ala618Thr		41685599	NM_020475	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	C	36	5.603145	0.96614	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.51	5.51	0.81932	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.74779	0.3761	L	0.45470	1.425	0.80722	D	1	P;D;B;P;P	0.56287	0.951;0.975;0.22;0.929;0.912	P;P;B;B;P	0.58172	0.834;0.834;0.028;0.227;0.773	T	0.72981	-0.4126	10	0.40728	T	0.16	.	19.4035	0.94640	0.0:1.0:0.0:0.0	.	651;618;618;618;618	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	T	618;618;618;618;618;618;651;618	ENSP00000339620:A618T;ENSP00000289734:A618T;ENSP00000369082:A618T;ENSP00000380149:A618T;ENSP00000380147:A618T;ENSP00000309131:A618T;ENSP00000265709:A651T	ENSP00000265709:A651T	A	-	1	0	ANK1	41685599	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	7.790000	0.85794	2.586000	0.87340	0.561000	0.74099	GCC		0.612	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
ADHFE1	137872	hgsc.bcm.edu	37	8	67369375	67369375	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:67369375G>A	ENST00000396623.3	+	12	1167	c.1136G>A	c.(1135-1137)cGa>cAa	p.R379Q	ADHFE1_ENST00000415254.1_Missense_Mutation_p.R331Q|ADHFE1_ENST00000496501.1_3'UTR	NM_144650.2	NP_653251.2	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1	379					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|molecular hydrogen transport (GO:0015993)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacid-oxoacid transhydrogenase activity (GO:0047988)|metal ion binding (GO:0046872)	p.R331Q(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	29		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			TTTCCAGAGCGACACCTGGAG	0.552																																					p.R379Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1136A	8						.						141.0	133.0	136.0					8																	67369375		2203	4300	6503	67531929	SO:0001583	missense	137872	exon12			AK056992	CCDS6190.2	8q12.3	2013-05-21			ENSG00000147576	ENSG00000147576	1.1.99.24	"""Alcohol dehydrogenases"""	16354	protein-coding gene	gene with protein product	"""hydroxyacid-oxoacid transhydrogenase"""	611083				12592711	Standard	NM_144650		Approved	ADHFe1, FLJ32430	uc003xwb.4	Q8IWW8	OTTHUMG00000150215	ENST00000396623.3:c.1136G>A	8.37:g.67369375G>A	ENSP00000379865:p.Arg379Gln		67531929	NM_144650	B4DTJ8|Q49A19|Q68CI7|Q6P2B6|Q96MF9	Missense_Mutation	SNP	ENST00000396623.3	37	CCDS6190.2	.	.	.	.	.	.	.	.	.	.	G	34	5.394089	0.96009	.	.	ENSG00000147576	ENST00000396623;ENST00000415254	T;T	0.50277	0.75;0.75	5.83	4.96	0.65561	Alcohol dehydrogenase, iron-type (1);	0.000000	0.85682	D	0.000000	T	0.71492	0.3346	M	0.94142	3.5	0.80722	D	1	P	0.50443	0.935	P	0.53593	0.73	T	0.80883	-0.1183	10	0.66056	D	0.02	-4.3133	15.2016	0.73142	0.0679:0.0:0.9321:0.0	.	379	Q8IWW8	HOT_HUMAN	Q	379;331	ENSP00000379865:R379Q;ENSP00000407115:R331Q	ENSP00000379865:R379Q	R	+	2	0	ADHFE1	67531929	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	7.854000	0.86942	1.467000	0.48044	0.563000	0.77884	CGA		0.552	ADHFE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316867.3	NM_144650	
PMP2	5375	hgsc.bcm.edu	37	8	82359581	82359581	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:82359581C>T	ENST00000256103.2	-	1	177	c.41G>A	c.(40-42)aGt>aAt	p.S14N	PMP2_ENST00000519260.1_Missense_Mutation_p.S14N|RP11-157I4.4_ENST00000524085.2_RNA	NM_002677.3	NP_002668.1	P02689	MYP2_HUMAN	peripheral myelin protein 2	14					membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cholesterol binding (GO:0015485)|fatty acid binding (GO:0005504)|transporter activity (GO:0005215)	p.S14N(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			Epithelial(68;0.186)			AAAGTTCTCACTAGAGACAAG	0.403																																					p.S14N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G41A	8						.						115.0	111.0	112.0					8																	82359581		2203	4300	6503	82522136	SO:0001583	missense	5375	exon1			X62167	CCDS6229.1	8q21.3-q22.1	2013-03-01			ENSG00000147588	ENSG00000147588		"""Fatty acid binding protein family"""	9117	protein-coding gene	gene with protein product		170715				1720307, 8288226	Standard	NM_002677		Approved	MP2, FABP8, M-FABP	uc003ycb.1	P02689	OTTHUMG00000164600	ENST00000256103.2:c.41G>A	8.37:g.82359581C>T	ENSP00000256103:p.Ser14Asn		82522136	NM_002677	Q6FHL4	Missense_Mutation	SNP	ENST00000256103.2	37	CCDS6229.1	.	.	.	.	.	.	.	.	.	.	C	9.989	1.230408	0.22542	.	.	ENSG00000147588	ENST00000256103;ENST00000519260	T;T	0.49720	0.77;0.77	5.98	5.1	0.69264	Calycin-like (1);Cytosolic fatty-acid binding (2);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.55273	0.1910	M	0.71036	2.16	0.28482	N	0.914894	P	0.48230	0.907	P	0.50136	0.632	T	0.57271	-0.7840	10	0.49607	T	0.09	.	10.6431	0.45604	0.0:0.7986:0.1332:0.0681	.	14	P02689	MYP2_HUMAN	N	14	ENSP00000256103:S14N;ENSP00000429917:S14N	ENSP00000256103:S14N	S	-	2	0	PMP2	82522136	1.000000	0.71417	0.978000	0.43139	0.258000	0.26162	4.666000	0.61554	1.513000	0.48852	0.650000	0.86243	AGT		0.403	PMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379365.1	NM_002677	
SDC2	6383	hgsc.bcm.edu	37	8	97621692	97621692	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:97621692G>T	ENST00000302190.4	+	5	1443	c.522G>T	c.(520-522)aaG>aaT	p.K174N	SDC2_ENST00000519914.1_Missense_Mutation_p.K145N|SDC2_ENST00000518385.1_Missense_Mutation_p.K138N|SDC2_ENST00000522911.1_Missense_Mutation_p.K145N	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2	174					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)	p.K174N(1)		breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	TGAGAAAGAAGGATGAAGGAA	0.423																																					p.K174N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G522T	8						.						158.0	140.0	146.0					8																	97621692		2203	4300	6503	97690868	SO:0001583	missense	6383	exon5			BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	ENST00000302190.4:c.522G>T	8.37:g.97621692G>T	ENSP00000307046:p.Lys174Asn		97690868	NM_002998	B3KQA3|Q6PIS6|Q9H6V1	Missense_Mutation	SNP	ENST00000302190.4	37	CCDS6272.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352733	0.61293	.	.	ENSG00000169439	ENST00000302190;ENST00000518385;ENST00000545117;ENST00000546193;ENST00000522911;ENST00000519914	T;T;T;T	0.57595	0.39;0.63;0.51;0.51	6.05	5.17	0.71159	Neurexin/syndecan/glycophorin C (1);	0.000000	0.85682	D	0.000000	T	0.71492	0.3346	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.74115	-0.3769	10	0.54805	T	0.06	-23.9363	10.6198	0.45474	0.1469:0.0:0.8531:0.0	.	174	P34741	SDC2_HUMAN	N	174;138;174;164;145;145	ENSP00000307046:K174N;ENSP00000429045:K138N;ENSP00000427784:K145N;ENSP00000428256:K145N	ENSP00000307046:K174N	K	+	3	2	SDC2	97690868	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.952000	0.87827	1.543000	0.49345	0.650000	0.86243	AAG		0.423	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379750.1	NM_002998	
WISP1	8840	hgsc.bcm.edu	37	8	134225219	134225219	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr8:134225219G>A	ENST00000250160.6	+	2	288	c.182G>A	c.(181-183)cGc>cAc	p.R61H	WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Missense_Mutation_p.R61H|WISP1_ENST00000517423.1_Missense_Mutation_p.R61H|WISP1_ENST00000377863.2_Intron	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	61	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.R61H(3)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			TCCCCACCCCGCTGCCCGCTG	0.627																																					p.R61H												.	.	3	Substitution - Missense(3)	upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)	c.G182A	8						.						36.0	36.0	36.0					8																	134225219		2203	4300	6503	134294401	SO:0001583	missense	8840	exon2			AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.182G>A	8.37:g.134225219G>A	ENSP00000250160:p.Arg61His		134294401	NM_080838	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Missense_Mutation	SNP	ENST00000250160.6	37	CCDS6371.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030189	0.54790	.	.	ENSG00000104415	ENST00000250160;ENST00000517423;ENST00000220856	T;T;T	0.58940	0.3;0.3;0.3	5.13	4.25	0.50352	Insulin-like growth factor-binding protein, IGFBP (3);	0.381335	0.29403	N	0.012256	T	0.41073	0.1143	L	0.46885	1.475	0.80722	D	1	B;P;P	0.40578	0.274;0.675;0.722	B;B;B	0.31946	0.045;0.085;0.138	T	0.22556	-1.0213	10	0.14252	T	0.57	-12.8409	8.5022	0.33165	0.0818:0.1535:0.7646:0.0	.	61;61;61	E7EMM5;O95388-2;O95388	.;.;WISP1_HUMAN	H	61	ENSP00000250160:R61H;ENSP00000427744:R61H;ENSP00000220856:R61H	ENSP00000220856:R61H	R	+	2	0	WISP1	134294401	0.996000	0.38824	1.000000	0.80357	0.937000	0.57800	1.178000	0.31981	1.170000	0.42753	0.549000	0.68633	CGC		0.627	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378794.2	NM_003882	
CASZ1	54897	hgsc.bcm.edu	37	1	10715816	10715816	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:10715816C>T	ENST00000377022.3	-	9	1872	c.1555G>A	c.(1555-1557)Gac>Aac	p.D519N	CASZ1_ENST00000344008.5_Missense_Mutation_p.D519N|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	519					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D519N(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		AGGGAGTTGTCGCGCTTCTTG	0.607																																					p.D519N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1555A	1						.						240.0	179.0	200.0					1																	10715816		2203	4300	6503	10638403	SO:0001583	missense	54897	exon9			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.1555G>A	1.37:g.10715816C>T	ENSP00000366221:p.Asp519Asn		10638403	NM_001079843	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	C	36	5.722006	0.96839	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.75561	0.3866	L	0.49778	1.585	0.54753	D	0.999982	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	T	0.77923	-0.2406	9	0.66056	D	0.02	-39.2131	18.3162	0.90221	0.0:1.0:0.0:0.0	.	543;519;519	B7Z1S3;Q86V15-2;Q86V15	.;.;CASZ1_HUMAN	N	519	.	ENSP00000339445:D519N	D	-	1	0	CASZ1	10638403	1.000000	0.71417	0.942000	0.38095	0.922000	0.55478	7.366000	0.79548	2.409000	0.81822	0.561000	0.74099	GAC		0.607	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
MASP2	10747	hgsc.bcm.edu	37	1	11087316	11087316	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:11087316T>C	ENST00000400897.3	-	11	1702	c.1687A>G	c.(1687-1689)Agg>Ggg	p.R563G	RP4-635E18.8_ENST00000607145.1_RNA	NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	563	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.R563G(1)		biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		TCATCTGTCCTCATAAAGGAT	0.383																																					p.R563G	GBM(35;611 746 20780 22741 36496)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1687G	1						.						138.0	138.0	138.0					1																	11087316		2203	4300	6503	11009903	SO:0001583	missense	10747	exon11			X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.1687A>G	1.37:g.11087316T>C	ENSP00000383690:p.Arg563Gly		11009903	NM_006610	A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Missense_Mutation	SNP	ENST00000400897.3	37	CCDS123.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.612689	0.28712	.	.	ENSG00000009724	ENST00000400897	D	0.88664	-2.41	5.06	1.35	0.21983	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.549814	0.18098	N	0.151777	T	0.80065	0.4555	L	0.37850	1.14	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.64841	-0.6312	10	0.25106	T	0.35	.	5.7229	0.17996	0.0:0.1534:0.1429:0.7036	.	563	O00187	MASP2_HUMAN	G	563	ENSP00000383690:R563G	ENSP00000383690:R563G	R	-	1	2	MASP2	11009903	0.435000	0.25577	0.681000	0.30009	0.933000	0.57130	2.846000	0.48262	-0.023000	0.13963	-0.376000	0.06991	AGG		0.383	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006072.1	NM_006610	
VAV3	10451	hgsc.bcm.edu	37	1	108160199	108160199	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:108160199G>T	ENST00000370056.4	-	21	2244	c.1970C>A	c.(1969-1971)cCt>cAt	p.P657H	VAV3_ENST00000544443.1_Missense_Mutation_p.P61H|VAV3_ENST00000527011.1_Missense_Mutation_p.P657H|VAV3_ENST00000415432.2_Missense_Mutation_p.P97H|VAV3_ENST00000343258.4_5'UTR	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	657	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.|Sufficient for interaction with ROS1.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.P657H(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		ACATGGGCAAGGCTTGACTGC	0.358																																					p.P657H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1970A	1						.						88.0	90.0	89.0					1																	108160199		2203	4300	6503	107961722	SO:0001583	missense	10451	exon21			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1970C>A	1.37:g.108160199G>T	ENSP00000359073:p.Pro657His		107961722	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	CCDS785.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490785	0.84962	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000544443;ENST00000415432	T;T;T;T	0.09911	2.93;2.93;2.93;2.93	5.76	5.76	0.90799	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.36110	0.0955	M	0.89095	3.005	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.36841	-0.9731	10	0.87932	D	0	.	19.9601	0.97247	0.0:0.0:1.0:0.0	.	657;61;657;97	E9PQ97;B7Z3Z5;Q9UKW4;Q9UKW4-3	.;.;VAV3_HUMAN;.	H	657;657;61;97	ENSP00000359073:P657H;ENSP00000432540:P657H;ENSP00000446404:P61H;ENSP00000394897:P97H	ENSP00000359073:P657H	P	-	2	0	VAV3	107961722	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.743000	0.85020	2.720000	0.93068	0.655000	0.94253	CCT		0.358	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
CD53	963	hgsc.bcm.edu	37	1	111435155	111435155	+	Splice_Site	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:111435155G>A	ENST00000271324.5	+	3	364	c.252G>A	c.(250-252)tcG>tcA	p.S84S	CD53_ENST00000429072.2_Splice_Site_p.S84S	NM_000560.3|NM_001040033.1	NP_000551.1|NP_001035122.1	P19397	CD53_HUMAN	CD53 molecule	84					positive regulation of myoblast fusion (GO:1901741)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S84S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	17		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		TGCTTATGTCGGTGAGTCCTT	0.493																																					p.S84S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G252A	1						.						196.0	176.0	183.0					1																	111435155		2203	4300	6503	111236678	SO:0001630	splice_region_variant	963	exon3			BC040693	CCDS829.1	1p13	2013-02-14	2006-03-28		ENSG00000143119	ENSG00000143119		"""CD molecules"", ""Tetraspanins"""	1686	protein-coding gene	gene with protein product		151525	"""CD53 antigen"""	MOX44		8319976	Standard	XM_006711053		Approved	TSPAN25	uc001dzw.3	P19397	OTTHUMG00000048020	ENST00000271324.5:c.252+1G>A	1.37:g.111435155G>A			111236678	NM_000560	B2R905|Q5U0D6	Silent	SNP	ENST00000271324.5	37	CCDS829.1																																																																																				0.493	CD53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032931.1	NM_000560	Silent
PHTF1	10745	hgsc.bcm.edu	37	1	114248659	114248659	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:114248659A>G	ENST00000369604.1	-	13	2007	c.1524T>C	c.(1522-1524)atT>atC	p.I508I	PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000393357.2_Silent_p.I508I|PHTF1_ENST00000357783.2_Silent_p.I508I|PHTF1_ENST00000369600.1_Silent_p.I455I|PHTF1_ENST00000369596.2_Silent_p.I455I|PHTF1_ENST00000369598.1_Silent_p.I463I			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	508					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I508I(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCTCAGCTGAAATGGACTTTA	0.373																																					p.I508I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1524C	1						.						86.0	77.0	80.0					1																	114248659		2203	4300	6503	114050182	SO:0001819	synonymous_variant	10745	exon12			AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.1524T>C	1.37:g.114248659A>G			114050182	NM_006608	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Silent	SNP	ENST00000369604.1	37	CCDS861.1	.	.	.	.	.	.	.	.	.	.	A	10.05	1.244981	0.22796	.	.	ENSG00000116793	ENST00000412670	.	.	.	5.54	-7.05	0.01573	.	.	.	.	.	T	0.32793	0.0841	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52786	-0.8529	4	.	.	.	-14.0506	8.475	0.33007	0.335:0.2745:0.3905:0.0	.	.	.	.	S	264	.	.	F	-	2	0	PHTF1	114050182	0.729000	0.28090	0.938000	0.37757	0.964000	0.63967	-0.100000	0.10990	-0.838000	0.04218	0.397000	0.26171	TTT		0.373	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608	
MTHFR	4524	hgsc.bcm.edu	37	1	11860328	11860328	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:11860328A>G	ENST00000376592.1	-	3	655	c.527T>C	c.(526-528)gTg>gCg	p.V176A	MTHFR_ENST00000376585.1_Missense_Mutation_p.V217A|MTHFR_ENST00000376583.3_Missense_Mutation_p.V217A|MTHFR_ENST00000376590.3_Missense_Mutation_p.V176A			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	176					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)	p.V176A(1)		NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	CACCAGGTCCACTGCGTAGTT	0.567																																					p.V176A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T527C	1						.						352.0	262.0	292.0					1																	11860328		2203	4300	6503	11782915	SO:0001583	missense	4524	exon4			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.527T>C	1.37:g.11860328A>G	ENSP00000365777:p.Val176Ala		11782915	NM_005957	B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Missense_Mutation	SNP	ENST00000376592.1	37	CCDS137.1	.	.	.	.	.	.	.	.	.	.	A	10.70	1.425405	0.25639	.	.	ENSG00000177000	ENST00000376592;ENST00000376583;ENST00000376590;ENST00000376585	D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06	5.76	-0.864	0.10666	.	1.144530	0.06251	N	0.692100	D	0.82939	0.5146	N	0.17674	0.51	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.12837	0.008;0.002	T	0.66300	-0.5958	10	0.18276	T	0.48	.	5.2514	0.15524	0.6135:0.0:0.2645:0.122	.	176;217	P42898;Q5SNW6	MTHR_HUMAN;.	A	176;217;176;217	ENSP00000365777:V176A;ENSP00000365767:V217A;ENSP00000365775:V176A;ENSP00000365770:V217A	ENSP00000365767:V217A	V	-	2	0	MTHFR	11782915	0.000000	0.05858	0.000000	0.03702	0.959000	0.62525	0.652000	0.24888	-0.428000	0.07339	0.448000	0.29417	GTG		0.567	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006538.1	NM_005957	
MTHFR	4524	hgsc.bcm.edu	37	1	11861250	11861250	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:11861250A>C	ENST00000376592.1	-	2	571	c.443T>G	c.(442-444)cTg>cGg	p.L148R	MTHFR_ENST00000376585.1_Missense_Mutation_p.L189R|MTHFR_ENST00000376583.3_Missense_Mutation_p.L189R|MTHFR_ENST00000376590.3_Missense_Mutation_p.L148R			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	148					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)	p.L148R(1)		NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	CTTCAGGCCCAGCTGCTTAGC	0.612																																					p.L148R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T443G	1						.						95.0	91.0	92.0					1																	11861250		2203	4300	6503	11783837	SO:0001583	missense	4524	exon3			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.443T>G	1.37:g.11861250A>C	ENSP00000365777:p.Leu148Arg		11783837	NM_005957	B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Missense_Mutation	SNP	ENST00000376592.1	37	CCDS137.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.126972	0.77549	.	.	ENSG00000177000	ENST00000376592;ENST00000376583;ENST00000376590;ENST00000376585	D;D;D;D	0.93133	-3.17;-3.17;-3.17;-3.17	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.95040	0.8394	M	0.64567	1.98	0.58432	D	0.999992	P;D	0.63046	0.624;0.992	B;P	0.62089	0.316;0.898	D	0.93642	0.6965	10	0.25106	T	0.35	.	14.7253	0.69341	1.0:0.0:0.0:0.0	.	148;189	P42898;Q5SNW6	MTHR_HUMAN;.	R	148;189;148;189	ENSP00000365777:L148R;ENSP00000365767:L189R;ENSP00000365775:L148R;ENSP00000365770:L189R	ENSP00000365767:L189R	L	-	2	0	MTHFR	11783837	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.773000	0.75006	2.155000	0.67459	0.448000	0.29417	CTG		0.612	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006538.1	NM_005957	
PRDM2	7799	hgsc.bcm.edu	37	1	14107190	14107190	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:14107190C>A	ENST00000235372.7	+	8	3756	c.2900C>A	c.(2899-2901)cCc>cAc	p.P967H	PRDM2_ENST00000343137.4_Missense_Mutation_p.P766H|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.P967H|PRDM2_ENST00000413440.1_Missense_Mutation_p.P766H	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	967	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P967H(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		CTCTTGATCCCCACAGATCCC	0.602																																					p.P766H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2297A	1						.						165.0	153.0	157.0					1																	14107190		2203	4300	6503	13979777	SO:0001583	missense	7799	exon3			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.2900C>A	1.37:g.14107190C>A	ENSP00000235372:p.Pro967His		13979777	NM_001007257	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	C	16.48	3.134365	0.56828	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.02369	4.41;4.32;4.32;4.32	5.97	5.97	0.96955	.	0.052674	0.85682	D	0.000000	T	0.13884	0.0336	M	0.63428	1.95	0.39426	D	0.967001	D;D;D	0.76494	0.999;0.999;0.999	P;P;D	0.67382	0.894;0.894;0.951	T	0.00019	-1.2363	10	0.72032	D	0.01	.	18.9918	0.92796	0.0:1.0:0.0:0.0	.	825;967;967	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	H	967;967;967;766;766	ENSP00000235372:P967H;ENSP00000312352:P967H;ENSP00000411103:P766H;ENSP00000341621:P766H	ENSP00000235372:P967H	P	+	2	0	PRDM2	13979777	0.902000	0.30710	0.825000	0.32803	0.716000	0.41182	5.553000	0.67287	2.837000	0.97791	0.655000	0.94253	CCC		0.602	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
TRIM45	80263	hgsc.bcm.edu	37	1	117656086	117656086	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:117656086C>T	ENST00000256649.4	-	5	2015	c.1489G>A	c.(1489-1491)Gtg>Atg	p.V497M	TRIM45_ENST00000369464.3_Missense_Mutation_p.V479M|TRIM45_ENST00000369461.3_Missense_Mutation_p.V440M	NM_025188.3	NP_079464.2	Q9H8W5	TRI45_HUMAN	tripartite motif containing 45	497					bone development (GO:0060348)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.V497M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|prostate(1)	23	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		TTTCTCCTCACCATCACAGTG	0.552																																					p.V479M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1435A	1						.						67.0	62.0	64.0					1																	117656086		2203	4300	6503	117457609	SO:0001583	missense	80263	exon5				CCDS893.1, CCDS44200.1	1p13.1	2011-04-20	2011-01-25		ENSG00000134253	ENSG00000134253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19018	protein-coding gene	gene with protein product		609318	"""tripartite motif-containing 45"""			15351693	Standard	NM_025188		Approved	FLJ13181, RNF99	uc001egz.2	Q9H8W5	OTTHUMG00000012119	ENST00000256649.4:c.1489G>A	1.37:g.117656086C>T	ENSP00000256649:p.Val497Met		117457609	NM_001145635	Q53GN0|Q5T2K4|Q5T2K5|Q8IYV6	Missense_Mutation	SNP	ENST00000256649.4	37	CCDS893.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981540	0.74474	.	.	ENSG00000134253	ENST00000256649;ENST00000369464;ENST00000369461	T;T;T	0.61859	0.94;0.07;0.94	4.96	4.96	0.65561	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.72170	0.3427	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75687	-0.3231	10	0.87932	D	0	-24.5755	17.3862	0.87416	0.0:1.0:0.0:0.0	.	479;497	Q9H8W5-2;Q9H8W5	.;TRI45_HUMAN	M	497;479;440	ENSP00000256649:V497M;ENSP00000358476:V479M;ENSP00000358473:V440M	ENSP00000256649:V497M	V	-	1	0	TRIM45	117457609	1.000000	0.71417	0.962000	0.40283	0.406000	0.30931	7.075000	0.76798	2.584000	0.87258	0.563000	0.77884	GTG		0.552	TRIM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033503.1	NM_025188	
PI4KB	5298	hgsc.bcm.edu	37	1	151262682	151262682	+	IGR	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:151262682G>A	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_Missense_Mutation_p.E1017K			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.E1017K(1)		breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGTTAATCACGAGGGCATCAA	0.582																																					p.E1017K	Colon(154;765 1838 9854 28443 37492)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3049A	1						.						95.0	83.0	87.0					1																	151262682		2203	4300	6503	149529306	SO:0001628	intergenic_variant	57592	exon7			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		1.37:g.151262682G>A			149529306	NM_020832	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	ENST00000368873.1	37		.	.	.	.	.	.	.	.	.	.	G	13.64	2.298673	0.40694	.	.	ENSG00000143373	ENST00000336715;ENST00000324048;ENST00000368879	T;T;T	0.00856	5.61;5.61;5.95	5.15	5.15	0.70609	Zinc finger, C2H2 (1);	0.000000	0.34507	U	0.003908	T	0.00384	0.0012	N	0.04090	-0.28	0.45183	D	0.998199	D;D	0.56968	0.973;0.978	B;P	0.48270	0.437;0.572	T	0.79217	-0.1894	10	0.08837	T	0.75	.	16.1557	0.81666	0.0:0.0:1.0:0.0	.	1017;1017	Q8N1G0-2;Q8N1G0	.;ZN687_HUMAN	K	1017	ENSP00000336620:E1017K;ENSP00000319829:E1017K;ENSP00000357874:E1017K	ENSP00000319829:E1017K	E	+	1	0	ZNF687	149529306	1.000000	0.71417	0.997000	0.53966	0.939000	0.58152	5.243000	0.65395	2.673000	0.90976	0.467000	0.42956	GAG		0.582	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651	
HRNR	388697	hgsc.bcm.edu	37	1	152192393	152192393	+	Missense_Mutation	SNP	C	C	T	rs375817815		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:152192393C>T	ENST00000368801.2	-	3	1787	c.1712G>A	c.(1711-1713)cGt>cAt	p.R571H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	571					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R571H(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATATGGGCCACGGCTTGAAGA	0.592																																					p.R571H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1712A	1						.	C	HIS/ARG	0,4406		0,0,2203	178.0	185.0	183.0		1712	-7.4	0.0	1		183	2,8598		0,2,4298	no	missense	HRNR	NM_001009931.1	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	571/2851	152192393	2,13004	2203	4300	6503	150459017	SO:0001583	missense	388697	exon3			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1712G>A	1.37:g.152192393C>T	ENSP00000357791:p.Arg571His		150459017	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	9.013	0.982928	0.18889	0.0	2.33E-4	ENSG00000197915	ENST00000368801	T	0.04194	3.68	3.68	-7.37	0.01412	.	.	.	.	.	T	0.00356	0.0011	N	0.08118	0	0.09310	N	1	P	0.48694	0.914	B	0.31016	0.123	T	0.51498	-0.8698	9	0.12766	T	0.61	.	1.3093	0.02094	0.4657:0.1179:0.1168:0.2996	.	571	Q86YZ3	HORN_HUMAN	H	571	ENSP00000357791:R571H	ENSP00000357791:R571H	R	-	2	0	HRNR	150459017	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-10.653000	0.00005	-1.564000	0.01678	-0.282000	0.10007	CGT		0.592	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
SLC39A1	27173	hgsc.bcm.edu	37	1	153935038	153935038	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:153935038G>A	ENST00000368623.3	-	1	913	c.154C>T	c.(154-156)Ctg>Ttg	p.L52L	SLC39A1_ENST00000368621.1_Silent_p.L52L|SLC39A1_ENST00000461071.1_5'UTR|SLC39A1_ENST00000537590.1_5'UTR|SLC39A1_ENST00000310483.6_Silent_p.L52L|SLC39A1_ENST00000356205.4_Silent_p.L52L			Q9NY26	S39A1_HUMAN	solute carrier family 39 (zinc transporter), member 1	52					cation transport (GO:0006812)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic cation transmembrane transporter activity (GO:0022890)|zinc ion transmembrane transporter activity (GO:0005385)	p.L52L(1)		kidney(2)|large_intestine(2)|lung(7)|urinary_tract(1)	12	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)	Colorectal(1306;0.019)		GGCCGGCGCAGCACACAGATG	0.632																																					p.L52L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C154T	1						.						38.0	45.0	42.0					1																	153935038		2203	4300	6503	152201662	SO:0001819	synonymous_variant	27173	exon3			BC007886	CCDS1055.1, CCDS72920.1	1q21	2013-05-22		2002-02-15	ENSG00000143570	ENSG00000143570		"""Solute carriers"""	12876	protein-coding gene	gene with protein product		604740	"""zinc/iron regulated transporter-like"""	ZIRTL		10610721, 10681536	Standard	NM_014437		Approved	ZIP1	uc031ppi.1	Q9NY26	OTTHUMG00000037158	ENST00000368623.3:c.154C>T	1.37:g.153935038G>A			152201662	NM_014437	B4DDY7|Q5T4K1|Q8N2H7|Q9BTV0|Q9UBI7|Q9Y2Z7|Q9Y380	Silent	SNP	ENST00000368623.3	37	CCDS1055.1																																																																																				0.632	SLC39A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090284.1	NM_014437	
CHRNB2	1141	hgsc.bcm.edu	37	1	154543992	154543992	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:154543992C>T	ENST00000368476.3	+	5	957	c.693C>T	c.(691-693)cgC>cgT	p.R231R		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	231					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)	p.R231R(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	TCATCATTCGCCGCAAGCCGC	0.582																																					p.R231R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C693T	1						.						310.0	238.0	263.0					1																	154543992		2203	4300	6503	152810616	SO:0001819	synonymous_variant	1141	exon5			U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.693C>T	1.37:g.154543992C>T			152810616	NM_000748	Q9UEH9	Silent	SNP	ENST00000368476.3	37	CCDS1070.1																																																																																				0.582	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748	
DCST2	127579	hgsc.bcm.edu	37	1	155005957	155005957	+	Missense_Mutation	SNP	C	C	T	rs376847671		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:155005957C>T	ENST00000368424.3	-	1	279	c.221G>A	c.(220-222)cGc>cAc	p.R74H	DCST1_ENST00000368419.2_5'Flank|DCST1_ENST00000295542.1_5'Flank|DCST2_ENST00000295536.5_Missense_Mutation_p.R74H|DCST1_ENST00000392480.1_5'Flank|DCST1_ENST00000423025.2_5'Flank	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	74						integral component of membrane (GO:0016021)		p.R74H(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TCGGACCTGGCGAGAGAATCC	0.662																																					p.R74H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G221A	1						.						50.0	48.0	48.0					1																	155005957		2203	4300	6503	153272581	SO:0001583	missense	127579	exon1			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.221G>A	1.37:g.155005957C>T	ENSP00000357409:p.Arg74His		153272581	NM_144622	Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	ENST00000368424.3	37	CCDS1082.2	.	.	.	.	.	.	.	.	.	.	C	13.76	2.333458	0.41297	.	.	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.24723	1.84;1.87	5.44	3.55	0.40652	.	0.415614	0.22338	N	0.061377	T	0.10380	0.0254	L	0.57536	1.79	0.27416	N	0.954448	B	0.11235	0.004	B	0.04013	0.001	T	0.16247	-1.0409	10	0.28530	T	0.3	-29.5281	10.1181	0.42603	0.0:0.8358:0.0:0.1642	.	74	Q5T1A1	DCST2_HUMAN	H	74	ENSP00000357409:R74H;ENSP00000295536:R74H	ENSP00000295536:R74H	R	-	2	0	DCST2	153272581	0.026000	0.19158	0.996000	0.52242	0.832000	0.47134	-0.074000	0.11450	1.309000	0.44985	-0.254000	0.11334	CGC		0.662	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090953.3	NM_144622	
SMG5	23381	hgsc.bcm.edu	37	1	156220734	156220734	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:156220734G>A	ENST00000361813.5	-	21	3026	c.2882C>T	c.(2881-2883)gCa>gTa	p.A961V	PAQR6_ENST00000492619.1_5'Flank|PAQR6_ENST00000292291.5_5'Flank|SMG5_ENST00000368267.5_Intron|PAQR6_ENST00000540423.1_5'Flank|PAQR6_ENST00000368270.1_5'Flank|PAQR6_ENST00000356983.2_5'Flank|PAQR6_ENST00000335852.1_5'Flank	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	961	PINc.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.A961V(1)		NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					CTCCTCACCTGCCCCCTGGGC	0.597																																					p.A961V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2882T	1						.						75.0	75.0	75.0					1																	156220734		2203	4300	6503	154487358	SO:0001583	missense	23381	exon21			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2882C>T	1.37:g.156220734G>A	ENSP00000355261:p.Ala961Val		154487358	NM_015327	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	ENST00000361813.5	37	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.362157	0.41902	.	.	ENSG00000198952	ENST00000361813	T	0.30448	1.53	4.34	3.42	0.39159	Nucleotide binding protein, PINc (1);	0.279426	0.35525	N	0.003157	T	0.05777	0.0151	N	0.04508	-0.205	0.80722	D	1	B	0.10296	0.003	B	0.17098	0.017	T	0.09975	-1.0650	10	0.41790	T	0.15	-0.3384	6.2033	0.20587	0.1027:0.3104:0.5868:0.0	.	961	Q9UPR3	SMG5_HUMAN	V	961	ENSP00000355261:A961V	ENSP00000355261:A961V	A	-	2	0	SMG5	154487358	0.967000	0.33354	1.000000	0.80357	0.976000	0.68499	1.530000	0.36007	2.430000	0.82344	0.655000	0.94253	GCA		0.597	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	
C1orf61	10485	hgsc.bcm.edu	37	1	156384447	156384447	+	Splice_Site	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:156384447G>A	ENST00000368243.1	-	4	286	c.170C>T	c.(169-171)gCg>gTg	p.A57V		NM_006365.1	NP_006356.1	Q13536	CROC4_HUMAN	chromosome 1 open reading frame 61	57						nucleus (GO:0005634)		p.A57V(1)		large_intestine(2)|lung(2)|skin(1)	5	Hepatocellular(266;0.158)					TTCACTCACCGCCCGGGAGCT	0.567																																					p.A57V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C170T	1						.						33.0	31.0	31.0					1																	156384447		2203	4300	6503	154651071	SO:0001630	splice_region_variant	10485	exon4				CCDS1142.1	1q22	2014-03-17			ENSG00000125462	ENSG00000125462			30780	protein-coding gene	gene with protein product	"""contingent replication of cDNA-4"", ""transcriptional activator of the c fos promoter"""					10995546, 23012322	Standard	XM_005244832		Approved	CROC4	uc001fou.1	Q13536	OTTHUMG00000031022	ENST00000368243.1:c.171+1C>T	1.37:g.156384447G>A			154651071	NM_006365	B1ALL5|B1ALL8	Missense_Mutation	SNP	ENST00000368243.1	37	CCDS1142.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.96|17.96	3.516520|3.516520	0.64634|0.64634	.|.	.|.	ENSG00000125462|ENSG00000125462	ENST00000310027;ENST00000368243;ENST00000357975|ENST00000368242	.|.	.|.	.|.	4.08|4.08	-1.18|-1.18	0.09617|0.09617	.|.	.|.	.|.	.|.	.|.	T|T	0.09158|0.09158	0.0226|0.0226	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	0.999998|0.999998	P|.	0.45428|.	0.858|.	B|.	0.32928|.	0.155|.	T|T	0.37549|0.37549	-0.9701|-0.9701	8|5	0.87932|.	D|.	0|.	-1.0455|-1.0455	7.2431|7.2431	0.26107|0.26107	0.5528:0.0:0.4472:0.0|0.5528:0.0:0.4472:0.0	.|.	57|.	Q13536|.	CROC4_HUMAN|.	V|C	71;57;70|89	.|.	ENSP00000310651:A71V|.	A|R	-|-	2|1	0|0	C1orf61|C1orf61	154651071|154651071	0.000000|0.000000	0.05858|0.05858	0.182000|0.182000	0.23118|0.23118	0.991000|0.991000	0.79684|0.79684	-1.213000|-1.213000	0.02991|0.02991	-0.097000|-0.097000	0.12307|0.12307	0.561000|0.561000	0.74099|0.74099	GCG|CGC		0.567	C1orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075988.1	NM_006365	Missense_Mutation
ARHGEF11	9826	hgsc.bcm.edu	37	1	156907269	156907269	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:156907269G>A	ENST00000361409.2	-	38	4834	c.4092C>T	c.(4090-4092)agC>agT	p.S1364S	MIR765_ENST00000390226.1_RNA|ARHGEF11_ENST00000368194.3_Silent_p.S1404S|ARHGEF11_ENST00000315174.8_Silent_p.S780S|ARHGEF11_ENST00000487682.1_5'UTR	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1364					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S1404S(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGATGGCATGCTGACATAAA	0.587																																					p.S1404S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4212T	1						.						70.0	66.0	68.0					1																	156907269		2203	4300	6503	155173893	SO:0001819	synonymous_variant	9826	exon39			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.4092C>T	1.37:g.156907269G>A			155173893	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	ENST00000361409.2	37	CCDS1162.1																																																																																				0.587	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
EPHA2	1969	hgsc.bcm.edu	37	1	16462195	16462195	+	Silent	SNP	C	C	T	rs143181899		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:16462195C>T	ENST00000358432.5	-	6	1537	c.1383G>A	c.(1381-1383)ccG>ccA	p.P461P		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	461	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P461P(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	GGCTCTGCTGCGGCGGGGGGA	0.677																																					p.P461P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1383A	1						.	C		0,4406		0,0,2203	56.0	55.0	55.0		1383	-6.9	0.0	1	dbSNP_134	55	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous	EPHA2	NM_004431.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		461/977	16462195	2,13004	2203	4300	6503	16334782	SO:0001819	synonymous_variant	1969	exon6			BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.1383G>A	1.37:g.16462195C>T			16334782	NM_004431	B5A968|Q8N3Z2	Silent	SNP	ENST00000358432.5	37	CCDS169.1																																																																																				0.677	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
NCSTN	23385	hgsc.bcm.edu	37	1	160319436	160319436	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:160319436G>A	ENST00000294785.5	+	4	537	c.412G>A	c.(412-414)Gta>Ata	p.V138I	NCSTN_ENST00000368063.1_Missense_Mutation_p.V118I|NCSTN_ENST00000368065.4_5'Flank|NCSTN_ENST00000535857.1_Missense_Mutation_p.V138I|NCSTN_ENST00000392212.4_Missense_Mutation_p.V118I	NM_015331.2	NP_056146.1	Q92542	NICA_HUMAN	nicastrin	138					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)|proteolysis (GO:0006508)|T cell proliferation (GO:0042098)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)	p.V138I(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(2)	34	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTCTCCTAGTGTACAGTGCCC	0.512																																					p.V138I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G412A	1						.						92.0	79.0	83.0					1																	160319436		2203	4300	6503	158586060	SO:0001583	missense	23385	exon4			AF240468	CCDS1203.1	1q22-q23	2014-09-17			ENSG00000162736	ENSG00000162736			17091	protein-coding gene	gene with protein product		605254				9039502, 10993067	Standard	XM_005245053		Approved	KIAA0253, APH2	uc001fvx.3	Q92542	OTTHUMG00000033110	ENST00000294785.5:c.412G>A	1.37:g.160319436G>A	ENSP00000294785:p.Val138Ile		158586060	NM_015331	Q5T207|Q5T208|Q86VV5	Missense_Mutation	SNP	ENST00000294785.5	37	CCDS1203.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.856117	0.32791	.	.	ENSG00000162736	ENST00000294785;ENST00000368063;ENST00000421914;ENST00000535857;ENST00000438008;ENST00000392212	T;T;T;T;T;T	0.76839	-1.04;-1.05;-0.02;-0.02;-0.04;-1.05	4.53	3.57	0.40892	.	0.329762	0.29900	N	0.010908	T	0.52517	0.1739	L	0.47716	1.5	0.80722	D	1	B;B;B	0.28291	0.206;0.181;0.113	B;B;B	0.28011	0.085;0.079;0.033	T	0.51364	-0.8715	10	0.18710	T	0.47	-5.9685	7.8463	0.29426	0.0:0.1742:0.6463:0.1796	.	138;118;138	F6Y097;Q92542-2;Q92542	.;.;NICA_HUMAN	I	138;118;138;138;171;118	ENSP00000294785:V138I;ENSP00000357042:V118I;ENSP00000390409:V138I;ENSP00000442605:V138I;ENSP00000389370:V171I;ENSP00000376047:V118I	ENSP00000294785:V138I	V	+	1	0	NCSTN	158586060	0.933000	0.31639	1.000000	0.80357	0.993000	0.82548	1.782000	0.38654	2.348000	0.79779	0.655000	0.94253	GTA		0.512	NCSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080622.1	NM_015331	
RCSD1	92241	hgsc.bcm.edu	37	1	167663451	167663451	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:167663451G>A	ENST00000367854.3	+	5	717	c.386G>A	c.(385-387)gGt>gAt	p.G129D	RCSD1_ENST00000537350.1_Missense_Mutation_p.G99D	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	129					cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)	p.G129D(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					AGCAGCCCTGGTGTGCGATCT	0.597																																					p.G129D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G386A	1						.						69.0	65.0	66.0					1																	167663451		2203	4300	6503	165930075	SO:0001583	missense	92241	exon5			BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.386G>A	1.37:g.167663451G>A	ENSP00000356828:p.Gly129Asp		165930075	NM_052862	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	Missense_Mutation	SNP	ENST00000367854.3	37	CCDS1263.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939898	0.73557	.	.	ENSG00000198771	ENST00000367854;ENST00000361496;ENST00000537350	T;T	0.50001	0.77;0.76	5.18	5.18	0.71444	.	0.192285	0.45606	D	0.000350	T	0.61286	0.2335	M	0.64997	1.995	0.40484	D	0.980471	D;D	0.89917	0.999;1.0	D;D	0.91635	0.968;0.999	T	0.62558	-0.6829	9	0.56958	D	0.05	-13.5714	18.0781	0.89433	0.0:0.0:1.0:0.0	.	99;129	B7ZKW8;Q6JBY9	.;CPZIP_HUMAN	D	129;105;99	ENSP00000356828:G129D;ENSP00000439409:G99D	ENSP00000355291:G105D	G	+	2	0	RCSD1	165930075	1.000000	0.71417	0.497000	0.27552	0.609000	0.37215	6.342000	0.72982	2.572000	0.86782	0.655000	0.94253	GGT		0.597	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085451.1	NM_052862	
ADCY10	55811	hgsc.bcm.edu	37	1	167814853	167814853	+	Silent	SNP	G	G	A	rs368950665		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:167814853G>A	ENST00000367851.4	-	21	3139	c.2955C>T	c.(2953-2955)aaC>aaT	p.N985N	ADCY10_ENST00000545172.1_Silent_p.N832N|ADCY10_ENST00000367848.1_Silent_p.N893N	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	985					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.N985N(1)|p.N985K(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TGTCTAAAGCGTTGAGCCGAA	0.403													G|||	1	0.000199681	0.0	0.0	5008	,	,		21211	0.0		0.0	False		,,,				2504	0.001				p.N832N												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C2496T	1						.	G	,	2,4404	4.2+/-10.8	0,2,2201	81.0	79.0	80.0		2496,2955	3.0	0.7	1		80	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ADCY10	NM_001167749.1,NM_018417.4	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	832/1458,985/1611	167814853	2,13004	2203	4300	6503	166081477	SO:0001819	synonymous_variant	55811	exon18			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.2955C>T	1.37:g.167814853G>A			166081477	NM_001167749	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	ENST00000367851.4	37	CCDS1265.1																																																																																				0.403	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
ATP1B1	481	hgsc.bcm.edu	37	1	169100586	169100586	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:169100586C>T	ENST00000367816.1	+	7	1234	c.705C>T	c.(703-705)tcC>tcT	p.S235S	ATP1B1_ENST00000367815.4_Silent_p.S235S|ATP1B1_ENST00000499679.3_Silent_p.S179S|ATP1B1_ENST00000367813.3_Silent_p.S227S			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	235	immunoglobulin-like.				blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.S235S(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					TGGGCAACTCCCCTGGTTTTC	0.453																																					p.S235S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C705T	1						.						150.0	148.0	149.0					1																	169100586		2203	4300	6503	167367210	SO:0001819	synonymous_variant	481	exon6			U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.705C>T	1.37:g.169100586C>T			167367210	NM_001677	Q5TGZ3	Silent	SNP	ENST00000367816.1	37	CCDS1276.1																																																																																				0.453	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
PADI1	29943	hgsc.bcm.edu	37	1	17566216	17566216	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:17566216A>C	ENST00000375471.4	+	14	1662	c.1570A>C	c.(1570-1572)Aaa>Caa	p.K524Q	PADI1_ENST00000460293.1_3'UTR|PADI1_ENST00000413717.2_Missense_Mutation_p.K81Q|PADI1_ENST00000536552.1_5'UTR|PADI1_ENST00000537499.1_Missense_Mutation_p.K81Q	NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	524					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.K524Q(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	ACACCAGGCAAAAAGAAGCAT	0.522																																					p.K524Q	Esophageal Squamous(80;414 1257 4580 27746 50832)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1570C	1						.						63.0	61.0	62.0					1																	17566216		2203	4300	6503	17438803	SO:0001583	missense	29943	exon14			AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.1570A>C	1.37:g.17566216A>C	ENSP00000364620:p.Lys524Gln		17438803	NM_013358	A1L4K6|Q70SX6	Missense_Mutation	SNP	ENST00000375471.4	37	CCDS178.1	.	.	.	.	.	.	.	.	.	.	A	0.170	-1.072511	0.01918	.	.	ENSG00000142623	ENST00000375471;ENST00000537499;ENST00000413717	T;T;T	0.24151	1.87;1.87;1.87	5.0	5.0	0.66597	Protein-arginine deiminase, C-terminal (1);	1.022250	0.07751	N	0.948617	T	0.24236	0.0587	L	0.37897	1.145	0.33098	D	0.538847	B;B	0.22414	0.011;0.069	B;B	0.31101	0.016;0.124	T	0.20273	-1.0280	10	0.12103	T	0.63	-12.1027	11.3643	0.49662	1.0:0.0:0.0:0.0	.	81;524	B4DPX6;Q9ULC6	.;PADI1_HUMAN	Q	524;81;81	ENSP00000364620:K524Q;ENSP00000444032:K81Q;ENSP00000396697:K81Q	ENSP00000364620:K524Q	K	+	1	0	PADI1	17438803	0.045000	0.20229	0.613000	0.29037	0.015000	0.08874	3.162000	0.50755	2.003000	0.58678	0.460000	0.39030	AAA		0.522	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006621.1	NM_013358	
PAX7	5081	hgsc.bcm.edu	37	1	19062332	19062332	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:19062332G>A	ENST00000375375.3	+	8	1960	c.1362G>A	c.(1360-1362)gtG>gtA	p.V454V	PAX7_ENST00000420770.2_Silent_p.V454V|PAX7_ENST00000400661.3_Silent_p.V452V	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	454					anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V454V(1)	PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		GCTACAGCGTGGACCCCGTGG	0.692			T	FOXO1A	alveolar rhabdomyosarcoma																																p.V452V			Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1356A	1						.						74.0	71.0	72.0					1																	19062332		2203	4299	6502	18934919	SO:0001819	synonymous_variant	5081	exon8			X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.1362G>A	1.37:g.19062332G>A			18934919	NM_013945	E9PFV9|Q0VA99|Q2PJS5	Silent	SNP	ENST00000375375.3	37	CCDS186.1																																																																																				0.692	PAX7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006928.1	NM_002584	
AKR7A2	8574	hgsc.bcm.edu	37	1	19632584	19632584	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:19632584G>A	ENST00000235835.3	-	6	867	c.846C>T	c.(844-846)gcC>gcT	p.A282A	RNU6-1099P_ENST00000363533.1_RNA	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	282					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)	p.A282A(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CGCCATATGCGGCCTGCAGGG	0.632																																					p.A282A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C846T	1						.						81.0	76.0	78.0					1																	19632584		2203	4300	6503	19505171	SO:0001819	synonymous_variant	8574	exon6			AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.846C>T	1.37:g.19632584G>A			19505171	NM_003689	O75749|Q5TG63	Silent	SNP	ENST00000235835.3	37	CCDS194.1																																																																																				0.632	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	NM_003689	
GORAB	92344	hgsc.bcm.edu	37	1	170521240	170521240	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:170521240T>C	ENST00000367763.3	+	5	842	c.822T>C	c.(820-822)acT>acC	p.T274T		NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	274	Necessary for interaction with RCHY1.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.T274T(1)		endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						AGCAACTCACTGAACACCTTT	0.443																																					p.T274T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T822C	1						.						95.0	91.0	93.0					1																	170521240		2203	4300	6503	168787864	SO:0001819	synonymous_variant	92344	exon5			AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.822T>C	1.37:g.170521240T>C			168787864	NM_152281	Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Silent	SNP	ENST00000367763.3	37	CCDS1289.1																																																																																				0.443	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085226.1	NM_152281	
ADIPOR1	51094	hgsc.bcm.edu	37	1	202911328	202911328	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:202911328C>T	ENST00000340990.5	-	7	1122	c.824G>A	c.(823-825)gGc>gAc	p.G275D	ADIPOR1_ENST00000436244.1_Missense_Mutation_p.G275D	NM_015999.4	NP_057083.2	Q96A54	ADR1_HUMAN	adiponectin receptor 1	275					adiponectin-activated signaling pathway (GO:0033211)|fatty acid oxidation (GO:0019395)|hormone-mediated signaling pathway (GO:0009755)|leptin-mediated signaling pathway (GO:0033210)|negative regulation of cell growth (GO:0030308)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of JAK-STAT cascade (GO:0046427)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)	p.G275D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(75;0.141)			GCCACTCAAGCCAAGTCCCAG	0.532																																					p.G275D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G824A	1						.						71.0	66.0	68.0					1																	202911328		2203	4300	6503	201177951	SO:0001583	missense	51094	exon8				CCDS1430.1	1q32.1	2012-08-22			ENSG00000159346	ENSG00000159346		"""GPCR / Unclassified : Adiponectin receptors"""	24040	protein-coding gene	gene with protein product		607945				12802337	Standard	XM_006711360		Approved	PAQR1, ACDCR1	uc001gyq.5	Q96A54	OTTHUMG00000041391	ENST00000340990.5:c.824G>A	1.37:g.202911328C>T	ENSP00000341785:p.Gly275Asp		201177951	NM_001127687	B3KMB0|Q53HS7|Q53YY6|Q9Y360	Missense_Mutation	SNP	ENST00000340990.5	37	CCDS1430.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.445012	0.63178	.	.	ENSG00000159346	ENST00000340990;ENST00000436244	T;T	0.43294	0.95;0.95	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.79947	0.4534	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86958	0.2090	10	0.87932	D	0	.	19.1235	0.93372	0.0:1.0:0.0:0.0	.	275	Q96A54	ADR1_HUMAN	D	275	ENSP00000341785:G275D;ENSP00000395469:G275D	ENSP00000341785:G275D	G	-	2	0	ADIPOR1	201177951	1.000000	0.71417	1.000000	0.80357	0.153000	0.21895	7.734000	0.84928	2.868000	0.98415	0.555000	0.69702	GGC		0.532	ADIPOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099160.2	NM_015999	
ADORA1	134	hgsc.bcm.edu	37	1	203134970	203134970	+	Missense_Mutation	SNP	G	G	A	rs141819948		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:203134970G>A	ENST00000367236.4	+	3	1844	c.923G>A	c.(922-924)cGc>cAc	p.R308H	ADORA1_ENST00000472535.1_3'UTR|ADORA1_ENST00000367235.1_3'UTR|ADORA1_ENST00000337894.4_Missense_Mutation_p.R308H|ADORA1_ENST00000309502.3_Missense_Mutation_p.R308H	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor	308					activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)	p.R308H(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	GACCATTTCCGCTGCCAGCCT	0.577																																					p.R308H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G923A	1						.	G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	134.0	102.0	113.0		923,923	5.4	1.0	1	dbSNP_134	113	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADORA1	NM_000674.2,NM_001048230.1	29,29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging	308/327,308/327	203134970	2,13004	2203	4300	6503	201401593	SO:0001583	missense	134	exon3			BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.923G>A	1.37:g.203134970G>A	ENSP00000356205:p.Arg308His		201401593	NM_001048230	A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	Missense_Mutation	SNP	ENST00000367236.4	37	CCDS1434.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277784	0.40294	2.27E-4	1.16E-4	ENSG00000163485	ENST00000309502;ENST00000367236;ENST00000337894	T;T;T	0.38401	1.14;1.14;1.14	5.37	5.37	0.77165	.	0.103731	0.64402	D	0.000003	T	0.36635	0.0974	L	0.36672	1.1	0.29999	N	0.816172	P;D;P	0.63046	0.954;0.992;0.674	B;P;B	0.49708	0.325;0.62;0.2	T	0.24905	-1.0147	10	0.32370	T	0.25	-37.0266	13.4232	0.61009	0.0752:0.0:0.9248:0.0	.	341;240;308	B7Z379;B7Z1L9;P30542	.;.;AA1R_HUMAN	H	308	ENSP00000308549:R308H;ENSP00000356205:R308H;ENSP00000338435:R308H	ENSP00000308549:R308H	R	+	2	0	ADORA1	201401593	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.562000	0.67346	2.505000	0.84491	0.655000	0.94253	CGC		0.577	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100273.1	NM_000674	
CHIT1	1118	hgsc.bcm.edu	37	1	203194936	203194936	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:203194936G>A	ENST00000367229.1	-	3	152	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C	CHIT1_ENST00000255427.3_Missense_Mutation_p.R40C|CHIT1_ENST00000484834.1_5'UTR|CHIT1_ENST00000535569.1_Missense_Mutation_p.R50C	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	40			R -> H (in dbSNP:rs35920428).		chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)	p.R40C(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						GGCAGGAAGCGAGCCTCCCCC	0.577																																					p.R40C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C118T	1						.						117.0	106.0	110.0					1																	203194936		2203	4300	6503	201461559	SO:0001583	missense	1118	exon3			U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.118C>T	1.37:g.203194936G>A	ENSP00000356198:p.Arg40Cys		201461559	NM_003465	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Missense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	G	13.09	2.134267	0.37630	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	T;T;T	0.05925	3.37;3.37;3.37	5.12	1.91	0.25777	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.442010	0.19058	N	0.123851	T	0.22399	0.0540	M	0.89353	3.025	0.18873	N	0.999986	D;D	0.89917	1.0;1.0	P;D	0.70487	0.828;0.969	T	0.06427	-1.0827	10	0.87932	D	0	-10.0203	3.8612	0.08996	0.0879:0.1429:0.5082:0.2611	.	50;40	G5EA51;Q13231	.;CHIT1_HUMAN	C	40;40;50	ENSP00000356198:R40C;ENSP00000255427:R40C;ENSP00000438078:R50C	ENSP00000255427:R40C	R	-	1	0	CHIT1	201461559	0.000000	0.05858	0.203000	0.23512	0.977000	0.68977	0.143000	0.16115	0.529000	0.28599	0.655000	0.94253	CGC		0.577	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465	
NUAK2	81788	hgsc.bcm.edu	37	1	205273075	205273075	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:205273075C>T	ENST00000367157.3	-	7	1516	c.1390G>A	c.(1390-1392)Gag>Aag	p.E464K		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2									p.E464K(1)		breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TCACTGGGCTCGGGAGAGGAG	0.637																																					p.E464K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1390A	1						.						29.0	28.0	28.0					1																	205273075		2203	4300	6503	203539698	SO:0001583	missense	81788	exon7			AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.1390G>A	1.37:g.205273075C>T	ENSP00000356125:p.Glu464Lys		203539698	NM_030952		Missense_Mutation	SNP	ENST00000367157.3	37	CCDS1453.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069482	0.76301	.	.	ENSG00000163545	ENST00000367157	T	0.79940	-1.32	4.78	4.78	0.61160	.	0.000000	0.45867	D	0.000329	D	0.87277	0.6137	M	0.76574	2.34	0.48341	D	0.999635	D	0.71674	0.998	P	0.58820	0.846	D	0.88606	0.3153	10	0.56958	D	0.05	.	15.567	0.76300	0.0:1.0:0.0:0.0	.	464	Q9H093	NUAK2_HUMAN	K	464	ENSP00000356125:E464K	ENSP00000356125:E464K	E	-	1	0	NUAK2	203539698	1.000000	0.71417	0.903000	0.35520	0.523000	0.34469	5.386000	0.66238	2.198000	0.70561	0.407000	0.27541	GAG		0.637	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952	
ELK4	2005	hgsc.bcm.edu	37	1	205589082	205589082	+	Intron	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:205589082C>T	ENST00000357992.4	-	3	1420				ELK4_ENST00000468523.1_5'Flank|ELK4_ENST00000289703.4_Silent_p.S364S	NM_001973.3	NP_001964.2	P28324	ELK4_HUMAN	ELK4, ETS-domain protein (SRF accessory protein 1)						cell differentiation (GO:0030154)|histone H3 deacetylation (GO:0070932)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)	p.S364S(1)	SLC45A3/ELK4(18)	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	12	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			CCATAAAGAGCGAGCAAGCTA	0.418			T	SLC45A3	prostate																																p.S364S			Dom	yes		1	1q32	2005	"""ELK4, ETS-domain protein (SRF accessory protein 1)"""		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1092A	1						.						77.0	79.0	78.0					1																	205589082		2203	4300	6503	203855705	SO:0001627	intron_variant	2005	exon3			M85165	CCDS1456.1, CCDS1457.1	1q32	2008-02-05			ENSG00000158711	ENSG00000158711			3326	protein-coding gene	gene with protein product		600246				7851904, 8575773	Standard	NM_001973		Approved	SAP1		P28324	OTTHUMG00000037221	ENST00000357992.4:c.1080+11G>A	1.37:g.205589082C>T			203855705	NM_021795	P28323|Q6GSJ2	Silent	SNP	ENST00000357992.4	37	CCDS1456.1																																																																																				0.418	ELK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090615.1	NM_021795	
SLC45A3	85414	hgsc.bcm.edu	37	1	205628523	205628523	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:205628523G>A	ENST00000367145.3	-	5	1796	c.1501C>T	c.(1501-1503)Ctg>Ttg	p.L501L	SLC45A3_ENST00000460934.1_5'UTR	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	501					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.L501L(2)	SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			ACCTGGGACAGCAGGAAGGCA	0.642			T	"""ETV1, ETV5, ELK4, ERG"""	prostate						OREG0014161	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L501L			Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C1501T	1						.						65.0	57.0	60.0					1																	205628523		2203	4300	6503	203895146	SO:0001819	synonymous_variant	85414	exon5			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.1501C>T	1.37:g.205628523G>A		2153	203895146	NM_033102	A8K2U9	Silent	SNP	ENST00000367145.3	37	CCDS1458.1																																																																																				0.642	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090619.1	NM_033102	
HHAT	55733	hgsc.bcm.edu	37	1	210637994	210637994	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:210637994G>A	ENST00000367010.1	+	8	1229	c.1002G>A	c.(1000-1002)atG>atA	p.M334I	HHAT_ENST00000308852.6_Missense_Mutation_p.M289I|HHAT_ENST00000545781.1_Missense_Mutation_p.M271I|HHAT_ENST00000367009.1_Missense_Mutation_p.M24I|HHAT_ENST00000537898.1_Missense_Mutation_p.M269I|HHAT_ENST00000541565.1_Missense_Mutation_p.M197I|HHAT_ENST00000261458.3_Missense_Mutation_p.M334I|HHAT_ENST00000413764.2_Missense_Mutation_p.M334I|HHAT_ENST00000545154.1_Missense_Mutation_p.M335I|HHAT_ENST00000391905.3_Missense_Mutation_p.M334I	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	334					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)	p.M334I(1)		breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TCACCGGGATGTGGAGGTCAG	0.622																																					p.M334I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1002A	1						.						71.0	62.0	65.0					1																	210637994		2203	4300	6503	208704617	SO:0001583	missense	55733	exon8			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.1002G>A	1.37:g.210637994G>A	ENSP00000355977:p.Met334Ile		208704617	NM_018194	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	ENST00000367010.1	37	CCDS1495.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143378	0.77888	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010;ENST00000426968;ENST00000367009	T;T;T;T;T;T;T;T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73	5.56	5.56	0.83823	.	0.038300	0.85682	D	0.000000	T	0.77498	0.4139	M	0.76574	2.34	0.58432	D	0.999999	P;P;P;D;P	0.52996	0.91;0.89;0.711;0.957;0.884	P;B;P;P;P	0.52646	0.531;0.396;0.474;0.705;0.705	T	0.80020	-0.1557	10	0.66056	D	0.02	-32.5645	11.7481	0.51832	0.0815:0.0:0.9185:0.0	.	289;335;197;269;334	B7Z2U8;F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;.;HHAT_HUMAN	I	334;197;335;269;334;271;334;289;334;206;24	ENSP00000416845:M334I;ENSP00000444995:M197I;ENSP00000438468:M335I;ENSP00000442625:M269I;ENSP00000375773:M334I;ENSP00000439229:M271I;ENSP00000261458:M334I;ENSP00000308628:M289I;ENSP00000355977:M334I;ENSP00000413399:M206I;ENSP00000355976:M24I	ENSP00000261458:M334I	M	+	3	0	HHAT	208704617	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.269000	0.78482	2.614000	0.88457	0.555000	0.69702	ATG		0.622	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088662.1	NM_018194	
TMEM206	55248	hgsc.bcm.edu	37	1	212538674	212538674	+	Silent	SNP	G	G	T	rs371543331	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:212538674G>T	ENST00000261455.4	-	8	1073	c.936C>A	c.(934-936)ggC>ggA	p.G312G	TMEM206_ENST00000535273.1_Silent_p.G373G	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	312						cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.G312G(1)		breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		CCAAGAAGGCGCCACAGAGAA	0.388																																					p.G373G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1119A	1						.						142.0	143.0	142.0					1																	212538674		2203	4300	6503	210605297	SO:0001819	synonymous_variant	55248	exon9			AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.936C>A	1.37:g.212538674G>T			210605297	NM_001198862	B7Z4D6|Q6IA87|Q9NV85	Silent	SNP	ENST00000261455.4	37	CCDS1504.1																																																																																				0.388	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1	NM_018252	
KCNK2	3776	hgsc.bcm.edu	37	1	215408305	215408305	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:215408305G>A	ENST00000444842.2	+	7	1248	c.1098G>A	c.(1096-1098)tcG>tcA	p.S366S	KCNK2_ENST00000391894.2_Silent_p.S351S|KCNK2_ENST00000391895.2_Silent_p.S362S	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	366	Required for basal channel activity. {ECO:0000250}.				G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.S351S(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	GGAAGCTCTCGGCAGAACTGG	0.552																																					p.S362S												.	.	2	Substitution - coding silent(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.G1086A	1						.						64.0	63.0	63.0					1																	215408305		2203	4300	6503	213474928	SO:0001819	synonymous_variant	3776	exon7			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.1098G>A	1.37:g.215408305G>A			213474928	NM_001017424	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Silent	SNP	ENST00000444842.2	37	CCDS41467.1																																																																																				0.552	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
ESRRG	2104	hgsc.bcm.edu	37	1	216741435	216741435	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:216741435G>A	ENST00000408911.3	-	4	748	c.595C>T	c.(595-597)Cgt>Tgt	p.R199C	ESRRG_ENST00000360012.3_Missense_Mutation_p.R176C|ESRRG_ENST00000359162.2_Missense_Mutation_p.R176C|ESRRG_ENST00000493748.1_Missense_Mutation_p.R176C|ESRRG_ENST00000361525.3_Missense_Mutation_p.R176C|ESRRG_ENST00000463665.1_Missense_Mutation_p.R137C|ESRRG_ENST00000493603.1_Missense_Mutation_p.R176C|ESRRG_ENST00000366940.2_Missense_Mutation_p.R176C|ESRRG_ENST00000391890.3_Missense_Mutation_p.R176C|ESRRG_ENST00000487276.1_Missense_Mutation_p.R176C|ESRRG_ENST00000366937.1_Missense_Mutation_p.R204C|ESRRG_ENST00000366938.2_Missense_Mutation_p.R176C|ESRRG_ENST00000361395.2_Missense_Mutation_p.R176C	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	199					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R199C(1)		endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CTGTCAAGACGCACCCCTGTG	0.507																																					p.R176C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C526T	1						.						114.0	100.0	105.0					1																	216741435		2203	4300	6503	214808058	SO:0001583	missense	2104	exon5			AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.595C>T	1.37:g.216741435G>A	ENSP00000386171:p.Arg199Cys		214808058	NM_206595	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	37	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591958	0.86953	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748;ENST00000475275	D;D;D;D;D;D;D;D;D;D;T;D;D;D	0.99207	-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;-5.56;0.43;-5.56;-5.56;-5.56	5.5	5.5	0.81552	Zinc finger, NHR/GATA-type (1);Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (1);	0.000000	0.85682	D	0.000000	D	0.99521	0.9829	M	0.89414	3.03	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;P;P	0.87578	0.998;0.901;0.893	D	0.98541	1.0632	10	0.87932	D	0	.	19.3869	0.94560	0.0:0.0:1.0:0.0	.	137;204;199	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	C	176;176;204;199;176;176;176;176;176;176;137;176;176;176;176	ENSP00000355225:R176C;ENSP00000355907:R176C;ENSP00000355904:R204C;ENSP00000386171:R199C;ENSP00000352077:R176C;ENSP00000354584:R176C;ENSP00000355905:R176C;ENSP00000353108:R176C;ENSP00000419594:R176C;ENSP00000375761:R176C;ENSP00000418629:R137C;ENSP00000419155:R176C;ENSP00000417374:R176C;ENSP00000419514:R176C	ENSP00000346386:R176C	R	-	1	0	ESRRG	214808058	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.578000	0.87016	0.650000	0.86243	CGT		0.507	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	
C1orf115	79762	hgsc.bcm.edu	37	1	220869984	220869984	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:220869984C>T	ENST00000294889.5	+	2	898	c.340C>T	c.(340-342)Cgc>Tgc	p.R114C		NM_024709.4	NP_078985.3	Q9H7X2	CA115_HUMAN	chromosome 1 open reading frame 115	114						integral component of membrane (GO:0016021)		p.R114C(1)		large_intestine(1)|lung(1)	2				GBM - Glioblastoma multiforme(131;0.0273)		CAAAGGATGCCGCTACGTGGT	0.507																																					p.R114C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C340T	1						.						111.0	111.0	111.0					1																	220869984		2203	4300	6503	218936607	SO:0001583	missense	79762	exon2			AK024208	CCDS1524.1	1q41	2008-02-05			ENSG00000162817	ENSG00000162817			25873	protein-coding gene	gene with protein product						12477932	Standard	NM_024709		Approved	FLJ14146	uc001hmp.1	Q9H7X2	OTTHUMG00000037361	ENST00000294889.5:c.340C>T	1.37:g.220869984C>T	ENSP00000294889:p.Arg114Cys		218936607	NM_024709	B3KRN3|D3DTB2	Missense_Mutation	SNP	ENST00000294889.5	37	CCDS1524.1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600104	0.66332	.	.	ENSG00000162817	ENST00000294889	.	.	.	5.05	4.14	0.48551	.	0.555019	0.14913	N	0.291108	T	0.56963	0.2021	L	0.32530	0.975	0.44816	D	0.997827	D	0.76494	0.999	P	0.59288	0.855	T	0.57289	-0.7837	9	0.87932	D	0	-8.7476	11.2743	0.49157	0.0:0.9107:0.0:0.0893	.	114	Q9H7X2	CA115_HUMAN	C	114	.	ENSP00000294889:R114C	R	+	1	0	C1orf115	218936607	1.000000	0.71417	0.908000	0.35775	0.995000	0.86356	4.555000	0.60767	1.118000	0.41863	0.555000	0.69702	CGC		0.507	C1orf115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090922.3	NM_024709	
CDC42BPA	8476	hgsc.bcm.edu	37	1	227262058	227262058	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:227262058C>T	ENST00000366769.3	-	18	3779	c.2488G>A	c.(2488-2490)Gat>Aat	p.D830N	CDC42BPA_ENST00000366764.2_Missense_Mutation_p.D830N|CDC42BPA_ENST00000488131.1_5'UTR|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.D830N|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.D830N|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.D830N|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.D830N|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.D749N	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)									p.D749N(1)|p.D830N(1)		NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				TCCTTTTCATCGCTGACCCTA	0.363																																					p.D749N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2245A	1						.						79.0	77.0	78.0					1																	227262058		2203	4300	6503	225328681	SO:0001583	missense	8476	exon17			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2488G>A	1.37:g.227262058C>T	ENSP00000355731:p.Asp830Asn		225328681	NM_014826		Missense_Mutation	SNP	ENST00000366769.3	37	CCDS1558.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.286445|5.286445	0.95517|0.95517	.|.	.|.	ENSG00000143776|ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000366762;ENST00000535525;ENST00000366765|ENST00000448940;ENST00000442054;ENST00000441725	T;T;T;T;T;T;T|.	0.46819|.	0.86;0.86;0.86;0.86;0.86;0.86;0.86|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78149|0.78149	0.4238|0.4238	M|M	0.78456|0.78456	2.415|2.415	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.91635|.	0.998;0.999;0.998;0.995;0.995|.	T|T	0.78157|0.78157	-0.2313|-0.2313	10|5	0.59425|.	D|.	0.04|.	.|.	19.2345|19.2345	0.93853|0.93853	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	830;830;749;830;830|.	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5;Q5VT25-2|.	.;.;.;.;.|.	N|Q	830;749;830;830;830;94;830;830|32;123;3	ENSP00000355731:D830N;ENSP00000355729:D749N;ENSP00000335341:D830N;ENSP00000355728:D830N;ENSP00000355726:D830N;ENSP00000443275:D830N;ENSP00000355727:D830N|.	ENSP00000335341:D830N|.	D|R	-|-	1|2	0|0	CDC42BPA|CDC42BPA	225328681|225328681	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.445000|7.445000	0.80570|0.80570	2.625000|2.625000	0.88918|0.88918	0.655000|0.655000	0.94253|0.94253	GAT|CGA		0.363	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
DFFB	1677	hgsc.bcm.edu	37	1	3782393	3782393	+	Missense_Mutation	SNP	C	C	T	rs375484294		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:3782393C>T	ENST00000378209.3	+	3	582	c.259C>T	c.(259-261)Cgc>Tgc	p.R87C	DFFB_ENST00000338895.3_Missense_Mutation_p.R87C	NM_004402.2	NP_004393.1	O76075	DFFB_HUMAN	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	87					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.R87C(1)		endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		CGACATCAGGCGCTTCCTCAG	0.607																																					p.R87C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C259T	1						.	C	CYS/ARG	0,4406		0,0,2203	53.0	51.0	52.0		259	2.6	0.2	1		52	1,8599	1.2+/-3.3	0,1,4299	no	missense	DFFB	NM_004402.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	87/339	3782393	1,13005	2203	4300	6503	3772253	SO:0001583	missense	1677	exon3				CCDS52.1, CCDS72693.1	1p36.3	2014-03-06	2002-08-29		ENSG00000169598	ENSG00000169598			2773	protein-coding gene	gene with protein product		601883				9108473, 9560346	Standard	NM_004402		Approved	CAD, CPAN, DFF-40, DFF40	uc001alc.3	O76075	OTTHUMG00000003525	ENST00000378209.3:c.259C>T	1.37:g.3782393C>T	ENSP00000367454:p.Arg87Cys		3772253	NM_004402	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000378209.3	37	CCDS52.1	.	.	.	.	.	.	.	.	.	.	C	4.924	0.171605	0.09391	0.0	1.16E-4	ENSG00000169598	ENST00000378209;ENST00000338895;ENST00000339350;ENST00000378206	T;T	0.48201	0.82;0.82	4.48	2.56	0.30785	.	0.368878	0.31673	N	0.007242	T	0.41328	0.1154	L	0.59436	1.845	0.37718	D	0.924801	D;B;P;D	0.69078	0.997;0.38;0.605;0.994	B;B;B;B	0.41813	0.367;0.017;0.065;0.367	T	0.48703	-0.9012	10	0.62326	D	0.03	-16.5891	9.0169	0.36175	0.1674:0.6711:0.1615:0.0	.	111;23;87;87	B4DZS0;Q5SR21;O76075-2;O76075	.;.;.;DFFB_HUMAN	C	87;87;23;23	ENSP00000367454:R87C;ENSP00000339524:R87C	ENSP00000339524:R87C	R	+	1	0	DFFB	3772253	0.059000	0.20769	0.191000	0.23289	0.037000	0.13140	2.421000	0.44688	0.479000	0.27511	0.462000	0.41574	CGC		0.607	DFFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009821.2	NM_001282669	
CAMTA1	23261	hgsc.bcm.edu	37	1	7723930	7723930	+	Missense_Mutation	SNP	G	G	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:7723930G>C	ENST00000303635.7	+	9	1530	c.1323G>C	c.(1321-1323)aaG>aaC	p.K441N	CAMTA1_ENST00000439411.2_Missense_Mutation_p.K441N	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K441N(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		ATGGCCACAAGTTCGCCTTTC	0.662			T	WWTR1	epitheliod hemangioendothelioma																																p.K441N			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1323C	1						.						82.0	80.0	81.0					1																	7723930		2203	4300	6503	7646517	SO:0001583	missense	23261	exon9			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.1323G>C	1.37:g.7723930G>C	ENSP00000306522:p.Lys441Asn		7646517	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	g	15.28	2.786505	0.49997	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.57907	0.37;0.37	5.02	2.09	0.27110	.	0.000000	0.85682	D	0.000000	T	0.62829	0.2460	L	0.50333	1.59	0.43381	D	0.995489	D	0.76494	0.999	D	0.78314	0.991	T	0.62789	-0.6780	10	0.72032	D	0.01	-24.4986	10.1998	0.43075	0.2833:0.0:0.7167:0.0	.	441	Q9Y6Y1	CMTA1_HUMAN	N	441	ENSP00000306522:K441N;ENSP00000402561:K441N	ENSP00000306522:K441N	K	+	3	2	CAMTA1	7646517	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	0.403000	0.20982	0.537000	0.28751	0.543000	0.68304	AAG		0.662	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
SLC2A7	155184	hgsc.bcm.edu	37	1	9070257	9070257	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:9070257C>T	ENST00000400906.1	-	9	1060	c.1061G>A	c.(1060-1062)gGc>gAc	p.G354D		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	354					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.G354D(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GATGCCGTAGCCGGCCAGCAG	0.677																																					p.G354D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1061A	1						.						16.0	14.0	14.0					1																	9070257		2064	4052	6116	8992844	SO:0001583	missense	155184	exon9			AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.1061G>A	1.37:g.9070257C>T	ENSP00000383698:p.Gly354Asp		8992844	NM_207420	A2A333	Missense_Mutation	SNP	ENST00000400906.1	37	CCDS98.2	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524778	0.64747	.	.	ENSG00000197241	ENST00000400906	D	0.85773	-2.03	4.14	4.14	0.48551	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.93468	0.7916	H	0.94658	3.565	0.49130	D	0.999751	P	0.47409	0.895	P	0.61328	0.887	D	0.94923	0.8075	10	0.87932	D	0	.	13.2456	0.60022	0.0:1.0:0.0:0.0	.	354	Q6PXP3	GTR7_HUMAN	D	354	ENSP00000383698:G354D	ENSP00000383698:G354D	G	-	2	0	SLC2A7	8992844	1.000000	0.71417	0.679000	0.29978	0.254000	0.26022	4.499000	0.60380	2.120000	0.65058	0.491000	0.48974	GGC		0.677	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127768.3	NM_207420	
RPS6KA1	6195	hgsc.bcm.edu	37	1	26881656	26881656	+	Silent	SNP	G	G	A	rs375217524		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:26881656G>A	ENST00000374168.2	+	10	925	c.771G>A	c.(769-771)acG>acA	p.T257T	RPS6KA1_ENST00000374166.4_Intron|RPS6KA1_ENST00000374162.2_Silent_p.T165T|RPS6KA1_ENST00000526792.1_Silent_p.T165T|MIR1976_ENST00000459548.1_RNA|RPS6KA1_ENST00000530003.1_Silent_p.T241T|RPS6KA1_ENST00000531382.1_Silent_p.T266T	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	257	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.T266T(1)		lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		AGATGCTGACGGGCTCCCTGC	0.592																																					p.T266T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G798A	1						.	G	,	1,4405	2.1+/-5.4	0,1,2202	96.0	89.0	92.0		798,771	-4.3	0.9	1		92	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	RPS6KA1	NM_001006665.1,NM_002953.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	266/745,257/736	26881656	1,13005	2203	4300	6503	26754243	SO:0001819	synonymous_variant	6195	exon9			BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.771G>A	1.37:g.26881656G>A			26754243	NM_001006665	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	ENST00000374168.2	37	CCDS284.1																																																																																				0.592	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	
AHDC1	27245	hgsc.bcm.edu	37	1	27878167	27878167	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:27878167G>A	ENST00000247087.5	-	5	1056	c.460C>T	c.(460-462)Cgc>Tgc	p.R154C	AHDC1_ENST00000374011.2_Missense_Mutation_p.R154C			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	154	Pro-rich.						DNA binding (GO:0003677)	p.R154C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCAGGCGGGCGGCTCAGTCGG	0.627																																					p.R154C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C460T	1						.						95.0	96.0	96.0					1																	27878167		2203	4300	6503	27750754	SO:0001583	missense	27245	exon6			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.460C>T	1.37:g.27878167G>A	ENSP00000247087:p.Arg154Cys		27750754	NM_001029882	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	ENST00000247087.5	37	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220283	0.58560	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.46063	0.88;0.88	4.35	4.35	0.52113	.	.	.	.	.	T	0.28400	0.0702	N	0.14661	0.345	0.37784	D	0.927108	D	0.76494	0.999	P	0.47251	0.542	T	0.21484	-1.0244	9	0.87932	D	0	-7.9928	5.6072	0.17387	0.103:0.0:0.6996:0.1974	.	154	Q5TGY3	AHDC1_HUMAN	C	154	ENSP00000247087:R154C;ENSP00000363123:R154C	ENSP00000247087:R154C	R	-	1	0	AHDC1	27750754	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	4.238000	0.58688	1.961000	0.56991	0.305000	0.20034	CGC		0.627	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
PTPRU	10076	hgsc.bcm.edu	37	1	29647292	29647292	+	Silent	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:29647292C>A	ENST00000345512.3	+	27	3942	c.3813C>A	c.(3811-3813)acC>acA	p.T1271T	PTPRU_ENST00000373779.3_Silent_p.T1261T|PTPRU_ENST00000356870.3_Silent_p.T1267T|PTPRU_ENST00000460170.2_Silent_p.T1267T|PTPRU_ENST00000428026.2_Silent_p.T1258T|PTPRU_ENST00000323874.8_Silent_p.T1267T	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1271	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T1271T(1)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ACGGGTGCACCTCCATCGTCA	0.637																																					p.T1271T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3813A	1						.						79.0	68.0	72.0					1																	29647292		2203	4300	6503	29519879	SO:0001819	synonymous_variant	10076	exon27			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.3813C>A	1.37:g.29647292C>A			29519879	NM_005704	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Silent	SNP	ENST00000345512.3	37	CCDS334.1																																																																																				0.637	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
PHC2	1912	hgsc.bcm.edu	37	1	33832735	33832735	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:33832735G>A	ENST00000257118.5	-	6	1011	c.958C>T	c.(958-960)Cac>Tac	p.H320Y	PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000431992.1_Missense_Mutation_p.H291Y|PHC2_ENST00000419414.2_Missense_Mutation_p.H320Y	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	320					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.H320Y(1)		autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				ATGAGGGGGTGGGCAGCCACA	0.567																																					p.H320Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C958T	1						.						72.0	75.0	74.0					1																	33832735		2202	4299	6501	33605322	SO:0001583	missense	1912	exon6			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.958C>T	1.37:g.33832735G>A	ENSP00000257118:p.His320Tyr		33605322	NM_198040	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	ENST00000257118.5	37	CCDS378.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419262	0.83559	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000419414	T;T;T	0.37058	1.68;1.22;1.59	5.88	5.88	0.94601	.	0.174159	0.51477	D	0.000082	T	0.56731	0.2005	M	0.74881	2.28	0.80722	D	1	D;D;D	0.59357	0.967;0.967;0.985	P;P;P	0.61132	0.784;0.784;0.884	T	0.52034	-0.8629	10	0.34782	T	0.22	-10.4415	15.7423	0.77910	0.0:0.0:1.0:0.0	.	320;291;320	A8KA40;B7ZLY0;Q8IXK0	.;.;PHC2_HUMAN	Y	291;320;320	ENSP00000389436:H291Y;ENSP00000257118:H320Y;ENSP00000391440:H320Y	ENSP00000257118:H320Y	H	-	1	0	PHC2	33605322	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.732000	0.84908	2.782000	0.95742	0.655000	0.94253	CAC		0.567	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
MACF1	23499	hgsc.bcm.edu	37	1	39765918	39765918	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:39765918G>A	ENST00000372915.3	+	21	2620	c.2533G>A	c.(2533-2535)Gtt>Att	p.V845I	MACF1_ENST00000361689.2_Missense_Mutation_p.V845I|MACF1_ENST00000539005.1_Missense_Mutation_p.V845I|MACF1_ENST00000317713.7_Missense_Mutation_p.V845I|MACF1_ENST00000545844.1_Missense_Mutation_p.V845I|MACF1_ENST00000567887.1_Missense_Mutation_p.V877I|MACF1_ENST00000564288.1_Missense_Mutation_p.V840I			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	845					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.V845I(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAAGAGTTCCGTTGCCAGTCT	0.418																																					p.V845I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2533A	1						.						192.0	172.0	179.0					1																	39765918		2203	4300	6503	39538505	SO:0001583	missense	23499	exon23			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.2533G>A	1.37:g.39765918G>A	ENSP00000362006:p.Val845Ile		39538505	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	G	13.40	2.226717	0.39399	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262;ENST00000372900	D;D;D;D;D;D;D	0.94092	-3.35;-3.35;-3.35;-3.35;-3.35;-3.35;-3.35	5.81	4.89	0.63831	.	.	.	.	.	D	0.90297	0.6965	L	0.45744	1.44	0.80722	D	1	B;B	0.23937	0.016;0.094	B;B	0.23574	0.014;0.047	D	0.86440	0.1766	9	0.33141	T	0.24	.	14.3003	0.66341	0.0709:0.0:0.929:0.0	.	845;810	F8W8Q1;Q9UPN3-3	.;.	I	845;845;845;845;845;803;994;1007	ENSP00000439537:V845I;ENSP00000362006:V845I;ENSP00000354573:V845I;ENSP00000313438:V845I;ENSP00000444364:V845I;ENSP00000435070:V803I;ENSP00000437059:V994I	ENSP00000313438:V845I	V	+	1	0	MACF1	39538505	1.000000	0.71417	0.982000	0.44146	0.992000	0.81027	6.708000	0.74660	2.750000	0.94351	0.655000	0.94253	GTT		0.418	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
MACF1	23499	hgsc.bcm.edu	37	1	39824847	39824847	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:39824847C>A	ENST00000372915.3	+	46	12257	c.12170C>A	c.(12169-12171)cCt>cAt	p.P4057H	MACF1_ENST00000361689.2_Missense_Mutation_p.P1990H|MACF1_ENST00000289893.4_Missense_Mutation_p.P2492H|MACF1_ENST00000539005.1_Missense_Mutation_p.P1990H|MACF1_ENST00000317713.7_Missense_Mutation_p.P1990H|MACF1_ENST00000545844.1_Missense_Mutation_p.P1990H|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000567887.1_Missense_Mutation_p.P4089H|MACF1_ENST00000564288.1_Missense_Mutation_p.P4052H			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4057					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.P2492H(1)|p.P1990H(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CACCAAGTACCTGTGGAAAAA	0.428																																					p.P1990H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5969A	1						.						74.0	72.0	73.0					1																	39824847		2203	4300	6503	39597434	SO:0001583	missense	23499	exon43			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.12170C>A	1.37:g.39824847C>A	ENSP00000362006:p.Pro4057His		39597434	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	C	19.99	3.928012	0.73327	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000007	T	0.63710	0.2534	L	0.51422	1.61	0.80722	D	1	D;D;D;P	0.63880	0.993;0.96;0.991;0.808	D;P;D;P	0.70016	0.967;0.77;0.917;0.605	T	0.62676	-0.6804	10	0.51188	T	0.08	.	17.597	0.88014	0.0:1.0:0.0:0.0	.	4057;1990;1990;1955	Q9UPN3;F8W8Q1;Q9UPN3-2;Q9UPN3-3	MACF1_HUMAN;.;.;.	H	1990;4057;1990;1990;1990;2492	ENSP00000439537:P1990H;ENSP00000362006:P4057H;ENSP00000354573:P1990H;ENSP00000313438:P1990H;ENSP00000444364:P1990H;ENSP00000289893:P2492H	ENSP00000289893:P2492H	P	+	2	0	MACF1	39597434	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.080000	0.41586	2.660000	0.90430	0.563000	0.77884	CCT		0.428	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
IPO13	9670	hgsc.bcm.edu	37	1	44426874	44426874	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:44426874C>T	ENST00000372343.3	+	14	2946	c.2284C>T	c.(2284-2286)Ccc>Tcc	p.P762S		NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	762					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P762S(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TGCCCACTTTCCCCCAATTGA	0.582																																					p.P762S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2284T	1						.						319.0	283.0	295.0					1																	44426874		2203	4300	6503	44199461	SO:0001583	missense	9670	exon14			AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.2284C>T	1.37:g.44426874C>T	ENSP00000361418:p.Pro762Ser		44199461	NM_014652	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Missense_Mutation	SNP	ENST00000372343.3	37	CCDS503.1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.610248	0.46527	.	.	ENSG00000117408	ENST00000372343	T	0.65732	-0.17	5.33	5.33	0.75918	Armadillo-like helical (1);Armadillo-type fold (1);	0.052239	0.85682	D	0.000000	T	0.41259	0.1151	N	0.05510	-0.035	0.80722	D	1	B	0.19706	0.038	B	0.19391	0.025	T	0.41161	-0.9524	10	0.02654	T	1	-17.7879	19.2213	0.93797	0.0:1.0:0.0:0.0	.	762	O94829	IPO13_HUMAN	S	762	ENSP00000361418:P762S	ENSP00000361418:P762S	P	+	1	0	IPO13	44199461	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.865000	0.69583	2.775000	0.95449	0.655000	0.94253	CCC		0.582	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022846.1	NM_014652	
ATP6V0B	533	hgsc.bcm.edu	37	1	44442280	44442280	+	Silent	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:44442280T>G	ENST00000472174.2	+	5	690	c.297T>G	c.(295-297)gcT>gcG	p.A99A	ATP6V0B_ENST00000498664.1_Silent_p.A52A|B4GALT2_ENST00000372324.1_5'Flank|B4GALT2_ENST00000434555.2_5'Flank|ATP6V0B_ENST00000532642.1_Silent_p.A99A|ATP6V0B_ENST00000236067.4_Silent_p.A52A|ATP6V0B_ENST00000471859.2_Silent_p.A146A|ATP6V0B_ENST00000472277.1_Intron	NM_004047.3	NP_004038.1	Q99437	VATO_HUMAN	ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b	99					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuole (GO:0005773)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)	p.A99A(1)		breast(2)|kidney(1)|large_intestine(3)|lung(3)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				TCTGTGAGGCTGTGGCCATCT	0.498																																					p.A99A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T297G	1						.						107.0	98.0	101.0					1																	44442280		2203	4300	6503	44214867	SO:0001819	synonymous_variant	533	exon5			BC000423	CCDS505.1, CCDS41315.1, CCDS72772.1	1p32.3	2010-04-21	2006-01-20	2002-05-10	ENSG00000117410	ENSG00000117410		"""ATPases / V-type"""	861	protein-coding gene	gene with protein product		603717	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 21kD"", ""ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c''"""	ATP6F		9653649	Standard	XM_005270944		Approved	VMA16, HATPL	uc001cld.3	Q99437	OTTHUMG00000008298	ENST00000472174.2:c.297T>G	1.37:g.44442280T>G			44214867	NM_004047	D3DPY5|Q6IB32	Silent	SNP	ENST00000472174.2	37	CCDS505.1																																																																																				0.498	ATP6V0B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022854.2	NM_004047	
MKNK1	8569	hgsc.bcm.edu	37	1	47046212	47046212	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:47046212T>C	ENST00000371946.4	-	4	387	c.224A>G	c.(223-225)tAt>tGt	p.Y75C	MKNK1_ENST00000371944.4_Missense_Mutation_p.M5V|MKNK1_ENST00000465783.1_Missense_Mutation_p.Y75C|MKNK1_ENST00000428112.2_Missense_Mutation_p.Y75C|MKNK1_ENST00000545730.1_Missense_Mutation_p.Y75C|MKNK1_ENST00000341183.5_Missense_Mutation_p.Y75C|MKNK1_ENST00000371945.4_Missense_Mutation_p.Y75C	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1	75	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Y75C(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					TTTGACGGCATACTCTTTGCC	0.423																																					p.Y75C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A224G	1						.						150.0	119.0	129.0					1																	47046212		2203	4300	6503	46818799	SO:0001583	missense	8569	exon4			AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.224A>G	1.37:g.47046212T>C	ENSP00000361014:p.Tyr75Cys		46818799	NM_198973	D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Missense_Mutation	SNP	ENST00000371946.4	37	CCDS538.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.00|19.00	3.741456|3.741456	0.69304|0.69304	.|.	.|.	ENSG00000079277|ENSG00000079277	ENST00000371944|ENST00000371946;ENST00000371945;ENST00000341183;ENST00000428112;ENST00000532783;ENST00000496619;ENST00000528237;ENST00000545730;ENST00000529170;ENST00000531769;ENST00000465783	T|T;T;T;T;T;T;T;T;T;T;T	0.58797|0.67698	0.31|2.0;2.0;2.0;2.0;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;3.22	5.49|5.49	4.32|4.32	0.51571|0.51571	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.109676	.|0.64402	.|D	.|0.000004	T|T	0.68155|0.68155	0.2970|0.2970	N|N	0.25094|0.25094	0.71|0.71	0.80722|0.80722	D|D	1|1	B;B|P;B;D;D	0.14012|0.89917	0.009;0.009|0.703;0.118;0.999;1.0	B;B|P;B;D;D	0.16289|0.80764	0.009;0.015|0.562;0.136;0.973;0.994	T|T	0.69643|0.69643	-0.5090|-0.5090	9|10	0.87932|0.54805	D|T	0|0.06	.|.	10.2048|10.2048	0.43107|0.43107	0.1481:0.0:0.0:0.8519|0.1481:0.0:0.0:0.8519	.|.	5;5|75;75;75;75	B4DQK5;Q7Z319|B4E1V9;Q9BUB5-3;Q9BUB5-2;Q9BUB5	.;.|.;.;.;MKNK1_HUMAN	V|C	5|75;75;75;75;63;75;69;75;75;75;75	ENSP00000361012:M5V|ENSP00000361014:Y75C;ENSP00000361013:Y75C;ENSP00000339573:Y75C;ENSP00000411135:Y75C;ENSP00000431837:Y63C;ENSP00000436709:Y75C;ENSP00000432665:Y69C;ENSP00000440974:Y75C;ENSP00000435163:Y75C;ENSP00000434021:Y75C;ENSP00000434834:Y75C	ENSP00000361012:M5V|ENSP00000339573:Y75C	M|Y	-|-	1|2	0|0	MKNK1|MKNK1	46818799|46818799	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.525000|2.525000	0.45598|0.45598	2.311000|2.311000	0.77944|0.77944	0.533000|0.533000	0.62120|0.62120	ATG|TAT		0.423	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021897.2	NM_003684	
SCP2	6342	hgsc.bcm.edu	37	1	53444026	53444026	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:53444026G>T	ENST00000528311.1	+	8	865	c.569G>T	c.(568-570)aGc>aTc	p.S190I	SCP2_ENST00000371513.5_Missense_Mutation_p.S227I|SCP2_ENST00000371509.4_Missense_Mutation_p.S227I|SCP2_ENST00000371514.3_Missense_Mutation_p.S271I|SCP2_ENST00000473584.1_3'UTR|SCP2_ENST00000407246.2_Missense_Mutation_p.S247I	NM_001193617.1	NP_001180546.1	Q9BX26	SYCP2_HUMAN	sterol carrier protein 2	0					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)	p.S271I(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	15						GAAGAAAAAAGCATTATTAAA	0.328																																					p.S190I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G569T	1						.						93.0	91.0	92.0					1																	53444026		2203	4300	6503	53216614	SO:0001583	missense	6342	exon8			M75884	CCDS572.1, CCDS30719.1, CCDS41338.1, CCDS44149.1, CCDS44150.1, CCDS53317.1, CCDS53318.1, CCDS53319.1	1p32	2010-08-20			ENSG00000116171	ENSG00000116171			10606	protein-coding gene	gene with protein product		184755				1703300, 1718316	Standard	NM_001007098		Approved		uc001cur.2	P22307	OTTHUMG00000008936	ENST00000528311.1:c.569G>T	1.37:g.53444026G>T	ENSP00000434132:p.Ser190Ile		53216614	NM_001193617	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000528311.1	37	CCDS53319.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.80|17.80	3.478113|3.478113	0.63849|0.63849	.|.	.|.	ENSG00000116171|ENSG00000116171	ENST00000529363|ENST00000371514;ENST00000528311;ENST00000371509;ENST00000407246;ENST00000371513	.|T;T;T;T;D	.|0.87412	.|-0.51;-0.52;-0.55;-0.51;-2.25	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94518|0.94518	0.8235|0.8235	M|M	0.88842|0.88842	2.985|2.985	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.69078	.|0.997;0.997;0.997;0.997	.|D;D;D;D	.|0.71414	.|0.973;0.963;0.942;0.95	D|D	0.95065|0.95065	0.8199|0.8199	5|10	.|0.87932	.|D	.|0	-18.247|-18.247	18.8107|18.8107	0.92057|0.92057	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|247;227;271;227	.|C9JC79;A6NM69;P22307;Q6NXF4	.|.;.;NLTP_HUMAN;.	S|I	217|271;190;227;247;227	.|ENSP00000360569:S271I;ENSP00000434132:S190I;ENSP00000360564:S227I;ENSP00000384569:S247I;ENSP00000360568:S227I	.|ENSP00000360564:S227I	A|S	+|+	1|2	0|0	SCP2|SCP2	53216614|53216614	1.000000|1.000000	0.71417|0.71417	0.114000|0.114000	0.21550|0.21550	0.332000|0.332000	0.28634|0.28634	6.752000|6.752000	0.74898|0.74898	2.761000|2.761000	0.94854|0.94854	0.650000|0.650000	0.86243|0.86243	GCA|AGC		0.328	SCP2-010	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387558.1	NM_002979	
FAM151A	338094	hgsc.bcm.edu	37	1	55075481	55075481	+	Silent	SNP	G	G	A	rs375651280		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:55075481G>A	ENST00000302250.2	-	8	1378	c.1218C>T	c.(1216-1218)ccC>ccT	p.P406P	ACOT11_ENST00000481208.1_3'UTR|ACOT11_ENST00000371316.3_Intron|FAM151A_ENST00000371304.2_Intron|ACOT11_ENST00000343744.2_3'UTR	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	406						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.P406P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						CCCAGTGTCCGGGATGTGTGG	0.617																																					p.P406P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1218T	1						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	43.0	45.0	44.0		,,1218	-8.3	0.0	1		44	0,8600		0,0,4300	no	intron,utr-3,coding-synonymous	ACOT11,FAM151A	NM_015547.3,NM_147161.3,NM_176782.2	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	,,406/586	55075481	1,13005	2203	4300	6503	54848069	SO:0001819	synonymous_variant	338094	exon8			AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.1218C>T	1.37:g.55075481G>A			54848069	NM_176782	Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Silent	SNP	ENST00000302250.2	37	CCDS594.1																																																																																				0.617	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027342.1	NM_176782	
CACHD1	57685	hgsc.bcm.edu	37	1	65130278	65130278	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:65130278G>A	ENST00000371073.2	+	15	2192	c.2192G>A	c.(2191-2193)cGt>cAt	p.R731H	CACHD1_ENST00000290039.5_Missense_Mutation_p.R680H|CACHD1_ENST00000495994.1_3'UTR			Q5VU97	CAHD1_HUMAN	cache domain containing 1	731					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)		p.R680H(1)		breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						ATTGTCCGCCGTTACATAGCA	0.458																																					p.R680H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2039A	1						.						192.0	166.0	175.0					1																	65130278		2203	4300	6503	64902866	SO:0001583	missense	57685	exon15			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.2192G>A	1.37:g.65130278G>A	ENSP00000360113:p.Arg731His		64902866	NM_020925	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	ENST00000371073.2	37		.	.	.	.	.	.	.	.	.	.	G	35	5.480951	0.96307	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.34072	1.38;1.41	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.58750	0.2144	M	0.78637	2.42	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.59600	-0.7424	10	0.66056	D	0.02	-20.8087	20.5666	0.99351	0.0:0.0:1.0:0.0	.	731	Q5VU97	CAHD1_HUMAN	H	731;680	ENSP00000360113:R731H;ENSP00000290039:R680H	ENSP00000290039:R680H	R	+	2	0	CACHD1	64902866	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.854000	0.98071	0.655000	0.94253	CGT		0.458	CACHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_020925	
FPGT-TNNI3K	100526835	hgsc.bcm.edu	37	1	74819033	74819033	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:74819033A>G	ENST00000370899.3	+	12	1356	c.1319A>G	c.(1318-1320)gAt>gGt	p.D440G	FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.D440G|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.D453G|TNNI3K_ENST00000370891.2_Missense_Mutation_p.D440G|TNNI3K_ENST00000326637.3_Missense_Mutation_p.D339G|RP11-439H8.4_ENST00000415549.2_RNA	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough									p.D339G(1)									CAAGGAAGGGATGGGCACACT	0.403																																					p.D440G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1319G	1						.						101.0	88.0	93.0					1																	74819033		2203	4300	6503	74591621	SO:0001583	missense	51086	exon12					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1319A>G	1.37:g.74819033A>G	ENSP00000359936:p.Asp440Gly		74591621	NM_001199327		Missense_Mutation	SNP	ENST00000370899.3	37		.	.	.	.	.	.	.	.	.	.	A	18.53	3.643403	0.67244	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3	4.66	3.55	0.40652	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.24661	0.0598	M	0.64080	1.96	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.87578	0.996;0.998;0.998;0.995	T	0.02167	-1.1202	10	0.72032	D	0.01	.	9.9767	0.41789	0.921:0.0:0.079:0.0	.	339;440;440;440	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	G	440;440;440;440;339	ENSP00000359936:D440G;ENSP00000359932:D440G;ENSP00000450895:D440G;ENSP00000359928:D440G;ENSP00000322251:D339G	ENSP00000322251:D339G	D	+	2	0	RP11-653A5.2;AC093158.1	74591621	1.000000	0.71417	0.993000	0.49108	0.866000	0.49608	6.660000	0.74417	0.840000	0.34995	0.533000	0.62120	GAT		0.403	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
IFI44	10561	hgsc.bcm.edu	37	1	79128549	79128549	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:79128549C>A	ENST00000370747.4	+	8	1359	c.1274C>A	c.(1273-1275)cCt>cAt	p.P425H	IFI44_ENST00000495254.1_3'UTR	NM_006417.4	NP_006408.3	Q8TCB0	IFI44_HUMAN	interferon-induced protein 44	425					response to virus (GO:0009615)	cytoplasm (GO:0005737)		p.P425H(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21						GAGGATTTGCCTTTTGAGCAA	0.458																																					p.P425H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1274A	1						.						193.0	188.0	189.0					1																	79128549		2203	4300	6503	78901137	SO:0001583	missense	10561	exon8			D28915	CCDS688.1	1p31.1	2013-03-14			ENSG00000137965	ENSG00000137965			16938	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 5"""	610468				7925411	Standard	NM_006417		Approved	MTAP44, p44, TLDC5	uc001dip.4	Q8TCB0	OTTHUMG00000009723	ENST00000370747.4:c.1274C>A	1.37:g.79128549C>A	ENSP00000359783:p.Pro425His		78901137	NM_006417	B7ZAG3|D3DQ80|Q14496	Missense_Mutation	SNP	ENST00000370747.4	37	CCDS688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.74|15.74	2.921597|2.921597	0.52653|0.52653	.|.	.|.	ENSG00000137965|ENSG00000137965	ENST00000446486|ENST00000370747	.|T	.|0.08634	.|3.07	3.52|3.52	3.52|3.52	0.40303|0.40303	.|.	.|0.437011	.|0.21521	.|N	.|0.073205	T|T	0.20659|0.20659	0.0497|0.0497	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.81914	.|0.995	T|T	0.01102|0.01102	-1.1451|-1.1451	5|10	.|0.72032	.|D	.|0.01	.|.	12.9991|12.9991	0.58666|0.58666	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|425	.|Q8TCB0	.|IFI44_HUMAN	I|H	44|425	.|ENSP00000359783:P425H	.|ENSP00000359783:P425H	L|P	+|+	1|2	0|0	IFI44|IFI44	78901137|78901137	0.225000|0.225000	0.23685|0.23685	0.996000|0.996000	0.52242|0.52242	0.708000|0.708000	0.40852|0.40852	1.675000|1.675000	0.37555|0.37555	2.232000|2.232000	0.73038|0.73038	0.514000|0.514000	0.50259|0.50259	CTT|CCT		0.458	IFI44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026825.1	NM_006417	
ZNF644	84146	hgsc.bcm.edu	37	1	91405790	91405790	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:91405790C>T	ENST00000370440.1	-	3	1338	c.1121G>A	c.(1120-1122)aGt>aAt	p.S374N	ZNF644_ENST00000337393.5_Missense_Mutation_p.S374N|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000467231.1_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S374N(1)		breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		AACAGGTGAACTCTCTTCTCC	0.383																																					p.S374N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1121A	1						.						115.0	114.0	115.0					1																	91405790		2203	4300	6503	91178378	SO:0001583	missense	84146	exon3			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.1121G>A	1.37:g.91405790C>T	ENSP00000359469:p.Ser374Asn		91178378	NM_201269	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	ENST00000370440.1	37	CCDS731.1	.	.	.	.	.	.	.	.	.	.	C	0.913	-0.718338	0.03182	.	.	ENSG00000122482	ENST00000370440;ENST00000337393	T;T	0.00571	6.5;6.5	5.58	2.69	0.31865	.	0.251636	0.47455	N	0.000224	T	0.00109	0.0003	N	0.08118	0	0.22675	N	0.998867	B	0.06786	0.001	B	0.04013	0.001	T	0.25363	-1.0134	10	0.23891	T	0.37	-4.1648	6.1079	0.20084	0.0:0.5104:0.2416:0.248	.	374	Q9H582	ZN644_HUMAN	N	374	ENSP00000359469:S374N;ENSP00000337008:S374N	ENSP00000337008:S374N	S	-	2	0	ZNF644	91178378	0.996000	0.38824	0.976000	0.42696	0.821000	0.46438	1.573000	0.36472	0.310000	0.22990	-0.136000	0.14681	AGT		0.383	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186	
CDC7	8317	hgsc.bcm.edu	37	1	91981368	91981368	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:91981368C>T	ENST00000428239.1	+	10	1374	c.1115C>T	c.(1114-1116)cCt>cTt	p.P372L	CDC7_ENST00000234626.6_Missense_Mutation_p.P372L|CDC7_ENST00000430031.2_Missense_Mutation_p.P344L	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	372	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.P372L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		CAGGTTGCCCCTAGGGCAGGT	0.383																																					p.P372L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1115T	1						.						85.0	79.0	81.0					1																	91981368		2203	4300	6503	91753956	SO:0001583	missense	8317	exon10			AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.1115C>T	1.37:g.91981368C>T	ENSP00000393139:p.Pro372Leu		91753956	NM_003503	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	37	CCDS734.1	.	.	.	.	.	.	.	.	.	.	C	32	5.134363	0.94517	.	.	ENSG00000097046	ENST00000370415;ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.65178	-0.14;-0.14;-0.14	5.84	5.84	0.93424	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70176	0.3194	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.97110	1.0;0.993;1.0	T	0.68577	-0.5372	10	0.49607	T	0.09	-8.6929	20.1346	0.98019	0.0:1.0:0.0:0.0	.	344;372;372	B7Z5H7;B2R6V2;O00311	.;.;CDC7_HUMAN	L	35;344;372;372	ENSP00000407477:P344L;ENSP00000234626:P372L;ENSP00000393139:P372L	ENSP00000234626:P372L	P	+	2	0	CDC7	91753956	1.000000	0.71417	0.907000	0.35723	0.993000	0.82548	7.516000	0.81772	2.763000	0.94921	0.557000	0.71058	CCT		0.383	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
ABCA4	24	hgsc.bcm.edu	37	1	94490571	94490571	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:94490571G>T	ENST00000370225.3	-	31	4659	c.4573C>A	c.(4573-4575)Ctg>Atg	p.L1525M		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1525			L -> P (in STGD1).		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.L1525M(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CTGTCCGTCAGGTCTTGTAGA	0.428																																					p.L1525M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4573A	1						.						131.0	124.0	126.0					1																	94490571		2203	4300	6503	94263159	SO:0001583	missense	24	exon31			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.4573C>A	1.37:g.94490571G>T	ENSP00000359245:p.Leu1525Met		94263159	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.577982	0.65878	.	.	ENSG00000198691	ENST00000546054;ENST00000370225	D	0.95622	-3.76	5.09	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.90463	0.7013	M	0.66939	2.045	0.80722	D	1	P	0.35411	0.5	B	0.32980	0.156	D	0.90423	0.4418	10	0.52906	T	0.07	.	9.9383	0.41565	0.073:0.0:0.789:0.138	.	1525	P78363	ABCA4_HUMAN	M	317;1525	ENSP00000359245:L1525M	ENSP00000359245:L1525M	L	-	1	2	ABCA4	94263159	1.000000	0.71417	0.968000	0.41197	0.937000	0.57800	4.622000	0.61240	1.375000	0.46248	0.655000	0.94253	CTG		0.428	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
TRIM17	51127	hgsc.bcm.edu	37	1	228596882	228596882	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr1:228596882C>A	ENST00000366697.2	-	5	1830	c.874G>T	c.(874-876)Ggc>Tgc	p.G292C	TRIM17_ENST00000295033.3_Missense_Mutation_p.G292C|TRIM17_ENST00000366698.2_Missense_Mutation_p.G292C|TRIM11_ENST00000284551.6_5'Flank|TRIM11_ENST00000366699.3_5'Flank|RP11-245P10.4_ENST00000436779.1_RNA|TRIM17_ENST00000456946.2_Missense_Mutation_p.G292C			Q9Y577	TRI17_HUMAN	tripartite motif containing 17	292	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein autoubiquitination (GO:0051865)	intracellular (GO:0005622)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G292C(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	10		Prostate(94;0.0724)				CCTAGAAAGCCTCTTAGCACT	0.607																																					p.G292C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G874T	1						.						130.0	130.0	130.0					1																	228596882		2203	4300	6503	226663505	SO:0001583	missense	51127	exon6			AF156271	CCDS1571.1, CCDS44327.1	1q42	2013-01-09	2011-01-25	2001-11-30	ENSG00000162931	ENSG00000162931		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13430	protein-coding gene	gene with protein product	"""ring finger protein 16"", ""RING finger protein terf"", ""testis RING finger protein"""	606123	"""tripartite motif-containing 17"""	RNF16		9792805, 10894938	Standard	NM_016102		Approved	terf, RBCC	uc001hsv.3	Q9Y577	OTTHUMG00000039974	ENST00000366697.2:c.874G>T	1.37:g.228596882C>A	ENSP00000355658:p.Gly292Cys		226663505	NM_016102	B4DVJ2|Q5VST8	Missense_Mutation	SNP	ENST00000366697.2	37	CCDS1571.1	.	.	.	.	.	.	.	.	.	.	C	6.137	0.393536	0.11638	.	.	ENSG00000162931	ENST00000366697;ENST00000366698;ENST00000295033;ENST00000456946;ENST00000479800	T;T;T;T;T	0.60797	0.16;0.16;0.16;1.35;1.16	4.72	-3.21	0.05140	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.872056	0.09797	N	0.754537	T	0.36082	0.0954	N	0.22421	0.69	0.09310	N	1	B;B	0.13145	0.007;0.006	B;B	0.14023	0.01;0.003	T	0.19976	-1.0289	10	0.48119	T	0.1	.	4.4404	0.11572	0.1876:0.2527:0.0:0.5597	.	292;292	Q9Y577-2;Q9Y577	.;TRI17_HUMAN	C	292;292;292;292;265	ENSP00000355658:G292C;ENSP00000355659:G292C;ENSP00000295033:G292C;ENSP00000403312:G292C;ENSP00000430468:G265C	ENSP00000295033:G292C	G	-	1	0	TRIM17	226663505	0.000000	0.05858	0.014000	0.15608	0.004000	0.04260	-0.666000	0.05280	-0.622000	0.05626	-0.345000	0.07892	GGC		0.607	TRIM17-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096439.2	NM_016102	
MSANTD4	84437	hgsc.bcm.edu	37	11	105880606	105880606	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:105880606G>A	ENST00000301919.4	-	3	2109	c.694C>T	c.(694-696)Cgc>Tgc	p.R232C	MSANTD4_ENST00000529805.1_5'Flank	NM_032424.1	NP_115800.1	Q8NCY6	MSD4_HUMAN	Myb/SANT-like DNA-binding domain containing 4 with coiled-coils	232						nucleus (GO:0005634)		p.R232C(1)									ATTTGTAGGCGTTCCTTTTCT	0.463																																					p.R232C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C694T	11						.						87.0	85.0	86.0					11																	105880606		2201	4299	6500	105385816	SO:0001583	missense	84437	exon3			AB058729	CCDS31663.1	11q22	2012-03-13	2012-03-13	2012-03-13	ENSG00000170903	ENSG00000170903			29383	protein-coding gene	gene with protein product			"""KIAA1826"""	KIAA1826			Standard	XM_005271697		Approved		uc001piz.3	Q8NCY6	OTTHUMG00000166240	ENST00000301919.4:c.694C>T	11.37:g.105880606G>A	ENSP00000304713:p.Arg232Cys		105385816	NM_032424	Q96JK1|Q96JZ3|Q9H2N4	Missense_Mutation	SNP	ENST00000301919.4	37	CCDS31663.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.546880	0.45383	.	.	ENSG00000170903	ENST00000301919	.	.	.	5.78	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.61400	0.2344	L	0.32530	0.975	0.53688	D	0.999979	D	0.76494	0.999	P	0.58928	0.848	T	0.66139	-0.5998	9	0.72032	D	0.01	-17.0736	13.8629	0.63571	0.0:0.0:0.6023:0.3977	.	232	Q8NCY6	K1826_HUMAN	C	232	.	ENSP00000304713:R232C	R	-	1	0	KIAA1826	105385816	1.000000	0.71417	0.347000	0.25668	0.150000	0.21749	4.580000	0.60942	1.405000	0.46838	0.491000	0.48974	CGC		0.463	MSANTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388619.1	NM_032424	
RAB39A	54734	hgsc.bcm.edu	37	11	107799430	107799430	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:107799430G>A	ENST00000320578.2	+	1	202	c.136G>A	c.(136-138)Ggc>Agc	p.G46S	SLC35F2_ENST00000429869.1_5'Flank|SLC35F2_ENST00000525071.1_5'Flank	NM_017516.1	NP_059986.1	Q14964	RB39A_HUMAN	RAB39A, member RAS oncogene family	46					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.G46S(1)									CCCCACCGTCGGCGTGGACTT	0.692																																					p.G46S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G136A	11						.						27.0	28.0	28.0					11																	107799430		2199	4298	6497	107304640	SO:0001583	missense	54734	exon1			X99962	CCDS8338.1	11q22.3	2011-11-22	2011-11-22	2011-11-22	ENSG00000179331	ENSG00000179331		"""RAB, member RAS oncogene"""	16521	protein-coding gene	gene with protein product	"""rab-related GTP-binding protein"""		"""RAB39, member RAS oncogene family"""	RAB39		9119394	Standard	NM_017516		Approved		uc001pjt.3	Q14964	OTTHUMG00000166367	ENST00000320578.2:c.136G>A	11.37:g.107799430G>A	ENSP00000322594:p.Gly46Ser		107304640	NM_017516	A8KAA4|Q8N6W2	Missense_Mutation	SNP	ENST00000320578.2	37	CCDS8338.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005184	0.93287	.	.	ENSG00000179331	ENST00000320578	D	0.83163	-1.69	4.61	4.61	0.57282	Small GTP-binding protein domain (1);	0.000000	0.51477	D	0.000094	D	0.88455	0.6441	M	0.92268	3.29	0.80722	D	1	B	0.22414	0.069	B	0.31495	0.131	D	0.88777	0.3268	10	0.87932	D	0	.	16.7242	0.85417	0.0:0.0:1.0:0.0	.	46	Q14964	RB39A_HUMAN	S	46	ENSP00000322594:G46S	ENSP00000322594:G46S	G	+	1	0	RAB39	107304640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.548000	0.85928	0.555000	0.69702	GGC		0.692	RAB39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389423.1	NM_017516	
BACE1	23621	hgsc.bcm.edu	37	11	117161700	117161700	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:117161700G>A	ENST00000313005.6	-	7	1468	c.1008C>T	c.(1006-1008)acC>acT	p.T336T	BACE1_ENST00000513780.1_Silent_p.T311T|BACE1_ENST00000445823.2_Silent_p.T292T|BACE1_ENST00000428381.2_Silent_p.T267T|BACE1_ENST00000392937.6_Silent_p.T236T|BACE1_ENST00000514464.1_5'Flank|BACE1_ENST00000528053.1_Silent_p.T302T|BACE1_ENST00000510630.1_Silent_p.T211T	NM_012104.4|NM_138971.3|NM_138972.3|NM_138973.3	NP_036236|NP_620427.1|NP_620428.1|NP_620429.1	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1	336					beta-amyloid metabolic process (GO:0050435)|membrane protein ectodomain proteolysis (GO:0006509)|proteolysis (GO:0006508)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	aspartic-type endopeptidase activity (GO:0004190)|beta-amyloid binding (GO:0001540)|beta-aspartyl-peptidase activity (GO:0008798)|enzyme binding (GO:0019899)	p.T336T(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)		TGTTCCAAGGGGTGGTGCCTG	0.527																																					p.T267T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C801T	11						.						171.0	154.0	160.0					11																	117161700		2201	4296	6497	116666910	SO:0001819	synonymous_variant	23621	exon7			AF190725	CCDS8383.1, CCDS44739.1, CCDS44740.1, CCDS44741.1, CCDS55787.1, CCDS55786.1	11q23-q24	2011-07-27	2004-04-02	2004-04-02	ENSG00000186318	ENSG00000186318			933	protein-coding gene	gene with protein product		604252	"""beta-site APP-cleaving enzyme"""	BACE		10531052	Standard	NM_012104		Approved		uc001pqz.3	P56817	OTTHUMG00000160636	ENST00000313005.6:c.1008C>T	11.37:g.117161700G>A			116666910	NM_138973	A0M8W7|B0YIU9|E9PE65|H7BXJ9|Q9BYB9|Q9BYC0|Q9BYC1|Q9UJT5|Q9ULS1	Silent	SNP	ENST00000313005.6	37	CCDS8383.1																																																																																				0.527	BACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361505.1		
KMT2A	4297	hgsc.bcm.edu	37	11	118374585	118374585	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:118374585G>T	ENST00000389506.5	+	27	7969	c.7969G>T	c.(7969-7971)Ggc>Tgc	p.G2657C	KMT2A_ENST00000534358.1_Missense_Mutation_p.G2660C|KMT2A_ENST00000354520.4_Missense_Mutation_p.G2619C			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2657					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.G2657C(1)									GAAGAAGCGAGGCAAGAGATC	0.443																																					p.G2657C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7969T	11						.						87.0	77.0	81.0					11																	118374585		2200	4296	6496	117879795	SO:0001583	missense	4297	exon27			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.7969G>T	11.37:g.118374585G>T	ENSP00000374157:p.Gly2657Cys		117879795	NM_005933	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840386	0.32513	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.92545	-3.06;-3.06;-2.99	5.95	5.04	0.67666	.	0.052133	0.85682	D	0.000000	D	0.92107	0.7498	L	0.38175	1.15	0.52501	D	0.999954	D;D	0.59767	0.986;0.986	P;P	0.53722	0.733;0.733	D	0.92970	0.6397	10	0.72032	D	0.01	.	17.3158	0.87224	0.0:0.1251:0.8749:0.0	.	2660;2657	E9PQG7;Q03164	.;MLL1_HUMAN	C	2660;2657;2619;1567	ENSP00000436786:G2660C;ENSP00000374157:G2657C;ENSP00000346516:G2619C	ENSP00000346516:G2619C	G	+	1	0	MLL	117879795	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	1.516000	0.48900	0.655000	0.94253	GGC		0.443	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
USP2	9099	hgsc.bcm.edu	37	11	119227939	119227939	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:119227939C>T	ENST00000260187.2	-	12	1982	c.1688G>A	c.(1687-1689)cGc>cAc	p.R563H	USP2_ENST00000525735.1_Missense_Mutation_p.R354H|USP2_ENST00000455332.2_Missense_Mutation_p.R320H	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	563	USP.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R563H(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		CCCTGGACTGCGACAGTAGGC	0.602																																					p.R354H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1061A	11						.						99.0	88.0	92.0					11																	119227939		2199	4295	6494	118733149	SO:0001583	missense	9099	exon11			AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.1688G>A	11.37:g.119227939C>T	ENSP00000260187:p.Arg563His		118733149	NM_171997	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Missense_Mutation	SNP	ENST00000260187.2	37	CCDS8422.1	.	.	.	.	.	.	.	.	.	.	C	33	5.255424	0.95336	.	.	ENSG00000036672	ENST00000455332;ENST00000260187;ENST00000392808;ENST00000525735	T;T;T	0.03496	3.91;3.91;3.91	5.63	5.63	0.86233	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.123550	0.52532	D	0.000076	T	0.17365	0.0417	M	0.87827	2.91	0.43476	D	0.995691	D;D;P	0.71674	0.998;0.978;0.734	P;P;B	0.62435	0.902;0.558;0.099	T	0.00068	-1.2140	10	0.72032	D	0.01	-3.5939	10.2739	0.43499	0.0:0.8492:0.0:0.1508	.	320;563;354	E9PPM2;O75604;O75604-4	.;UBP2_HUMAN;.	H	320;563;310;354	ENSP00000407842:R320H;ENSP00000260187:R563H;ENSP00000436952:R354H	ENSP00000260187:R563H	R	-	2	0	USP2	118733149	0.980000	0.34600	1.000000	0.80357	0.963000	0.63663	1.445000	0.35079	2.639000	0.89480	0.643000	0.83706	CGC		0.602	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	NM_171997	
HSPA8	3312	hgsc.bcm.edu	37	11	122931912	122931912	+	Missense_Mutation	SNP	A	A	G	rs75739900		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:122931912A>G	ENST00000532636.1	-	2	240	c.121T>C	c.(121-123)Tat>Cat	p.Y41H	HSPA8_ENST00000534624.1_Missense_Mutation_p.Y41H|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000453788.2_Missense_Mutation_p.Y41H|HSPA8_ENST00000533540.1_Missense_Mutation_p.Y41H|HSPA8_ENST00000534319.1_5'Flank|HSPA8_ENST00000526110.1_Missense_Mutation_p.Y41H|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000526862.1_5'Flank|HSPA8_ENST00000227378.3_Missense_Mutation_p.Y41H			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	41					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AAGGCGACATAGCTTGGAGTG	0.463																																					p.Y41H	Colon(21;486 594 5900 6733 14272)											.	.	0			c.T121C	11						.						99.0	82.0	87.0					11																	122931912		2202	4299	6501	122437122	SO:0001583	missense	3312	exon2			Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.121T>C	11.37:g.122931912A>G	ENSP00000437125:p.Tyr41His		122437122	NM_153201	Q9H3R6	Missense_Mutation	SNP	ENST00000532636.1	37	CCDS8440.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.483750	0.84854	.	.	ENSG00000109971	ENST00000532636;ENST00000533540;ENST00000534624;ENST00000453788;ENST00000227378;ENST00000526110;ENST00000525463;ENST00000525624;ENST00000534567;ENST00000527387;ENST00000532182;ENST00000524590;ENST00000530391	T;T;T;T;T;T;T;T;T;T;T;T;T	0.03951	5.39;5.39;5.39;5.39;5.39;5.39;3.75;5.39;5.39;5.39;5.39;5.39;5.39	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.35335	0.0928	H	0.98218	4.175	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0	D;D;D;D;D	0.91635	0.993;0.999;0.997;0.995;0.998	T	0.58831	-0.7567	10	0.87932	D	0	-22.5338	13.9807	0.64304	1.0:0.0:0.0:0.0	.	41;41;41;41;41	B4DTX2;Q53GZ6;E7ET08;P11142-2;P11142	.;.;.;.;HSP7C_HUMAN	H	41	ENSP00000437125:Y41H;ENSP00000437189:Y41H;ENSP00000432083:Y41H;ENSP00000404372:Y41H;ENSP00000227378:Y41H;ENSP00000433584:Y41H;ENSP00000436762:Y41H;ENSP00000435154:Y41H;ENSP00000431641:Y41H;ENSP00000436183:Y41H;ENSP00000434415:Y41H;ENSP00000434565:Y41H;ENSP00000434851:Y41H	ENSP00000227378:Y41H	Y	-	1	0	HSPA8	122437122	1.000000	0.71417	0.995000	0.50966	0.781000	0.44180	9.337000	0.96545	1.748000	0.51833	0.397000	0.26171	TAT		0.463	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387515.1		
ROBO4	54538	hgsc.bcm.edu	37	11	124766903	124766903	+	Silent	SNP	G	G	A	rs143490922		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:124766903G>A	ENST00000306534.3	-	2	810	c.325C>T	c.(325-327)Ctg>Ttg	p.L109L	ROBO4_ENST00000526899.1_5'UTR|ROBO4_ENST00000533054.1_5'UTR	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	109	Ig-like C2-type 1.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.L109L(1)		NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		TAGACACCCAGGTCTGTGGAC	0.672																																					p.L109L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C325T	11						.	G		0,4402		0,0,2201	43.0	44.0	44.0		325	2.9	0.4	11	dbSNP_134	44	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	ROBO4	NM_019055.5		0,1,6499	AA,AG,GG		0.0116,0.0,0.0077		109/1008	124766903	1,12999	2201	4299	6500	124272113	SO:0001819	synonymous_variant	54538	exon2			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.325C>T	11.37:g.124766903G>A			124272113	NM_019055	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	ENST00000306534.3	37	CCDS8455.1																																																																																				0.672	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055	
ODF3	113746	hgsc.bcm.edu	37	11	197383	197383	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:197383G>T	ENST00000325113.4	+	2	396	c.79G>T	c.(79-81)Gga>Tga	p.G27*	BET1L_ENST00000410108.1_Intron|ODF3_ENST00000342593.5_Nonsense_Mutation_p.G27*|ODF3_ENST00000525282.1_Nonsense_Mutation_p.G27*	NM_053280.3	NP_444510.2	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	27					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	outer dense fiber (GO:0001520)		p.G27*(1)		biliary_tract(1)|breast(1)|kidney(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)	9		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CAGCAGCCCTGGACCCAAGTA	0.637																																					p.G27X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G79T	11						.						43.0	36.0	39.0					11																	197383		2200	4292	6492	187383	SO:0001587	stop_gained	113746	exon2			AB067774	CCDS7688.1, CCDS65981.1	11p15.5	2010-04-23			ENSG00000177947	ENSG00000177947			19905	protein-coding gene	gene with protein product	"""cancer/testis antigen 135"""	608356				11870087	Standard	NM_001286136		Approved	SHIPPO1, hSHIPPO, CT135	uc001lob.3	Q96PU9	OTTHUMG00000119073	ENST00000325113.4:c.79G>T	11.37:g.197383G>T	ENSP00000325868:p.Gly27*		187383	NM_053280	B7ZLT0|Q69YX0	Nonsense_Mutation	SNP	ENST00000325113.4	37	CCDS7688.1	.	.	.	.	.	.	.	.	.	.	G	38	6.640804	0.97726	.	.	ENSG00000177947	ENST00000325113;ENST00000540150;ENST00000342593;ENST00000525282	.	.	.	5.02	4.1	0.47936	.	0.000000	0.47093	D	0.000243	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.4156	13.5949	0.61984	0.0:0.1571:0.8429:0.0	.	.	.	.	X	27	.	ENSP00000325868:G27X	G	+	1	0	ODF3	187383	1.000000	0.71417	0.997000	0.53966	0.902000	0.53008	3.772000	0.55325	1.238000	0.43771	-0.304000	0.09214	GGA		0.637	ODF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239287.1		
B4GALNT4	338707	hgsc.bcm.edu	37	11	380881	380881	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:380881C>T	ENST00000329962.6	+	19	2926	c.2926C>T	c.(2926-2928)Cgg>Tgg	p.R976W		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	976					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)	p.R976W(1)		endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGACTTTGACCGGGTTGGAGG	0.607																																					p.R976W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2926T	11						.						76.0	74.0	74.0					11																	380881		2203	4300	6503	370881	SO:0001583	missense	338707	exon19			AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.2926C>T	11.37:g.380881C>T	ENSP00000328277:p.Arg976Trp		370881	NM_178537	Q96LV2	Missense_Mutation	SNP	ENST00000329962.6	37	CCDS7694.1	.	.	.	.	.	.	.	.	.	.	c	18.02	3.529476	0.64860	.	.	ENSG00000182272	ENST00000329962	T	0.37058	1.22	3.76	2.83	0.33086	.	0.060791	0.64402	D	0.000009	T	0.54431	0.1858	M	0.79805	2.47	0.33147	D	0.54512	D	0.63880	0.993	P	0.59012	0.85	T	0.70077	-0.4971	10	0.87932	D	0	-25.7692	11.1455	0.48428	0.332:0.668:0.0:0.0	.	976	Q76KP1	B4GN4_HUMAN	W	976	ENSP00000328277:R976W	ENSP00000328277:R976W	R	+	1	2	B4GALNT4	370881	0.995000	0.38212	0.189000	0.23252	0.897000	0.52465	1.953000	0.40352	0.895000	0.36342	0.561000	0.74099	CGG		0.607	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239289.2	NM_178537	
NLRP14	338323	hgsc.bcm.edu	37	11	7063773	7063773	+	Silent	SNP	C	C	T	rs374770509	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:7063773C>T	ENST00000299481.4	+	4	862	c.516C>T	c.(514-516)acC>acT	p.T172T		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	172					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)	p.T172T(2)		breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		ATGTCAAAACCGGTGCACAGC	0.473													C|||	2	0.000399361	0.0	0.0	5008	,	,		16707	0.0		0.0	False		,,,				2504	0.002				p.T172T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C516T	11						.						100.0	104.0	103.0					11																	7063773		2201	4296	6497	7020349	SO:0001819	synonymous_variant	338323	exon4			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.516C>T	11.37:g.7063773C>T			7020349	NM_176822	Q7RTR6	Silent	SNP	ENST00000299481.4	37	CCDS7776.1																																																																																				0.473	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	
DENND5A	23258	hgsc.bcm.edu	37	11	9225689	9225689	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:9225689A>G	ENST00000328194.3	-	4	787	c.467T>C	c.(466-468)aTg>aCg	p.M156T	DENND5A_ENST00000530044.1_Missense_Mutation_p.M156T	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	156					positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.M156T(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AGCATTGTGCATGTGGTAGAG	0.512																																					p.M156T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T467C	11						.						186.0	139.0	155.0					11																	9225689		2201	4296	6497	9182265	SO:0001583	missense	23258	exon4			AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.467T>C	11.37:g.9225689A>G	ENSP00000328524:p.Met156Thr		9182265	NM_015213	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	ENST00000328194.3	37	CCDS31423.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.109544	0.77096	.	.	ENSG00000184014	ENST00000328194;ENST00000530044	T;T	0.04454	3.64;3.62	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.22742	0.0549	M	0.79258	2.445	0.80722	D	1	D;D	0.71674	0.969;0.998	P;D	0.79108	0.695;0.992	T	0.00283	-1.1849	10	0.54805	T	0.06	.	16.1708	0.81812	1.0:0.0:0.0:0.0	.	156;156	E9PS91;Q6IQ26	.;DEN5A_HUMAN	T	156	ENSP00000328524:M156T;ENSP00000435866:M156T	ENSP00000328524:M156T	M	-	2	0	DENND5A	9182265	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.225000	0.72522	0.533000	0.62120	ATG		0.512	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
CYP2R1	120227	hgsc.bcm.edu	37	11	14901721	14901721	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:14901721A>G	ENST00000334636.5	-	3	1007	c.961T>C	c.(961-963)Tgg>Cgg	p.W321R	CYP2R1_ENST00000526489.1_5'UTR|CYP2R1_ENST00000532378.1_Missense_Mutation_p.W88R	NM_024514.4	NP_078790.2	Q6VVX0	CP2R1_HUMAN	cytochrome P450, family 2, subfamily R, polypeptide 1	321					small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|vitamin D3 25-hydroxylase activity (GO:0030343)	p.W321R(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14					Cholecalciferol(DB00169)|Ergocalciferol(DB00153)	AGAATCGCCCACCGTAGCACA	0.393																																					p.W321R	NSCLC(173;1584 2058 26117 29365 41534)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T961C	11						.						67.0	64.0	65.0					11																	14901721		2200	4293	6493	14858297	SO:0001583	missense	120227	exon3			AY323817	CCDS7818.1	11p15.2	2008-02-05			ENSG00000186104	ENSG00000186104		"""Cytochrome P450s"""	20580	protein-coding gene	gene with protein product		608713				12464240, 12867411	Standard	XM_005252788		Approved		uc001mlr.3	Q6VVX0	OTTHUMG00000165900	ENST00000334636.5:c.961T>C	11.37:g.14901721A>G	ENSP00000334592:p.Trp321Arg		14858297	NM_024514	Q2M3H3|Q5RT65	Missense_Mutation	SNP	ENST00000334636.5	37	CCDS7818.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.151351	0.78001	.	.	ENSG00000186104	ENST00000532378;ENST00000334636	T;T	0.73575	-0.76;-0.76	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.90597	0.7052	H	0.95402	3.665	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93103	0.6510	10	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	206;321;88	E9PS56;Q6VVX0;E9PJT9	.;CP2R1_HUMAN;.	R	88;321	ENSP00000435484:W88R;ENSP00000334592:W321R	ENSP00000334592:W321R	W	-	1	0	CYP2R1	14858297	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	TGG		0.393	CYP2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386985.1	NM_024514	
KCNC1	3746	hgsc.bcm.edu	37	11	17793358	17793358	+	Silent	SNP	C	C	T	rs143670270		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:17793358C>T	ENST00000379472.3	+	2	747	c.717C>T	c.(715-717)gcC>gcT	p.A239A	KCNC1_ENST00000265969.6_Silent_p.A239A	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	239					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)	p.A239A(1)		breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	ACCGGGAGGCCGAGACGGAGG	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22073	0.0		0.0	False		,,,				2504	0.0				p.A239A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C717T	11						.	C	,	9,4391	15.5+/-35.6	0,9,2191	262.0	216.0	232.0		717,717	-8.2	0.7	11	dbSNP_134	232	0,8586		0,0,4293	no	coding-synonymous,coding-synonymous	KCNC1	NM_001112741.1,NM_004976.4	,	0,9,6484	TT,TC,CC		0.0,0.2045,0.0693	,	239/586,239/512	17793358	9,12977	2200	4293	6493	17749934	SO:0001819	synonymous_variant	3746	exon2			M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.717C>T	11.37:g.17793358C>T			17749934	NM_004976	K4DI87	Silent	SNP	ENST00000379472.3	37	CCDS7827.1																																																																																				0.577	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	NM_004976	
ANO5	203859	hgsc.bcm.edu	37	11	22297693	22297693	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:22297693T>C	ENST00000324559.8	+	21	2785	c.2468T>C	c.(2467-2469)aTg>aCg	p.M823T	ANO5_ENST00000532043.1_3'UTR	NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	823					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)	p.M823T(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TTTCATAATATGCAATTCTGG	0.328																																					p.M822T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2465C	11						.						103.0	92.0	96.0					11																	22297693		2203	4298	6501	22254269	SO:0001583	missense	203859	exon21			AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.2468T>C	11.37:g.22297693T>C	ENSP00000315371:p.Met823Thr		22254269	NM_001142649		Missense_Mutation	SNP	ENST00000324559.8	37	CCDS31444.1	.	.	.	.	.	.	.	.	.	.	T	17.44	3.389538	0.61956	.	.	ENSG00000171714	ENST00000324559	T	0.70282	-0.47	4.96	2.45	0.29901	.	0.178764	0.64402	D	0.000001	T	0.72317	0.3445	L	0.57536	1.79	0.51767	D	0.999933	P	0.50272	0.933	P	0.55785	0.784	T	0.66027	-0.6025	10	0.15499	T	0.54	.	9.9137	0.41421	0.2724:0.0:0.0:0.7276	.	823	Q75V66	ANO5_HUMAN	T	823	ENSP00000315371:M823T	ENSP00000315371:M823T	M	+	2	0	ANO5	22254269	1.000000	0.71417	0.683000	0.30040	0.918000	0.54935	5.033000	0.64146	0.257000	0.21650	0.454000	0.30748	ATG		0.328	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387615.1	NM_213599	
GAS2	2620	hgsc.bcm.edu	37	11	22696538	22696538	+	Silent	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:22696538C>A	ENST00000454584.2	+	2	428	c.123C>A	c.(121-123)gcC>gcA	p.A41A	GAS2_ENST00000533092.1_3'UTR|GAS2_ENST00000278187.3_Silent_p.A41A|GAS2_ENST00000433790.1_Silent_p.A41A	NM_001143830.1	NP_001137302.1	O43903	GAS2_HUMAN	growth arrest-specific 2	41	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|regulation of cell shape (GO:0008360)	actin filament (GO:0005884)|cytosol (GO:0005829)|membrane (GO:0016020)		p.A41A(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(4)|stomach(1)	24						AAGATCTGGCCTTGTGGTTAA	0.413																																					p.A41A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C123A	11						.						92.0	90.0	91.0					11																	22696538		2203	4300	6503	22653114	SO:0001819	synonymous_variant	2620	exon2			BC040470	CCDS7858.1	11p14.3	2005-10-11			ENSG00000148935	ENSG00000148935			4167	protein-coding gene	gene with protein product		602835				9521882	Standard	NM_005256		Approved		uc001mqo.3	O43903	OTTHUMG00000166071	ENST00000454584.2:c.123C>A	11.37:g.22696538C>A			22653114	NM_001143830	B2R9C8|D3DQZ0|Q6ICV8|Q7Z3X8	Silent	SNP	ENST00000454584.2	37	CCDS7858.1																																																																																				0.413	GAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387717.1	NM_177553	
MUC15	143662	hgsc.bcm.edu	37	11	26584787	26584787	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:26584787G>A	ENST00000455601.2	-	3	838	c.720C>T	c.(718-720)ttC>ttT	p.F240F	ANO3_ENST00000531568.1_Intron|ANO3_ENST00000256737.3_Intron|ANO3_ENST00000525139.1_Intron|ANO3_ENST00000537978.1_Intron|MUC15_ENST00000436318.2_Silent_p.F267F|MUC15_ENST00000527569.1_Intron|MUC15_ENST00000281268.8_Intron|MUC15_ENST00000529533.1_Silent_p.F267F	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	240					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F240F(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						AAATGGCCCCGAATACTATTC	0.363																																					p.F240F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C720T	11						.						90.0	95.0	93.0					11																	26584787		2203	4300	6503	26541363	SO:0001819	synonymous_variant	143662	exon3			AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.720C>T	11.37:g.26584787G>A			26541363	NM_145650	B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Silent	SNP	ENST00000455601.2	37	CCDS7859.1																																																																																				0.363	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387866.1	NM_145650	
WT1	7490	hgsc.bcm.edu	37	11	32413565	32413565	+	Missense_Mutation	SNP	C	C	T	rs121907903		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:32413565C>T	ENST00000379079.2	-	9	1022	c.749G>A	c.(748-750)cGg>cAg	p.R250Q	WT1_ENST00000448076.3_Missense_Mutation_p.R462Q|WT1_ENST00000332351.3_Missense_Mutation_p.R462Q|WT1_ENST00000530998.1_Missense_Mutation_p.R233Q	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	394					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R394Q(6)|p.R394P(6)|p.R250L(1)|p.V380_S410del(1)|p.R394L(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			GTGGTCGGACCGGGAGAACTT	0.433			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.R250Q		yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	WT1,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15	Substitution - Missense(14)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(12)|lung(2)|large_intestine(1)	c.G749A	11	GRCh37	CM041493|CM920718|CM982050	WT1	M	rs121907903	.						192.0	188.0	190.0					11																	32413565		2202	4299	6501	32370141	SO:0001583	missense	7490	exon9	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.749G>A	11.37:g.32413565C>T	ENSP00000368370:p.Arg250Gln		32370141	NM_001198551	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	ENST00000379079.2	37	CCDS55751.1	.	.	.	.	.	.	.	.	.	.	C	36	5.955295	0.97145	.	.	ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076	T;T;T;T;T	0.60672	3.19;0.17;0.17;3.19;3.19	6.04	6.04	0.98038	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000011	T	0.66992	0.2846	L	0.28054	0.825	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.997;0.999;0.998;0.998;0.998	T	0.61422	-0.7066	10	0.29301	T	0.29	.	20.5792	0.99380	0.0:1.0:0.0:0.0	.	450;394;467;233;250	P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.;WT1_HUMAN;.;.;.	Q	250;462;233;445;462	ENSP00000368370:R250Q;ENSP00000331327:R462Q;ENSP00000435307:R233Q;ENSP00000415516:R445Q;ENSP00000413452:R462Q	ENSP00000331327:R462Q	R	-	2	0	WT1	32370141	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.794000	0.85869	2.873000	0.98535	0.561000	0.74099	CGG		0.433	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378	
CAPRIN1	4076	hgsc.bcm.edu	37	11	34101276	34101276	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:34101276T>C	ENST00000341394.4	+	7	979	c.790T>C	c.(790-792)Tca>Cca	p.S264P	CAPRIN1_ENST00000530820.1_Missense_Mutation_p.S264P|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.S264P|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.S183P|CAPRIN1_ENST00000389645.3_Missense_Mutation_p.S264P	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	264					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S264P(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				AGAGGCAGCCTCAGCACCTGC	0.428																																					p.S264P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T790C	11						.						92.0	83.0	86.0					11																	34101276		2202	4298	6500	34057852	SO:0001583	missense	4076	exon7			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.790T>C	11.37:g.34101276T>C	ENSP00000340329:p.Ser264Pro		34057852	NM_203364	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	ENST00000341394.4	37	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	T	8.001	0.755492	0.15846	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.66	3.28	0.37604	.	0.567395	0.18763	N	0.131823	T	0.08447	0.0210	N	0.00926	-1.1	0.29082	N	0.882611	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.07751	-1.0756	10	0.35671	T	0.21	-6.0354	2.6226	0.04920	0.0:0.2241:0.2619:0.514	.	264;264	Q14444;Q14444-2	CAPR1_HUMAN;.	P	264;264;264;264;183	ENSP00000340329:S264P;ENSP00000374296:S264P;ENSP00000434150:S264P;ENSP00000434204:S264P;ENSP00000431581:S183P	ENSP00000340329:S264P	S	+	1	0	CAPRIN1	34057852	0.979000	0.34478	0.982000	0.44146	0.043000	0.13939	2.827000	0.48112	2.280000	0.76307	0.519000	0.50382	TCA		0.428	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
CAT	847	hgsc.bcm.edu	37	11	34489903	34489903	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:34489903C>T	ENST00000241052.4	+	11	1484	c.1395C>T	c.(1393-1395)ggC>ggT	p.G465G		NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase	465					aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.G465G(1)		breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	ACATTGCCGGCCACCTGAAGG	0.493																																					p.G465G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1395T	11						.						141.0	133.0	136.0					11																	34489903		2202	4298	6500	34446479	SO:0001819	synonymous_variant	847	exon11			AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.1395C>T	11.37:g.34489903C>T			34446479	NM_001752	A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	Silent	SNP	ENST00000241052.4	37	CCDS7891.1																																																																																				0.493	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103197.2	NM_001752	
PRR5L	79899	hgsc.bcm.edu	37	11	36424918	36424918	+	Missense_Mutation	SNP	G	G	A	rs149927791		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:36424918G>A	ENST00000378867.3	+	4	590	c.235G>A	c.(235-237)Gaa>Aaa	p.E79K	PRR5L_ENST00000530639.1_Missense_Mutation_p.E79K|PRR5L_ENST00000311599.5_Missense_Mutation_p.E53K|PRR5L_ENST00000527487.1_Missense_Mutation_p.E79K|PRR5L_ENST00000389693.3_Intron	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	79					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)	p.E79K(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						TGCCCTGAACGAAAACATCAG	0.502																																					p.E79K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G235A	11						.	G	LYS/GLU,,LYS/GLU,LYS/GLU	0,4404		0,0,2202	93.0	79.0	84.0		235,,235,235	5.8	1.0	11	dbSNP_134	84	1,8595	1.2+/-3.3	0,1,4297	no	missense,intron,missense,missense	PRR5L	NM_001160167.1,NM_001160168.1,NM_001160169.1,NM_024841.4	56,,56,56	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,,possibly-damaging,possibly-damaging	79/369,,79/206,79/369	36424918	1,12999	2202	4298	6500	36381494	SO:0001583	missense	79899	exon2				CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.235G>A	11.37:g.36424918G>A	ENSP00000368144:p.Glu79Lys		36381494	NM_001160169	A4QN22|E9PKY1|Q96H46|Q9H7V4	Missense_Mutation	SNP	ENST00000378867.3	37	CCDS31463.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320478	0.81469	0.0	1.16E-4	ENSG00000135362	ENST00000530639;ENST00000532121;ENST00000311599;ENST00000378867;ENST00000526679;ENST00000527487	T;T;T;T;T;T	0.75821	1.66;0.0;1.67;1.66;-0.03;-0.97	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.80869	0.4706	L	0.54323	1.7	0.58432	D	0.999998	D;D	0.63046	0.992;0.986	P;P	0.53490	0.727;0.483	T	0.81780	-0.0776	10	0.72032	D	0.01	0.0528	20.1364	0.98032	0.0:0.0:1.0:0.0	.	79;79	E9PKY1;Q6MZQ0	.;PRR5L_HUMAN	K	79;79;53;79;79;79	ENSP00000435050:E79K;ENSP00000433893:E79K;ENSP00000310103:E53K;ENSP00000368144:E79K;ENSP00000436402:E79K;ENSP00000435241:E79K	ENSP00000310103:E53K	E	+	1	0	PRR5L	36381494	1.000000	0.71417	0.991000	0.47740	0.717000	0.41224	8.065000	0.89485	2.768000	0.95171	0.491000	0.48974	GAA		0.502	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389209.1	NM_024841	
LRRC4C	57689	hgsc.bcm.edu	37	11	40136946	40136946	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:40136946A>G	ENST00000278198.2	-	2	2860	c.897T>C	c.(895-897)caT>caC	p.H299H	LRRC4C_ENST00000528697.1_Silent_p.H299H|LRRC4C_ENST00000527150.1_Silent_p.H299H|LRRC4C_ENST00000530763.1_Silent_p.H299H			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	299					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.H299H(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				AAGGGTTGTGATGTAAATGTA	0.473																																					p.H299H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T897C	11						.						179.0	147.0	158.0					11																	40136946		2203	4300	6503	40093522	SO:0001819	synonymous_variant	57689	exon2			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.897T>C	11.37:g.40136946A>G			40093522	NM_020929	A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	37	CCDS31464.1																																																																																				0.473	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
APLNR	187	hgsc.bcm.edu	37	11	57003936	57003936	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:57003936G>A	ENST00000606794.1	-	1	739	c.543C>T	c.(541-543)tgC>tgT	p.C181C		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	181					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.C181C(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						AGTCCATGTAGCACTGCACCT	0.622																																					p.C181C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C543T	11						.						106.0	86.0	93.0					11																	57003936		2201	4292	6493	56760512	SO:0001819	synonymous_variant	187	exon1			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.543C>T	11.37:g.57003936G>A			56760512	NM_005161		Silent	SNP	ENST00000606794.1	37	CCDS7950.1																																																																																				0.622	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470575.1	NM_005161	
CD6	923	hgsc.bcm.edu	37	11	60785843	60785843	+	Silent	SNP	G	G	A	rs147448427	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:60785843G>A	ENST00000313421.7	+	12	2106	c.1920G>A	c.(1918-1920)tcG>tcA	p.S640S	CD6_ENST00000352009.5_Intron|CD6_ENST00000452451.2_Intron|CD6_ENST00000344028.5_Silent_p.S608S|CD6_ENST00000346437.4_Silent_p.S567S	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	640					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)	p.S640S(2)		endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						AGCCCCCTTCGGAGGAGCAGT	0.612													G|||	5	0.000998403	0.0	0.0	5008	,	,		16297	0.0		0.004	False		,,,				2504	0.001				p.S640S	Pancreas(169;904 2017 4767 38890 42505)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1920A	11						.	G		1,4405		0,1,2202	27.0	25.0	26.0		1920	-10.6	0.0	11	dbSNP_134	26	22,8574		0,22,4276	no	coding-synonymous	CD6	NM_006725.3		0,23,6478	AA,AG,GG		0.2559,0.0227,0.1769		640/669	60785843	23,12979	2203	4298	6501	60542419	SO:0001819	synonymous_variant	923	exon12				CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1920G>A	11.37:g.60785843G>A			60542419	NM_006725	A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Silent	SNP	ENST00000313421.7	37	CCDS7999.1																																																																																				0.612	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396449.1	NM_006725	
VWCE	220001	hgsc.bcm.edu	37	11	61048484	61048484	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:61048484C>T	ENST00000335613.5	-	8	1397	c.1011G>A	c.(1009-1011)ctG>ctA	p.L337L		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	337						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.L337L(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GCAGGGTGGACAGCAGCCACA	0.687																																					p.L337L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1011A	11						.						27.0	32.0	30.0					11																	61048484		2198	4299	6497	60805060	SO:0001819	synonymous_variant	220001	exon8			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1011G>A	11.37:g.61048484C>T			60805060	NM_152718	A5PKV0|Q7Z7L6|Q86WK8	Silent	SNP	ENST00000335613.5	37	CCDS8002.1																																																																																				0.687	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
AHNAK	79026	hgsc.bcm.edu	37	11	62284562	62284562	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:62284562G>A	ENST00000378024.4	-	5	17601	c.17327C>T	c.(17326-17328)cCa>cTa	p.P5776L	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'UTR	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5776					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.P5776L(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GCGGTGCCGTGGCTTCTTACT	0.517																																					p.P5776L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C17327T	11						.						59.0	64.0	62.0					11																	62284562		2202	4299	6501	62041138	SO:0001583	missense	79026	exon5			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17327C>T	11.37:g.62284562G>A	ENSP00000367263:p.Pro5776Leu		62041138	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952266	0.53293	.	.	ENSG00000124942	ENST00000378024	T	0.02812	4.15	4.92	4.92	0.64577	.	.	.	.	.	T	0.07458	0.0188	L	0.50333	1.59	0.47949	D	0.999556	P	0.38395	0.629	P	0.46389	0.515	T	0.34875	-0.9811	9	0.39692	T	0.17	.	17.7607	0.88463	0.0:0.0:1.0:0.0	.	5776	Q09666	AHNK_HUMAN	L	5776	ENSP00000367263:P5776L	ENSP00000367263:P5776L	P	-	2	0	AHNAK	62041138	1.000000	0.71417	0.885000	0.34714	0.977000	0.68977	5.138000	0.64795	2.289000	0.77006	0.549000	0.68633	CCA		0.517	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
MTA2	9219	hgsc.bcm.edu	37	11	62361508	62361508	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:62361508G>T	ENST00000278823.2	-	18	2235	c.1846C>A	c.(1846-1848)Cta>Ata	p.L616I	MIR3654_ENST00000496634.2_5'Flank|TUT1_ENST00000476907.1_5'Flank|TUT1_ENST00000308436.7_5'Flank|MTA2_ENST00000524902.1_Missense_Mutation_p.L443I|MTA2_ENST00000527204.1_Missense_Mutation_p.L443I	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	616					ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L616I(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						GCCTTCCGTAGGGCCCTGGCC	0.567											OREG0021027	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L616I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1846A	11						.						69.0	69.0	69.0					11																	62361508		2202	4299	6501	62118084	SO:0001583	missense	9219	exon18			AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.1846C>A	11.37:g.62361508G>T	ENSP00000278823:p.Leu616Ile	1060	62118084	NM_004739	Q68DB1|Q9UQB5	Missense_Mutation	SNP	ENST00000278823.2	37	CCDS8022.1	.	.	.	.	.	.	.	.	.	.	G	0.720	-0.783801	0.02907	.	.	ENSG00000149480	ENST00000278823;ENST00000524902;ENST00000527204	T;T;T	0.45668	1.49;0.89;0.89	5.87	1.32	0.21799	.	0.237352	0.33980	N	0.004368	T	0.36166	0.0957	N	0.14661	0.345	0.39790	D	0.972414	P	0.52842	0.956	P	0.62184	0.899	T	0.09840	-1.0656	10	0.11182	T	0.66	-8.6426	10.1107	0.42561	0.3324:0.0:0.6676:0.0	.	616	O94776	MTA2_HUMAN	I	616;443;443	ENSP00000278823:L616I;ENSP00000431346:L443I;ENSP00000431797:L443I	ENSP00000278823:L616I	L	-	1	2	MTA2	62118084	1.000000	0.71417	0.989000	0.46669	0.707000	0.40811	1.464000	0.35288	0.366000	0.24427	0.650000	0.86243	CTA		0.567	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395578.1	NM_004739	
INTS5	80789	hgsc.bcm.edu	37	11	62415874	62415874	+	Missense_Mutation	SNP	G	G	A	rs150766238		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:62415874G>A	ENST00000330574.2	-	2	1730	c.1678C>T	c.(1678-1680)Cgg>Tgg	p.R560W	GANAB_ENST00000534779.1_5'Flank|GANAB_ENST00000346178.4_5'Flank|GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000356638.3_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	560					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)		p.R560W(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						GCATGCACCCGAGCCAGACAG	0.622																																					p.R560W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1678T	11						.	G	TRP/ARG	1,4403	2.1+/-5.4	0,1,2201	57.0	55.0	55.0		1678	4.4	1.0	11	dbSNP_134	55	0,8598		0,0,4299	no	missense	INTS5	NM_030628.1	101	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	560/1020	62415874	1,13001	2202	4299	6501	62172450	SO:0001583	missense	80789	exon2			AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.1678C>T	11.37:g.62415874G>A	ENSP00000327889:p.Arg560Trp		62172450	NM_030628	Q8N6W5|Q9C0G5	Missense_Mutation	SNP	ENST00000330574.2	37	CCDS8027.1	.	.	.	.	.	.	.	.	.	.	G	17.65	3.442766	0.63067	2.27E-4	0.0	ENSG00000185085	ENST00000330574	.	.	.	5.28	4.36	0.52297	.	0.067259	0.64402	D	0.000009	T	0.53110	0.1776	N	0.14661	0.345	0.38608	D	0.950828	D	0.89917	1.0	D	0.64877	0.93	T	0.62905	-0.6755	9	0.72032	D	0.01	.	12.8215	0.57696	0.0:0.0:0.8275:0.1725	.	560	Q6P9B9	INT5_HUMAN	W	560	.	ENSP00000327889:R560W	R	-	1	2	INTS5	62172450	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.615000	0.67702	1.436000	0.47453	0.655000	0.94253	CGG		0.622	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395327.1	NM_030628	
DPF2	5977	hgsc.bcm.edu	37	11	65116380	65116380	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:65116380G>A	ENST00000528416.1	+	10	1210	c.1077G>A	c.(1075-1077)ccG>ccA	p.P359P	DPF2_ENST00000252268.4_Silent_p.P373P|DPF2_ENST00000415073.2_Silent_p.P175P	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	359					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)	p.P359P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						GTCTCACCCCGTCCATGTCTG	0.448																																					p.P359P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1077A	11						.						183.0	149.0	161.0					11																	65116380		2201	4297	6498	64872956	SO:0001819	synonymous_variant	5977	exon10			U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.1077G>A	11.37:g.65116380G>A			64872956	NM_006268	A8K7C9|B4DT58	Silent	SNP	ENST00000528416.1	37	CCDS8100.1																																																																																				0.448	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268	
YIF1A	10897	hgsc.bcm.edu	37	11	66055106	66055106	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:66055106G>A	ENST00000376901.4	-	4	574	c.390C>T	c.(388-390)ccC>ccT	p.P130P	YIF1A_ENST00000359461.6_Silent_p.P130P|YIF1A_ENST00000471387.2_5'UTR|YIF1A_ENST00000496746.1_5'Flank|YIF1A_ENST00000526497.1_5'Flank	NM_020470.2	NP_065203.2	O95070	YIF1A_HUMAN	Yip1 interacting factor homolog A (S. cerevisiae)	130					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)		p.P130P(1)		endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	9						GGTCTTGCCGGGGGGGCAGAG	0.617																																					p.P130P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C390T	11						.						30.0	30.0	30.0					11																	66055106		2200	4294	6494	65811682	SO:0001819	synonymous_variant	10897	exon4			AF004876	CCDS8132.1, CCDS73325.1	11q13	2009-01-05	2005-06-07	2005-06-07	ENSG00000174851	ENSG00000174851			16688	protein-coding gene	gene with protein product		611484	"""Yip1 interacting factor homolog (S. cerevisiae)"""	YIF1		8824393, 10970842, 18718466	Standard	NM_020470		Approved	YIF1P, 54TM, FinGER7	uc001ohk.4	O95070	OTTHUMG00000102079	ENST00000376901.4:c.390C>T	11.37:g.66055106G>A			65811682	NM_020470	A6NM00|Q96G83|Q9BVD0	Silent	SNP	ENST00000376901.4	37	CCDS8132.1																																																																																				0.617	YIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219903.3	NM_020470	
BBS1	582	hgsc.bcm.edu	37	11	66278531	66278531	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:66278531C>T	ENST00000318312.7	+	2	146	c.95C>T	c.(94-96)gCc>gTc	p.A32V	BBS1_ENST00000537537.1_5'UTR|BBS1_ENST00000393994.2_Missense_Mutation_p.A32V|BBS1_ENST00000455748.2_Missense_Mutation_p.A32V|CTD-3074O7.11_ENST00000419755.3_Missense_Mutation_p.A69V|BBS1_ENST00000529766.1_3'UTR	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	32					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)	p.A32V(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						GACCCAATGGCCAATATCCAC	0.537									Bardet-Biedl syndrome																												p.A32V	GBM(152;173 2612 9770 10137)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C95T	11						.						229.0	218.0	221.0					11																	66278531		2200	4295	6495	66035107	SO:0001583	missense	582	exon2	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.95C>T	11.37:g.66278531C>T	ENSP00000317469:p.Ala32Val		66035107	NM_024649	Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	ENST00000318312.7	37	CCDS8142.1	.	.	.	.	.	.	.	.	.	.	C	36	5.947584	0.97134	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483;ENSG00000174483;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000526815;ENST00000525809;ENST00000455748;ENST00000393994	D;D;D;D;D;D	0.91124	-2.79;-2.79;-2.79;-2.79;-2.79;-2.79	5.31	5.31	0.75309	.	.	.	.	.	D	0.95840	0.8646	M	0.86953	2.85	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.997;0.984;0.984	D	0.96341	0.9251	9	0.72032	D	0.01	.	16.5303	0.84355	0.0:1.0:0.0:0.0	.	32;32;32;69	E7EQH1;Q32MM9;Q8NFJ9;Q8NFJ9-2	.;.;BBS1_HUMAN;.	V	69;32;2;32;32;32	ENSP00000398526:A69V;ENSP00000317469:A32V;ENSP00000436860:A2V;ENSP00000431187:A32V;ENSP00000405764:A32V;ENSP00000377563:A32V	ENSP00000317469:A32V	A	+	2	0	BBS1;CTD-3074O7.11	66035107	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.890000	0.75633	2.503000	0.84419	0.650000	0.86243	GCC		0.537	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393235.2		
SPTBN2	6712	hgsc.bcm.edu	37	11	66460676	66460676	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:66460676A>G	ENST00000533211.1	-	24	5166	c.4835T>C	c.(4834-4836)aTg>aCg	p.M1612T	SPTBN2_ENST00000529997.1_Missense_Mutation_p.M1612T|SPTBN2_ENST00000309996.2_Missense_Mutation_p.M1612T			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1612					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.M1612T(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CTCCTGGCCCATCATGTGTAA	0.632																																					p.M1612T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4835C	11						.						71.0	73.0	72.0					11																	66460676		2200	4295	6495	66217252	SO:0001583	missense	6712	exon23			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.4835T>C	11.37:g.66460676A>G	ENSP00000432568:p.Met1612Thr		66217252	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	A	18.49	3.634770	0.67130	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.45276	0.9;0.9;0.9	4.52	4.52	0.55395	.	0.094982	0.64402	D	0.000001	T	0.37073	0.0990	L	0.42008	1.315	0.58432	D	0.999999	P	0.36660	0.564	B	0.40702	0.338	T	0.09707	-1.0662	10	0.14656	T	0.56	.	12.9592	0.58447	1.0:0.0:0.0:0.0	.	1612	O15020	SPTN2_HUMAN	T	1612	ENSP00000432568:M1612T;ENSP00000311489:M1612T;ENSP00000433593:M1612T	ENSP00000311489:M1612T	M	-	2	0	SPTBN2	66217252	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.200000	0.58433	1.909000	0.55274	0.379000	0.24179	ATG		0.632	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
LRP5	4041	hgsc.bcm.edu	37	11	68204452	68204452	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:68204452G>A	ENST00000294304.7	+	19	4202	c.4096G>A	c.(4096-4098)Gac>Aac	p.D1366N		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1366	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.D1366N(1)		autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CGACGGCTCCGACGAGCTCAT	0.632																																					p.D1366N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4096A	11						.						140.0	104.0	116.0					11																	68204452		2200	4294	6494	67961028	SO:0001583	missense	4041	exon19			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.4096G>A	11.37:g.68204452G>A	ENSP00000294304:p.Asp1366Asn		67961028	NM_002335	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.007735	0.93287	.	.	ENSG00000162337	ENST00000294304	D	0.99214	-5.57	4.37	4.37	0.52481	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.49916	U	0.000129	D	0.99306	0.9757	H	0.97540	4.025	0.80722	D	1	P;P	0.48089	0.905;0.905	P;P	0.48304	0.573;0.573	D	0.98832	1.0751	10	0.72032	D	0.01	.	12.0883	0.53710	0.0833:0.0:0.9167:0.0	.	1366;1366	Q9UES7;O75197	.;LRP5_HUMAN	N	1366	ENSP00000294304:D1366N	ENSP00000294304:D1366N	D	+	1	0	LRP5	67961028	1.000000	0.71417	0.851000	0.33527	0.997000	0.91878	7.663000	0.83820	2.453000	0.82957	0.638000	0.83543	GAC		0.632	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
DHCR7	1717	hgsc.bcm.edu	37	11	71155200	71155200	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:71155200C>T	ENST00000355527.3	-	4	436	c.160G>A	c.(160-162)Gtc>Atc	p.V54I	DHCR7_ENST00000407721.2_Missense_Mutation_p.V54I	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	54					blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)	p.V54I(1)		endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						AAGTAGTAGACGATGAAGGGG	0.602									Smith-Lemli-Opitz syndrome																												p.V54I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G160A	11						.						59.0	47.0	51.0					11																	71155200		2200	4294	6494	70832848	SO:0001583	missense	1717	exon4	Familial Cancer Database	SLOS type I & II	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.160G>A	11.37:g.71155200C>T	ENSP00000347717:p.Val54Ile		70832848	NM_001360	B2R6Z2|O60492|O60717	Missense_Mutation	SNP	ENST00000355527.3	37	CCDS8200.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.031339	0.54790	.	.	ENSG00000172893	ENST00000407721;ENST00000355527;ENST00000524694;ENST00000526780;ENST00000525346;ENST00000531364;ENST00000529990;ENST00000527452	D;D;D;D;D;D;D	0.97811	-4.55;-4.55;-4.01;-3.37;-3.21;-3.82;-2.99	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	D	0.96537	0.8870	L	0.39397	1.21	0.80722	D	1	D	0.64830	0.994	P	0.52031	0.688	D	0.95491	0.8569	10	0.30078	T	0.28	-35.7044	15.0473	0.71838	0.0:1.0:0.0:0.0	.	54	Q9UBM7	DHCR7_HUMAN	I	54;54;54;54;54;54;34;54	ENSP00000384739:V54I;ENSP00000347717:V54I;ENSP00000435668:V54I;ENSP00000435707:V54I;ENSP00000432589:V54I;ENSP00000435058:V34I;ENSP00000436007:V54I	ENSP00000347717:V54I	V	-	1	0	DHCR7	70832848	0.997000	0.39634	1.000000	0.80357	0.180000	0.23129	3.818000	0.55678	2.209000	0.71365	0.462000	0.41574	GTC		0.602	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394243.1	NM_001360	
NUMA1	4926	hgsc.bcm.edu	37	11	71733419	71733419	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:71733419G>T	ENST00000393695.3	-	7	669	c.338C>A	c.(337-339)cCc>cAc	p.P113H	RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000351960.6_Missense_Mutation_p.P113H|NUMA1_ENST00000358965.6_Missense_Mutation_p.P113H	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.P113H(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						CCAGTCCCTGGGACTTTTGGA	0.507			T	RARA	APL																																p.P113H			Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C338A	11						.						165.0	169.0	168.0					11																	71733419		2200	4293	6493	71411067	SO:0001583	missense	4926	exon7			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.338C>A	11.37:g.71733419G>T	ENSP00000377298:p.Pro113His		71411067	NM_006185		Missense_Mutation	SNP	ENST00000393695.3	37	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.184740	0.57909	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000542977;ENST00000537217;ENST00000544238;ENST00000543937;ENST00000543009;ENST00000537930;ENST00000544129;ENST00000535947	T;T;T;T;T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.03	-4.83	0.03161	.	0.752009	0.12213	N	0.489180	T	0.46814	0.1412	L	0.48642	1.525	0.09310	N	1	D;D;D;D;D;P	0.65815	0.995;0.988;0.988;0.963;0.988;0.8	P;P;P;P;P;B	0.57548	0.823;0.8;0.8;0.606;0.614;0.398	T	0.52510	-0.8566	10	0.66056	D	0.02	.	13.1768	0.59633	0.5953:0.0:0.4047:0.0	.	113;113;113;113;113;113	F5H6Y5;F5H4J1;A8K394;Q14980-2;Q14980;Q9BTE9	.;.;.;.;NUMA1_HUMAN;.	H	113	ENSP00000260051:P113H;ENSP00000351851:P113H;ENSP00000377298:P113H;ENSP00000444880:P113H;ENSP00000442936:P113H;ENSP00000442761:P113H;ENSP00000439759:P113H;ENSP00000438821:P113H;ENSP00000438589:P113H;ENSP00000439092:P113H;ENSP00000444175:P113H	ENSP00000260051:P113H	P	-	2	0	NUMA1	71411067	0.567000	0.26626	0.472000	0.27241	0.966000	0.64601	0.636000	0.24644	-0.810000	0.04375	-0.136000	0.14681	CCC		0.507	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		
NUMA1	4926	hgsc.bcm.edu	37	11	71735379	71735379	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:71735379T>C	ENST00000393695.3	-	5	480	c.149A>G	c.(148-150)cAg>cGg	p.Q50R	NUMA1_ENST00000351960.6_Missense_Mutation_p.Q50R|NUMA1_ENST00000358965.6_Missense_Mutation_p.Q50R	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1									p.Q50R(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						CAAGATTTGCTGTCCCTCTTC	0.468			T	RARA	APL																																p.Q50R			Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A149G	11						.						114.0	106.0	109.0					11																	71735379		2200	4293	6493	71413027	SO:0001583	missense	4926	exon5			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.149A>G	11.37:g.71735379T>C	ENSP00000377298:p.Gln50Arg		71413027	NM_006185		Missense_Mutation	SNP	ENST00000393695.3	37	CCDS31633.1	.	.	.	.	.	.	.	.	.	.	T	14.84	2.656750	0.47467	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000542977;ENST00000537217;ENST00000544238;ENST00000543937;ENST00000543009;ENST00000537930;ENST00000544129;ENST00000535947;ENST00000535087;ENST00000368959;ENST00000541719;ENST00000366394;ENST00000541641;ENST00000535111;ENST00000535838;ENST00000546131	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.12	4.0	0.46444	.	0.339563	0.29015	N	0.013412	T	0.52725	0.1752	L	0.51422	1.61	0.28018	N	0.93464	D;D;D;B;D;B	0.67145	0.988;0.981;0.981;0.008;0.996;0.011	P;D;D;B;P;B	0.70487	0.736;0.969;0.969;0.011;0.895;0.015	T	0.44019	-0.9355	10	0.41790	T	0.15	.	8.4323	0.32766	0.0:0.0895:0.0:0.9105	.	50;50;50;50;50;50	F5H6Y5;F5H4J1;A8K394;Q14980-2;Q14980;Q9BTE9	.;.;.;.;NUMA1_HUMAN;.	R	50	ENSP00000260051:Q50R;ENSP00000351851:Q50R;ENSP00000377298:Q50R;ENSP00000444880:Q50R;ENSP00000442936:Q50R;ENSP00000442761:Q50R;ENSP00000439759:Q50R;ENSP00000438821:Q50R;ENSP00000438589:Q50R;ENSP00000439092:Q50R;ENSP00000444175:Q50R;ENSP00000439576:Q50R;ENSP00000357955:Q50R;ENSP00000438331:Q50R;ENSP00000438318:Q50R;ENSP00000441598:Q50R	ENSP00000260051:Q50R	Q	-	2	0	NUMA1	71413027	0.971000	0.33674	0.997000	0.53966	0.946000	0.59487	1.456000	0.35201	0.973000	0.38340	0.533000	0.62120	CAG		0.468	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		
DNAJB13	374407	hgsc.bcm.edu	37	11	73679405	73679405	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:73679405C>T	ENST00000339764.1	+	6	1373	c.622C>T	c.(622-624)Cca>Tca	p.P208S	DNAJB13_ENST00000543947.1_Missense_Mutation_p.P33S|RP11-167N4.2_ENST00000537019.1_RNA|DNAJB13_ENST00000537753.1_Missense_Mutation_p.P33S	NM_153614.2	NP_705842.2	P59910	DJB13_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 13	208					protein folding (GO:0006457)			p.P208S(1)		large_intestine(3)|lung(2)	5	Breast(11;7.42e-05)					CAACATCATCCCAGCAGACAT	0.542																																					p.P208S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C622T	11						.						162.0	118.0	133.0					11																	73679405		2200	4293	6493	73357053	SO:0001583	missense	374407	exon6			AF516185	CCDS8227.1	11q13.3	2011-09-02	2010-04-21		ENSG00000187726	ENSG00000187726		"""Heat shock proteins / DNAJ (HSP40)"""	30718	protein-coding gene	gene with protein product	"""radial spoke 16 homolog A (Chlamydomonas)"""	610263	"""DnaJ (Hsp40) related, subfamily B, member 13"""				Standard	NM_153614		Approved	TSARG6, RSPH16A	uc001ouo.3	P59910	OTTHUMG00000168093	ENST00000339764.1:c.622C>T	11.37:g.73679405C>T	ENSP00000344431:p.Pro208Ser		73357053	NM_153614	B3LEP4|Q8IZW5	Missense_Mutation	SNP	ENST00000339764.1	37	CCDS8227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	27.9|27.9	4.869040|4.869040	0.91587|0.91587	.|.	.|.	ENSG00000187726|ENSG00000187726	ENST00000542350|ENST00000339764;ENST00000537753;ENST00000543947	.|D;T;T	.|0.84873	.|-1.91;0.54;0.54	5.23|5.23	5.23|5.23	0.72850|0.72850	.|HSP40/DnaJ peptide-binding (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.93268|0.93268	0.7855|0.7855	M|M	0.90309|0.90309	3.105|3.105	0.80722|0.80722	D|D	1|1	.|D	.|0.62365	.|0.991	.|D	.|0.63793	.|0.918	D|D	0.94475|0.94475	0.7688|0.7688	6|10	.|0.72032	.|D	.|0.01	.|.	17.4282|17.4282	0.87532|0.87532	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|208	.|P59910	.|DJB13_HUMAN	L|S	108|208;33;33	.|ENSP00000344431:P208S;ENSP00000439711:P33S;ENSP00000438576:P33S	.|ENSP00000344431:P208S	P|P	+|+	2|1	0|0	DNAJB13|DNAJB13	73357053|73357053	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	6.670000|6.670000	0.74467|0.74467	2.452000|2.452000	0.82932|0.82932	0.437000|0.437000	0.28790|0.28790	CCC|CCA		0.542	DNAJB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398100.1	NM_153614	
SLCO2B1	11309	hgsc.bcm.edu	37	11	74904277	74904277	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:74904277C>T	ENST00000289575.5	+	9	1485	c.1090C>T	c.(1090-1092)Ctg>Ttg	p.L364L	SLCO2B1_ENST00000531756.1_Silent_p.L109L|SLCO2B1_ENST00000454962.2_Silent_p.L137L|SLCO2B1_ENST00000525650.1_Silent_p.L220L|SLCO2B1_ENST00000532236.1_Silent_p.L248L|SLCO2B1_ENST00000341411.4_Silent_p.L137L|SLCO2B1_ENST00000428359.2_Silent_p.L342L	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	364					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.L364L(1)		breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	CCCCAGGGTGCTGCTGCAGAC	0.632																																					p.L220L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C658T	11						.						75.0	72.0	73.0					11																	74904277		2200	4293	6493	74581925	SO:0001819	synonymous_variant	11309	exon6			AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.1090C>T	11.37:g.74904277C>T			74581925	NM_001145212	A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Silent	SNP	ENST00000289575.5	37	CCDS8235.1																																																																																				0.632	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383933.1	NM_007256	
WNT11	7481	hgsc.bcm.edu	37	11	75898122	75898122	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:75898122T>C	ENST00000322563.3	-	5	1176	c.1052A>G	c.(1051-1053)tAt>tGt	p.Y351C		NM_004626.2	NP_004617.2	O96014	WNT11_HUMAN	wingless-type MMTV integration site family, member 11	351					adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|bone mineralization (GO:0030282)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cloacal septation (GO:0060197)|embryonic skeletal system development (GO:0048706)|lung-associated mesenchyme development (GO:0060484)|mesonephric duct development (GO:0072177)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroendocrine cell differentiation (GO:0061101)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway (GO:0035567)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta2 production (GO:0032915)|protein localization to cell surface (GO:0034394)|protein phosphorylation (GO:0006468)|response to nutrient levels (GO:0031667)|tight junction assembly (GO:0070830)|ureteric bud morphogenesis (GO:0060675)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|protein kinase activator activity (GO:0030295)|Ras GTPase activator activity (GO:0005099)|transcription regulatory region DNA binding (GO:0044212)	p.Y351C(1)		breast(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20						CTTGCAGACATAGCGCTCCAC	0.642																																					p.Y351C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1052G	11						.						103.0	77.0	86.0					11																	75898122		2200	4292	6492	75575770	SO:0001583	missense	7481	exon5			Y12692	CCDS8242.1	11q13.5	2008-02-05			ENSG00000085741	ENSG00000085741		"""Wingless-type MMTV integration sites"""	12776	protein-coding gene	gene with protein product		603699				9757009	Standard	NM_004626		Approved		uc001oxe.3	O96014	OTTHUMG00000165264	ENST00000322563.3:c.1052A>G	11.37:g.75898122T>C	ENSP00000325526:p.Tyr351Cys		75575770	NM_004626	B2R8Z6|Q14DE8|Q8WZ98	Missense_Mutation	SNP	ENST00000322563.3	37	CCDS8242.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.097922	0.56075	.	.	ENSG00000085741	ENST00000322563	T	0.76968	-1.06	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	D	0.89962	0.6867	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.92258	0.5814	10	0.72032	D	0.01	.	13.9141	0.63885	0.0:0.0:0.0:1.0	.	351	O96014	WNT11_HUMAN	C	351	ENSP00000325526:Y351C	ENSP00000325526:Y351C	Y	-	2	0	WNT11	75575770	1.000000	0.71417	0.997000	0.53966	0.869000	0.49853	3.952000	0.56691	2.033000	0.60031	0.254000	0.18369	TAT		0.642	WNT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383083.1	NM_004626	
ME3	10873	hgsc.bcm.edu	37	11	86267657	86267657	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:86267657G>A	ENST00000393324.3	-	3	658	c.405C>T	c.(403-405)atC>atT	p.I135I	ME3_ENST00000323418.6_Silent_p.I73I|ME3_ENST00000543262.1_Silent_p.I135I|ME3_ENST00000359636.2_Silent_p.I135I|RP11-317J19.1_ENST00000524610.1_RNA	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	135					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.I135I(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				GCGTGTACACGATTGGCATGA	0.587																																					p.I135I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C405T	11						.						101.0	80.0	87.0					11																	86267657		2202	4299	6501	85945305	SO:0001819	synonymous_variant	10873	exon4			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.405C>T	11.37:g.86267657G>A			85945305	NM_001161586	B7Z6V0|Q8TBJ0	Silent	SNP	ENST00000393324.3	37	CCDS8277.1																																																																																				0.587	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2		
KCNJ1	3758	hgsc.bcm.edu	37	11	128709954	128709954	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr11:128709954A>G	ENST00000392664.2	-	2	358	c.242T>C	c.(241-243)aTg>aCg	p.M81T	KCNJ1_ENST00000324036.3_Missense_Mutation_p.M62T|KCNJ1_ENST00000392665.2_Missense_Mutation_p.M62T|KCNJ1_ENST00000440599.2_Missense_Mutation_p.M62T|KCNJ1_ENST00000392666.1_Missense_Mutation_p.M62T	NM_000220.4	NP_000211.1	P48048	KCNJ1_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 1	81					cardiovascular system development (GO:0072358)|excretion (GO:0007588)|kidney development (GO:0001822)|post-embryonic development (GO:0009791)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of G-protein activated inward rectifier potassium channel activity (GO:1900128)|renal sodium ion absorption (GO:0070294)|synaptic transmission (GO:0007268)|tissue homeostasis (GO:0001894)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.M81T(1)		breast(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)	23	all_hematologic(175;0.0641)	all_lung(97;4.89e-06)|Lung NSC(97;9.34e-06)|Breast(109;0.00123)|all_hematologic(192;0.00793)|Renal(330;0.0112)|all_neural(223;0.0189)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;4.05e-06)|LUSC - Lung squamous cell carcinoma(976;0.008)|Lung(977;0.00942)	Bethanidine(DB00217)|Glimepiride(DB00222)|Glyburide(DB01016)|Glycodiazine(DB01382)|Minoxidil(DB00350)|Tolazamide(DB00839)|Tolbutamide(DB01124)|Yohimbine(DB01392)	GAAAATGGTCATTTTGTATCT	0.443																																					p.M62T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T185C	11						.						153.0	143.0	147.0					11																	128709954		2201	4297	6498	128215164	SO:0001583	missense	3758	exon3			BC063109	CCDS8476.1, CCDS8477.1	11q24	2011-07-05			ENSG00000151704	ENSG00000151704		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6255	protein-coding gene	gene with protein product		600359				7680431, 8190102, 16382105	Standard	NM_153765		Approved	Kir1.1, ROMK1	uc001qeo.2	P48048	OTTHUMG00000048247	ENST00000392664.2:c.242T>C	11.37:g.128709954A>G	ENSP00000376432:p.Met81Thr		128215164	NM_153765	B2RMR4|Q6LD67	Missense_Mutation	SNP	ENST00000392664.2	37	CCDS8476.1	.	.	.	.	.	.	.	.	.	.	A	16.73	3.204156	0.58234	.	.	ENSG00000151704	ENST00000392665;ENST00000392666;ENST00000440599;ENST00000324036;ENST00000392664;ENST00000324003	D;D;D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.34;-3.34;-3.34	5.79	5.79	0.91817	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.132494	0.64402	N	0.000002	D	0.93861	0.8036	L	0.52126	1.63	0.52501	D	0.999954	P	0.48911	0.917	P	0.51701	0.677	D	0.94459	0.7674	10	0.87932	D	0	.	16.1444	0.81555	1.0:0.0:0.0:0.0	.	81	P48048	IRK1_HUMAN	T	62;62;62;62;81;62	ENSP00000376433:M62T;ENSP00000376434:M62T;ENSP00000406320:M62T;ENSP00000316233:M62T;ENSP00000376432:M81T;ENSP00000316136:M62T	ENSP00000316136:M62T	M	-	2	0	KCNJ1	128215164	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	6.325000	0.72901	2.223000	0.72356	0.455000	0.32223	ATG		0.443	KCNJ1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386233.1	NM_000220	
REV3L	5980	hgsc.bcm.edu	37	6	111695773	111695773	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:111695773A>C	ENST00000358835.3	-	14	4239	c.3785T>G	c.(3784-3786)tTt>tGt	p.F1262C	REV3L_ENST00000368802.3_Missense_Mutation_p.F1262C|REV3L_ENST00000368805.1_Missense_Mutation_p.F1262C|REV3L_ENST00000435970.1_Missense_Mutation_p.F1184C			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1262					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TTTCTGTTTAAAAAGTAGTTG	0.413								DNA polymerases (catalytic subunits)																													p.F1262C												.	.	0			c.T3785G	6						.						71.0	73.0	73.0					6																	111695773		2203	4299	6502	111802466	SO:0001583	missense	5980	exon13			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.3785T>G	6.37:g.111695773A>C	ENSP00000351697:p.Phe1262Cys		111802466	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	A	7.949	0.744356	0.15710	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01527	4.89;4.89;4.89;4.8	5.69	0.141	0.14811	Ribonuclease H-like (1);	1.239510	0.05267	N	0.516792	T	0.00496	0.0016	L	0.29908	0.895	0.23043	N	0.998387	B	0.02656	0.0	B	0.01281	0.0	T	0.48186	-0.9057	10	0.38643	T	0.18	.	0.9997	0.01474	0.4086:0.1045:0.1535:0.3334	.	1262	O60673	DPOLZ_HUMAN	C	1262;1262;1262;1184	ENSP00000357792:F1262C;ENSP00000357795:F1262C;ENSP00000351697:F1262C;ENSP00000402003:F1184C	ENSP00000351697:F1262C	F	-	2	0	REV3L	111802466	0.990000	0.36364	0.977000	0.42913	0.863000	0.49368	0.674000	0.25218	0.142000	0.18901	-0.316000	0.08728	TTT		0.413	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
MAN1A1	4121	hgsc.bcm.edu	37	6	119515009	119515009	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:119515009A>G	ENST00000368468.3	-	9	1700	c.1259T>C	c.(1258-1260)cTg>cCg	p.L420P		NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	420					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|mannosidase activity (GO:0015923)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.L420P(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		CCAGGCCTTCAGCAAATACTC	0.378																																					p.L420P	Ovarian(136;8 1825 12608 33541 47587)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1259C	6						.						120.0	111.0	114.0					6																	119515009		2203	4300	6503	119556708	SO:0001583	missense	4121	exon9			AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885	3.2.1.113		6821	protein-coding gene	gene with protein product		604344				8223597	Standard	NM_005907		Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.1259T>C	6.37:g.119515009A>G	ENSP00000357453:p.Leu420Pro		119556708	NM_005907	E7EU32|Q6P052|Q9NU44|Q9UJI3	Missense_Mutation	SNP	ENST00000368468.3	37	CCDS5122.1	.	.	.	.	.	.	.	.	.	.	A	19.28	3.796390	0.70567	.	.	ENSG00000111885	ENST00000368468	T	0.73575	-0.76	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000001	T	0.80048	0.4552	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79864	-0.1623	10	0.40728	T	0.16	-0.4949	15.8082	0.78531	1.0:0.0:0.0:0.0	.	420	P33908	MA1A1_HUMAN	P	420	ENSP00000357453:L420P	ENSP00000357453:L420P	L	-	2	0	MAN1A1	119556708	1.000000	0.71417	0.985000	0.45067	0.456000	0.32438	9.339000	0.96797	2.137000	0.66172	0.533000	0.62120	CTG		0.378	MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042015.1	NM_005907	
GJA1	2697	hgsc.bcm.edu	37	6	121768566	121768566	+	Silent	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:121768566C>A	ENST00000282561.3	+	2	730	c.573C>A	c.(571-573)ccC>ccA	p.P191P		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	191					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)	p.P191P(1)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	AAAGAGATCCCTGCCCACATC	0.488																																					p.P191P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C573A	6						.						127.0	120.0	122.0					6																	121768566		2203	4300	6503	121810265	SO:0001819	synonymous_variant	2697	exon2			BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.573C>A	6.37:g.121768566C>A			121810265	NM_000165	B2R5U9|Q6FHU1|Q9Y5I8	Silent	SNP	ENST00000282561.3	37	CCDS5123.1																																																																																				0.488	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
ARHGAP18	93663	hgsc.bcm.edu	37	6	129921797	129921797	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:129921797A>C	ENST00000368149.2	-	11	1650	c.1562T>G	c.(1561-1563)cTt>cGt	p.L521R	ARHGAP18_ENST00000463225.1_5'Flank	NM_033515.2	NP_277050.2			Rho GTPase activating protein 18									p.L521R(1)		NS(2)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(3)	18				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		TGTCCACAGAAGTTTTTGGTA	0.323																																					p.L521R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1562G	6						.						92.0	84.0	87.0					6																	129921797		2203	4300	6503	129963490	SO:0001583	missense	93663	exon11			AB053293	CCDS34535.1	6q23.1	2011-06-29			ENSG00000146376	ENSG00000146376		"""Rho GTPase activating proteins"""	21035	protein-coding gene	gene with protein product		613351					Standard	NM_033515		Approved	MacGAP, bA307O14.2	uc003qbr.3	Q8N392	OTTHUMG00000015547	ENST00000368149.2:c.1562T>G	6.37:g.129921797A>C	ENSP00000357131:p.Leu521Arg		129963490	NM_033515		Missense_Mutation	SNP	ENST00000368149.2	37	CCDS34535.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.111940	0.77210	.	.	ENSG00000146376	ENST00000368149;ENST00000275189	.	.	.	5.75	5.75	0.90469	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.259866	0.39083	N	0.001471	T	0.71384	0.3333	M	0.69823	2.125	0.58432	D	0.999997	D;B	0.69078	0.997;0.16	D;B	0.65987	0.94;0.196	T	0.72947	-0.4137	8	.	.	.	.	16.0623	0.80847	1.0:0.0:0.0:0.0	.	521;521	A9UK01;Q8N392	.;RHG18_HUMAN	R	476;521	.	.	L	-	2	0	ARHGAP18	129963490	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	7.119000	0.77145	2.195000	0.70347	0.533000	0.62120	CTT		0.323	ARHGAP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042185.2	NM_033515	
SASH1	23328	hgsc.bcm.edu	37	6	148854014	148854014	+	Missense_Mutation	SNP	C	C	T	rs139081709		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:148854014C>T	ENST00000367467.3	+	14	2121	c.1646C>T	c.(1645-1647)cCg>cTg	p.P549L		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	549					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)	p.P549L(1)		breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GACGAAGAGCCGCCTTACCGA	0.572													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18666	0.0		0.0	False		,,,				2504	0.0				p.P549L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1646T	6						.	C	LEU/PRO	3,4403	6.2+/-15.9	0,3,2200	123.0	120.0	121.0		1646	-1.5	0.9	6	dbSNP_134	121	0,8600		0,0,4300	no	missense	SASH1	NM_015278.3	98	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign	549/1248	148854014	3,13003	2203	4300	6503	148895707	SO:0001583	missense	23328	exon14			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1646C>T	6.37:g.148854014C>T	ENSP00000356437:p.Pro549Leu		148895707	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	CCDS5212.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	8.633	0.894032	0.17613	6.81E-4	0.0	ENSG00000111961	ENST00000367467;ENST00000535767	T	0.32515	1.45	4.75	-1.48	0.08745	Src homology-3 domain (1);	0.304797	0.36167	N	0.002752	T	0.04543	0.0124	N	0.11201	0.11	0.51012	D	0.999903	B;B	0.26258	0.087;0.145	B;B	0.22880	0.042;0.042	T	0.27971	-1.0058	10	0.12430	T	0.62	-3.3307	10.7647	0.46286	0.0:0.4836:0.0:0.5164	.	530;549	Q6P4R9;O94885	.;SASH1_HUMAN	L	549;310	ENSP00000356437:P549L	ENSP00000356437:P549L	P	+	2	0	SASH1	148895707	0.764000	0.28473	0.941000	0.38009	0.571000	0.35966	1.374000	0.34283	-0.255000	0.09486	-0.794000	0.03295	CCG		0.572	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
AKAP12	9590	hgsc.bcm.edu	37	6	151672214	151672214	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:151672214C>T	ENST00000253332.1	+	3	2877	c.2688C>T	c.(2686-2688)gtC>gtT	p.V896V	AKAP12_ENST00000359755.5_Silent_p.V791V|AKAP12_ENST00000354675.6_Silent_p.V798V|AKAP12_ENST00000402676.2_Silent_p.V896V			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	896					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)	p.V896V(1)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CAGCAGCTGTCGCTGACGGGA	0.532																																					p.V896V	Melanoma(141;1616 1805 10049 24534 51979)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2688T	6						.						58.0	65.0	63.0					6																	151672214		2203	4300	6503	151713907	SO:0001819	synonymous_variant	9590	exon4			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.2688C>T	6.37:g.151672214C>T			151713907	NM_005100	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	37	CCDS5229.1																																																																																				0.532	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152751637	152751637	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:152751637A>G	ENST00000367255.5	-	35	5270	c.4669T>C	c.(4669-4671)Ttt>Ctt	p.F1557L	SYNE1_ENST00000423061.1_Missense_Mutation_p.F1564L|SYNE1_ENST00000367253.4_Missense_Mutation_p.F1557L|SYNE1_ENST00000265368.4_Missense_Mutation_p.F1557L|SYNE1_ENST00000448038.1_Missense_Mutation_p.F1564L|SYNE1_ENST00000341594.5_Missense_Mutation_p.F1627L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1557					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.F1557L(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCTCTTCAAACTTTTGCTGC	0.373										HNSCC(10;0.0054)																											p.F1564L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T4690C	6						.						136.0	130.0	132.0					6																	152751637		2203	4300	6503	152793330	SO:0001583	missense	23345	exon35			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.4669T>C	6.37:g.152751637A>G	ENSP00000356224:p.Phe1557Leu		152793330	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	A	17.73	3.462578	0.63513	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253	T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	5.66	5.66	0.87406	.	0.099951	0.44902	D	0.000408	T	0.48822	0.1521	L	0.59436	1.845	0.80722	D	1	D;P;P;P;P	0.58268	0.982;0.722;0.86;0.722;0.673	B;B;B;B;B	0.41860	0.368;0.231;0.352;0.231;0.327	T	0.53486	-0.8432	10	0.12103	T	0.63	.	16.2026	0.82095	1.0:0.0:0.0:0.0	.	1540;1557;1557;1557;1564	B3W695;Q8NF91;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	L	1557;1564;1557;1564;1627;1557	ENSP00000356224:F1557L;ENSP00000396024:F1564L;ENSP00000265368:F1557L;ENSP00000390975:F1564L;ENSP00000341887:F1627L;ENSP00000356222:F1557L	ENSP00000265368:F1557L	F	-	1	0	SYNE1	152793330	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.290000	0.72712	2.285000	0.76669	0.533000	0.62120	TTT		0.373	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
JARID2	3720	hgsc.bcm.edu	37	6	15374405	15374405	+	Silent	SNP	T	T	C	rs201814744		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:15374405T>C	ENST00000341776.2	+	2	347	c.103T>C	c.(103-105)Ttg>Ctg	p.L35L	JARID2_ENST00000397311.3_5'UTR	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	35					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AGTCCTTTATTTGTCTCTGAA	0.448																																					p.L35L												.	.	0			c.T103C	6						.						201.0	195.0	197.0					6																	15374405		2203	4300	6503	15482384	SO:0001819	synonymous_variant	3720	exon2			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.103T>C	6.37:g.15374405T>C			15482384	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Silent	SNP	ENST00000341776.2	37	CCDS4533.1																																																																																				0.448	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
IPCEF1	26034	hgsc.bcm.edu	37	6	154520845	154520845	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:154520845A>G	ENST00000265198.4	-	10	1019	c.864T>C	c.(862-864)ctT>ctC	p.L288L	IPCEF1_ENST00000422970.2_Silent_p.L289L|OPRM1_ENST00000337049.4_Intron|IPCEF1_ENST00000519344.1_Silent_p.L260L|IPCEF1_ENST00000519091.1_5'Flank|IPCEF1_ENST00000367220.4_Silent_p.L289L	NM_001130700.1|NM_015553.2	NP_001124172.1|NP_056368.1	Q8WWN9	ICEF1_HUMAN	interaction protein for cytohesin exchange factors 1	288					oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|positive regulation of GTP catabolic process (GO:0033126)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	oxygen transporter activity (GO:0005344)|peroxidase activity (GO:0004601)	p.L288L(1)		breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	12						CTGGGACAGTAAGATGGTCAT	0.353																																					p.L289L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T867C	6						.						87.0	86.0	86.0					6																	154520845		2203	4300	6503	154562537	SO:0001819	synonymous_variant	26034	exon10			AB007863	CCDS5245.1, CCDS47509.1	6q25.2	2013-01-10			ENSG00000074706	ENSG00000074706		"""Pleckstrin homology (PH) domain containing"""	21204	protein-coding gene	gene with protein product	"""phosphoinositide binding protein PIP3-E"""					11804589, 19756519	Standard	NM_001130699		Approved	PIP3-E, KIAA0403	uc021zhc.1	Q8WWN9	OTTHUMG00000015872	ENST00000265198.4:c.864T>C	6.37:g.154520845A>G			154562537	NM_001130700	A8K1K2|B7ZL78|B7ZL80|O43153|Q5HYL8	Silent	SNP	ENST00000265198.4	37	CCDS5245.1																																																																																				0.353	IPCEF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042789.2	NM_001130699	
GMDS	2762	hgsc.bcm.edu	37	6	1961149	1961149	+	Silent	SNP	G	G	A	rs368834744		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:1961149G>A	ENST00000380815.4	-	5	666	c.397C>T	c.(397-399)Cta>Tta	p.L133L	GMDS_ENST00000530927.1_Silent_p.L103L	NM_001500.3	NP_001491.1	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	133					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|GDP-mannose metabolic process (GO:0019673)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	GDP-mannose 4,6-dehydratase activity (GO:0008446)|NADP+ binding (GO:0070401)	p.L133L(1)	GMDS/PDE8B(2)	breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|prostate(1)	21	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		AGAAGTCGTAGAGTGCCAACT	0.468																																					p.L133L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C397T	6						.	G		0,4406		0,0,2203	108.0	101.0	103.0		397	-0.2	0.9	6		103	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	GMDS	NM_001500.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		133/373	1961149	1,13005	2203	4300	6503	1906148	SO:0001819	synonymous_variant	2762	exon5			AF042377	CCDS4474.1, CCDS58994.1	6p25	2011-09-14			ENSG00000112699	ENSG00000112699	4.2.1.47	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4369	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 3E, member 1"""	602884				9525924, 19027726	Standard	NM_001500		Approved	GMD, SDR3E1	uc003mtq.3	O60547	OTTHUMG00000016143	ENST00000380815.4:c.397C>T	6.37:g.1961149G>A			1906148	NM_001500	E9PI88|O75357|Q5T954|Q6FH09|Q9UGZ3|Q9UJK9	Silent	SNP	ENST00000380815.4	37	CCDS4474.1																																																																																				0.468	GMDS-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043380.3		
DSP	1832	hgsc.bcm.edu	37	6	7586104	7586104	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:7586104G>A	ENST00000379802.3	+	24	8950	c.8609G>A	c.(8608-8610)gGg>gAg	p.G2870E	DSP_ENST00000418664.2_Missense_Mutation_p.G2271E	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2870	Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.G2870E(1)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AGTTCTATTGGGCACTAGTAG	0.443																																					p.G2271E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6812A	6						.						88.0	97.0	94.0					6																	7586104		2203	4300	6503	7531103	SO:0001583	missense	1832	exon24			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.8609G>A	6.37:g.7586104G>A	ENSP00000369129:p.Gly2870Glu		7531103	NM_001008844	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129001	0.77549	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.78481	-0.96;-1.18	4.87	4.87	0.63330	.	0.000000	0.64402	D	0.000017	T	0.80670	0.4667	L	0.36672	1.1	0.37806	D	0.92787	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	D	0.83797	0.0234	10	0.87932	D	0	.	18.3606	0.90372	0.0:0.0:1.0:0.0	.	2318;2870	Q4LE79;P15924	.;DESP_HUMAN	E	2870;2271	ENSP00000369129:G2870E;ENSP00000396591:G2271E	ENSP00000369129:G2870E	G	+	2	0	DSP	7531103	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.341000	0.65964	2.411000	0.81874	0.655000	0.94253	GGG		0.443	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
BMP6	654	hgsc.bcm.edu	37	6	7845464	7845464	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:7845464G>A	ENST00000283147.6	+	2	915	c.756G>A	c.(754-756)acG>acA	p.T252T		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	252					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)	p.T252T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					AGGTGGTGACGGCTGCAGAAT	0.448																																					p.T252T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G756A	6						.						118.0	117.0	117.0					6																	7845464		2203	4300	6503	7790463	SO:0001819	synonymous_variant	654	exon2			AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.756G>A	6.37:g.7845464G>A			7790463	NM_001718	Q5TCP3	Silent	SNP	ENST00000283147.6	37	CCDS4503.1																																																																																				0.448	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718	
HIST1H1B	3009	hgsc.bcm.edu	37	6	27834859	27834859	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:27834859T>C	ENST00000331442.3	-	1	500	c.449A>G	c.(448-450)aAg>aGg	p.K150R		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	150					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)	p.K150R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						CTTCACTGCCTTTTTCGCCCC	0.622																																					p.K150R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A449G	6						.						97.0	111.0	106.0					6																	27834859		2203	4299	6502	27942838	SO:0001583	missense	3009	exon1			AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.449A>G	6.37:g.27834859T>C	ENSP00000330074:p.Lys150Arg		27942838	NM_005322	Q14529|Q3MJ42	Missense_Mutation	SNP	ENST00000331442.3	37	CCDS4635.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.041746	0.75732	.	.	ENSG00000184357	ENST00000331442	T	0.16597	2.33	5.19	5.19	0.71726	.	0.336830	0.26594	N	0.023513	T	0.11879	0.0289	N	0.08118	0	0.50467	D	0.999877	D	0.63880	0.993	D	0.70227	0.968	T	0.35574	-0.9783	10	0.26408	T	0.33	-5.5924	14.1885	0.65623	0.0:0.0:0.0:1.0	.	150	P16401	H15_HUMAN	R	150	ENSP00000330074:K150R	ENSP00000330074:K150R	K	-	2	0	HIST1H1B	27942838	1.000000	0.71417	0.828000	0.32881	0.957000	0.61999	6.302000	0.72788	2.103000	0.63969	0.533000	0.62120	AAG		0.622	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322	
MRPS18B	28973	hgsc.bcm.edu	37	6	30593314	30593314	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:30593314C>T	ENST00000259873.4	+	7	674	c.517C>T	c.(517-519)Cgg>Tgg	p.R173W	ATAT1_ENST00000330083.5_5'Flank|ATAT1_ENST00000376483.4_5'Flank|ATAT1_ENST00000318999.7_5'Flank|ATAT1_ENST00000376485.4_5'Flank|MRPS18B_ENST00000472229.1_3'UTR|ATAT1_ENST00000376478.2_5'Flank|ATAT1_ENST00000329992.8_5'Flank|MRPS18B_ENST00000506373.2_3'UTR|ATAT1_ENST00000319027.5_5'Flank	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B	173					translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)	p.R173W(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						GGTTGAACCACGGGACCTTGA	0.502																																					p.R173W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C517T	6						.						192.0	226.0	214.0					6																	30593314		1510	2709	4219	30701293	SO:0001583	missense	28973	exon7			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268	ENST00000259873.4:c.517C>T	6.37:g.30593314C>T	ENSP00000259873:p.Arg173Trp		30701293	NM_014046	A6NDQ0|Q659G4|Q9BS27	Missense_Mutation	SNP	ENST00000259873.4	37	CCDS4682.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918920	0.73098	.	.	ENSG00000204568	ENST00000259873;ENST00000376508	T	0.51574	0.7	4.93	4.93	0.64822	.	0.225469	0.36374	N	0.002628	T	0.59142	0.2172	M	0.63428	1.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.965	T	0.62760	-0.6786	10	0.87932	D	0	.	15.1787	0.72938	0.0:1.0:0.0:0.0	.	130;173	Q5STN0;Q9Y676	.;RT18B_HUMAN	W	173;130	ENSP00000259873:R173W	ENSP00000259873:R173W	R	+	1	2	MRPS18B	30701293	0.954000	0.32549	0.986000	0.45419	0.892000	0.51952	1.941000	0.40233	2.570000	0.86706	0.591000	0.81541	CGG		0.502	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076584.2		
HSPA1L	3305	hgsc.bcm.edu	37	6	31778117	31778117	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:31778117C>A	ENST00000375654.4	-	2	1822	c.1633G>T	c.(1633-1635)Gaa>Taa	p.E545*	HSPA1L_ENST00000417199.3_Nonsense_Mutation_p.E545*	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	545					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.E545*(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						GCATAGGATTCTAAGGCATTC	0.398																																					p.E545X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1633T	6						.						137.0	142.0	141.0					6																	31778117		2203	4300	6503	31886096	SO:0001587	stop_gained	3305	exon2			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1633G>T	6.37:g.31778117C>A	ENSP00000364805:p.Glu545*		31886096	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Nonsense_Mutation	SNP	ENST00000375654.4	37	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	C	37	5.992460	0.97179	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653	.	.	.	6.08	5.22	0.72569	.	0.000000	0.35805	N	0.002966	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.9489	13.2	0.59763	0.0:0.9235:0.0:0.0765	.	.	.	.	X	545;545;490	.	ENSP00000364804:E490X	E	-	1	0	HSPA1L	31886096	1.000000	0.71417	0.650000	0.29550	0.831000	0.47069	7.810000	0.86072	1.586000	0.49944	0.591000	0.81541	GAA		0.398	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
ITPR3	3710	hgsc.bcm.edu	37	6	33630709	33630709	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:33630709C>T	ENST00000374316.5	+	10	1940	c.880C>T	c.(880-882)Cgt>Tgt	p.R294C	ITPR3_ENST00000605930.1_Missense_Mutation_p.R294C			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	294					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.R294C(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CGACCCCTGCCGTGGAGGAGC	0.632																																					p.R294C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C880T	6						.						61.0	51.0	55.0					6																	33630709		2203	4300	6503	33738687	SO:0001583	missense	3710	exon9			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.880C>T	6.37:g.33630709C>T	ENSP00000363435:p.Arg294Cys		33738687	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	c	23.1	4.378282	0.82682	.	.	ENSG00000096433	ENST00000374316	D	0.88277	-2.36	5.34	5.34	0.76211	MIR (2);	0.000000	0.85682	D	0.000000	D	0.94404	0.8200	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95124	0.8249	10	0.87932	D	0	-13.3863	13.9414	0.64057	0.1519:0.8481:0.0:0.0	.	294	Q14573	ITPR3_HUMAN	C	294	ENSP00000363435:R294C	ENSP00000363435:R294C	R	+	1	0	ITPR3	33738687	1.000000	0.71417	0.996000	0.52242	0.767000	0.43475	2.408000	0.44574	2.494000	0.84150	0.306000	0.20318	CGT		0.632	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
ITPR3	3710	hgsc.bcm.edu	37	6	33650387	33650387	+	Silent	SNP	C	C	T	rs571319160	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:33650387C>T	ENST00000374316.5	+	35	5623	c.4563C>T	c.(4561-4563)tcC>tcT	p.S1521S	ITPR3_ENST00000605930.1_Silent_p.S1521S			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1521					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.S1521S(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	ACAAGGGCTCCGTGGAGGCCT	0.647													C|||	2	0.000399361	0.0	0.0	5008	,	,		16214	0.0		0.0	False		,,,				2504	0.002				p.S1521S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4563T	6						.						43.0	40.0	41.0					6																	33650387		2203	4300	6503	33758365	SO:0001819	synonymous_variant	3710	exon34			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.4563C>T	6.37:g.33650387C>T			33758365	NM_002224	Q14649|Q5TAQ2	Silent	SNP	ENST00000374316.5	37	CCDS4783.1																																																																																				0.647	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
GRM4	2914	hgsc.bcm.edu	37	6	34100871	34100871	+	Missense_Mutation	SNP	G	G	A	rs368604495		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:34100871G>A	ENST00000538487.2	-	2	846	c.403C>T	c.(403-405)Cgc>Tgc	p.R135C	GRM4_ENST00000374181.4_Missense_Mutation_p.R135C|GRM4_ENST00000374177.3_Intron	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	135					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.R135C(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CTGCCACAGCGGACCTCTGTG	0.627																																					p.R135C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C403T	6						.	G	CYS/ARG	0,4406		0,0,2203	57.0	47.0	50.0		403	4.0	1.0	6		50	1,8599	1.2+/-3.3	0,1,4299	no	missense	GRM4	NM_000841.1	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	135/913	34100871	1,13005	2203	4300	6503	34208849	SO:0001583	missense	2914	exon1			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.403C>T	6.37:g.34100871G>A	ENSP00000440556:p.Arg135Cys		34208849	NM_000841	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.406726	0.62399	0.0	1.16E-4	ENSG00000124493	ENST00000374181;ENST00000538487	D;D	0.82167	-1.58;-1.58	3.99	3.99	0.46301	Extracellular ligand-binding receptor (1);	0.078499	0.49916	D	0.000139	D	0.88618	0.6485	M	0.86343	2.81	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.997	P;P;P	0.58970	0.849;0.765;0.832	D	0.88980	0.3407	10	0.42905	T	0.14	.	16.2077	0.82141	0.0:0.0:1.0:0.0	.	135;135;135	B7ZLU9;A1L4F9;Q14833	.;.;GRM4_HUMAN	C	135	ENSP00000363296:R135C;ENSP00000440556:R135C	ENSP00000363296:R135C	R	-	1	0	GRM4	34208849	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	2.315000	0.43752	2.230000	0.72887	0.467000	0.42956	CGC		0.627	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
ANKS1A	23294	hgsc.bcm.edu	37	6	34952860	34952860	+	Splice_Site	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:34952860T>C	ENST00000360359.3	+	8	1152	c.1014T>C	c.(1012-1014)ggT>ggC	p.G338G	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	338					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.G338G(1)		cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						TCCTCTCAGGTGACGTGGAGA	0.502																																					p.G338G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1014C	6						.						96.0	93.0	94.0					6																	34952860		2203	4300	6503	35060838	SO:0001630	splice_region_variant	23294	exon8			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.1013-1T>C	6.37:g.34952860T>C			35060838	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Silent	SNP	ENST00000360359.3	37	CCDS4798.1																																																																																				0.502	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	Silent
CCND3	896	hgsc.bcm.edu	37	6	41908190	41908190	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:41908190G>T	ENST00000372991.4	-	2	530	c.332C>A	c.(331-333)tCc>tAc	p.S111Y	CCND3_ENST00000372988.4_Missense_Mutation_p.S30Y|CCND3_ENST00000414200.2_Intron|CCND3_ENST00000372987.4_Missense_Mutation_p.S61Y|CCND3_ENST00000511642.1_Missense_Mutation_p.S30Y|CCND3_ENST00000510503.1_Missense_Mutation_p.S30Y|CCND3_ENST00000415497.2_Intron|CCND3_ENST00000511686.1_Intron	NM_001760.3	NP_001751.1	P30281	CCND3_HUMAN	cyclin D3	111	Cyclin N-terminal.				cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)	p.S111Y(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(13)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	20	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GCGCAGCTTGGAGGCCAGCAG	0.627			T	IGH@	MM																																p.S30Y			Dom	yes		6	6p21	896	cyclin D3		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C89A	6						.						110.0	102.0	105.0					6																	41908190		2203	4300	6503	42016168	SO:0001583	missense	896	exon2				CCDS4863.1, CCDS47425.1, CCDS47426.1, CCDS47427.1, CCDS75452.1	6p21	2008-08-26			ENSG00000112576	ENSG00000112576			1585	protein-coding gene	gene with protein product		123834				1386335	Standard	NM_001136125		Approved		uc003orn.3	P30281	OTTHUMG00000014690	ENST00000372991.4:c.332C>A	6.37:g.41908190G>T	ENSP00000362082:p.Ser111Tyr		42016168	NM_001136017	B2RD63|B3KQ22|E9PAS4|E9PB36|Q5T8J0|Q6FG62|Q96F49	Missense_Mutation	SNP	ENST00000372991.4	37	CCDS4863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	23.0|23.0	4.365182|4.365182	0.82463|0.82463	.|.	.|.	ENSG00000112576|ENSG00000112576	ENST00000512426|ENST00000372991;ENST00000511642;ENST00000372987;ENST00000372988;ENST00000510503;ENST00000505064;ENST00000502771	.|T;T;T;T;T;T;T	.|0.15017	.|2.46;2.46;2.46;2.46;2.46;2.46;2.46	4.26|4.26	3.38|3.38	0.38709|0.38709	.|Cyclin, N-terminal (1);Cyclin-like (3);	.|0.122147	.|0.37304	.|N	.|0.002150	T|T	0.48259|0.48259	0.1490|0.1490	H|H	0.98594|0.98594	4.275|4.275	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.998;0.993	T|T	0.66752|0.66752	-0.5844|-0.5844	5|10	.|0.87932	.|D	.|0	.|.	11.5374|11.5374	0.50645|0.50645	0.0894:0.0:0.9106:0.0|0.0894:0.0:0.9106:0.0	.|.	.|30;111;61	.|B4E0N5;P30281;Q5T8J1	.|.;CCND3_HUMAN;.	T|Y	46|111;30;61;30;30;30;30	.|ENSP00000362082:S111Y;ENSP00000426212:S30Y;ENSP00000362078:S61Y;ENSP00000362079:S30Y;ENSP00000425986:S30Y;ENSP00000425830:S30Y;ENSP00000425334:S30Y	.|ENSP00000362078:S61Y	P|S	-|-	1|2	0|0	CCND3|CCND3	42016168|42016168	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.595000|9.595000	0.98260|0.98260	0.999000|0.999000	0.39023|0.39023	0.462000|0.462000	0.41574|0.41574	CCA|TCC		0.627	CCND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040540.2	NM_001760	
CUL7	9820	hgsc.bcm.edu	37	6	43016127	43016127	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:43016127A>G	ENST00000265348.3	-	8	2091	c.2006T>C	c.(2005-2007)cTg>cCg	p.L669P	CUL7_ENST00000535468.1_Missense_Mutation_p.L753P|CUL7_ENST00000478630.1_5'Flank			Q14999	CUL7_HUMAN	cullin 7	669					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.L669P(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GCTCTGCATCAGTGCCAGGAA	0.617																																					p.L669P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2006C	6						.						118.0	121.0	120.0					6																	43016127		2203	4300	6503	43124105	SO:0001583	missense	9820	exon8			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.2006T>C	6.37:g.43016127A>G	ENSP00000265348:p.Leu669Pro		43124105	NM_014780	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.390064	0.82902	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.76316	-1.01;-1.01	4.89	4.89	0.63831	Armadillo-like helical (1);	0.465945	0.22544	N	0.058688	D	0.82540	0.5059	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.998	D	0.85052	0.0929	10	0.87932	D	0	-20.0849	12.7706	0.57419	1.0:0.0:0.0:0.0	.	753;669	F5H0L1;Q14999	.;CUL7_HUMAN	P	669;753	ENSP00000265348:L669P;ENSP00000438788:L753P	ENSP00000265348:L669P	L	-	2	0	CUL7	43124105	0.965000	0.33210	0.031000	0.17742	0.677000	0.39632	4.541000	0.60670	1.970000	0.57323	0.533000	0.62120	CTG		0.617	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
MRPL2	51069	hgsc.bcm.edu	37	6	43023827	43023827	+	Missense_Mutation	SNP	C	C	T	rs532734983		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:43023827C>T	ENST00000388752.3	-	4	936	c.512G>A	c.(511-513)cGa>cAa	p.R171Q	MRPL2_ENST00000230413.5_Missense_Mutation_p.R171Q|MRPL2_ENST00000489623.1_Intron|CUL7_ENST00000535468.1_5'Flank|CUL7_ENST00000265348.3_5'Flank	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2	171					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.R171Q(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		ACCTGCCATTCGGCCTATGTG	0.517																																					p.R171Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G512A	6						.						114.0	107.0	109.0					6																	43023827		2203	4300	6503	43131805	SO:0001583	missense	51069	exon4			AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.512G>A	6.37:g.43023827C>T	ENSP00000373404:p.Arg171Gln		43131805	NM_015950	B2RC56|Q8WUL1|Q96Q56|Q9Y311	Missense_Mutation	SNP	ENST00000388752.3	37	CCDS34454.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976867	0.92982	.	.	ENSG00000112651	ENST00000388752;ENST00000230413	T	0.44083	0.93	5.85	4.98	0.66077	Nucleic acid-binding, OB-fold-like (1);	0.057434	0.64402	N	0.000003	T	0.56426	0.1984	M	0.77406	2.37	0.80722	D	1	D;D	0.89917	0.992;1.0	B;D	0.91635	0.44;0.999	T	0.64681	-0.6350	10	0.87932	D	0	-4.6752	13.1913	0.59713	0.0:0.9265:0.0:0.0735	.	171;171	B4DVE2;Q5T653	.;RM02_HUMAN	Q	171	ENSP00000373404:R171Q	ENSP00000230413:R171Q	R	-	2	0	MRPL2	43131805	1.000000	0.71417	0.909000	0.35828	0.894000	0.52154	4.651000	0.61447	1.471000	0.48121	0.655000	0.94253	CGA		0.517	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040577.2		
SLC22A7	10864	hgsc.bcm.edu	37	6	43267785	43267785	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:43267785C>A	ENST00000372585.5	+	5	903	c.808C>A	c.(808-810)Cca>Aca	p.P270T	SLC22A7_ENST00000372574.3_Missense_Mutation_p.P268T|SLC22A7_ENST00000372589.3_Missense_Mutation_p.P268T|SLC22A7_ENST00000487175.1_3'UTR	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	270					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.P270T(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	GCCTTGTGCCCCAGGCATCCT	0.577																																					p.P268T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C802A	6						.						160.0	120.0	134.0					6																	43267785		2203	4300	6503	43375763	SO:0001583	missense	10864	exon4			AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.808C>A	6.37:g.43267785C>A	ENSP00000361666:p.Pro270Thr		43375763	NM_006672	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	ENST00000372585.5	37	CCDS4893.2	.	.	.	.	.	.	.	.	.	.	C	7.347	0.622138	0.14193	.	.	ENSG00000137204	ENST00000451757;ENST00000372589;ENST00000372585;ENST00000372574	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.55	5.55	0.83447	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.605709	0.16912	N	0.194479	T	0.40297	0.1111	M	0.70275	2.135	0.80722	D	1	B;B;B	0.16603	0.018;0.014;0.014	B;B;B	0.16722	0.016;0.009;0.009	T	0.37291	-0.9712	10	0.46703	T	0.11	.	12.7304	0.57195	0.0:0.8348:0.1652:0.0	.	270;268;268	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	T	142;268;270;268	ENSP00000416052:P142T;ENSP00000361670:P268T;ENSP00000361666:P270T;ENSP00000361655:P268T	ENSP00000361655:P268T	P	+	1	0	SLC22A7	43375763	0.007000	0.16637	0.596000	0.28811	0.002000	0.02628	1.000000	0.29770	2.604000	0.88044	0.563000	0.77884	CCA		0.577	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1		
POLH	5429	hgsc.bcm.edu	37	6	43565465	43565465	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:43565465C>T	ENST00000372236.4	+	5	818	c.523C>T	c.(523-525)Ctc>Ttc	p.L175F	POLH_ENST00000535400.1_Missense_Mutation_p.L113F|POLH_ENST00000372226.1_Missense_Mutation_p.L175F	NM_006502.2	NP_006493.1	O75417	DPOLQ_HUMAN	polymerase (DNA directed), eta	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.L175F(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			ATTTCAATGGCTCGATTCTCT	0.403								DNA polymerases (catalytic subunits)	Xeroderma Pigmentosum																												p.L175F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C523T	6						.						94.0	92.0	93.0					6																	43565465		2203	4300	6503	43673443	SO:0001583	missense	5429	exon5	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AB024313	CCDS4902.1	6p21	2014-09-17			ENSG00000170734	ENSG00000170734			9181	protein-coding gene	gene with protein product		603968				10385124, 10398605	Standard	NM_006502		Approved	RAD30A, XP-V	uc003ovq.4	Q9Y253	OTTHUMG00000014743	ENST00000372236.4:c.523C>T	6.37:g.43565465C>T	ENSP00000361310:p.Leu175Phe		43673443	NM_006502	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000372236.4	37	CCDS4902.1	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757872	0.69648	.	.	ENSG00000170734	ENST00000372236;ENST00000535400;ENST00000372226	T;T;T	0.71934	-0.61;-0.61;-0.61	5.41	5.41	0.78517	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.071067	0.64402	D	0.000017	T	0.78438	0.4283	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.76567	-0.2912	10	0.40728	T	0.16	-12.0443	18.0253	0.89266	0.0:1.0:0.0:0.0	.	113;175	B4DG64;Q9Y253	.;POLH_HUMAN	F	175;113;175	ENSP00000361310:L175F;ENSP00000442102:L113F;ENSP00000361300:L175F	ENSP00000361300:L175F	L	+	1	0	POLH	43673443	1.000000	0.71417	1.000000	0.80357	0.368000	0.29767	3.421000	0.52742	2.548000	0.85928	0.472000	0.43445	CTC		0.403	POLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040666.1	NM_006502	
CD2AP	23607	hgsc.bcm.edu	37	6	47549760	47549760	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:47549760C>A	ENST00000359314.5	+	11	1523	c.1067C>A	c.(1066-1068)gCt>gAt	p.A356D		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	356	Pro-rich.				mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)	p.A356D(1)		kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			GAACTGATAGCTGCAGAGAAG	0.294																																					p.A356D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1067A	6						.						58.0	64.0	62.0					6																	47549760		2203	4299	6502	47657719	SO:0001583	missense	23607	exon11			AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.1067C>A	6.37:g.47549760C>A	ENSP00000352264:p.Ala356Asp		47657719	NM_012120	A6NL34|Q5VYA3|Q9UG97	Missense_Mutation	SNP	ENST00000359314.5	37	CCDS34472.1	.	.	.	.	.	.	.	.	.	.	C	9.853	1.194296	0.22037	.	.	ENSG00000198087	ENST00000359314	T	0.26067	1.76	5.38	2.56	0.30785	Src homology-3 domain (1);	0.509864	0.14377	U	0.323383	T	0.04907	0.0132	L	0.44542	1.39	0.09310	N	1	B	0.33413	0.411	B	0.29353	0.101	T	0.34304	-0.9834	10	0.11794	T	0.64	-1.9475	2.7822	0.05364	0.1486:0.5339:0.1631:0.1544	.	356	Q9Y5K6	CD2AP_HUMAN	D	356	ENSP00000352264:A356D	ENSP00000352264:A356D	A	+	2	0	CD2AP	47657719	0.183000	0.23186	0.046000	0.18839	0.526000	0.34562	0.784000	0.26816	0.729000	0.32403	0.491000	0.48974	GCT		0.294	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040817.2		
CRISP2	7180	hgsc.bcm.edu	37	6	49676895	49676895	+	Silent	SNP	C	C	T	rs142085951		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:49676895C>T	ENST00000339139.4	-	4	251	c.15G>A	c.(13-15)ccG>ccA	p.P5P		NM_001142407.2|NM_001142408.2|NM_001142417.2|NM_001142435.2|NM_001261822.1|NM_003296.3	NP_001135879.1|NP_001135880.1|NP_001135889.1|NP_001135907.1|NP_001248751.1|NP_003287.1	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2	5					single organismal cell-cell adhesion (GO:0016337)	extracellular space (GO:0005615)		p.P5P(1)		kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			GAAACAACACCGGTAGTAAAG	0.373													C|||	1	0.000199681	0.0	0.0	5008	,	,		20475	0.001		0.0	False		,,,				2504	0.0				p.P5P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G15A	6						.						93.0	91.0	92.0					6																	49676895		2203	4300	6503	49784854	SO:0001819	synonymous_variant	7180	exon4			X95239	CCDS4928.1	6p12.3	2009-03-12	2003-09-03	2003-09-05	ENSG00000124490	ENSG00000124490			12024	protein-coding gene	gene with protein product	"""cancer/testis antigen 36"""	187430	"""testis specific protein 1 (probe H4-1 p3-1)"""	GAPDL5, TPX1		2613236, 8665901	Standard	NM_003296		Approved	CRISP-2, CT36	uc003ozo.3	P16562	OTTHUMG00000014822	ENST00000339139.4:c.15G>A	6.37:g.49676895C>T			49784854	NM_003296	A8K8M0|Q53FF2|Q5U8Z9|Q7Z7B2	Silent	SNP	ENST00000339139.4	37	CCDS4928.1																																																																																				0.373	CRISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040870.2	NM_003296	
IMPG1	3617	hgsc.bcm.edu	37	6	76660442	76660442	+	Missense_Mutation	SNP	G	G	A	rs190423460		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:76660442G>A	ENST00000369950.3	-	13	1850	c.1661C>T	c.(1660-1662)tCa>tTa	p.S554L	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1									p.S554L(1)		breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CTGTAAAGCTGAGACAGGAGT	0.498																																					p.S554L	Pancreas(37;839 1141 2599 26037)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1661T	6						.						95.0	83.0	87.0					6																	76660442		2203	4300	6503	76717162	SO:0001583	missense	3617	exon13			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1661C>T	6.37:g.76660442G>A	ENSP00000358966:p.Ser554Leu		76717162	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	37	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200461	0.79015	.	.	ENSG00000112706	ENST00000369950	T	0.20332	2.08	5.67	5.67	0.87782	.	0.195254	0.36338	N	0.002657	T	0.08935	0.0221	N	0.14661	0.345	0.80722	D	1	B	0.25850	0.136	B	0.24006	0.05	T	0.10660	-1.0620	10	0.72032	D	0.01	.	19.7667	0.96346	0.0:0.0:1.0:0.0	.	554	Q17R60	IMPG1_HUMAN	L	554	ENSP00000358966:S554L	ENSP00000358966:S554L	S	-	2	0	IMPG1	76717162	0.660000	0.27420	0.072000	0.20136	0.320000	0.28249	3.029000	0.49712	2.660000	0.90430	0.650000	0.86243	TCA		0.498	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
CCDC28A	25901	hgsc.bcm.edu	37	6	139097330	139097330	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:139097330delA	ENST00000332797.6	+	2	498	c.343delA	c.(343-345)aaafs	p.K116fs		NM_015439.2	NP_056254.1	Q8IWP9	CC28A_HUMAN	coiled-coil domain containing 28A	116								p.N117fs*5(2)		autonomic_ganglia(1)|large_intestine(3)|lung(8)|ovary(1)	13				OV - Ovarian serous cystadenocarcinoma(155;0.000201)|GBM - Glioblastoma multiforme(68;0.000306)		TGTCAATGCCAAAAAAAATGC	0.413																																					p.K115fs												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.343delA	6						.						112.0	108.0	109.0					6																	139097330		2203	4300	6503	139139023	SO:0001589	frameshift_variant	25901	exon2			AY167571	CCDS5192.1	6q23.1-q24.1	2008-02-05	2005-09-12	2005-09-12	ENSG00000024862	ENSG00000024862			21098	protein-coding gene	gene with protein product		615353	"""chromosome 6 open reading frame 80"""	C6orf80			Standard	NM_015439		Approved	CCRL1AP, DKFZp586D0623	uc003qie.3	Q8IWP9	OTTHUMG00000015683	ENST00000332797.6:c.343delA	6.37:g.139097330delA	ENSP00000332716:p.Lys116fs		139139023	NM_015439	E1P591|Q32NC7|Q66K67|Q96E23|Q9Y430	Frame_Shift_Del	DEL	ENST00000332797.6	37	CCDS5192.1																																																																																				0.413	CCDC28A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042444.1	NM_015439	
ARID1B	57492	hgsc.bcm.edu	37	6	157522217	157522224	+	Frame_Shift_Del	DEL	GACGATAT	GACGATAT	-	rs34870395|rs138181857	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	GACGATAT	GACGATAT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:157522217_157522224delGACGATAT	ENST00000350026.5	+	17	4451_4458	c.4450_4457delGACGATAT	c.(4450-4458)gacgatatgfs	p.DDM1484fs	ARID1B_ENST00000367148.1_Frame_Shift_Del_p.DDM1537fs|ARID1B_ENST00000275248.4_Frame_Shift_Del_p.DDM1479fs|ARID1B_ENST00000346085.5_Frame_Shift_Del_p.DDM1497fs	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1484	Pro-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)	p.D1480fs*9(1)		NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GAACCGCACAGACGATATGATGGTACCC	0.572																																					p.1484_1486del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.4450_4457del	6						.																																			157563916	SO:0001589	frameshift_variant	57492	exon17			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4450_4457delGACGATAT	6.37:g.157522217_157522224delGACGATAT	ENSP00000055163:p.Asp1484fs		157563909	NM_017519	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Frame_Shift_Del	DEL	ENST00000350026.5	37	CCDS5251.2																																																																																				0.572	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
PNLDC1	154197	hgsc.bcm.edu	37	6	160240056	160240056	+	Missense_Mutation	SNP	G	G	A	rs145458684		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr6:160240056G>A	ENST00000610273.1	+	17	1474	c.1303G>A	c.(1303-1305)Gag>Aag	p.E435K	PNLDC1_ENST00000392167.3_Missense_Mutation_p.E446K	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	435						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.E435K(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TGGGGTCAGCGAGCAGCAAGT	0.458																																					p.E435K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1303A	6						.	G	LYS/GLU	0,4406		0,0,2203	105.0	105.0	105.0		1303	3.7	1.0	6	dbSNP_134	105	1,8599	1.2+/-3.3	0,1,4299	no	missense	PNLDC1	NM_173516.1	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	435/521	160240056	1,13005	2203	4300	6503	160160046	SO:0001583	missense	154197	exon17			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1303G>A	6.37:g.160240056G>A	ENSP00000476448:p.Glu435Lys		160160046	NM_173516	Q5TAP7|Q8N7X5	Missense_Mutation	SNP	ENST00000610273.1	37	CCDS5271.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.847126	0.32606	0.0	1.16E-4	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	4.57	3.69	0.42338	.	0.096141	0.44902	D	0.000407	T	0.29556	0.0737	L	0.27053	0.805	0.36310	D	0.857614	D;D	0.71674	0.998;0.992	P;B	0.54346	0.749;0.41	T	0.11743	-1.0575	9	0.06757	T	0.87	.	12.4627	0.55741	0.0:0.0:0.8326:0.1674	.	446;435	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	K	435;446	.	ENSP00000275275:E435K	E	+	1	0	PNLDC1	160160046	1.000000	0.71417	1.000000	0.80357	0.197000	0.23852	5.847000	0.69451	1.118000	0.41863	0.462000	0.41574	GAG		0.458	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516	
MYO1C	4641	hgsc.bcm.edu	37	17	1382900	1382900	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:1382900T>C	ENST00000575158.1	-	8	1077	c.901A>G	c.(901-903)Aag>Gag	p.K301E	MYO1C_ENST00000545534.2_Missense_Mutation_p.K312E|MYO1C_ENST00000573198.1_5'UTR|MYO1C_ENST00000359786.5_Missense_Mutation_p.K336E|MYO1C_ENST00000438665.2_Missense_Mutation_p.K317E|MYO1C_ENST00000361007.2_Missense_Mutation_p.K301E			Q12965	MYO1E_HUMAN	myosin IC	306	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)	p.K301E(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GTCAGATACTTGAGCTGGTTC	0.662																																					p.K317E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A949G	17						.						66.0	49.0	55.0					17																	1382900		2203	4300	6503	1329650	SO:0001583	missense	4641	exon8			X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.901A>G	17.37:g.1382900T>C	ENSP00000459174:p.Lys301Glu		1329650	NM_001080950	Q14778	Missense_Mutation	SNP	ENST00000575158.1	37	CCDS11003.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.076711	0.55753	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534;ENST00000535421	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	6.01	6.01	0.97437	Myosin head, motor domain (2);	0.086865	0.85682	D	0.000000	T	0.79257	0.4415	N	0.13198	0.31	0.53005	D	0.99996	B;B;B	0.14805	0.011;0.009;0.009	B;B;B	0.22152	0.038;0.014;0.022	T	0.73886	-0.3841	10	0.38643	T	0.18	.	15.7024	0.77552	0.0:0.0:0.0:1.0	.	312;336;317	B7Z3E5;O00159;O00159-3	.;MYO1C_HUMAN;.	E	336;317;317;301;312;301	ENSP00000352834:K336E;ENSP00000412197:K317E;ENSP00000354283:K301E;ENSP00000437685:K312E	ENSP00000352834:K336E	K	-	1	0	MYO1C	1329650	1.000000	0.71417	1.000000	0.80357	0.668000	0.39293	4.049000	0.57397	2.306000	0.77630	0.496000	0.49642	AAG		0.662	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2		
NCOR1	9611	hgsc.bcm.edu	37	17	15961010	15961010	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:15961010C>T	ENST00000268712.3	-	40	6467	c.6210G>A	c.(6208-6210)tcG>tcA	p.S2070S	NCOR1_ENST00000395857.3_Silent_p.S654S|NCOR1_ENST00000395851.1_Silent_p.S1967S	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2070	ID1. {ECO:0000250}.|Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.S2070S(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGGGAGTCTGCGAGGAAACTT	0.398																																					p.S1967S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5901A	17						.						103.0	104.0	104.0					17																	15961010		2203	4300	6503	15901735	SO:0001819	synonymous_variant	9611	exon39			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.6210G>A	17.37:g.15961010C>T			15901735	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	ENST00000268712.3	37	CCDS11175.1																																																																																				0.398	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
TRPV2	51393	hgsc.bcm.edu	37	17	16338275	16338275	+	Missense_Mutation	SNP	G	G	A	rs547123940		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:16338275G>A	ENST00000338560.7	+	14	2585	c.2186G>A	c.(2185-2187)gGt>gAt	p.G729D	TRPV2_ENST00000577397.1_Missense_Mutation_p.G299D	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	729					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)	p.G729D(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TCAGGGGCAGGTGTCCCTCGT	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19099	0.0		0.0	False		,,,				2504	0.0				p.G729D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2186A	17						.						96.0	78.0	84.0					17																	16338275		2203	4300	6503	16279000	SO:0001583	missense	51393	exon14			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.2186G>A	17.37:g.16338275G>A	ENSP00000342222:p.Gly729Asp		16279000	NM_016113	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	ENST00000338560.7	37	CCDS32576.1	.	.	.	.	.	.	.	.	.	.	G	10.36	1.327781	0.24080	.	.	ENSG00000187688	ENST00000338560	D	0.88664	-2.41	4.98	-3.92	0.04155	.	2.255530	0.02857	N	0.129814	T	0.74183	0.3683	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.66476	-0.5914	10	0.09338	T	0.73	-42.9642	7.9298	0.29895	0.2073:0.5586:0.2341:0.0	.	729	Q9Y5S1	TRPV2_HUMAN	D	729	ENSP00000342222:G729D	ENSP00000342222:G729D	G	+	2	0	TRPV2	16279000	0.000000	0.05858	0.000000	0.03702	0.138000	0.21146	0.021000	0.13489	-0.448000	0.07128	-0.137000	0.14449	GGT		0.617	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113	
TAOK1	57551	hgsc.bcm.edu	37	17	27802705	27802705	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:27802705T>C	ENST00000261716.3	+	4	741	c.222T>C	c.(220-222)atT>atC	p.I74I	TAOK1_ENST00000536202.1_Silent_p.I74I	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	74	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)	p.I74I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			AGGATATTATTAAGGAAGTCA	0.318																																					p.I74I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T222C	17						.						71.0	67.0	68.0					17																	27802705		2203	4299	6502	24826831	SO:0001819	synonymous_variant	57551	exon4			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.222T>C	17.37:g.27802705T>C			24826831	NM_020791	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Silent	SNP	ENST00000261716.3	37	CCDS32601.1																																																																																				0.318	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	NM_020791	
LIG3	3980	hgsc.bcm.edu	37	17	33328297	33328297	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:33328297A>G	ENST00000378526.4	+	17	2486	c.2353A>G	c.(2353-2355)Aca>Gca	p.T785A	LIG3_ENST00000262327.5_Missense_Mutation_p.T785A	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	785					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)	p.T698A(1)|p.T785A(1)		endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	GTGGGAGATCACAGGGGCTGA	0.537								Other BER factors																													p.T785A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2353G	17						.						71.0	66.0	68.0					17																	33328297		2203	4300	6503	30352410	SO:0001583	missense	3980	exon17				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.2353A>G	17.37:g.33328297A>G	ENSP00000367787:p.Thr785Ala		30352410	NM_013975	Q16714|Q6NVK3	Missense_Mutation	SNP	ENST00000378526.4	37	CCDS11284.2	.	.	.	.	.	.	.	.	.	.	A	20.9	4.065228	0.76187	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.61742	0.08;0.08	5.97	5.97	0.96955	DNA ligase, ATP-dependent, C-terminal (1);Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.091326	0.85682	D	0.000000	T	0.40719	0.1128	N	0.11651	0.15	0.80722	D	1	P;P	0.37370	0.592;0.592	B;B	0.37091	0.241;0.241	T	0.38993	-0.9635	10	0.31617	T	0.26	-11.5996	15.6316	0.76912	1.0:0.0:0.0:0.0	.	785;785	P49916;E5KLB6	DNLI3_HUMAN;.	A	785	ENSP00000367787:T785A;ENSP00000262327:T785A	ENSP00000262327:T785A	T	+	1	0	LIG3	30352410	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.737000	0.91562	2.288000	0.76882	0.533000	0.62120	ACA		0.537	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	NM_013975	
UNC45B	146862	hgsc.bcm.edu	37	17	33495230	33495230	+	Silent	SNP	C	C	T	rs113010242		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:33495230C>T	ENST00000268876.5	+	10	1399	c.1302C>T	c.(1300-1302)cgC>cgT	p.R434R	RP11-799D4.3_ENST00000585646.1_RNA|UNC45B_ENST00000433649.1_Silent_p.R434R|UNC45B_ENST00000591048.1_Silent_p.R434R|UNC45B_ENST00000394570.2_Silent_p.R434R|UNC45B_ENST00000378449.1_Silent_p.R434R	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	434					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.R434R(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				GCTCAGAGCGCGAGACGGACC	0.602																																					p.R434R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1302T	17						.						116.0	85.0	96.0					17																	33495230		2203	4300	6503	30519343	SO:0001819	synonymous_variant	146862	exon10			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.1302C>T	17.37:g.33495230C>T			30519343	NM_173167	Q495Q8|Q495Q9	Silent	SNP	ENST00000268876.5	37	CCDS11292.1																																																																																				0.602	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
IGFBP4	3487	hgsc.bcm.edu	37	17	38610312	38610312	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Visver			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:38610312C>T	ENST00000269593.4	+	3	915	c.640C>T	c.(640-642)Cag>Tag	p.Q214*	IGFBP4_ENST00000542955.1_Nonsense_Mutation_p.Q114*	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	214	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.Q214*(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			CCACCCCAAGCAGGTGGGTCT	0.652																																					p.Q214X	GBM(160;940 3581 26177)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C640T	17						.						109.0	102.0	105.0					17																	38610312		2203	4300	6503	35863838	SO:0001587	stop_gained	3487	exon3			M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.640C>T	17.37:g.38610312C>T	ENSP00000269593:p.Gln214*		35863838	NM_001552	A0N9W2|B4E351|Q5U012|Q9UCL6	Nonsense_Mutation	SNP	ENST00000269593.4	37	CCDS11367.1	.	.	.	.	.	.	.	.	.	.	C	39	7.393600	0.98255	.	.	ENSG00000141753	ENST00000542955;ENST00000269593	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-4.6239	18.0867	0.89460	0.0:1.0:0.0:0.0	.	.	.	.	X	114;214	.	ENSP00000269593:Q214X	Q	+	1	0	IGFBP4	35863838	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.658000	0.74407	2.793000	0.96121	0.655000	0.94253	CAG		0.652	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
KRT13	3860	hgsc.bcm.edu	37	17	39661393	39661393	+	Missense_Mutation	SNP	C	C	T	rs138959511	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:39661393C>T	ENST00000246635.3	-	1	456	c.410G>A	c.(409-411)cGt>cAt	p.R137H	AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587118.1_5'Flank|KRT13_ENST00000336861.3_Missense_Mutation_p.R137H|KRT13_ENST00000587544.1_Missense_Mutation_p.R137H	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	137	Coil 1A.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.R137H(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				GTGCCAGTCACGGATCTTCAC	0.602													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17457	0.0		0.001	False		,,,				2504	0.0				p.R137H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G410A	17						.	C	HIS/ARG,HIS/ARG	6,4400	11.4+/-27.6	0,6,2197	125.0	116.0	119.0		410,410	4.9	1.0	17	dbSNP_134	119	0,8600		0,0,4300	yes	missense,missense	KRT13	NM_002274.3,NM_153490.2	29,29	0,6,6497	TT,TC,CC		0.0,0.1362,0.0461	possibly-damaging,possibly-damaging	137/421,137/459	39661393	6,13000	2203	4300	6503	36914919	SO:0001583	missense	3860	exon1				CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.410G>A	17.37:g.39661393C>T	ENSP00000246635:p.Arg137His		36914919	NM_153490	Q53G54|Q6AZK5|Q8N240	Missense_Mutation	SNP	ENST00000246635.3	37	CCDS11396.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	0	0.0	1	0.0013192612137203166	C	16.66	3.184182	0.57800	0.001362	0.0	ENSG00000171401	ENST00000246635;ENST00000336861;ENST00000157775	D;D	0.89270	-2.49;-2.49	4.9	4.9	0.64082	Filament (1);	0.000000	0.46758	D	0.000262	D	0.88603	0.6481	M	0.73217	2.22	0.46521	D	0.999081	B;B;B;B	0.33964	0.223;0.434;0.38;0.434	B;B;B;B	0.38428	0.112;0.273;0.179;0.273	D	0.88651	0.3182	10	0.62326	D	0.03	.	11.7107	0.51623	0.0:0.9194:0.0:0.0806	.	125;137;137;137	P13646-2;A1A4E9;P13646-3;P13646	.;.;.;K1C13_HUMAN	H	137;137;125	ENSP00000246635:R137H;ENSP00000336604:R137H	ENSP00000157775:R125H	R	-	2	0	KRT13	36914919	0.930000	0.31532	0.968000	0.41197	0.447000	0.32167	2.096000	0.41738	2.564000	0.86499	0.655000	0.94253	CGT		0.602	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490	
KRT9	3857	hgsc.bcm.edu	37	17	39723545	39723545	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:39723545C>T	ENST00000246662.4	-	7	1917	c.1852G>A	c.(1852-1854)Gga>Aga	p.G618R	KRT9_ENST00000588431.1_Missense_Mutation_p.G385R	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	618	Tail.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.G618R(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				GATGATTTtccgcttcctcct	0.527																																					p.G618R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1852A	17						.						111.0	101.0	105.0					17																	39723545		2203	4300	6503	36977071	SO:0001583	missense	3857	exon7				CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.1852G>A	17.37:g.39723545C>T	ENSP00000246662:p.Gly618Arg		36977071	NM_000226	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	ENST00000246662.4	37	CCDS32654.1	.	.	.	.	.	.	.	.	.	.	C	0.119	-1.128141	0.01770	.	.	ENSG00000171403	ENST00000246662	D	0.81659	-1.52	2.58	0.0452	0.14229	.	.	.	.	.	T	0.61974	0.2390	N	0.14661	0.345	0.09310	N	1	B	0.16166	0.016	B	0.10450	0.005	T	0.52675	-0.8544	9	0.87932	D	0	.	4.2305	0.10601	0.0:0.481:0.0:0.519	.	618	P35527	K1C9_HUMAN	R	618	ENSP00000246662:G618R	ENSP00000246662:G618R	G	-	1	0	KRT9	36977071	0.263000	0.24083	0.072000	0.20136	0.043000	0.13939	0.115000	0.15540	0.022000	0.15160	0.542000	0.68232	GGA		0.527	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257707.1	NM_000226	
ETV4	2118	hgsc.bcm.edu	37	17	41611278	41611278	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:41611278C>T	ENST00000319349.5	-	6	630	c.332G>A	c.(331-333)aGc>aAc	p.S111N	ETV4_ENST00000393664.2_Missense_Mutation_p.S111N|ETV4_ENST00000591713.1_Missense_Mutation_p.S111N|ETV4_ENST00000538265.1_Missense_Mutation_p.S72N|ETV4_ENST00000545954.1_Missense_Mutation_p.S72N|ETV4_ENST00000545089.1_Missense_Mutation_p.S111N	NM_001079675.2	NP_001073143.1	P43268	ETV4_HUMAN	ets variant 4	111					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|motor neuron axon guidance (GO:0008045)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S111N(1)	EWSR1/ETV4(6)|CANT1/ETV4(3)|TMPRSS2/ETV4(13)|DDX5_ENST00000540698/ETV4(2)|KLK2/ETV4(2)	ovary(2)|upper_aerodigestive_tract(1)	3		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)		CGGCTTCCTGCTGCAGGACAG	0.642			T	"""EWSR1, TMPRSS2, DDX5, KLK2, CANT1"""	"""Ewing sarcoma, Prostate carcinoma"""																																p.S111N	Esophageal Squamous(116;1540 1611 12927 31103 34118)		Dom	yes		17	17q21	2118	"""ets variant gene 4 (E1A enhancer binding protein, E1AF)"""		"""M, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G332A	17						.						44.0	47.0	46.0					17																	41611278		2203	4300	6503	38966804	SO:0001583	missense	2118	exon6			U18018	CCDS11465.1, CCDS58553.1, CCDS59292.1	17q21	2014-04-30	2008-09-12			ENSG00000175832			3493	protein-coding gene	gene with protein product	"""E1A enhancer binding protein"""	600711	"""ets variant gene 4 (E1A enhancer-binding protein, E1AF)"""			8530053, 1547944	Standard	NM_001986		Approved	E1A-F, E1AF, PEA3	uc002idw.3	P43268		ENST00000319349.5:c.332G>A	17.37:g.41611278C>T	ENSP00000321835:p.Ser111Asn		38966804	NM_001986	A8K314|B7Z5J3|B7Z9J6|Q96AW9	Missense_Mutation	SNP	ENST00000319349.5	37	CCDS11465.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.289224	0.59976	.	.	ENSG00000175832	ENST00000319349;ENST00000393664;ENST00000538265;ENST00000545954;ENST00000545089	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79	5.66	4.69	0.59074	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.162448	0.64402	D	0.000002	T	0.25865	0.0630	L	0.41906	1.305	0.43613	D	0.995987	B;B;B	0.27192	0.171;0.029;0.0	B;B;B	0.35899	0.213;0.015;0.003	T	0.06643	-1.0815	10	0.52906	T	0.07	.	11.2184	0.48840	0.0:0.853:0.0:0.147	.	111;72;111	B7Z5F4;B7Z5J3;P43268	.;.;ETV4_HUMAN	N	111;111;72;72;111	ENSP00000321835:S111N;ENSP00000377273:S111N;ENSP00000443846:S72N;ENSP00000440023:S72N;ENSP00000441749:S111N	ENSP00000321835:S111N	S	-	2	0	ETV4	38966804	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.629000	0.54266	1.371000	0.46172	0.650000	0.86243	AGC		0.642	ETV4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453489.1	NM_001986	
G6PC3	92579	hgsc.bcm.edu	37	17	42152695	42152695	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:42152695C>T	ENST00000269097.4	+	5	784	c.553C>T	c.(553-555)Ctg>Ttg	p.L185L		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	185			L -> P (in SCN4). {ECO:0000269|PubMed:19118303}.		carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)	p.L185L(1)		endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CCTGGGCTGGCTGATGACTCC	0.597																																					p.L185L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C553T	17						.						103.0	93.0	96.0					17																	42152695		2203	4300	6503	39508221	SO:0001819	synonymous_variant	92579	exon5			BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.553C>T	17.37:g.42152695C>T			39508221	NM_138387	Q8WU15	Silent	SNP	ENST00000269097.4	37	CCDS11476.1																																																																																				0.597	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457675.1	NM_138387	
FZD2	2535	hgsc.bcm.edu	37	17	42636195	42636195	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:42636195C>T	ENST00000315323.3	+	1	1271	c.1139C>T	c.(1138-1140)cCg>cTg	p.P380L		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	380					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.P380L(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TGGGCCGTGCCGGCCGTCAAG	0.667																																					p.P380L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1139T	17						.						67.0	67.0	67.0					17																	42636195		2203	4299	6502	39991721	SO:0001583	missense	2535	exon1			L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1139C>T	17.37:g.42636195C>T	ENSP00000323901:p.Pro380Leu		39991721	NM_001466	Q0VG82	Missense_Mutation	SNP	ENST00000315323.3	37	CCDS11484.1	.	.	.	.	.	.	.	.	.	.	c	23.0	4.358774	0.82243	.	.	ENSG00000180340	ENST00000541149;ENST00000315323	D	0.91740	-2.9	5.0	5.0	0.66597	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.97676	0.9238	H	0.97240	3.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99466	1.0944	10	0.87932	D	0	.	17.9002	0.88901	0.0:1.0:0.0:0.0	.	380	Q14332	FZD2_HUMAN	L	456;380	ENSP00000323901:P380L	ENSP00000323901:P380L	P	+	2	0	FZD2	39991721	1.000000	0.71417	0.989000	0.46669	0.976000	0.68499	7.811000	0.86092	2.291000	0.77112	0.561000	0.74099	CCG		0.667	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457806.1	NM_001466	
SPOP	8405	hgsc.bcm.edu	37	17	47685238	47685238	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:47685238T>C	ENST00000393328.2	-	8	1077	c.712A>G	c.(712-714)Aag>Gag	p.K238E	SPOP_ENST00000504102.1_Missense_Mutation_p.K238E|SPOP_ENST00000347630.2_Missense_Mutation_p.K238E|SPOP_ENST00000393331.3_Missense_Mutation_p.K238E|SPOP_ENST00000503676.1_Missense_Mutation_p.K238E	NM_003563.3	NP_003554.1	O43791	SPOP_HUMAN	speckle-type POZ protein	238	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				glucose homeostasis (GO:0042593)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.K238E(1)		endometrium(18)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(3)|prostate(33)	63						TTACATACCTTTTTGCTCTCC	0.378										Prostate(2;0.17)																											p.K238E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A712G	17						.						288.0	280.0	282.0					17																	47685238		2203	4300	6503	45040237	SO:0001583	missense	8405	exon8			AJ000644	CCDS11551.1	17q21.33	2013-01-09			ENSG00000121067	ENSG00000121067		"""BTB/POZ domain containing"""	11254	protein-coding gene	gene with protein product		602650				9414087	Standard	NM_001007227		Approved	TEF2, BTBD32	uc002ipg.3	O43791	OTTHUMG00000161496	ENST00000393328.2:c.712A>G	17.37:g.47685238T>C	ENSP00000377001:p.Lys238Glu		45040237	NM_001007229	B2R6S3|D3DTW7|Q53HJ1	Missense_Mutation	SNP	ENST00000393328.2	37	CCDS11551.1	.	.	.	.	.	.	.	.	.	.	T	16.51	3.143682	0.57044	.	.	ENSG00000121067	ENST00000393328;ENST00000393331;ENST00000347630;ENST00000504102;ENST00000503536;ENST00000503676;ENST00000513872;ENST00000509079;ENST00000505581	T;T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;0.81	5.19	5.19	0.71726	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.46580	0.1400	N	0.10685	0.025	0.80722	D	1	B	0.30326	0.276	B	0.30105	0.111	T	0.46005	-0.9222	10	0.23891	T	0.37	-1.2529	14.8757	0.70493	0.0:0.0:0.0:1.0	.	238	O43791	SPOP_HUMAN	E	238;238;238;238;122;238;191;238;238	ENSP00000377001:K238E;ENSP00000377004:K238E;ENSP00000240327:K238E;ENSP00000425905:K238E;ENSP00000420908:K238E;ENSP00000426986:K238E;ENSP00000420960:K238E	ENSP00000240327:K238E	K	-	1	0	SPOP	45040237	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.846000	0.86887	2.187000	0.69744	0.459000	0.35465	AAG		0.378	SPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365154.2	NM_003563	
MYCBPAP	84073	hgsc.bcm.edu	37	17	48601070	48601070	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:48601070T>C	ENST00000323776.5	+	12	1851	c.1689T>C	c.(1687-1689)ggT>ggC	p.G563G	MYCBPAP_ENST00000436259.2_Silent_p.G526G	NM_032133.4	NP_115509.4			MYCBP associated protein									p.G526G(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			TATTAGGAGGTGCTATACTGC	0.493																																					p.G563G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1689C	17						.						92.0	91.0	91.0					17																	48601070		2203	4300	6503	45956069	SO:0001819	synonymous_variant	84073	exon12			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.1689T>C	17.37:g.48601070T>C			45956069	NM_032133		Silent	SNP	ENST00000323776.5	37	CCDS32680.2																																																																																				0.493	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133	
CHRNE	1145	hgsc.bcm.edu	37	17	4805561	4805561	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:4805561G>A	ENST00000293780.4	-	4	305	c.295C>T	c.(295-297)Cga>Tga	p.R99*	C17orf107_ENST00000381365.3_3'UTR|CHRNE_ENST00000575637.1_5'UTR	NM_000080.3	NP_000071.1	Q04844	ACHE_HUMAN	cholinergic receptor, nicotinic, epsilon (muscle)	99					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|cation transmembrane transporter activity (GO:0008324)	p.R99*(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)	12					Galantamine(DB00674)	GAAGGGACTCGCAGGGTTTCT	0.602																																					p.R99X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C295T	17						.						81.0	78.0	79.0					17																	4805561		2203	4300	6503	4746340	SO:0001587	stop_gained	1145	exon4			X66403	CCDS11058.1	17p13.2	2012-02-11	2012-02-07		ENSG00000108556	ENSG00000108556		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1966	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, epsilon (muscle)"""	100725	"""cholinergic receptor, nicotinic, epsilon"""			7688301	Standard	NM_000080		Approved	ACHRE	uc002fzk.1	Q04844	OTTHUMG00000090778	ENST00000293780.4:c.295C>T	17.37:g.4805561G>A	ENSP00000293780:p.Arg99*		4746340	NM_000080	D3DTK6	Nonsense_Mutation	SNP	ENST00000293780.4	37	CCDS11058.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.857546	0.32791	.	.	ENSG00000108556	ENST00000293780	.	.	.	4.53	-0.157	0.13387	.	0.101722	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.576	0.56363	0.0:0.0:0.4547:0.5453	.	.	.	.	X	99	.	ENSP00000293780:R99X	R	-	1	2	CHRNE	4746340	0.999000	0.42202	0.877000	0.34402	0.019000	0.09904	2.657000	0.46724	0.234000	0.21139	-1.089000	0.02181	CGA		0.602	CHRNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207560.3		
SLC52A1	55065	hgsc.bcm.edu	37	17	4936909	4936909	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:4936909A>G	ENST00000424747.1	-	3	1587	c.875T>C	c.(874-876)gTg>gCg	p.V292A	SLC52A1_ENST00000254853.5_Missense_Mutation_p.V292A|SLC52A1_ENST00000512825.2_Missense_Mutation_p.V292A	NM_001104577.1	NP_001098047.1	Q9NWF4	S52A1_HUMAN	solute carrier family 52 (riboflavin transporter), member 1	292					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)	p.V292A(1)									GCCATTGGTCACGGCACTGGT	0.647																																					p.V292A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T875C	17						.						77.0	59.0	65.0					17																	4936909		2203	4300	6503	4877633	SO:0001583	missense	55065	exon3			AY070775	CCDS11066.1	17p13.3	2013-07-17	2013-07-17	2012-02-29	ENSG00000132517	ENSG00000132517		"""Solute carriers"""	30225	protein-coding gene	gene with protein product	"""riboflavin transporter 1"""	607883	"""G protein-coupled receptor 172B"""	GPR172B		12740431, 18632736	Standard	NM_001104577		Approved	FLJ10060, GPCR42, PAR2, hRFT1, RFVT1	uc002gao.4	Q9NWF4	OTTHUMG00000099448	ENST00000424747.1:c.875T>C	17.37:g.4936909A>G	ENSP00000399979:p.Val292Ala		4877633	NM_017986	B5MEV1|B5MEV2|Q6P9E0|Q86UT0	Missense_Mutation	SNP	ENST00000424747.1	37	CCDS11066.1	.	.	.	.	.	.	.	.	.	.	A	10.94	1.492750	0.26774	.	.	ENSG00000132517	ENST00000254853;ENST00000512825;ENST00000424747	T;T;T	0.71579	-0.58;-0.58;-0.58	0.913	0.913	0.19354	.	0.000000	0.64402	D	0.000002	T	0.39733	0.1089	N	0.02539	-0.55	0.09310	N	0.999999	B;B	0.09022	0.001;0.002	B;B	0.13407	0.001;0.009	T	0.35992	-0.9766	10	0.54805	T	0.06	.	6.0104	0.19571	1.0:0.0:0.0:0.0	.	292;292	F5H5Y1;Q9NWF4	.;RFT_HUMAN	A	292	ENSP00000254853:V292A;ENSP00000443026:V292A;ENSP00000399979:V292A	ENSP00000254853:V292A	V	-	2	0	GPR172B	4877633	1.000000	0.71417	0.046000	0.18839	0.102000	0.19082	3.562000	0.53777	0.655000	0.30866	0.533000	0.62120	GTG		0.647	SLC52A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216913.1	NM_017986	
ZFP3	124961	hgsc.bcm.edu	37	17	4994948	4994948	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:4994948A>G	ENST00000318833.3	+	2	485	c.149A>G	c.(148-150)cAt>cGt	p.H50R		NM_153018.2	NP_694563.1	Q96NJ6	ZFP3_HUMAN	ZFP3 zinc finger protein	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H50R(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(3)|prostate(1)	20						TTGGAGGGACATTCGAGAGAG	0.433																																					p.H50R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A149G	17						.						107.0	105.0	106.0					17																	4994948		2203	4300	6503	4935672	SO:0001583	missense	124961	exon2			BX647638	CCDS11067.1	17p13.2	2013-01-08	2012-11-27		ENSG00000180787	ENSG00000180787		"""Zinc fingers, C2H2-type"""	12861	protein-coding gene	gene with protein product		194480	"""zinc finger protein homologous to Zfp-3 in mouse"", ""zinc finger protein 3 homolog (mouse)"""				Standard	NM_153018		Approved	FLJ30726, ZNF752	uc002gaq.3	Q96NJ6		ENST00000318833.3:c.149A>G	17.37:g.4994948A>G	ENSP00000320347:p.His50Arg		4935672	NM_153018	A5PLL4	Missense_Mutation	SNP	ENST00000318833.3	37	CCDS11067.1	.	.	.	.	.	.	.	.	.	.	A	6.189	0.403110	0.11754	.	.	ENSG00000180787	ENST00000318833	T	0.08546	3.08	4.23	1.92	0.25849	.	0.000000	0.34362	N	0.004027	T	0.03651	0.0104	N	0.08118	0	0.09310	N	1	B	0.32693	0.38	B	0.29440	0.102	T	0.37979	-0.9682	10	0.56958	D	0.05	-4.6672	6.1923	0.20530	0.6751:0.1658:0.0:0.1591	.	50	Q96NJ6	ZFP3_HUMAN	R	50	ENSP00000320347:H50R	ENSP00000320347:H50R	H	+	2	0	ZFP3	4935672	0.000000	0.05858	0.003000	0.11579	0.468000	0.32798	-0.183000	0.09712	0.373000	0.24621	0.460000	0.39030	CAT		0.433	ZFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438979.1	NM_153018	
ABCC3	8714	hgsc.bcm.edu	37	17	48746537	48746537	+	Silent	SNP	C	C	T	rs376150372		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:48746537C>T	ENST00000285238.8	+	16	2054	c.1974C>T	c.(1972-1974)gcC>gcT	p.A658A		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	658	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.A658A(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CACTGGTGGCCGTGGTGGGGC	0.612																																					p.A658A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1974T	17						.	C		0,4406		0,0,2203	48.0	58.0	54.0		1974	-7.0	0.8	17		54	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ABCC3	NM_003786.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		658/1528	48746537	1,13005	2203	4300	6503	46101536	SO:0001819	synonymous_variant	8714	exon16			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1974C>T	17.37:g.48746537C>T			46101536	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Silent	SNP	ENST00000285238.8	37	CCDS32681.1																																																																																				0.612	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
STXBP4	252983	hgsc.bcm.edu	37	17	53150298	53150298	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:53150298G>A	ENST00000376352.2	+	13	1256	c.1049G>A	c.(1048-1050)cGt>cAt	p.R350H	STXBP4_ENST00000434978.2_Missense_Mutation_p.R328H	NM_178509.5	NP_848604.3	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	350					cellular response to DNA damage stimulus (GO:0006974)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of keratinocyte proliferation (GO:0010838)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R350H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19						AGAGCCCTGCGTAGTCGGATT	0.393																																					p.R350H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1049A	17						.						88.0	82.0	84.0					17																	53150298		2203	4300	6503	50505297	SO:0001583	missense	252983	exon13			BC041485	CCDS11584.2	17q22	2008-02-05			ENSG00000166263	ENSG00000166263			19694	protein-coding gene	gene with protein product		610415				12855681	Standard	XM_005257187		Approved	Synip, MGC50337	uc002iuf.1	Q6ZWJ1	OTTHUMG00000074043	ENST00000376352.2:c.1049G>A	17.37:g.53150298G>A	ENSP00000365530:p.Arg350His		50505297	NM_178509	Q8IVZ5	Missense_Mutation	SNP	ENST00000376352.2	37	CCDS11584.2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345424	0.82022	.	.	ENSG00000166263	ENST00000376352;ENST00000434978	D;T	0.81659	-1.52;0.66	5.57	5.57	0.84162	.	0.059161	0.64402	D	0.000006	D	0.87253	0.6131	L	0.52573	1.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73708	0.981;0.98	D	0.86699	0.1928	10	0.48119	T	0.1	-4.7127	18.5196	0.90947	0.0:0.0:1.0:0.0	.	328;350	E7EPP7;Q6ZWJ1	.;STXB4_HUMAN	H	350;328	ENSP00000365530:R350H;ENSP00000391087:R328H	ENSP00000365530:R350H	R	+	2	0	STXBP4	50505297	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	6.256000	0.72473	2.593000	0.87608	0.650000	0.86243	CGT		0.393	STXBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157184.1	NM_178509	
ABCA10	10349	hgsc.bcm.edu	37	17	67148195	67148195	+	Silent	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:67148195A>C	ENST00000269081.4	-	37	5295	c.4386T>G	c.(4384-4386)gcT>gcG	p.A1462A	ABCA10_ENST00000416101.2_3'UTR|ABCA10_ENST00000519732.1_5'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	1462					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A1462A(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TTTCCTGCCAAGCAGCCTGTG	0.393																																					p.A1462A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T4386G	17						.						125.0	127.0	127.0					17																	67148195		2203	4300	6503	64659790	SO:0001819	synonymous_variant	10349	exon37			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.4386T>G	17.37:g.67148195A>C			64659790	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Silent	SNP	ENST00000269081.4	37	CCDS11684.1																																																																																				0.393	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
C17orf49	124944	hgsc.bcm.edu	37	17	6919952	6919952	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:6919952C>T	ENST00000439424.2	+	4	433	c.357C>T	c.(355-357)agC>agT	p.S119S	MIR497HG_ENST00000385194.1_RNA|RP11-589P10.7_ENST00000572547.1_RNA|MIR497HG_ENST00000385056.1_RNA|C17orf49_ENST00000552775.1_Silent_p.S93S|AC040977.1_ENST00000593646.1_5'Flank|MIR497HG_ENST00000572453.1_RNA|C17orf49_ENST00000552402.1_Silent_p.S85S|C17orf49_ENST00000547709.1_3'UTR|C17orf49_ENST00000546760.1_Silent_p.S119S|RNASEK-C17orf49_ENST00000547302.2_Missense_Mutation_p.A160V|C17orf49_ENST00000546495.1_Silent_p.S119S|MIR497HG_ENST00000443997.1_RNA	NM_001142798.2|NM_174893.3	NP_001136270.1|NP_777553.1	Q8IXM2	BAP18_HUMAN	chromosome 17 open reading frame 49	119					chromatin modification (GO:0016568)	MLL1 complex (GO:0071339)|NURF complex (GO:0016589)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S119S(1)		kidney(1)|large_intestine(2)|ovary(1)	4						CTCCTCCCAGCAGCTCCAGTG	0.597																																					p.S119S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C357T	17						.						70.0	75.0	73.0					17																	6919952		2203	4300	6503	6860676	SO:0001819	synonymous_variant	124944	exon4			AK055800	CCDS32542.1, CCDS45595.1, CCDS45596.1	17p13.1	2013-02-11			ENSG00000258315	ENSG00000258315			28737	protein-coding gene	gene with protein product	"""BPTF associated protein of 18 kDa"", ""human embryo lung cellular protein interacting with SARS-CoV nsp-10"""						Standard	NM_174893		Approved	MGC49942, BAP18, HEPIS		Q8IXM2	OTTHUMG00000170147	ENST00000439424.2:c.357C>T	17.37:g.6919952C>T			6860676	NM_001142798	B4DIV3|C9J4G0|E9PB29	Silent	SNP	ENST00000439424.2	37	CCDS32542.1	.	.	.	.	.	.	.	.	.	.	C	8.552	0.875776	0.17395	.	.	ENSG00000161939	ENST00000547302	.	.	.	5.07	2.94	0.34122	.	.	.	.	.	T	0.49677	0.1571	.	.	.	0.31024	N	0.717955	.	.	.	.	.	.	T	0.57562	-0.7790	3	.	.	.	-11.0602	9.1959	0.37228	0.0:0.76:0.1515:0.0886	.	.	.	.	V	160	.	.	A	+	2	0	C17orf49	6860676	0.860000	0.29831	1.000000	0.80357	0.998000	0.95712	0.540000	0.23191	2.335000	0.79485	0.655000	0.94253	GCA		0.597	C17orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407666.1	NM_174893	
ABCA10	10349	hgsc.bcm.edu	37	17	67187393	67187393	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:67187393A>G	ENST00000269081.4	-	18	2844	c.1935T>C	c.(1933-1935)ccT>ccC	p.P645P	ABCA10_ENST00000416101.2_3'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	645					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.P645P(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					ACTTGGCATCAGGAATGTGCT	0.333																																					p.P645P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1935C	17						.						144.0	132.0	136.0					17																	67187393		2202	4299	6501	64698988	SO:0001819	synonymous_variant	10349	exon18			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.1935T>C	17.37:g.67187393A>G			64698988	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Silent	SNP	ENST00000269081.4	37	CCDS11684.1																																																																																				0.333	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
DNAI2	64446	hgsc.bcm.edu	37	17	72277978	72277978	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:72277978G>A	ENST00000311014.6	+	2	89	c.22G>A	c.(22-24)Gtc>Atc	p.V8I	DNAI2_ENST00000582036.1_Missense_Mutation_p.V8I|DNAI2_ENST00000579490.1_Missense_Mutation_p.V65I|DNAI2_ENST00000307504.5_5'UTR|DNAI2_ENST00000446837.2_Missense_Mutation_p.V8I			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	8					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.V8I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GTACGTGTACGTCAAGAAGCG	0.627									Kartagener syndrome																												p.V8I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G22A	17						.						105.0	88.0	94.0					17																	72277978		2203	4300	6503	69789573	SO:0001583	missense	64446	exon2	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.22G>A	17.37:g.72277978G>A	ENSP00000308312:p.Val8Ile		69789573	NM_023036	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	ENST00000311014.6	37	CCDS11697.1	.	.	.	.	.	.	.	.	.	.	G	10.08	1.251954	0.22880	.	.	ENSG00000171595	ENST00000311014;ENST00000446837	T;T	0.64991	-0.13;-0.13	5.22	-9.78	0.00496	.	1.337880	0.05412	N	0.542713	T	0.29652	0.0740	N	0.04203	-0.255	0.18873	N	0.999987	B	0.10296	0.003	B	0.06405	0.002	T	0.12041	-1.0563	10	0.17832	T	0.49	-28.0573	7.1971	0.25860	0.2214:0.544:0.1134:0.1211	.	8	Q9GZS0	DNAI2_HUMAN	I	8	ENSP00000308312:V8I;ENSP00000400252:V8I	ENSP00000308312:V8I	V	+	1	0	DNAI2	69789573	0.000000	0.05858	0.049000	0.19019	0.984000	0.73092	-0.905000	0.04075	-1.055000	0.03209	-0.893000	0.02921	GTC		0.627	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442537.1	NM_023036	
TMEM104	54868	hgsc.bcm.edu	37	17	72781659	72781659	+	Silent	SNP	G	G	A	rs555178328		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:72781659G>A	ENST00000335464.5	+	3	246	c.84G>A	c.(82-84)acG>acA	p.T28T	TMEM104_ENST00000417024.2_Intron|TMEM104_ENST00000582773.1_Silent_p.T28T|TMEM104_ENST00000582330.1_Silent_p.T28T	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	28						integral component of membrane (GO:0016021)		p.T28T(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					TCGTGGGCACGGGCGCACTCA	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		21298	0.0		0.001	False		,,,				2504	0.0				p.T28T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G84A	17						.						131.0	109.0	116.0					17																	72781659		2203	4300	6503	70293254	SO:0001819	synonymous_variant	54868	exon3			AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.84G>A	17.37:g.72781659G>A			70293254	NM_017728	Q8TEU1|Q9NT56|Q9NXH1	Silent	SNP	ENST00000335464.5	37	CCDS32723.1																																																																																				0.582	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444442.1	NM_017728	
QRICH2	84074	hgsc.bcm.edu	37	17	74287232	74287232	+	Silent	SNP	C	C	T	rs150036961	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:74287232C>T	ENST00000262765.5	-	4	3257	c.3078G>A	c.(3076-3078)acG>acA	p.T1026T		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1026								p.T1026T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						TCTCCACTGCCGTGGGGAAAC	0.532																																					p.T1026T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3078A	17						.						117.0	112.0	113.0					17																	74287232		2203	4300	6503	71798827	SO:0001819	synonymous_variant	84074	exon4			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3078G>A	17.37:g.74287232C>T			71798827	NM_032134	A2RRE1|Q96LM3	Silent	SNP	ENST00000262765.5	37	CCDS32741.1																																																																																				0.532	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
RHBDF2	79651	hgsc.bcm.edu	37	17	74467891	74467891	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:74467891A>G	ENST00000313080.4	-	19	2668	c.2395T>C	c.(2395-2397)Tac>Cac	p.Y799H	RHBDF2_ENST00000591885.1_Missense_Mutation_p.Y770H|RHBDF2_ENST00000389760.4_Missense_Mutation_p.Y770H	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	799					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)	p.Y799H(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						CGCTTGCGGTACTTGTCGCTG	0.622																																					p.Y799H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2395C	17						.						105.0	74.0	85.0					17																	74467891		2200	4297	6497	71979486	SO:0001583	missense	79651	exon19			BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.2395T>C	17.37:g.74467891A>G	ENSP00000322775:p.Tyr799His		71979486	NM_024599	A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Missense_Mutation	SNP	ENST00000313080.4	37	CCDS32743.1	.	.	.	.	.	.	.	.	.	.	A	15.81	2.943412	0.53079	.	.	ENSG00000129667	ENST00000313080;ENST00000389760	T;T	0.56941	0.43;0.44	4.52	4.52	0.55395	.	0.072537	0.56097	D	0.000022	T	0.42698	0.1214	L	0.45137	1.4	0.50313	D	0.999861	B;B	0.31383	0.215;0.321	B;B	0.29353	0.101;0.086	T	0.29518	-1.0009	10	0.17369	T	0.5	-38.0749	14.0152	0.64519	1.0:0.0:0.0:0.0	.	799;770	Q6PJF5;Q6PJF5-2	RHDF2_HUMAN;.	H	799;770	ENSP00000322775:Y799H;ENSP00000374410:Y770H	ENSP00000322775:Y799H	Y	-	1	0	RHBDF2	71979486	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.230000	0.78097	1.924000	0.55735	0.383000	0.25322	TAC		0.622	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450134.1	NM_024599	
ST6GALNAC2	10610	hgsc.bcm.edu	37	17	74563543	74563543	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:74563543A>G	ENST00000225276.5	-	8	1268	c.949T>C	c.(949-951)Tgt>Cgt	p.C317R	RP11-666A8.9_ENST00000588104.1_RNA	NM_006456.2	NP_006447.2	Q9UJ37	SIA7B_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2	317					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)	p.C317R(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	11						ACCTGGTCACAGGTATGCAAA	0.493																																					p.C317R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T949C	17						.						96.0	93.0	94.0					17																	74563543		2202	4300	6502	72075138	SO:0001583	missense	10610	exon8			U14550	CCDS11747.1	17q25.1	2013-03-01	2003-12-05	2005-02-07	ENSG00000070731	ENSG00000070731	2.4.99.7	"""Sialyltransferases"""	10867	protein-coding gene	gene with protein product		610137	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase)"", ""sialyltransferase-like 1"""	SIAT7, SIAT7B, SIATL1		11984005	Standard	NM_006456		Approved	ST6GalNAII, STHM	uc002jsg.4	Q9UJ37	OTTHUMG00000180301	ENST00000225276.5:c.949T>C	17.37:g.74563543A>G	ENSP00000225276:p.Cys317Arg		72075138	NM_006456	Q12971	Missense_Mutation	SNP	ENST00000225276.5	37	CCDS11747.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.938272	0.73557	.	.	ENSG00000070731	ENST00000225276	D	0.82893	-1.66	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.94235	0.8149	H	0.97682	4.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96042	0.9025	10	0.87932	D	0	-17.0464	14.4583	0.67431	1.0:0.0:0.0:0.0	.	317	Q9UJ37	SIA7B_HUMAN	R	317	ENSP00000225276:C317R	ENSP00000225276:C317R	C	-	1	0	ST6GALNAC2	72075138	1.000000	0.71417	0.997000	0.53966	0.812000	0.45895	8.072000	0.89496	2.062000	0.61559	0.533000	0.62120	TGT		0.493	ST6GALNAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450650.1	NM_006456	
SLC26A11	284129	hgsc.bcm.edu	37	17	78201670	78201670	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:78201670A>C	ENST00000361193.3	+	7	927	c.647A>C	c.(646-648)aAg>aCg	p.K216T	SLC26A11_ENST00000572725.1_Missense_Mutation_p.K216T|SLC26A11_ENST00000411502.3_Missense_Mutation_p.K216T|SLC26A11_ENST00000546047.2_Missense_Mutation_p.K216T	NM_001166347.1|NM_173626.3	NP_001159819.1|NP_775897.3			solute carrier family 26 (anion exchanger), member 11									p.K216T(1)		central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	28	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CTGGTGCTGAAGCTGATGCGG	0.692																																					p.K216T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A647C	17						.						95.0	76.0	83.0					17																	78201670		2203	4300	6503	75816265	SO:0001583	missense	284129	exon6				CCDS11771.2	17q25	2013-07-18	2013-07-18		ENSG00000181045	ENSG00000181045		"""Solute carriers"""	14471	protein-coding gene	gene with protein product		610117	"""solute carrier family 26, member 11"""				Standard	NM_001166347		Approved		uc010dhv.2	Q86WA9	OTTHUMG00000133419	ENST00000361193.3:c.647A>C	17.37:g.78201670A>C	ENSP00000355384:p.Lys216Thr		75816265	NM_001166349		Missense_Mutation	SNP	ENST00000361193.3	37	CCDS11771.2	.	.	.	.	.	.	.	.	.	.	A	15.13	2.742065	0.49151	.	.	ENSG00000181045	ENST00000411502;ENST00000546047;ENST00000361193	D;D;D	0.93712	-3.27;-3.27;-3.27	4.52	4.52	0.55395	Sulphate transporter (1);	0.465993	0.20998	N	0.081918	D	0.91895	0.7434	M	0.72576	2.205	0.30590	N	0.761658	B	0.24823	0.112	B	0.31946	0.138	D	0.89435	0.3719	10	0.49607	T	0.09	-28.1316	7.9899	0.30235	0.9029:0.0:0.0971:0.0	.	216	Q86WA9	S2611_HUMAN	T	216	ENSP00000403998:K216T;ENSP00000440724:K216T;ENSP00000355384:K216T	ENSP00000355384:K216T	K	+	2	0	SLC26A11	75816265	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.342000	0.33919	1.675000	0.50919	0.402000	0.26972	AAG		0.692	SLC26A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257281.1		
DNAH2	146754	hgsc.bcm.edu	37	17	7720675	7720675	+	Missense_Mutation	SNP	T	T	C	rs370528101		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:7720675T>C	ENST00000572933.1	+	65	11422	c.9962T>C	c.(9961-9963)aTg>aCg	p.M3321T	DNAH2_ENST00000389173.2_Missense_Mutation_p.M3321T			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3321					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.M3321T(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGTCCTACATGGGACCCTTC	0.607																																					p.M3321T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T9962C	17						.						81.0	85.0	83.0					17																	7720675		2203	4300	6503	7661400	SO:0001583	missense	146754	exon64			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.9962T>C	17.37:g.7720675T>C	ENSP00000458355:p.Met3321Thr		7661400	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	T	14.52	2.560385	0.45590	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.74209	-0.82	5.0	5.0	0.66597	Dynein heavy chain, coiled coil stalk (1);	0.092745	0.64402	D	0.000001	T	0.67373	0.2886	L	0.40543	1.245	0.80722	D	1	B;B	0.27264	0.101;0.173	B;B	0.32022	0.053;0.139	T	0.65792	-0.6082	10	0.40728	T	0.16	.	12.3095	0.54920	0.0:0.0:0.0:1.0	.	3282;3321	Q9P225-2;Q9P225	.;DYH2_HUMAN	T	3282;3321	ENSP00000373825:M3321T	ENSP00000353818:M3282T	M	+	2	0	DNAH2	7661400	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.842000	0.75379	2.097000	0.63578	0.460000	0.39030	ATG		0.607	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
DNAH2	146754	hgsc.bcm.edu	37	17	7720679	7720679	+	Silent	SNP	A	A	G	rs375895814		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:7720679A>G	ENST00000572933.1	+	65	11426	c.9966A>G	c.(9964-9966)ggA>ggG	p.G3322G	DNAH2_ENST00000389173.2_Silent_p.G3322G			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3322					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G3322G(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTACATGGGACCCTTCCTGA	0.607																																					p.G3322G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A9966G	17						.						83.0	87.0	86.0					17																	7720679		2203	4300	6503	7661404	SO:0001819	synonymous_variant	146754	exon64			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.9966A>G	17.37:g.7720679A>G			7661404	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																				0.607	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
RNF213	57674	hgsc.bcm.edu	37	17	78341937	78341937	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr17:78341937C>T	ENST00000582970.1	+	44	12292	c.12149C>T	c.(12148-12150)gCg>gTg	p.A4050V	CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.A2123V|RNF213_ENST00000508628.2_Missense_Mutation_p.A4099V	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4050					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A2123V(1)|p.A4099V(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GTTTCCCAAGCGCACAGGTAC	0.443																																					p.A4099V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C12296T	17						.						144.0	139.0	140.0					17																	78341937		2203	4300	6503	75956532	SO:0001583	missense	57674	exon45			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.12149C>T	17.37:g.78341937C>T	ENSP00000464087:p.Ala4050Val		75956532	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	2.569	-0.300157	0.05532	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.23754	1.89	4.67	-1.79	0.07932	Zinc finger, RING/FYVE/PHD-type (1);	1.198480	0.05865	N	0.623652	T	0.13586	0.0329	N	0.16266	0.395	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.26224	-1.0109	10	0.33940	T	0.23	.	3.4765	0.07586	0.5925:0.117:0.0679:0.2227	.	4099;2123	C9JCP4;Q63HN8	.;RN213_HUMAN	V	4050;4099;2123	ENSP00000338218:A2123V	ENSP00000338218:A2123V	A	+	2	0	RNF213	75956532	0.945000	0.32115	0.003000	0.11579	0.000000	0.00434	2.261000	0.43276	-0.618000	0.05656	-4.147000	0.00010	GCG		0.443	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
PAXBP1	94104	hgsc.bcm.edu	37	21	34132276	34132276	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr21:34132276A>G	ENST00000331923.4	-	6	1194	c.1005T>C	c.(1003-1005)aaT>aaC	p.N335N	PAXBP1_ENST00000472588.1_5'UTR|PAXBP1_ENST00000290178.4_Silent_p.N335N	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	335					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N335N(1)									GGTAGTACATATTCACTTCTG	0.383																																					p.N335N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1005C	21						.						117.0	121.0	119.0					21																	34132276		2203	4300	6503	33054147	SO:0001819	synonymous_variant	94104	exon6			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.1005T>C	21.37:g.34132276A>G			33054147	NM_013329	D3DSE7|Q96DU8|Q9NYQ0	Silent	SNP	ENST00000331923.4	37	CCDS13619.1																																																																																				0.383	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139563.1	NM_013329	
BACE2	25825	hgsc.bcm.edu	37	21	42647413	42647416	+	Frame_Shift_Del	DEL	TGCG	TGCG	-	rs559873325		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	TGCG	TGCG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr21:42647413_42647416delTGCG	ENST00000330333.6	+	9	1882_1885	c.1419_1422delTGCG	c.(1417-1422)tatgcgfs	p.YA473fs	BACE2_ENST00000466122.1_3'UTR|BACE2_ENST00000347667.5_Frame_Shift_Del_p.YA423fs|BACE2_ENST00000328735.6_3'UTR	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	473					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)	p.A474fs*2(1)		endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				TTGTGTCCTATGCGCTCATGAGCG	0.564																																					p.423_424del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1269_1272del	21						.																																			41569286	SO:0001589	frameshift_variant	25825	exon8			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.1419_1422delTGCG	21.37:g.42647413_42647416delTGCG	ENSP00000332979:p.Tyr473fs		41569283	NM_138991	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Frame_Shift_Del	DEL	ENST00000330333.6	37	CCDS13668.1																																																																																				0.564	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
PRDM15	63977	hgsc.bcm.edu	37	21	43282100	43282100	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr21:43282100C>T	ENST00000269844.3	-	6	746	c.636G>A	c.(634-636)aaG>aaA	p.K212K	PRDM15_ENST00000398548.1_Intron|PRDM15_ENST00000538201.1_Intron|PRDM15_ENST00000447207.2_5'Flank|PRDM15_ENST00000422911.1_Intron	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	212					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.K212K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CGCATTCGGCCTTGCCTGCCC	0.547																																					p.K212K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G636A	21						.						73.0	55.0	61.0					21																	43282100		2203	4300	6503	42155169	SO:0001819	synonymous_variant	63977	exon6			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.636G>A	21.37:g.43282100C>T			42155169	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Silent	SNP	ENST00000269844.3	37	CCDS13676.1																																																																																				0.547	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
NUBP1	4682	hgsc.bcm.edu	37	16	10851770	10851770	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:10851770G>T	ENST00000283027.5	+	7	511	c.492G>T	c.(490-492)gaG>gaT	p.E164D	NUBP1_ENST00000433392.2_Missense_Mutation_p.E153D|NUBP1_ENST00000571790.1_3'UTR	NM_002484.2	NP_002475.2			nucleotide binding protein 1									p.E164D(1)		large_intestine(2)|lung(3)|ovary(1)|skin(4)	10						ACTGGGGAGAGGTCGACTACC	0.527																																					p.E164D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G492T	16						.						146.0	133.0	137.0					16																	10851770		2197	4300	6497	10759271	SO:0001583	missense	4682	exon7			U01833	CCDS10543.1, CCDS61839.1	16p13.13	2014-01-13	2011-05-19		ENSG00000103274	ENSG00000103274			8041	protein-coding gene	gene with protein product		600280	"""nucleotide binding protein 1 (E.coli MinD like)"", ""nucleotide binding protein 1 (MinD homolog, E. coli)"""	NBP1		7926816	Standard	NM_002484		Approved	NBP35	uc002daa.1	P53384	OTTHUMG00000129751	ENST00000283027.5:c.492G>T	16.37:g.10851770G>T	ENSP00000283027:p.Glu164Asp		10759271	NM_002484		Missense_Mutation	SNP	ENST00000283027.5	37	CCDS10543.1	.	.	.	.	.	.	.	.	.	.	G	9.731	1.162235	0.21538	.	.	ENSG00000103274	ENST00000283027;ENST00000433392	T;T	0.39592	1.07;1.07	5.14	-0.341	0.12639	Mrp, conserved site (1);ATPase, AAA+ type, core (1);	0.258494	0.44097	N	0.000486	T	0.17534	0.0421	N	0.16478	0.41	0.36870	D	0.888864	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.07947	-1.0746	10	0.16896	T	0.51	-9.8332	1.4607	0.02395	0.2476:0.3643:0.2509:0.1373	.	153;164	P53384-2;P53384	.;NUBP1_HUMAN	D	164;153	ENSP00000283027:E164D;ENSP00000409654:E153D	ENSP00000283027:E164D	E	+	3	2	NUBP1	10759271	0.002000	0.14202	0.564000	0.28396	0.964000	0.63967	-0.520000	0.06252	-0.052000	0.13311	0.561000	0.74099	GAG		0.527	NUBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251964.2	NM_002484	
ABCA3	21	hgsc.bcm.edu	37	16	2350120	2350120	+	Silent	SNP	C	C	A	rs368865276		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:2350120C>A	ENST00000301732.5	-	13	2197	c.1497G>T	c.(1495-1497)gcG>gcT	p.A499A	ABCA3_ENST00000382381.3_Silent_p.A441A	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	499					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.A499A(1)		breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	TCCCTGCAACCGCCCTTGGCT	0.542																																					p.A499A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1497T	16						.						137.0	116.0	123.0					16																	2350120		2198	4300	6498	2290121	SO:0001819	synonymous_variant	21	exon13			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.1497G>T	16.37:g.2350120C>A			2290121	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	37	CCDS10466.1																																																																																				0.542	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
CCNF	899	hgsc.bcm.edu	37	16	2488101	2488101	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:2488101G>A	ENST00000397066.4	+	6	659	c.571G>A	c.(571-573)Ggc>Agc	p.G191S		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	191					mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)		p.G191D(1)|p.G191S(1)		breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				GCACTGCTTGGGCAGAGTGCT	0.498																																					p.G191S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G571A	16						.						166.0	147.0	154.0					16																	2488101		2198	4300	6498	2428102	SO:0001583	missense	899	exon6			Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.571G>A	16.37:g.2488101G>A	ENSP00000380256:p.Gly191Ser		2428102	NM_001761	B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	37	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.548938	0.86127	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.26067	1.76	4.36	4.36	0.52297	.	0.230252	0.42682	D	0.000674	T	0.29093	0.0723	L	0.43152	1.355	0.40519	D	0.980813	P	0.48294	0.908	P	0.46585	0.521	T	0.09357	-1.0678	10	0.62326	D	0.03	-30.618	14.4534	0.67401	0.0:0.0:1.0:0.0	.	191	P41002	CCNF_HUMAN	S	191;106	ENSP00000380256:G191S	ENSP00000293968:G106S	G	+	1	0	CCNF	2428102	1.000000	0.71417	0.997000	0.53966	0.849000	0.48306	6.775000	0.75018	2.372000	0.80975	0.655000	0.94253	GGC		0.498	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761	
ZC3H7A	29066	hgsc.bcm.edu	37	16	11873136	11873136	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:11873136G>A	ENST00000396516.2	-	3	389	c.192C>T	c.(190-192)agC>agT	p.S64S	ZC3H7A_ENST00000355758.4_Silent_p.S64S|ZC3H7A_ENST00000575170.1_5'UTR			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	64						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S64S(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						CCGTGTACTGGCTTATCGAGT	0.323																																					p.S64S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C192T	16						.						147.0	155.0	153.0					16																	11873136		2196	4300	6496	11780637	SO:0001819	synonymous_variant	29066	exon4			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.192C>T	16.37:g.11873136G>A			11780637	NM_014153	D3DUG5|Q9NPE9	Silent	SNP	ENST00000396516.2	37	CCDS10550.1																																																																																				0.323	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153	
SEZ6L2	26470	hgsc.bcm.edu	37	16	29908192	29908192	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:29908192C>T	ENST00000308713.5	-	3	989	c.462G>A	c.(460-462)acG>acA	p.T154T	SEZ6L2_ENST00000562159.1_5'UTR|SEZ6L2_ENST00000350527.3_Silent_p.T84T|SEZ6L2_ENST00000537485.1_Silent_p.T110T|SEZ6L2_ENST00000346932.5_Silent_p.T154T	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	154	Thr-rich.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.T154T(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGATGGTGGTCGTCGTCTCCT	0.667																																					p.T154T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G462A	16						.						150.0	96.0	114.0					16																	29908192		2197	4300	6497	29815693	SO:0001819	synonymous_variant	26470	exon3			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.462G>A	16.37:g.29908192C>T			29815693	NM_001114100	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Silent	SNP	ENST00000308713.5	37	CCDS10659.1																																																																																				0.667	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
ITGAL	3683	hgsc.bcm.edu	37	16	30510462	30510462	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:30510462G>A	ENST00000356798.6	+	16	2080	c.1900G>A	c.(1900-1902)Gtg>Atg	p.V634M	ITGAL_ENST00000358164.5_Missense_Mutation_p.V551M|ITGAL_ENST00000433423.2_Intron|RP11-297C4.1_ENST00000563751.1_RNA	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	634					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.V634M(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	AGTGCATGAAGTGGAGTGCTC	0.512																																					p.V551M	NSCLC(110;1462 1641 3311 33990 49495)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1651A	16						.						131.0	102.0	112.0					16																	30510462		2197	4300	6497	30417963	SO:0001583	missense	3683	exon14				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1900G>A	16.37:g.30510462G>A	ENSP00000349252:p.Val634Met		30417963	NM_001114380	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484618	0.84854	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.55760	0.5;0.5	6.14	6.14	0.99180	Integrin alpha-2 (1);	0.000000	0.50627	D	0.000107	T	0.73458	0.3589	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.991	T	0.72272	-0.4342	10	0.51188	T	0.08	.	17.7765	0.88510	0.0:0.0:1.0:0.0	.	551;634	Q96HB1;P20701	.;ITAL_HUMAN	M	634;551	ENSP00000349252:V634M;ENSP00000350886:V551M	ENSP00000349252:V634M	V	+	1	0	ITGAL	30417963	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.849000	0.55910	2.937000	0.99478	0.650000	0.86243	GTG		0.512	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
CREBBP	1387	hgsc.bcm.edu	37	16	3900430	3900430	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:3900430A>G	ENST00000262367.5	-	2	1475	c.666T>C	c.(664-666)gcT>gcC	p.A222A	CREBBP_ENST00000382070.3_Silent_p.A222A	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	222					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A222A(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		ACGGCATTCCAGCTCCCCTTC	0.572			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.A222A			Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T666C	16						.						93.0	85.0	88.0					16																	3900430		2197	4300	6497	3840431	SO:0001819	synonymous_variant	1387	exon2			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.666T>C	16.37:g.3900430A>G			3840431	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	37	CCDS10509.1																																																																																				0.572	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
PRR14	78994	hgsc.bcm.edu	37	16	30666047	30666047	+	Silent	SNP	C	C	T	rs138283893	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:30666047C>T	ENST00000542965.2	+	7	1212	c.756C>T	c.(754-756)tcC>tcT	p.S252S	PRR14_ENST00000300835.4_Silent_p.S252S			Q9BWN1	PRR14_HUMAN	proline rich 14	252	Pro-rich.							p.S252S(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	18			Colorectal(24;0.103)			TCTTCCGTTCCGTCCGCTCCA	0.642																																					p.S252S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C756T	16						.	C		0,4394		0,0,2197	46.0	41.0	43.0		756	1.4	1.0	16	dbSNP_134	43	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PRR14	NM_024031.2		0,1,6496	TT,TC,CC		0.0116,0.0,0.0077		252/586	30666047	1,12993	2197	4300	6497	30573548	SO:0001819	synonymous_variant	78994	exon8			AK074783	CCDS10687.1	16p11.2	2008-02-05			ENSG00000156858	ENSG00000156858			28458	protein-coding gene	gene with protein product						12477932	Standard	NM_024031		Approved	MGC3121	uc002dyy.3	Q9BWN1	OTTHUMG00000132414	ENST00000542965.2:c.756C>T	16.37:g.30666047C>T			30573548	NM_024031	Q8WTX2	Silent	SNP	ENST00000542965.2	37	CCDS10687.1																																																																																				0.642	PRR14-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434433.1	NM_024031	
GLYR1	84656	hgsc.bcm.edu	37	16	4861284	4861284	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:4861284C>A	ENST00000321919.9	-	15	1550	c.1474G>T	c.(1474-1476)Gga>Tga	p.G492*	GLYR1_ENST00000381983.3_Nonsense_Mutation_p.G475*|GLYR1_ENST00000591451.1_Nonsense_Mutation_p.G486*|GLYR1_ENST00000436648.5_Nonsense_Mutation_p.G411*	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	492					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)	p.G492*(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						TTAAAGTTTCCTTGCAGGATA	0.463																																					p.G492X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1474T	16						.						127.0	119.0	122.0					16																	4861284		2197	4300	6497	4801285	SO:0001587	stop_gained	84656	exon15			AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.1474G>T	16.37:g.4861284C>A	ENSP00000322716:p.Gly492*		4801285	NM_032569	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Nonsense_Mutation	SNP	ENST00000321919.9	37	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	C	38	7.025773	0.98010	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.4492	18.6366	0.91380	0.0:1.0:0.0:0.0	.	.	.	.	X	492;475;411	.	ENSP00000322716:G492X	G	-	1	0	GLYR1	4801285	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.765000	0.85310	2.700000	0.92200	0.561000	0.74099	GGA		0.463	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2	NM_032569	
PPL	5493	hgsc.bcm.edu	37	16	4940236	4940236	+	Silent	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:4940236G>T	ENST00000345988.2	-	18	2351	c.2262C>A	c.(2260-2262)ccC>ccA	p.P754P	PPL_ENST00000590782.2_Silent_p.P752P	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	754					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.P754P(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CTGTCTCCTGGGGCTCGTAAC	0.622																																					p.P754P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2262A	16						.						140.0	109.0	120.0					16																	4940236		2197	4300	6497	4880237	SO:0001819	synonymous_variant	5493	exon18			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2262C>A	16.37:g.4940236G>T			4880237	NM_002705	O60314|O60454|Q14C98	Silent	SNP	ENST00000345988.2	37	CCDS10526.1																																																																																				0.622	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
PHKB	5257	hgsc.bcm.edu	37	16	47614263	47614263	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:47614263C>T	ENST00000323584.5	+	8	792	c.768C>T	c.(766-768)ggC>ggT	p.G256G	PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000455779.1_Silent_p.G249G|PHKB_ENST00000566044.1_Silent_p.G249G|PHKB_ENST00000299167.8_Silent_p.G256G	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	256					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.G256G(2)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				ACCTTTTTGGCAACCAGGTAA	0.323																																					p.G249G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C747T	16						.						105.0	101.0	102.0					16																	47614263		2201	4300	6501	46171764	SO:0001819	synonymous_variant	5257	exon9				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.768C>T	16.37:g.47614263C>T			46171764	NM_001031835	Q8N4T5	Silent	SNP	ENST00000323584.5	37	CCDS10729.1																																																																																				0.323	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
CES1	1066	hgsc.bcm.edu	37	16	55853496	55853496	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:55853496C>T	ENST00000361503.4	-	7	984	c.854G>A	c.(853-855)tGc>tAc	p.C285Y	CES1_ENST00000566555.1_5'Flank|CES1_ENST00000422046.2_Missense_Mutation_p.C285Y|CES1_ENST00000360526.3_Missense_Mutation_p.C286Y			P23141	EST1_HUMAN	carboxylesterase 1	285					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)	p.C286Y(1)							all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	CTGTCGCAGGCAGTGAACCAT	0.507																																					p.C285Y	NSCLC(162;1801 2756 42904 52896)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G854A	16						.						148.0	144.0	146.0					16																	55853496		2198	4300	6498	54410997	SO:0001583	missense	1066	exon7			BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.854G>A	16.37:g.55853496C>T	ENSP00000355193:p.Cys285Tyr		54410997	NM_001266	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	ENST00000361503.4	37	CCDS45488.1	.	.	.	.	.	.	.	.	.	.	.	17.23	3.338050	0.60963	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046;ENST00000426667	T;T;T	0.74842	-0.88;-0.88;-0.88	3.81	3.81	0.43845	Carboxylesterase, type B (1);	0.196402	0.36665	N	0.002462	D	0.87545	0.6204	M	0.91249	3.19	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89558	0.3804	10	0.87932	D	0	.	11.2501	0.49020	0.0:1.0:0.0:0.0	.	285;285;286	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	Y	286;285;285;150	ENSP00000353720:C286Y;ENSP00000355193:C285Y;ENSP00000390492:C285Y	ENSP00000353720:C286Y	C	-	2	0	CES1	54410997	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	5.168000	0.64978	1.701000	0.51217	0.456000	0.33151	TGC		0.507	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266	
CNOT1	23019	hgsc.bcm.edu	37	16	58612692	58612692	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:58612692G>A	ENST00000317147.5	-	13	1827	c.1495C>T	c.(1495-1497)Cgc>Tgc	p.R499C	CNOT1_ENST00000569240.1_Missense_Mutation_p.R499C|CNOT1_ENST00000441024.2_Missense_Mutation_p.R499C	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	499					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)	p.R499C(1)		breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		AGTTCATGGCGCAAGGTATGC	0.438																																					p.R499C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1495T	16						.						235.0	210.0	218.0					16																	58612692		2198	4300	6498	57170193	SO:0001583	missense	23019	exon13			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.1495C>T	16.37:g.58612692G>A	ENSP00000320949:p.Arg499Cys		57170193	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	G	33	5.237521	0.95240	.	.	ENSG00000125107	ENST00000317147;ENST00000394200;ENST00000441024	T;T	0.20069	2.1;2.1	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.55000	0.1893	M	0.87827	2.91	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.992;0.997;1.0	T	0.59182	-0.7502	9	.	.	.	0.4983	19.7214	0.96144	0.0:0.0:1.0:0.0	.	499;499;499	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	C	499	ENSP00000320949:R499C;ENSP00000413113:R499C	.	R	-	1	0	CNOT1	57170193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.852000	0.99516	2.666000	0.90696	0.555000	0.69702	CGC		0.438	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CDH11	1009	hgsc.bcm.edu	37	16	65032613	65032613	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:65032613C>T	ENST00000268603.4	-	4	990	c.375G>A	c.(373-375)acG>acA	p.T125T	CDH11_ENST00000394156.3_Silent_p.T125T|CDH11_ENST00000566827.1_5'UTR	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	125	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T125T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GAGCCATCAACGTGTACTGGG	0.522			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.T125T			Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G375A	16						.						156.0	117.0	130.0					16																	65032613		2203	4300	6503	63590114	SO:0001819	synonymous_variant	1009	exon4			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.375G>A	16.37:g.65032613C>T			63590114	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	ENST00000268603.4	37	CCDS10803.1																																																																																				0.522	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
CDH16	1014	hgsc.bcm.edu	37	16	66947115	66947115	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:66947115G>A	ENST00000299752.4	-	9	1166	c.973C>T	c.(973-975)Ctg>Ttg	p.L325L	CDH16_ENST00000565796.1_Silent_p.L325L|CDH16_ENST00000568632.1_Silent_p.L228L|CDH16_ENST00000570262.1_Silent_p.L245L|CDH16_ENST00000394055.3_Silent_p.L325L	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	325	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.L325L(1)		endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		TCCATCACCAGCACGTGCAGC	0.617											OREG0007817	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=CDH16|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.L325L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C973T	16						.						134.0	123.0	127.0					16																	66947115		2200	4300	6500	65504616	SO:0001819	synonymous_variant	1014	exon9			AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.973C>T	16.37:g.66947115G>A		1095	65504616	NM_004062	B4DPA8|H3BPD3|Q6UW93	Silent	SNP	ENST00000299752.4	37	CCDS10823.1																																																																																				0.617	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	
CTCF	10664	hgsc.bcm.edu	37	16	67663406	67663406	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:67663406C>T	ENST00000264010.4	+	10	2251	c.1807C>T	c.(1807-1809)Cgc>Tgc	p.R603C	CTCF_ENST00000401394.1_Missense_Mutation_p.R275C	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	603					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R603C(1)		breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		AAGAAAGATGCGCTCTAAGAA	0.448																																					p.R275C	Colon(175;1200 1966 6945 23069 27405)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C823T	16						.						178.0	163.0	168.0					16																	67663406		2198	4300	6498	66220907	SO:0001583	missense	10664	exon8			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1807C>T	16.37:g.67663406C>T	ENSP00000264010:p.Arg603Cys		66220907	NM_001191022	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	ENST00000264010.4	37	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.716098	0.68844	.	.	ENSG00000102974	ENST00000264010;ENST00000401394	T;T	0.09445	2.98;3.05	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000004	T	0.20618	0.0496	N	0.24115	0.695	0.80722	D	1	D;D	0.71674	0.998;0.997	P;P	0.62089	0.898;0.551	T	0.01413	-1.1361	10	0.87932	D	0	-2.7723	19.0839	0.93194	0.0:1.0:0.0:0.0	.	275;603	B5MC38;P49711	.;CTCF_HUMAN	C	603;275	ENSP00000264010:R603C;ENSP00000384707:R275C	ENSP00000264010:R603C	R	+	1	0	CTCF	66220907	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	4.777000	0.62361	2.625000	0.88918	0.313000	0.20887	CGC		0.448	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565	
CTRL	1506	hgsc.bcm.edu	37	16	67963982	67963982	+	Missense_Mutation	SNP	G	G	T	rs372848843		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:67963982G>T	ENST00000574481.1	-	7	1211	c.650C>A	c.(649-651)cCt>cAt	p.P217H	CTRL_ENST00000576408.1_5'Flank	NM_001907.2	NP_001898.1	P40313	CTRL_HUMAN	chymotrypsin-like	217	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)	p.P217H(1)		kidney(1)|large_intestine(2)|urinary_tract(1)	4		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		GCAGACAAGAGGGCCTCCGGA	0.577																																					p.P217H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C650A	16						.						95.0	102.0	100.0					16																	67963982		2198	4300	6498	66521483	SO:0001583	missense	1506	exon7				CCDS10852.1	16q22.1	2008-02-05			ENSG00000141086	ENSG00000141086			2524	protein-coding gene	gene with protein product		118888				8268911	Standard	NM_001907		Approved		uc002euw.3	P40313	OTTHUMG00000137552	ENST00000574481.1:c.650C>A	16.37:g.67963982G>T	ENSP00000458537:p.Pro217His		66521483	NM_001907		Missense_Mutation	SNP	ENST00000574481.1	37	CCDS10852.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484987	0.84854	.	.	ENSG00000141086	ENST00000319955	.	.	.	5.74	4.79	0.61399	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.398733	0.27778	N	0.017884	D	0.91379	0.7280	H	0.99634	4.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94909	0.8063	9	0.87932	D	0	-0.6137	14.8231	0.70087	0.0693:0.0:0.9307:0.0	.	217	P40313	CTRL_HUMAN	H	217	.	ENSP00000322629:P217H	P	-	2	0	CTRL	66521483	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.912000	0.87465	1.441000	0.47550	0.491000	0.48974	CCT		0.577	CTRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268886.3		
ZNF23	7571	hgsc.bcm.edu	37	16	71482764	71482764	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:71482764A>G	ENST00000393539.2	-	6	1977	c.1164T>C	c.(1162-1164)ggT>ggC	p.G388G	ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000428724.2_Silent_p.G330G|ZNF23_ENST00000417828.1_Silent_p.G388G|ZNF23_ENST00000358700.2_3'UTR|ZNF23_ENST00000357254.4_Silent_p.G388G|ZNF23_ENST00000564528.1_Silent_p.G330G|ZNF23_ENST00000539742.1_5'UTR|AC010547.9_ENST00000561908.1_3'UTR	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	388					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G388G(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		AGGGTTTCTCACCTGTGTGGA	0.423																																					p.G388G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1164C	16						.						68.0	62.0	64.0					16																	71482764		2198	4300	6498	70040265	SO:0001819	synonymous_variant	7571	exon6			X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.1164T>C	16.37:g.71482764A>G			70040265	NM_145911	Q8NDP5|Q96IT3|Q9UG42	Silent	SNP	ENST00000393539.2	37	CCDS10900.1	.	.	.	.	.	.	.	.	.	.	A	6.850	0.526192	0.13066	.	.	ENSG00000167377	ENST00000358700	.	.	.	4.14	-8.29	0.01009	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.6981	0.12813	0.1357:0.5332:0.154:0.177	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF23	70040265	0.000000	0.05858	0.422000	0.26621	0.995000	0.86356	-3.240000	0.00544	-1.829000	0.01201	0.454000	0.30748	.		0.423	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268985.23	NM_145911	
CHST4	10164	hgsc.bcm.edu	37	16	71571350	71571350	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:71571350A>G	ENST00000338482.5	+	3	1113	c.770A>G	c.(769-771)tAc>tGc	p.Y257C	RP11-510M2.5_ENST00000568523.1_RNA|CHST4_ENST00000572450.1_Missense_Mutation_p.Y257C|ZNF19_ENST00000568446.1_Intron|CHST4_ENST00000539698.3_Missense_Mutation_p.Y257C			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	257					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.Y257C(1)		cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						CTGGAGATCTACAAGACCATC	0.562											OREG0023923	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y257C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A770G	16						.						96.0	82.0	87.0					16																	71571350		2198	4300	6498	70128851	SO:0001583	missense	10164	exon2			AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.770A>G	16.37:g.71571350A>G	ENSP00000341206:p.Tyr257Cys	1131	70128851	NM_001166395	Q8IV46|Q9Y5R3	Missense_Mutation	SNP	ENST00000338482.5	37	CCDS10902.1	.	.	.	.	.	.	.	.	.	.	A	15.07	2.722764	0.48728	.	.	ENSG00000140835	ENST00000338482;ENST00000539698	D;D	0.82526	-1.62;-1.62	6.02	-4.14	0.03892	Sulfotransferase domain (1);	0.820126	0.11417	N	0.566221	D	0.88665	0.6498	M	0.78916	2.43	0.09310	N	0.999999	D	0.67145	0.996	D	0.67231	0.95	T	0.83054	-0.0151	10	0.44086	T	0.13	-4.8257	14.6189	0.68569	0.2475:0.0:0.0:0.7525	.	257	Q8NCG5	CHST4_HUMAN	C	257	ENSP00000341206:Y257C;ENSP00000441204:Y257C	ENSP00000341206:Y257C	Y	+	2	0	CHST4	70128851	0.014000	0.17966	0.002000	0.10522	0.924000	0.55760	0.913000	0.28611	-0.636000	0.05524	0.533000	0.62120	TAC		0.562	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268992.4	NM_005769	
RBFOX1	54715	hgsc.bcm.edu	37	16	7568326	7568326	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:7568326G>A	ENST00000550418.1	+	5	1193	c.205G>A	c.(205-207)Gcc>Acc	p.A69T	RBFOX1_ENST00000355637.4_Missense_Mutation_p.A89T|RBFOX1_ENST00000422070.4_Missense_Mutation_p.A112T|RBFOX1_ENST00000340209.4_Missense_Mutation_p.A74T|RBFOX1_ENST00000552089.1_Missense_Mutation_p.A105T|RBFOX1_ENST00000436368.2_Missense_Mutation_p.A89T|RBFOX1_ENST00000311745.5_Missense_Mutation_p.A89T|RBFOX1_ENST00000547372.1_Missense_Mutation_p.A112T|RBFOX1_ENST00000535565.2_Missense_Mutation_p.A105T|RBFOX1_ENST00000553186.1_Missense_Mutation_p.A69T|RBFOX1_ENST00000547338.1_Missense_Mutation_p.A69T	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	69					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)	p.A89T(2)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						GTACCCTCCCGCCCAGACGCA	0.642																																					p.A89T	Ovarian(157;934 2567 15163 39509)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G265A	16						.						114.0	108.0	110.0					16																	7568326		2197	4300	6497	7508327	SO:0001583	missense	54715	exon2			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.205G>A	16.37:g.7568326G>A	ENSP00000450031:p.Ala69Thr		7508327	NM_145893	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	ENST00000550418.1	37	CCDS55983.1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.555922	0.27827	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000552089;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T;T;T	0.33654	1.88;1.41;1.72;1.63;1.65;1.82;1.41;1.51;1.72;1.67;1.4	4.67	3.71	0.42584	.	0.140569	0.47093	N	0.000258	T	0.13884	0.0336	N	0.12569	0.235	0.42711	D	0.993641	B;P;B;B;B;B;B;B;B	0.43314	0.021;0.803;0.084;0.093;0.002;0.045;0.0;0.0;0.183	B;B;B;B;B;B;B;B;B	0.25884	0.007;0.064;0.007;0.025;0.006;0.013;0.002;0.001;0.025	T	0.09228	-1.0684	10	0.21540	T	0.41	-4.6637	9.3326	0.38032	0.1769:0.0:0.8231:0.0	.	89;105;112;89;89;89;69;69;112	F8WAC5;F5H0M1;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;.;RFOX1_HUMAN;.	T	69;69;69;112;112;105;105;69;69;89;89;89;89;74	ENSP00000450402:A69T;ENSP00000450031:A69T;ENSP00000447753:A69T;ENSP00000446842:A112T;ENSP00000391269:A112T;ENSP00000447281:A69T;ENSP00000447717:A69T;ENSP00000402745:A89T;ENSP00000309117:A89T;ENSP00000347855:A89T;ENSP00000344196:A74T	ENSP00000309117:A89T	A	+	1	0	RBFOX1	7508327	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.754000	0.55189	0.920000	0.36970	0.557000	0.71058	GCC		0.642	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409492.2	NM_145891	
DHX38	9785	hgsc.bcm.edu	37	16	72137513	72137513	+	Silent	SNP	C	C	T	rs142314860	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:72137513C>T	ENST00000268482.3	+	13	2159	c.1650C>T	c.(1648-1650)atC>atT	p.I550I	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	550	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.I550I(1)		endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				ACAACAGCATCGTGATCGTGG	0.552													C|||	2	0.000399361	0.0	0.0029	5008	,	,		21172	0.0		0.0	False		,,,				2504	0.0				p.I550I	Melanoma(97;711 1442 7855 13832 28836)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1650T	16						.	C		1,4395	2.1+/-5.4	0,1,2197	113.0	89.0	97.0		1650	-2.9	1.0	16	dbSNP_134	97	13,8587	10.5+/-38.8	0,13,4287	no	coding-synonymous	DHX38	NM_014003.3		0,14,6484	TT,TC,CC		0.1512,0.0227,0.1077		550/1228	72137513	14,12982	2198	4300	6498	70695014	SO:0001819	synonymous_variant	9785	exon13			AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.1650C>T	16.37:g.72137513C>T			70695014	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Silent	SNP	ENST00000268482.3	37	CCDS10907.1																																																																																				0.552	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
ADAMTS18	170692	hgsc.bcm.edu	37	16	77353779	77353779	+	Silent	SNP	C	C	T	rs538095477		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:77353779C>T	ENST00000282849.5	-	16	2917	c.2499G>A	c.(2497-2499)gcG>gcA	p.A833A		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	833	Spacer.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A833A(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TGGGCCCTGGCGCGTACAGAC	0.542																																					p.A833A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2499A	16						.						60.0	60.0	60.0					16																	77353779		2198	4300	6498	75911280	SO:0001819	synonymous_variant	170692	exon16			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2499G>A	16.37:g.77353779C>T			75911280	NM_199355	Q6P4R5|Q6ZWJ9	Silent	SNP	ENST00000282849.5	37	CCDS10926.1																																																																																				0.542	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
MBTPS1	8720	hgsc.bcm.edu	37	16	84094363	84094363	+	Silent	SNP	C	C	T	rs200652370		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr16:84094363C>T	ENST00000343411.3	-	20	3123	c.2628G>A	c.(2626-2628)ccG>ccA	p.P876P		NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	876					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.P876P(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TGAGGCTAGGCGGTGTCACCC	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		18760	0.0		0.0	False		,,,				2504	0.001				p.P876P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2628A	16						.	C		0,4400		0,0,2200	69.0	58.0	61.0		2628	-5.2	0.9	16		61	1,8597	1.2+/-3.3	0,1,4298	yes	coding-synonymous	MBTPS1	NM_003791.2		0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		876/1053	84094363	1,12997	2200	4299	6499	82651864	SO:0001819	synonymous_variant	8720	exon20			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.2628G>A	16.37:g.84094363C>T			82651864	NM_003791	A8K6V8|Q24JQ2|Q9UF67	Silent	SNP	ENST00000343411.3	37	CCDS10941.1																																																																																				0.547	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
PIEZO2	63895	hgsc.bcm.edu	37	18	10696188	10696188	+	Silent	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr18:10696188C>A	ENST00000503781.3	-	43	6734	c.6735G>T	c.(6733-6735)gtG>gtT	p.V2245V	PIEZO2_ENST00000580640.1_Silent_p.V2270V|PIEZO2_ENST00000285141.4_Silent_p.V100V|PIEZO2_ENST00000302079.6_Silent_p.V2245V|PIEZO2_ENST00000538948.1_Silent_p.V202V	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2245					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.V2245V(1)|p.V100V(1)									CTCGGTCCACCACCATGGTTC	0.507																																					p.V2245V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G6735T	18						.						86.0	82.0	83.0					18																	10696188		2203	4300	6503	10686188	SO:0001819	synonymous_variant	63895	exon43			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.6735G>T	18.37:g.10696188C>A			10686188	NM_022068	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Silent	SNP	ENST00000503781.3	37																																																																																					0.507	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442385.4	NM_022068	
DSC2	1824	hgsc.bcm.edu	37	18	28666574	28666574	+	Missense_Mutation	SNP	C	C	T	rs145560678	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr18:28666574C>T	ENST00000280904.6	-	7	1350	c.907G>A	c.(907-909)Gtg>Atg	p.V303M	DSC2_ENST00000251081.6_Missense_Mutation_p.V303M	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	303	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V303M(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			GTGGTGATCACGCCTGTAGTT	0.448													C|||	15	0.00299521	0.0	0.0	5008	,	,		18079	0.0		0.001	False		,,,				2504	0.0143				p.V303M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G907A	18						.	C	MET/VAL,MET/VAL	0,4406		0,0,2203	322.0	279.0	293.0		907,907	3.8	0.7	18	dbSNP_134	293	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	DSC2	NM_004949.3,NM_024422.3	21,21	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	303/848,303/902	28666574	2,13004	2203	4300	6503	26920572	SO:0001583	missense	1824	exon7			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.907G>A	18.37:g.28666574C>T	ENSP00000280904:p.Val303Met		26920572	NM_004949		Missense_Mutation	SNP	ENST00000280904.6	37	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	C	16.32	3.088813	0.55968	0.0	2.33E-4	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.53423	0.62;0.62	5.61	3.8	0.43715	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.56529	0.1991	M	0.70787	2.145	0.29419	N	0.860661	D;D	0.61697	0.99;0.988	P;P	0.56343	0.796;0.693	T	0.55398	-0.8147	9	0.56958	D	0.05	.	4.7952	0.13269	0.3051:0.5373:0.0:0.1576	.	303;303	Q02487;Q02487-2	DSC2_HUMAN;.	M	303;303;69;316	ENSP00000251081:V303M;ENSP00000280904:V303M	ENSP00000251081:V303M	V	-	1	0	DSC2	26920572	0.151000	0.22747	0.739000	0.30968	0.951000	0.60555	0.854000	0.27791	0.706000	0.31912	0.655000	0.94253	GTG		0.448	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
CDH20	28316	hgsc.bcm.edu	37	18	59221520	59221520	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr18:59221520C>T	ENST00000262717.4	+	12	2396	c.1998C>T	c.(1996-1998)gaC>gaT	p.D666D	CDH20_ENST00000538374.1_Silent_p.D666D|CDH20_ENST00000536675.2_Silent_p.D666D			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	666					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D666D(1)		breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				TCCGCTACGACGACGAGGGCG	0.647																																					p.D666D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1998T	18						.						110.0	107.0	108.0					18																	59221520		2203	4300	6503	57372500	SO:0001819	synonymous_variant	28316	exon11			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1998C>T	18.37:g.59221520C>T			57372500	NM_031891	Q495S3	Silent	SNP	ENST00000262717.4	37	CCDS11977.1																																																																																				0.647	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
CDH19	28513	hgsc.bcm.edu	37	18	64218443	64218443	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr18:64218443C>A	ENST00000540086.1	-	5	909	c.663G>T	c.(661-663)tgG>tgT	p.W221C	CDH19_ENST00000262150.2_Missense_Mutation_p.W221C	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	329	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.W221C(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				GAATGATTACCCAATACTCAT	0.313																																					p.W221C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G663T	18						.						88.0	94.0	92.0					18																	64218443		2203	4300	6503	62369423	SO:0001583	missense	28513	exon5			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.663G>T	18.37:g.64218443C>A	ENSP00000439593:p.Trp221Cys		62369423	NM_021153	O15098	Missense_Mutation	SNP	ENST00000540086.1	37	CCDS59325.1	.	.	.	.	.	.	.	.	.	.	C	8.337	0.827866	0.16749	.	.	ENSG00000071991	ENST00000262150;ENST00000540086;ENST00000454642	T;T	0.51071	0.72;0.72	5.83	1.27	0.21489	Cadherin (5);Cadherin-like (1);	0.620786	0.16542	N	0.209879	T	0.27489	0.0675	N	0.17082	0.46	0.44409	D	0.997325	B;B	0.09022	0.002;0.001	B;B	0.15052	0.005;0.012	T	0.04467	-1.0949	10	0.35671	T	0.21	.	6.8934	0.24243	0.4354:0.4191:0.0:0.1455	.	221;221	F5H1K0;Q9H159	.;CAD19_HUMAN	C	221;221;166	ENSP00000262150:W221C;ENSP00000439593:W221C	ENSP00000262150:W221C	W	-	3	0	CDH19	62369423	0.428000	0.25522	0.793000	0.32043	0.950000	0.60333	0.094000	0.15107	0.318000	0.23185	0.585000	0.79938	TGG		0.313	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153	
LAMA1	284217	hgsc.bcm.edu	37	18	6982566	6982566	+	Silent	SNP	G	G	A	rs368850544		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr18:6982566G>A	ENST00000389658.3	-	41	5913	c.5820C>T	c.(5818-5820)aaC>aaT	p.N1940N		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1940	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.N1940N(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CCGCTTTCCCGTTAGAAACAA	0.547																																					p.N1940N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5820T	18						.						122.0	121.0	121.0					18																	6982566		2203	4300	6503	6972566	SO:0001819	synonymous_variant	284217	exon41			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.5820C>T	18.37:g.6982566G>A			6972566	NM_005559		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																				0.547	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
DOK6	220164	hgsc.bcm.edu	37	18	67406338	67406338	+	Splice_Site	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr18:67406338G>A	ENST00000382713.5	+	6	927	c.737G>A	c.(736-738)cGg>cAg	p.R246Q		NM_152721.5	NP_689934.2	Q6PKX4	DOK6_HUMAN	docking protein 6	246								p.R246Q(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	20		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				CAGAAGGCCCGGGTAAGGCCC	0.478																																					p.R246Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G737A	18						.						82.0	80.0	81.0					18																	67406338		2203	4300	6503	65557318	SO:0001630	splice_region_variant	220164	exon6			AK057795	CCDS32841.1	18q22.2	2013-01-10	2005-01-18	2005-01-18		ENSG00000206052		"""Pleckstrin homology (PH) domain containing"""	28301	protein-coding gene	gene with protein product		611402	"""docking protein 5-like"""	DOK5L		15286081	Standard	NM_152721		Approved	MGC20785, HsT3226	uc002lkl.3	Q6PKX4		ENST00000382713.5:c.738+1G>A	18.37:g.67406338G>A			65557318	NM_152721	A6NNG3|Q4V9S3|Q8WUZ8|Q96HI2|Q96LU2	Missense_Mutation	SNP	ENST00000382713.5	37	CCDS32841.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.111467	0.56398	.	.	ENSG00000206052	ENST00000382713	T	0.79845	-1.31	6.08	6.08	0.98989	.	0.061375	0.64402	D	0.000002	T	0.65719	0.2718	N	0.12746	0.255	0.42438	D	0.9927	B	0.30511	0.282	B	0.12156	0.007	T	0.62941	-0.6747	10	0.19147	T	0.46	-3.3203	19.6603	0.95864	0.0:0.0:1.0:0.0	.	246	Q6PKX4	DOK6_HUMAN	Q	246	ENSP00000372160:R246Q	ENSP00000372160:R246Q	R	+	2	0	DOK6	65557318	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.929000	0.70096	2.894000	0.99253	0.591000	0.81541	CGG		0.478	DOK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442969.1	NM_152721	Missense_Mutation
MBP	4155	hgsc.bcm.edu	37	18	74729158	74729158	+	Missense_Mutation	SNP	C	C	T	rs529411261		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr18:74729158C>T	ENST00000397860.3	-	4	420	c.206G>A	c.(205-207)cGc>cAc	p.R69H	MBP_ENST00000355994.2_Missense_Mutation_p.R69H|MBP_ENST00000526111.1_5'Flank|MBP_ENST00000359645.3_5'Flank|MBP_ENST00000382582.3_5'Flank|MBP_ENST00000580402.1_Missense_Mutation_p.R69H|MBP_ENST00000397869.3_5'Flank|MBP_ENST00000579129.1_Missense_Mutation_p.R69H|MBP_ENST00000487778.1_5'UTR|MBP_ENST00000527041.1_5'Flank|MBP_ENST00000578193.1_5'Flank|MBP_ENST00000397863.1_Missense_Mutation_p.R69H|MBP_ENST00000528160.1_5'Flank|MBP_ENST00000397865.5_5'Flank|MBP_ENST00000354542.4_5'UTR|MBP_ENST00000397875.3_5'Flank|MBP_ENST00000397866.4_5'Flank	NM_001025100.1	NP_001020271.1	P13727	PRG2_HUMAN	myelin basic protein	0					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)	p.R69H(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)	Sargramostim(DB00020)	GTCCGCTGTGCGCTTGGAGTC	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		18125	0.001		0.0	False		,,,				2504	0.0				p.R69H	NSCLC(17;72 1131 19392)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G206A	18						.						71.0	70.0	70.0					18																	74729158		2203	4300	6503	72858146	SO:0001583	missense	4155	exon4				CCDS12011.1, CCDS32847.1, CCDS42448.1, CCDS42449.1, CCDS42450.1	18q23	2008-08-01			ENSG00000197971	ENSG00000197971			6925	protein-coding gene	gene with protein product		159430				2425357	Standard	XM_005266699		Approved		uc010xfd.2	P02686	OTTHUMG00000132874	ENST00000397860.3:c.206G>A	18.37:g.74729158C>T	ENSP00000380958:p.Arg69His		72858146	NM_001025100	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	ENST00000397860.3	37	CCDS42450.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.155309	0.38021	.	.	ENSG00000197971	ENST00000355994;ENST00000397863;ENST00000397860	.	.	.	4.88	1.02	0.19986	.	0.440596	0.25994	N	0.026998	T	0.14874	0.0359	N	0.03608	-0.345	0.23510	N	0.997523	B;B	0.10296	0.002;0.003	B;B	0.06405	0.001;0.002	T	0.20075	-1.0286	9	0.32370	T	0.25	.	9.3694	0.38246	0.0:0.6425:0.0:0.3575	.	69;69	P02686;P02686-2	MBP_HUMAN;.	H	69	.	ENSP00000348273:R69H	R	-	2	0	MBP	72858146	0.998000	0.40836	0.991000	0.47740	0.987000	0.75469	1.414000	0.34736	-0.029000	0.13827	-0.151000	0.13558	CGC		0.607	MBP-005	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000267945.1	NM_001025081	
ATP9B	374868	hgsc.bcm.edu	37	18	77067228	77067228	+	Silent	SNP	G	G	A	rs150481617		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr18:77067228G>A	ENST00000426216.2	+	15	1784	c.1767G>A	c.(1765-1767)ccG>ccA	p.P589P	ATP9B_ENST00000307671.7_Silent_p.P589P	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	589					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.P589P(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		CTTCCAGCCCGGATGAGGTCA	0.532													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19074	0.0		0.0	False		,,,				2504	0.0				p.P589P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1767A	18						.	G		1,4405		0,1,2202	70.0	69.0	70.0		1767	-10.2	0.0	18	dbSNP_134	70	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ATP9B	NM_198531.3		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		589/1148	77067228	2,13004	2203	4300	6503	75168216	SO:0001819	synonymous_variant	374868	exon15			R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.1767G>A	18.37:g.77067228G>A			75168216	NM_198531	O60872|Q08AD8|Q08AD9	Silent	SNP	ENST00000426216.2	37	CCDS12014.1																																																																																				0.532	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	
RBFA	79863	hgsc.bcm.edu	37	18	77804232	77804232	+	Silent	SNP	C	C	T	rs192937311		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr18:77804232C>T	ENST00000306735.5	+	6	735	c.597C>T	c.(595-597)gtC>gtT	p.V199V	RP11-795F19.5_ENST00000564012.1_Intron|RP11-795F19.5_ENST00000569722.1_Intron|RBFA_ENST00000262197.7_Missense_Mutation_p.S171L	NM_024805.2	NP_079081.2	Q8N0V3	RBFA_HUMAN	ribosome binding factor A (putative)	199					rRNA processing (GO:0006364)	mitochondrion (GO:0005739)		p.V199V(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						TACTGGCAGTCGCAGACTTTG	0.502													c|||	1	0.000199681	0.0008	0.0	5008	,	,		19738	0.0		0.0	False		,,,				2504	0.0				p.S171L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C512T	18						.						196.0	182.0	187.0					18																	77804232		2203	4300	6503	75905220	SO:0001819	synonymous_variant	79863	exon5			BC014195	CCDS12021.1, CCDS54194.1	18q23	2010-10-21	2010-10-21	2010-10-21	ENSG00000101546	ENSG00000101546			26120	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 22"""	C18orf22		12477932	Standard	NM_024805		Approved	FLJ21172, HsT169	uc002lns.3	Q8N0V3	OTTHUMG00000132923	ENST00000306735.5:c.597C>T	18.37:g.77804232C>T			75905220	NM_001171967	Q6PF07|Q8WZ65|Q9H776	Silent	SNP	ENST00000306735.5	37	CCDS12021.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	c	12.17	1.856245	0.32791	.	.	ENSG00000101546	ENST00000262197	T	0.44482	0.92	5.11	-9.31	0.00646	.	.	.	.	.	T	0.11024	0.0269	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.18935	-1.0321	8	0.02654	T	1	-11.9166	1.6827	0.02835	0.1967:0.3293:0.2907:0.1832	.	171	Q8N0V3-2	.	L	171	ENSP00000262197:S171L	ENSP00000262197:S171L	S	+	2	0	RBFA	75905220	0.082000	0.21442	0.001000	0.08648	0.004000	0.04260	-0.002000	0.12924	-2.134000	0.00812	-2.188000	0.00313	TCG		0.502	RBFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256436.2	NM_024805	
SENP7	57337	hgsc.bcm.edu	37	3	101066796	101066796	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:101066796G>A	ENST00000394095.2	-	13	1810	c.1757C>T	c.(1756-1758)gCt>gTt	p.A586V	SENP7_ENST00000394091.1_Missense_Mutation_p.A422V|SENP7_ENST00000314261.7_Missense_Mutation_p.A520V|SENP7_ENST00000394094.2_Missense_Mutation_p.A521V|SENP7_ENST00000358203.3_Missense_Mutation_p.A422V|SENP7_ENST00000348610.3_Missense_Mutation_p.A553V	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	586						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.A520V(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GAAAAGAATAGCATGACTCCT	0.368																																					p.A586V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1757T	3						.						126.0	132.0	130.0					3																	101066796		2203	4298	6501	102549486	SO:0001583	missense	57337	exon13				CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.1757C>T	3.37:g.101066796G>A	ENSP00000377655:p.Ala586Val		102549486	NM_020654	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	ENST00000394095.2	37	CCDS2941.2	.	.	.	.	.	.	.	.	.	.	G	16.47	3.131511	0.56828	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.20200	2.09;2.11;2.11;2.12;2.12;2.1	5.62	4.75	0.60458	.	0.324794	0.29246	N	0.012714	T	0.26304	0.0642	L	0.29908	0.895	0.26503	N	0.974734	P;P;P;P	0.51449	0.775;0.945;0.887;0.819	B;P;B;B	0.52909	0.356;0.713;0.444;0.412	T	0.05146	-1.0903	10	0.54805	T	0.06	-0.8366	13.6705	0.62422	0.0757:0.0:0.9243:0.0	.	422;520;553;586	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	V	586;521;520;422;422;553	ENSP00000377655:A586V;ENSP00000377654:A521V;ENSP00000313624:A520V;ENSP00000377651:A422V;ENSP00000350936:A422V;ENSP00000342159:A553V	ENSP00000313624:A520V	A	-	2	0	SENP7	102549486	1.000000	0.71417	0.995000	0.50966	0.760000	0.43138	3.437000	0.52863	1.373000	0.46208	0.650000	0.86243	GCT		0.368	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654	
ADCY5	111	hgsc.bcm.edu	37	3	123044275	123044275	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:123044275C>T	ENST00000462833.1	-	8	3194	c.1982G>A	c.(1981-1983)cGc>cAc	p.R661H	ADCY5_ENST00000309879.5_Missense_Mutation_p.R311H|ADCY5_ENST00000491190.1_Missense_Mutation_p.R294H	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	661					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.R661H(2)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		GGTTCTCTGGCGGTTCATCTT	0.592																																					p.R661H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1982A	3						.						174.0	178.0	177.0					3																	123044275		2203	4300	6503	124526965	SO:0001583	missense	111	exon8			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1982G>A	3.37:g.123044275C>T	ENSP00000419361:p.Arg661His		124526965	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.991873	0.74703	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879;ENST00000466617	T;D;D;T	0.82344	-1.19;-1.6;-1.59;-1.44	5.23	4.34	0.51931	.	0.000000	0.64402	D	0.000001	T	0.80182	0.4576	M	0.79258	2.445	0.80722	D	1	P;B	0.43542	0.81;0.218	B;B	0.31191	0.125;0.049	T	0.81750	-0.0790	10	0.41790	T	0.15	.	15.7407	0.77894	0.0:0.8631:0.1369:0.0	.	661;294	O95622;B3KWA8	ADCY5_HUMAN;.	H	661;294;311;220	ENSP00000419361:R661H;ENSP00000418537:R294H;ENSP00000308685:R311H;ENSP00000420082:R220H	ENSP00000308685:R311H	R	-	2	0	ADCY5	124526965	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.320000	0.79064	1.403000	0.46800	0.655000	0.94253	CGC		0.592	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
MYLK	4638	hgsc.bcm.edu	37	3	123376047	123376047	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:123376047C>T	ENST00000475616.1	-	21	4213	c.4214G>A	c.(4213-4215)cGt>cAt	p.R1405H	MYLK_ENST00000360772.3_Missense_Mutation_p.R1405H|MYLK_ENST00000360304.3_Missense_Mutation_p.R1405H|MYLK_ENST00000346322.5_Missense_Mutation_p.R1336H|MYLK_ENST00000354792.5_Missense_Mutation_p.R205H|MYLK_ENST00000359169.1_Missense_Mutation_p.R1405H			Q15746	MYLK_HUMAN	myosin light chain kinase	1405	Actin-binding (calcium/calmodulin- insensitive). {ECO:0000250}.|Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.R1405H(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GTTGATTGCACGTACACGGAA	0.527																																					p.R1405H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4214A	3						.						194.0	170.0	178.0					3																	123376047		2203	4300	6503	124858737	SO:0001583	missense	4638	exon24			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.4214G>A	3.37:g.123376047C>T	ENSP00000418335:p.Arg1405His		124858737	NM_053025	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	C	35	5.550045	0.96501	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000354792;ENST00000475616;ENST00000508240	T;T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.39	5.39	0.77823	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77552	0.4147	M	0.91920	3.255	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.78314	0.983;0.991;0.983;0.991;0.99	T	0.75850	-0.3172	9	0.15952	T	0.53	.	19.5158	0.95165	0.0:1.0:0.0:0.0	.	1405;1336;1405;1336;1405	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	H	1405;1405;1405;1336;205;1405;205	ENSP00000354004:R1405H;ENSP00000353452:R1405H;ENSP00000352088:R1405H;ENSP00000320622:R1336H;ENSP00000346846:R205H;ENSP00000418335:R1405H;ENSP00000422984:R205H	ENSP00000320622:R1336H	R	-	2	0	MYLK	124858737	1.000000	0.71417	0.293000	0.24932	0.981000	0.71138	7.744000	0.85034	2.694000	0.91930	0.561000	0.74099	CGT		0.527	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
OSBPL11	114885	hgsc.bcm.edu	37	3	125295147	125295147	+	Silent	SNP	C	C	T	rs201706095		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:125295147C>T	ENST00000296220.5	-	5	841	c.552G>A	c.(550-552)tcG>tcA	p.S184S		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	184			S -> L (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)	p.S184S(1)		NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						GTCTCCTCTGCGATATAGGAG	0.373													C|||	1	0.000199681	0.0	0.0	5008	,	,		18163	0.0		0.001	False		,,,				2504	0.0				p.S184S												OSBPL11,breast,NS,Substitution - Missense,-1	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G552A	3						.	C		0,4406		0,0,2203	96.0	99.0	98.0		552	0.6	1.0	3		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OSBPL11	NM_022776.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		184/748	125295147	1,13005	2203	4300	6503	126777837	SO:0001819	synonymous_variant	114885	exon5			AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.552G>A	3.37:g.125295147C>T			126777837	NM_022776	A8K9I7	Silent	SNP	ENST00000296220.5	37	CCDS3033.1																																																																																				0.373	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
TMEM40	55287	hgsc.bcm.edu	37	3	12779660	12779660	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:12779660T>C	ENST00000314124.7	-	7	755	c.399A>G	c.(397-399)cgA>cgG	p.R133R	TMEM40_ENST00000435218.2_Silent_p.R103R|TMEM40_ENST00000431022.2_Silent_p.R149R|TMEM40_ENST00000435575.1_Silent_p.R57R|TMEM40_ENST00000264728.8_Silent_p.R133R|TMEM40_ENST00000476331.1_5'UTR	NM_001284406.1|NM_018306.2	NP_001271335.1|NP_060776.2	Q8WWA1	TMM40_HUMAN	transmembrane protein 40	133						integral component of membrane (GO:0016021)		p.R133R(1)		breast(1)|large_intestine(3)|lung(5)|urinary_tract(1)	10						AGCCTCTCCTTCGGAGTCCTG	0.537																																					p.R133R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A399G	3						.						81.0	77.0	78.0					3																	12779660		2203	4300	6503	12754660	SO:0001819	synonymous_variant	55287	exon7			BC020658	CCDS2613.1, CCDS68347.1, CCDS68348.1	3p25.2	2005-01-10			ENSG00000088726	ENSG00000088726			25620	protein-coding gene	gene with protein product						12477932	Standard	NM_018306		Approved	FLJ11036	uc003bxg.1	Q8WWA1	OTTHUMG00000129801	ENST00000314124.7:c.399A>G	3.37:g.12779660T>C			12754660	NM_018306	C9JID5|Q8NAL4|Q9NUZ4	Silent	SNP	ENST00000314124.7	37	CCDS2613.1																																																																																				0.537	TMEM40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252029.2	NM_018306	
SLC41A3	54946	hgsc.bcm.edu	37	3	125731515	125731515	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:125731515G>T	ENST00000315891.6	-	9	1286	c.1048C>A	c.(1048-1050)Ctg>Atg	p.L350M	SLC41A3_ENST00000508835.1_Missense_Mutation_p.L233M|SLC41A3_ENST00000383598.2_Missense_Mutation_p.L324M|SLC41A3_ENST00000360370.4_Missense_Mutation_p.L350M|SLC41A3_ENST00000346785.5_Missense_Mutation_p.L314M	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	350						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)	p.L350M(1)|p.L324M(1)		breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		TGGAGGGGCAGGACGCCAGGT	0.517																																					p.L350M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1048A	3						.						161.0	154.0	156.0					3																	125731515		2203	4300	6503	127214205	SO:0001583	missense	54946	exon9				CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.1048C>A	3.37:g.125731515G>T	ENSP00000326070:p.Leu350Met		127214205	NM_001008485	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Missense_Mutation	SNP	ENST00000315891.6	37	CCDS33843.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890650	0.33348	.	.	ENSG00000114544	ENST00000360370;ENST00000346785;ENST00000383598;ENST00000458524;ENST00000315891;ENST00000508835	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	5.43	4.56	0.56223	MgtE magnesium transporter, integral membrane (1);	0.064438	0.64402	D	0.000006	T	0.58090	0.2098	M	0.86268	2.805	0.53688	D	0.999973	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.998	T	0.63808	-0.6553	10	0.62326	D	0.03	4.377	12.072	0.53622	0.0846:0.0:0.9153:0.0	.	233;350;314;350;324	B7Z4Y2;E7ENY4;Q96GZ6-3;Q96GZ6;Q96GZ6-7	.;.;.;S41A3_HUMAN;.	M	350;314;324;341;350;233	ENSP00000353533:L350M;ENSP00000264471:L314M;ENSP00000373092:L324M;ENSP00000326070:L350M;ENSP00000427409:L233M	ENSP00000326070:L350M	L	-	1	2	SLC41A3	127214205	1.000000	0.71417	0.681000	0.30009	0.006000	0.05464	1.933000	0.40153	1.288000	0.44600	0.591000	0.81541	CTG		0.517	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370886.1	NM_017836	
MCM2	4171	hgsc.bcm.edu	37	3	127336909	127336909	+	Silent	SNP	C	C	T	rs111530425	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:127336909C>T	ENST00000265056.7	+	12	2242	c.1998C>T	c.(1996-1998)acC>acT	p.T666T	MCM2_ENST00000468414.1_3'UTR	NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	666	MCM.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)	p.T666T(1)		ovary(3)|skin(2)|stomach(1)	6						TGAGGGACACCGTGGACCCAG	0.572													C|||	2	0.000399361	0.0	0.0	5008	,	,		21305	0.0		0.0	False		,,,				2504	0.002				p.T666T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1998T	3						.						105.0	80.0	88.0					3																	127336909		2203	4300	6503	128819599	SO:0001819	synonymous_variant	4171	exon12			X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.1998C>T	3.37:g.127336909C>T			128819599	NM_004526	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Silent	SNP	ENST00000265056.7	37	CCDS3043.1	.	.	.	.	.	.	.	.	.	.	C	6.982	0.551281	0.13374	.	.	ENSG00000073111	ENST00000491422	.	.	.	5.83	-11.7	0.00046	.	.	.	.	.	T	0.31979	0.0814	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61008	-0.7149	4	.	.	.	-15.284	1.4221	0.02314	0.3906:0.2392:0.1161:0.254	.	.	.	.	L	598	.	.	P	+	2	0	MCM2	128819599	0.000000	0.05858	0.003000	0.11579	0.959000	0.62525	-4.300000	0.00257	-5.683000	0.00010	-1.265000	0.01443	CCG		0.572	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		
RUVBL1	8607	hgsc.bcm.edu	37	3	127823639	127823639	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:127823639C>T	ENST00000322623.5	-	4	589	c.490G>A	c.(490-492)Gcc>Acc	p.A164T	RUVBL1_ENST00000464873.1_Missense_Mutation_p.A104T|RUVBL1_ENST00000417360.1_Missense_Mutation_p.A164T	NM_003707.2	NP_003698.1	Q9Y265	RUVB1_HUMAN	RuvB-like AAA ATPase 1	164					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Ino80 complex (GO:0031011)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)	p.A164T(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26				GBM - Glioblastoma multiforme(114;0.181)		gttcctttggctgttttgagt	0.473																																					p.A164T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G490A	3						.						308.0	201.0	237.0					3																	127823639		2203	4300	6503	129306329	SO:0001583	missense	8607	exon4			AF070735	CCDS3047.1	3q21	2013-09-12	2013-09-12		ENSG00000175792	ENSG00000175792		"""INO80 complex subunits"", ""ATPases / AAA-type"""	10474	protein-coding gene	gene with protein product	"""pontin"", ""INO80 complex subunit H"""	603449	"""RuvB (E coli homolog)-like 1"", ""RuvB-like 1 (E. coli)"", ""RuvB-like AAA ATPase"""			9774387, 9588198	Standard	NM_003707		Approved	TIP49, NMP238, RVB1, TIP49a, Pontin52, ECP54, TIH1, Rvb1, INO80H	uc003ekh.3	Q9Y265	OTTHUMG00000159658	ENST00000322623.5:c.490G>A	3.37:g.127823639C>T	ENSP00000318297:p.Ala164Thr		129306329	NM_003707	B2R5S0|P82276|Q1KMR0|Q53HK5|Q53HL7|Q53Y27|Q9BSX9	Missense_Mutation	SNP	ENST00000322623.5	37	CCDS3047.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.055543	0.36277	.	.	ENSG00000175792	ENST00000464873;ENST00000322623;ENST00000417360	T;T;T	0.62105	0.05;0.06;0.47	5.52	5.52	0.82312	TIP49, C-terminal (1);Nucleic acid-binding, OB-fold-like (1);ATPase, AAA+ type, core (1);	0.096454	0.64402	D	0.000001	T	0.37265	0.0997	N	0.02842	-0.48	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.12837	0.005;0.008;0.005	T	0.43589	-0.9382	10	0.02654	T	1	-17.3892	19.4323	0.94776	0.0:1.0:0.0:0.0	.	164;164;104	Q9Y265-2;Q9Y265;E7ETR0	.;RUVB1_HUMAN;.	T	104;164;164	ENSP00000420738:A104T;ENSP00000318297:A164T;ENSP00000393755:A164T	ENSP00000318297:A164T	A	-	1	0	RUVBL1	129306329	1.000000	0.71417	0.987000	0.45799	0.998000	0.95712	6.009000	0.70745	2.601000	0.87937	0.585000	0.79938	GCC		0.473	RUVBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356728.2		
TMCC1	23023	hgsc.bcm.edu	37	3	129547076	129547076	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:129547076C>T	ENST00000393238.3	-	3	486	c.146G>A	c.(145-147)gGc>gAc	p.G49D	TMCC1_ENST00000426664.2_Intron	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	49						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.G49D(2)	PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CAAGCCTTGGCCAATCACGTT	0.468																																					p.G49D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G146A	3						.						90.0	80.0	84.0					3																	129547076		2203	4300	6503	131029766	SO:0001583	missense	23023	exon3			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.146G>A	3.37:g.129547076C>T	ENSP00000376930:p.Gly49Asp		131029766	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	37	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700406	0.88924	.	.	ENSG00000172765	ENST00000393238	T	0.43688	0.94	5.64	5.64	0.86602	.	0.182306	0.46442	N	0.000289	T	0.65101	0.2659	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65438	-0.6168	10	0.87932	D	0	-16.992	20.1358	0.98028	0.0:1.0:0.0:0.0	.	49	O94876	TMCC1_HUMAN	D	49	ENSP00000376930:G49D	ENSP00000376930:G49D	G	-	2	0	TMCC1	131029766	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.399000	0.79935	2.834000	0.97654	0.586000	0.80456	GGC		0.468	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
UBA5	79876	hgsc.bcm.edu	37	3	132384835	132384835	+	Missense_Mutation	SNP	G	G	A	rs150313260		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:132384835G>A	ENST00000356232.4	+	3	1287	c.215G>A	c.(214-216)cGt>cAt	p.R72H	UBA5_ENST00000494238.2_Missense_Mutation_p.R16H|UBA5_ENST00000264991.4_Missense_Mutation_p.R16H|UBA5_ENST00000493720.2_Missense_Mutation_p.R72H|UBA5_ENST00000473651.1_Missense_Mutation_p.R72H	NM_024818.3	NP_079094.1	Q9GZZ9	UBA5_HUMAN	ubiquitin-like modifier activating enzyme 5	72					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|UFM1 activating enzyme activity (GO:0071566)	p.R72H(1)		breast(2)|endometrium(4)|kidney(4)|large_intestine(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CAGAAAATCCGTACCTTTGCC	0.333																																					p.R16H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G47A	3						.	G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	165.0	156.0	159.0		215,47	6.0	1.0	3	dbSNP_134	159	0,8600		0,0,4300	no	missense,missense	UBA5	NM_024818.3,NM_198329.2	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	72/405,16/349	132384835	1,13005	2203	4300	6503	133867525	SO:0001583	missense	79876	exon3			AY253672	CCDS3076.1, CCDS3077.1	3q22	2007-11-30	2007-11-30	2007-11-30	ENSG00000081307	ENSG00000081307		"""Ubiquitin-like modifier activating enzymes"""	23230	protein-coding gene	gene with protein product	"""UBA5, ubiquitin-activating enzyme E1 homolog (yeast)"""	610552	"""ubiquitin-activating enzyme E1-domain containing 1"""	UBE1DC1		11230166, 15071506	Standard	NM_198329		Approved	FLJ23251	uc003epa.4	Q9GZZ9	OTTHUMG00000159759	ENST00000356232.4:c.215G>A	3.37:g.132384835G>A	ENSP00000348565:p.Arg72His		133867525	NM_198329	A6NJL3|D3DNC8|Q96ST1	Missense_Mutation	SNP	ENST00000356232.4	37	CCDS3076.1	.	.	.	.	.	.	.	.	.	.	G	35	5.517858	0.96416	2.27E-4	0.0	ENSG00000081307	ENST00000264991;ENST00000356232;ENST00000493720;ENST00000468022;ENST00000473651;ENST00000494238;ENST00000489361	T;T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37;1.37	6.02	6.02	0.97574	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.65512	0.2698	M	0.85299	2.745	0.80722	D	1	D;D	0.76494	0.992;0.999	P;D	0.65010	0.561;0.931	T	0.66135	-0.5999	10	0.51188	T	0.08	-17.0478	20.5373	0.99239	0.0:0.0:1.0:0.0	.	72;72	E7EWE1;Q9GZZ9	.;UBA5_HUMAN	H	16;72;72;16;72;16;16	ENSP00000264991:R16H;ENSP00000348565:R72H;ENSP00000417879:R72H;ENSP00000418569:R16H;ENSP00000424984:R72H;ENSP00000418807:R16H;ENSP00000417905:R16H	ENSP00000264991:R16H	R	+	2	0	UBA5	133867525	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.544000	0.98092	2.857000	0.98124	0.650000	0.86243	CGT		0.333	UBA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357187.2	NM_024818	
COLQ	8292	hgsc.bcm.edu	37	3	15497518	15497518	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:15497518A>G	ENST00000383788.5	-	15	1208	c.1083T>C	c.(1081-1083)ccT>ccC	p.P361P	COLQ_ENST00000383787.2_Silent_p.P352P|COLQ_ENST00000383781.4_Silent_p.P351P|COLQ_ENST00000383785.2_3'UTR|COLQ_ENST00000603808.1_Silent_p.P361P|COLQ_ENST00000383786.5_Silent_p.P327P|COLQ_ENST00000435459.2_Silent_p.P351P	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	361					acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)		p.P361P(1)		endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						CAGGGTAGAAAGGGGTCAGCT	0.592																																					p.P327P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T981C	3						.						78.0	58.0	64.0					3																	15497518		2203	4300	6503	15472522	SO:0001819	synonymous_variant	8292	exon14			AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.1083T>C	3.37:g.15497518A>G			15472522	NM_080539	B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Silent	SNP	ENST00000383788.5	37	CCDS33709.1																																																																																				0.592	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343575.1	NM_005677	
TRIM42	287015	hgsc.bcm.edu	37	3	140397101	140397101	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:140397101A>G	ENST00000286349.3	+	1	221	c.30A>G	c.(28-30)ccA>ccG	p.P10P		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	10	Cys-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.P10P(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TTTGCTGTCCATGTTGTACAT	0.512																																					p.P10P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A30G	3						.						375.0	315.0	336.0					3																	140397101		2203	4300	6503	141879791	SO:0001819	synonymous_variant	287015	exon1			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.30A>G	3.37:g.140397101A>G			141879791	NM_152616	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	37	CCDS3113.1																																																																																				0.512	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
RSRC1	51319	hgsc.bcm.edu	37	3	158262033	158262033	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:158262033A>G	ENST00000295930.3	+	10	1136	c.974A>G	c.(973-975)cAa>cGa	p.Q325R	RP11-538P18.2_ENST00000475981.1_RNA|RSRC1_ENST00000480820.1_Missense_Mutation_p.Q325R|RSRC1_ENST00000464171.1_Missense_Mutation_p.Q267R|RSRC1_ENST00000475278.2_Missense_Mutation_p.Q274R|RSRC1_ENST00000312179.6_Missense_Mutation_p.Q267R	NM_001271838.1|NM_016625.2	NP_001258767.1|NP_057709.2	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1	325					mRNA splicing, via spliceosome (GO:0000398)|nucleocytoplasmic transport (GO:0006913)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)		p.Q325R(1)		cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	18			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			GCTCTCCGACAAGAAAGACTA	0.338																																					p.Q325R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A974G	3						.						110.0	119.0	116.0					3																	158262033		2203	4299	6502	159744727	SO:0001583	missense	51319	exon10			AF208853	CCDS3181.1, CCDS63822.1	3q25.32	2009-09-09			ENSG00000174891	ENSG00000174891			24152	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 21"""	613352				15798186, 19065146	Standard	NM_001271838		Approved	MGC12197, BM-011, SRrp53, SFRS21	uc003fbu.2	Q96IZ7	OTTHUMG00000158758	ENST00000295930.3:c.974A>G	3.37:g.158262033A>G	ENSP00000295930:p.Gln325Arg		159744727	NM_016625	A8K2R9|Q96QK2|Q9NZE5	Missense_Mutation	SNP	ENST00000295930.3	37	CCDS3181.1	.	.	.	.	.	.	.	.	.	.	A	17.78	3.473054	0.63737	.	.	ENSG00000174891	ENST00000480820;ENST00000295930;ENST00000464171;ENST00000312179;ENST00000475278	.	.	.	5.81	5.81	0.92471	.	0.059217	0.64402	D	0.000002	T	0.56992	0.2023	L	0.60455	1.87	0.43372	D	0.995466	P;P	0.37731	0.607;0.607	B;B	0.39465	0.3;0.202	T	0.55296	-0.8163	9	0.28530	T	0.3	.	15.8251	0.78698	1.0:0.0:0.0:0.0	.	267;325	Q96IZ7-2;Q96IZ7	.;RSRC1_HUMAN	R	325;325;267;267;274	.	ENSP00000295930:Q325R	Q	+	2	0	RSRC1	159744727	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	7.325000	0.79124	2.216000	0.71823	0.533000	0.62120	CAA		0.338	RSRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352063.2	NM_016625	
BCHE	590	hgsc.bcm.edu	37	3	165548102	165548102	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:165548102T>C	ENST00000264381.3	-	2	886	c.720A>G	c.(718-720)ggA>ggG	p.G240G	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	240					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)	p.G240G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	ATGAATGGCTTCCAGGAGAAA	0.428																																					p.G240G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A720G	3						.						88.0	92.0	91.0					3																	165548102		2203	4299	6502	167030796	SO:0001819	synonymous_variant	590	exon2			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.720A>G	3.37:g.165548102T>C			167030796	NM_000055	A8K7P8	Silent	SNP	ENST00000264381.3	37	CCDS3198.1																																																																																				0.428	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1		
SAMD7	344658	hgsc.bcm.edu	37	3	169644745	169644745	+	Missense_Mutation	SNP	C	C	A	rs201077493		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:169644745C>A	ENST00000428432.2	+	6	1084	c.695C>A	c.(694-696)cCc>cAc	p.P232H	SAMD7_ENST00000335556.3_Missense_Mutation_p.P232H	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	232								p.P232H(1)		NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			ATTGAAGCACCCAGCAACCAG	0.483																																					p.P232H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C695A	3						.						111.0	109.0	110.0					3																	169644745		2203	4300	6503	171127439	SO:0001583	missense	344658	exon6			BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.695C>A	3.37:g.169644745C>A	ENSP00000391299:p.Pro232His		171127439	NM_182610		Missense_Mutation	SNP	ENST00000428432.2	37	CCDS3209.1	.	.	.	.	.	.	.	.	.	.	C	9.862	1.196530	0.22037	.	.	ENSG00000187033	ENST00000428432;ENST00000335556	T;T	0.43294	0.95;0.95	6.16	-2.5	0.06384	.	1.779520	0.02220	N	0.063903	T	0.20414	0.0491	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11108	-1.0601	10	0.39692	T	0.17	9.17	1.3768	0.02222	0.3814:0.1395:0.1026:0.3764	.	232	Q7Z3H4	SAMD7_HUMAN	H	232	ENSP00000391299:P232H;ENSP00000334668:P232H	ENSP00000334668:P232H	P	+	2	0	SAMD7	171127439	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.191000	0.17076	-0.202000	0.10268	-0.171000	0.13296	CCC		0.483	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1	NM_182610	
ECT2	1894	hgsc.bcm.edu	37	3	172491726	172491726	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:172491726C>T	ENST00000392692.3	+	14	1638	c.1462C>T	c.(1462-1464)Cgt>Tgt	p.R488C	ECT2_ENST00000540509.1_Missense_Mutation_p.R488C|SNORA72_ENST00000363485.1_RNA|ECT2_ENST00000417960.1_Missense_Mutation_p.R456C|ECT2_ENST00000232458.5_Missense_Mutation_p.R457C|ECT2_ENST00000441497.2_Missense_Mutation_p.R457C|ECT2_ENST00000427830.1_Missense_Mutation_p.R457C	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	488	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.R457C(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			GGAAGGACAACGTGGTGGACC	0.348																																					p.R457C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1369T	3						.						120.0	112.0	115.0					3																	172491726		2203	4300	6503	173974420	SO:0001583	missense	1894	exon12			AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.1462C>T	3.37:g.172491726C>T	ENSP00000376457:p.Arg488Cys		173974420	NM_018098	Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	ENST00000392692.3	37	CCDS58860.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234994	0.58886	.	.	ENSG00000114346	ENST00000232458;ENST00000392692;ENST00000427830;ENST00000417960;ENST00000441497;ENST00000540509	T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74	5.61	4.74	0.60224	Dbl homology (DH) domain (5);	0.170888	0.51477	N	0.000090	T	0.36524	0.0970	L	0.34521	1.04	0.42485	D	0.992877	D;D;D;D	0.64830	0.971;0.994;0.989;0.958	P;P;P;P	0.56788	0.806;0.781;0.781;0.707	T	0.10989	-1.0606	10	0.54805	T	0.06	-7.3775	17.6519	0.88167	0.0:0.9344:0.0:0.0656	.	488;488;457;456	Q9H8V3;Q9H8V3-3;G5E9L8;Q9H8V3-2	ECT2_HUMAN;.;.;.	C	457;488;457;456;457;488	ENSP00000232458:R457C;ENSP00000376457:R488C;ENSP00000401910:R457C;ENSP00000415876:R456C;ENSP00000412259:R457C;ENSP00000443160:R488C	ENSP00000232458:R457C	R	+	1	0	ECT2	173974420	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	4.835000	0.62781	0.735000	0.32537	-1.128000	0.01989	CGT		0.348	ECT2-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345994.2	NM_018098	
ACTL6A	86	hgsc.bcm.edu	37	3	179304377	179304377	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:179304377G>T	ENST00000429709.2	+	13	1379	c.1166G>T	c.(1165-1167)cGg>cTg	p.R389L	ACTL6A_ENST00000392662.1_Missense_Mutation_p.R347L|ACTL6A_ENST00000450518.2_Missense_Mutation_p.R347L|RP11-15L13.4_ENST00000608818.1_RNA|RP11-145M9.6_ENST00000610007.1_RNA	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A	389					ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)	p.R389L(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			ACAGTGGAACGGAGGTTTAGC	0.338																																					p.R347L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1040T	3						.						93.0	94.0	94.0					3																	179304377		2203	4300	6503	180787071	SO:0001583	missense	86	exon13			AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.1166G>T	3.37:g.179304377G>T	ENSP00000397552:p.Arg389Leu		180787071	NM_178042	B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Missense_Mutation	SNP	ENST00000429709.2	37	CCDS3231.1	.	.	.	.	.	.	.	.	.	.	G	32	5.163993	0.94727	.	.	ENSG00000136518	ENST00000429709;ENST00000450518;ENST00000392662	D;D;D	0.96232	-3.95;-3.95;-3.95	5.7	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.98501	0.9500	H	0.95294	3.65	0.80722	D	1	D	0.57571	0.98	D	0.62955	0.909	D	0.99316	1.0905	10	0.87932	D	0	.	14.7798	0.69756	0.0691:0.0:0.9309:0.0	.	389	O96019	ACL6A_HUMAN	L	389;347;347	ENSP00000397552:R389L;ENSP00000394014:R347L;ENSP00000376430:R347L	ENSP00000376430:R347L	R	+	2	0	ACTL6A	180787071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.371000	0.97162	1.410000	0.46936	0.655000	0.94253	CGG		0.338	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349599.1	NM_004301	
MCCC1	56922	hgsc.bcm.edu	37	3	182790189	182790189	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:182790189A>G	ENST00000265594.4	-	5	602	c.456T>C	c.(454-456)ccT>ccC	p.P152P	MCCC1_ENST00000492597.1_Silent_p.P43P|MCCC1_ENST00000539926.1_Silent_p.P17P	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	152	Biotin carboxylation.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)	p.P152P(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	CAGATGGAGGAGGGCCTATAA	0.368																																					p.P152P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T456C	3						.						62.0	64.0	63.0					3																	182790189		2203	4300	6503	184272883	SO:0001819	synonymous_variant	56922	exon5			AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.456T>C	3.37:g.182790189A>G			184272883	NM_020166	Q59ES4|Q9H959|Q9NS97	Silent	SNP	ENST00000265594.4	37	CCDS3241.1																																																																																				0.368	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350775.1	NM_020166	
THPO	7066	hgsc.bcm.edu	37	3	184090433	184090433	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:184090433T>C	ENST00000204615.7	-	6	1144	c.930A>G	c.(928-930)ccA>ccG	p.P310P	THPO_ENST00000421442.2_Missense_Mutation_p.T272A|THPO_ENST00000477594.1_5'Flank|THPO_ENST00000445696.2_Silent_p.P306P|EIF2B5_ENST00000444495.1_Intron	NM_000460.2|NM_001177597.1|NM_001177598.1	NP_000451.1|NP_001171068.1|NP_001171069.1	P40225	TPO_HUMAN	thrombopoietin	310	Pro-rich.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|thrombopoietin-mediated signaling pathway (GO:0038163)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.P310P(1)		NS(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCAAGGTGGGTGGAAGAGGGA	0.587																																					p.T305A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A913G	3						.						146.0	156.0	152.0					3																	184090433		2203	4300	6503	185573127	SO:0001819	synonymous_variant	7066	exon6				CCDS3265.1, CCDS54693.1	3q27	2014-01-30	2008-07-31		ENSG00000090534	ENSG00000090534		"""Endogenous ligands"""	11795	protein-coding gene	gene with protein product	"""prepro-thrombopoietin"", ""megakaryocyte stimulating factor"", ""myeloproliferative leukemia virus oncogene ligand"", ""megakaryocyte growth and development factor"", ""MPL ligand"", ""megakaryocyte colony-stimulating factor"", ""c-mpl ligand"", ""thrombopoietin nirs variant 1"""	600044		MGDF		8202154	Standard	XM_006713738		Approved	TPO, MPLLG	uc003fol.1	P40225	OTTHUMG00000156745	ENST00000204615.7:c.930A>G	3.37:g.184090433T>C			185573127	NM_001177598	A1L3Y0|B7ZLR8|B9EGA8|Q13020|Q15790|Q15791|Q15792	Silent	SNP	ENST00000204615.7	37	CCDS3265.1	.	.	.	.	.	.	.	.	.	.	T	14.47	2.545297	0.45280	.	.	ENSG00000090534	ENST00000421442	T	0.35236	1.32	4.3	-2.99	0.05497	.	.	.	.	.	T	0.22627	0.0546	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.22871	-1.0204	8	0.59425	D	0.04	-39.8457	4.8259	0.13416	0.0:0.3084:0.362:0.3296	.	272	F8W6L1	.	A	272	ENSP00000411704:T272A	ENSP00000411704:T272A	T	-	1	0	THPO	185573127	0.011000	0.17503	0.000000	0.03702	0.390000	0.30446	0.002000	0.13061	-0.775000	0.04584	0.383000	0.25322	ACC		0.587	THPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345554.1	NM_000460	
TRA2B	6434	hgsc.bcm.edu	37	3	185643253	185643253	+	Splice_Site	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:185643253C>A	ENST00000453386.2	-	3	607	c.332G>T	c.(331-333)cGg>cTg	p.R111L	TRA2B_ENST00000382191.4_Splice_Site_p.R11L|TRA2B_ENST00000471134.1_5'Flank	NM_004593.2	NP_004584.1	P62995	TRA2B_HUMAN	transformer 2 beta homolog (Drosophila)	111	Arg/Ser-rich (RS1 domain).				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R111L(1)		breast(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	18						TCATCTTACCCGATTCCCAAC	0.443																																					p.R111L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G332T	3						.						114.0	99.0	104.0					3																	185643253		2203	4300	6503	187125947	SO:0001630	splice_region_variant	6434	exon3			AF057159	CCDS33905.1, CCDS58872.1	3q26.2-q27	2014-06-13	2009-02-27	2009-02-27	ENSG00000136527	ENSG00000136527		"""RNA binding motif (RRM) containing"""	10781	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 156"""	602719	"""splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)"""	SFRS10		9790768	Standard	NM_004593		Approved	Htra2-beta, PPP1R156	uc003fpv.3	P62995	OTTHUMG00000156641	ENST00000453386.2:c.333+1G>T	3.37:g.185643253C>A			187125947	NM_004593	B4DVK2|D3DNU3|O15449|Q15815|Q64283	Missense_Mutation	SNP	ENST00000453386.2	37	CCDS33905.1	.	.	.	.	.	.	.	.	.	.	C	36	5.682337	0.96774	.	.	ENSG00000136527	ENST00000453386;ENST00000382191	T;T	0.34859	1.34;1.97	6.17	6.17	0.99709	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.64011	0.2560	M	0.80616	2.505	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.65684	0.937;0.937	T	0.65278	-0.6207	10	0.87932	D	0	-1.947	19.6509	0.95805	0.0:1.0:0.0:0.0	.	111;111	B2RDQ3;P62995	.;TRA2B_HUMAN	L	111;11	ENSP00000416959:R111L;ENSP00000371626:R11L	ENSP00000371626:R11L	R	-	2	0	TRA2B	187125947	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.599000	0.82757	2.941000	0.99782	0.655000	0.94253	CGG		0.443	TRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344984.1	NM_004593	Missense_Mutation
SLC51A	200931	hgsc.bcm.edu	37	3	195954567	195954567	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:195954567G>A	ENST00000296327.5	+	4	530	c.321G>A	c.(319-321)tgG>tgA	p.W107*		NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	107					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)	p.W107*(1)								Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	TTGGTCTCTGGATCCCTCGTT	0.647																																					p.W107X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G321A	3						.						244.0	183.0	204.0					3																	195954567		2203	4300	6503	197438964	SO:0001587	stop_gained	200931	exon4				CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.321G>A	3.37:g.195954567G>A	ENSP00000296327:p.Trp107*		197438964	NM_152672	Q6ZMC7	Nonsense_Mutation	SNP	ENST00000296327.5	37	CCDS3314.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.0|28.0	4.885623|4.885623	0.91814|0.91814	.|.	.|.	ENSG00000163959|ENSG00000163959	ENST00000428985|ENST00000296327	.|.	.|.	.|.	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	.|0.000000	.|0.44688	.|D	.|0.000427	T|.	0.48978|.	0.1530|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.33624|.	-0.9861|.	4|.	.|0.06494	.|T	.|0.89	.|.	18.1615|18.1615	0.89709|0.89709	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	120|107	.|.	.|ENSP00000296327:W107X	G|W	+|+	2|3	0|0	AC069257.9|AC069257.9	197438964|197438964	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	6.137000|6.137000	0.71710|0.71710	2.768000|2.768000	0.95171|0.95171	0.609000|0.609000	0.83330|0.83330	GGA|TGG		0.647	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341253.1	NM_152672	
PAK2	5062	hgsc.bcm.edu	37	3	196554178	196554178	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:196554178A>G	ENST00000327134.3	+	14	1784	c.1462A>G	c.(1462-1464)Agg>Ggg	p.R488G		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	488	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.R488G(1)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		TGTGGAAAAAAGGGGTTCAGC	0.368																																					p.R488G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1462G	3						.						76.0	81.0	79.0					3																	196554178		2203	4300	6503	198038575	SO:0001583	missense	5062	exon14			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.1462A>G	3.37:g.196554178A>G	ENSP00000314067:p.Arg488Gly		198038575	NM_002577	Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.169125	0.38315	.	.	ENSG00000180370	ENST00000327134	T	0.44482	0.92	4.81	0.966	0.19667	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74122	0.3675	H	0.99682	4.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68250	-0.5458	10	0.87932	D	0	.	3.651	0.08203	0.6566:0.1383:0.0729:0.1322	.	488	Q13177	PAK2_HUMAN	G	488	ENSP00000314067:R488G	ENSP00000314067:R488G	R	+	1	2	PAK2	198038575	1.000000	0.71417	0.862000	0.33874	0.097000	0.18754	3.109000	0.50345	0.022000	0.15160	-0.468000	0.05107	AGG		0.368	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
SLC4A7	9497	hgsc.bcm.edu	37	3	27439757	27439757	+	Missense_Mutation	SNP	T	T	C	rs374900487		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:27439757T>C	ENST00000295736.5	-	17	2558	c.2488A>G	c.(2488-2490)Atc>Gtc	p.I830V	SLC4A7_ENST00000428386.1_Missense_Mutation_p.I706V|SLC4A7_ENST00000440156.1_Missense_Mutation_p.I826V|SLC4A7_ENST00000437179.1_Missense_Mutation_p.I711V|SLC4A7_ENST00000446700.1_Missense_Mutation_p.I822V|SLC4A7_ENST00000445684.1_Missense_Mutation_p.I826V|SLC4A7_ENST00000435667.2_Missense_Mutation_p.I715V|SLC4A7_ENST00000454389.1_Missense_Mutation_p.I839V|SLC4A7_ENST00000455077.1_Missense_Mutation_p.I711V|SLC4A7_ENST00000388777.4_Missense_Mutation_p.I380V|SLC4A7_ENST00000425128.2_3'UTR	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	830					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.I830V(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	AAAAACAAGATGACACACCAA	0.373																																					p.I830V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2488G	3						.						114.0	115.0	115.0					3																	27439757		2203	4300	6503	27414761	SO:0001583	missense	9497	exon17			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.2488A>G	3.37:g.27439757T>C	ENSP00000295736:p.Ile830Val		27414761	NM_003615	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	ENST00000295736.5	37	CCDS33721.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.940352	0.52972	.	.	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	5.71	4.56	0.56223	Bicarbonate transporter, C-terminal (1);	0.050455	0.85682	N	0.000000	T	0.66557	0.2801	L	0.33339	1.005	0.80722	D	1	B;B;B;B;B;B;B;B;B	0.09022	0.001;0.001;0.001;0.001;0.001;0.002;0.001;0.001;0.001	B;B;B;B;B;B;B;B;B	0.20384	0.029;0.029;0.029;0.029;0.029;0.015;0.017;0.029;0.029	T	0.58358	-0.7650	10	0.23891	T	0.37	.	10.8728	0.46894	0.0:0.0745:0.0:0.9255	.	826;711;822;826;839;380;706;830;711	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	V	381;830;706;839;826;711;822;711;826;715;380;726	ENSP00000411031:I381V;ENSP00000295736:I830V;ENSP00000416368:I706V;ENSP00000390394:I839V;ENSP00000414797:I826V;ENSP00000394252:I711V;ENSP00000406605:I822V;ENSP00000407382:I711V;ENSP00000406804:I826V;ENSP00000395336:I715V;ENSP00000373429:I380V;ENSP00000388703:I726V	ENSP00000295736:I830V	I	-	1	0	SLC4A7	27414761	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.146000	0.64845	1.008000	0.39264	0.460000	0.39030	ATC		0.373	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341230.2	NM_003615	
ITGA9	3680	hgsc.bcm.edu	37	3	37783231	37783231	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:37783231G>T	ENST00000264741.5	+	21	2501	c.2245G>T	c.(2245-2247)Gag>Tag	p.E749*		NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	749					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)	p.E749*(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		TGGCAACACGGAGCGCTCTGA	0.552																																					p.E749X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2245T	3						.						104.0	80.0	88.0					3																	37783231		2203	4300	6503	37758235	SO:0001587	stop_gained	3680	exon21			L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.2245G>T	3.37:g.37783231G>T	ENSP00000264741:p.Glu749*		37758235	NM_002207	Q14638	Nonsense_Mutation	SNP	ENST00000264741.5	37	CCDS2669.1	.	.	.	.	.	.	.	.	.	.	G	40	8.065377	0.98635	.	.	ENSG00000144668	ENST00000264741	.	.	.	5.22	5.22	0.72569	.	0.111039	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	17.5568	0.87892	0.0:0.0:1.0:0.0	.	.	.	.	X	749	.	ENSP00000264741:E749X	E	+	1	0	ITGA9	37758235	1.000000	0.71417	0.998000	0.56505	0.278000	0.26855	7.814000	0.86154	2.439000	0.82584	0.591000	0.81541	GAG		0.552	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
GORASP1	64689	hgsc.bcm.edu	37	3	39144218	39144218	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:39144218A>G	ENST00000319283.3	-	3	1120	c.299T>C	c.(298-300)gTg>gCg	p.V100A	GORASP1_ENST00000422110.2_Intron|GORASP1_ENST00000479927.1_Intron	NM_031899.2	NP_114105.1	Q9BQQ3	GORS1_HUMAN	golgi reassembly stacking protein 1, 65kDa	100					Golgi organization (GO:0007030)|mitotic cell cycle (GO:0000278)|negative regulation of dendrite morphogenesis (GO:0050774)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)		p.V100A(1)		central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(1)|ovary(3)|urinary_tract(1)	14				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		GCAGAAGCGCACACTGGCACC	0.612																																					p.V100A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T299C	3						.						124.0	114.0	117.0					3																	39144218		2203	4300	6503	39119222	SO:0001583	missense	64689	exon3			AJ409349	CCDS2681.1, CCDS63596.1, CCDS63597.1	3p22-p21.33	2008-04-23	2002-08-29	2002-05-24	ENSG00000114745	ENSG00000114745			16769	protein-coding gene	gene with protein product		606867	"""golgi phosphoprotein 5"""	GOLPH5			Standard	NM_001278789		Approved	GRASP65, P65, FLJ23443	uc003ciw.1	Q9BQQ3	OTTHUMG00000131292	ENST00000319283.3:c.299T>C	3.37:g.39144218A>G	ENSP00000313869:p.Val100Ala		39119222	NM_031899	B3KWC8|Q3SYG7|Q8N272|Q96H42	Missense_Mutation	SNP	ENST00000319283.3	37	CCDS2681.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.898049	0.91962	.	.	ENSG00000114745	ENST00000319283;ENST00000437458;ENST00000416741;ENST00000411813	T	0.32988	1.43	5.05	5.05	0.67936	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.57888	0.2084	M	0.83953	2.67	0.80722	D	1	D	0.67145	0.996	D	0.68765	0.96	T	0.65549	-0.6141	10	0.87932	D	0	-24.6286	14.7878	0.69816	1.0:0.0:0.0:0.0	.	100	Q9BQQ3	GORS1_HUMAN	A	100;140;27;100	ENSP00000313869:V100A	ENSP00000313869:V100A	V	-	2	0	GORASP1	39119222	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	9.307000	0.96226	1.885000	0.54596	0.454000	0.30748	GTG		0.612	GORASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254060.1		
SETD2	29072	hgsc.bcm.edu	37	3	47125235	47125235	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:47125235A>C	ENST00000409792.3	-	12	6077	c.6035T>G	c.(6034-6036)cTc>cGc	p.L2012R	SETD2_ENST00000492397.1_5'UTR	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2012					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.L2012R(1)|p.L1509R(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ACTGTCCAGGAGTTTGGTGGC	0.413			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.L2012R			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T6035G	3						.						204.0	195.0	198.0					3																	47125235		2203	4300	6503	47100239	SO:0001583	missense	29072	exon12			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6035T>G	3.37:g.47125235A>C	ENSP00000386759:p.Leu2012Arg		47100239	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	A	21.5	4.154306	0.78114	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	T	0.24538	1.85	5.59	5.59	0.84812	.	0.000000	0.48286	D	0.000199	T	0.49525	0.1562	M	0.62723	1.935	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.998	T	0.50767	-0.8789	10	0.72032	D	0.01	.	15.7653	0.78120	1.0:0.0:0.0:0.0	.	2012;2012	F2Z317;Q9BYW2	.;SETD2_HUMAN	R	2012	ENSP00000386759:L2012R	ENSP00000386759:L2012R	L	-	2	0	SETD2	47100239	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.957000	0.93082	2.112000	0.64535	0.528000	0.53228	CTC		0.413	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
KLHL18	23276	hgsc.bcm.edu	37	3	47364087	47364087	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:47364087A>G	ENST00000232766.5	+	3	310	c.290A>G	c.(289-291)tAc>tGc	p.Y97C	KLHL18_ENST00000455924.2_5'UTR	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	97	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.							p.Y97C(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		AACTTTGCCTACAACGGCAAC	0.552																																					p.Y97C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A290G	3						.						102.0	81.0	88.0					3																	47364087		2203	4300	6503	47339091	SO:0001583	missense	23276	exon3			AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.290A>G	3.37:g.47364087A>G	ENSP00000232766:p.Tyr97Cys		47339091	NM_025010	A8K612|Q7Z3E8|Q8N125	Missense_Mutation	SNP	ENST00000232766.5	37	CCDS33749.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.473486	0.84640	.	.	ENSG00000114648	ENST00000232766;ENST00000437353	D;D	0.89343	-2.5;-2.5	5.29	5.29	0.74685	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.97201	0.9085	H	0.99732	4.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98705	1.0702	10	0.87932	D	0	.	14.5603	0.68130	1.0:0.0:0.0:0.0	.	97;32	O94889;O94889-2	KLH18_HUMAN;.	C	97	ENSP00000232766:Y97C;ENSP00000411839:Y97C	ENSP00000232766:Y97C	Y	+	2	0	KLHL18	47339091	1.000000	0.71417	0.999000	0.59377	0.946000	0.59487	9.017000	0.93651	2.229000	0.72834	0.533000	0.62120	TAC		0.552	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010	
TREX1	11277	hgsc.bcm.edu	37	3	48508693	48508693	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:48508693G>T	ENST00000422277.2	+	1	1465	c.804G>T	c.(802-804)caG>caT	p.Q268H	TREX1_ENST00000436480.2_Missense_Mutation_p.Q213H|SHISA5_ENST00000465449.1_5'Flank|TREX1_ENST00000444177.1_Missense_Mutation_p.Q203H|TREX1_ENST00000296443.9_Missense_Mutation_p.Q213H|TREX1_ENST00000492235.1_3'UTR|TREX1_ENST00000433541.1_Missense_Mutation_p.Q74H|TREX1_ENST00000456089.1_Missense_Mutation_p.Q74H	NM_016381.4	NP_057465.1	Q9NSU2	TREX1_HUMAN	three prime repair exonuclease 1	268					cell death (GO:0008219)|cellular response to interferon-beta (GO:0035458)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|innate immune response (GO:0045087)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	endoplasmic reticulum membrane (GO:0005789)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|3'-5'-exodeoxyribonuclease activity (GO:0008296)|adenyl deoxyribonucleotide binding (GO:0032558)|double-stranded DNA binding (GO:0003690)|exodeoxyribonuclease III activity (GO:0008853)|metal ion binding (GO:0046872)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein homodimerization activity (GO:0042803)|single-stranded DNA binding (GO:0003697)	p.Q268H(1)		breast(1)|kidney(1)|large_intestine(1)|lung(3)|skin(3)	9				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GGAGACCACAGGCCCTGCTGC	0.622																																					p.Q268H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G804T	3						.						73.0	61.0	65.0					3																	48508693		2203	4300	6503	48483697	SO:0001583	missense	11277	exon1			AF151105	CCDS2769.1, CCDS59451.1	3p21.31	2014-09-17			ENSG00000213689	ENSG00000213689			12269	protein-coding gene	gene with protein product		606609	"""Aicardi-Goutieres syndrome 1"""	AGS1		10391904, 10393201, 16845398	Standard	NM_033629		Approved	DRN3	uc010hka.4	Q9NSU2	OTTHUMG00000156205	ENST00000422277.2:c.804G>T	3.37:g.48508693G>T	ENSP00000390478:p.Gln268His		48483697	NM_016381	B2RCN9|Q8TEU2|Q9BPW1|Q9Y4X2	Missense_Mutation	SNP	ENST00000422277.2	37	CCDS43086.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.551691	0.45487	.	.	ENSG00000213689	ENST00000296443;ENST00000433541;ENST00000436480;ENST00000422277;ENST00000444177;ENST00000456089	D;D;D;D;D;D	0.95205	-3.64;-3.64;-3.64;-3.64;-3.64;-3.64	5.24	4.36	0.52297	Ribonuclease H-like (1);	0.559846	0.13290	U	0.399054	D	0.91382	0.7281	L	0.47716	1.5	0.25706	N	0.985532	B	0.30937	0.301	B	0.34590	0.186	D	0.84199	0.0449	10	0.40728	T	0.16	.	7.1369	0.25533	0.0881:0.0:0.7441:0.1678	.	268	Q9NSU2	TREX1_HUMAN	H	213;74;213;268;203;74	ENSP00000296443:Q213H;ENSP00000412404:Q74H;ENSP00000392569:Q213H;ENSP00000390478:Q268H;ENSP00000415972:Q203H;ENSP00000411331:Q74H	ENSP00000296443:Q213H	Q	+	3	2	TREX1	48483697	0.975000	0.34042	0.970000	0.41538	0.903000	0.53119	2.098000	0.41757	1.184000	0.42957	0.561000	0.74099	CAG		0.622	TREX1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_016381	
COL7A1	1294	hgsc.bcm.edu	37	3	48605028	48605028	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:48605028C>A	ENST00000328333.8	-	108	8132	c.8025G>T	c.(8023-8025)aaG>aaT	p.K2675N	COL7A1_ENST00000470076.1_5'Flank|COL7A1_ENST00000454817.1_Missense_Mutation_p.K2643N	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2675	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.K2675N(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCAGGCCCTCCTTGCCAGGGG	0.637																																					p.K2675N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8025T	3						.						58.0	67.0	64.0					3																	48605028		2202	4299	6501	48580032	SO:0001583	missense	1294	exon108			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.8025G>T	3.37:g.48605028C>A	ENSP00000332371:p.Lys2675Asn		48580032	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.617081	0.28801	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.94232	-3.38;-3.38	4.7	2.87	0.33458	.	0.000000	0.42172	D	0.000750	D	0.93736	0.7998	L	0.52823	1.66	0.32176	N	0.581053	D	0.89917	1.0	D	0.77004	0.989	D	0.90417	0.4414	10	0.23302	T	0.38	.	6.3084	0.21151	0.0:0.6227:0.0:0.3773	.	2675	Q02388	CO7A1_HUMAN	N	2675;2643	ENSP00000332371:K2675N;ENSP00000412569:K2643N	ENSP00000332371:K2675N	K	-	3	2	COL7A1	48580032	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	0.691000	0.25467	0.498000	0.27948	0.563000	0.77884	AAG		0.637	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
CELSR3	1951	hgsc.bcm.edu	37	3	48697682	48697682	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:48697682C>T	ENST00000164024.4	-	1	2666	c.2386G>A	c.(2386-2388)Ggc>Agc	p.G796S	CELSR3_ENST00000544264.1_Missense_Mutation_p.G796S	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	796	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.G796S(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CGGGTGTTGCCGCCTGTGATC	0.587																																					p.G796S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2386A	3						.						93.0	82.0	86.0					3																	48697682		2203	4300	6503	48672686	SO:0001583	missense	1951	exon1			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.2386G>A	3.37:g.48697682C>T	ENSP00000164024:p.Gly796Ser		48672686	NM_001407	O75092	Missense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537864	0.85917	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.56275	0.47;0.47	5.67	5.67	0.87782	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.74007	0.3660	M	0.76727	2.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.72893	-0.4154	9	0.45353	T	0.12	.	19.7607	0.96316	0.0:1.0:0.0:0.0	.	796;866	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	S	796	ENSP00000164024:G796S;ENSP00000445694:G796S	ENSP00000164024:G796S	G	-	1	0	CELSR3	48672686	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.818000	0.86416	2.686000	0.91538	0.561000	0.74099	GGC		0.587	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
NICN1	84276	hgsc.bcm.edu	37	3	49462804	49462804	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:49462804C>T	ENST00000273598.3	-	4	577	c.491G>A	c.(490-492)cGt>cAt	p.R164H	AMT_ENST00000476226.1_5'Flank|AMT_ENST00000546031.1_5'Flank|AMT_ENST00000458307.2_5'Flank|NICN1_ENST00000436744.2_Missense_Mutation_p.R126H|NICN1-AS1_ENST00000424915.1_RNA|AMT_ENST00000273588.3_5'Flank|AMT_ENST00000395338.2_5'Flank|NICN1_ENST00000422593.1_5'UTR|AMT_ENST00000538581.1_5'Flank	NM_032316.3	NP_115692.1	Q9BSH3	NICN1_HUMAN	nicolin 1	164						microtubule (GO:0005874)|nucleus (GO:0005634)		p.R164H(1)		kidney(1)|large_intestine(3)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;4.52e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCTTACCTCACGGAGGAGTGC	0.567																																					p.R164H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G491A	3						.						54.0	50.0	52.0					3																	49462804		2203	4300	6503	49437808	SO:0001583	missense	84276	exon4			AJ299740	CCDS2798.1	3p21.31	2008-07-18			ENSG00000145029	ENSG00000145029			18317	protein-coding gene	gene with protein product		611516				12392556	Standard	NM_032316		Approved	MGC12936	uc003cwz.1	Q9BSH3	OTTHUMG00000156848	ENST00000273598.3:c.491G>A	3.37:g.49462804C>T	ENSP00000273598:p.Arg164His		49437808	NM_032316	Q8IZQ2	Missense_Mutation	SNP	ENST00000273598.3	37	CCDS2798.1	.	.	.	.	.	.	.	.	.	.	C	1.301	-0.604762	0.03717	.	.	ENSG00000145029	ENST00000273598;ENST00000430622;ENST00000436744	T;T	0.22134	1.97;1.97	5.33	0.201	0.15186	.	0.579723	0.15871	N	0.240544	T	0.05044	0.0135	N	0.02011	-0.69	0.09310	N	0.999999	P;P	0.36712	0.566;0.566	B;B	0.30855	0.121;0.121	T	0.35500	-0.9786	10	0.14656	T	0.56	-14.6696	4.9099	0.13816	0.4397:0.381:0.1793:0.0	.	126;164	B4DX77;Q9BSH3	.;NICN1_HUMAN	H	164;126;126	ENSP00000273598:R164H;ENSP00000402335:R126H	ENSP00000273598:R164H	R	-	2	0	NICN1	49437808	0.666000	0.27475	0.082000	0.20525	0.165000	0.22458	0.070000	0.14573	0.072000	0.16694	-0.274000	0.10170	CGT		0.567	NICN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346224.3	NM_032316	
GNAT1	2779	hgsc.bcm.edu	37	3	50232223	50232223	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:50232223C>T	ENST00000433068.1	+	8	944	c.888C>T	c.(886-888)ggC>ggT	p.G296G	GNAT1_ENST00000232461.3_Silent_p.G296G	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	296					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.G296G(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		AGGACGCCGGCAACTACATCA	0.642											OREG0015580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G296G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C888T	3						.						70.0	61.0	64.0					3																	50232223		2203	4300	6503	50207227	SO:0001819	synonymous_variant	2779	exon8				CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.888C>T	3.37:g.50232223C>T		968	50207227	NM_000172	Q4VBN2	Silent	SNP	ENST00000433068.1	37	CCDS2812.1																																																																																				0.642	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345957.1	NM_000172	
GNL3	26354	hgsc.bcm.edu	37	3	52726985	52726985	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:52726985C>T	ENST00000418458.1	+	10	1140	c.967C>T	c.(967-969)Cga>Tga	p.R323*	SNORD19B_ENST00000459623.1_RNA|SNORD19_ENST00000410413.1_RNA|GLT8D1_ENST00000463827.1_5'Flank|SNORD69_ENST00000391150.1_RNA|GNL3_ENST00000394799.2_Nonsense_Mutation_p.R311*	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)	323	Intermediate. {ECO:0000250}.				cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.R323*(1)		breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		GCTTGCTCTGCGAAGTCCAGC	0.498																																					p.R311X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C931T	3						.						120.0	110.0	114.0					3																	52726985		2203	4300	6503	52702025	SO:0001587	stop_gained	26354	exon10			AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.967C>T	3.37:g.52726985C>T	ENSP00000395772:p.Arg323*		52702025	NM_206825	B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Nonsense_Mutation	SNP	ENST00000418458.1	37	CCDS2861.1	.	.	.	.	.	.	.	.	.	.	C	37	6.556574	0.97663	.	.	ENSG00000163938	ENST00000418458;ENST00000394799	.	.	.	5.91	3.74	0.42951	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.4583	0.55716	0.7926:0.2074:0.0:0.0	.	.	.	.	X	323;311	.	ENSP00000378278:R311X	R	+	1	2	GNL3	52702025	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	2.691000	0.47010	0.620000	0.30215	0.650000	0.86243	CGA		0.498	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352032.1	NM_014366	
ADAMTS9	56999	hgsc.bcm.edu	37	3	64536696	64536696	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:64536696C>T	ENST00000498707.1	-	31	5083	c.4741G>A	c.(4741-4743)Gtg>Atg	p.V1581M	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.V1553M	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1581	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V1581M(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TCCACACACACCACCTTGCGG	0.512																																					p.V1581M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4741A	3						.						194.0	168.0	176.0					3																	64536696		2203	4300	6503	64511736	SO:0001583	missense	56999	exon31			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4741G>A	3.37:g.64536696C>T	ENSP00000418735:p.Val1581Met		64511736	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.49|14.49	2.550792|2.550792	0.45383|0.45383	.|.	.|.	ENSG00000163638|ENSG00000163638	ENST00000295903;ENST00000498707|ENST00000481060	T;T|.	0.52983|.	0.64;0.64|.	5.83|5.83	2.98|2.98	0.34508|0.34508	.|.	0.565158|.	0.17909|.	N|.	0.157917|.	T|.	0.45357|.	0.1338|.	L|L	0.46614|0.46614	1.455|1.455	0.47819|0.47819	D|D	0.999525|0.999525	P;P;P|.	0.45715|.	0.76;0.865;0.76|.	B;B;P|.	0.45913|.	0.396;0.406;0.497|.	T|.	0.30238|.	-0.9985|.	10|.	0.34782|.	T|.	0.22|.	.|.	2.2388|2.2388	0.04015|0.04015	0.1817:0.4372:0.233:0.1481|0.1817:0.4372:0.233:0.1481	.|.	1553;1581;1581|.	B7ZVX9;Q9P2N4-1;Q9P2N4|.	.;.;ATS9_HUMAN|.	M|X	1553;1581|636	ENSP00000295903:V1553M;ENSP00000418735:V1581M|.	ENSP00000295903:V1553M|.	V|W	-|-	1|3	0|0	ADAMTS9|ADAMTS9	64511736|64511736	0.000000|0.000000	0.05858|0.05858	0.980000|0.980000	0.43619|0.43619	0.917000|0.917000	0.54804|0.54804	-1.195000|-1.195000	0.03043|0.03043	0.327000|0.327000	0.23409|0.23409	0.585000|0.585000	0.79938|0.79938	GTG|TGG		0.512	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
SENP5	205564	hgsc.bcm.edu	37	3	196613404	196613404	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr3:196613404G>T	ENST00000323460.5	+	2	1601	c.1352G>T	c.(1351-1353)aGc>aTc	p.S451I	SENP5_ENST00000445299.2_Missense_Mutation_p.S451I|SENP5_ENST00000419026.1_Intron	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	451					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.S451I(1)		NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		CTCAAGCAGAGCATTCTTAGT	0.478																																					p.S451I	Ovarian(47;891 1095 11174 13858 51271)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1352T	3						.						105.0	99.0	101.0					3																	196613404		2203	4300	6503	198097801	SO:0001583	missense	205564	exon2			BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.1352G>T	3.37:g.196613404G>T	ENSP00000327197:p.Ser451Ile		198097801	NM_152699	B4DY82|Q96SA5	Missense_Mutation	SNP	ENST00000323460.5	37	CCDS3322.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.617355	0.28801	.	.	ENSG00000119231	ENST00000323460;ENST00000445299	T;T	0.23754	2.21;1.89	5.4	2.92	0.33932	.	0.299862	0.28933	N	0.013672	T	0.14356	0.0347	N	0.14661	0.345	0.80722	D	1	B;B	0.24533	0.105;0.105	B;B	0.24541	0.054;0.033	T	0.06899	-1.0801	10	0.72032	D	0.01	-7.5892	7.5825	0.27974	0.7534:0.0:0.2466:0.0	.	451;451	B4DY82;Q96HI0	.;SENP5_HUMAN	I	451	ENSP00000327197:S451I;ENSP00000390231:S451I	ENSP00000327197:S451I	S	+	2	0	SENP5	198097801	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.163000	0.42377	0.396000	0.25283	-0.294000	0.09567	AGC		0.478	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1	NM_152699	
UTP20	27340	hgsc.bcm.edu	37	12	101764327	101764327	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:101764327T>G	ENST00000261637.4	+	50	6847	c.6673T>G	c.(6673-6675)Ttt>Gtt	p.F2225V		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2225					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.F2225V(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AGCCACTGCCTTTGGTCTTCT	0.403																																					p.F2225V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T6673G	12						.						159.0	149.0	153.0					12																	101764327		2203	4300	6503	100288458	SO:0001583	missense	27340	exon50			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.6673T>G	12.37:g.101764327T>G	ENSP00000261637:p.Phe2225Val		100288458	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.356368	0.82243	.	.	ENSG00000120800	ENST00000261637	T	0.63913	-0.07	5.94	4.8	0.61643	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80602	0.4654	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82675	-0.0340	10	0.87932	D	0	-19.4056	10.3614	0.43996	0.0:0.0747:0.0:0.9253	.	2225	O75691	UTP20_HUMAN	V	2225	ENSP00000261637:F2225V	ENSP00000261637:F2225V	F	+	1	0	UTP20	100288458	1.000000	0.71417	0.856000	0.33681	0.916000	0.54674	7.666000	0.83877	1.073000	0.40885	0.455000	0.32223	TTT		0.403	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
STAB2	55576	hgsc.bcm.edu	37	12	104144414	104144414	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:104144414C>T	ENST00000388887.2	+	60	6700	c.6496C>T	c.(6496-6498)Ccg>Tcg	p.P2166S	RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2									p.P2166S(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GAACTGTGAGCCGGAGCAGCT	0.537																																					p.P2166S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6496T	12						.						103.0	93.0	96.0					12																	104144414		2203	4300	6503	102668544	SO:0001583	missense	55576	exon60			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.6496C>T	12.37:g.104144414C>T	ENSP00000373539:p.Pro2166Ser		102668544	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532602	0.45073	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	T	0.63913	-0.07	5.32	3.42	0.39159	.	0.306880	0.30101	N	0.010403	T	0.49372	0.1553	L	0.47716	1.5	0.19775	N	0.999958	P	0.45348	0.856	B	0.41813	0.367	T	0.36890	-0.9729	10	0.10636	T	0.68	.	8.4937	0.33115	0.1194:0.464:0.4167:0.0	.	2166	Q8WWQ8	STAB2_HUMAN	S	2166;853	ENSP00000373539:P2166S	ENSP00000258495:P853S	P	+	1	0	STAB2	102668544	0.829000	0.29322	0.987000	0.45799	0.817000	0.46193	3.131000	0.50515	1.220000	0.43490	0.555000	0.69702	CCG		0.537	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
NT5DC3	51559	hgsc.bcm.edu	37	12	104179138	104179138	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:104179138A>G	ENST00000392876.3	-	12	1344	c.1304T>C	c.(1303-1305)tTg>tCg	p.L435S		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	435						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.L360S(1)		NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						TAAGCCAGTCAAGGTCTGCAG	0.423																																					p.L435S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1304C	12						.						230.0	195.0	207.0					12																	104179138		2203	4300	6503	102703268	SO:0001583	missense	51559	exon12			AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.1304T>C	12.37:g.104179138A>G	ENSP00000376615:p.Leu435Ser		102703268	NM_001031701	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	ENST00000392876.3	37	CCDS41824.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.599019	0.87055	.	.	ENSG00000111696	ENST00000392876	T	0.34275	1.37	5.46	5.46	0.80206	HAD-like domain (1);	0.000000	0.85682	D	0.000000	T	0.68869	0.3048	M	0.92970	3.365	0.58432	D	0.999999	D	0.76494	0.999	D	0.77557	0.99	T	0.77950	-0.2395	10	0.87932	D	0	-13.3396	15.5351	0.75996	1.0:0.0:0.0:0.0	.	435	Q86UY8	NT5D3_HUMAN	S	435	ENSP00000376615:L435S	ENSP00000376615:L435S	L	-	2	0	NT5DC3	102703268	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.283000	0.95860	2.070000	0.61991	0.533000	0.62120	TTG		0.423	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347118.2	NM_016575	
UBE3B	89910	hgsc.bcm.edu	37	12	109948214	109948214	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:109948214G>A	ENST00000342494.3	+	17	2402	c.1807G>A	c.(1807-1809)Gag>Aag	p.E603K	UBE3B_ENST00000535900.1_3'UTR|UBE3B_ENST00000280774.5_Missense_Mutation_p.E603K|UBE3B_ENST00000434735.2_Missense_Mutation_p.E603K	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	603					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.E603K(1)		NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						GGTGCTGTACGAGCGGGACTG	0.622																																					p.E603K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1807A	12						.						48.0	42.0	44.0					12																	109948214		2203	4300	6503	108432597	SO:0001583	missense	89910	exon17			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.1807G>A	12.37:g.109948214G>A	ENSP00000340596:p.Glu603Lys		108432597	NM_130466	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	ENST00000342494.3	37	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957711	0.92726	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000539599;ENST00000342494;ENST00000539584	T;T;T;T	0.51325	1.19;0.71;1.43;1.19	4.98	4.98	0.66077	.	0.049167	0.85682	D	0.000000	T	0.43964	0.1271	M	0.62723	1.935	0.80722	D	1	P	0.37612	0.602	B	0.27796	0.083	T	0.51787	-0.8661	10	0.52906	T	0.07	-10.5293	16.8064	0.85706	0.0:0.0:1.0:0.0	.	603	Q7Z3V4	UBE3B_HUMAN	K	603;603;603;603;30	ENSP00000391529:E603K;ENSP00000280774:E603K;ENSP00000443131:E603K;ENSP00000340596:E603K	ENSP00000280774:E603K	E	+	1	0	UBE3B	108432597	1.000000	0.71417	0.949000	0.38748	0.931000	0.56810	7.477000	0.81069	2.298000	0.77334	0.462000	0.41574	GAG		0.622	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	
ACAD10	80724	hgsc.bcm.edu	37	12	112184880	112184880	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:112184880G>A	ENST00000313698.4	+	15	2439	c.2284G>A	c.(2284-2286)Ggc>Agc	p.G762S	ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000392636.2_Missense_Mutation_p.G364S|ACAD10_ENST00000455480.2_Missense_Mutation_p.G793S	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	762						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.G762S(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						GCCTGACACGGGCAACATGGA	0.537																																					p.G762S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2284A	12						.						88.0	75.0	80.0					12																	112184880		2203	4300	6503	110669263	SO:0001583	missense	80724	exon15			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.2284G>A	12.37:g.112184880G>A	ENSP00000325137:p.Gly762Ser		110669263	NM_025247	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	ENST00000313698.4	37	CCDS31903.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.526958	0.64860	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000455480;ENST00000313698	D;D;D	0.99709	-6.48;-6.48;-6.48	5.83	4.94	0.65067	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.190697	0.44097	D	0.000498	D	0.99816	0.9919	H	0.96833	3.89	0.48696	D	0.999695	D;D;D	0.89917	1.0;0.999;0.997	D;D;D	0.97110	1.0;0.997;0.917	D	0.96813	0.9598	10	0.87932	D	0	.	13.9	0.63797	0.0742:0.0:0.9258:0.0	.	793;762;762	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	S	364;762;793;762	ENSP00000376411:G364S;ENSP00000389813:G793S;ENSP00000325137:G762S	ENSP00000325137:G762S	G	+	1	0	ACAD10	110669263	1.000000	0.71417	0.993000	0.49108	0.043000	0.13939	6.762000	0.74950	1.479000	0.48272	-0.140000	0.14226	GGC		0.537	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247	
RBM19	9904	hgsc.bcm.edu	37	12	114261092	114261092	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:114261092G>A	ENST00000545145.2	-	24	2898	c.2820C>T	c.(2818-2820)gaC>gaT	p.D940D	RBM19_ENST00000392561.3_Silent_p.D940D|RBM19_ENST00000261741.5_Silent_p.D940D	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	940					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.D940D(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CCAGGATCTCGTCCAACACCA	0.617																																					p.D940D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2820T	12						.						51.0	46.0	48.0					12																	114261092		2203	4300	6503	112745475	SO:0001819	synonymous_variant	9904	exon24			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2820C>T	12.37:g.114261092G>A			112745475	NM_016196	A8K5X9|Q9BPY6|Q9UFN5	Silent	SNP	ENST00000545145.2	37	CCDS9172.1																																																																																				0.617	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196	
ETV6	2120	hgsc.bcm.edu	37	12	12022669	12022669	+	Missense_Mutation	SNP	C	C	G	rs141868934		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:12022669C>G	ENST00000396373.4	+	5	1049	c.775C>G	c.(775-777)Cgg>Ggg	p.R259G		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	259					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R259G(1)	ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				ATCCAGCCCCCGGCAGGAGAG	0.607			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																p.R259G			Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C775G	12						.						99.0	96.0	97.0					12																	12022669		2203	4300	6503	11913936	SO:0001583	missense	2120	exon5			BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.775C>G	12.37:g.12022669C>G	ENSP00000379658:p.Arg259Gly		11913936	NM_001987	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	ENST00000396373.4	37	CCDS8643.1	.	.	.	.	.	.	.	.	.	.	C	9.372	1.070663	0.20147	.	.	ENSG00000139083	ENST00000396373	T	0.03860	3.78	5.76	3.88	0.44766	.	0.221359	0.48286	D	0.000196	T	0.05456	0.0144	L	0.51422	1.61	0.39573	D	0.969308	B	0.02656	0.0	B	0.01281	0.0	T	0.32402	-0.9908	10	0.19590	T	0.45	.	9.7055	0.40214	0.1414:0.7844:0.0:0.0742	.	259	P41212	ETV6_HUMAN	G	259	ENSP00000379658:R259G	ENSP00000379658:R259G	R	+	1	2	ETV6	11913936	0.990000	0.36364	1.000000	0.80357	0.994000	0.84299	1.854000	0.39368	0.723000	0.32274	0.655000	0.94253	CGG		0.607	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400130.2	NM_001987	
TBX5	6910	hgsc.bcm.edu	37	12	114832609	114832609	+	Silent	SNP	C	C	T	rs139329918	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:114832609C>T	ENST00000310346.4	-	6	1266	c.600G>A	c.(598-600)gcG>gcA	p.A200A	TBX5_ENST00000405440.2_Silent_p.A200A|TBX5_ENST00000552726.1_5'Flank|TBX5_ENST00000526441.1_Silent_p.A200A|TBX5_ENST00000349716.5_Silent_p.A150A	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	200					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.A200A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GAGTGCAGAACGCTGTATTTT	0.433																																					p.A200A	NSCLC(152;1358 1980 4050 23898 40356)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G600A	12						.						217.0	216.0	216.0					12																	114832609		2203	4300	6503	113316992	SO:0001819	synonymous_variant	6910	exon6			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.600G>A	12.37:g.114832609C>T			113316992	NM_000192	A6ND77|O15301|Q96TB0|Q9Y4I2	Silent	SNP	ENST00000310346.4	37	CCDS9173.1																																																																																				0.433	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717	
SPPL3	121665	hgsc.bcm.edu	37	12	121248612	121248612	+	Splice_Site	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:121248612C>T	ENST00000353487.2	-	2	604	c.101G>A	c.(100-102)aGg>aAg	p.R34K		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	34						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)	p.R34K(1)				all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AATATCTTACCTGAAACTACC	0.388																																					p.R34K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G101A	12						.						105.0	110.0	108.0					12																	121248612		2203	4300	6503	119732995	SO:0001630	splice_region_variant	121665	exon2				CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.101+1G>A	12.37:g.121248612C>T			119732995	NM_139015	Q3MJ04|Q8TAU4|Q96DD9	Missense_Mutation	SNP	ENST00000353487.2	37	CCDS9208.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742325	0.89573	.	.	ENSG00000157837	ENST00000353487;ENST00000405631	T	0.18657	2.2	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.34454	0.0898	M	0.81802	2.56	0.80722	D	1	P;P	0.49447	0.924;0.825	P;B	0.44860	0.462;0.192	T	0.23619	-1.0183	9	.	.	.	-15.117	17.6966	0.88283	0.0:1.0:0.0:0.0	.	34;34	Q8TCT6;Q3MJ04	PSL4_HUMAN;.	K	34;33	ENSP00000288680:R34K	.	R	-	2	0	AC069214.1	119732995	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.643000	0.74334	2.716000	0.92895	0.563000	0.77884	AGG		0.388	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402980.2	NM_139015	Missense_Mutation
B3GNT4	79369	hgsc.bcm.edu	37	12	122691667	122691667	+	Missense_Mutation	SNP	G	G	A	rs147517845	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:122691667G>A	ENST00000324189.4	+	3	1225	c.869G>A	c.(868-870)cGc>cAc	p.R290H	B3GNT4_ENST00000545141.1_Intron|B3GNT4_ENST00000546192.1_Missense_Mutation_p.R265H|B3GNT4_ENST00000535274.1_Missense_Mutation_p.R265H	NM_030765.2	NP_110392.1	Q9C0J1	B3GN4_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4	290					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)	p.R290H(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000297)|Epithelial(86;0.000497)|BRCA - Breast invasive adenocarcinoma(302;0.222)		ACAGTGCGGCGCCTCCAGGCT	0.557																																					p.R290H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G869A	12						.	G	HIS/ARG	0,4406		0,0,2203	120.0	104.0	110.0		869	-2.7	0.0	12	dbSNP_134	110	3,8597	2.2+/-6.3	0,3,4297	yes	missense	B3GNT4	NM_030765.2	29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign	290/379	122691667	3,13003	2203	4300	6503	121257620	SO:0001583	missense	79369	exon3			AB049586	CCDS9227.1	12q24	2013-02-19						"""Beta 3-glycosyltransferases"""	15683	protein-coding gene	gene with protein product		605864				11042166	Standard	NM_030765		Approved	B3GN-T4, beta3Gn-T4	uc001ubx.3	Q9C0J1		ENST00000324189.4:c.869G>A	12.37:g.122691667G>A	ENSP00000319636:p.Arg290His		121257620	NM_030765	Q8N5W4|Q8N934|Q8ND21|Q8WWR5|Q8WY02|Q96QH5	Missense_Mutation	SNP	ENST00000324189.4	37	CCDS9227.1	.	.	.	.	.	.	.	.	.	.	G	10.08	1.251665	0.22880	0.0	3.49E-4	ENSG00000176383	ENST00000324189;ENST00000546192;ENST00000535274	T;T;T	0.44482	0.92;0.92;0.92	5.5	-2.65	0.06095	.	0.242319	0.27130	N	0.020798	T	0.32496	0.0831	M	0.67397	2.05	0.09310	N	1	B	0.20671	0.047	B	0.17722	0.019	T	0.20672	-1.0268	10	0.46703	T	0.11	.	5.2698	0.15618	0.3555:0.2444:0.4001:0.0	.	290	Q9C0J1	B3GN4_HUMAN	H	290;265;265	ENSP00000319636:R290H;ENSP00000438840:R265H;ENSP00000444534:R265H	ENSP00000319636:R290H	R	+	2	0	B3GNT4	121257620	0.000000	0.05858	0.001000	0.08648	0.234000	0.25298	0.579000	0.23788	-0.436000	0.07254	-0.136000	0.14681	CGC		0.557	B3GNT4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401595.1	NM_030765	
PITPNM2	57605	hgsc.bcm.edu	37	12	123472151	123472151	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:123472151G>A	ENST00000542749.1	-	20	3233	c.3170C>T	c.(3169-3171)aCg>aTg	p.T1057M	PITPNM2_ENST00000280562.5_Missense_Mutation_p.T1051M|PITPNM2_ENST00000320201.4_Missense_Mutation_p.T1057M|PITPNM2_ENST00000392428.1_Missense_Mutation_p.T778M			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	1057					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)	p.T1057M(1)		NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		GGTCACCAGCGTATCCAGGTA	0.617																																					p.T1057M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3170T	12						.						118.0	98.0	105.0					12																	123472151		2203	4300	6503	122038104	SO:0001583	missense	57605	exon21			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.3170C>T	12.37:g.123472151G>A	ENSP00000437611:p.Thr1057Met		122038104	NM_020845	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	37	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.562394	0.86335	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	D;D;D;D	0.95756	-3.8;-3.8;-3.8;-3.8	5.13	5.13	0.70059	.	0.058904	0.64402	D	0.000003	D	0.98169	0.9395	M	0.90252	3.1	0.52501	D	0.999955	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.987	D	0.99278	1.0895	10	0.87932	D	0	-26.2521	18.5707	0.91135	0.0:0.0:1.0:0.0	.	1051;1057	Q9BZ72-2;Q9BZ72	.;PITM2_HUMAN	M	1051;1057;778;1057	ENSP00000280562:T1051M;ENSP00000322218:T1057M;ENSP00000376223:T778M;ENSP00000437611:T1057M	ENSP00000280562:T1051M	T	-	2	0	PITPNM2	122038104	1.000000	0.71417	0.982000	0.44146	0.921000	0.55340	9.781000	0.99029	2.386000	0.81285	0.491000	0.48974	ACG		0.617	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
PITPNM2	57605	hgsc.bcm.edu	37	12	123485362	123485362	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:123485362C>A	ENST00000542749.1	-	8	1250	c.1187G>T	c.(1186-1188)aGg>aTg	p.R396M	PITPNM2_ENST00000280562.5_Missense_Mutation_p.R396M|PITPNM2_ENST00000451868.2_5'UTR|PITPNM2_ENST00000546049.1_Missense_Mutation_p.R434M|PITPNM2_ENST00000320201.4_Missense_Mutation_p.R396M|PITPNM2_ENST00000392428.1_Missense_Mutation_p.R117M			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	396					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)	p.R396M(1)		NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		GGAGGCCACCCTGAACTCAGG	0.652																																					p.R396M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1187T	12						.						56.0	51.0	52.0					12																	123485362		2203	4300	6503	122051315	SO:0001583	missense	57605	exon9			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.1187G>T	12.37:g.123485362C>A	ENSP00000437611:p.Arg396Met		122051315	NM_020845	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	37	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.459447	0.43736	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	T;T;T;T	0.50001	1.11;1.11;0.76;1.11	4.91	2.94	0.34122	.	0.921928	0.09332	N	0.816758	T	0.45357	0.1338	L	0.36672	1.1	0.23933	N	0.996428	D;P;P	0.54601	0.967;0.817;0.94	P;P;B	0.49085	0.525;0.6;0.332	T	0.26573	-1.0099	10	0.49607	T	0.09	-24.9267	8.9217	0.35615	0.0:0.5056:0.4098:0.0846	.	396;396;396	A5D8U3;Q9BZ72-2;Q9BZ72	.;.;PITM2_HUMAN	M	396;396;117;396	ENSP00000280562:R396M;ENSP00000322218:R396M;ENSP00000376223:R117M;ENSP00000437611:R396M	ENSP00000280562:R396M	R	-	2	0	PITPNM2	122051315	0.641000	0.27251	1.000000	0.80357	0.947000	0.59692	0.572000	0.23684	1.191000	0.43056	-0.304000	0.09214	AGG		0.652	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
CCDC92	80212	hgsc.bcm.edu	37	12	124422201	124422201	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:124422201G>T	ENST00000238156.3	-	5	754	c.400C>A	c.(400-402)Ctg>Atg	p.L134M	DNAH10OS_ENST00000514254.2_5'Flank|CCDC92_ENST00000545891.1_Missense_Mutation_p.L117M|RP11-380L11.3_ENST00000602292.1_RNA|CCDC92_ENST00000544798.1_Intron|CCDC92_ENST00000545135.1_Missense_Mutation_p.L117M	NM_025140.1	NP_079416.1	Q53HC0	CCD92_HUMAN	coiled-coil domain containing 92	134						centriole (GO:0005814)		p.L134M(1)		large_intestine(5)|lung(2)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.0002)|OV - Ovarian serous cystadenocarcinoma(86;0.000222)|all cancers(50;0.00129)|BRCA - Breast invasive adenocarcinoma(302;0.242)		TTGGCCTTCAGCTCCTCCAGG	0.557																																					p.L134M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C400A	12						.						244.0	209.0	221.0					12																	124422201		2203	4300	6503	122988154	SO:0001583	missense	80212	exon5			AK026124	CCDS9256.1	12q24.31	2011-09-02			ENSG00000119242	ENSG00000119242			29563	protein-coding gene	gene with protein product	"""limkain beta 2"""					12477932	Standard	NM_025140		Approved	FLJ22471	uc001ufw.1	Q53HC0	OTTHUMG00000168725	ENST00000238156.3:c.400C>A	12.37:g.124422201G>T	ENSP00000238156:p.Leu134Met		122988154	NM_025140	B3KNQ0|Q9H697	Missense_Mutation	SNP	ENST00000238156.3	37	CCDS9256.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112255	0.77210	.	.	ENSG00000119242	ENST00000238156;ENST00000545135;ENST00000545891	T;T;T	0.56275	0.47;0.5;0.5	5.56	3.74	0.42951	.	0.000000	0.85682	D	0.000000	T	0.71668	0.3367	M	0.86343	2.81	0.47949	D	0.999553	D	0.89917	1.0	D	0.91635	0.999	T	0.73477	-0.3970	10	0.56958	D	0.05	0.3764	7.7383	0.28827	0.2752:0.0:0.7248:0.0	.	134	Q53HC0	CCD92_HUMAN	M	134;117;117	ENSP00000238156:L134M;ENSP00000439526:L117M;ENSP00000440024:L117M	ENSP00000238156:L134M	L	-	1	2	CCDC92	122988154	1.000000	0.71417	0.997000	0.53966	0.923000	0.55619	4.506000	0.60428	1.356000	0.45884	0.555000	0.69702	CTG		0.557	CCDC92-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400780.2	NM_025140	
TMEM132D	121256	hgsc.bcm.edu	37	12	129566495	129566495	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:129566495G>A	ENST00000422113.2	-	7	2058	c.1732C>T	c.(1732-1734)Cgg>Tgg	p.R578W	TMEM132D_ENST00000389441.4_Missense_Mutation_p.R116W	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	578					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.R578W(2)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GTCAGGACCCGCACCATGGCG	0.652																																					p.R578W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1732T	12						.						45.0	47.0	47.0					12																	129566495		2203	4299	6502	128132448	SO:0001583	missense	121256	exon7			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1732C>T	12.37:g.129566495G>A	ENSP00000408581:p.Arg578Trp		128132448	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787869	0.70337	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.55588	0.51;0.51	4.72	3.76	0.43208	.	0.101204	0.42964	D	0.000622	T	0.74741	0.3756	M	0.88105	2.93	0.44619	D	0.997599	D;D	0.89917	1.0;1.0	D;D	0.85130	0.984;0.997	T	0.79671	-0.1706	9	.	.	.	-44.7815	12.9732	0.58524	0.0:0.0:0.7201:0.2798	.	578;116	Q14C87;Q14C87-2	T132D_HUMAN;.	W	116;578	ENSP00000374092:R116W;ENSP00000408581:R578W	.	R	-	1	2	TMEM132D	128132448	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.775000	0.47702	2.149000	0.67028	0.561000	0.74099	CGG		0.652	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
EP400	57634	hgsc.bcm.edu	37	12	132497596	132497596	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:132497596T>C	ENST00000333577.4	+	18	3701	c.3592T>C	c.(3592-3594)Tac>Cac	p.Y1198H	EP400_ENST00000389562.2_Missense_Mutation_p.Y1161H|EP400_ENST00000330386.6_Missense_Mutation_p.Y1162H|EP400_ENST00000389561.2_Missense_Mutation_p.Y1162H|EP400_ENST00000332482.4_Missense_Mutation_p.Y1125H			Q96L91	EP400_HUMAN	E1A binding protein p400	1198	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Interactions with RUVBL1 and RUVBL2.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Y1161H(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CATCACGTCCTACACTCAGTT	0.577																																					p.Y1161H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3481C	12						.						107.0	82.0	91.0					12																	132497596		2203	4300	6503	131063549	SO:0001583	missense	57634	exon17			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.3592T>C	12.37:g.132497596T>C	ENSP00000333602:p.Tyr1198His		131063549	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	T	15.49	2.848670	0.51164	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296;ENST00000542457	D;D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95;-3.95	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.99061	0.9678	H	0.99545	4.62	0.51233	D	0.99991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98886	1.0771	10	0.87932	D	0	.	15.1844	0.72989	0.0:0.0:0.0:1.0	.	1162;1162;1161	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	H	1198;1162;1161;1125;1162;1162;1162	ENSP00000333602:Y1198H;ENSP00000374212:Y1162H;ENSP00000374213:Y1161H;ENSP00000331737:Y1125H;ENSP00000330620:Y1162H	ENSP00000330620:Y1162H	Y	+	1	0	EP400	131063549	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.661000	0.83786	1.977000	0.57605	0.448000	0.29417	TAC		0.577	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
NINJ2	4815	hgsc.bcm.edu	37	12	772531	772531	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:772531C>T	ENST00000305108.4	-	1	414	c.134G>A	c.(133-135)aGc>aAc	p.S45N	RP11-218M22.1_ENST00000543884.1_RNA	NM_016533.4	NP_057617.2	Q9NZG7	NINJ2_HUMAN	ninjurin 2	0					nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|tissue regeneration (GO:0042246)	integral component of plasma membrane (GO:0005887)		p.S45N(1)		large_intestine(3)|lung(1)|ovary(2)	6	all_cancers(10;0.0101)|all_epithelial(11;0.0174)|Ovarian(42;0.0512)|all_lung(10;0.103)|Lung NSC(10;0.185)		OV - Ovarian serous cystadenocarcinoma(31;3.26e-05)|BRCA - Breast invasive adenocarcinoma(9;0.0508)			TTCCATCTCGCTGCCCTCAAG	0.577																																					p.S45N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G134A	12						.						129.0	129.0	129.0					12																	772531		2203	4300	6503	642792	SO:0001583	missense	4815	exon1			AF205633	CCDS8505.1, CCDS73418.1	12p13	2008-08-05			ENSG00000171840	ENSG00000171840			7825	protein-coding gene	gene with protein product		607297				10627596	Standard	XM_005253689		Approved		uc001qil.3	Q9NZG7	OTTHUMG00000090311	ENST00000305108.4:c.134G>A	12.37:g.772531C>T	ENSP00000307552:p.Ser45Asn		642792	NM_016533		Missense_Mutation	SNP	ENST00000305108.4	37	CCDS8505.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.599779	0.28534	.	.	ENSG00000171840	ENST00000305108	T	0.48836	0.8	4.75	4.75	0.60458	.	0.198120	0.25172	N	0.032592	T	0.48241	0.1489	N	0.19112	0.55	0.80722	D	1	D	0.69078	0.997	D	0.63597	0.916	T	0.43718	-0.9374	10	0.44086	T	0.13	-12.8359	10.2935	0.43610	0.0:0.908:0.0:0.092	.	45	B4DJC1	.	N	45	ENSP00000307552:S45N	ENSP00000307552:S45N	S	-	2	0	NINJ2	642792	1.000000	0.71417	0.931000	0.37212	0.129000	0.20672	1.739000	0.38217	2.469000	0.83416	0.591000	0.81541	AGC		0.577	NINJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206673.2	NM_016533	
SCNN1A	6337	hgsc.bcm.edu	37	12	6463613	6463613	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:6463613T>G	ENST00000228916.2	-	8	1449	c.1351A>C	c.(1351-1353)Agt>Cgt	p.S451R	SCNN1A_ENST00000358945.3_Missense_Mutation_p.S451R|SCNN1A_ENST00000538979.1_5'UTR|SCNN1A_ENST00000360168.3_Missense_Mutation_p.S510R|SCNN1A_ENST00000396966.2_Missense_Mutation_p.S451R|SCNN1A_ENST00000543768.1_Missense_Mutation_p.S474R|SCNN1A_ENST00000540037.1_Missense_Mutation_p.S151R	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	451					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)	p.S451R(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	CCCCAGGAACTGTGCTTTCTG	0.572																																					p.S510R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1528C	12						.						73.0	74.0	73.0					12																	6463613		2203	4300	6503	6333874	SO:0001583	missense	6337	exon7			Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.1351A>C	12.37:g.6463613T>G	ENSP00000228916:p.Ser451Arg		6333874	NM_001159576	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Missense_Mutation	SNP	ENST00000228916.2	37	CCDS8543.1	.	.	.	.	.	.	.	.	.	.	T	9.413	1.080977	0.20309	.	.	ENSG00000111319	ENST00000360168;ENST00000358945;ENST00000540037;ENST00000228916;ENST00000396966;ENST00000543768	T;T;T;T;T;T	0.70516	-0.48;-0.49;-0.28;-0.47;-0.12;-0.47	4.95	-1.85	0.07784	.	1.271270	0.05347	N	0.531186	T	0.61426	0.2346	L	0.40543	1.245	0.09310	N	1	B;B;B	0.29646	0.253;0.245;0.217	B;B;B	0.33960	0.173;0.124;0.138	T	0.54873	-0.8228	10	0.66056	D	0.02	-1.5617	5.5596	0.17135	0.0:0.3874:0.1525:0.4601	.	474;451;510	B4E2Q5;P37088;P37088-2	.;SCNNA_HUMAN;.	R	510;451;151;451;451;474	ENSP00000353292:S510R;ENSP00000351825:S451R;ENSP00000440876:S151R;ENSP00000228916:S451R;ENSP00000380166:S451R;ENSP00000438739:S474R	ENSP00000228916:S451R	S	-	1	0	SCNN1A	6333874	0.000000	0.05858	0.002000	0.10522	0.232000	0.25224	-0.018000	0.12568	-0.330000	0.08514	0.402000	0.26972	AGT		0.572	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399055.1		
PPFIBP1	8496	hgsc.bcm.edu	37	12	27845556	27845556	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:27845556A>G	ENST00000318304.8	+	28	3199	c.2916A>G	c.(2914-2916)atA>atG	p.I972M	PPFIBP1_ENST00000542629.1_Missense_Mutation_p.I941M|PPFIBP1_ENST00000537927.1_Missense_Mutation_p.I819M|PPFIBP1_ENST00000228425.6_Missense_Mutation_p.I966M	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	972					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)		p.I966M(1)|p.I972M(1)	PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					TGAGACAGATAGGTGCATTCT	0.378																																					p.I819M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2457G	12						.						210.0	200.0	203.0					12																	27845556		2203	4300	6503	27736823	SO:0001583	missense	8496	exon26			AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.2916A>G	12.37:g.27845556A>G	ENSP00000314724:p.Ile972Met		27736823	NM_001198915	O75336|Q86X70|Q9NY03|Q9ULJ0	Missense_Mutation	SNP	ENST00000318304.8	37	CCDS55812.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.86|18.86	3.713156|3.713156	0.68730|0.68730	.|.	.|.	ENSG00000110841|ENSG00000110841	ENST00000537927;ENST00000318304;ENST00000542629;ENST00000228425|ENST00000539326	T;T;T;T|.	0.44083|.	0.93;1.36;1.35;1.38|.	5.56|5.56	-1.9|-1.9	0.07665|0.07665	.|.	0.000000|.	0.37053|.	U|.	0.002276|.	T|.	0.61438|.	0.2347|.	M|M	0.71036|0.71036	2.16|2.16	0.49051|0.49051	D|D	0.999747|0.999747	D;D;D|.	0.89917|.	0.999;1.0;0.999|.	D;D;D|.	0.97110|.	0.999;0.999;1.0|.	T|.	0.61426|.	-0.7065|.	10|.	0.87932|.	D|.	0|.	-28.1118|-28.1118	8.7006|8.7006	0.34323|0.34323	0.3482:0.4565:0.0:0.1953|0.3482:0.4565:0.0:0.1953	.|.	972;966;941|.	Q86W92;Q86W92-2;Q86W92-4|.	LIPB1_HUMAN;.;.|.	M|W	819;972;941;966|203	ENSP00000445425:I819M;ENSP00000314724:I972M;ENSP00000443442:I941M;ENSP00000228425:I966M|.	ENSP00000228425:I966M|.	I|X	+|+	3|2	3|0	PPFIBP1|PPFIBP1	27736823|27736823	0.573000|0.573000	0.26676|0.26676	0.995000|0.995000	0.50966|0.50966	0.995000|0.995000	0.86356|0.86356	-0.132000|-0.132000	0.10467|0.10467	0.060000|0.060000	0.16281|0.16281	0.533000|0.533000	0.62120|0.62120	ATA|TAG		0.378	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402877.1	NM_003622	
CNTN1	1272	hgsc.bcm.edu	37	12	41312491	41312491	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:41312491A>G	ENST00000551295.2	+	4	262	c.145A>G	c.(145-147)Aat>Gat	p.N49D	CNTN1_ENST00000547702.1_Missense_Mutation_p.N49D|CNTN1_ENST00000348761.2_Missense_Mutation_p.N38D|CNTN1_ENST00000360099.3_Missense_Mutation_p.N49D|CNTN1_ENST00000547849.1_Missense_Mutation_p.N49D|CNTN1_ENST00000347616.1_Missense_Mutation_p.N49D	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	49	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.N49D(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GCAGCCAATCAATACCATTTA	0.398																																					p.N38D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A112G	12						.						81.0	88.0	85.0					12																	41312491		2203	4300	6503	39598758	SO:0001583	missense	1272	exon3			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.145A>G	12.37:g.41312491A>G	ENSP00000447006:p.Asn49Asp		39598758	NM_175038	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	A	7.339	0.620596	0.14193	.	.	ENSG00000018236	ENST00000547702;ENST00000551424;ENST00000551295;ENST00000548005;ENST00000552248;ENST00000547849;ENST00000552913;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T;T;T	0.62788	-0.0;0.38;1.06;1.06;-0.0;0.38;-0.0;0.33	5.1	3.93	0.45458	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.109437	0.64402	D	0.000013	T	0.24967	0.0606	N	0.01631	-0.79	0.35423	D	0.793411	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.11329	0.001;0.003;0.006	T	0.38672	-0.9650	10	0.02654	T	1	.	5.3065	0.15807	0.7329:0.0:0.2671:0.0	.	49;38;49	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	D	49;49;49;49;49;49;49;49;49;38	ENSP00000448004:N49D;ENSP00000447006:N49D;ENSP00000447862:N49D;ENSP00000447860:N49D;ENSP00000448653:N49D;ENSP00000325660:N49D;ENSP00000353213:N49D;ENSP00000261160:N38D	ENSP00000325660:N49D	N	+	1	0	CNTN1	39598758	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.832000	0.62759	2.049000	0.60858	0.477000	0.44152	AAT		0.398	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
PDZRN4	29951	hgsc.bcm.edu	37	12	41967534	41967534	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:41967534A>C	ENST00000402685.2	+	10	2961	c.2953A>C	c.(2953-2955)Atc>Ctc	p.I985L	PDZRN4_ENST00000539469.2_Missense_Mutation_p.I727L|PDZRN4_ENST00000298919.7_Missense_Mutation_p.I725L	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	985							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I985L(1)|p.I727L(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CAAGAAGGAGATCAATATCAT	0.478																																					p.I985L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2953C	12						.						55.0	52.0	53.0					12																	41967534		2203	4300	6503	40253801	SO:0001583	missense	29951	exon10			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2953A>C	12.37:g.41967534A>C	ENSP00000384197:p.Ile985Leu		40253801	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	A	2.975	-0.211520	0.06140	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.75154	-0.91;-0.91;-0.91	4.25	-4.16	0.03869	.	0.631509	0.16018	N	0.233479	T	0.41096	0.1144	N	0.05078	-0.115	0.29719	N	0.838788	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.45644	-0.9247	10	0.06365	T	0.9	-5.2155	7.0973	0.25317	0.2698:0.4814:0.2488:0.0	.	985;725;727	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	L	985;727;725	ENSP00000384197:I985L;ENSP00000439990:I727L;ENSP00000298919:I725L	ENSP00000298919:I725L	I	+	1	0	PDZRN4	40253801	0.993000	0.37304	0.917000	0.36280	0.345000	0.29048	0.420000	0.21263	-0.696000	0.05098	0.455000	0.32223	ATC		0.478	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
IRAK4	51135	hgsc.bcm.edu	37	12	44171523	44171523	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:44171523A>G	ENST00000448290.2	+	7	878	c.807A>G	c.(805-807)tcA>tcG	p.S269S	IRAK4_ENST00000440781.2_Silent_p.S145S|IRAK4_ENST00000551736.1_Silent_p.S269S|IRAK4_ENST00000431837.1_Silent_p.S145S	NM_016123.3	NP_057207.2	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4	269	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S269S(1)				all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		CTAATGGTTCATTGCTAGACA	0.348																																					p.S269S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A807G	12						.						181.0	162.0	168.0					12																	44171523		2203	4300	6503	42457790	SO:0001819	synonymous_variant	51135	exon7			AF155118	CCDS8744.1, CCDS44862.1	12q12	2014-09-17				ENSG00000198001			17967	protein-coding gene	gene with protein product		606883				3772297, 10508479	Standard	NM_001114182		Approved	NY-REN-64	uc001rnt.3	Q9NWZ3		ENST00000448290.2:c.807A>G	12.37:g.44171523A>G			42457790	NM_016123	Q69FE1|Q8TDF7|Q9Y589	Silent	SNP	ENST00000448290.2	37	CCDS8744.1																																																																																				0.348	IRAK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403947.1		
DBX2	440097	hgsc.bcm.edu	37	12	45417619	45417619	+	Silent	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:45417619G>T	ENST00000332700.6	-	3	729	c.558C>A	c.(556-558)ggC>ggA	p.G186G		NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	186					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G186G(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		TTCTTAAAATGCCCCTCCGAG	0.433																																					p.G186G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C558A	12						.						79.0	82.0	81.0					12																	45417619		2203	4300	6503	43703886	SO:0001819	synonymous_variant	440097	exon3				CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.558C>A	12.37:g.45417619G>T			43703886	NM_001004329		Silent	SNP	ENST00000332700.6	37	CCDS31781.1																																																																																				0.433	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404810.1	NM_001004329	
ARID2	196528	hgsc.bcm.edu	37	12	46245518	46245518	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:46245518C>T	ENST00000334344.6	+	15	3784	c.3612C>T	c.(3610-3612)agC>agT	p.S1204S	ARID2_ENST00000444670.1_Silent_p.S814S|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Silent_p.S1055S|ARID2_ENST00000457135.1_5'Flank	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1204				S -> G (in Ref. 3; CAD97878). {ECO:0000305}.	chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S1204S(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TTACCATGAGCGGAACGCAGA	0.488			"""N, S, F"""		hepatocellular carcinoma																																p.S1204S			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3612T	12						.						68.0	63.0	65.0					12																	46245518		2203	4300	6503	44531785	SO:0001819	synonymous_variant	196528	exon15				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.3612C>T	12.37:g.46245518C>T			44531785	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Silent	SNP	ENST00000334344.6	37	CCDS31783.1																																																																																				0.488	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
RAPGEF3	10411	hgsc.bcm.edu	37	12	48132947	48132947	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:48132947A>G	ENST00000449771.2	-	24	2528	c.2440T>C	c.(2440-2442)Ttc>Ctc	p.F814L	RAPGEF3_ENST00000171000.4_Missense_Mutation_p.F772L|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.F772L|RP1-197B17.3_ENST00000547799.1_lincRNA|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.F772L|RAPGEF3_ENST00000548919.1_Missense_Mutation_p.F705L|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.F814L			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	814	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)	p.F772L(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		AGGGGCATGAAGGGGATGACA	0.602																																					p.F772L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2314C	12						.						110.0	84.0	93.0					12																	48132947		2203	4300	6503	46419214	SO:0001583	missense	10411	exon23			AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.2440T>C	12.37:g.48132947A>G	ENSP00000395708:p.Phe814Leu		46419214	NM_001098532	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	37	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.826931	0.71143	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000541821;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919	T;T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15;1.15	4.66	4.66	0.58398	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine-nucleotide exchange factor, conserved site (1);Ras guanine nucleotide exchange factor, domain (1);	0.054356	0.85682	D	0.000000	T	0.40498	0.1119	M	0.71920	2.185	0.58432	D	0.999999	B	0.13145	0.007	B	0.23018	0.043	T	0.40289	-0.9571	10	0.62326	D	0.03	.	13.358	0.60640	1.0:0.0:0.0:0.0	.	814	O95398	RPGF3_HUMAN	L	772;814;461;772;772;772;814;759;705	ENSP00000384521:F772L;ENSP00000395708:F814L;ENSP00000448619:F772L;ENSP00000171000:F772L;ENSP00000373864:F814L;ENSP00000448480:F705L	ENSP00000171000:F772L	F	-	1	0	RAPGEF3	46419214	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.765000	0.74965	2.085000	0.62840	0.459000	0.35465	TTC		0.602	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	NM_006105	
HDAC7	51564	hgsc.bcm.edu	37	12	48191202	48191202	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:48191202C>T	ENST00000427332.2	-	6	581	c.425G>A	c.(424-426)aGt>aAt	p.S142N	HDAC7_ENST00000080059.7_Missense_Mutation_p.S181N|HDAC7_ENST00000552960.1_Missense_Mutation_p.S164N|HDAC7_ENST00000354334.3_Missense_Mutation_p.S181N|HDAC7_ENST00000380610.4_Missense_Mutation_p.S198N			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	142	Interaction with MEF2A. {ECO:0000250}.|Transcription repression 1. {ECO:0000250}.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)	p.S142N(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		TGGGGGGTCACTGGGCAGGCT	0.617																																					p.S181N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G542A	12						.						109.0	108.0	108.0					12																	48191202		2203	4300	6503	46477469	SO:0001583	missense	51564	exon6			AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.425G>A	12.37:g.48191202C>T	ENSP00000404394:p.Ser142Asn		46477469	NM_001098416	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	ENST00000427332.2	37		.	.	.	.	.	.	.	.	.	.	C	12.91	2.079712	0.36662	.	.	ENSG00000061273	ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000427332;ENST00000430670;ENST00000422254;ENST00000440293;ENST00000447463;ENST00000434070	T;T;T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;2.0;1.91;1.91	4.84	0.704	0.18121	.	0.888005	0.10113	N	0.714472	T	0.11324	0.0276	N	0.14661	0.345	0.22001	N	0.999423	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.002;0.002	T	0.37478	-0.9704	10	0.14252	T	0.57	.	2.9348	0.05811	0.1286:0.4483:0.2655:0.1576	.	181;164;181	Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	.;.;.	N	181;181;164;198;142;157;118;140;142;142	ENSP00000080059:S181N;ENSP00000351326:S181N;ENSP00000448532:S164N;ENSP00000369984:S198N;ENSP00000404394:S142N;ENSP00000396159:S157N;ENSP00000389501:S142N;ENSP00000388561:S142N	ENSP00000080059:S181N	S	-	2	0	HDAC7	46477469	0.928000	0.31464	0.996000	0.52242	0.997000	0.91878	0.849000	0.27723	0.034000	0.15491	0.655000	0.94253	AGT		0.617	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2		
DIP2B	57609	hgsc.bcm.edu	37	12	51112572	51112572	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:51112572C>T	ENST00000301180.5	+	24	2966	c.2932C>T	c.(2932-2934)Caa>Taa	p.Q978*		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	978						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.Q978*(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						GGATCTGGGACAAATAGAAGA	0.463																																					p.Q978X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2932T	12						.						142.0	122.0	129.0					12																	51112572		2203	4300	6503	49398839	SO:0001587	stop_gained	57609	exon24			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2932C>T	12.37:g.51112572C>T	ENSP00000301180:p.Gln978*		49398839	NM_173602	Q6B011|Q8N1L5|Q8NB38	Nonsense_Mutation	SNP	ENST00000301180.5	37	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	C	39	7.772896	0.98480	.	.	ENSG00000066084	ENST00000301180	.	.	.	4.69	4.69	0.59074	.	0.239623	0.43416	D	0.000574	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-12.4346	18.9332	0.92574	0.0:1.0:0.0:0.0	.	.	.	.	X	978	.	ENSP00000301180:Q978X	Q	+	1	0	DIP2B	49398839	0.997000	0.39634	1.000000	0.80357	0.977000	0.68977	2.587000	0.46128	2.885000	0.99019	0.655000	0.94253	CAA		0.463	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	
METTL7A	25840	hgsc.bcm.edu	37	12	51323740	51323740	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:51323740C>T	ENST00000548553.1	+	3	1523	c.542C>T	c.(541-543)tCg>tTg	p.S181L	METTL7A_ENST00000332160.4_Missense_Mutation_p.S181L			Q9H8H3	MET7A_HUMAN	methyltransferase like 7A	181						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)	methyltransferase activity (GO:0008168)	p.S181L(1)		endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	10						GCTGAGTGTTCGACTTGGAAT	0.458																																					p.S181L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C542T	12						.						132.0	131.0	131.0					12																	51323740		2203	4300	6503	49610007	SO:0001583	missense	25840	exon2				CCDS8804.1	12q13.12	2013-06-20			ENSG00000185432	ENSG00000185432			24550	protein-coding gene	gene with protein product						12975309	Standard	XM_006719332		Approved	DKFZP586A0522	uc001rxb.3	Q9H8H3	OTTHUMG00000169484	ENST00000548553.1:c.542C>T	12.37:g.51323740C>T	ENSP00000448785:p.Ser181Leu		49610007	NM_014033	Q9H7R3|Q9UHZ7|Q9Y422	Missense_Mutation	SNP	ENST00000548553.1	37	CCDS8804.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064812	0.76187	.	.	ENSG00000185432	ENST00000548553;ENST00000332160;ENST00000433599	T;T	0.19250	2.16;2.16	5.61	4.66	0.58398	.	0.220336	0.39909	N	0.001228	T	0.25382	0.0617	M	0.72479	2.2	0.53688	D	0.999978	P	0.38767	0.646	B	0.36378	0.223	T	0.03566	-1.1024	10	0.41790	T	0.15	-4.57	14.7585	0.69588	0.1449:0.8551:0.0:0.0	.	181	Q9H8H3	MET7A_HUMAN	L	181;181;112	ENSP00000448785:S181L;ENSP00000331787:S181L	ENSP00000331787:S181L	S	+	2	0	METTL7A	49610007	0.455000	0.25736	0.139000	0.22197	0.577000	0.36160	2.551000	0.45820	2.810000	0.96702	0.655000	0.94253	TCG		0.458	METTL7A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404294.2	NM_014033	
TFCP2	7024	hgsc.bcm.edu	37	12	51493513	51493513	+	Missense_Mutation	SNP	A	A	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:51493513A>T	ENST00000257915.5	-	12	1659	c.1201T>A	c.(1201-1203)Ttg>Atg	p.L401M	TFCP2_ENST00000549867.1_Missense_Mutation_p.L323M|TFCP2_ENST00000548115.1_Missense_Mutation_p.L350M|TFCP2_ENST00000307660.4_Missense_Mutation_p.L350M	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	401	Gln-rich.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L401M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						tgctCCCTCAACTGCAGTGAT	0.453																																					p.L401M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1201A	12						.						240.0	179.0	200.0					12																	51493513		2203	4300	6503	49779780	SO:0001583	missense	7024	exon12			U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.1201T>A	12.37:g.51493513A>T	ENSP00000257915:p.Leu401Met		49779780	NM_001173452	A8K5E9|Q12801|Q9UD75|Q9UD77	Missense_Mutation	SNP	ENST00000257915.5	37	CCDS8808.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.350289	0.41599	.	.	ENSG00000135457	ENST00000257915;ENST00000307660;ENST00000549867;ENST00000548115;ENST00000548108	T;T;T;T;T	0.45276	2.22;0.9;2.22;0.9;2.22	5.53	-1.73	0.08081	.	0.626255	0.15215	N	0.274278	T	0.37812	0.1017	L	0.36672	1.1	0.27979	N	0.936092	B;B;B;P	0.35982	0.343;0.002;0.375;0.531	B;B;B;P	0.45474	0.281;0.006;0.289;0.482	T	0.42015	-0.9476	10	0.33940	T	0.23	-3.6495	11.6495	0.51279	0.4857:0.0:0.5143:0.0	.	350;323;401;401	Q12800-2;F8VX55;Q12800;Q12800-4	.;.;TFCP2_HUMAN;.	M	401;350;323;350;303	ENSP00000257915:L401M;ENSP00000304411:L350M;ENSP00000449742:L323M;ENSP00000447991:L350M;ENSP00000449280:L303M	ENSP00000257915:L401M	L	-	1	2	TFCP2	49779780	0.000000	0.05858	0.997000	0.53966	0.706000	0.40770	-1.128000	0.03247	-0.129000	0.11620	-0.386000	0.06593	TTG		0.453	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405119.1	NM_005653	
KRT80	144501	hgsc.bcm.edu	37	12	52567468	52567468	+	Silent	SNP	G	G	A	rs369613010		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:52567468G>A	ENST00000394815.2	-	5	844	c.747C>T	c.(745-747)agC>agT	p.S249S	KRT80_ENST00000313234.5_Silent_p.S249S	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	249	Linker 12.|Rod.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.S284S(1)		endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		CCACGATGCCGCTCAGGTCGA	0.657																																					p.S249S	GBM(178;2309 2916 15678 35873)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C747T	12						.	G	,	0,4406		0,0,2203	85.0	72.0	76.0		747,747	0.4	1.0	12		76	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	KRT80	NM_001081492.1,NM_182507.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	249/423,249/453	52567468	1,13005	2203	4300	6503	50853735	SO:0001819	synonymous_variant	144501	exon5			BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.747C>T	12.37:g.52567468G>A			50853735	NM_182507	Q6P1A5|Q7Z3Q0	Silent	SNP	ENST00000394815.2	37	CCDS8821.2																																																																																				0.657	KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316757.1	NM_182507	
KRT85	3891	hgsc.bcm.edu	37	12	52754767	52754767	+	Missense_Mutation	SNP	C	C	T	rs370269453	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:52754767C>T	ENST00000257901.3	-	9	1469	c.1394G>A	c.(1393-1395)cGc>cAc	p.R465H	KRT85_ENST00000544265.1_Missense_Mutation_p.R253H	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	465	Tail.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.R465H(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGTGATCTGGCGCCCTGGGGT	0.662													C|||	2	0.000399361	0.0	0.0	5008	,	,		17291	0.002		0.0	False		,,,				2504	0.0				p.R465H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1394A	12						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	28.0	31.0	30.0		1394	3.2	1.0	12		30	0,8600		0,0,4300	no	missense	KRT85	NM_002283.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	465/508	52754767	1,13005	2203	4300	6503	51041034	SO:0001583	missense	3891	exon9			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.1394G>A	12.37:g.52754767C>T	ENSP00000257901:p.Arg465His		51041034	NM_002283	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	37	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146606	0.57044	2.27E-4	0.0	ENSG00000135443	ENST00000257901;ENST00000544265	D;T	0.81821	-1.54;-1.42	5.11	3.16	0.36331	.	0.101248	0.41823	D	0.000814	T	0.69251	0.3090	L	0.55990	1.75	0.23640	N	0.99723	P	0.43857	0.819	B	0.34873	0.191	T	0.59590	-0.7426	10	0.15499	T	0.54	.	10.4787	0.44680	0.3489:0.6511:0.0:0.0	.	465	P78386	KRT85_HUMAN	H	465;253	ENSP00000257901:R465H;ENSP00000440240:R253H	ENSP00000257901:R465H	R	-	2	0	KRT85	51041034	0.985000	0.35326	0.997000	0.53966	0.957000	0.61999	0.237000	0.17985	1.337000	0.45525	0.609000	0.83330	CGC		0.662	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
ESPL1	9700	hgsc.bcm.edu	37	12	53677205	53677205	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:53677205T>C	ENST00000257934.4	+	16	3051	c.2960T>C	c.(2959-2961)gTg>gCg	p.V987A	ESPL1_ENST00000552462.1_Missense_Mutation_p.V987A	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	987					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.V987A(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						CTTTCAGAGGTGCTGAGCTGC	0.502																																					p.V987A	Colon(53;1069 1201 2587 5382)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2960C	12						.						101.0	105.0	104.0					12																	53677205		2203	4300	6503	51963472	SO:0001583	missense	9700	exon16			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.2960T>C	12.37:g.53677205T>C	ENSP00000257934:p.Val987Ala		51963472	NM_012291		Missense_Mutation	SNP	ENST00000257934.4	37	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.779967	0.90195	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.15487	2.42;2.42	5.12	5.12	0.69794	.	0.148749	0.43260	D	0.000594	T	0.33847	0.0877	M	0.70595	2.14	0.40156	D	0.977001	D;D	0.60575	0.988;0.988	P;P	0.54815	0.761;0.76	T	0.18840	-1.0324	10	0.72032	D	0.01	.	14.045	0.64700	0.0:0.0:0.0:1.0	.	198;987	B4DRU1;Q14674	.;ESPL1_HUMAN	A	987;662;987	ENSP00000257934:V987A;ENSP00000449831:V987A	ENSP00000257934:V987A	V	+	2	0	ESPL1	51963472	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.124000	0.77185	2.154000	0.67381	0.533000	0.62120	GTG		0.502	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
ESPL1	9700	hgsc.bcm.edu	37	12	53685596	53685596	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:53685596G>T	ENST00000257934.4	+	26	5734	c.5643G>T	c.(5641-5643)caG>caT	p.Q1881H	ESPL1_ENST00000552462.1_Missense_Mutation_p.Q1881H	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1881					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.Q1881H(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GACGTCTACAGGGCCTGACAG	0.597																																					p.Q1881H	Colon(53;1069 1201 2587 5382)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5643T	12						.						135.0	119.0	125.0					12																	53685596		2203	4300	6503	51971863	SO:0001583	missense	9700	exon26			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.5643G>T	12.37:g.53685596G>T	ENSP00000257934:p.Gln1881His		51971863	NM_012291		Missense_Mutation	SNP	ENST00000257934.4	37	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	G	8.972	0.973123	0.18736	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.12672	2.66;2.66	4.65	0.82	0.18793	.	0.520028	0.20470	N	0.091705	T	0.12263	0.0298	N	0.21448	0.665	0.20821	N	0.999841	P	0.42941	0.794	P	0.49140	0.601	T	0.13045	-1.0524	10	0.46703	T	0.11	.	7.3095	0.26467	0.4626:0.0:0.5374:0.0	.	1881	Q14674	ESPL1_HUMAN	H	1881;1556;1881	ENSP00000257934:Q1881H;ENSP00000449831:Q1881H	ENSP00000257934:Q1881H	Q	+	3	2	ESPL1	51971863	0.000000	0.05858	0.678000	0.29963	0.123000	0.20343	0.149000	0.16243	0.054000	0.16065	-0.145000	0.13849	CAG		0.597	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
PCBP2	5094	hgsc.bcm.edu	37	12	53856285	53856285	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:53856285G>A	ENST00000439930.3	+	7	547	c.525G>A	c.(523-525)ccG>ccA	p.P175P	RP11-793H13.8_ENST00000547717.1_RNA|PCBP2_ENST00000359282.5_Silent_p.P171P|PCBP2_ENST00000437231.1_Silent_p.P171P|PCBP2_ENST00000548933.1_Silent_p.P175P|PCBP2_ENST00000546463.1_Silent_p.P171P|PCBP2_ENST00000552296.2_Silent_p.P171P|PCBP2_ENST00000549863.1_Silent_p.P175P|PCBP2_ENST00000603815.1_Silent_p.P175P|PCBP2_ENST00000455667.3_Silent_p.P171P|PCBP2_ENST00000541275.1_Silent_p.P171P|PCBP2_ENST00000447282.1_Silent_p.P175P|PCBP2_ENST00000359462.5_Silent_p.P175P|PCBP2_ENST00000552819.1_Silent_p.P175P			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	175					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)	p.P175P(1)		central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						AGTCCCCCCCGAAGGGCGTGA	0.507																																					p.P175P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G525A	12						.						48.0	52.0	51.0					12																	53856285		2203	4300	6503	52142552	SO:0001819	synonymous_variant	5094	exon8			BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.525G>A	12.37:g.53856285G>A			52142552	NM_001128911	A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Silent	SNP	ENST00000439930.3	37	CCDS44901.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.294515	0.40594	.	.	ENSG00000197111	ENST00000546652	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	T	0.56992	0.2023	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55029	-0.8204	5	0.35671	T	0.21	.	6.9516	0.24548	0.0914:0.1772:0.7314:0.0	.	.	.	.	Q	184	.	ENSP00000447068:R184Q	R	+	2	0	PCBP2	52142552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.940000	0.28992	2.559000	0.86315	0.655000	0.94253	CGA		0.507	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407545.2	NM_005016	
DGKA	1606	hgsc.bcm.edu	37	12	56333945	56333945	+	Missense_Mutation	SNP	G	G	T	rs374348340		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:56333945G>T	ENST00000331886.5	+	10	1243	c.789G>T	c.(787-789)aaG>aaT	p.K263N	DGKA_ENST00000551156.1_Missense_Mutation_p.K263N|DGKA_ENST00000394147.1_Missense_Mutation_p.K263N|DGKA_ENST00000549079.2_3'UTR	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	263					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)	p.K263N(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	AGTCTCGGAAGGACATTGGTG	0.567											OREG0021913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K263N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G789T	12						.						227.0	192.0	204.0					12																	56333945		2203	4300	6503	54620212	SO:0001583	missense	1606	exon10			AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.789G>T	12.37:g.56333945G>T	ENSP00000328405:p.Lys263Asn	1014	54620212	NM_001345	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	ENST00000331886.5	37	CCDS8896.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818391	0.50633	.	.	ENSG00000065357	ENST00000331886;ENST00000555218;ENST00000394147;ENST00000551156	D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88	5.05	0.00413	0.14057	.	0.000000	0.85682	D	0.000000	D	0.85062	0.5611	L	0.55990	1.75	0.48452	D	0.999655	P;D;P	0.65815	0.692;0.995;0.914	B;P;P	0.58721	0.433;0.844;0.71	T	0.81595	-0.0861	10	0.72032	D	0.01	.	5.5394	0.17030	0.3917:0.0:0.4795:0.1288	.	182;263;263	G3V4E1;B4E0C6;P23743	.;.;DGKA_HUMAN	N	263;182;263;263	ENSP00000328405:K263N;ENSP00000451743:K182N;ENSP00000377703:K263N;ENSP00000450359:K263N	ENSP00000328405:K263N	K	+	3	2	DGKA	54620212	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	0.531000	0.23052	0.102000	0.17638	-0.218000	0.12543	AAG		0.567	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1		
PMEL	6490	hgsc.bcm.edu	37	12	56349278	56349278	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:56349278C>T	ENST00000548747.1	-	9	2394	c.1732G>A	c.(1732-1734)Gca>Aca	p.A578T	PMEL_ENST00000548493.1_Missense_Mutation_p.A578T|PMEL_ENST00000552882.1_Missense_Mutation_p.A578T|PMEL_ENST00000548689.1_5'Flank|PMEL_ENST00000360714.4_Missense_Mutation_p.A578T|PMEL_ENST00000536427.1_Missense_Mutation_p.A536T|PMEL_ENST00000550447.1_Missense_Mutation_p.A207T|PMEL_ENST00000550464.1_Missense_Mutation_p.A492T|PMEL_ENST00000539511.1_Missense_Mutation_p.A492T|PMEL_ENST00000449260.2_Missense_Mutation_p.A578T			P40967	PMEL_HUMAN	premelanosome protein	578					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)		p.A578T(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTGACCACTGCCAGGCTGTTG	0.572																																					p.A578T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1732A	12						.						75.0	70.0	72.0					12																	56349278		2203	4300	6503	54635545	SO:0001583	missense	6490	exon9			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.1732G>A	12.37:g.56349278C>T	ENSP00000448828:p.Ala578Thr		54635545	NM_006928	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Missense_Mutation	SNP	ENST00000548747.1	37	CCDS8897.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.336762|5.336762	0.95758|0.95758	.|.	.|.	ENSG00000185664|ENSG00000185664	ENST00000449260;ENST00000552882;ENST00000550464;ENST00000548747;ENST00000548493;ENST00000360714;ENST00000536427;ENST00000539511;ENST00000550447|ENST00000549404	T;T;T;T;T;T;T;T|.	0.28454|.	1.91;2.02;1.97;2.02;2.02;1.91;1.61;1.97|.	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	0.000000|.	0.56097|.	D|.	0.000036|.	T|T	0.77928|0.77928	0.4204|0.4204	M|M	0.78049|0.78049	2.395|2.395	0.51233|0.51233	D|D	0.999918|0.999918	D;D;D|.	0.71674|.	0.998;0.996;0.986|.	D;D;P|.	0.72075|.	0.976;0.932;0.793|.	T|T	0.77143|0.77143	-0.2696|-0.2696	10|5	0.72032|.	D|.	0.01|.	-0.8764|-0.8764	18.7104|18.7104	0.91655|0.91655	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	492;578;578|.	P40967-3;P40967-2;P40967|.	.;.;PMEL_HUMAN|.	T|D	578;578;492;578;578;578;536;492;207|423	ENSP00000402758:A578T;ENSP00000449690:A578T;ENSP00000450036:A492T;ENSP00000448828:A578T;ENSP00000447374:A578T;ENSP00000353940:A578T;ENSP00000438695:A536T;ENSP00000445005:A492T|.	ENSP00000353940:A578T|.	A|G	-|-	1|2	0|0	PMEL|PMEL	54635545|54635545	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.316000|7.316000	0.79007|0.79007	2.793000|2.793000	0.96121|0.96121	0.563000|0.563000	0.77884|0.77884	GCA|GGC		0.572	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409626.1	NM_006928	
HELB	92797	hgsc.bcm.edu	37	12	66698627	66698627	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:66698627T>C	ENST00000247815.4	+	2	363	c.304T>C	c.(304-306)Tat>Cat	p.Y102H		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	102					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)	p.Y102H(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		ATCAAGGAGCTATCAATATCA	0.403																																					p.Y102H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T304C	12						.						171.0	163.0	166.0					12																	66698627		2203	4300	6503	64984894	SO:0001583	missense	92797	exon2			AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.304T>C	12.37:g.66698627T>C	ENSP00000247815:p.Tyr102His		64984894	NM_033647	A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	ENST00000247815.4	37	CCDS8976.1	.	.	.	.	.	.	.	.	.	.	T	6.937	0.542669	0.13250	.	.	ENSG00000127311	ENST00000247815	T	0.11604	2.76	0.225	0.225	0.15325	.	.	.	.	.	T	0.08714	0.0216	M	0.68593	2.085	0.23320	N	0.997919	P	0.40144	0.704	B	0.23419	0.046	T	0.23297	-1.0192	7	.	.	.	.	.	.	.	.	102	Q8NG08	HELB_HUMAN	H	102	ENSP00000247815:Y102H	.	Y	+	1	0	HELB	64984894	0.353000	0.24904	0.628000	0.29241	0.877000	0.50540	0.310000	0.19356	0.257000	0.21650	0.254000	0.18369	TAT		0.403	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401919.1		
CAND1	55832	hgsc.bcm.edu	37	12	67701185	67701185	+	Missense_Mutation	SNP	T	T	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:67701185T>A	ENST00000545606.1	+	11	3375	c.2938T>A	c.(2938-2940)Tat>Aat	p.Y980N		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	980					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.Y980N(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		AGGCTCATCATATGCCCGAAG	0.383																																					p.Y980N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2938A	12						.						76.0	72.0	74.0					12																	67701185		2203	4299	6502	65987452	SO:0001583	missense	55832	exon11				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.2938T>A	12.37:g.67701185T>A	ENSP00000442318:p.Tyr980Asn		65987452	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	CCDS8977.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.80|11.80	1.747034|1.747034	0.30955|0.30955	.|.	.|.	ENSG00000111530|ENSG00000111530	ENST00000540047|ENST00000545606;ENST00000299218;ENST00000544619	.|T;T	.|0.15718	.|2.4;2.4	5.26|5.26	5.26|5.26	0.73747|0.73747	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.10121|0.10121	0.0248|0.0248	N|N	0.10809|0.10809	0.05|0.05	0.80722|0.80722	D|D	1|1	.|B;B	.|0.19445	.|0.036;0.002	.|B;B	.|0.17722	.|0.019;0.007	T|T	0.21655|0.21655	-1.0239|-1.0239	5|9	.|.	.|.	.|.	-15.5292|-15.5292	15.4513|15.4513	0.75277|0.75277	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|812;980	.|Q86VP6-2;Q86VP6	.|.;CAND1_HUMAN	Q|N	393|980;980;520	.|ENSP00000442318:Y980N;ENSP00000444089:Y520N	.|.	H|Y	+|+	3|1	2|0	CAND1|CAND1	65987452|65987452	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.870000|0.870000	0.49936|0.49936	4.186000|4.186000	0.58337|0.58337	2.123000|2.123000	0.65237|0.65237	0.477000|0.477000	0.44152|0.44152	CAT|TAT		0.383	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
BEST3	144453	hgsc.bcm.edu	37	12	70049475	70049475	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:70049475T>C	ENST00000330891.5	-	10	1445	c.1219A>G	c.(1219-1221)Agc>Ggc	p.S407G	BEST3_ENST00000553096.1_Missense_Mutation_p.S301G|BEST3_ENST00000488961.1_Missense_Mutation_p.S194G|BEST3_ENST00000331471.4_Intron	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	407					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.S407G(1)|p.S194G(1)		cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			CTTCTGGGGCTGGAGGGGTGT	0.562																																					p.S194G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A580G	12						.						108.0	117.0	114.0					12																	70049475		2081	4206	6287	68335742	SO:0001583	missense	144453	exon6			AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1219A>G	12.37:g.70049475T>C	ENSP00000332413:p.Ser407Gly		68335742	NM_152439	B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	ENST00000330891.5	37	CCDS8992.2	.	.	.	.	.	.	.	.	.	.	T	7.390	0.630667	0.14322	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.98120	-4.44;-4.73;-4.71	5.63	4.48	0.54585	.	1.011290	0.07933	N	0.977785	D	0.94483	0.8224	L	0.43701	1.375	0.23589	N	0.997345	B;B	0.13145	0.006;0.007	B;B	0.10450	0.004;0.005	D	0.85450	0.1160	10	0.14252	T	0.57	-11.2589	4.1534	0.10249	0.1499:0.1607:0.0:0.6894	.	407;194	Q8N1M1;B5MDI8	BEST3_HUMAN;.	G	194;407;301	ENSP00000433213:S194G;ENSP00000332413:S407G;ENSP00000449548:S301G	ENSP00000332413:S407G	S	-	1	0	BEST3	68335742	0.886000	0.30341	0.631000	0.29282	0.054000	0.15201	1.332000	0.33805	0.949000	0.37715	0.533000	0.62120	AGC		0.562	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439	
TSPAN8	7103	hgsc.bcm.edu	37	12	71551428	71551430	+	In_Frame_Del	DEL	AAT	AAT	-			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	AAT	AAT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:71551428_71551430delAAT	ENST00000393330.2	-	5	581_583	c.29_31delATT	c.(28-33)tattct>tct	p.Y10del	TSPAN8_ENST00000247829.3_In_Frame_Del_p.Y10del|TSPAN8_ENST00000546561.1_In_Frame_Del_p.Y10del|TSPAN8_ENST00000552786.1_5'UTR			P19075	TSN8_HUMAN	tetraspanin 8	10					negative regulation of blood coagulation (GO:0030195)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.Y10delY(1)		breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(7)|skin(3)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)			GTAAACATAGAATATTTTATACA	0.35																																					p.10_11del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.29_31del	12						.																																			69837697	SO:0001651	inframe_deletion	7103	exon2			M35252	CCDS8999.1	12q14.1-q21.1	2013-02-14	2005-03-21	2005-03-21		ENSG00000127324		"""Tetraspanins"""	11855	protein-coding gene	gene with protein product		600769	"""transmembrane 4 superfamily member 3"""	TM4SF3		2395876	Standard	NM_004616		Approved	CO-029	uc001swj.1	P19075		ENST00000393330.2:c.29_31delATT	12.37:g.71551428_71551430delAAT	ENSP00000377003:p.Tyr10del		69837695	NM_004616	B2R7T7|Q9BS78	In_Frame_Del	DEL	ENST00000393330.2	37	CCDS8999.1																																																																																				0.350	TSPAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404737.1	NM_004616	
FGD6	55785	hgsc.bcm.edu	37	12	95502126	95502126	+	Missense_Mutation	SNP	G	G	A	rs149533885		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:95502126G>A	ENST00000343958.4	-	11	3485	c.3262C>T	c.(3262-3264)Cgg>Tgg	p.R1088W	FGD6_ENST00000549499.1_Missense_Mutation_p.R1088W|FGD6_ENST00000546711.1_Missense_Mutation_p.R1088W	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	1088					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.R1088W(1)		breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						ATGCTTACCCGACCAGGCTGC	0.348																																					p.R1088W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3262T	12						.	G	TRP/ARG	0,4406		0,0,2203	109.0	101.0	104.0		3262	5.1	1.0	12	dbSNP_134	104	1,8599	1.2+/-3.3	0,1,4299	no	missense	FGD6	NM_018351.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1088/1431	95502126	1,13005	2203	4300	6503	94026257	SO:0001583	missense	55785	exon11			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.3262C>T	12.37:g.95502126G>A	ENSP00000344446:p.Arg1088Trp		94026257	NM_018351	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	37	CCDS31878.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.130389	0.77549	0.0	1.16E-4	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000551521;ENST00000549499	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	6.07	5.12	0.69794	Pleckstrin homology-type (1);	0.000000	0.43579	D	0.000547	T	0.81851	0.4910	M	0.69823	2.125	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82756	-0.0300	10	0.87932	D	0	-19.3514	11.8976	0.52665	0.0:0.0:0.6319:0.3681	.	1088;1088	Q6ZV73-2;Q6ZV73	.;FGD6_HUMAN	W	1088;1088;84;1088	ENSP00000344446:R1088W;ENSP00000450342:R1088W;ENSP00000450240:R84W;ENSP00000449005:R1088W	ENSP00000344446:R1088W	R	-	1	2	FGD6	94026257	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	2.422000	0.44696	2.885000	0.99019	0.655000	0.94253	CGG		0.348	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351	
ZNF605	100289635	hgsc.bcm.edu	37	12	133502432	133502432	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:133502432T>C	ENST00000360187.4	-	5	1801	c.1453A>G	c.(1453-1455)Acc>Gcc	p.T485A	ZNF605_ENST00000392321.3_Missense_Mutation_p.T516A|ZNF605_ENST00000331711.7_5'Flank	NM_183238.3	NP_899061.1	Q86T29	ZN605_HUMAN	zinc finger protein 605	485					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T485A(1)		breast(1)|kidney(16)|large_intestine(5)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00227)|all_epithelial(31;0.142)		OV - Ovarian serous cystadenocarcinoma(86;9.24e-09)|Epithelial(86;2.11e-07)|all cancers(50;5.27e-06)		TCACTGAAGGTTTTCCTGCAT	0.453																																					p.T485A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1453G	12						.						20.0	21.0	21.0					12																	133502432		2153	4248	6401	132012505	SO:0001583	missense	90462	exon5			AL832623	CCDS31938.1, CCDS53850.1	12q24.33	2013-01-08	2009-09-11	2009-09-11		ENSG00000196458		"""Zinc fingers, C2H2-type"", ""-"""	28068	protein-coding gene	gene with protein product							Standard	NM_183238		Approved		uc001uli.3	Q86T29		ENST00000360187.4:c.1453A>G	12.37:g.133502432T>C	ENSP00000353314:p.Thr485Ala		132012505	NM_183238	B3KVG4|D3DXJ0|Q86T91	Missense_Mutation	SNP	ENST00000360187.4	37	CCDS31938.1	.	.	.	.	.	.	.	.	.	.	T	0.021	-1.425963	0.01126	.	.	ENSG00000196458	ENST00000360187;ENST00000392321	T;T	0.18502	3.82;2.21	3.95	-2.56	0.06268	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.253142	0.20849	N	0.084566	T	0.04861	0.0131	N	0.11000	0.08	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.12837	0.008;0.001	T	0.35301	-0.9794	10	0.02654	T	1	.	2.7285	0.05220	0.1282:0.4048:0.1304:0.3366	.	516;485	B3KVG4;Q86T29	.;ZN605_HUMAN	A	485;516	ENSP00000353314:T485A;ENSP00000376135:T516A	ENSP00000353314:T485A	T	-	1	0	ZNF605	132012505	0.000000	0.05858	0.839000	0.33178	0.956000	0.61745	-0.681000	0.05191	-0.625000	0.05604	0.454000	0.30748	ACC		0.453	ZNF605-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397135.2	NM_183238	
CYFIP1	23191	hgsc.bcm.edu	37	15	22958275	22958275	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:22958275A>G	ENST00000313077.7	+	17	2043	c.1918A>G	c.(1918-1920)Att>Gtt	p.I640V	CYFIP1_ENST00000560848.1_Missense_Mutation_p.I640V|CYFIP1_ENST00000435939.2_Missense_Mutation_p.I209V	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1									p.I640V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		CCAGTTCCCCATTGAGATGTC	0.587																																					p.I640V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1918G	15						.						137.0	107.0	118.0					15																	22958275		2203	4300	6503	20509716	SO:0001583	missense	23191	exon17			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1918A>G	15.37:g.22958275A>G	ENSP00000324549:p.Ile640Val		20509716	NM_014608		Missense_Mutation	SNP	ENST00000313077.7	37	CCDS10009.1	.	.	.	.	.	.	.	.	.	.	A	19.27	3.794420	0.70452	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.24151	1.87;1.87	4.96	3.84	0.44239	.	0.000000	0.64402	D	0.000005	T	0.50837	0.1639	M	0.84326	2.69	0.80722	D	1	B;D;D	0.89917	0.022;1.0;0.995	B;D;D	0.85130	0.012;0.997;0.984	T	0.50972	-0.8764	10	0.45353	T	0.12	-21.8924	10.7793	0.46369	0.9247:0.0:0.0753:0.0	.	668;209;640	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	V	640;668;209	ENSP00000324549:I640V;ENSP00000405956:I209V	ENSP00000324549:I640V	I	+	1	0	CYFIP1	20509716	1.000000	0.71417	0.965000	0.40720	0.669000	0.39330	9.127000	0.94417	0.844000	0.35094	0.454000	0.30748	ATT		0.587	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251136.2	NM_014608	
THBS1	7057	hgsc.bcm.edu	37	15	39883720	39883720	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:39883720C>T	ENST00000260356.5	+	16	2593	c.2428C>T	c.(2428-2430)Cgg>Tgg	p.R810W	CTD-2033D15.1_ENST00000560769.1_RNA	NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	810					activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)	p.R810W(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		CCTCAATGAACGGGACAACTG	0.488																																					p.R810W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2428T	15						.						158.0	136.0	144.0					15																	39883720		2200	4297	6497	37671012	SO:0001583	missense	7057	exon16				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.2428C>T	15.37:g.39883720C>T	ENSP00000260356:p.Arg810Trp		37671012	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812608	0.70912	.	.	ENSG00000137801	ENST00000260356	D	0.98362	-4.89	5.7	3.67	0.42095	.	0.000000	0.30676	N	0.009108	D	0.98473	0.9491	M	0.74258	2.255	0.46061	D	0.998847	D;D	0.76494	0.999;0.998	D;P	0.64776	0.929;0.869	D	0.98237	1.0486	10	0.56958	D	0.05	-11.3363	12.7309	0.57197	0.6837:0.3163:0.0:0.0	.	725;810	B4E3J7;P07996	.;TSP1_HUMAN	W	810	ENSP00000260356:R810W	ENSP00000260356:R810W	R	+	1	2	THBS1	37671012	1.000000	0.71417	0.988000	0.46212	0.935000	0.57460	4.915000	0.63355	0.683000	0.31428	-0.182000	0.12963	CGG		0.488	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
HAUS2	55142	hgsc.bcm.edu	37	15	42853577	42853577	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:42853577A>G	ENST00000260372.3	+	4	429	c.366A>G	c.(364-366)ttA>ttG	p.L122L	HAUS2_ENST00000568876.1_Silent_p.L91L|HAUS2_ENST00000568846.2_3'UTR	NM_018097.2	NP_060567.1	Q9NVX0	HAUS2_HUMAN	HAUS augmin-like complex, subunit 2	122					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.L122L(1)		endometrium(1)|large_intestine(1)|lung(1)	3						AGGAAAACTTACCTATTGAAG	0.373																																					p.L91L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A273G	15						.						112.0	102.0	105.0					15																	42853577		2203	4299	6502	40640869	SO:0001819	synonymous_variant	55142	exon3			AK001322	CCDS10090.1, CCDS45247.1	15q15.1	2014-02-20	2009-04-20	2009-04-20	ENSG00000137814	ENSG00000137814		"""HAUS augmin-like complex subunits"""	25530	protein-coding gene	gene with protein product		613429	"""chromosome 15 open reading frame 25"", ""centrosomal protein 27kDa"""	C15orf25, CEP27		14702039, 14654843, 19427217	Standard	NM_018097		Approved	FLJ10460, HsT17025	uc001zqe.3	Q9NVX0	OTTHUMG00000130678	ENST00000260372.3:c.366A>G	15.37:g.42853577A>G			40640869	NM_001130447	C9JH36|Q9H9B3	Silent	SNP	ENST00000260372.3	37	CCDS10090.1																																																																																				0.373	HAUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253173.1	NM_018097	
B2M	567	hgsc.bcm.edu	37	15	45003745	45003745	+	Start_Codon_SNP	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:45003745A>C	ENST00000558401.1	+	1	71	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	B2M_ENST00000544417.1_Start_Codon_SNP_p.M1L|B2M_ENST00000559916.1_Start_Codon_SNP_p.M1L|PATL2_ENST00000558573.1_5'Flank	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	1					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.M1L(3)|p.M1V(2)|p.?(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TCGGGCCGAGATGTCTCGCTC	0.612																																					p.M1L												.	.	6	Substitution - Missense(5)|Unknown(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(2)|lung(1)|large_intestine(1)	c.A1C	15						.						126.0	92.0	104.0					15																	45003745		2198	4298	6496	42791037	SO:0001582	initiator_codon_variant	567	exon1			AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.1A>C	15.37:g.45003745A>C	ENSP00000452780:p.Met1Leu		42791037	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.134850	0.77662	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01165	5.24	5.35	5.35	0.76521	.	.	.	.	.	T	0.01765	0.0056	.	.	.	0.80722	D	1	P;P;P	0.47302	0.835;0.893;0.745	B;B;B	0.41271	0.352;0.294;0.192	T	0.62821	-0.6773	8	0.87932	D	0	.	11.9	0.52678	1.0:0.0:0.0:0.0	.	1;1;1	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	L	1	ENSP00000437604:M1L	ENSP00000340858:M1L	M	+	1	0	B2M	42791037	0.891000	0.30450	0.406000	0.26421	0.024000	0.10985	1.849000	0.39318	2.371000	0.80710	0.533000	0.62120	ATG		0.612	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	Missense_Mutation
DUOX1	53905	hgsc.bcm.edu	37	15	45436303	45436303	+	Missense_Mutation	SNP	G	G	A	rs150755159	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:45436303G>A	ENST00000321429.4	+	18	2413	c.2006G>A	c.(2005-2007)cGt>cAt	p.R669H	DUOX1_ENST00000389037.3_Missense_Mutation_p.R669H|DUOX1_ENST00000561166.1_Missense_Mutation_p.R315H	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	669					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)	p.R669H(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GGGCAGATCCGTGTGGTAGAT	0.632													G|||	2	0.000399361	0.0	0.0029	5008	,	,		19105	0.0		0.0	False		,,,				2504	0.0				p.R669H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2006A	15						.	G	HIS/ARG,HIS/ARG	2,4394	4.2+/-10.8	0,2,2196	70.0	61.0	64.0		2006,2006	1.6	0.3	15	dbSNP_134	64	26,8570	18.5+/-59.3	0,26,4272	yes	missense,missense	DUOX1	NM_017434.3,NM_175940.1	29,29	0,28,6468	AA,AG,GG		0.3025,0.0455,0.2155	benign,benign	669/1552,669/1552	45436303	28,12964	2198	4298	6496	43223595	SO:0001583	missense	53905	exon18			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2006G>A	15.37:g.45436303G>A	ENSP00000317997:p.Arg669His		43223595	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	37	CCDS32221.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	8.069	0.769774	0.15983	4.55E-4	0.003025	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.85484	-1.99;-1.99	4.78	1.59	0.23543	.	0.428210	0.26761	N	0.022624	T	0.67411	0.2890	N	0.14661	0.345	0.27588	N	0.949351	B	0.12630	0.006	B	0.06405	0.002	T	0.52525	-0.8564	10	0.22109	T	0.4	-0.3087	6.0414	0.19736	0.4672:0.0:0.5327:0.0	.	669	Q9NRD9	DUOX1_HUMAN	H	669	ENSP00000317997:R669H;ENSP00000373689:R669H	ENSP00000317997:R669H	R	+	2	0	DUOX1	43223595	1.000000	0.71417	0.298000	0.25002	0.168000	0.22595	4.725000	0.61979	0.586000	0.29626	0.655000	0.94253	CGT		0.632	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
SECISBP2L	9728	hgsc.bcm.edu	37	15	49293139	49293139	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:49293139T>C	ENST00000559471.1	-	15	2446	c.2183A>G	c.(2182-2184)cAt>cGt	p.H728R	SECISBP2L_ENST00000559122.1_5'UTR|SECISBP2L_ENST00000261847.3_Missense_Mutation_p.H683R	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	728							poly(A) RNA binding (GO:0044822)	p.H683R(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TAACTTCATATGTTTGGTAAC	0.373																																					p.H683R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2048G	15						.						126.0	112.0	117.0					15																	49293139		2197	4295	6492	47080431	SO:0001583	missense	9728	exon14			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.2183A>G	15.37:g.49293139T>C	ENSP00000453854:p.His728Arg		47080431	NM_014701	Q8N767	Missense_Mutation	SNP	ENST00000559471.1	37	CCDS53942.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.348412	0.82132	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	T	0.57595	0.39	5.24	5.24	0.73138	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.000000	0.85682	D	0.000000	T	0.65312	0.2679	L	0.45352	1.415	0.58432	D	0.99999	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.943	T	0.68059	-0.5509	10	0.66056	D	0.02	.	15.4336	0.75125	0.0:0.0:0.0:1.0	.	728;683	Q93073;Q93073-2	SBP2L_HUMAN;.	R	683;728	ENSP00000261847:H683R	ENSP00000261847:H683R	H	-	2	0	SECISBP2L	47080431	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.635000	0.83286	2.104000	0.64026	0.460000	0.39030	CAT		0.373	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	
CYP19A1	1588	hgsc.bcm.edu	37	15	51503034	51503034	+	Nonsense_Mutation	SNP	T	T	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:51503034T>A	ENST00000396402.1	-	10	1636	c.1483A>T	c.(1483-1485)Aga>Tga	p.R495*	CYP19A1_ENST00000559878.1_Nonsense_Mutation_p.R495*|CYP19A1_ENST00000396404.4_Nonsense_Mutation_p.R495*|RP11-108K3.1_ENST00000559909.1_lincRNA|CYP19A1_ENST00000260433.2_Nonsense_Mutation_p.R495*	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	495					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.R495*(1)		endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	TCTGAGTTTCTTGGGGTAAAG	0.453																																					p.R495X	Melanoma(142;1016 1807 39614 48966 51721)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A1483T	15						.						239.0	225.0	230.0					15																	51503034		2196	4293	6489	49290326	SO:0001587	stop_gained	1588	exon11			D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.1483A>T	15.37:g.51503034T>A	ENSP00000379683:p.Arg495*		49290326	NM_031226	Q16731|Q3B764|Q58FA0|Q8IYJ7	Nonsense_Mutation	SNP	ENST00000396402.1	37	CCDS10139.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.369279	0.82463	.	.	ENSG00000137869	ENST00000396402;ENST00000260433;ENST00000396404	.	.	.	5.46	4.26	0.50523	.	0.130543	0.64402	D	0.000002	.	.	.	.	.	.	0.52501	D	0.999956	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.1016	12.3991	0.55402	0.0:0.0:0.1402:0.8598	.	.	.	.	X	495	.	ENSP00000260433:R495X	R	-	1	2	CYP19A1	49290326	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	1.837000	0.39201	2.201000	0.70794	0.533000	0.62120	AGA		0.453	CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254669.1		
WDR72	256764	hgsc.bcm.edu	37	15	54008832	54008832	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:54008832G>A	ENST00000396328.1	-	4	550	c.311C>T	c.(310-312)aCa>aTa	p.T104I	WDR72_ENST00000557913.1_Missense_Mutation_p.T104I|WDR72_ENST00000559418.1_Missense_Mutation_p.T104I|WDR72_ENST00000360509.5_Missense_Mutation_p.T104I	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	104								p.T104I(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		GTAAGGAAGTGTAGCCTTCTC	0.428																																					p.T104I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C311T	15						.						252.0	201.0	218.0					15																	54008832		2194	4293	6487	51796124	SO:0001583	missense	256764	exon4			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.311C>T	15.37:g.54008832G>A	ENSP00000379619:p.Thr104Ile		51796124	NM_182758	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	ENST00000396328.1	37	CCDS10151.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978464	0.34942	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.42131	0.98;0.98	5.49	2.41	0.29592	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.304281	0.30649	N	0.009176	T	0.19046	0.0457	N	0.08118	0	0.24208	N	0.995484	B	0.09022	0.002	B	0.09377	0.004	T	0.12091	-1.0561	10	0.59425	D	0.04	.	3.7424	0.08536	0.0838:0.1197:0.4988:0.2978	.	104	Q3MJ13	WDR72_HUMAN	I	104	ENSP00000379619:T104I;ENSP00000353699:T104I	ENSP00000353699:T104I	T	-	2	0	WDR72	51796124	0.934000	0.31675	0.780000	0.31762	0.933000	0.57130	1.378000	0.34328	0.677000	0.31305	0.555000	0.69702	ACA		0.428	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758	
USP3	9960	hgsc.bcm.edu	37	15	63862684	63862684	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:63862684C>A	ENST00000380324.3	+	9	943	c.814C>A	c.(814-816)Cta>Ata	p.L272I	USP3-AS1_ENST00000559357.1_RNA|USP3-AS1_ENST00000559861.1_RNA|USP3_ENST00000558285.1_Missense_Mutation_p.L255I|USP3_ENST00000536001.1_3'UTR|USP3_ENST00000268049.7_Missense_Mutation_p.L250I|USP3_ENST00000559711.1_Missense_Mutation_p.L183I|USP3_ENST00000540797.1_Missense_Mutation_p.L228I|USP3-AS1_ENST00000560350.1_RNA|USP3_ENST00000539772.1_Missense_Mutation_p.L23I	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3	272	USP.				DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.L272I(1)		endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		TTTGGACCACCTACACTTGGA	0.488																																					p.L272I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C814A	15						.						108.0	98.0	101.0					15																	63862684		2203	4300	6503	61649737	SO:0001583	missense	9960	exon9			AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.814C>A	15.37:g.63862684C>A	ENSP00000369681:p.Leu272Ile		61649737	NM_006537	B4DVU5|F5H1A6|Q8WVD0	Missense_Mutation	SNP	ENST00000380324.3	37	CCDS32265.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876536	0.91664	.	.	ENSG00000140455	ENST00000540797;ENST00000380324;ENST00000268049;ENST00000539772;ENST00000536848;ENST00000538686	T;T;T;T	0.04809	3.55;3.55;3.55;3.55	5.95	5.04	0.67666	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.060024	0.64402	D	0.000002	T	0.13543	0.0328	M	0.62088	1.915	0.58432	D	0.999997	P;P;P;P	0.45531	0.469;0.707;0.86;0.717	P;P;P;B	0.52424	0.486;0.698;0.665;0.442	T	0.01178	-1.1427	10	0.40728	T	0.16	.	15.1404	0.72607	0.0:0.9323:0.0:0.0677	.	228;228;250;272	F5H1A6;B4DVU5;Q6JHV3;Q9Y6I4	.;.;.;UBP3_HUMAN	I	228;272;250;23;187;103	ENSP00000445828:L228I;ENSP00000369681:L272I;ENSP00000268049:L250I;ENSP00000445642:L23I	ENSP00000268049:L250I	L	+	1	2	USP3	61649737	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.019000	0.70818	1.528000	0.49103	0.563000	0.77884	CTA		0.488	USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417773.1		
ANKDD1A	348094	hgsc.bcm.edu	37	15	65214164	65214164	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:65214164A>G	ENST00000380230.3	+	4	341	c.312A>G	c.(310-312)ttA>ttG	p.L104L	ANKDD1A_ENST00000395720.1_Silent_p.L104L|ANKDD1A_ENST00000357698.3_Silent_p.L104L|ANKDD1A_ENST00000496660.1_Silent_p.L13L|ANKDD1A_ENST00000491145.1_3'UTR|ANKDD1A_ENST00000395723.1_Silent_p.L13L|ANKDD1A_ENST00000319580.8_Missense_Mutation_p.T27A|AC069368.3_ENST00000437723.1_Silent_p.L176L	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	104					signal transduction (GO:0007165)			p.L104L(1)		NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						TCGGCCACTTACGAATCCTCC	0.577																																					p.L104L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A312G	15						.						131.0	101.0	111.0					15																	65214164		2202	4299	6501	63001217	SO:0001819	synonymous_variant	348094	exon4				CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.312A>G	15.37:g.65214164A>G			63001217	NM_182703	Q495B2|Q495B3|Q8N7A0|Q8NBS5	Silent	SNP	ENST00000380230.3	37	CCDS10197.2	.	.	.	.	.	.	.	.	.	.	A	9.409	1.079919	0.20309	.	.	ENSG00000166839	ENST00000319580	.	.	.	4.63	-1.55	0.08558	.	.	.	.	.	T	0.42720	0.1215	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.48875	-0.8996	5	0.87932	D	0	-7.874	9.81	0.40817	0.3627:0.0:0.6373:0.0	.	.	.	.	A	27	.	ENSP00000325895:T27A	T	+	1	0	ANKDD1A	63001217	0.001000	0.12720	0.084000	0.20598	0.990000	0.78478	-0.422000	0.07043	-0.146000	0.11274	-0.242000	0.12053	ACG		0.577	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256705.2	NM_182703	
CYP1A2	1544	hgsc.bcm.edu	37	15	75045579	75045579	+	Silent	SNP	C	C	A	rs150839466		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:75045579C>A	ENST00000343932.4	+	6	1284	c.1221C>A	c.(1219-1221)gtC>gtA	p.V407V		NM_000761.3	NP_000752.2	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 2	407					alkaloid metabolic process (GO:0009820)|arachidonic acid metabolic process (GO:0019369)|cellular respiration (GO:0045333)|cellular response to cadmium ion (GO:0071276)|dibenzo-p-dioxin metabolic process (GO:0018894)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|hydrogen peroxide biosynthetic process (GO:0050665)|lung development (GO:0030324)|methylation (GO:0032259)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative deethylation (GO:0071615)|oxidative demethylation (GO:0070989)|porphyrin-containing compound metabolic process (GO:0006778)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|toxin biosynthetic process (GO:0009403)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|demethylase activity (GO:0032451)|electron carrier activity (GO:0009055)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)	p.V407V(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33					"""""""Insulin(DB00071)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Agomelatine(DB06594)|Albendazole(DB00518)|Alitretinoin(DB00523)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Anagrelide(DB00261)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Asenapine(DB06216)|Atropine(DB00572)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzyl alcohol(DB06770)|Betaxolol(DB00195)|Bortezomib(DB00188)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Caffeine(DB00201)|Carbamazepine(DB00564)|Carmustine(DB00262)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clenbuterol(DB01407)|Clevidipine(DB04920)|Clobetasol propionate(DB01013)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Diazepam(DB00829)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Edetic Acid(DB00974)|Efavirenz(DB00625)|Eltrombopag(DB06210)|Enoxacin(DB00467)|Epinephrine(DB00668)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Ethanol(DB00898)|Etoposide(DB00773)|Etoricoxib(DB01628)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Gemfibrozil(DB01241)|Griseofulvin(DB00400)|Guanabenz(DB00629)|Haloperidol(DB00502)|Hesperetin(DB01094)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|inhaled insulin(DB05278)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Losartan(DB00678)|Lumiracoxib(DB01283)|Malathion(DB00772)|Maprotiline(DB00934)|Meclizine(DB00737)|Melatonin(DB01065)|Menadione(DB00170)|Methadone(DB00333)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Nabumetone(DB00461)|Nafcillin(DB00607)|Naproxen(DB00788)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitric Oxide(DB00435)|Nitroprusside(DB00325)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxaliplatin(DB00526)|Oxtriphylline(DB01303)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pefloxacin(DB00487)|Pentamidine(DB00738)|Pentoxifylline(DB00806)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pomalidomide(DB08910)|Praziquantel(DB01058)|Primaquine(DB01087)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|SIMEPREVIR(DB06290)|Sorafenib(DB00398)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Tenofovir(DB00300)|Terbinafine(DB00857)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiabendazole(DB00730)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tizanidine(DB00697)|Tocainide(DB01056)|Toremifene(DB00539)|Tranylcypromine(DB00752)|Triamterene(DB00384)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)|Vemurafenib(DB08881)|Verapamil(DB00661)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)|Zolpidem(DB00425)"""	AATGCTGTGTCTTCGTAAACC	0.532																																					p.V407V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1221A	15						.						158.0	105.0	123.0					15																	75045579		2197	4296	6493	72832632	SO:0001819	synonymous_variant	1544	exon6			AF182274	CCDS32293.1	15q24.1	2013-11-11	2003-01-14		ENSG00000140505	ENSG00000140505	1.14.14.1	"""Cytochrome P450s"""	2596	protein-coding gene	gene with protein product		124060	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 2"""			15128046	Standard	NM_000761		Approved	P3-450, CP12	uc002ayr.1	P05177	OTTHUMG00000172901	ENST00000343932.4:c.1221C>A	15.37:g.75045579C>A			72832632	NM_000761	Q16754|Q6NWU5|Q9BXX7|Q9UK49	Silent	SNP	ENST00000343932.4	37	CCDS32293.1																																																																																				0.532	CYP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421263.2	NM_000761	
KIAA1024	23251	hgsc.bcm.edu	37	15	79750014	79750014	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:79750014G>T	ENST00000305428.3	+	2	1600	c.1525G>T	c.(1525-1527)Gat>Tat	p.D509Y		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	509						integral component of membrane (GO:0016021)		p.D509Y(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						GCACTCAGACGATGACTCAGA	0.522																																					p.D509Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1525T	15						.						112.0	88.0	96.0					15																	79750014		2196	4293	6489	77537069	SO:0001583	missense	23251	exon2			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.1525G>T	15.37:g.79750014G>T	ENSP00000307461:p.Asp509Tyr		77537069	NM_015206	A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	G	16.01	3.002676	0.54254	.	.	ENSG00000169330	ENST00000305428	T	0.38722	1.12	5.24	5.24	0.73138	.	0.258676	0.44285	D	0.000473	T	0.57213	0.2038	L	0.56769	1.78	0.80722	D	1	D	0.59357	0.985	P	0.57324	0.818	T	0.54846	-0.8232	9	.	.	.	.	18.8071	0.92041	0.0:0.0:1.0:0.0	.	509	Q9UPX6	K1024_HUMAN	Y	509	ENSP00000307461:D509Y	.	D	+	1	0	KIAA1024	77537069	1.000000	0.71417	0.347000	0.25668	0.251000	0.25915	9.350000	0.97070	2.440000	0.82611	0.491000	0.48974	GAT		0.522	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206	
MESDC2	23184	hgsc.bcm.edu	37	15	81274441	81274441	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:81274441C>T	ENST00000261758.4	-	2	382	c.296G>A	c.(295-297)aGc>aAc	p.S99N		NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	99	Chaperone domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)		p.S99N(1)		cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						TTCAGGCTTGCTTGGGTCTAT	0.423																																					p.S99N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G296A	15						.						212.0	181.0	191.0					15																	81274441		2203	4300	6503	79061496	SO:0001583	missense	23184	exon2			D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.296G>A	15.37:g.81274441C>T	ENSP00000261758:p.Ser99Asn		79061496	NM_015154	B4DW84|D3DW96|Q969U1	Missense_Mutation	SNP	ENST00000261758.4	37	CCDS32308.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092480	0.36952	.	.	ENSG00000117899	ENST00000261758	.	.	.	5.12	5.12	0.69794	.	0.416945	0.27659	N	0.018394	T	0.26048	0.0635	N	0.17474	0.49	0.27977	N	0.936192	B	0.11235	0.004	B	0.12156	0.007	T	0.10428	-1.0630	9	0.17832	T	0.49	-23.0613	11.9964	0.53206	0.0:0.921:0.0:0.079	.	99	Q14696	MESD_HUMAN	N	99	.	ENSP00000261758:S99N	S	-	2	0	MESDC2	79061496	1.000000	0.71417	0.993000	0.49108	0.976000	0.68499	2.962000	0.49176	2.379000	0.81126	0.650000	0.86243	AGC		0.423	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417673.2	NM_015154	
ZSCAN2	54993	hgsc.bcm.edu	37	15	85164531	85164531	+	Missense_Mutation	SNP	G	G	A	rs144452460		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:85164531G>A	ENST00000448803.2	+	3	1397	c.1105G>A	c.(1105-1107)Gaa>Aaa	p.E369K	ZSCAN2_ENST00000358472.3_Missense_Mutation_p.E219K|ZSCAN2_ENST00000485222.2_Intron|ZSCAN2_ENST00000327179.6_Missense_Mutation_p.E368K|ZSCAN2_ENST00000538076.1_Intron|ZSCAN2_ENST00000546148.1_Missense_Mutation_p.E369K|ZSCAN2_ENST00000541040.1_Intron	NM_181877.3	NP_870992.2	Q7Z7L9	ZSCA2_HUMAN	zinc finger and SCAN domain containing 2	369					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E369K(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|liver(2)|lung(4)|ovary(1)|pancreas(1)	19				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		AGAATGCGGCGAAAGCTTTAG	0.502																																					p.E369K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1105A	15						.	G	LYS/GLU	0,4406		0,0,2203	131.0	136.0	135.0		1105	4.7	1.0	15	dbSNP_134	135	1,8597	1.2+/-3.3	0,1,4298	no	missense	ZSCAN2	NM_181877.3	56	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign	369/615	85164531	1,13003	2203	4299	6502	82965535	SO:0001583	missense	54993	exon3			BC041620	CCDS10329.2, CCDS32315.1, CCDS32316.1	15q25.2	2013-01-08	2004-11-01	2004-11-02	ENSG00000176371	ENSG00000176371		"""-"", ""Zinc fingers, C2H2-type"""	20994	protein-coding gene	gene with protein product			"""zinc finger protein 29"""	ZFP29		1937051	Standard	NM_017894		Approved	FLJ20595, ZNF854	uc002bkr.3	Q7Z7L9	OTTHUMG00000074027	ENST00000448803.2:c.1105G>A	15.37:g.85164531G>A	ENSP00000410198:p.Glu369Lys		82965535	NM_181877	A6NG83|B2RMQ9|Q6ZQY9|Q9NWU4	Missense_Mutation	SNP	ENST00000448803.2	37	CCDS10329.2	.	.	.	.	.	.	.	.	.	.	G	4.164	0.028988	0.08054	0.0	1.16E-4	ENSG00000176371	ENST00000448803;ENST00000546148;ENST00000358472;ENST00000327179;ENST00000379353	T;T;T;T	0.10960	2.82;2.82;2.82;2.82	4.71	4.71	0.59529	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000021	T	0.01592	0.0051	N	0.00038	-2.52	0.80722	D	1	B;B	0.26445	0.149;0.11	B;B	0.22152	0.038;0.035	T	0.43988	-0.9357	9	.	.	.	-27.8622	9.2151	0.37342	0.1012:0.0:0.8988:0.0	.	369;369	A8K5A9;Q7Z7L9	.;ZSCA2_HUMAN	K	369;369;219;368;350	ENSP00000410198:E369K;ENSP00000445451:E369K;ENSP00000351257:E219K;ENSP00000325123:E368K	.	E	+	1	0	ZSCAN2	82965535	1.000000	0.71417	0.962000	0.40283	0.861000	0.49209	5.176000	0.65026	2.319000	0.78375	0.655000	0.94253	GAA		0.502	ZSCAN2-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396956.1	NM_017894	
AKAP13	11214	hgsc.bcm.edu	37	15	86118503	86118503	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:86118503T>C	ENST00000394518.2	+	6	899	c.804T>C	c.(802-804)ccT>ccC	p.P268P	AKAP13_ENST00000361243.2_Silent_p.P268P	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	268					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)	p.P268P(1)		NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						ACCCATTTCCTGGAGACGGTT	0.383																																					p.P268P	Melanoma(94;603 1453 3280 32295 32951)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T804C	15						.						150.0	141.0	144.0					15																	86118503		2202	4299	6501	83919507	SO:0001819	synonymous_variant	11214	exon6			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.804T>C	15.37:g.86118503T>C			83919507	NM_006738	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	ENST00000394518.2	37	CCDS32319.1																																																																																				0.383	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
TICRR	90381	hgsc.bcm.edu	37	15	90168384	90168384	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:90168384A>C	ENST00000268138.7	+	20	4948	c.4843A>C	c.(4843-4845)Agc>Cgc	p.S1615R	KIF7_ENST00000558928.1_Intron|TICRR_ENST00000560985.1_Missense_Mutation_p.S1614R			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1615					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.S1615R(1)									CAGGTCCTTAAGCAAACCTGA	0.607																																					p.S1615R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4843C	15						.						45.0	42.0	43.0					15																	90168384		2200	4298	6498	87969388	SO:0001583	missense	90381	exon20			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.4843A>C	15.37:g.90168384A>C	ENSP00000268138:p.Ser1615Arg		87969388	NM_152259	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	A	13.30	2.196748	0.38806	.	.	ENSG00000140534	ENST00000268138	T	0.08896	3.04	5.51	-9.0	0.00747	.	0.736937	0.12642	N	0.451229	T	0.04363	0.0120	L	0.29908	0.895	0.09310	N	0.999999	B	0.27656	0.184	B	0.24848	0.056	T	0.21042	-1.0257	10	0.45353	T	0.12	0.3591	6.8428	0.23973	0.1068:0.0902:0.6222:0.1808	.	1615	Q7Z2Z1	TICRR_HUMAN	R	1615	ENSP00000268138:S1615R	ENSP00000268138:S1615R	S	+	1	0	C15orf42	87969388	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.027000	0.12371	-1.813000	0.01226	-1.140000	0.01884	AGC		0.607	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
BLM	641	hgsc.bcm.edu	37	15	91312406	91312406	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:91312406A>G	ENST00000355112.3	+	11	2469	c.2351A>G	c.(2350-2352)tAt>tGt	p.Y784C	BLM_ENST00000560136.1_3'UTR|BLM_ENST00000560509.1_Missense_Mutation_p.Y784C	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	784	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.Y784C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			GAGAATCTCTATGAGAGGAAG	0.368			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.Y784C		yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2351G	15						.						167.0	158.0	161.0					15																	91312406		2198	4298	6496	89113410	SO:0001583	missense	641	exon11	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.2351A>G	15.37:g.91312406A>G	ENSP00000347232:p.Tyr784Cys		89113410	NM_000057	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.401303	0.83120	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	T	0.14893	2.47	5.4	5.4	0.78164	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.37945	0.1022	M	0.78456	2.415	0.80722	D	1	D;P;D	0.53151	0.958;0.799;0.958	P;P;P	0.57502	0.671;0.822;0.671	T	0.26883	-1.0090	10	0.72032	D	0.01	-18.4011	13.3802	0.60762	1.0:0.0:0.0:0.0	.	784;409;784	B2RAN0;B7ZKN7;P54132	.;.;BLM_HUMAN	C	784;437	ENSP00000347232:Y784C	ENSP00000347232:Y784C	Y	+	2	0	BLM	89113410	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.077000	0.76814	2.035000	0.60131	0.482000	0.46254	TAT		0.368	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
MAN2A2	4122	hgsc.bcm.edu	37	15	91461490	91461490	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:91461490G>A	ENST00000559717.1	+	21	3520	c.3061G>A	c.(3061-3063)Gcc>Acc	p.A1021T	AC068831.15_ENST00000560522.1_RNA|MAN2A2_ENST00000430376.2_Missense_Mutation_p.A211T|MAN2A2_ENST00000558538.1_3'UTR|MAN2A2_ENST00000431652.2_Missense_Mutation_p.A529T|MAN2A2_ENST00000360468.3_Missense_Mutation_p.A1021T			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	1021					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)	p.A1021T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GTACCTGAACGCCCCGGCGCT	0.592																																					p.A1021T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3061A	15						.						131.0	121.0	124.0					15																	91461490		2198	4298	6496	89262494	SO:0001583	missense	4122	exon20			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.3061G>A	15.37:g.91461490G>A	ENSP00000452948:p.Ala1021Thr		89262494	NM_006122	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	G	2.595	-0.294372	0.05568	.	.	ENSG00000196547	ENST00000360468;ENST00000431652;ENST00000430376	T;T;T	0.78707	-1.2;-1.2;-1.2	5.58	0.329	0.15924	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.583642	0.20196	N	0.097202	T	0.55481	0.1923	N	0.05467	-0.045	0.20703	N	0.999864	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.42749	-0.9433	10	0.35671	T	0.21	-6.9476	10.6224	0.45487	0.5936:0.0:0.4064:0.0	.	529;649;1021	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	T	1021;529;211	ENSP00000353655:A1021T;ENSP00000388221:A529T;ENSP00000394372:A211T	ENSP00000353655:A1021T	A	+	1	0	MAN2A2	89262494	0.002000	0.14202	0.087000	0.20705	0.057000	0.15508	1.331000	0.33793	-0.117000	0.11872	-0.430000	0.05897	GCC		0.592	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
TTC23	64927	hgsc.bcm.edu	37	15	99768897	99768897	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:99768897G>A	ENST00000394132.2	-	5	838	c.21C>T	c.(19-21)acC>acT	p.T7T	TTC23_ENST00000394129.2_Silent_p.T7T|TTC23_ENST00000262074.4_Silent_p.T7T|TTC23_ENST00000394130.1_Silent_p.T7T|TTC23_ENST00000394135.3_Silent_p.T7T|TTC23_ENST00000558613.1_Silent_p.T7T|TTC23_ENST00000394136.1_Silent_p.T7T|TTC23_ENST00000558663.1_Silent_p.T7T			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	7								p.T7T(1)		endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			TGGATATGTGGGTTTCCTGTG	0.328																																					p.T7T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C21T	15						.						139.0	137.0	138.0					15																	99768897		2197	4297	6494	97586420	SO:0001819	synonymous_variant	64927	exon2				CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.21C>T	15.37:g.99768897G>A			97586420	NM_001040659	A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Silent	SNP	ENST00000394132.2	37	CCDS10379.2																																																																																				0.328	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303953.2	NM_022905	
EIF3J	8669	hgsc.bcm.edu	37	15	44843099	44843100	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	AA	AA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:44843099_44843100delAA	ENST00000535391.1	+	3	185_186	c.173_174delAA	c.(172-174)gaafs	p.E58fs	EIF3J_ENST00000261868.5_Frame_Shift_Del_p.E58fs|EIF3J_ENST00000424492.3_Intron					eukaryotic translation initiation factor 3, subunit J									p.K60fs*36(1)		endometrium(1)|large_intestine(5)|liver(2)|skin(1)	9		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		GATGATGATGAAAAAAAAGAGG	0.356																																					p.58_58del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.173_174del	15						.																																			42630392	SO:0001589	frameshift_variant	8669	exon3			U97670	CCDS10111.1, CCDS61612.1, CCDS61613.1	15q21.1	2014-05-13	2007-07-27	2007-07-27	ENSG00000104131	ENSG00000104131			3270	protein-coding gene	gene with protein product		603910	"""eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa"""	EIF3S1		9822659	Standard	NM_001284335		Approved	eIF3-p35, eIF3-alpha, eIF3j	uc001ztv.3	O75822	OTTHUMG00000131158	ENST00000535391.1:c.173_174delAA	15.37:g.44843105_44843106delAA	ENSP00000440221:p.Glu58fs		42630391	NM_003758		Frame_Shift_Del	DEL	ENST00000535391.1	37																																																																																					0.356	EIF3J-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000396804.1	NM_003758	
ADAMTS17	170691	hgsc.bcm.edu	37	15	100657064	100657064	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr15:100657064C>T	ENST00000268070.4	-	13	1981	c.1876G>A	c.(1876-1878)Gtg>Atg	p.V626M		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	626	Cys-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V626M(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		TCAACCACCACGGCTGTCAGC	0.612																																					p.V626M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1876A	15						.						83.0	66.0	72.0					15																	100657064		2203	4300	6503	98474587	SO:0001583	missense	170691	exon13			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1876G>A	15.37:g.100657064C>T	ENSP00000268070:p.Val626Met		98474587	NM_139057	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	ENST00000268070.4	37	CCDS10383.1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.706082	0.48412	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	T	0.65549	-0.16	5.18	5.18	0.71444	.	0.079477	0.49916	D	0.000126	T	0.78323	0.4265	M	0.84082	2.675	0.50313	D	0.999861	D;D	0.65815	0.995;0.974	P;B	0.57283	0.817;0.252	T	0.81309	-0.0991	10	0.54805	T	0.06	.	18.7048	0.91633	0.0:1.0:0.0:0.0	.	383;626	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	M	626;383	ENSP00000268070:V626M	ENSP00000268070:V626M	V	-	1	0	ADAMTS17	98474587	0.996000	0.38824	0.989000	0.46669	0.141000	0.21300	2.903000	0.48711	2.419000	0.82065	0.655000	0.94253	GTG		0.612	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
TBCK	93627	hgsc.bcm.edu	37	4	107154146	107154146	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:107154146G>A	ENST00000273980.5	-	18	2035	c.1588C>T	c.(1588-1590)Cgt>Tgt	p.R530C	TBCK_ENST00000361687.4_Missense_Mutation_p.R467C|TBCK_ENST00000394706.3_Missense_Mutation_p.R491C|TBCK_ENST00000394708.2_Missense_Mutation_p.R530C|TBCK_ENST00000432496.2_Missense_Mutation_p.R530C					TBC1 domain containing kinase									p.R530C(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						TTTAATACACGCCTAAATTTT	0.368																																					p.R491C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1471T	4						.						133.0	129.0	130.0					4																	107154146		2203	4300	6503	107373595	SO:0001583	missense	93627	exon17				CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.1588C>T	4.37:g.107154146G>A	ENSP00000273980:p.Arg530Cys		107373595	NM_001163437		Missense_Mutation	SNP	ENST00000273980.5	37	CCDS54788.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813343	0.90707	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.07114	3.22;3.22;3.22;3.22;3.22	5.46	5.46	0.80206	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.36908	0.0984	M	0.91818	3.245	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.995;0.999;1.0	T	0.39603	-0.9606	10	0.87932	D	0	.	14.1788	0.65559	0.0:0.0:0.8503:0.1497	.	530;491;467	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	C	530;530;467;491;530	ENSP00000273980:R530C;ENSP00000405847:R530C;ENSP00000355338:R467C;ENSP00000378196:R491C;ENSP00000378198:R530C	ENSP00000273980:R530C	R	-	1	0	TBCK	107373595	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	4.475000	0.60210	2.563000	0.86464	0.655000	0.94253	CGT		0.368	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115	
ETNPPL	64850	hgsc.bcm.edu	37	4	109669182	109669182	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:109669182T>C	ENST00000296486.3	-	9	1215	c.1061A>G	c.(1060-1062)cAc>cGc	p.H354R	ETNPPL_ENST00000512646.1_Missense_Mutation_p.H296R|ETNPPL_ENST00000510706.1_Missense_Mutation_p.H314R|ETNPPL_ENST00000411864.2_Missense_Mutation_p.H348R	NM_001146590.1|NM_031279.3	NP_001140062.1|NP_112569.2	Q8TBG4	AT2L1_HUMAN	ethanolamine-phosphate phospho-lyase	354						mitochondrion (GO:0005739)	ethanolamine-phosphate phospho-lyase activity (GO:0050459)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.H354R(1)									TATCAAAGTGTGTTTAGCCTT	0.343																																					p.H296R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A887G	4						.						172.0	169.0	170.0					4																	109669182		2203	4300	6503	109888631	SO:0001583	missense	64850	exon8			AJ298293	CCDS3682.1, CCDS54792.1, CCDS54793.1	4q25	2013-06-12	2013-06-12	2013-06-12	ENSG00000164089	ENSG00000164089	4.2.3.2		14404	protein-coding gene	gene with protein product		614682	"""alanine-glyoxylate aminotransferase 2-like 1"""	AGXT2L1		7592550, 22241472	Standard	NM_031279		Approved		uc003hzc.3	Q8TBG4	OTTHUMG00000161036	ENST00000296486.3:c.1061A>G	4.37:g.109669182T>C	ENSP00000296486:p.His354Arg		109888631	NM_001146627	B7Z1Y0|E9PBY0|Q9H174	Missense_Mutation	SNP	ENST00000296486.3	37	CCDS3682.1	.	.	.	.	.	.	.	.	.	.	T	18.24	3.580924	0.65992	.	.	ENSG00000164089	ENST00000296486;ENST00000411864;ENST00000512646;ENST00000510706	D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04	5.54	5.54	0.83059	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.096628	0.64402	D	0.000001	D	0.91646	0.7360	M	0.90483	3.12	0.80722	D	1	P;P;P	0.45902	0.868;0.711;0.85	P;P;P	0.52309	0.695;0.464;0.652	D	0.92727	0.6196	9	.	.	.	-23.9587	15.9692	0.79998	0.0:0.0:0.0:1.0	.	296;348;354	E9PBY0;Q8TBG4-2;Q8TBG4	.;.;AT2L1_HUMAN	R	354;348;296;314	ENSP00000296486:H354R;ENSP00000392269:H348R;ENSP00000427065:H296R;ENSP00000423240:H314R	.	H	-	2	0	AGXT2L1	109888631	1.000000	0.71417	0.461000	0.27105	0.495000	0.33615	7.948000	0.87774	2.239000	0.73571	0.533000	0.62120	CAC		0.343	ETNPPL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363508.1	NM_031279	
ENPEP	2028	hgsc.bcm.edu	37	4	111469410	111469410	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:111469410G>A	ENST00000265162.5	+	14	2421	c.2079G>A	c.(2077-2079)caG>caA	p.Q693Q		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	693					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Q693Q(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		TACCATGGCAGAGAGTAATTT	0.343																																					p.Q693Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2079A	4						.						107.0	109.0	108.0					4																	111469410		2203	4300	6503	111688859	SO:0001819	synonymous_variant	2028	exon14			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.2079G>A	4.37:g.111469410G>A			111688859	NM_001977	Q504U2	Silent	SNP	ENST00000265162.5	37	CCDS3691.1																																																																																				0.343	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
SPATA5	166378	hgsc.bcm.edu	37	4	123855353	123855353	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:123855353T>C	ENST00000274008.4	+	5	676	c.607T>C	c.(607-609)Ttg>Ctg	p.L203L	SPATA5_ENST00000422835.2_3'UTR	NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	203					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)	p.L203L(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						TGGCATGATATTGGGAGGGCC	0.473																																					p.L203L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T607C	4						.						96.0	91.0	93.0					4																	123855353		2203	4300	6503	124074803	SO:0001819	synonymous_variant	166378	exon5			AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.607T>C	4.37:g.123855353T>C			124074803	NM_145207	C9JT97|Q86XW1|Q8NI20|Q8TDL7	Silent	SNP	ENST00000274008.4	37	CCDS3730.1																																																																																				0.473	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256714.2	NM_145207	
PCDH10	57575	hgsc.bcm.edu	37	4	134084410	134084410	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:134084410C>T	ENST00000264360.5	+	4	3902	c.3076C>T	c.(3076-3078)Cga>Tga	p.R1026*		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	1026					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R1026*(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GACTAATACGCGAGCGCCTTA	0.483																																					p.R1026X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3076T	4						.						106.0	116.0	113.0					4																	134084410		2203	4300	6503	134303860	SO:0001587	stop_gained	57575	exon4			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.3076C>T	4.37:g.134084410C>T	ENSP00000264360:p.Arg1026*		134303860	NM_032961	Q4W5F6|Q96SF0	Nonsense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	48	14.712704	0.99807	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	.	.	.	5.24	5.24	0.73138	.	0.000000	0.31936	N	0.006821	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5742	0.61864	0.1555:0.8445:0.0:0.0	.	.	.	.	X	1026	.	ENSP00000264360:R1026X	R	+	1	2	PCDH10	134303860	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.242000	0.58714	2.717000	0.92951	0.650000	0.86243	CGA		0.483	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
UCP1	7350	hgsc.bcm.edu	37	4	141488984	141488984	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:141488984T>C	ENST00000262999.3	-	2	349	c.274A>G	c.(274-276)Agg>Ggg	p.R92G		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	92					brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)	p.R92G(1)		NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					AGGCCGATCCTGAGAGAGGCG	0.597																																					p.R92G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A274G	4						.						58.0	63.0	61.0					4																	141488984		2203	4300	6503	141708434	SO:0001583	missense	7350	exon2			X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.274A>G	4.37:g.141488984T>C	ENSP00000262999:p.Arg92Gly		141708434	NM_021833	Q13218|Q4KMZ3|Q68G66	Missense_Mutation	SNP	ENST00000262999.3	37	CCDS3753.1	.	.	.	.	.	.	.	.	.	.	T	14.00	2.404188	0.42613	.	.	ENSG00000109424	ENST00000262999	T	0.79749	-1.3	5.51	-0.306	0.12780	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.93641	0.7969	H	0.99197	4.465	0.33248	D	0.558183	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95573	0.8640	10	0.87932	D	0	.	16.572	0.84615	0.0:0.0:0.7395:0.2605	.	92;92	Q4KMT7;P25874	.;UCP1_HUMAN	G	92	ENSP00000262999:R92G	ENSP00000262999:R92G	R	-	1	2	UCP1	141708434	0.508000	0.26154	0.035000	0.18076	0.075000	0.17131	0.196000	0.17176	-0.290000	0.09025	0.533000	0.62120	AGG		0.597	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257273.1		
USP38	84640	hgsc.bcm.edu	37	4	144134773	144134773	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:144134773A>G	ENST00000307017.4	+	9	2150	c.1644A>G	c.(1642-1644)tcA>tcG	p.S548S	USP38_ENST00000510377.1_Silent_p.S548S	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	548	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.S548S(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					TTCAGGCCTCACACAAGCCTT	0.393																																					p.S548S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1644G	4						.						38.0	38.0	38.0					4																	144134773		2202	4300	6502	144354223	SO:0001819	synonymous_variant	84640	exon9			AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.1644A>G	4.37:g.144134773A>G			144354223	NM_032557	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Silent	SNP	ENST00000307017.4	37	CCDS3758.1																																																																																				0.393	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557	
NR3C2	4306	hgsc.bcm.edu	37	4	149075914	149075914	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:149075914G>A	ENST00000358102.3	-	5	2515	c.2153C>T	c.(2152-2154)tCg>tTg	p.S718L	NR3C2_ENST00000355292.3_Missense_Mutation_p.S722L|NR3C2_ENST00000511528.1_Missense_Mutation_p.S722L|NR3C2_ENST00000344721.4_Missense_Mutation_p.S718L|NR3C2_ENST00000503313.1_5'UTR|NR3C2_ENST00000512865.1_Intron|RP11-76G10.1_ENST00000514843.1_RNA	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	718	Hinge.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.S718L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	TGTGTTGACCGAGGGTTCTTT	0.567																																					p.S718L	Melanoma(27;428 957 40335 51025 51111)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2153T	4						.						192.0	172.0	179.0					4																	149075914		2203	4300	6503	149295364	SO:0001583	missense	4306	exon5			M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.2153C>T	4.37:g.149075914G>A	ENSP00000350815:p.Ser718Leu		149295364	NM_000901	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	37	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.853498	0.51270	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000511528	D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65	5.57	5.57	0.84162	.	0.406531	0.27932	N	0.017264	D	0.90696	0.7081	M	0.77313	2.365	0.36331	D	0.858852	B	0.25809	0.135	B	0.20955	0.032	D	0.89645	0.3865	9	.	.	.	.	19.5581	0.95361	0.0:0.0:1.0:0.0	.	718	B0ZBF6	.	L	718;722;718;722	ENSP00000341390:S718L;ENSP00000347441:S722L;ENSP00000350815:S718L;ENSP00000421481:S722L	.	S	-	2	0	NR3C2	149295364	0.985000	0.35326	0.611000	0.29010	0.430000	0.31655	3.814000	0.55643	2.614000	0.88457	0.655000	0.94253	TCG		0.567	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
FBXW7	55294	hgsc.bcm.edu	37	4	153247367	153247367	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:153247367G>A	ENST00000281708.4	-	10	2664	c.1435C>T	c.(1435-1437)Cga>Tga	p.R479*	FBXW7_ENST00000603548.1_Nonsense_Mutation_p.R479*|FBXW7_ENST00000603841.1_Nonsense_Mutation_p.R479*|FBXW7_ENST00000393956.3_Nonsense_Mutation_p.R303*|FBXW7_ENST00000296555.5_Nonsense_Mutation_p.R361*|FBXW7_ENST00000263981.5_Nonsense_Mutation_p.R399*	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	479					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R479*(4)|p.R479G(3)|p.R240*(2)|p.R479R(2)|p.R399*(2)|p.R399R(1)|p.?(1)|p.R361R(1)|p.R361*(1)|p.R240R(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				GTGGCATCTCGAGAACCGCTA	0.398			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R399X			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,+1	.	18	Substitution - Nonsense(9)|Substitution - coding silent(5)|Substitution - Missense(3)|Unknown(1)	lung(10)|large_intestine(4)|haematopoietic_and_lymphoid_tissue(3)|endometrium(1)	c.C1195T	4						.						83.0	78.0	79.0					4																	153247367		2203	4299	6502	153466817	SO:0001587	stop_gained	55294	exon9			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1435C>T	4.37:g.153247367G>A	ENSP00000281708:p.Arg479*		153466817	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Nonsense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	38	6.707523	0.97780	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	.	.	.	5.72	4.85	0.62838	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.7081	15.6805	0.77364	0.0:0.0:0.8491:0.1508	.	.	.	.	X	479;361;399;303	.	ENSP00000263981:R399X	R	-	1	2	FBXW7	153466817	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.541000	0.73865	1.492000	0.48499	0.650000	0.86243	CGA		0.398	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
ASIC5	51802	hgsc.bcm.edu	37	4	156757927	156757927	+	Silent	SNP	C	C	T	rs145582686		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:156757927C>T	ENST00000537611.2	-	8	1195	c.1149G>A	c.(1147-1149)ccG>ccA	p.P383P		NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	383					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)	p.P383P(1)									AAATAGTGGCCGGGTATTCTA	0.368													C|||	1	0.000199681	0.0	0.0	5008	,	,		15233	0.0		0.0	False		,,,				2504	0.001				p.P383P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1149A	4						.	C		2,4404	4.2+/-10.8	0,2,2201	74.0	81.0	79.0		1149	-7.2	0.3	4	dbSNP_134	79	0,8600		0,0,4300	no	coding-synonymous	ACCN5	NM_017419.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		383/506	156757927	2,13004	2203	4300	6503	156977377	SO:0001819	synonymous_variant	51802	exon8			AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.1149G>A	4.37:g.156757927C>T			156977377	NM_017419		Silent	SNP	ENST00000537611.2	37	CCDS3793.1																																																																																				0.368	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1		
TMEM144	55314	hgsc.bcm.edu	37	4	159140523	159140523	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:159140523G>A	ENST00000296529.6	+	6	914	c.394G>A	c.(394-396)Gct>Act	p.A132T	TMEM144_ENST00000514558.1_Missense_Mutation_p.A132T	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	132						integral component of membrane (GO:0016021)		p.A132T(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		TTACATTGGAGCTGGGCTATC	0.363																																					p.A132T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G394A	4						.						145.0	145.0	145.0					4																	159140523		2203	4300	6503	159359973	SO:0001583	missense	55314	exon6			AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.394G>A	4.37:g.159140523G>A	ENSP00000296529:p.Ala132Thr		159359973	NM_018342	D3DP24|Q49A05|Q9NUT3	Missense_Mutation	SNP	ENST00000296529.6	37	CCDS3799.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495991	0.64186	.	.	ENSG00000164124	ENST00000508243;ENST00000296529;ENST00000504569;ENST00000514558	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.68339	0.2990	M	0.82923	2.615	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.68074	-0.5505	10	0.46703	T	0.11	-31.5107	19.1176	0.93348	0.0:0.0:1.0:0.0	.	132	Q7Z5S9	TM144_HUMAN	T	132	ENSP00000422297:A132T;ENSP00000296529:A132T;ENSP00000422082:A132T;ENSP00000426211:A132T	ENSP00000296529:A132T	A	+	1	0	TMEM144	159359973	1.000000	0.71417	0.998000	0.56505	0.072000	0.16883	8.081000	0.89511	2.884000	0.98904	0.655000	0.94253	GCT		0.363	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365597.1	NM_018342	
SLBP	7884	hgsc.bcm.edu	37	4	1696525	1696525	+	Silent	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:1696525G>T	ENST00000489418.1	-	7	1038	c.672C>A	c.(670-672)ccC>ccA	p.P224P	SLBP_ENST00000429429.2_Silent_p.P185P|SLBP_ENST00000488267.1_Silent_p.P189P|SLBP_ENST00000318386.4_Silent_p.P231P	NM_006527.2	NP_006518.1	Q14493	SLBP_HUMAN	stem-loop binding protein	224					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA transport (GO:0051028)|nuclear cell cycle DNA replication (GO:0033260)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	histone pre-mRNA DCP binding (GO:0071208)|histone pre-mRNA stem-loop binding (GO:0071207)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.P224P(1)		endometrium(1)|large_intestine(2)|lung(2)	5		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.0055)			AGCTGGTCTGGGGCTCGGAGC	0.463																																					p.P224P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C672A	4						.						117.0	110.0	113.0					4																	1696525		2203	4300	6503	1666323	SO:0001819	synonymous_variant	7884	exon7			Z71188	CCDS3350.1	4p16.3	2008-02-11	2008-02-11		ENSG00000163950	ENSG00000163950			10904	protein-coding gene	gene with protein product	"""histone binding protein"""	602422	"""stem-loop (histone) binding protein"""			9049306, 1338771	Standard	NM_006527		Approved	HBP	uc003gdi.1	Q14493	OTTHUMG00000089349	ENST00000489418.1:c.672C>A	4.37:g.1696525G>T			1666323	NM_006527	B3KRJ5	Silent	SNP	ENST00000489418.1	37	CCDS3350.1	.	.	.	.	.	.	.	.	.	.	g	9.045	0.990540	0.18966	.	.	ENSG00000163950	ENST00000483348	.	.	.	5.36	-0.312	0.12758	.	0.609439	0.17479	N	0.172795	T	0.53142	0.1778	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49380	-0.8946	6	0.45353	T	0.12	-14.9926	3.8683	0.09025	0.0851:0.3849:0.3219:0.2081	.	.	.	.	H	179	.	ENSP00000426891:P179H	P	-	2	0	SLBP	1666323	0.995000	0.38212	0.995000	0.50966	0.779000	0.44077	-0.027000	0.12371	0.241000	0.21283	-0.126000	0.14955	CCC		0.463	SLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000203176.1	NM_006527	
FSTL5	56884	hgsc.bcm.edu	37	4	162380464	162380464	+	Missense_Mutation	SNP	C	C	T	rs375718347		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:162380464C>T	ENST00000306100.5	-	14	2052	c.1616G>A	c.(1615-1617)aGc>aAc	p.S539N	FSTL5_ENST00000427802.2_Missense_Mutation_p.S529N|FSTL5_ENST00000379164.4_Missense_Mutation_p.S538N|FSTL5_ENST00000536695.1_Missense_Mutation_p.S538N	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	539						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.S539N(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AGGGTCTGTGCTCACTGCCTA	0.378																																					p.S539N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1616A	4						.		ASN/SER,ASN/SER,ASN/SER	0,4406		0,0,2203	102.0	93.0	96.0		1616,1586,1613	4.4	1.0	4		96	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	FSTL5	NM_020116.3,NM_001128428.1,NM_001128427.1	46,46,46	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	539/848,529/838,538/847	162380464	1,13005	2203	4300	6503	162599914	SO:0001583	missense	56884	exon14			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1616G>A	4.37:g.162380464C>T	ENSP00000305334:p.Ser539Asn		162599914	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	c	10.10	1.257763	0.22965	0.0	1.16E-4	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.27	4.43	0.53597	WD40/YVTN repeat-like-containing domain (1);	0.152611	0.64402	N	0.000001	T	0.29914	0.0748	M	0.62723	1.935	0.44275	D	0.99713	P;B;B	0.35077	0.483;0.001;0.0	B;B;B	0.33339	0.162;0.005;0.002	T	0.05666	-1.0871	10	0.20519	T	0.43	.	13.35	0.60597	0.0:0.9236:0.0:0.0764	.	529;538;539	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	N	539;538;529;538	ENSP00000305334:S539N;ENSP00000368462:S538N;ENSP00000389270:S529N;ENSP00000440409:S538N	ENSP00000305334:S539N	S	-	2	0	FSTL5	162599914	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	1.765000	0.38481	1.363000	0.46019	0.580000	0.79431	AGC		0.378	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
SLC25A4	291	hgsc.bcm.edu	37	4	186068077	186068077	+	Silent	SNP	C	C	T	rs374918344		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:186068077C>T	ENST00000281456.6	+	4	981	c.849C>T	c.(847-849)ggC>ggT	p.G283G		NM_001151.3	NP_001142.2	P12235	ADT1_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	283					adenine transport (GO:0015853)|apoptotic mitochondrial changes (GO:0008637)|energy reserve metabolic process (GO:0006112)|generation of precursor metabolites and energy (GO:0006091)|mitochondrial genome maintenance (GO:0000002)|negative regulation of necroptotic process (GO:0060546)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)	p.G283G(2)		endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	GAGGCATGGGCGGTGCTTTTG	0.428																																					p.G283G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C849T	4						.	C		1,4405	2.1+/-5.4	0,1,2202	143.0	127.0	133.0		849	-10.6	0.8	4		133	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC25A4	NM_001151.3		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		283/299	186068077	2,13004	2203	4300	6503	186305071	SO:0001819	synonymous_variant	291	exon4			BC008664	CCDS34114.1	4q35	2014-09-17			ENSG00000151729	ENSG00000151729		"""Solute carriers"""	10990	protein-coding gene	gene with protein product		103220		PEO3, PEO2, ANT1		1582253	Standard	NM_001151		Approved	T1	uc003ixd.3	P12235	OTTHUMG00000134299	ENST00000281456.6:c.849C>T	4.37:g.186068077C>T			186305071	NM_001151	D3DP59	Silent	SNP	ENST00000281456.6	37	CCDS34114.1																																																																																				0.428	SLC25A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259170.3	NM_001151	
CYP4V2	285440	hgsc.bcm.edu	37	4	187122436	187122436	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:187122436C>T	ENST00000378802.4	+	7	1231	c.927C>T	c.(925-927)gaC>gaT	p.D309D		NM_207352.3	NP_997235.3	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily V, polypeptide 2	309					fatty acid omega-oxidation (GO:0010430)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)	p.D309D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)|stomach(2)	20		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		TGACTGATGACGAAGGGAACA	0.418																																					p.D309D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C927T	4						.						141.0	142.0	141.0					4																	187122436		2203	4300	6503	187359430	SO:0001819	synonymous_variant	285440	exon7			AK022114	CCDS34119.1	4q35.2	2004-07-05			ENSG00000145476	ENSG00000145476		"""Cytochrome P450s"""	23198	protein-coding gene	gene with protein product		608614				15042513	Standard	NM_207352		Approved	CYP4AH1	uc003iyw.4	Q6ZWL3	OTTHUMG00000160379	ENST00000378802.4:c.927C>T	4.37:g.187122436C>T			187359430	NM_207352	B7U6W2|Q6ZTM4	Silent	SNP	ENST00000378802.4	37	CCDS34119.1																																																																																				0.418	CYP4V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360398.1	XM_209612	
RGS12	6002	hgsc.bcm.edu	37	4	3429853	3429854	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	AG	AG	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:3429853_3429854delAG	ENST00000344733.5	+	15	4272_4273	c.3368_3369delAG	c.(3367-3369)cagfs	p.Q1123fs	RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000306648.7_Frame_Shift_Del_p.Q521fs|RGS12_ENST00000382788.3_Frame_Shift_Del_p.Q1123fs|RGS12_ENST00000338806.4_Frame_Shift_Del_p.Q475fs|RGS12_ENST00000538395.1_Frame_Shift_Del_p.Q465fs|RGS12_ENST00000336727.3_Frame_Shift_Del_p.Q1123fs	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	1123					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)	p.N1124fs*23(1)		autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCAGTGAAACAGAACACAGCTG	0.51																																					p.1123_1123del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.3368_3369del	4						.																																			3399652	SO:0001589	frameshift_variant	6002	exon15			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.3368_3369delAG	4.37:g.3429853_3429854delAG	ENSP00000339381:p.Gln1123fs		3399651	NM_002926	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Frame_Shift_Del	DEL	ENST00000344733.5	37	CCDS3366.1																																																																																				0.510	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	
EVC	2121	hgsc.bcm.edu	37	4	5735085	5735085	+	Missense_Mutation	SNP	G	G	A	rs202026284		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:5735085G>A	ENST00000264956.6	+	5	809	c.625G>A	c.(625-627)Gtt>Att	p.V209I	EVC_ENST00000509451.1_Missense_Mutation_p.V209I|EVC_ENST00000382674.2_Missense_Mutation_p.V209I	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	209					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V209I(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				CAGTGTAGACGTTGACCTGTG	0.453																																					p.V209I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G625A	4						.						326.0	320.0	322.0					4																	5735085		2203	4300	6503	5785986	SO:0001583	missense	2121	exon5			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.625G>A	4.37:g.5735085G>A	ENSP00000264956:p.Val209Ile		5785986	NM_153717		Missense_Mutation	SNP	ENST00000264956.6	37	CCDS3383.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.200571	0.00296	.	.	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.49432	0.78;0.78;0.78	4.73	-1.47	0.08772	.	0.591400	0.16897	N	0.195060	T	0.15478	0.0373	N	0.02539	-0.55	0.09310	N	0.999993	B	0.06786	0.001	B	0.04013	0.001	T	0.33803	-0.9854	10	0.02654	T	1	.	8.8323	0.35091	0.2218:0.1827:0.5955:0.0	.	209	P57679	EVC_HUMAN	I	209	ENSP00000264956:V209I;ENSP00000372120:V209I;ENSP00000426774:V209I	ENSP00000264956:V209I	V	+	1	0	EVC	5785986	0.991000	0.36638	0.044000	0.18714	0.001000	0.01503	0.419000	0.21247	-0.193000	0.10415	-1.043000	0.02367	GTT		0.453	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
PPP2R2C	5522	hgsc.bcm.edu	37	4	6382805	6382805	+	Silent	SNP	G	G	A	rs563983100		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:6382805G>A	ENST00000382599.4	-	2	303	c.87C>T	c.(85-87)acC>acT	p.T29T	PPP2R2C_ENST00000314348.8_5'UTR|PPP2R2C_ENST00000515571.1_Silent_p.T12T|PPP2R2C_ENST00000507294.1_Silent_p.T22T|PPP2R2C_ENST00000335585.5_Silent_p.T29T|PPP2R2C_ENST00000506140.1_Silent_p.T22T			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	29					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.T29T(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						TGAACTCAACGGTAGAGATGA	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		13845	0.0		0.0	False		,,,				2504	0.001				p.T29T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C87T	4						.						45.0	36.0	39.0					4																	6382805		2203	4300	6503	6433706	SO:0001819	synonymous_variant	5522	exon2			AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.87C>T	4.37:g.6382805G>A			6433706	NM_020416	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Silent	SNP	ENST00000382599.4	37																																																																																					0.627	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
SLC34A2	10568	hgsc.bcm.edu	37	4	25677760	25677760	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:25677760G>T	ENST00000382051.3	+	13	1512	c.1462G>T	c.(1462-1464)Gcc>Tcc	p.A488S	SLC34A2_ENST00000504570.1_Missense_Mutation_p.A487S|SLC34A2_ENST00000503434.1_Missense_Mutation_p.A487S	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	488					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)	p.A488S(1)	SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GTTGCAGATCGCCCTGTGCCA	0.602			T	ROS1	NSCLC																																p.A487S			Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1459T	4						.						86.0	69.0	75.0					4																	25677760		2203	4300	6503	25286858	SO:0001583	missense	10568	exon13			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1462G>T	4.37:g.25677760G>T	ENSP00000371483:p.Ala488Ser		25286858	NM_001177999	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	ENST00000382051.3	37	CCDS3435.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.926083	0.73327	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	D;D;D	0.86627	-2.15;-2.15;-2.15	5.04	4.13	0.48395	.	0.106321	0.64402	D	0.000005	D	0.91479	0.7310	M	0.79805	2.47	0.80722	D	1	B;B	0.31100	0.263;0.308	B;P	0.47402	0.238;0.546	D	0.91321	0.5082	10	0.49607	T	0.09	-35.5842	14.5209	0.67849	0.0:0.0:0.8528:0.1472	.	487;488	O95436-2;O95436	.;NPT2B_HUMAN	S	487;488;487	ENSP00000425501:A487S;ENSP00000371483:A488S;ENSP00000423021:A487S	ENSP00000371483:A488S	A	+	1	0	SLC34A2	25286858	1.000000	0.71417	0.996000	0.52242	0.811000	0.45836	6.559000	0.73946	2.504000	0.84457	0.561000	0.74099	GCC		0.602	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
ATP8A1	10396	hgsc.bcm.edu	37	4	42457424	42457424	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:42457424T>C	ENST00000381668.5	-	29	2938	c.2707A>G	c.(2707-2709)Atg>Gtg	p.M903V	ATP8A1_ENST00000264449.10_Missense_Mutation_p.M888V	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	903					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.M903V(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	AAAGGAGGCATTGCTGTAAAC	0.388																																					p.M903V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2707G	4						.						152.0	144.0	147.0					4																	42457424		2203	4300	6503	42152181	SO:0001583	missense	10396	exon29			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.2707A>G	4.37:g.42457424T>C	ENSP00000371084:p.Met903Val		42152181	NM_006095	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	37	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	T	12.62	1.993677	0.35131	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.66638	-0.22;-0.22	5.22	5.22	0.72569	.	0.063418	0.64402	D	0.000005	T	0.47985	0.1475	N	0.04959	-0.14	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.09377	0.002;0.004;0.004	T	0.48163	-0.9059	10	0.72032	D	0.01	.	15.3999	0.74830	0.0:0.0:0.0:1.0	.	888;903;895	Q32M35;Q9Y2Q0;E7EUK4	.;AT8A1_HUMAN;.	V	903;888	ENSP00000371084:M903V;ENSP00000264449:M888V	ENSP00000264449:M888V	M	-	1	0	ATP8A1	42152181	0.995000	0.38212	0.996000	0.52242	0.939000	0.58152	2.225000	0.42954	2.085000	0.62840	0.528000	0.53228	ATG		0.388	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
DCUN1D4	23142	hgsc.bcm.edu	37	4	52757945	52757945	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:52757945C>T	ENST00000334635.5	+	7	614	c.434C>T	c.(433-435)gCt>gTt	p.A145V	DCUN1D4_ENST00000381441.3_Missense_Mutation_p.A145V|DCUN1D4_ENST00000381437.4_Missense_Mutation_p.A85V|DCUN1D4_ENST00000451288.2_Missense_Mutation_p.A189V	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	145	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					nucleus (GO:0005634)		p.A145V(1)		endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			CTTGTCCTAGCTTGGAAATTG	0.323																																					p.A145V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C434T	4						.						111.0	114.0	113.0					4																	52757945		2203	4300	6503	52452702	SO:0001583	missense	23142	exon7			D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.434C>T	4.37:g.52757945C>T	ENSP00000334625:p.Ala145Val		52452702	NM_001040402	B4DH25|Q7Z3F3|Q7Z6B8	Missense_Mutation	SNP	ENST00000334635.5	37	CCDS33982.1	.	.	.	.	.	.	.	.	.	.	C	33	5.281843	0.95489	.	.	ENSG00000109184	ENST00000334635;ENST00000381441;ENST00000381437;ENST00000505403;ENST00000451288	T;T;T	0.66638	-0.22;-0.22;-0.22	6.17	6.17	0.99709	Domain of unknown function DUF298 (1);	0.000000	0.85682	D	0.000000	D	0.88492	0.6451	H	0.96111	3.77	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.991;0.994;0.996	D	0.90910	0.4775	10	0.87932	D	0	-18.5039	19.4432	0.94831	0.0:1.0:0.0:0.0	.	189;145;145	B4DH25;Q92564-2;Q92564	.;.;DCNL4_HUMAN	V	145;145;85;189;189	ENSP00000334625:A145V;ENSP00000370846:A85V;ENSP00000389900:A189V	ENSP00000334625:A145V	A	+	2	0	DCUN1D4	52452702	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.589000	0.82641	2.941000	0.99782	0.655000	0.94253	GCT		0.323	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250599.2	NM_015115	
GSX2	170825	hgsc.bcm.edu	37	4	54967935	54967935	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:54967935G>A	ENST00000326902.2	+	2	1075	c.761G>A	c.(760-762)cGa>cAa	p.R254Q	GSX2_ENST00000548609.1_3'UTR|GSX2_ENST00000503800.1_3'UTR|FIP1L1_ENST00000507166.1_Intron|AC110298.1_ENST00000408292.1_RNA	NM_133267.2	NP_573574.1	Q9BZM3	GSX2_HUMAN	GS homeobox 2	254					forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|hindbrain morphogenesis (GO:0021575)|neuron fate specification (GO:0048665)|olfactory bulb interneuron differentiation (GO:0021889)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|spinal cord association neuron differentiation (GO:0021527)|subpallium neuron fate commitment (GO:0060163)|telencephalon regionalization (GO:0021978)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.R254Q(1)		endometrium(2)|large_intestine(2)|lung(2)	6	all_cancers(7;0.00671)|Lung NSC(11;0.0154)|all_neural(26;0.0209)|Glioma(25;0.08)|all_epithelial(27;0.147)		LUSC - Lung squamous cell carcinoma(32;0.00216)			CAGAACCGCCGAGTGAAGCAC	0.572																																					p.R254Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G761A	4						.						102.0	105.0	104.0					4																	54967935		2203	4300	6503	54662692	SO:0001583	missense	170825	exon2				CCDS3494.1	4q12	2012-03-09			ENSG00000180613	ENSG00000180613		"""Homeoboxes / ANTP class : HOXL subclass"""	24959	protein-coding gene	gene with protein product						11861295, 12205114	Standard	NM_133267		Approved	Gsh2	uc010igp.1	Q9BZM3	OTTHUMG00000128696	ENST00000326902.2:c.761G>A	4.37:g.54967935G>A	ENSP00000319118:p.Arg254Gln		54662692	NM_133267		Missense_Mutation	SNP	ENST00000326902.2	37	CCDS3494.1	.	.	.	.	.	.	.	.	.	.	G	36	5.728072	0.96856	.	.	ENSG00000180613	ENST00000326902	D	0.99143	-5.48	4.9	4.9	0.64082	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.057904	0.64402	D	0.000006	D	0.99661	0.9874	H	0.99286	4.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97210	0.9870	10	0.87932	D	0	.	18.2636	0.90044	0.0:0.0:1.0:0.0	.	254	Q9BZM3	GSX2_HUMAN	Q	254	ENSP00000319118:R254Q	ENSP00000319118:R254Q	R	+	2	0	GSX2	54662692	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.657000	0.98554	2.535000	0.85469	0.484000	0.47621	CGA		0.572	GSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250595.1	NM_133267	
PPAT	5471	hgsc.bcm.edu	37	4	57272662	57272662	+	Splice_Site	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:57272662T>C	ENST00000264220.2	-	3	538	c.401A>G	c.(400-402)aAg>aGg	p.K134R	PPAT_ENST00000507648.1_5'UTR	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	134	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)	p.K134R(1)		cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	CAAACGTACCTTTTTCCTTAA	0.363																																					p.K134R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A401G	4						.						115.0	101.0	106.0					4																	57272662		2203	4300	6503	56967419	SO:0001630	splice_region_variant	5471	exon3				CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.402+1A>G	4.37:g.57272662T>C			56967419	NM_002703		Missense_Mutation	SNP	ENST00000264220.2	37	CCDS3505.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.579835	0.46006	.	.	ENSG00000128059	ENST00000264220	T	0.76186	-1.0	5.62	5.62	0.85841	Glutamine amidotransferase, type II (1);Glutamine amidotransferase, class-II (1);	0.096234	0.64402	D	0.000002	T	0.63803	0.2542	N	0.21448	0.665	0.58432	D	0.999997	B	0.14012	0.009	B	0.20384	0.029	T	0.58896	-0.7555	10	0.35671	T	0.21	-24.6589	15.8261	0.78709	0.0:0.0:0.0:1.0	.	134	Q06203	PUR1_HUMAN	R	134	ENSP00000264220:K134R	ENSP00000264220:K134R	K	-	2	0	PPAT	56967419	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	5.557000	0.67313	2.138000	0.66242	0.477000	0.44152	AAG		0.363	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	Missense_Mutation
EREG	2069	hgsc.bcm.edu	37	4	75245229	75245230	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	CA	CA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:75245229_75245230delCA	ENST00000244869.2	+	2	298_299	c.132_133delCA	c.(130-135)tccagtfs	p.SS44fs		NM_001432.2	NP_001423.1	O14944	EREG_HUMAN	epiregulin	44					anatomical structure morphogenesis (GO:0009653)|angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|luteinizing hormone signaling pathway (GO:0042700)|mRNA transcription (GO:0009299)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|organ morphogenesis (GO:0009887)|ovarian cumulus expansion (GO:0001550)|ovulation (GO:0030728)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine biosynthetic process (GO:0042108)|positive regulation of cytokine production (GO:0001819)|positive regulation of DNA replication (GO:0045740)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of innate immune response (GO:0045089)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of smooth muscle cell proliferation (GO:0048661)|primary follicle stage (GO:0048160)|response to peptide hormone (GO:0043434)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	epidermal growth factor receptor binding (GO:0005154)	p.S45fs*1(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13			Lung(101;0.196)			CAGGAGAGTCCAGTGATAACTG	0.351																																					p.44_45del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.132_133del	4						.																																			75464094	SO:0001589	frameshift_variant	2069	exon2			D30783	CCDS3564.1	4q21.21	2008-07-29			ENSG00000124882	ENSG00000124882			3443	protein-coding gene	gene with protein product		602061				9337852	Standard	NM_001432		Approved	ER	uc003hie.1	O14944	OTTHUMG00000130005	ENST00000244869.2:c.132_133delCA	4.37:g.75245229_75245230delCA	ENSP00000244869:p.Ser44fs		75464093	NM_001432	B2RC66|Q6FH69	Frame_Shift_Del	DEL	ENST00000244869.2	37	CCDS3564.1																																																																																				0.351	EREG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252276.1		
SCARB2	950	hgsc.bcm.edu	37	4	77102168	77102168	+	Missense_Mutation	SNP	C	C	T	rs73826386	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:77102168C>T	ENST00000264896.2	-	3	711	c.362G>A	c.(361-363)cGa>cAa	p.R121Q	SCARB2_ENST00000452464.2_Intron	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	121					cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)	p.R121Q(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			AGATTGGTCTCGTTCAAAAAC	0.323													C|||	39	0.00778754	0.0265	0.0058	5008	,	,		16233	0.0		0.0	False		,,,				2504	0.0				p.R121Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G362A	4						.	C	,GLN/ARG	90,4312	74.1+/-112.3	1,88,2112	116.0	116.0	116.0		,362	4.2	0.2	4	dbSNP_130	116	3,8597	2.2+/-6.3	0,3,4297	yes	intron,missense	SCARB2	NM_001204255.1,NM_005506.3	,43	1,91,6409	TT,TC,CC		0.0349,2.0445,0.7153	,probably-damaging	,121/479	77102168	93,12909	2201	4300	6501	77321192	SO:0001583	missense	950	exon3			D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.362G>A	4.37:g.77102168C>T	ENSP00000264896:p.Arg121Gln		77321192	NM_005506	B4DKD8|E7EM68|Q53Y63	Missense_Mutation	SNP	ENST00000264896.2	37	CCDS3577.1	14	0.00641025641025641	11	0.022357723577235773	3	0.008287292817679558	0	0.0	0	0.0	C	12.18	1.859131	0.32884	0.020445	3.49E-4	ENSG00000138760	ENST00000264896	T	0.71579	-0.58	5.87	4.16	0.48862	.	0.158622	0.56097	N	0.000035	T	0.46833	0.1413	L	0.60845	1.875	0.39395	D	0.966482	B	0.25441	0.126	B	0.25291	0.059	T	0.53746	-0.8395	10	0.30854	T	0.27	.	7.7786	0.29051	0.0:0.7217:0.1335:0.1448	.	121	Q14108	SCRB2_HUMAN	Q	121	ENSP00000264896:R121Q	ENSP00000264896:R121Q	R	-	2	0	SCARB2	77321192	0.068000	0.21057	0.192000	0.23308	0.794000	0.44872	0.020000	0.13466	0.946000	0.37632	0.655000	0.94253	CGA		0.323	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252403.1	NM_005506	
NUDT9	53343	hgsc.bcm.edu	37	4	88359499	88359499	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:88359499T>C	ENST00000302174.4	+	3	742	c.418T>C	c.(418-420)Tat>Cat	p.Y140H	NUDT9_ENST00000473942.1_Missense_Mutation_p.Y90H	NM_024047.4	NP_076952.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 9	140					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.Y140H(1)		endometrium(1)|large_intestine(4)|lung(6)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		GAATGGCCTGTATGAGATTGA	0.353																																					p.Y90H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T268C	4						.						114.0	109.0	111.0					4																	88359499		2203	4300	6503	88578523	SO:0001583	missense	53343	exon3			AY026252	CCDS3620.1, CCDS3621.1	4q22.1	2008-08-29			ENSG00000170502	ENSG00000170502		"""Nudix motif containing"""	8056	protein-coding gene	gene with protein product		606022				11385575, 12427752	Standard	NM_024047		Approved	MGC3037	uc003hqq.3	Q9BW91	OTTHUMG00000130591	ENST00000302174.4:c.418T>C	4.37:g.88359499T>C	ENSP00000303575:p.Tyr140His		88578523	NM_198038	Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	ENST00000302174.4	37	CCDS3620.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.241942	0.79912	.	.	ENSG00000170502	ENST00000302174;ENST00000512216;ENST00000473942	T;T;T	0.21031	2.03;2.03;2.03	5.4	5.4	0.78164	NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	T	0.54447	0.1859	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64980	-0.6279	10	0.87932	D	0	-15.9383	13.4731	0.61292	0.0:0.0:0.0:1.0	.	140	Q9BW91	NUDT9_HUMAN	H	140;90;90	ENSP00000303575:Y140H;ENSP00000424702:Y90H;ENSP00000421811:Y90H	ENSP00000303575:Y140H	Y	+	1	0	NUDT9	88578523	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.289000	0.65656	2.185000	0.69588	0.528000	0.53228	TAT		0.353	NUDT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253035.2		
ENPEP	2028	hgsc.bcm.edu	37	4	111397583	111397584	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	GA	GA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:111397583_111397584delGA	ENST00000265162.5	+	1	355_356	c.13_14delGA	c.(13-15)gagfs	p.E5fs		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	5					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E7fs*3(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		GAACTTTGCGGAGAGAGAGGGC	0.421																																					p.5_5del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.13_14del	4						.																																			111617033	SO:0001589	frameshift_variant	2028	exon1			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.13_14delGA	4.37:g.111397589_111397590delGA	ENSP00000265162:p.Glu5fs		111617032	NM_001977	Q504U2	Frame_Shift_Del	DEL	ENST00000265162.5	37	CCDS3691.1																																																																																				0.421	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
F11	2160	hgsc.bcm.edu	37	4	187201235	187201235	+	Silent	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr4:187201235T>G	ENST00000403665.2	+	8	1177	c.825T>G	c.(823-825)ctT>ctG	p.L275L	F11_ENST00000264692.4_Silent_p.L223L	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	275	Apple 3. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)	p.L275L(1)		NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	GCAAAGCTCTTTCTGGTTTCA	0.438																																					p.L275L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T825G	4						.						78.0	79.0	79.0					4																	187201235		2203	4300	6503	187438229	SO:0001819	synonymous_variant	2160	exon8			M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.825T>G	4.37:g.187201235T>G			187438229	NM_000128	D3DP64|Q4W5C2|Q9Y495	Silent	SNP	ENST00000403665.2	37	CCDS3847.1	.	.	.	.	.	.	.	.	.	.	T	5.393	0.257644	0.10239	.	.	ENSG00000088926	ENST00000452239	.	.	.	5.63	-1.06	0.10002	.	.	.	.	.	T	0.33059	0.0850	.	.	.	0.35607	D	0.808307	.	.	.	.	.	.	T	0.35624	-0.9781	4	.	.	.	.	0.8585	0.01188	0.1895:0.1915:0.305:0.314	.	.	.	.	C	91	.	.	F	+	2	0	F11	187438229	0.039000	0.19947	0.815000	0.32552	0.638000	0.38207	-0.595000	0.05727	-0.069000	0.12931	0.524000	0.50904	TTT		0.438	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4		
DRP2	1821	hgsc.bcm.edu	37	X	100505427	100505427	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:100505427T>C	ENST00000395209.3	+	15	2083	c.1556T>C	c.(1555-1557)gTg>gCg	p.V519A	DRP2_ENST00000402866.1_Missense_Mutation_p.V519A|DRP2_ENST00000538510.1_Missense_Mutation_p.V519A|DRP2_ENST00000541709.1_Missense_Mutation_p.V441A	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	519					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.V516A(2)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						TTCAGCCAAGTGGCCAACTCA	0.587																																					p.V519A												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.T1556C	X						.						84.0	80.0	81.0					X																	100505427		2203	4300	6503	100392083	SO:0001583	missense	1821	exon15			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.1556T>C	X.37:g.100505427T>C	ENSP00000378635:p.Val519Ala		100392083	NM_001939	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	ENST00000395209.3	37	CCDS14480.2	.	.	.	.	.	.	.	.	.	.	T	28.0	4.879079	0.91740	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.53	5.53	0.82687	EF-hand domain, type 2 (1);	0.000000	0.85682	D	0.000000	D	0.86451	0.5936	M	0.80422	2.495	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.88392	0.3009	10	0.87932	D	0	-13.7072	14.683	0.69031	0.0:0.0:0.0:1.0	.	519	Q13474	DRP2_HUMAN	A	519;519;441;519	ENSP00000385038:V519A;ENSP00000378635:V519A;ENSP00000444752:V441A;ENSP00000441051:V519A	ENSP00000378635:V519A	V	+	2	0	DRP2	100392083	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	7.868000	0.87116	2.044000	0.60594	0.486000	0.48141	GTG		0.587	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	
ARMCX5	64860	hgsc.bcm.edu	37	X	101857748	101857748	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:101857748G>A	ENST00000604957.1	+	1	3301	c.679G>A	c.(679-681)Gcc>Acc	p.A227T	RP4-769N13.6_ENST00000476910.2_RNA|ARMCX5_ENST00000372742.1_Missense_Mutation_p.A227T|ARMCX5_ENST00000537008.1_Missense_Mutation_p.A227T|ARMCX5_ENST00000536530.1_Missense_Mutation_p.A227T|ARMCX5_ENST00000246174.2_Missense_Mutation_p.A227T|RP4-769N13.7_ENST00000602441.1_RNA|ARMCX5_ENST00000541409.1_Missense_Mutation_p.A227T	NM_001168478.1	NP_001161950.1	Q6P1M9	ARMX5_HUMAN	armadillo repeat containing, X-linked 5	227								p.A227T(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	22						ATGGTCAAGGGCCAGGTATAT	0.468																																					p.A227T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G679A	X						.						120.0	112.0	115.0					X																	101857748		2203	4300	6503	101744404	SO:0001583	missense	64860	exon5				CCDS14500.1	Xq22.1-q22.3	2014-03-21			ENSG00000125962	ENSG00000125962		"""Armadillo repeat containing"""	25772	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_022838		Approved	FLJ12969, GASP5	uc004ejh.3	Q6P1M9	OTTHUMG00000022062	ENST00000604957.1:c.679G>A	X.37:g.101857748G>A	ENSP00000474720:p.Ala227Thr		101744404	NM_001168485	B3KU88|D3DX99|Q68DB4|Q9BVZ3|Q9H969	Missense_Mutation	SNP	ENST00000604957.1	37	CCDS14500.1	.	.	.	.	.	.	.	.	.	.	G	8.492	0.862161	0.17178	.	.	ENSG00000125962	ENST00000246174;ENST00000537008;ENST00000541409;ENST00000536530;ENST00000372742	T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03	3.7	2.8	0.32819	.	0.369708	0.19961	N	0.102202	T	0.10766	0.0263	N	0.14661	0.345	0.23519	N	0.997504	P	0.37781	0.608	B	0.34824	0.19	T	0.15065	-1.0450	10	0.40728	T	0.16	-0.1671	8.1122	0.30922	0.0:0.2427:0.7573:0.0	.	227	Q6P1M9	ARMX5_HUMAN	T	227	ENSP00000246174:A227T;ENSP00000439001:A227T;ENSP00000446385:A227T;ENSP00000445851:A227T;ENSP00000361827:A227T	ENSP00000246174:A227T	A	+	1	0	ARMCX5	101744404	0.707000	0.27866	0.911000	0.35937	0.331000	0.28603	0.086000	0.14935	0.910000	0.36722	0.600000	0.82982	GCC		0.468	ARMCX5-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469659.1	NM_022838	
IRS4	8471	hgsc.bcm.edu	37	X	107979349	107979349	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:107979349C>T	ENST00000372129.2	-	1	302	c.226G>A	c.(226-228)Ggg>Agg	p.G76R	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	76					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.G76R(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						ACTTCCTCCCCGACGGGCAGG	0.637																																					p.G76R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G226A	X						.						47.0	38.0	41.0					X																	107979349		2200	4291	6491	107866005	SO:0001583	missense	8471	exon1			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.226G>A	X.37:g.107979349C>T	ENSP00000361202:p.Gly76Arg		107866005	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.247074	0.59103	.	.	ENSG00000133124	ENST00000372129	T	0.36340	1.26	3.8	3.8	0.43715	Pleckstrin homology-type (1);	0.988235	0.08251	N	0.974650	T	0.52837	0.1759	L	0.39898	1.24	0.35908	D	0.830898	D	0.76494	0.999	D	0.66602	0.945	T	0.57087	-0.7871	10	0.66056	D	0.02	-3.3719	15.5517	0.76158	0.0:1.0:0.0:0.0	.	76	O14654	IRS4_HUMAN	R	76	ENSP00000361202:G76R	ENSP00000361202:G76R	G	-	1	0	IRS4	107866005	0.679000	0.27596	1.000000	0.80357	0.857000	0.48899	2.264000	0.43302	1.913000	0.55393	0.529000	0.55759	GGG		0.637	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
IRS4	8471	hgsc.bcm.edu	37	X	107979353	107979353	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:107979353G>A	ENST00000372129.2	-	1	298	c.222C>T	c.(220-222)ccC>ccT	p.P74P	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	74					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.P74P(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CCTCCCCGACGGGCAGGTCCT	0.642													G|||	1	0.000264901	0.0008	0.0	3775	,	,		7851	0.0		0.0	False		,,,				2504	0.0				p.P74P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C222T	X						.						43.0	35.0	38.0					X																	107979353		2199	4289	6488	107866009	SO:0001819	synonymous_variant	8471	exon1			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.222C>T	X.37:g.107979353G>A			107866009	NM_003604		Silent	SNP	ENST00000372129.2	37	CCDS14544.1																																																																																				0.642	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
FRMPD4	9758	hgsc.bcm.edu	37	X	12735869	12735869	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:12735869C>A	ENST00000380682.1	+	16	3430	c.2924C>A	c.(2923-2925)cCa>cAa	p.P975Q		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	975					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.P965Q(1)|p.P975Q(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GCTGCTAGGCCAGCAACCGAC	0.602																																					p.P975Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2924A	X						.						58.0	58.0	58.0					X																	12735869		2203	4300	6503	12645790	SO:0001583	missense	9758	exon16			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2924C>A	X.37:g.12735869C>A	ENSP00000370057:p.Pro975Gln		12645790	NM_014728	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	C	0.031	-1.333144	0.01298	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.05996	3.36	5.47	5.47	0.80525	.	0.220108	0.36854	N	0.002361	T	0.04679	0.0127	N	0.19112	0.55	0.09310	N	1	B;B	0.25390	0.125;0.059	B;B	0.19666	0.026;0.014	T	0.41556	-0.9502	10	0.22109	T	0.4	-6.6501	11.5532	0.50733	0.3241:0.6759:0.0:0.0	.	967;975	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	Q	975;966;964	ENSP00000370057:P975Q	ENSP00000304583:P964Q	P	+	2	0	FRMPD4	12645790	0.801000	0.28930	0.045000	0.18777	0.330000	0.28571	5.321000	0.65846	2.293000	0.77203	0.513000	0.50165	CCA		0.602	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
TLR7	51284	hgsc.bcm.edu	37	X	12906103	12906103	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:12906103A>G	ENST00000380659.3	+	3	2615	c.2476A>G	c.(2476-2478)Atc>Gtc	p.I826V		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	826					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.I826V(1)		NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	CCAAAGTGTGATCTCCCTGGA	0.483																																					p.I826V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2476G	X						.						192.0	154.0	167.0					X																	12906103		2203	4300	6503	12816024	SO:0001583	missense	51284	exon3			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.2476A>G	X.37:g.12906103A>G	ENSP00000370034:p.Ile826Val		12816024	NM_016562	D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	37	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.338289	0.00017	.	.	ENSG00000196664	ENST00000380659	T	0.32988	1.43	5.82	0.766	0.18476	Cysteine-rich flanking region, C-terminal (1);	0.335271	0.28371	N	0.015590	T	0.10165	0.0249	N	0.03253	-0.375	0.34164	D	0.668983	B	0.02656	0.0	B	0.04013	0.001	T	0.42816	-0.9429	10	0.02654	T	1	.	9.6706	0.40011	0.1996:0.1033:0.6971:0.0	.	826	Q9NYK1	TLR7_HUMAN	V	826	ENSP00000370034:I826V	ENSP00000370034:I826V	I	+	1	0	TLR7	12816024	0.104000	0.21937	0.248000	0.24265	0.052000	0.14988	0.157000	0.16402	-0.026000	0.13895	-1.326000	0.01283	ATC		0.483	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562	
RGAG1	57529	hgsc.bcm.edu	37	X	109693924	109693924	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:109693924G>T	ENST00000465301.2	+	3	325	c.79G>T	c.(79-81)Gcc>Tcc	p.A27S	RGAG1_ENST00000540313.1_Missense_Mutation_p.A27S	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	27								p.A27S(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CAAGCAGATGGCCTTCTGTAG	0.468											OREG0019909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A27S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G79T	X						.						207.0	180.0	189.0					X																	109693924		2203	4300	6503	109580580	SO:0001583	missense	57529	exon3			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.79G>T	X.37:g.109693924G>T	ENSP00000419786:p.Ala27Ser	1421	109580580	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.747460	0.00669	.	.	ENSG00000243978	ENST00000520821;ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.47528	0.84;0.84	4.16	-4.2	0.03823	.	1.863060	0.03260	N	0.183183	T	0.25975	0.0633	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.07501	-1.0769	9	.	.	.	0.02	4.3462	0.11134	0.2521:0.0:0.4296:0.3183	.	27	Q8NET4	RGAG1_HUMAN	S	27	ENSP00000419786:A27S;ENSP00000441452:A27S	.	A	+	1	0	RGAG1	109580580	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.525000	0.06214	-1.097000	0.03042	-1.348000	0.01239	GCC		0.468	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
SMARCA1	6594	hgsc.bcm.edu	37	X	128605250	128605250	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:128605250T>C	ENST00000371122.4	-	20	2625	c.2496A>G	c.(2494-2496)caA>caG	p.Q832Q	SMARCA1_ENST00000371121.3_Silent_p.Q820Q|SMARCA1_ENST00000371123.1_Silent_p.Q820Q	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	832					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						CAATCTTTTTTTGCTCTTCTC	0.348																																					p.Q832Q												.	.	0			c.A2496G	X						.						144.0	133.0	136.0					X																	128605250		2203	4300	6503	128432931	SO:0001819	synonymous_variant	6594	exon20			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.2496A>G	X.37:g.128605250T>C			128432931	NM_003069	Q5JV41|Q5JV42	Silent	SNP	ENST00000371122.4	37	CCDS14612.1																																																																																				0.348	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
USP26	83844	hgsc.bcm.edu	37	X	132159667	132159667	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:132159667C>T	ENST00000511190.1	-	6	3051	c.2582G>A	c.(2581-2583)cGg>cAg	p.R861Q	USP26_ENST00000370832.1_Missense_Mutation_p.R861Q|USP26_ENST00000406273.1_Missense_Mutation_p.R861Q	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	861	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.R861Q(2)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					ACCTAACACCCGCATATCATC	0.438																																					p.R861Q	NSCLC(104;342 1621 36940 47097 52632)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2582A	X						.						139.0	117.0	125.0					X																	132159667		2203	4300	6503	131987333	SO:0001583	missense	83844	exon1			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2582G>A	X.37:g.132159667C>T	ENSP00000423390:p.Arg861Gln		131987333	NM_031907	B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	T	4.834	0.154967	0.09236	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.31510	1.49;1.49;1.49	3.64	1.08	0.20341	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.646050	0.04079	N	0.309366	T	0.09069	0.0224	N	0.00707	-1.245	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.21827	-1.0234	10	0.13470	T	0.59	5.8655	3.5089	0.07701	0.3452:0.1062:0.0:0.5486	.	861	Q9BXU7	UBP26_HUMAN	Q	861	ENSP00000359869:R861Q;ENSP00000423390:R861Q;ENSP00000384360:R861Q	ENSP00000359869:R861Q	R	-	2	0	USP26	131987333	0.007000	0.16637	0.000000	0.03702	0.224000	0.24922	1.442000	0.35046	-0.159000	0.11021	-0.428000	0.05917	CGG		0.438	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907	
EGFL6	25975	hgsc.bcm.edu	37	X	13626557	13626557	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:13626557G>A	ENST00000361306.1	+	7	1027	c.770G>A	c.(769-771)cGg>cAg	p.R257Q	EGFL6_ENST00000380602.3_Missense_Mutation_p.R257Q	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	257	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)	p.R257Q(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						AATGGACTTCGGTGTTCTGGT	0.448																																					p.R257Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G770A	X						.						247.0	195.0	213.0					X																	13626557		2203	4300	6503	13536478	SO:0001583	missense	25975	exon7			AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.770G>A	X.37:g.13626557G>A	ENSP00000355126:p.Arg257Gln		13536478	NM_001167890	B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Missense_Mutation	SNP	ENST00000361306.1	37	CCDS14155.1	.	.	.	.	.	.	.	.	.	.	G	5.709	0.315280	0.10789	.	.	ENSG00000198759	ENST00000361306;ENST00000380602	D;D	0.87103	-2.21;-2.21	5.04	2.44	0.29823	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.425306	0.26289	N	0.025238	T	0.67942	0.2947	N	0.04746	-0.17	0.25290	N	0.989362	B;B	0.13594	0.003;0.008	B;B	0.08055	0.001;0.003	T	0.51911	-0.8645	10	0.10902	T	0.67	.	7.5821	0.27972	0.782:0.0:0.218:0.0	.	257;257	Q8IUX8-2;Q8IUX8	.;EGFL6_HUMAN	Q	257	ENSP00000355126:R257Q;ENSP00000369976:R257Q	ENSP00000355126:R257Q	R	+	2	0	EGFL6	13536478	1.000000	0.71417	0.680000	0.29994	0.459000	0.32528	5.735000	0.68587	0.075000	0.16796	-0.373000	0.07131	CGG		0.448	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055800.1	NM_015507	
GPR112	139378	hgsc.bcm.edu	37	X	135494469	135494469	+	Missense_Mutation	SNP	G	G	A	rs139763945		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:135494469G>A	ENST00000394143.1	+	24	9272	c.8981G>A	c.(8980-8982)cGg>cAg	p.R2994Q	GPR112_ENST00000287534.4_Intron|GPR112_ENST00000394141.1_Missense_Mutation_p.R2789Q|GPR112_ENST00000370652.1_Missense_Mutation_p.R2994Q|GPR112_ENST00000412101.1_Missense_Mutation_p.R2789Q	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2994					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R2994Q(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GAGAGTGTGCGGGAGCAGTGG	0.423																																					p.R2994Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8981A	X						.	G	GLN/ARG	1,3834		0,1,1631,571	254.0	193.0	214.0		8981	3.5	0.7	X	dbSNP_134	214	0,6728		0,0,2428,1872	no	missense	GPR112	NM_153834.3	43	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	probably-damaging	2994/3081	135494469	1,10562	2203	4300	6503	135322135	SO:0001583	missense	139378	exon24			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8981G>A	X.37:g.135494469G>A	ENSP00000377699:p.Arg2994Gln		135322135	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030335	0.75504	2.61E-4	0.0	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000394141	T;T;T;T	0.57273	0.41;0.41;0.41;0.41	5.29	3.53	0.40419	.	.	.	.	.	T	0.49729	0.1574	L	0.38649	1.16	0.80722	D	1	D;P	0.62365	0.991;0.755	P;P	0.55508	0.777;0.533	T	0.36578	-0.9742	9	0.22706	T	0.39	.	7.1883	0.25811	0.1558:0.0:0.7068:0.1374	.	2789;2994	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	Q	2994;2994;2789;2789	ENSP00000377699:R2994Q;ENSP00000359686:R2994Q;ENSP00000416526:R2789Q;ENSP00000377697:R2789Q	ENSP00000359686:R2994Q	R	+	2	0	GPR112	135322135	0.987000	0.35691	0.691000	0.30163	0.994000	0.84299	2.019000	0.41001	0.550000	0.28991	0.529000	0.55759	CGG		0.423	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
GPR101	83550	hgsc.bcm.edu	37	X	136113397	136113397	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:136113397C>T	ENST00000298110.1	-	1	436	c.437G>A	c.(436-438)cGc>cAc	p.R146H		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.R146H(1)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					GTAACCGCGGCGCTGGGTCAT	0.592																																					p.R146H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G437A	X						.						57.0	44.0	48.0					X																	136113397		2203	4300	6503	135941063	SO:0001583	missense	83550	exon1			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.437G>A	X.37:g.136113397C>T	ENSP00000298110:p.Arg146His		135941063	NM_054021	Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.087005	0.36855	.	.	ENSG00000165370	ENST00000298110	T	0.42513	0.97	5.04	1.12	0.20585	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33110	N	0.005275	T	0.33990	0.0882	M	0.78285	2.405	0.25864	N	0.983789	B	0.27732	0.187	B	0.19391	0.025	T	0.40478	-0.9561	10	0.62326	D	0.03	-14.906	0.523	0.00615	0.1814:0.3422:0.174:0.3024	.	146	Q96P66	GP101_HUMAN	H	146	ENSP00000298110:R146H	ENSP00000298110:R146H	R	-	2	0	GPR101	135941063	1.000000	0.71417	0.809000	0.32408	0.971000	0.66376	1.550000	0.36223	0.920000	0.36970	0.600000	0.82982	CGC		0.592	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		
MAGEC1	9947	hgsc.bcm.edu	37	X	140995106	140995106	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:140995106G>A	ENST00000285879.4	+	4	2202	c.1916G>A	c.(1915-1917)aGt>aAt	p.S639N	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	639								p.S639N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					ACTCCATCCAGTCTTCCCCAG	0.567										HNSCC(15;0.026)																											p.S639N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1916A	X						.						179.0	191.0	187.0					X																	140995106		2203	4300	6503	140822772	SO:0001583	missense	9947	exon4			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1916G>A	X.37:g.140995106G>A	ENSP00000285879:p.Ser639Asn		140822772	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	g	6.776	0.512167	0.12944	.	.	ENSG00000155495	ENST00000285879	T	0.02323	4.34	1.01	-2.02	0.07388	.	.	.	.	.	T	0.01254	0.0041	N	0.08118	0	0.23430	N	0.997698	P	0.47604	0.898	B	0.31869	0.137	T	0.48917	-0.8992	9	0.87932	D	0	.	5.766	0.18227	0.0:0.0:0.4872:0.5128	.	639	O60732	MAGC1_HUMAN	N	639	ENSP00000285879:S639N	ENSP00000285879:S639N	S	+	2	0	MAGEC1	140822772	0.071000	0.21146	0.045000	0.18777	0.045000	0.14185	0.316000	0.19469	-0.800000	0.04433	-0.789000	0.03336	AGT		0.567	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
S100G	795	hgsc.bcm.edu	37	X	16669199	16669199	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:16669199C>A	ENST00000380200.3	+	2	124	c.70C>A	c.(70-72)Cca>Aca	p.P24T	CTPS2_ENST00000359276.4_Intron|CTPS2_ENST00000380241.3_Intron|CTPS2_ENST00000443824.1_Intron	NM_004057.2	NP_004048.1	P29377	S100G_HUMAN	S100 calcium binding protein G	24	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)	calcium ion binding (GO:0005509)|vitamin D binding (GO:0005499)	p.P24T(1)		large_intestine(1)|lung(1)	2	Hepatocellular(33;0.0997)					AGAAGGTGATCCAGACCAGTT	0.408																																					p.P24T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C70A	X						.						132.0	133.0	132.0					X																	16669199		2203	4300	6503	16579120	SO:0001583	missense	795	exon2				CCDS14176.1	Xp22.2	2014-01-28	2001-11-28	2004-10-07	ENSG00000169906	ENSG00000169906		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	1436	protein-coding gene	gene with protein product	"""calbindin-D9K"""	302020	"""calbindin 3, (vitamin D-dependent calcium-binding protein)"""	CALB3		1610358, 1379540	Standard	NM_004057		Approved	CABP9K, CABP1	uc004cxn.1	P29377	OTTHUMG00000021194	ENST00000380200.3:c.70C>A	X.37:g.16669199C>A	ENSP00000369547:p.Pro24Thr		16579120	NM_004057	Q5JS49	Missense_Mutation	SNP	ENST00000380200.3	37	CCDS14176.1	.	.	.	.	.	.	.	.	.	.	C	9.869	1.198517	0.22037	.	.	ENSG00000169906	ENST00000380200	T	0.09073	3.02	5.58	5.58	0.84498	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	0.146091	0.44483	D	0.000458	T	0.17577	0.0422	.	.	.	0.40069	D	0.975992	P	0.51537	0.946	P	0.57679	0.825	T	0.03887	-1.0995	9	0.20046	T	0.44	-0.3688	14.018	0.64536	0.0:1.0:0.0:0.0	.	24	P29377	S100G_HUMAN	T	24	ENSP00000369547:P24T	ENSP00000369547:P24T	P	+	1	0	S100G	16579120	0.990000	0.36364	0.954000	0.39281	0.632000	0.37999	2.097000	0.41748	2.471000	0.83476	0.600000	0.82982	CCA		0.408	S100G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055910.1	NM_004057	
NHS	4810	hgsc.bcm.edu	37	X	17750442	17750442	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:17750442G>A	ENST00000380060.3	+	8	5089	c.4751G>A	c.(4750-4752)cGg>cAg	p.R1584Q	NHS_ENST00000398097.3_Missense_Mutation_p.R1428Q	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1605					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.R1584Q(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					GGACGTTCTCGGGCCCCTCCT	0.582																																					p.R1428Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4283A	X						.						61.0	55.0	57.0					X																	17750442		2203	4300	6503	17660363	SO:0001583	missense	4810	exon9				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.4751G>A	X.37:g.17750442G>A	ENSP00000369400:p.Arg1584Gln		17660363	NM_001136024	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	G	36	5.663272	0.96745	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.64085	-0.08;-0.08	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.79913	0.4528	M	0.70275	2.135	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	T	0.80804	-0.1219	10	0.72032	D	0.01	-14.1044	19.3889	0.94570	0.0:0.0:1.0:0.0	.	1605;1426;1428;1584	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	Q	1584;1428;1426	ENSP00000369400:R1584Q;ENSP00000381170:R1428Q	ENSP00000369397:R1426Q	R	+	2	0	NHS	17660363	1.000000	0.71417	0.986000	0.45419	0.986000	0.74619	7.581000	0.82535	2.618000	0.88619	0.600000	0.82982	CGG		0.582	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270	
DMD	1756	hgsc.bcm.edu	37	X	32429961	32429961	+	Missense_Mutation	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:32429961A>C	ENST00000357033.4	-	30	4347	c.4141T>G	c.(4141-4143)Tta>Gta	p.L1381V	DMD_ENST00000378677.2_Missense_Mutation_p.L1377V	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1381					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.L1376V(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCCTGGATTAAGTGTAAGGAT	0.458																																					p.L40V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T118G	X						.						116.0	91.0	99.0					X																	32429961		2202	4300	6502	32339882	SO:0001583	missense	1756	exon2			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4141T>G	X.37:g.32429961A>C	ENSP00000354923:p.Leu1381Val		32339882	NM_004011	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	A	0.516	-0.864218	0.02590	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.18016	2.24;2.24	5.68	4.32	0.51571	.	0.000000	0.28877	U	0.013841	T	0.08980	0.0222	N	0.25144	0.715	0.80722	D	1	B;B;B;B;B	0.32101	0.356;0.014;0.243;0.243;0.243	B;B;B;B;B	0.35182	0.197;0.008;0.097;0.097;0.097	T	0.12372	-1.0550	10	0.02654	T	1	.	5.9194	0.19073	0.7198:0.0:0.1396:0.1406	.	1373;1381;1377;40;37	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	V	1373;40;37;1377;1381;1381;1258	ENSP00000367948:L1377V;ENSP00000354923:L1381V	ENSP00000354923:L1381V	L	-	1	2	DMD	32339882	0.999000	0.42202	1.000000	0.80357	0.954000	0.61252	1.704000	0.37857	1.904000	0.55121	0.412000	0.27726	TTA		0.458	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
SYN1	6853	hgsc.bcm.edu	37	X	47435566	47435566	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:47435566C>T	ENST00000295987.7	-	9	1246	c.1122G>A	c.(1120-1122)gcG>gcA	p.A374A	SYN1_ENST00000340666.4_Silent_p.A374A	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	374	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)	p.A374A(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						TGCCATGTAGCGCTTCCACTG	0.562																																					p.A374A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1122A	X						.						166.0	77.0	108.0					X																	47435566		2203	4300	6503	47320510	SO:0001819	synonymous_variant	6853	exon9				CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.1122G>A	X.37:g.47435566C>T			47320510	NM_133499	B1AJQ1|O75825|Q5H9A9	Silent	SNP	ENST00000295987.7	37	CCDS14280.1																																																																																				0.562	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056445.1	NM_006950	
HDAC6	10013	hgsc.bcm.edu	37	X	48678599	48678599	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:48678599T>C	ENST00000334136.5	+	23	2452	c.2274T>C	c.(2272-2274)ggT>ggC	p.G758G	HDAC6_ENST00000444343.2_Silent_p.G772G|HDAC6_ENST00000376619.2_Silent_p.G758G			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	758	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.G758G(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	CACCTGAGGGTTATGCCCACC	0.592																																					p.G758G	Pancreas(112;205 1675 2305 8976 15959)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2274C	X						.						82.0	66.0	72.0					X																	48678599		2203	4300	6503	48563543	SO:0001819	synonymous_variant	10013	exon23			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.2274T>C	X.37:g.48678599T>C			48563543	NM_006044	O94975|Q6NT75|Q7L3E5|Q96CY0	Silent	SNP	ENST00000334136.5	37	CCDS14306.1																																																																																				0.592	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083394.2	NM_006044	
KDM5C	8242	hgsc.bcm.edu	37	X	53239681	53239681	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:53239681G>T	ENST00000375401.3	-	12	2193	c.1661C>A	c.(1660-1662)cCt>cAt	p.P554H	KDM5C_ENST00000465402.1_5'UTR|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000404049.3_Missense_Mutation_p.P553H|KDM5C_ENST00000375379.3_Missense_Mutation_p.P554H|KDM5C_ENST00000452825.3_Missense_Mutation_p.P487H|KDM5C_ENST00000375383.3_Missense_Mutation_p.P513H	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	554	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.P554H(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						AAATAGTTCAGGTGTCAGCTT	0.532			"""N, F, S"""		clear cell renal carcinoma																																p.P554H			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1661A	X						.						204.0	181.0	189.0					X																	53239681		2203	4300	6503	53256406	SO:0001583	missense	8242	exon12			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1661C>A	X.37:g.53239681G>T	ENSP00000364550:p.Pro554His		53256406	NM_004187	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112219	0.77210	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6;-0.6	5.62	5.62	0.85841	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.86548	0.5959	M	0.88979	2.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.89066	0.3466	10	0.87932	D	0	-11.5014	15.8643	0.79052	0.0:0.0:1.0:0.0	.	487;553;554	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	H	487;554;553;554;513	ENSP00000445176:P487H;ENSP00000364550:P554H;ENSP00000385394:P553H;ENSP00000364528:P554H;ENSP00000364532:P513H	ENSP00000364528:P554H	P	-	2	0	KDM5C	53256406	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.869000	0.99810	2.344000	0.79699	0.600000	0.82982	CCT		0.532	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
RIBC1	158787	hgsc.bcm.edu	37	X	53457377	53457377	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:53457377C>T	ENST00000375327.3	+	7	850	c.697C>T	c.(697-699)Cgt>Tgt	p.R233C	HSD17B10_ENST00000495986.1_5'Flank|RIBC1_ENST00000414955.2_Missense_Mutation_p.R118C|RP3-339A18.6_ENST00000418049.1_RNA	NM_001031745.2	NP_001026915.1	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1	233								p.R233C(1)		lung(2)	2						GCGCTGTGAGCGTCAGCGTGA	0.612																																					p.R233C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C697T	X						.						37.0	27.0	31.0					X																	53457377		2202	4298	6500	53474102	SO:0001583	missense	158787	exon7			AK057345	CCDS14353.1, CCDS35299.1, CCDS59168.1	Xp11.23	2006-04-12			ENSG00000158423	ENSG00000158423			26537	protein-coding gene	gene with protein product							Standard	NM_144968		Approved	FLJ32783	uc004dsk.4	Q8N443	OTTHUMG00000021615	ENST00000375327.3:c.697C>T	X.37:g.53457377C>T	ENSP00000364476:p.Arg233Cys		53474102	NM_001031745	B4E297|E9PDU2|Q5H931|Q96A80	Missense_Mutation	SNP	ENST00000375327.3	37	CCDS35299.1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.894020	0.33442	.	.	ENSG00000158423	ENST00000414955;ENST00000375327	T;T	0.25085	1.82;1.82	5.79	4.04	0.47022	.	0.825122	0.11339	N	0.574213	T	0.37320	0.0999	L	0.47190	1.495	0.09310	N	0.999994	D;D	0.76494	0.999;0.999	P;P	0.57679	0.825;0.825	T	0.14227	-1.0480	10	0.62326	D	0.03	-1.6361	9.204	0.37278	0.0:0.8255:0.0:0.1745	.	118;233	E9PDU2;Q8N443	.;RIBC1_HUMAN	C	118;233	ENSP00000401463:R118C;ENSP00000364476:R233C	ENSP00000364476:R233C	R	+	1	0	RIBC1	53474102	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.708000	0.25719	0.614000	0.30107	0.529000	0.55759	CGT		0.612	RIBC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056762.1	NM_144968	
TRO	7216	hgsc.bcm.edu	37	X	54952914	54952914	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:54952914C>G	ENST00000173898.7	+	8	1761	c.1649C>G	c.(1648-1650)gCc>gGc	p.A550G	TRO_ENST00000420798.2_Missense_Mutation_p.A81G|TRO_ENST00000375022.4_Missense_Mutation_p.A550G|TRO_ENST00000375041.2_Missense_Mutation_p.A153G|TRO_ENST00000319167.8_Missense_Mutation_p.A550G|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000399736.1_Missense_Mutation_p.A153G	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	550	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A550G(2)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GGCAACAAGGCCAGTGAGGGT	0.517																																					p.A550G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1649G	X						.						107.0	108.0	108.0					X																	54952914		2203	4300	6503	54969639	SO:0001583	missense	7216	exon8			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1649C>G	X.37:g.54952914C>G	ENSP00000173898:p.Ala550Gly		54969639	NM_016157	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150256	0.37923	.	.	ENSG00000067445	ENST00000173898;ENST00000319167;ENST00000375022;ENST00000399736;ENST00000319179;ENST00000420798;ENST00000375041	T;T;T;T;T;T	0.06142	3.34;3.34;3.34;3.34;3.34;3.34	2.78	2.78	0.32641	.	.	.	.	.	T	0.23926	0.0579	M	0.92169	3.28	0.33586	D	0.600514	D;D;D;D	0.63880	0.979;0.993;0.986;0.979	P;P;P;P	0.60609	0.645;0.842;0.877;0.645	T	0.36383	-0.9750	9	0.87932	D	0	.	5.0129	0.14321	0.0:0.8315:0.0:0.1685	.	153;153;550;550	B1AKE9;B1AKF1;Q96SX2;Q12816	.;.;.;TROP_HUMAN	G	550;550;550;153;153;81;153	ENSP00000173898:A550G;ENSP00000318278:A550G;ENSP00000364162:A550G;ENSP00000382641:A153G;ENSP00000405126:A81G;ENSP00000364181:A153G	ENSP00000173898:A550G	A	+	2	0	TRO	54969639	0.321000	0.24625	0.876000	0.34364	0.456000	0.32438	0.608000	0.24223	1.666000	0.50821	0.436000	0.28706	GCC		0.517	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157	
APEX2	27301	hgsc.bcm.edu	37	X	55033732	55033732	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:55033732A>G	ENST00000374987.3	+	6	1487	c.1421A>G	c.(1420-1422)gAg>gGg	p.E474G	ALAS2_ENST00000498636.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	474					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)	p.E474G(1)		breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						GGCCACAGGGAGCCATGTGTG	0.612								Other BER factors																													p.E474G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1421G	X						.						29.0	24.0	26.0					X																	55033732		2203	4299	6502	55050457	SO:0001583	missense	27301	exon6			AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.1421A>G	X.37:g.55033732A>G	ENSP00000364126:p.Glu474Gly		55050457	NM_014481	Q9Y5X7	Missense_Mutation	SNP	ENST00000374987.3	37	CCDS14365.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.511992	0.85389	.	.	ENSG00000169188	ENST00000374987	T	0.21191	2.02	4.87	4.87	0.63330	Zinc finger, GRF-type (1);	0.000000	0.85682	D	0.000000	T	0.53850	0.1822	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64943	-0.6288	10	0.87932	D	0	-27.0453	13.0094	0.58724	1.0:0.0:0.0:0.0	.	474	Q9UBZ4	APEX2_HUMAN	G	474	ENSP00000364126:E474G	ENSP00000364126:E474G	E	+	2	0	APEX2	55050457	1.000000	0.71417	0.983000	0.44433	0.983000	0.72400	7.866000	0.87056	1.875000	0.54330	0.417000	0.27973	GAG		0.612	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056845.1		
LAS1L	81887	hgsc.bcm.edu	37	X	64732728	64732728	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:64732728C>T	ENST00000374811.3	-	14	2172	c.2132G>A	c.(2131-2133)aGc>aAc	p.S711N	LAS1L_ENST00000374804.5_Missense_Mutation_p.S652N|LAS1L_ENST00000374807.5_Missense_Mutation_p.S694N|LAS1L_ENST00000312391.8_3'UTR	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	711					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S711N(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						GAAGTtgctgctgctgctgtt	0.602																																					p.S711N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2132A	X						.						28.0	21.0	24.0					X																	64732728		2032	3968	6000	64649453	SO:0001583	missense	81887	exon14			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.2132G>A	X.37:g.64732728C>T	ENSP00000363944:p.Ser711Asn		64649453	NM_031206	A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Missense_Mutation	SNP	ENST00000374811.3	37	CCDS14381.1	.	.	.	.	.	.	.	.	.	.	C	9.606	1.129936	0.21041	.	.	ENSG00000001497	ENST00000374807;ENST00000374811;ENST00000374804	.	.	.	4.6	1.71	0.24356	.	0.596624	0.16042	N	0.232375	T	0.22475	0.0542	N	0.21448	0.665	0.09310	N	1	B;D;B	0.57899	0.004;0.981;0.002	B;P;B	0.47470	0.01;0.548;0.001	T	0.09707	-1.0662	9	0.72032	D	0.01	.	5.3955	0.16266	0.3251:0.5709:0.0:0.104	.	652;694;711	Q9Y4W2-3;Q9Y4W2-2;Q9Y4W2	.;.;LAS1L_HUMAN	N	694;711;652	.	ENSP00000363937:S652N	S	-	2	0	LAS1L	64649453	0.504000	0.26123	0.010000	0.14722	0.995000	0.86356	0.417000	0.21214	0.089000	0.17243	0.483000	0.47432	AGC		0.602	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206	
GDPD2	54857	hgsc.bcm.edu	37	X	69647188	69647188	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:69647188C>T	ENST00000374382.3	+	10	1062	c.811C>T	c.(811-813)Cat>Tat	p.H271Y	GDPD2_ENST00000538649.1_Missense_Mutation_p.H192Y|GDPD2_ENST00000472623.1_3'UTR|GDPD2_ENST00000536730.1_Missense_Mutation_p.H192Y|GDPD2_ENST00000453994.2_Missense_Mutation_p.H271Y	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	271	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)	p.H271Y(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					CTTCCTCATGCATGATGAGCA	0.577																																					p.H192Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C574T	X						.						86.0	62.0	70.0					X																	69647188		2203	4300	6503	69563913	SO:0001583	missense	54857	exon9			AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.811C>T	X.37:g.69647188C>T	ENSP00000363503:p.His271Tyr		69563913	NM_001171193	B4DRH4|B4DVC9|Q9NXJ6	Missense_Mutation	SNP	ENST00000374382.3	37	CCDS14402.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.246884	0.80024	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.26	5.26	0.73747	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.000000	0.85682	D	0.000000	D	0.87787	0.6265	H	0.98721	4.31	0.48288	D	0.99962	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	D	0.92699	0.6173	9	.	.	.	-11.9353	16.3252	0.82977	0.0:1.0:0.0:0.0	.	271;57;271	B4DVC9;B3KUI6;Q9HCC8	.;.;GDPD2_HUMAN	Y	271;192;192;271	ENSP00000414019:H271Y;ENSP00000445982:H192Y;ENSP00000444601:H192Y;ENSP00000363503:H271Y	.	H	+	1	0	GDPD2	69563913	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	6.960000	0.76036	2.422000	0.82143	0.544000	0.68410	CAT		0.577	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057070.1	NM_017711	
ERCC6L	54821	hgsc.bcm.edu	37	X	71427424	71427424	+	Missense_Mutation	SNP	C	C	T	rs139313430	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:71427424C>T	ENST00000334463.3	-	2	1328	c.1193G>A	c.(1192-1194)cGc>cAc	p.R398H	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Missense_Mutation_p.R275H	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	398					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R398H(1)		breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					CAAAGGTGAGCGCGTCTCCAT	0.408																																					p.R398H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1193A	X						.	C	,HIS/ARG	0,3835		0,0,0,1632,571	89.0	82.0	84.0		,1193	5.8	1.0	X	dbSNP_134	84	4,6724		0,3,1,2425,1871	yes	intron,missense	PIN4,ERCC6L	NM_001170747.1,NM_017669.2	,29	0,3,1,4057,2442	TT,TC,T,CC,C		0.0595,0.0,0.0379	,probably-damaging	,398/1251	71427424	4,10559	2203	4300	6503	71344149	SO:0001583	missense	54821	exon2			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.1193G>A	X.37:g.71427424C>T	ENSP00000334675:p.Arg398His		71344149	NM_017669	Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	ENST00000334463.3	37	CCDS35329.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692247	0.48202	0.0	5.95E-4	ENSG00000186871	ENST00000373657;ENST00000334463	D;D	0.93019	-3.15;-3.15	5.82	5.82	0.92795	.	.	.	.	.	D	0.92244	0.7540	M	0.69185	2.1	0.58432	D	0.999996	P	0.38767	0.646	B	0.36244	0.22	D	0.92818	0.6270	9	0.72032	D	0.01	-0.2798	16.3174	0.82932	0.0:1.0:0.0:0.0	.	398	Q2NKX8	ERC6L_HUMAN	H	275;398	ENSP00000362761:R275H;ENSP00000334675:R398H	ENSP00000334675:R398H	R	-	2	0	ERCC6L	71344149	0.998000	0.40836	0.996000	0.52242	0.956000	0.61745	3.726000	0.54977	2.458000	0.83093	0.600000	0.82982	CGC		0.408	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669	
RLIM	51132	hgsc.bcm.edu	37	X	73811702	73811702	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:73811702C>T	ENST00000332687.6	-	4	1666	c.1448G>A	c.(1447-1449)gGt>gAt	p.G483D	RLIM_ENST00000349225.2_Missense_Mutation_p.G483D	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	483	Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGAACTTTCACCAccggaact	0.498																																					p.G483D	Esophageal Squamous(169;1899 1923 14997 18818 32118)											.	.	0			c.G1448A	X						.						36.0	32.0	33.0					X																	73811702		2203	4300	6503	73728427	SO:0001583	missense	51132	exon5			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1448G>A	X.37:g.73811702C>T	ENSP00000328059:p.Gly483Asp		73728427	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	C	0.266	-0.996034	0.02145	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	D;D	0.92446	-3.04;-3.04	5.29	4.34	0.51931	.	0.461241	0.25427	N	0.030747	T	0.78710	0.4326	N	0.12887	0.27	0.27827	N	0.941589	P	0.36616	0.561	B	0.34242	0.178	T	0.70059	-0.4976	10	0.09338	T	0.73	-1.8673	5.002	0.14269	0.3444:0.5146:0.0:0.1411	.	483	Q9NVW2	RNF12_HUMAN	D	483	ENSP00000328059:G483D;ENSP00000253571:G483D	ENSP00000328059:G483D	G	-	2	0	RLIM	73728427	0.512000	0.26186	1.000000	0.80357	0.954000	0.61252	0.569000	0.23638	2.218000	0.71995	0.600000	0.82982	GGT		0.498	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RLIM	51132	hgsc.bcm.edu	37	X	73811705	73811705	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:73811705C>T	ENST00000332687.6	-	4	1663	c.1445G>A	c.(1444-1446)gGt>gAt	p.G482D	RLIM_ENST00000349225.2_Missense_Mutation_p.G482D	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	482	Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ACTTTCACCAccggaactgga	0.488																																					p.G482D	Esophageal Squamous(169;1899 1923 14997 18818 32118)											.	.	0			c.G1445A	X						.						36.0	32.0	34.0					X																	73811705		2203	4300	6503	73728430	SO:0001583	missense	51132	exon5			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1445G>A	X.37:g.73811705C>T	ENSP00000328059:p.Gly482Asp		73728430	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	C	6.732	0.503784	0.12822	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	D;D	0.92446	-3.04;-3.04	5.29	2.5	0.30297	.	0.515148	0.23367	N	0.048958	T	0.78117	0.4233	N	0.08118	0	0.23120	N	0.998263	B	0.06786	0.001	B	0.10450	0.005	T	0.62728	-0.6793	10	0.23891	T	0.37	-6.1864	2.1751	0.03860	0.1361:0.5079:0.1296:0.2264	.	482	Q9NVW2	RNF12_HUMAN	D	482	ENSP00000328059:G482D;ENSP00000253571:G482D	ENSP00000328059:G482D	G	-	2	0	RLIM	73728430	0.002000	0.14202	0.978000	0.43139	0.928000	0.56348	-0.022000	0.12480	0.097000	0.17492	-0.229000	0.12294	GGT		0.488	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
TAF9B	51616	hgsc.bcm.edu	37	X	77387156	77387156	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:77387156T>G	ENST00000341864.5	-	7	801	c.707A>C	c.(706-708)aAc>aCc	p.N236T		NM_015975.4	NP_057059.2	Q9HBM6	TAF9B_HUMAN	TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa	236					DNA-templated transcription, initiation (GO:0006352)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell growth (GO:0030307)|programmed cell death (GO:0012501)|protein stabilization (GO:0050821)|response to organic cyclic compound (GO:0014070)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	transcription corepressor activity (GO:0003714)	p.N236T(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	14						CTTCAGTGGGTTTGCTTCATT	0.363																																					p.N236T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A707C	X						.						247.0	208.0	221.0					X																	77387156		2203	4296	6499	77273812	SO:0001583	missense	51616	exon7			AF220509	CCDS35340.1	Xq13.1-q21.1	2010-08-16	2006-01-04	2006-01-04	ENSG00000187325	ENSG00000187325			17306	protein-coding gene	gene with protein product		300754	"""TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa"""	TAF9L		15899866	Standard	XM_005262142		Approved	TAFII31L, DN-7, DN7, TFIID-31	uc004eda.3	Q9HBM6	OTTHUMG00000021887	ENST00000341864.5:c.707A>C	X.37:g.77387156T>G	ENSP00000339917:p.Asn236Thr		77273812	NM_015975	B2RUZ9|Q9Y2S3	Missense_Mutation	SNP	ENST00000341864.5	37	CCDS35340.1	.	.	.	.	.	.	.	.	.	.	T	7.426	0.637734	0.14386	.	.	ENSG00000187325	ENST00000341864	T	0.15017	2.46	4.03	4.03	0.46877	.	0.069287	0.56097	D	0.000039	T	0.13329	0.0323	L	0.35854	1.095	0.32258	N	0.570579	B	0.10296	0.003	B	0.04013	0.001	T	0.06643	-1.0815	10	0.33940	T	0.23	-5.9449	10.0424	0.42166	0.0:0.0:0.0:1.0	.	236	Q9HBM6	TAF9B_HUMAN	T	236	ENSP00000339917:N236T	ENSP00000339917:N236T	N	-	2	0	TAF9B	77273812	1.000000	0.71417	0.998000	0.56505	0.128000	0.20619	3.139000	0.50577	1.486000	0.48398	0.345000	0.21793	AAC		0.363	TAF9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057308.1	NM_015975	
TAF9B	51616	hgsc.bcm.edu	37	X	77394407	77394407	+	Silent	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:77394407G>T	ENST00000341864.5	-	2	160	c.66C>A	c.(64-66)atC>atA	p.I22I		NM_015975.4	NP_057059.2	Q9HBM6	TAF9B_HUMAN	TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa	22					DNA-templated transcription, initiation (GO:0006352)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell growth (GO:0030307)|programmed cell death (GO:0012501)|protein stabilization (GO:0050821)|response to organic cyclic compound (GO:0014070)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	transcription corepressor activity (GO:0003714)	p.I22I(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	14						TATCCTTCAGGATCTGTGCCA	0.368																																					p.I22I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C66A	X						.						117.0	108.0	111.0					X																	77394407		2203	4296	6499	77281063	SO:0001819	synonymous_variant	51616	exon2			AF220509	CCDS35340.1	Xq13.1-q21.1	2010-08-16	2006-01-04	2006-01-04	ENSG00000187325	ENSG00000187325			17306	protein-coding gene	gene with protein product		300754	"""TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa"""	TAF9L		15899866	Standard	XM_005262142		Approved	TAFII31L, DN-7, DN7, TFIID-31	uc004eda.3	Q9HBM6	OTTHUMG00000021887	ENST00000341864.5:c.66C>A	X.37:g.77394407G>T			77281063	NM_015975	B2RUZ9|Q9Y2S3	Silent	SNP	ENST00000341864.5	37	CCDS35340.1																																																																																				0.368	TAF9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057308.1	NM_015975	
CPXCR1	53336	hgsc.bcm.edu	37	X	88008450	88008450	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:88008450C>T	ENST00000276127.4	+	3	294	c.35C>T	c.(34-36)gCt>gTt	p.A12V	CPXCR1_ENST00000373111.1_Missense_Mutation_p.A12V	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	12							metal ion binding (GO:0046872)	p.A12V(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						AGTGATACAGCTGGAAATGCT	0.353																																					p.A12V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C35T	X						.						27.0	24.0	25.0					X																	88008450		2202	4297	6499	87895106	SO:0001583	missense	53336	exon3			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.35C>T	X.37:g.88008450C>T	ENSP00000276127:p.Ala12Val		87895106	NM_001184771	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	C	9.161	1.018624	0.19355	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.29397	1.57;1.57	3.28	-0.711	0.11230	.	0.972892	0.08355	N	0.958693	T	0.15565	0.0375	N	0.24115	0.695	0.09310	N	1	B	0.16396	0.017	B	0.18561	0.022	T	0.31110	-0.9955	9	.	.	.	.	0.5159	0.00603	0.1986:0.358:0.1916:0.2518	.	12	Q8N123	CPXCR_HUMAN	V	12	ENSP00000276127:A12V;ENSP00000362203:A12V	.	A	+	2	0	CPXCR1	87895106	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.152000	0.16302	-0.303000	0.08856	-1.057000	0.02308	GCT		0.353	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048	
PNMA5	114824	hgsc.bcm.edu	37	X	152159576	152159576	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chrX:152159576C>T	ENST00000439251.1	-	2	1005	c.567G>A	c.(565-567)tgG>tgA	p.W189*	PNMA5_ENST00000452693.1_Nonsense_Mutation_p.W189*|PNMA5_ENST00000361887.5_Nonsense_Mutation_p.W189*|PNMA5_ENST00000535214.1_Nonsense_Mutation_p.W189*	NM_001103150.1	NP_001096620.1	Q96PV4	PNMA5_HUMAN	paraneoplastic Ma antigen family member 5	189					positive regulation of apoptotic process (GO:0043065)			p.W189*(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					CAGACACTTGCCATATGGGCA	0.532																																					p.W189X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G567A	X						.						84.0	72.0	76.0					X																	152159576		2203	4300	6503	151910232	SO:0001587	stop_gained	114824	exon2			AB067521	CCDS14718.1	Xq28	2012-02-09	2012-02-09		ENSG00000198883	ENSG00000198883		"""Paraneoplastic Ma antigens"""	18743	protein-coding gene	gene with protein product	"""paraneoplastic antigen family 5"""	300916	"""paraneoplastic antigen like 5"""			16214224	Standard	NM_052926		Approved	KIAA1934	uc004fgy.4	Q96PV4	OTTHUMG00000024184	ENST00000439251.1:c.567G>A	X.37:g.152159576C>T	ENSP00000388850:p.Trp189*		151910232	NM_001103150	B4DI72|B7Z9Y9|Q495L5|Q8NET3	Nonsense_Mutation	SNP	ENST00000439251.1	37	CCDS14718.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.791495	0.90367	.	.	ENSG00000198883	ENST00000361887;ENST00000535214;ENST00000439251;ENST00000452693	.	.	.	3.05	3.05	0.35203	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.8548	0.35221	0.0:1.0:0.0:0.0	.	.	.	.	X	189	.	ENSP00000354834:W189X	W	-	3	0	PNMA5	151910232	0.593000	0.26840	0.447000	0.26932	0.126000	0.20510	1.206000	0.32321	1.821000	0.53095	0.468000	0.43344	TGG		0.532	PNMA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060925.1	NM_052926	
SLC9A4	389015	hgsc.bcm.edu	37	2	103095697	103095697	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:103095697G>A	ENST00000295269.4	+	2	1113	c.656G>A	c.(655-657)cGc>cAc	p.R219H		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	219					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.R219H(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GAGGAAGCGCGCGTGAACGAG	0.612																																					p.R219H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G656A	2						.						50.0	39.0	43.0					2																	103095697		2203	4300	6503	102462129	SO:0001583	missense	389015	exon2				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.656G>A	2.37:g.103095697G>A	ENSP00000295269:p.Arg219His		102462129	NM_001011552	Q69YK0	Missense_Mutation	SNP	ENST00000295269.4	37	CCDS33264.1	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.882992	0.00532	.	.	ENSG00000180251	ENST00000295269	T	0.16897	2.31	5.26	3.44	0.39384	Cation/H+ exchanger (1);	0.614501	0.17290	N	0.179675	T	0.03011	0.0089	N	0.00230	-1.795	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.40059	-0.9583	10	0.02654	T	1	.	7.3378	0.26619	0.1659:0.2405:0.5936:0.0	.	219	Q6AI14	SL9A4_HUMAN	H	219	ENSP00000295269:R219H	ENSP00000295269:R219H	R	+	2	0	SLC9A4	102462129	0.000000	0.05858	0.010000	0.14722	0.152000	0.21847	0.475000	0.22164	1.204000	0.43247	0.655000	0.94253	CGC		0.612	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1	NM_001011552.3	
LPIN1	23175	hgsc.bcm.edu	37	2	11959687	11959687	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:11959687C>T	ENST00000256720.2	+	18	2465	c.2372C>T	c.(2371-2373)aCa>aTa	p.T791I	LPIN1_ENST00000396099.1_Missense_Mutation_p.T833I|LPIN1_ENST00000396097.1_Missense_Mutation_p.T521I|LPIN1_ENST00000404113.2_Missense_Mutation_p.T292I|LPIN1_ENST00000449576.2_Missense_Mutation_p.T876I|LPIN1_ENST00000425416.2_Missense_Mutation_p.T797I	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	791	C-LIP.				cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)	p.T791I(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		TTCCCCAACACAGAACCCTTT	0.383																																					p.T791I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2372T	2						.						170.0	174.0	173.0					2																	11959687		2203	4300	6503	11877138	SO:0001583	missense	23175	exon18			D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.2372C>T	2.37:g.11959687C>T	ENSP00000256720:p.Thr791Ile		11877138	NM_145693	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	37	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.026731	0.35797	.	.	ENSG00000134324	ENST00000449576;ENST00000396099;ENST00000425416;ENST00000256720;ENST00000396097;ENST00000404113	T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08;-1.08	5.32	3.5	0.40072	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.696409	0.14520	N	0.314556	T	0.72518	0.3470	L	0.48642	1.525	0.22796	N	0.998727	B;B;B	0.30763	0.075;0.294;0.046	B;B;B	0.39419	0.281;0.299;0.148	T	0.62969	-0.6741	10	0.38643	T	0.18	-9.4797	6.4125	0.21698	0.148:0.7013:0.0:0.1507	.	292;876;791	B4DET9;F5GY24;Q14693	.;.;LPIN1_HUMAN	I	876;833;797;791;521;292	ENSP00000397908:T876I;ENSP00000379406:T833I;ENSP00000401522:T797I;ENSP00000256720:T791I;ENSP00000379404:T521I;ENSP00000386120:T292I	ENSP00000256720:T791I	T	+	2	0	LPIN1	11877138	0.007000	0.16637	0.021000	0.16686	0.890000	0.51754	0.441000	0.21611	1.385000	0.46445	0.655000	0.94253	ACA		0.383	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
NCK2	8440	hgsc.bcm.edu	37	2	106471730	106471730	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:106471730C>T	ENST00000233154.4	+	3	653	c.211C>T	c.(211-213)Ctg>Ttg	p.L71L	AC009505.2_ENST00000427050.2_RNA|NCK2_ENST00000393349.2_Silent_p.L71L|NCK2_ENST00000451463.2_Silent_p.L71L|AC009505.2_ENST00000598281.1_RNA|NCK2_ENST00000522586.1_Silent_p.L71L|AC009505.2_ENST00000596418.1_RNA	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	71					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)	p.L71L(1)		endometrium(1)|lung(3)|ovary(1)	5						CGTGAAGAACCTGAAGGACAC	0.527																																					p.L71L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C211T	2						.						70.0	54.0	59.0					2																	106471730		2203	4300	6503	105838162	SO:0001819	synonymous_variant	8440	exon2			AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.211C>T	2.37:g.106471730C>T			105838162	NM_001004720	D3DVK1|Q9BWN9|Q9UIC3	Silent	SNP	ENST00000233154.4	37	CCDS33266.1																																																																																				0.527	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329634.1	NM_003581	
MGAT5	4249	hgsc.bcm.edu	37	2	135102527	135102527	+	Missense_Mutation	SNP	G	G	A	rs145359732		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:135102527G>A	ENST00000409645.1	+	9	1256	c.1004G>A	c.(1003-1005)cGa>cAa	p.R335Q	MGAT5_ENST00000281923.2_Missense_Mutation_p.R335Q			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	335					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)	p.R335Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		GTAGGAAACCGATCTGGCTGC	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		13080	0.0		0.001	False		,,,				2504	0.0				p.R335Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1004A	2						.						135.0	132.0	133.0					2																	135102527		2203	4300	6503	134818997	SO:0001583	missense	4249	exon8			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.1004G>A	2.37:g.135102527G>A	ENSP00000386377:p.Arg335Gln		134818997	NM_002410	D3DP70	Missense_Mutation	SNP	ENST00000409645.1	37	CCDS2171.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	18.98	3.738422	0.69304	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.38	5.38	0.77491	.	0.050399	0.85682	D	0.000000	T	0.52901	0.1763	M	0.68317	2.08	0.49687	D	0.999814	P	0.46327	0.876	B	0.28709	0.093	T	0.65446	-0.6166	9	0.66056	D	0.02	-8.4478	19.4972	0.95079	0.0:0.0:1.0:0.0	.	335	Q09328	MGT5A_HUMAN	Q	335	.	ENSP00000281923:R335Q	R	+	2	0	MGAT5	134818997	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.576000	0.82467	2.668000	0.90789	0.563000	0.77884	CGA		0.388	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410	
LRP1B	53353	hgsc.bcm.edu	37	2	141214059	141214059	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:141214059T>C	ENST00000389484.3	-	62	10899	c.9928A>G	c.(9928-9930)Aat>Gat	p.N3310D		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3310	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.N3310D(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAAGTCCTATTATCAGCTGCC	0.443										TSP Lung(27;0.18)																											p.N3310D	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A9928G	2						.						109.0	102.0	104.0					2																	141214059		2203	4300	6503	140930529	SO:0001583	missense	53353	exon62			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.9928A>G	2.37:g.141214059T>C	ENSP00000374135:p.Asn3310Asp		140930529	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	15.37	2.812617	0.50527	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.96716	-4.1	5.31	4.08	0.47627	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.000000	0.85682	U	0.000000	D	0.92835	0.7721	L	0.61036	1.89	0.38443	D	0.946754	P	0.38922	0.651	B	0.30401	0.115	D	0.91810	0.5459	10	0.16420	T	0.52	.	11.9	0.52678	0.0:0.0:0.1456:0.8544	.	3310	Q9NZR2	LRP1B_HUMAN	D	3310;3248	ENSP00000374135:N3310D	ENSP00000374135:N3310D	N	-	1	0	LRP1B	140930529	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	3.396000	0.52565	1.992000	0.58205	0.528000	0.53228	AAT		0.443	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRP1B	53353	hgsc.bcm.edu	37	2	141299385	141299385	+	Silent	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:141299385T>G	ENST00000389484.3	-	44	8321	c.7350A>C	c.(7348-7350)ccA>ccC	p.P2450P		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2450					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.P2450P(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGATTCCCATTGGCTGATGTG	0.378										TSP Lung(27;0.18)																											p.P2450P	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A7350C	2						.						165.0	154.0	158.0					2																	141299385		2203	4299	6502	141015855	SO:0001819	synonymous_variant	53353	exon44			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7350A>C	2.37:g.141299385T>G			141015855	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																				0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ACVR2A	92	hgsc.bcm.edu	37	2	148683614	148683614	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:148683614T>G	ENST00000241416.7	+	10	1867	c.1231T>G	c.(1231-1233)Tac>Gac	p.Y411D	ACVR2A_ENST00000495775.1_3'UTR|ACVR2A_ENST00000404590.1_Missense_Mutation_p.Y411D|ACVR2A_ENST00000535787.1_Missense_Mutation_p.Y303D	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	411	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.Y411D(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TGTAGATGAATACATGTTGCC	0.338																																					p.Y411D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1231G	2						.						193.0	166.0	175.0					2																	148683614		2203	4299	6502	148400084	SO:0001583	missense	92	exon10				CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1231T>G	2.37:g.148683614T>G	ENSP00000241416:p.Tyr411Asp		148400084	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	37	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.380389	0.82682	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	D;D;D	0.93307	-3.2;-3.2;-3.2	5.2	5.2	0.72013	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96448	0.8841	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97014	0.9738	10	0.87932	D	0	.	15.228	0.73364	0.0:0.0:0.0:1.0	.	411	P27037	AVR2A_HUMAN	D	411;303;411	ENSP00000241416:Y411D;ENSP00000439988:Y303D;ENSP00000384338:Y411D	ENSP00000241416:Y411D	Y	+	1	0	ACVR2A	148400084	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.868000	0.87116	2.196000	0.70406	0.482000	0.46254	TAC		0.338	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
RIF1	55183	hgsc.bcm.edu	37	2	152326358	152326358	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:152326358A>G	ENST00000243326.5	+	33	7558	c.7075A>G	c.(7075-7077)Aga>Gga	p.R2359G	RIF1_ENST00000428287.2_Missense_Mutation_p.R2333G|RIF1_ENST00000430328.2_Missense_Mutation_p.R2333G|RIF1_ENST00000444746.2_Missense_Mutation_p.R2359G|RIF1_ENST00000453091.2_Missense_Mutation_p.R2333G			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.R2359G(1)		NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		AAAGGCTCTCAGAATATATCA	0.313																																					p.R2333G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6997G	2						.						63.0	67.0	66.0					2																	152326358		2203	4300	6503	152034604	SO:0001583	missense	55183	exon33			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.7075A>G	2.37:g.152326358A>G	ENSP00000243326:p.Arg2359Gly		152034604	NM_001177664	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.363298	0.82353	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.12039	2.73;2.72;2.72;2.73;2.72	4.91	4.91	0.64330	.	0.180308	0.64402	D	0.000014	T	0.25901	0.0631	L	0.56769	1.78	0.80722	D	1	D;D	0.60575	0.979;0.988	P;P	0.53062	0.525;0.717	T	0.01401	-1.1364	10	0.87932	D	0	-22.6478	14.643	0.68739	1.0:0.0:0.0:0.0	.	2359;2333	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	G	2359;2333;2333;2359;2333	ENSP00000390181:R2359G;ENSP00000414615:R2333G;ENSP00000415691:R2333G;ENSP00000243326:R2359G;ENSP00000416123:R2333G	ENSP00000243326:R2359G	R	+	1	2	RIF1	152034604	1.000000	0.71417	0.997000	0.53966	0.955000	0.61496	3.672000	0.54583	2.185000	0.69588	0.454000	0.30748	AGA		0.313	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		
UPP2	151531	hgsc.bcm.edu	37	2	158978099	158978099	+	Silent	SNP	A	A	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:158978099A>T	ENST00000005756.4	+	5	827	c.633A>T	c.(631-633)ggA>ggT	p.G211G	UPP2_ENST00000460456.1_Intron|UPP2_ENST00000605860.1_Silent_p.G268G|UPP2_ENST00000409859.4_Silent_p.G268G	NM_173355.3	NP_775491.1	O95045	UPP2_HUMAN	uridine phosphorylase 2	211					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)|type III intermediate filament (GO:0045098)	uridine phosphorylase activity (GO:0004850)	p.G211G(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31					Fluorouracil(DB00544)	CCCTCGTTGGACATACAATGT	0.388																																					p.G268G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A804T	2						.						120.0	117.0	118.0					2																	158978099		2203	4299	6502	158686345	SO:0001819	synonymous_variant	151531	exon7			AY225131	CCDS2207.1, CCDS46435.1	2q24.2	2008-02-05			ENSG00000007001	ENSG00000007001			23061	protein-coding gene	gene with protein product						12849978	Standard	NM_173355		Approved	UPASE2, UP2, UDRPASE2	uc002tzo.3	O95045	OTTHUMG00000131969	ENST00000005756.4:c.633A>T	2.37:g.158978099A>T			158686345	NM_001135098	B3KV87	Silent	SNP	ENST00000005756.4	37	CCDS2207.1																																																																																				0.388	UPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254929.2	NM_173355	
IFIH1	64135	hgsc.bcm.edu	37	2	163134104	163134104	+	Missense_Mutation	SNP	G	G	A	rs186942719		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:163134104G>A	ENST00000263642.2	-	10	2260	c.1865C>T	c.(1864-1866)gCg>gTg	p.A622V		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	622					cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)	p.A622V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						ATGAGTATACGCATCTATCAT	0.368																																					p.A622V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1865T	2						.						136.0	123.0	128.0					2																	163134104		2203	4299	6502	162842350	SO:0001583	missense	64135	exon10			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.1865C>T	2.37:g.163134104G>A	ENSP00000263642:p.Ala622Val		162842350	NM_022168	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	ENST00000263642.2	37	CCDS2217.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	29.0	4.967767	0.92855	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.09538	2.97	5.66	5.66	0.87406	.	0.048833	0.85682	D	0.000000	T	0.43567	0.1253	M	0.90082	3.085	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.51379	-0.8713	10	0.87932	D	0	-19.8249	19.7554	0.96287	0.0:0.0:1.0:0.0	.	622	Q9BYX4	IFIH1_HUMAN	V	622	ENSP00000263642:A622V	ENSP00000263642:A622V	A	-	2	0	IFIH1	162842350	1.000000	0.71417	0.960000	0.40013	0.615000	0.37417	9.589000	0.98235	2.665000	0.90641	0.563000	0.77884	GCG		0.368	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168	
TTC21B	79809	hgsc.bcm.edu	37	2	166786757	166786757	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:166786757C>A	ENST00000243344.7	-	9	1149	c.1012G>T	c.(1012-1014)Gga>Tga	p.G338*		NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	338					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)		p.G338*(1)		breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						TTAACTCTTCCTTGTAAAATC	0.363																																					p.G338X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1012T	2						.						127.0	128.0	128.0					2																	166786757		2203	4300	6503	166495003	SO:0001587	stop_gained	79809	exon9			AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.1012G>T	2.37:g.166786757C>A	ENSP00000243344:p.Gly338*		166495003	NM_024753	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Nonsense_Mutation	SNP	ENST00000243344.7	37	CCDS33315.1	.	.	.	.	.	.	.	.	.	.	C	37	6.114406	0.97296	.	.	ENSG00000123607	ENST00000243344	.	.	.	5.06	5.06	0.68205	.	0.050859	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-10.7791	18.7961	0.91994	0.0:1.0:0.0:0.0	.	.	.	.	X	338	.	ENSP00000243344:G338X	G	-	1	0	TTC21B	166495003	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	5.834000	0.69361	2.510000	0.84645	0.650000	0.86243	GGA		0.363	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753	
NT5C1B	93034	hgsc.bcm.edu	37	2	18745273	18745273	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:18745273G>A	ENST00000359846.2	-	10	1699	c.1622C>T	c.(1621-1623)gCa>gTa	p.A541V	NT5C1B_ENST00000600945.1_Missense_Mutation_p.A541V|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.A541V|NT5C1B_ENST00000304081.4_Missense_Mutation_p.A481V	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	541					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.A541V(1)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TGAACTGGCTGCACTCCTAGC	0.507																																					p.A481V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1442T	2						.						81.0	82.0	81.0					2																	18745273		2203	4300	6503	18608754	SO:0001583	missense	93034	exon9			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.1622C>T	2.37:g.18745273G>A	ENSP00000352904:p.Ala541Val		18608754	NM_033253	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	ENST00000359846.2	37	CCDS33150.1	.	.	.	.	.	.	.	.	.	.	G	36	5.785422	0.96937	.	.	ENSG00000250741;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000304081;ENST00000359846	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.86049	0.5840	M	0.89030	3	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.997;0.997;0.997;0.983;0.994;0.997;0.999	D	0.86862	0.2030	9	0.87932	D	0	-21.2316	20.8598	0.99761	0.0:0.0:1.0:0.0	.	524;558;481;524;481;541;541	E7EXB7;B4DZ86;B4DXQ9;B4DXZ9;Q96P26-2;Q96P26;Q96P26-4	.;.;.;.;.;5NT1B_HUMAN;.	V	541;481;541	.	ENSP00000305979:A481V	A	-	2	0	NT5C1B-RDH14;NT5C1B	18608754	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	2.937000	0.99478	0.650000	0.86243	GCA		0.507	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
TTN	7273	hgsc.bcm.edu	37	2	179666929	179666929	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:179666929T>C	ENST00000591111.1	-	3	455	c.231A>G	c.(229-231)cgA>cgG	p.R77R	TTN_ENST00000360870.5_Silent_p.R77R|TTN_ENST00000589042.1_Silent_p.R77R|TTN_ENST00000342992.6_Silent_p.R77R|TTN_ENST00000342175.6_Silent_p.R77R|TTN_ENST00000359218.5_Silent_p.R77R|TTN_ENST00000460472.2_Silent_p.R77R			Q8WZ42	TITIN_HUMAN	titin	32689	Ig-like 1.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R77R(5)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGGGAATATCGTCCACTGT	0.562																																					p.R77R												.	.	5	Substitution - coding silent(5)	large_intestine(5)	c.A231G	2						.						170.0	152.0	158.0					2																	179666929		2203	4300	6503	179375174	SO:0001819	synonymous_variant	7273	exon3			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.231A>G	2.37:g.179666929T>C			179375174	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.562	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
HECW2	57520	hgsc.bcm.edu	37	2	197184557	197184557	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:197184557C>T	ENST00000260983.3	-	9	1239	c.1057G>A	c.(1057-1059)Gat>Aat	p.D353N	HECW2_ENST00000409111.1_5'UTR	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	353					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.D353N(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TCCTCGTCATCGGAAGGGCTA	0.493																																					p.D353N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1057A	2						.						81.0	70.0	74.0					2																	197184557		2203	4300	6503	196892802	SO:0001583	missense	57520	exon9			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.1057G>A	2.37:g.197184557C>T	ENSP00000260983:p.Asp353Asn		196892802	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360696	0.82353	.	.	ENSG00000138411	ENST00000260983	T	0.35605	1.3	5.65	4.74	0.60224	.	0.412764	0.26428	N	0.024435	T	0.31451	0.0797	L	0.32530	0.975	0.50632	D	0.999888	D	0.64830	0.994	P	0.49597	0.616	T	0.03287	-1.1052	10	0.05351	T	0.99	.	14.5796	0.68278	0.1449:0.8551:0.0:0.0	.	353	Q9P2P5	HECW2_HUMAN	N	353	ENSP00000260983:D353N	ENSP00000260983:D353N	D	-	1	0	HECW2	196892802	1.000000	0.71417	0.993000	0.49108	0.835000	0.47333	5.129000	0.64739	2.941000	0.99782	0.655000	0.94253	GAT		0.493	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
SF3B1	23451	hgsc.bcm.edu	37	2	198257869	198257869	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:198257869T>C	ENST00000335508.6	-	24	3674	c.3583A>G	c.(3583-3585)Atg>Gtg	p.M1195V		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1195					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.M1195V(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CCAAGTGACATGTGCTGTACC	0.423			Mis		myelodysplastic syndrome																																p.M1195V			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3583G	2						.						109.0	95.0	100.0					2																	198257869		2203	4300	6503	197966114	SO:0001583	missense	23451	exon24			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3583A>G	2.37:g.198257869T>C	ENSP00000335321:p.Met1195Val		197966114	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	8.762	0.923831	0.18056	.	.	ENSG00000115524	ENST00000335508	T	0.64085	-0.08	5.39	4.21	0.49690	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59810	0.2221	M	0.67953	2.075	0.80722	D	1	B	0.11235	0.004	B	0.15484	0.013	T	0.56306	-0.8001	10	0.42905	T	0.14	.	12.4081	0.55451	0.0:0.0:0.1408:0.8592	.	1195	O75533	SF3B1_HUMAN	V	1195	ENSP00000335321:M1195V	ENSP00000335321:M1195V	M	-	1	0	SF3B1	197966114	1.000000	0.71417	1.000000	0.80357	0.084000	0.17831	6.218000	0.72224	0.872000	0.35775	-0.619000	0.04042	ATG		0.423	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
AOX1	316	hgsc.bcm.edu	37	2	201515843	201515843	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:201515843A>G	ENST00000374700.2	+	26	3235	c.2994A>G	c.(2992-2994)gcA>gcG	p.A998A	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	998					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)	p.A998A(1)		breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	AGTTCAATGCAGAGAATTATT	0.473																																					p.A998A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2994G	2						.						165.0	164.0	165.0					2																	201515843		2203	4300	6503	201224088	SO:0001819	synonymous_variant	316	exon26			AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.2994A>G	2.37:g.201515843A>G			201224088	NM_001159	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Silent	SNP	ENST00000374700.2	37	CCDS33360.1																																																																																				0.473	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	
APOB	338	hgsc.bcm.edu	37	2	21225889	21225889	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:21225889A>G	ENST00000233242.1	-	29	12532	c.12405T>C	c.(12403-12405)agT>agC	p.S4135S	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4135					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.S4135S(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGTGGTGCCACTGGCTGCTT	0.507																																					p.S4135S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T12405C	2						.						126.0	121.0	123.0					2																	21225889		2203	4300	6503	21079394	SO:0001819	synonymous_variant	338	exon29			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.12405T>C	2.37:g.21225889A>G			21079394	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																				0.507	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
APOB	338	hgsc.bcm.edu	37	2	21239330	21239330	+	Missense_Mutation	SNP	C	C	T	rs375294575		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:21239330C>T	ENST00000233242.1	-	21	3440	c.3313G>A	c.(3313-3315)Gcc>Acc	p.A1105T		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1105					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.A1105T(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCATGAGGGCGACCTCAGTA	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		17334	0.0		0.0	False		,,,				2504	0.001				p.A1105T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3313A	2						.	C	THR/ALA	0,4406		0,0,2203	83.0	80.0	81.0		3313	-2.5	0.0	2		81	1,8599	1.2+/-3.3	0,1,4299	no	missense	APOB	NM_000384.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1105/4564	21239330	1,13005	2203	4300	6503	21092835	SO:0001583	missense	338	exon21			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3313G>A	2.37:g.21239330C>T	ENSP00000233242:p.Ala1105Thr		21092835	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	0.210	-1.037540	0.02013	0.0	1.16E-4	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00640	6.03	4.88	-2.53	0.06326	.	0.561720	0.16879	N	0.195786	T	0.00241	0.0007	N	0.00760	-1.21	0.80722	D	1	B	0.12013	0.005	B	0.06405	0.002	T	0.44003	-0.9356	10	0.02654	T	1	.	6.4744	0.22026	0.1113:0.3044:0.0:0.5843	.	1105	P04114	APOB_HUMAN	T	1105	ENSP00000233242:A1105T	ENSP00000233242:A1105T	A	-	1	0	APOB	21092835	0.262000	0.24073	0.001000	0.08648	0.006000	0.05464	0.313000	0.19415	-1.094000	0.03054	-1.134000	0.01955	GCC		0.483	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
MAP2	4133	hgsc.bcm.edu	37	2	210574976	210574976	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:210574976C>A	ENST00000360351.4	+	12	5577	c.5071C>A	c.(5071-5073)Cag>Aag	p.Q1691K	MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000361559.4_Missense_Mutation_p.Q335K|MAP2_ENST00000447185.1_Missense_Mutation_p.Q1687K|MAP2_ENST00000392194.1_Missense_Mutation_p.Q335K|MAP2_ENST00000199940.6_Missense_Mutation_p.Q392K	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1691					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.Q1691K(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TAAAGGGGGGCAGGTAAGAAT	0.403																																					p.Q335K	Pancreas(27;423 979 28787 29963)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1003A	2						.						40.0	34.0	36.0					2																	210574976		2193	4282	6475	210283221	SO:0001583	missense	4133	exon9				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.5071C>A	2.37:g.210574976C>A	ENSP00000353508:p.Gln1691Lys		210283221	NM_031847	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.596550	0.46318	.	.	ENSG00000078018	ENST00000199940;ENST00000360351;ENST00000361559;ENST00000392194;ENST00000447185	D;D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2;-3.2	5.61	5.61	0.85477	.	0.113799	0.39834	N	0.001256	D	0.91683	0.7371	N	0.11673	0.155	0.80722	D	1	D;B;P;P;B	0.69078	0.997;0.05;0.932;0.946;0.004	D;B;D;D;B	0.74674	0.984;0.032;0.949;0.909;0.127	D	0.86469	0.1784	10	0.02654	T	1	-2.7008	19.6271	0.95682	0.0:1.0:0.0:0.0	.	1687;335;336;1691;392	P11137-3;P11137-2;Q59FX9;P11137;Q8IUX2	.;.;.;MAP2_HUMAN;.	K	392;1691;335;335;1687	ENSP00000199940:Q392K;ENSP00000353508:Q1691K;ENSP00000355290:Q335K;ENSP00000376032:Q335K;ENSP00000392164:Q1687K	ENSP00000199940:Q392K	Q	+	1	0	MAP2	210283221	1.000000	0.71417	0.950000	0.38849	0.020000	0.10135	4.656000	0.61483	2.645000	0.89757	0.591000	0.81541	CAG		0.403	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
ERBB4	2066	hgsc.bcm.edu	37	2	212248376	212248376	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:212248376C>T	ENST00000342788.4	-	28	4201	c.3891G>A	c.(3889-3891)ccG>ccA	p.P1297P	ERBB4_ENST00000402597.1_Silent_p.P1287P|ERBB4_ENST00000436443.1_Silent_p.P1281P	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1297					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P1297P(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	AAGGTGGAGGCGGCAGCACAG	0.498										TSP Lung(8;0.080)																											p.P1297P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3891A	2						.						66.0	70.0	68.0					2																	212248376		2203	4300	6503	211956621	SO:0001819	synonymous_variant	2066	exon28			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3891G>A	2.37:g.212248376C>T			211956621	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	ENST00000342788.4	37	CCDS2394.1																																																																																				0.498	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
ERBB4	2066	hgsc.bcm.edu	37	2	212488727	212488727	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:212488727C>T	ENST00000342788.4	-	18	2432	c.2122G>A	c.(2122-2124)Gct>Act	p.A708T	ERBB4_ENST00000402597.1_Missense_Mutation_p.A698T|ERBB4_ENST00000436443.1_Missense_Mutation_p.A708T	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	708					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A708T(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CGAAGTTGAGCTTGATTGGGT	0.428										TSP Lung(8;0.080)																											p.A708T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2122A	2						.						105.0	102.0	103.0					2																	212488727		2203	4300	6503	212196972	SO:0001583	missense	2066	exon18			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2122G>A	2.37:g.212488727C>T	ENSP00000342235:p.Ala708Thr		212196972	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	37	6.019042	0.97205	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.76316	-1.0;-1.01;-1.01	5.74	5.74	0.90152	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.86814	0.6023	M	0.74258	2.255	0.80722	D	1	D;D;D;D	0.71674	0.998;0.97;0.988;0.984	P;P;P;P	0.58928	0.848;0.79;0.693;0.578	D	0.87111	0.2185	10	0.59425	D	0.04	.	19.9351	0.97137	0.0:1.0:0.0:0.0	.	698;698;708;708	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	T	708;708;698	ENSP00000342235:A708T;ENSP00000403204:A708T;ENSP00000385565:A698T	ENSP00000342235:A708T	A	-	1	0	ERBB4	212196972	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.794000	0.85869	2.703000	0.92315	0.655000	0.94253	GCT		0.428	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
TNS1	7145	hgsc.bcm.edu	37	2	218683200	218683200	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:218683200G>A	ENST00000171887.4	-	24	3995	c.3543C>T	c.(3541-3543)cgC>cgT	p.R1181R	TNS1_ENST00000419504.1_Silent_p.R1168R|TNS1_ENST00000430930.1_Silent_p.R1160R	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	1181					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)	p.R1181R(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CTGTTCTGTGGCGCGCCTGAG	0.627																																					p.R1181R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3543T	2						.						56.0	60.0	59.0					2																	218683200		2203	4300	6503	218391445	SO:0001819	synonymous_variant	7145	exon24			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.3543C>T	2.37:g.218683200G>A			218391445	NM_022648	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	37	CCDS2407.1																																																																																				0.627	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
CCDC108	255101	hgsc.bcm.edu	37	2	219875375	219875375	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:219875375G>T	ENST00000341552.5	-	26	4284	c.4201C>A	c.(4201-4203)Cag>Aag	p.Q1401K	CCDC108_ENST00000441968.1_Missense_Mutation_p.Q1401K|AC097468.4_ENST00000441450.1_RNA|CCDC108_ENST00000453220.1_Missense_Mutation_p.Q1401K	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1401						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.Q1401K(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCACTCCCTGGAAGTGGATG	0.602																																					p.Q1401K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4201A	2						.						65.0	52.0	57.0					2																	219875375		2201	4299	6500	219583619	SO:0001583	missense	255101	exon26			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.4201C>A	2.37:g.219875375G>T	ENSP00000340776:p.Gln1401Lys		219583619	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	G	11.95	1.792164	0.31685	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220	T;T;T	0.04809	3.55;3.55;3.55	5.26	3.37	0.38596	.	0.162448	0.29192	N	0.012862	T	0.05227	0.0139	L	0.48362	1.52	0.80722	D	1	B	0.30236	0.274	B	0.33960	0.173	T	0.29941	-0.9995	10	0.09084	T	0.74	-22.8004	11.1094	0.48223	0.0:0.2182:0.6638:0.118	.	1401	Q6ZU64	CC108_HUMAN	K	1401	ENSP00000340776:Q1401K;ENSP00000413377:Q1401K;ENSP00000409117:Q1401K	ENSP00000340776:Q1401K	Q	-	1	0	CCDC108	219583619	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.589000	0.36644	2.474000	0.83562	0.555000	0.69702	CAG		0.602	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
INHA	3623	hgsc.bcm.edu	37	2	220440061	220440061	+	Missense_Mutation	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:220440061T>G	ENST00000243786.2	+	2	1094	c.914T>G	c.(913-915)cTt>cGt	p.L305R		NM_002191.3	NP_002182.1	P05111	INHA_HUMAN	inhibin, alpha	305					cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|erythrocyte differentiation (GO:0030218)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|ovarian follicle development (GO:0001541)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|regulation of cell cycle (GO:0051726)|regulation of cell proliferation (GO:0042127)|response to external stimulus (GO:0009605)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|inhibin A complex (GO:0043512)|inhibin-betaglycan-ActRII complex (GO:0034673)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|receptor binding (GO:0005102)	p.L305R(1)		large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		AACCTGTCCCTTCCAGTCCCT	0.637																																					p.L305R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T914G	2						.						125.0	126.0	126.0					2																	220440061		2203	4300	6503	220148305	SO:0001583	missense	3623	exon2				CCDS2444.1	2q35	2013-09-19			ENSG00000123999	ENSG00000123999			6065	protein-coding gene	gene with protein product		147380				3345731	Standard	NM_002191		Approved		uc002vmk.2	P05111	OTTHUMG00000059237	ENST00000243786.2:c.914T>G	2.37:g.220440061T>G	ENSP00000243786:p.Leu305Arg		220148305	NM_002191	A8K8H5	Missense_Mutation	SNP	ENST00000243786.2	37	CCDS2444.1	.	.	.	.	.	.	.	.	.	.	T	11.02	1.514672	0.27123	.	.	ENSG00000123999	ENST00000243786	D	0.89343	-2.5	5.39	0.255	0.15561	Transforming growth factor-beta, C-terminal (3);	0.212579	0.23979	N	0.042687	D	0.84437	0.5472	M	0.61703	1.905	0.09310	N	1	P	0.46327	0.876	P	0.44860	0.462	T	0.75393	-0.3333	9	.	.	.	-4.0211	3.0717	0.06233	0.3182:0.1475:0.0:0.5343	.	305	P05111	INHA_HUMAN	R	305	ENSP00000243786:L305R	.	L	+	2	0	INHA	220148305	0.011000	0.17503	0.044000	0.18714	0.138000	0.21146	0.866000	0.27954	0.295000	0.22570	0.459000	0.35465	CTT		0.637	INHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131425.1		
NCL	4691	hgsc.bcm.edu	37	2	232320209	232320209	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:232320209G>A	ENST00000322723.4	-	13	2199	c.1959C>T	c.(1957-1959)ttC>ttT	p.F653F	SNORD20_ENST00000384550.1_RNA|SNORA75_ENST00000384158.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	653	Arg/Gly/Phe-rich.				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)	p.F653F(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CACGACCCCCGAAGCCACCTT	0.582																																					p.F653F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1959T	2						.						184.0	196.0	192.0					2																	232320209		2203	4300	6503	232028453	SO:0001819	synonymous_variant	4691	exon13				CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.1959C>T	2.37:g.232320209G>A			232028453	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Silent	SNP	ENST00000322723.4	37	CCDS33397.1																																																																																				0.582	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
CAPN10	11132	hgsc.bcm.edu	37	2	241533985	241533985	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:241533985G>A	ENST00000391984.2	+	6	1052	c.856G>A	c.(856-858)Gca>Aca	p.A286T	CAPN10_ENST00000391982.2_Missense_Mutation_p.A286T|CAPN10_ENST00000270364.7_Intron|CAPN10_ENST00000404753.3_Missense_Mutation_p.A286T|CAPN10_ENST00000354082.4_Missense_Mutation_p.A286T|CAPN10_ENST00000352879.4_Intron	NM_023083.3	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10	286	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				actin cytoskeleton reorganization (GO:0031532)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to insulin stimulus (GO:0032869)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin secretion (GO:0032024)|positive regulation of intracellular transport (GO:0032388)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteolysis (GO:0006508)|type B pancreatic cell apoptotic process (GO:0097050)	cell (GO:0005623)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cytoskeletal protein binding (GO:0008092)|SNARE binding (GO:0000149)	p.A286T(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|urinary_tract(1)	27		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		CCAGGTAGATGCAGCGGTAGC	0.597																																					p.A286T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G856A	2						.						140.0	145.0	143.0					2																	241533985		2203	4300	6503	241182658	SO:0001583	missense	11132	exon6			AF089088	CCDS33420.1, CCDS42838.1	2q37.3	2008-05-22			ENSG00000142330	ENSG00000142330			1477	protein-coding gene	gene with protein product		605286				11017071, 11018080	Standard	NM_023083		Approved		uc002vzk.2	Q9HC96	OTTHUMG00000133358	ENST00000391984.2:c.856G>A	2.37:g.241533985G>A	ENSP00000375844:p.Ala286Thr		241182658	NM_023085	A8MVS7|Q4ZFV1|Q8NCD4|Q96IG4|Q96JI2|Q9HC89|Q9HC90|Q9HC91|Q9HC92|Q9HC93|Q9HC94|Q9HC95	Missense_Mutation	SNP	ENST00000391984.2	37	CCDS42838.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130581	0.37630	.	.	ENSG00000142330	ENST00000391984;ENST00000391982;ENST00000404753;ENST00000354082	T;T;T;T	0.15834	2.39;2.39;2.39;2.39	4.93	-1.61	0.08399	Peptidase C2, calpain, catalytic domain (3);	0.520034	0.20293	N	0.095184	T	0.10895	0.0266	N	0.26092	0.79	0.09310	N	1	P;B;B;B	0.36086	0.536;0.267;0.332;0.166	B;B;B;B	0.38156	0.124;0.215;0.104;0.266	T	0.16660	-1.0395	10	0.72032	D	0.01	.	7.2245	0.26007	0.0:0.3097:0.4471:0.2432	.	286;286;286;286	B7Z6G3;B7WPF5;Q9HC96-3;Q9HC96	.;.;.;CAN10_HUMAN	T	286	ENSP00000375844:A286T;ENSP00000375842:A286T;ENSP00000384422:A286T;ENSP00000270362:A286T	ENSP00000270362:A286T	A	+	1	0	CAPN10	241182658	0.001000	0.12720	0.002000	0.10522	0.036000	0.12997	0.240000	0.18042	-0.450000	0.07107	-0.211000	0.12701	GCA		0.597	CAPN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257191.3	NM_023083	
CPSF3	51692	hgsc.bcm.edu	37	2	9570889	9570889	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:9570889T>C	ENST00000238112.3	+	4	427	c.221T>C	c.(220-222)tTg>tCg	p.L74S	CPSF3_ENST00000460593.1_Missense_Mutation_p.L37S	NM_016207.3	NP_057291.1	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3, 73kDa	74					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	5'-3' exonuclease activity (GO:0008409)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.L74S(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		AGTTTCCATTTGGATCACTGT	0.343																																					p.L74S	Colon(194;1259 2048 3845 5218 19985)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T221C	2						.						122.0	135.0	130.0					2																	9570889		2203	4300	6503	9488340	SO:0001583	missense	51692	exon4			AF171877	CCDS1664.1	2p25.1	2009-01-06	2002-08-29		ENSG00000119203	ENSG00000119203			2326	protein-coding gene	gene with protein product		606029	"""cleavage and polyadenylation specific factor 3, 73kD subunit"""			8929409	Standard	NM_016207		Approved	CPSF-73, CPSF73, YSH1	uc002qzo.2	Q9UKF6	OTTHUMG00000090415	ENST00000238112.3:c.221T>C	2.37:g.9570889T>C	ENSP00000238112:p.Leu74Ser		9488340	NM_016207	O14769|Q53RS2|Q96F36	Missense_Mutation	SNP	ENST00000238112.3	37	CCDS1664.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.399228	0.83120	.	.	ENSG00000119203	ENST00000238112;ENST00000475482;ENST00000427001;ENST00000460593	T;T;T	0.80304	-1.36;-1.36;-1.36	5.44	5.44	0.79542	Beta-lactamase-like (2);	0.000000	0.64402	D	0.000002	D	0.90188	0.6933	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.978;0.996	D	0.91715	0.5384	10	0.87932	D	0	-14.5325	15.4995	0.75684	0.0:0.0:0.0:1.0	.	74;74	E7ER23;Q9UKF6	.;CPSF3_HUMAN	S	74;37;74;37	ENSP00000238112:L74S;ENSP00000419744:L37S;ENSP00000418957:L37S	ENSP00000238112:L74S	L	+	2	0	CPSF3	9488340	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.953000	0.87836	2.068000	0.61886	0.533000	0.62120	TTG		0.343	CPSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206843.1	NM_016207	
MAPRE3	22924	hgsc.bcm.edu	37	2	27245206	27245206	+	Splice_Site	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:27245206A>G	ENST00000233121.2	+	2	318	c.120A>G	c.(118-120)tcA>tcG	p.S40S	MAPRE3_ENST00000491354.1_3'UTR|MAPRE3_ENST00000402218.1_Splice_Site_p.S40S|MAPRE3_ENST00000405074.3_Splice_Site_p.S40S			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	40	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)	p.S40S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCTTTGTTCAGGTAGGAGGC	0.498																																					p.S40S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A120G	2						.						107.0	103.0	104.0					2																	27245206		2203	4300	6503	27098710	SO:0001630	splice_region_variant	22924	exon2			Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.121+1A>G	2.37:g.27245206A>G			27098710	NM_012326	B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Silent	SNP	ENST00000233121.2	37	CCDS1731.1																																																																																				0.498	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214183.1	NM_012326	Silent
LTBP1	4052	hgsc.bcm.edu	37	2	33411949	33411949	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:33411949G>T	ENST00000404816.2	+	6	1581	c.1228G>T	c.(1228-1230)Ggt>Tgt	p.G410C	LTBP1_ENST00000354476.3_Missense_Mutation_p.G410C|LTBP1_ENST00000407925.1_Missense_Mutation_p.G84C|LTBP1_ENST00000390003.4_Missense_Mutation_p.G84C|LTBP1_ENST00000418533.2_Missense_Mutation_p.G84C|LTBP1_ENST00000402934.1_Missense_Mutation_p.G84C|LTBP1_ENST00000404525.1_Missense_Mutation_p.G84C			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	410	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.G410C(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ATGTATGAATGGTGGCCAGTG	0.433																																					p.G84C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G250T	2						.						95.0	92.0	93.0					2																	33411949		2203	4300	6503	33265453	SO:0001583	missense	4052	exon2				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1228G>T	2.37:g.33411949G>T	ENSP00000386043:p.Gly410Cys		33265453	NM_000627	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632031	0.87660	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000432635;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31;-3.31;-3.31;-3.31	5.3	5.3	0.74995	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.96488	0.8854	M	0.70595	2.14	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.96895	0.9656	9	0.87932	D	0	.	18.9638	0.92687	0.0:0.0:1.0:0.0	.	410;84;84;84;84;410	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	C	410;410;99;84;84;84;84;84	ENSP00000386043:G410C;ENSP00000346467:G410C;ENSP00000374653:G84C;ENSP00000393057:G84C;ENSP00000384373:G84C;ENSP00000385359:G84C;ENSP00000384091:G84C	ENSP00000346467:G410C	G	+	1	0	LTBP1	33265453	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.092000	0.94157	2.468000	0.83385	0.655000	0.94253	GGT		0.433	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
SOS1	6654	hgsc.bcm.edu	37	2	39213109	39213109	+	Silent	SNP	G	G	A	rs530210974		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:39213109G>A	ENST00000426016.1	-	24	3944	c.3858C>T	c.(3856-3858)tcC>tcT	p.S1286S	SOS1_ENST00000395038.2_Silent_p.S1271S|SOS1_ENST00000402219.2_Silent_p.S1286S			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	1286					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S1286S(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				GCCCAGCAATGGAATGAAGGT	0.512									Noonan syndrome																												p.S1286S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3858T	2						.						261.0	234.0	243.0					2																	39213109		2203	4300	6503	39066613	SO:0001819	synonymous_variant	6654	exon23	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.3858C>T	2.37:g.39213109G>A			39066613	NM_005633	A8K2G3|B4DXG2	Silent	SNP	ENST00000426016.1	37	CCDS1802.1																																																																																				0.512	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
CEP68	23177	hgsc.bcm.edu	37	2	65299612	65299612	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:65299612G>A	ENST00000377990.2	+	3	1585	c.1382G>A	c.(1381-1383)cGg>cAg	p.R461Q	CEP68_ENST00000537589.1_Missense_Mutation_p.R73Q|CEP68_ENST00000260569.4_Missense_Mutation_p.R461Q|CEP68_ENST00000497039.1_3'UTR|CEP68_ENST00000546106.1_Missense_Mutation_p.R461Q|RAB1A_ENST00000494188.1_Intron	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	461					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.R461Q(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						CAGAGTGCCCGGCGCCCTACC	0.602																																					p.R461Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1382A	2						.						51.0	56.0	54.0					2																	65299612		2203	4300	6503	65153116	SO:0001583	missense	23177	exon3			BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.1382G>A	2.37:g.65299612G>A	ENSP00000367229:p.Arg461Gln		65153116	NM_015147	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	37	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	G	10.12	1.263938	0.23136	.	.	ENSG00000011523	ENST00000377990;ENST00000546106;ENST00000537589;ENST00000260569;ENST00000545501	T;T;T;T	0.22945	2.53;2.56;1.93;2.56	5.78	-7.7	0.01259	.	2.356960	0.01289	N	0.009943	T	0.10809	0.0264	N	0.16478	0.41	0.09310	N	0.999999	B;B;B;B;B	0.13594	0.008;0.008;0.004;0.003;0.008	B;B;B;B;B	0.08055	0.002;0.002;0.001;0.001;0.003	T	0.19289	-1.0310	10	0.12766	T	0.61	1.8471	1.5876	0.02647	0.4119:0.1809:0.2451:0.1622	.	449;461;461;461;461	F5H3N9;F5H2Y2;Q76N32;Q76N32-2;Q05C09	.;.;CEP68_HUMAN;.;.	Q	461;461;73;461;449	ENSP00000367229:R461Q;ENSP00000438306:R461Q;ENSP00000443357:R73Q;ENSP00000260569:R461Q	ENSP00000260569:R461Q	R	+	2	0	CEP68	65153116	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.837000	0.01689	-1.546000	0.01717	-0.216000	0.12614	CGG		0.602	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
SLC4A5	57835	hgsc.bcm.edu	37	2	74474267	74474267	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:74474267G>A	ENST00000377634.4	-	19	2354	c.1955C>T	c.(1954-1956)gCc>gTc	p.A652V	RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000346834.4_Missense_Mutation_p.A652V|SLC4A5_ENST00000357822.5_Missense_Mutation_p.A652V|SLC4A5_ENST00000359484.4_Missense_Mutation_p.A588V|SLC4A5_ENST00000377632.1_Missense_Mutation_p.A652V|SLC4A5_ENST00000394019.2_Missense_Mutation_p.A652V|SLC4A5_ENST00000423644.1_Missense_Mutation_p.A652V|SLC4A5_ENST00000358683.4_Missense_Mutation_p.A588V					solute carrier family 4 (sodium bicarbonate cotransporter), member 5									p.A652V(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						CTTCTTGATGGCATCGTAGAT	0.478																																					p.A652V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1955T	2						.						263.0	253.0	256.0					2																	74474267		2203	4300	6503	74327775	SO:0001583	missense	57835	exon14			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.1955C>T	2.37:g.74474267G>A	ENSP00000366861:p.Ala652Val		74327775	NM_021196		Missense_Mutation	SNP	ENST00000377634.4	37	CCDS1936.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.022309	0.93462	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000423644;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249	T;T;T;T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	5.17	5.17	0.71159	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90494	0.7022	M	0.85373	2.75	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.987;1.0;1.0;1.0;0.999	D	0.91699	0.5372	10	0.87932	D	0	.	16.2183	0.82241	0.0:0.0:1.0:0.0	.	652;652;588;652;652	Q9BY07-4;E7EQT3;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;.;S4A5_HUMAN;.	V	652;652;652;588;652;588;652;652;652;652	ENSP00000377587:A652V;ENSP00000251768:A652V;ENSP00000352461:A588V;ENSP00000395804:A652V;ENSP00000351513:A588V;ENSP00000350475:A652V;ENSP00000366859:A652V;ENSP00000366861:A652V;ENSP00000405678:A652V	ENSP00000251768:A652V	A	-	2	0	SLC4A5	74327775	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.657000	0.98554	2.687000	0.91594	0.655000	0.94253	GCC		0.478	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3		
WDR54	84058	hgsc.bcm.edu	37	2	74650058	74650058	+	Splice_Site	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:74650058A>C	ENST00000348227.4	+	3	372	c.284A>C	c.(283-285)cAg>cCg	p.Q95P	WDR54_ENST00000409791.1_Splice_Site_p.Q43P|WDR54_ENST00000461531.1_3'UTR	NM_032118.2	NP_115494.1	Q9H977	WDR54_HUMAN	WD repeat domain 54	95								p.Q95P(1)		breast(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9						CGAGGAATACAGGTAAGAAGA	0.542																																					p.Q95P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A284C	2						.						114.0	105.0	108.0					2																	74650058		2203	4300	6503	74503566	SO:0001630	splice_region_variant	84058	exon3			AK023015	CCDS1940.1	2p13.1	2013-01-09			ENSG00000005448	ENSG00000005448		"""WD repeat domain containing"""	25770	protein-coding gene	gene with protein product						12477932	Standard	NM_032118		Approved	FLJ12953	uc002slb.3	Q9H977	OTTHUMG00000129951	ENST00000348227.4:c.285+1A>C	2.37:g.74650058A>C			74503566	NM_032118	D6W5I3|Q53H85|Q86V45	Missense_Mutation	SNP	ENST00000348227.4	37	CCDS1940.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.642998	0.87859	.	.	ENSG00000005448	ENST00000409791;ENST00000426787;ENST00000348227	T;T	0.52057	0.68;0.68	5.46	5.46	0.80206	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61362	0.2341	L	0.55481	1.735	0.58432	D	0.999999	D	0.89917	1.0	D	0.74023	0.982	T	0.58429	-0.7638	10	0.30854	T	0.27	-14.8742	13.0493	0.58946	1.0:0.0:0.0:0.0	.	95	Q9H977	WDR54_HUMAN	P	43;95;95	ENSP00000387236:Q43P;ENSP00000006526:Q95P	ENSP00000006526:Q95P	Q	+	2	0	WDR54	74503566	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.067000	0.76741	2.072000	0.62099	0.533000	0.62120	CAG		0.542	WDR54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252213.1	NM_032118	Missense_Mutation
KDM3A	55818	hgsc.bcm.edu	37	2	86683622	86683622	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:86683622A>G	ENST00000409556.1	+	7	979	c.614A>G	c.(613-615)cAg>cGg	p.Q205R	KDM3A_ENST00000312912.5_Missense_Mutation_p.Q205R|KDM3A_ENST00000542128.1_Missense_Mutation_p.Q153R|KDM3A_ENST00000409064.1_Missense_Mutation_p.Q205R			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	205					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.Q205R(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						CCATCTACTCAGTGGTTTTCA	0.318																																					p.Q205R	NSCLC(96;1150 1523 6936 46253 49736)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A614G	2						.						50.0	51.0	51.0					2																	86683622		2203	4300	6503	86537133	SO:0001583	missense	55818	exon6			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.614A>G	2.37:g.86683622A>G	ENSP00000386660:p.Gln205Arg		86537133	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	ENST00000409556.1	37	CCDS1990.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.182390	0.78677	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.61040	0.14;0.14;0.14;0.17	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000004	T	0.73830	0.3637	M	0.70275	2.135	0.42176	D	0.991667	D;D	0.67145	0.996;0.993	D;D	0.75484	0.986;0.968	T	0.77443	-0.2586	10	0.72032	D	0.01	.	13.2517	0.60055	1.0:0.0:0.0:0.0	.	153;205	F5H070;Q9Y4C1	.;KDM3A_HUMAN	R	205;205;205;205;153	ENSP00000386660:Q205R;ENSP00000323659:Q205R;ENSP00000386516:Q205R;ENSP00000438324:Q153R	ENSP00000323659:Q205R	Q	+	2	0	KDM3A	86537133	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.507000	0.66999	2.013000	0.59113	0.459000	0.35465	CAG		0.318	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
BOK	666	hgsc.bcm.edu	37	2	242511737	242511737	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr2:242511737G>A	ENST00000318407.3	+	5	841	c.539G>A	c.(538-540)aGc>aAc	p.S180N		NM_032515.4	NP_115904.1	Q9UMX3	BOK_HUMAN	BCL2-related ovarian killer	180					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cell proliferation (GO:0008283)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male gonad development (GO:0008584)|neuron apoptotic process (GO:0051402)|oligodendrocyte differentiation (GO:0048709)|positive regulation of apoptotic process (GO:0043065)|positive regulation of execution phase of apoptosis (GO:1900119)	cytoplasm (GO:0005737)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.S180N(1)		large_intestine(1)|lung(3)|ovary(1)	5		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.04e-33)|all cancers(36;7.87e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.52e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.64e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0835)		TGTGTGGTCAGCACAGACCCT	0.647																																					p.S180N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G539A	2						.						67.0	53.0	58.0					2																	242511737		2203	4300	6503	242160410	SO:0001583	missense	666	exon5			AF174487	CCDS2550.1	2q37.3	2008-05-22			ENSG00000176720	ENSG00000176720			1087	protein-coding gene	gene with protein product		605404				9356461, 11034351, 15102863	Standard	NM_032515		Approved	BCL2L9, BOKL, MGC4631	uc002wbq.3	Q9UMX3	OTTHUMG00000133411	ENST00000318407.3:c.539G>A	2.37:g.242511737G>A	ENSP00000314132:p.Ser180Asn		242160410	NM_032515		Missense_Mutation	SNP	ENST00000318407.3	37	CCDS2550.1	.	.	.	.	.	.	.	.	.	.	G	7.530	0.658417	0.14645	.	.	ENSG00000176720	ENST00000318407	T	0.44482	0.92	4.96	1.68	0.24146	.	0.199389	0.52532	D	0.000080	T	0.16769	0.0403	N	0.08118	0	0.38351	D	0.944342	B	0.06786	0.001	B	0.04013	0.001	T	0.07693	-1.0759	10	0.13470	T	0.59	-29.2676	4.7003	0.12823	0.4138:0.1612:0.425:0.0	.	180	Q9UMX3	BOK_HUMAN	N	180	ENSP00000314132:S180N	ENSP00000314132:S180N	S	+	2	0	BOK	242160410	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	1.732000	0.38146	0.479000	0.27511	-0.244000	0.11960	AGC		0.647	BOK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257268.2	NM_032515	
IKBKAP	8518	hgsc.bcm.edu	37	9	111674598	111674598	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:111674598G>A	ENST00000374647.5	-	11	1442	c.1135C>T	c.(1135-1137)Cgg>Tgg	p.R379W	IKBKAP_ENST00000537196.1_Missense_Mutation_p.R30W	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	379					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)	p.R379W(1)		NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CCCACGCTCCGGTCAGTCGTC	0.542																																					p.R379W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1135T	9						.						112.0	93.0	99.0					9																	111674598		2203	4300	6503	110714419	SO:0001583	missense	8518	exon11			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1135C>T	9.37:g.111674598G>A	ENSP00000363779:p.Arg379Trp		110714419	NM_003640	Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	ENST00000374647.5	37	CCDS6773.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.871546	0.33069	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.28895	3.33;1.59	5.77	1.56	0.23342	.	0.101807	0.64402	D	0.000002	T	0.48572	0.1507	M	0.86268	2.805	0.37718	D	0.924809	D	0.89917	1.0	D	0.75484	0.986	T	0.49872	-0.8893	10	0.38643	T	0.18	-23.3248	1.873	0.03212	0.153:0.1381:0.4241:0.2848	.	379	O95163	ELP1_HUMAN	W	379;30	ENSP00000363779:R379W;ENSP00000439367:R30W	ENSP00000363779:R379W	R	-	1	2	IKBKAP	110714419	1.000000	0.71417	0.997000	0.53966	0.006000	0.05464	1.673000	0.37534	0.426000	0.26116	-0.145000	0.13849	CGG		0.542	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1		
TNC	3371	hgsc.bcm.edu	37	9	117849446	117849446	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:117849446G>A	ENST00000350763.4	-	3	975	c.564C>T	c.(562-564)ccC>ccT	p.P188P	TNC_ENST00000340094.3_Silent_p.P188P|TNC_ENST00000423613.2_Silent_p.P188P|TNC_ENST00000542877.1_Silent_p.P188P|TNC_ENST00000535648.1_Silent_p.P188P|TNC_ENST00000537320.1_Silent_p.P188P|TNC_ENST00000345230.3_Silent_p.P188P|TNC_ENST00000346706.3_Silent_p.P188P|TNC_ENST00000341037.4_Silent_p.P188P	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	188	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.P188P(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CTGGACATTCGGGCTCAGAGC	0.617																																					p.P188P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C564T	9						.						102.0	91.0	95.0					9																	117849446		2203	4300	6503	116889267	SO:0001819	synonymous_variant	3371	exon3				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.564C>T	9.37:g.117849446G>A			116889267	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	ENST00000350763.4	37	CCDS6811.1																																																																																				0.617	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
DENND1A	57706	hgsc.bcm.edu	37	9	126520064	126520064	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:126520064C>T	ENST00000373624.2	-	5	421	c.220G>A	c.(220-222)Gtg>Atg	p.V74M	DENND1A_ENST00000394219.3_Missense_Mutation_p.V42M|DENND1A_ENST00000373620.3_Missense_Mutation_p.V74M|DENND1A_ENST00000373618.1_Missense_Mutation_p.V42M|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394215.2_Missense_Mutation_p.V44M	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	74	UDENN.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.V74M(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						TCAGTGAGCACGAATGTGAAG	0.458																																					p.V74M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G220A	9						.						86.0	74.0	78.0					9																	126520064		2203	4300	6503	125559885	SO:0001583	missense	57706	exon5			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.220G>A	9.37:g.126520064C>T	ENSP00000362727:p.Val74Met		125559885	NM_024820	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	37	CCDS35133.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267669	0.80469	.	.	ENSG00000119522	ENST00000373624;ENST00000394219;ENST00000373620;ENST00000394215;ENST00000373618	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	6.02	6.02	0.97574	uDENN (3);	0.000000	0.85682	D	0.000000	T	0.76069	0.3936	M	0.81497	2.545	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.996;0.981;1.0;0.996;0.998	T	0.77472	-0.2575	10	0.87932	D	0	-17.2913	19.5254	0.95203	0.0:1.0:0.0:0.0	.	42;42;44;74;74	Q8TEH3-6;Q8TEH3-4;Q8TEH3-5;Q8TEH3-2;Q8TEH3	.;.;.;.;DEN1A_HUMAN	M	74;42;74;44;42	ENSP00000362727:V74M;ENSP00000377766:V42M;ENSP00000362722:V74M;ENSP00000377763:V44M;ENSP00000362720:V42M	ENSP00000362720:V42M	V	-	1	0	DENND1A	125559885	1.000000	0.71417	0.994000	0.49952	0.976000	0.68499	7.487000	0.81328	2.857000	0.98124	0.650000	0.86243	GTG		0.458	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820	
NR6A1	2649	hgsc.bcm.edu	37	9	127289093	127289093	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:127289093T>C	ENST00000487099.2	-	8	1323	c.1166A>G	c.(1165-1167)tAt>tGt	p.Y389C	NR6A1_ENST00000416460.2_Missense_Mutation_p.Y384C|NR6A1_ENST00000373584.3_Missense_Mutation_p.Y385C|NR6A1_ENST00000344523.4_Missense_Mutation_p.Y388C	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	389					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.Y389C(1)		NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						CATGCAAGCATACTCCTCGTT	0.498																																					p.Y389C	Esophageal Squamous(192;272 2884 6208 20560)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1166G	9						.						200.0	169.0	179.0					9																	127289093		2203	4300	6503	126328914	SO:0001583	missense	2649	exon8			U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.1166A>G	9.37:g.127289093T>C	ENSP00000420267:p.Tyr389Cys		126328914	NM_033334	O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Missense_Mutation	SNP	ENST00000487099.2	37	CCDS35137.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.300187	0.81136	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523	D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4	5.37	5.37	0.77165	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98463	0.9488	M	0.87381	2.88	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.989;0.994;0.98	D	0.99126	1.0851	10	0.52906	T	0.07	.	14.8619	0.70387	0.0:0.0:0.0:1.0	.	385;389;384	F1DAM1;Q15406;Q15406-5	.;NR6A1_HUMAN;.	C	389;385;384;388	ENSP00000420267:Y389C;ENSP00000362686:Y385C;ENSP00000413701:Y384C;ENSP00000341135:Y388C	ENSP00000341135:Y388C	Y	-	2	0	NR6A1	126328914	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	7.431000	0.80335	2.153000	0.67306	0.533000	0.62120	TAT		0.498	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054043.4		
PIP5KL1	138429	hgsc.bcm.edu	37	9	130684333	130684333	+	Silent	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:130684333G>T	ENST00000388747.4	-	10	1022	c.978C>A	c.(976-978)ccC>ccA	p.P326P	PIP5KL1_ENST00000300432.3_Silent_p.P123P	NM_001135219.1	NP_001128691.1	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	326	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)	p.P123P(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)	8						TGGGGGCGTCGGGCAGCAGCC	0.682																																					p.P123P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C369A	9						.						17.0	19.0	18.0					9																	130684333		2170	4265	6435	129724154	SO:0001819	synonymous_variant	138429	exon5			BC042184	CCDS6885.1, CCDS48030.1	9q34.13	2008-02-05			ENSG00000167103	ENSG00000167103			28711	protein-coding gene	gene with protein product		612865				12477932	Standard	NM_001135219		Approved	bA203J24.5, MGC46424	uc011mao.2	Q5T9C9	OTTHUMG00000020719	ENST00000388747.4:c.978C>A	9.37:g.130684333G>T			129724154	NM_173492	Q8IVS3	Silent	SNP	ENST00000388747.4	37	CCDS48030.1																																																																																				0.682	PIP5KL1-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054289.2	NM_173492	
SPTAN1	6709	hgsc.bcm.edu	37	9	131344063	131344063	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:131344063G>A	ENST00000372731.4	+	12	1574	c.1464G>A	c.(1462-1464)gcG>gcA	p.A488A	SPTAN1_ENST00000372739.3_Silent_p.A488A|SPTAN1_ENST00000358161.5_Silent_p.A488A	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	488					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.A488A(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TTGGCAAGGCGTTCCTGTTGA	0.408																																					p.A488A	NSCLC(120;833 1744 2558 35612 37579)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1464A	9						.						257.0	255.0	256.0					9																	131344063		2203	4300	6503	130383884	SO:0001819	synonymous_variant	6709	exon12			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.1464G>A	9.37:g.131344063G>A			130383884	NM_001195532	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	ENST00000372731.4	37	CCDS6905.1																																																																																				0.408	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
SPTAN1	6709	hgsc.bcm.edu	37	9	131388738	131388738	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:131388738G>T	ENST00000372731.4	+	48	6443	c.6333G>T	c.(6331-6333)gaG>gaT	p.E2111D	SPTAN1_ENST00000372739.3_Missense_Mutation_p.E2116D|SPTAN1_ENST00000358161.5_Missense_Mutation_p.E2116D	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	2111					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.E2111D(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						AAAATGCAGAGGAGGACTTAA	0.567																																					p.E2091D	NSCLC(120;833 1744 2558 35612 37579)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6273T	9						.						117.0	122.0	120.0					9																	131388738		2203	4300	6503	130428559	SO:0001583	missense	6709	exon47			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.6333G>T	9.37:g.131388738G>T	ENSP00000361816:p.Glu2111Asp		130428559	NM_001195532	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556868	0.65425	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719;ENST00000372721	T;T;T	0.58060	0.36;0.36;0.36	5.68	2.83	0.33086	.	0.000000	0.85682	D	0.000000	T	0.69780	0.3149	M	0.79614	2.46	0.80722	D	1	D;D;D	0.89917	0.998;0.974;1.0	D;D;D	0.85130	0.995;0.953;0.997	T	0.68150	-0.5485	10	0.44086	T	0.13	.	11.6315	0.51178	0.1965:0.0:0.8035:0.0	.	2091;2116;2111	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	D	2116;2111;2116;2091;360	ENSP00000350882:E2116D;ENSP00000361816:E2111D;ENSP00000361824:E2116D	ENSP00000350882:E2116D	E	+	3	2	SPTAN1	130428559	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	1.337000	0.33862	0.325000	0.23359	0.563000	0.77884	GAG		0.567	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
DOLK	22845	hgsc.bcm.edu	37	9	131708469	131708469	+	Missense_Mutation	SNP	A	A	C	rs146395561	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:131708469A>C	ENST00000372586.3	-	1	1429	c.1114T>G	c.(1114-1116)Ttc>Gtc	p.F372V	NUP188_ENST00000372577.2_5'Flank|RP11-101E3.5_ENST00000482796.1_Intron	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase	372					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)	p.F372V(1)		breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						TACTCCAGGAAGATGAAGACC	0.522																																					p.F372V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1114G	9						.						122.0	125.0	124.0					9																	131708469		2203	4300	6503	130748290	SO:0001583	missense	22845	exon1			AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.1114T>G	9.37:g.131708469A>C	ENSP00000361667:p.Phe372Val		130748290	NM_014908	Q5SRE6	Missense_Mutation	SNP	ENST00000372586.3	37	CCDS6915.1	.	.	.	.	.	.	.	.	.	.	A	0.490	-0.875671	0.02550	.	.	ENSG00000175283	ENST00000372586	T	0.59083	0.29	5.33	2.79	0.32731	.	0.133014	0.48767	D	0.000164	T	0.34048	0.0884	N	0.20357	0.565	0.46725	D	0.999179	B	0.17667	0.023	B	0.19946	0.027	T	0.05566	-1.0877	10	0.13108	T	0.6	-21.2964	4.8675	0.13616	0.6335:0.0:0.0774:0.2891	.	372	Q9UPQ8	DOLK_HUMAN	V	372	ENSP00000361667:F372V	ENSP00000361667:F372V	F	-	1	0	DOLK	130748290	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	0.963000	0.29293	0.812000	0.34326	0.379000	0.24179	TTC		0.522	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054515.1	NM_014908	
JAK2	3717	hgsc.bcm.edu	37	9	5077459	5077459	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:5077459T>C	ENST00000381652.3	+	15	2365	c.1871T>C	c.(1870-1872)cTg>cCg	p.L624P	JAK2_ENST00000544510.1_Missense_Mutation_p.L475P|AL161450.1_ENST00000601793.1_Intron|JAK2_ENST00000539801.1_Missense_Mutation_p.L624P	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	624	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)	p.L624P(1)	BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	GCAGATATTCTGGTTCAGGAG	0.219		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.L624P			Dom	yes		9	9p24	3717	Janus kinase 2		L	JAK2,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.T1871C	9						.						8.0	9.0	9.0					9																	5077459		1960	4110	6070	5067459	SO:0001583	missense	3717	exon15	Familial Cancer Database			CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.1871T>C	9.37:g.5077459T>C	ENSP00000371067:p.Leu624Pro		5067459	NM_004972	O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.163611	0.78226	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	D;D;D	0.85556	-2.0;-2.0;-2.0	5.98	5.98	0.97165	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.052580	0.85682	D	0.000000	D	0.94202	0.8139	M	0.93420	3.415	0.80722	D	1	D	0.69078	0.997	D	0.68483	0.958	D	0.95462	0.8544	10	0.87932	D	0	-8.4724	16.4696	0.84102	0.0:0.0:0.0:1.0	.	624	O60674	JAK2_HUMAN	P	624;624;475	ENSP00000440387:L624P;ENSP00000371067:L624P;ENSP00000443103:L475P	ENSP00000371067:L624P	L	+	2	0	JAK2	5067459	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.628000	0.83189	2.289000	0.77006	0.482000	0.46254	CTG		0.219	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
KDM4C	23081	hgsc.bcm.edu	37	9	6990453	6990453	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:6990453G>A	ENST00000381309.3	+	12	2280	c.1715G>A	c.(1714-1716)cGc>cAc	p.R572H	KDM4C_ENST00000442236.2_Intron|KDM4C_ENST00000535193.1_Missense_Mutation_p.R594H|KDM4C_ENST00000543771.1_Missense_Mutation_p.R572H|KDM4C_ENST00000381306.3_Missense_Mutation_p.R572H|KDM4C_ENST00000536108.1_Missense_Mutation_p.R391H|KDM4C_ENST00000428870.2_Missense_Mutation_p.R259H	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	572					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)	p.R572H(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						AAGAGTTGGCGCCATCCACTT	0.418																																					p.R594H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1781A	9						.						61.0	53.0	56.0					9																	6990453		2203	4300	6503	6980453	SO:0001583	missense	23081	exon12			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.1715G>A	9.37:g.6990453G>A	ENSP00000370710:p.Arg572His		6980453	NM_001146696	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	37	CCDS6471.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059947	0.55325	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000536108;ENST00000428870	T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76	4.96	4.96	0.65561	.	0.111469	0.64402	D	0.000010	T	0.49012	0.1532	M	0.83384	2.64	0.58432	D	0.99999	P;P;P;P	0.47841	0.588;0.901;0.7;0.593	B;B;B;B	0.38985	0.103;0.287;0.103;0.14	T	0.55939	-0.8061	10	0.38643	T	0.18	-24.73	12.0345	0.53417	0.0824:0.0:0.9176:0.0	.	572;594;572;572	F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;KDM4C_HUMAN;.	H	594;572;572;572;391;259	ENSP00000442382:R594H;ENSP00000445427:R572H;ENSP00000370710:R572H;ENSP00000370707:R572H;ENSP00000440656:R391H;ENSP00000405739:R259H	ENSP00000370707:R572H	R	+	2	0	KDM4C	6980453	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	6.290000	0.72712	2.570000	0.86706	0.563000	0.77884	CGC		0.418	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
TTC39B	158219	hgsc.bcm.edu	37	9	15188020	15188020	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:15188020C>T	ENST00000512701.2	-	14	1380	c.1344G>A	c.(1342-1344)atG>atA	p.M448I	TTC39B_ENST00000507993.1_Missense_Mutation_p.M283I|TTC39B_ENST00000380850.4_Missense_Mutation_p.M435I|TTC39B_ENST00000355694.2_Missense_Mutation_p.M382I|TTC39B_ENST00000297615.5_Missense_Mutation_p.M379I|TTC39B_ENST00000507285.1_Missense_Mutation_p.M283I			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	448								p.M382I(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						AATATGCCTGCATCCAGTTTT	0.363																																					p.M435I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1305A	9						.						163.0	154.0	157.0					9																	15188020		2203	4300	6503	15178020	SO:0001583	missense	158219	exon13			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.1344G>A	9.37:g.15188020C>T	ENSP00000422496:p.Met448Ile		15178020	NM_001168340	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	ENST00000512701.2	37	CCDS6477.2	.	.	.	.	.	.	.	.	.	.	C	12.02	1.811557	0.32053	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993	T;T;T;T;T;T	0.41758	0.99;1.2;0.99;0.99;1.2;1.2	5.12	2.97	0.34412	.	0.363431	0.30177	N	0.010222	T	0.30103	0.0754	L	0.36672	1.1	0.80722	D	1	B;B;B;B;B	0.22211	0.03;0.066;0.048;0.004;0.001	B;B;B;B;B	0.25759	0.026;0.063;0.016;0.007;0.007	T	0.12785	-1.0534	10	0.46703	T	0.11	-9.334	6.4505	0.21900	0.3801:0.5243:0.0:0.0956	.	379;435;448;380;382	F5H705;E9PAQ9;E9PE60;A5PLN1;Q5VTQ0	.;.;.;.;TT39B_HUMAN	I	435;379;382;448;283;283	ENSP00000370231:M435I;ENSP00000297615:M379I;ENSP00000347920:M382I;ENSP00000422496:M448I;ENSP00000426539:M283I;ENSP00000423392:M283I	ENSP00000297615:M379I	M	-	3	0	TTC39B	15178020	0.995000	0.38212	1.000000	0.80357	0.979000	0.70002	0.962000	0.29280	1.293000	0.44690	0.460000	0.39030	ATG		0.363	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051758.3	NM_152574	
PLIN2	123	hgsc.bcm.edu	37	9	19123618	19123618	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:19123618T>C	ENST00000276914.2	-	4	433	c.254A>G	c.(253-255)aAg>aGg	p.K85R	PLIN2_ENST00000411567.1_Missense_Mutation_p.K85R|PLIN2_ENST00000380465.3_Missense_Mutation_p.K85R|PLIN2_ENST00000380464.3_Missense_Mutation_p.K85R	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	85					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.K85R(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						GTCTAGCCCCTTACAGGCATA	0.418																																					p.K85R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A254G	9						.						109.0	88.0	95.0					9																	19123618		2203	4300	6503	19113618	SO:0001583	missense	123	exon4			X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.254A>G	9.37:g.19123618T>C	ENSP00000276914:p.Lys85Arg		19113618	NM_001122	Q9BSC3	Missense_Mutation	SNP	ENST00000276914.2	37	CCDS6490.1	.	.	.	.	.	.	.	.	.	.	T	7.138	0.581198	0.13686	.	.	ENSG00000147872	ENST00000411567;ENST00000276914;ENST00000434144;ENST00000380465;ENST00000380464	T;T;T;T;T	0.07021	3.23;3.23;3.23;3.23;3.23	5.94	3.52	0.40303	.	0.259655	0.44483	D	0.000454	T	0.04588	0.0125	N	0.17800	0.525	0.31386	N	0.678436	B;B	0.15930	0.015;0.007	B;B	0.22152	0.027;0.038	T	0.28933	-1.0028	10	0.12766	T	0.61	.	4.9341	0.13932	0.3598:0.0919:0.0:0.5483	.	85;85	E9PG83;Q99541	.;PLIN2_HUMAN	R	85	ENSP00000415270:K85R;ENSP00000276914:K85R;ENSP00000403421:K85R;ENSP00000369832:K85R;ENSP00000369831:K85R	ENSP00000276914:K85R	K	-	2	0	PLIN2	19113618	0.981000	0.34729	1.000000	0.80357	0.877000	0.50540	2.457000	0.45005	1.078000	0.41014	0.482000	0.46254	AAG		0.418	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051835.1	NM_001122	
PLAA	9373	hgsc.bcm.edu	37	9	26907897	26907897	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:26907897C>G	ENST00000397292.3	-	13	2174	c.1757G>C	c.(1756-1758)aGt>aCt	p.S586T	PLAA_ENST00000520884.1_Missense_Mutation_p.S586T	NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	586	PUL. {ECO:0000255|PROSITE- ProRule:PRU00729}.				inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)	p.S529T(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		TTCTGAAGAACTATTACATAT	0.363																																					p.S586T	Melanoma(175;2670 2735 14091 35526)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1757C	9						.						112.0	110.0	111.0					9																	26907897		2203	4300	6503	26897897	SO:0001583	missense	9373	exon13			AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.1757G>C	9.37:g.26907897C>G	ENSP00000380460:p.Ser586Thr		26897897	NM_001031689	Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	Missense_Mutation	SNP	ENST00000397292.3	37	CCDS35000.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.995|1.995	-0.430941|-0.430941	0.04669|0.04669	.|.	.|.	ENSG00000137055|ENSG00000137055	ENST00000397292;ENST00000520884|ENST00000487173	T;T|.	0.52057|.	0.81;0.68|.	5.5|5.5	0.0969|0.0969	0.14492|0.14492	PUL (2);|.	0.706453|.	0.14808|.	N|.	0.297230|.	T|.	0.13543|.	0.0328|.	N|N	0.03608|0.03608	-0.345|-0.345	0.24928|0.24928	N|N	0.991935|0.991935	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|.	0.30592|.	-0.9973|.	10|.	0.07644|.	T|.	0.81|.	-4.1671|-4.1671	6.543|6.543	0.22390|0.22390	0.0:0.3463:0.2065:0.4472|0.0:0.3463:0.2065:0.4472	.|.	586;586|.	E5RIM3;Q9Y263|.	.;PLAP_HUMAN|.	T|Y	586|112	ENSP00000380460:S586T;ENSP00000429372:S586T|.	ENSP00000380460:S586T|.	S|X	-|-	2|3	0|2	PLAA|PLAA	26897897|26897897	0.972000|0.972000	0.33761|0.33761	0.991000|0.991000	0.47740|0.47740	0.984000|0.984000	0.73092|0.73092	0.001000|0.001000	0.13038|0.13038	-0.013000|-0.013000	0.14199|0.14199	0.650000|0.650000	0.86243|0.86243	AGT|TAG		0.363	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051958.2	NM_001031689	
TAF1L	138474	hgsc.bcm.edu	37	9	32633737	32633737	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:32633737G>T	ENST00000242310.4	-	1	1930	c.1841C>A	c.(1840-1842)gCt>gAt	p.A614D	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	614					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.A614D(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TAATTCCATAGCAGGAATTGA	0.478																																					p.A614D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1841A	9						.						101.0	109.0	106.0					9																	32633737		2203	4300	6503	32623737	SO:0001583	missense	138474	exon1			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.1841C>A	9.37:g.32633737G>T	ENSP00000418379:p.Ala614Asp		32623737	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.516137	0.64634	.	.	ENSG00000122728	ENST00000242310	T	0.27720	1.65	0.479	0.479	0.16796	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.051146	0.85682	D	0.000000	T	0.54919	0.1888	M	0.91717	3.235	0.45806	D	0.998681	D	0.60575	0.988	D	0.69654	0.965	T	0.57551	-0.7792	10	0.87932	D	0	.	6.6915	0.23174	2.0E-4:0.0:0.9998:0.0	.	614	Q8IZX4	TAF1L_HUMAN	D	614	ENSP00000418379:A614D	ENSP00000418379:A614D	A	-	2	0	TAF1L	32623737	1.000000	0.71417	0.988000	0.46212	0.523000	0.34469	6.137000	0.71710	0.507000	0.28148	0.195000	0.17529	GCT		0.478	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
RPP25L	138716	hgsc.bcm.edu	37	9	34611147	34611147	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:34611147G>A	ENST00000297613.4	-	2	427	c.147C>T	c.(145-147)ggC>ggT	p.G49G	DCTN3_ENST00000479399.1_5'Flank|RPP25L_ENST00000378959.4_Silent_p.G49G	NM_148179.2	NP_680545.1	Q8N5L8	RP25L_HUMAN	ribonuclease P/MRP 25kDa subunit-like	49						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G49G(1)									GAGCACTGCCGCCCTCCAACC	0.622																																					p.G49G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C147T	9						.						63.0	65.0	64.0					9																	34611147		2203	4300	6503	34601147	SO:0001819	synonymous_variant	138716	exon2			BC032136	CCDS6559.1	9p11.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164967	ENSG00000164967			19909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 23"""	C9orf23		16998185	Standard	NM_148178		Approved	bA296L22.5, MGC29635	uc003zuv.3	Q8N5L8	OTTHUMG00000000443	ENST00000297613.4:c.147C>T	9.37:g.34611147G>A			34601147	NM_148178	D3DRM5	Silent	SNP	ENST00000297613.4	37	CCDS6559.1																																																																																				0.622	RPP25L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001130.1	NM_148179	
FRMPD1	22844	hgsc.bcm.edu	37	9	37745558	37745558	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:37745558C>T	ENST00000539465.1	+	16	4122	c.3529C>T	c.(3529-3531)Ccc>Tcc	p.P1177S	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.P1177S			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1177						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.P1177S(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CCCACCACATCCCCCTAGAGA	0.483																																					p.P1177S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3529T	9						.						51.0	54.0	53.0					9																	37745558		2203	4300	6503	37735558	SO:0001583	missense	22844	exon16			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3529C>T	9.37:g.37745558C>T	ENSP00000444411:p.Pro1177Ser		37735558	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	C	0.391	-0.923334	0.02377	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.05717	3.4;3.4	4.6	-3.32	0.04973	.	2.068360	0.01607	N	0.022342	T	0.02848	0.0085	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.37572	-0.9700	10	0.20519	T	0.43	2.1281	2.7796	0.05357	0.3626:0.333:0.2135:0.0908	.	1177	Q5SYB0	FRPD1_HUMAN	S	1177	ENSP00000366995:P1177S;ENSP00000444411:P1177S	ENSP00000366995:P1177S	P	+	1	0	FRMPD1	37735558	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-1.171000	0.03115	-2.126000	0.00820	-2.455000	0.00206	CCC		0.483	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
MAMDC2	256691	hgsc.bcm.edu	37	9	72758601	72758601	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:72758601A>G	ENST00000377182.4	+	9	1887	c.1270A>G	c.(1270-1272)Atg>Gtg	p.M424V	MAMDC2-AS1_ENST00000591368.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	424	MAM 3. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						ATTTTTAAAAATGAGTGACAC	0.458																																					p.M424V												.	.	0			c.A1270G	9						.						122.0	118.0	119.0					9																	72758601		2203	4300	6503	71948421	SO:0001583	missense	256691	exon9			BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.1270A>G	9.37:g.72758601A>G	ENSP00000366387:p.Met424Val		71948421	NM_153267	Q5VW47|Q8WX43|Q96BM4	Missense_Mutation	SNP	ENST00000377182.4	37	CCDS6631.1	.	.	.	.	.	.	.	.	.	.	A	3.785	-0.044765	0.07452	.	.	ENSG00000165072	ENST00000377182	T	0.01854	4.6	5.91	5.91	0.95273	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.255887	0.52532	D	0.000069	T	0.03608	0.0103	L	0.44542	1.39	0.39819	D	0.972819	B	0.13594	0.008	B	0.23716	0.048	T	0.52087	-0.8622	10	0.29301	T	0.29	-23.1227	16.3351	0.83056	1.0:0.0:0.0:0.0	.	424	Q7Z304	MAMC2_HUMAN	V	424	ENSP00000366387:M424V	ENSP00000366387:M424V	M	+	1	0	MAMDC2	71948421	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.124000	0.64709	2.262000	0.75019	0.528000	0.53228	ATG		0.458	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052600.1	NM_153267	
COL5A1	1289	hgsc.bcm.edu	37	9	137671964	137671964	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr9:137671964G>A	ENST00000371817.3	+	28	2816	c.2402G>A	c.(2401-2403)cGt>cAt	p.R801H		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	801	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.R801H(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GATGGCATCCGTGGTCTGAAG	0.602																																					p.R801H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2402A	9						.						93.0	97.0	96.0					9																	137671964		2203	4300	6503	136811785	SO:0001583	missense	1289	exon28			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2402G>A	9.37:g.137671964G>A	ENSP00000360882:p.Arg801His		136811785	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991295	0.74703	.	.	ENSG00000130635	ENST00000371817	D	0.93604	-3.25	3.99	3.99	0.46301	.	.	.	.	.	D	0.95743	0.8615	M	0.62088	1.915	0.54753	D	0.999988	D	0.89917	1.0	D	0.91635	0.999	D	0.96336	0.9247	9	0.87932	D	0	.	15.2143	0.73250	0.0:0.0:1.0:0.0	.	801	P20908	CO5A1_HUMAN	H	801	ENSP00000360882:R801H	ENSP00000360882:R801H	R	+	2	0	COL5A1	136811785	1.000000	0.71417	0.934000	0.37439	0.584000	0.36387	8.204000	0.89741	1.933000	0.56026	0.655000	0.94253	CGT		0.602	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
NALCN	259232	hgsc.bcm.edu	37	13	101755545	101755545	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:101755545C>T	ENST00000251127.6	-	26	3116	c.3035G>A	c.(3034-3036)aGc>aAc	p.S1012N		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1012					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.S1012N(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTTGAAGCCGCTGAAAAGTTC	0.453																																					p.S1012N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3035A	13						.						108.0	114.0	112.0					13																	101755545		2203	4300	6503	100553546	SO:0001583	missense	259232	exon26			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3035G>A	13.37:g.101755545C>T	ENSP00000251127:p.Ser1012Asn		100553546	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.022541	0.54683	.	.	ENSG00000102452	ENST00000251127	D	0.98419	-4.92	5.03	5.03	0.67393	Ion transport (1);	0.089980	0.85682	D	0.000000	D	0.94988	0.8378	N	0.13140	0.3	0.80722	D	1	B	0.25235	0.121	B	0.23852	0.049	D	0.92352	0.5890	10	0.34782	T	0.22	.	18.7562	0.91833	0.0:1.0:0.0:0.0	.	1012	Q8IZF0	NALCN_HUMAN	N	1012	ENSP00000251127:S1012N	ENSP00000251127:S1012N	S	-	2	0	NALCN	100553546	1.000000	0.71417	0.977000	0.42913	0.941000	0.58515	5.454000	0.66651	2.488000	0.83962	0.650000	0.86243	AGC		0.453	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
NALCN	259232	hgsc.bcm.edu	37	13	101756753	101756753	+	Missense_Mutation	SNP	A	A	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:101756753A>T	ENST00000251127.6	-	25	2863	c.2782T>A	c.(2782-2784)Ttc>Atc	p.F928I		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	928					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.F928I(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATGCTCATGAATATCACAAAC	0.398																																					p.F928I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2782A	13						.						104.0	94.0	97.0					13																	101756753		2203	4300	6503	100554754	SO:0001583	missense	259232	exon25			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2782T>A	13.37:g.101756753A>T	ENSP00000251127:p.Phe928Ile		100554754	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	A	19.07	3.755113	0.69648	.	.	ENSG00000102452	ENST00000251127	D	0.98075	-4.7	5.81	5.81	0.92471	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.91901	0.7436	N	0.03209	-0.39	0.80722	D	1	B	0.32862	0.387	B	0.32289	0.143	D	0.91615	0.5306	10	0.15499	T	0.54	.	16.1612	0.81712	1.0:0.0:0.0:0.0	.	928	Q8IZF0	NALCN_HUMAN	I	928	ENSP00000251127:F928I	ENSP00000251127:F928I	F	-	1	0	NALCN	100554754	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.216000	0.71823	0.533000	0.62120	TTC		0.398	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
TPP2	7174	hgsc.bcm.edu	37	13	103282529	103282529	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:103282529T>C	ENST00000376065.4	+	10	1264	c.1228T>C	c.(1228-1230)Tct>Cct	p.S410P	TPP2_ENST00000376052.3_Missense_Mutation_p.S410P	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	410	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)	p.S410P(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATATACTTGGTCTTCTAGAGG	0.403																																					p.S410P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1228C	13						.						117.0	105.0	109.0					13																	103282529		2203	4300	6503	102080530	SO:0001583	missense	7174	exon10			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.1228T>C	13.37:g.103282529T>C	ENSP00000365233:p.Ser410Pro		102080530	NM_003291	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	37	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.630723	0.87660	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	T;T	0.74632	-0.86;-0.86	5.8	5.8	0.92144	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.89656	0.6778	H	0.97491	4.015	0.80722	D	1	D	0.61697	0.99	P	0.57679	0.825	D	0.93171	0.6566	10	0.72032	D	0.01	.	16.1606	0.81704	0.0:0.0:0.0:1.0	.	410	P29144	TPP2_HUMAN	P	410	ENSP00000365233:S410P;ENSP00000365220:S410P	ENSP00000365220:S410P	S	+	1	0	TPP2	102080530	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.470000	0.80973	2.227000	0.72691	0.460000	0.39030	TCT		0.403	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
ERCC5	2073	hgsc.bcm.edu	37	13	103519153	103519153	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:103519153T>C	ENST00000355739.4	+	11	3914	c.2491T>C	c.(2491-2493)Ttt>Ctt	p.F831L	BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.V1256A|ERCC5_ENST00000375954.1_Missense_Mutation_p.F64L	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	831	I-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)	p.F831L(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TAAAAACAAGTTTGTAGAATA	0.373			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.F831L		yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2491C	13						.						31.0	34.0	33.0					13																	103519153		2202	4300	6502	102317154	SO:0001583	missense	2073	exon11	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2491T>C	13.37:g.103519153T>C	ENSP00000347978:p.Phe831Leu		102317154	NM_000123	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	T	19.18	3.778359	0.70107	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	T;T	0.69435	-0.4;-0.4	5.77	5.77	0.91146	XPG/RAD2 endonuclease (2);	0.165836	0.53938	D	0.000044	T	0.53077	0.1774	L	0.28344	0.845	0.80722	D	1	P;B	0.41131	0.739;0.145	B;B	0.41723	0.365;0.298	T	0.51012	-0.8759	10	0.21014	T	0.42	-15.2122	10.4351	0.44430	0.0:0.0726:0.0:0.9274	.	831;1256	P28715;Q59FZ7	ERCC5_HUMAN;.	L	1256;831;663;64	ENSP00000347978:F831L;ENSP00000365121:F64L	ENSP00000347978:F831L	F	+	1	0	ERCC5	102317154	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.376000	0.52417	2.203000	0.70933	0.533000	0.62120	TTT		0.373	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
ABHD13	84945	hgsc.bcm.edu	37	13	108882412	108882412	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:108882412C>T	ENST00000375898.3	+	2	1147	c.846C>T	c.(844-846)ctC>ctT	p.L282L		NM_032859.2	NP_116248.2	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	282						integral component of membrane (GO:0016021)|membrane (GO:0016020)	hydrolase activity (GO:0016787)	p.L282L(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TTTATGAACTCTCCCCATCTC	0.413																																					p.L282L	Pancreas(22;506 789 38166 45896 51596)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C846T	13						.						88.0	89.0	88.0					13																	108882412		2203	4300	6503	107680413	SO:0001819	synonymous_variant	84945	exon2			AK027812	CCDS32007.1	13q33.2	2007-04-03	2006-03-10	2006-03-10	ENSG00000139826	ENSG00000139826		"""Abhydrolase domain containing"""	20293	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 6"""	C13orf6			Standard	NM_032859		Approved	bA153I24.2, FLJ14906, BEM46L1	uc001vqq.3	Q7L211	OTTHUMG00000017330	ENST00000375898.3:c.846C>T	13.37:g.108882412C>T			107680413	NM_032859	B3KWE7|Q8NBW1|Q96JX9	Silent	SNP	ENST00000375898.3	37	CCDS32007.1																																																																																				0.413	ABHD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045743.1	NM_032859	
COL4A1	1282	hgsc.bcm.edu	37	13	110807644	110807644	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:110807644A>G	ENST00000375820.4	-	50	4862	c.4741T>C	c.(4741-4743)Tac>Cac	p.Y1581H		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1581	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.Y1224H(1)|p.Y1581H(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			ACAAAAGAGTAGCCGATCCAC	0.612																																					p.Y1581H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T4741C	13						.						58.0	58.0	58.0					13																	110807644		2203	4300	6503	109605645	SO:0001583	missense	1282	exon50			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.4741T>C	13.37:g.110807644A>G	ENSP00000364979:p.Tyr1581His		109605645	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.781122	0.70222	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.96685	-4.09	5.31	5.31	0.75309	C-type lectin fold (1);	0.000000	0.85682	D	0.000000	D	0.98498	0.9499	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99731	1.1012	10	0.87932	D	0	.	15.2899	0.73857	1.0:0.0:0.0:0.0	.	1581	P02462	CO4A1_HUMAN	H	1224;1581;1230	ENSP00000364979:Y1581H	ENSP00000364973:Y1224H	Y	-	1	0	COL4A1	109605645	1.000000	0.71417	0.997000	0.53966	0.931000	0.56810	8.982000	0.93471	2.008000	0.58898	0.496000	0.49642	TAC		0.612	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
COL4A1	1282	hgsc.bcm.edu	37	13	110838876	110838876	+	Missense_Mutation	SNP	G	G	A	rs374223828		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:110838876G>A	ENST00000375820.4	-	26	1874	c.1753C>T	c.(1753-1755)Cgt>Tgt	p.R585C		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	585	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.R585C(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GGGGGGCCACGCTCTCCTTTC	0.547																																					p.R585C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1753T	13						.	G	CYS/ARG	2,4404	2.1+/-5.4	0,2,2201	30.0	34.0	32.0		1753	3.3	0.9	13		32	1,8599	1.2+/-3.3	0,1,4299	no	missense	COL4A1	NM_001845.4	180	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	probably-damaging	585/1670	110838876	3,13003	2203	4300	6503	109636877	SO:0001583	missense	1282	exon26			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1753C>T	13.37:g.110838876G>A	ENSP00000364979:p.Arg585Cys		109636877	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.931012	0.52866	4.54E-4	1.16E-4	ENSG00000187498	ENST00000375820	D	0.96168	-3.93	4.12	3.26	0.37387	.	0.208574	0.42548	D	0.000696	D	0.97495	0.9180	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.97729	1.0201	10	0.62326	D	0.03	.	13.6711	0.62424	0.0:0.0:0.8449:0.1551	.	585	P02462	CO4A1_HUMAN	C	585	ENSP00000364979:R585C	ENSP00000364979:R585C	R	-	1	0	COL4A1	109636877	1.000000	0.71417	0.939000	0.37840	0.794000	0.44872	4.294000	0.59043	1.047000	0.40274	0.655000	0.94253	CGT		0.547	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
ING1	3621	hgsc.bcm.edu	37	13	111371923	111371923	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:111371923G>A	ENST00000375774.3	+	2	1375	c.913G>A	c.(913-915)Gcg>Acg	p.A305T	ING1_ENST00000375775.3_Missense_Mutation_p.A93T|ING1_ENST00000333219.7_Missense_Mutation_p.A162T|ING1_ENST00000338450.7_Missense_Mutation_p.A118T	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	305					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.A162T(1)		endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CCGTGAGAACGCGTCCAGCAA	0.657																																					p.A162T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G484A	13						.						55.0	44.0	48.0					13																	111371923		2199	4299	6498	110169924	SO:0001583	missense	3621	exon2				CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.913G>A	13.37:g.111371923G>A	ENSP00000364929:p.Ala305Thr		110169924	NM_198219	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	ENST00000375774.3	37	CCDS9517.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.605052	0.28623	.	.	ENSG00000153487	ENST00000338450;ENST00000333219;ENST00000375775;ENST00000375774	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.36	5.36	0.76844	.	0.117840	0.56097	D	0.000022	T	0.39145	0.1067	L	0.51422	1.61	0.41181	D	0.986233	D;P;P	0.60160	0.987;0.858;0.854	P;B;B	0.45639	0.488;0.096;0.113	T	0.17623	-1.0363	10	0.10902	T	0.67	-29.626	13.981	0.64304	0.0:0.0:0.8483:0.1517	.	305;162;118	Q9UK53;Q5T9H0;Q9UK53-4	ING1_HUMAN;.;.	T	118;162;93;305	ENSP00000345202:A118T;ENSP00000328436:A162T;ENSP00000364930:A93T;ENSP00000364929:A305T	ENSP00000328436:A162T	A	+	1	0	ING1	110169924	1.000000	0.71417	0.882000	0.34594	0.109000	0.19521	4.149000	0.58091	2.506000	0.84524	0.491000	0.48974	GCG		0.657	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
CDX2	1045	hgsc.bcm.edu	37	13	28537485	28537485	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:28537485G>A	ENST00000381020.7	-	3	2841	c.709C>T	c.(709-711)Cgc>Tgc	p.R237C	CDX2_ENST00000548877.1_5'UTR	NM_001265.4	NP_001256.3	Q99626	CDX2_HUMAN	caudal type homeobox 2	237					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|endosome to lysosome transport (GO:0008333)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R237C(1)		endometrium(2)|large_intestine(1)|lung(6)	9	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)		TTTGCTCTGCGGTTCTGAAAC	0.517			T	ETV6	AML																																p.R237C			Dom	yes		13	13q12.3	1045	caudal type homeo box transcription factor 2		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C709T	13						.						61.0	39.0	47.0					13																	28537485		2200	4292	6492	27435485	SO:0001583	missense	1045	exon3			Y13709	CCDS9328.1	13q12.2	2012-03-09	2007-07-09		ENSG00000165556	ENSG00000165556		"""Homeoboxes / ANTP class : HOXL subclass"""	1806	protein-coding gene	gene with protein product		600297	"""caudal type homeo box transcription factor 2"""	CDX3		7698771	Standard	NM_001265		Approved		uc001urv.4	Q99626	OTTHUMG00000016640	ENST00000381020.7:c.709C>T	13.37:g.28537485G>A	ENSP00000370408:p.Arg237Cys		27435485	NM_001265	O00503|Q5VTU7|Q969L8|Q9UD92	Missense_Mutation	SNP	ENST00000381020.7	37	CCDS9328.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.006048	0.74932	.	.	ENSG00000165556	ENST00000381020	D	0.97831	-4.56	5.48	5.48	0.80851	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.64402	D	0.000015	D	0.99309	0.9758	H	0.99211	4.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98440	1.0586	10	0.87932	D	0	-36.9403	13.7935	0.63157	0.0:0.0:0.7155:0.2845	.	237	Q99626	CDX2_HUMAN	C	237	ENSP00000370408:R237C	ENSP00000370408:R237C	R	-	1	0	CDX2	27435485	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.387000	0.34430	2.572000	0.86782	0.655000	0.94253	CGC		0.517	CDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044312.5		
FLT3	2322	hgsc.bcm.edu	37	13	28636174	28636174	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:28636174C>T	ENST00000241453.7	-	3	279	c.198G>A	c.(196-198)gcG>gcA	p.A66A	FLT3_ENST00000537084.1_Silent_p.A66A|FLT3_ENST00000380982.4_Silent_p.A66A	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	66					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.A66A(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGGGTCTCAACGCACACCCGA	0.537			"""Mis, O"""		"""AML, ALL"""																																p.A66A			Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G198A	13						.						93.0	92.0	93.0					13																	28636174		2203	4300	6503	27534174	SO:0001819	synonymous_variant	2322	exon3			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.198G>A	13.37:g.28636174C>T			27534174	NM_004119	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Silent	SNP	ENST00000241453.7	37	CCDS31953.1																																																																																				0.537	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2		
DCLK1	9201	hgsc.bcm.edu	37	13	36367572	36367572	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:36367572T>C	ENST00000360631.3	-	16	2200	c.1989A>G	c.(1987-1989)ggA>ggG	p.G663G	DCLK1_ENST00000255448.4_Silent_p.G663G|DCLK1_ENST00000379893.1_Silent_p.G356G			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	663					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)	p.G663G(2)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TCTTTATCTTTCCAGCTACTG	0.388																																					p.G356G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A1068G	13						.						240.0	230.0	233.0					13																	36367572		2203	4300	6503	35265572	SO:0001819	synonymous_variant	9201	exon12			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1989A>G	13.37:g.36367572T>C			35265572	NM_001195416	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Silent	SNP	ENST00000360631.3	37																																																																																					0.388	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
FREM2	341640	hgsc.bcm.edu	37	13	39266192	39266192	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:39266192A>G	ENST00000280481.7	+	1	4927	c.4711A>G	c.(4711-4713)Act>Gct	p.T1571A		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1571					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T1571A(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CCTGAAATTCACTATCACCCA	0.423																																					p.T1571A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4711G	13						.						104.0	103.0	104.0					13																	39266192		2203	4300	6503	38164192	SO:0001583	missense	341640	exon1			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4711A>G	13.37:g.39266192A>G	ENSP00000280481:p.Thr1571Ala		38164192	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	A	11.71	1.721253	0.30503	.	.	ENSG00000150893	ENST00000280481	T	0.26223	1.75	6.07	6.07	0.98685	.	0.244803	0.47455	D	0.000224	T	0.34542	0.0901	M	0.77103	2.36	0.40719	D	0.982645	B	0.10296	0.003	B	0.15870	0.014	T	0.10382	-1.0632	10	0.36615	T	0.2	.	16.6277	0.84984	1.0:0.0:0.0:0.0	.	1571	Q5SZK8	FREM2_HUMAN	A	1571	ENSP00000280481:T1571A	ENSP00000280481:T1571A	T	+	1	0	FREM2	38164192	1.000000	0.71417	0.939000	0.37840	0.953000	0.61014	4.322000	0.59215	2.330000	0.79161	0.528000	0.53228	ACT		0.423	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
NAA16	79612	hgsc.bcm.edu	37	13	41932476	41932476	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:41932476G>T	ENST00000379406.3	+	11	1448	c.1124G>T	c.(1123-1125)tGg>tTg	p.W375L	NAA16_ENST00000403412.3_Missense_Mutation_p.W375L|NAA16_ENST00000379367.3_Missense_Mutation_p.W375L	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	375					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)	p.W375L(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						ACACTACTCTGGGTTCAGTAT	0.358																																					p.W375L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1124T	13						.						92.0	90.0	91.0					13																	41932476		2203	4300	6503	40830476	SO:0001583	missense	79612	exon11			AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.1124G>T	13.37:g.41932476G>T	ENSP00000368716:p.Trp375Leu		40830476	NM_024561	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	ENST00000379406.3	37	CCDS9379.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.119293	0.56505	.	.	ENSG00000172766	ENST00000379367;ENST00000379406;ENST00000403412	T;T;T	0.57107	0.42;0.42;0.42	5.02	5.02	0.67125	Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000006	T	0.77061	0.4075	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81134	-0.1071	10	0.56958	D	0.05	-5.1239	18.3123	0.90204	0.0:0.0:1.0:0.0	.	375;375	Q6N069;Q6N069-4	NAA16_HUMAN;.	L	375	ENSP00000368674:W375L;ENSP00000368716:W375L;ENSP00000386103:W375L	ENSP00000368674:W375L	W	+	2	0	NAA16	40830476	1.000000	0.71417	0.999000	0.59377	0.028000	0.11728	7.348000	0.79366	2.313000	0.78055	0.484000	0.47621	TGG		0.358	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
MLNR	2862	hgsc.bcm.edu	37	13	49796456	49796456	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:49796456T>C	ENST00000218721.1	+	2	1182	c.1182T>C	c.(1180-1182)acT>acC	p.T394T	MLNR_ENST00000398307.1_3'UTR	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	394					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)	p.T394T(1)		endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		CAGGGGACACTGGAGGAGACA	0.582																																					p.T394T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1182C	13						.						52.0	53.0	53.0					13																	49796456		2203	4300	6503	48694457	SO:0001819	synonymous_variant	2862	exon2			AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.1182T>C	13.37:g.49796456T>C			48694457	NM_001507		Silent	SNP	ENST00000218721.1	37	CCDS9414.1																																																																																				0.582	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044897.1	NM_001507	
ATP4B	496	hgsc.bcm.edu	37	13	114303758	114303758	+	Silent	SNP	G	G	A	rs541430131		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr13:114303758G>A	ENST00000335288.4	-	7	848	c.807C>T	c.(805-807)caC>caT	p.H269H		NM_000705.3	NP_000696.1	P51164	ATP4B_HUMAN	ATPase, H+/K+ exchanging, beta polypeptide	269	immunoglobulin-like.				cell adhesion (GO:0007155)|hydrogen ion transmembrane transport (GO:1902600)|ion transmembrane transport (GO:0034220)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	hydrogen:potassium-exchanging ATPase activity (GO:0008900)	p.H269H(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.171)			TGAAGGTCACGTGCTCCGCCA	0.577													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20184	0.0		0.0	False		,,,				2504	0.0				p.H269H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C807T	13						.						117.0	82.0	94.0					13																	114303758		2203	4300	6503	113351759	SO:0001819	synonymous_variant	496	exon7				CCDS9539.1	13q34	2011-08-01			ENSG00000186009	ENSG00000186009	3.6.3.10	"""ATPases / P-type"""	820	protein-coding gene	gene with protein product		137217				1330887, 15057823	Standard	NM_000705		Approved	ATP6B	uc001vtz.3	P51164	OTTHUMG00000140234	ENST00000335288.4:c.807C>T	13.37:g.114303758G>A			113351759	NM_000705	B1B0N8	Silent	SNP	ENST00000335288.4	37	CCDS9539.1																																																																																				0.577	ATP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276703.2	NM_000705	
LOXL4	84171	hgsc.bcm.edu	37	10	100020854	100020854	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:100020854G>A	ENST00000260702.3	-	4	637	c.487C>T	c.(487-489)Ccc>Tcc	p.P163S		NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	163	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.P163S(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		GCAAGGATGGGCTTGAGCCGC	0.672																																					p.P163S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C487T	10						.						77.0	62.0	67.0					10																	100020854		2203	4300	6503	100010844	SO:0001583	missense	84171	exon4			AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.487C>T	10.37:g.100020854G>A	ENSP00000260702:p.Pro163Ser		100010844	NM_032211	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Missense_Mutation	SNP	ENST00000260702.3	37	CCDS7473.1	.	.	.	.	.	.	.	.	.	.	G	33	5.251150	0.95305	.	.	ENSG00000138131	ENST00000260702	T	0.42131	0.98	5.43	5.43	0.79202	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	0.049776	0.85682	D	0.000000	T	0.66867	0.2833	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63216	-0.6687	10	0.34782	T	0.22	.	19.4202	0.94719	0.0:0.0:1.0:0.0	.	163	Q96JB6	LOXL4_HUMAN	S	163	ENSP00000260702:P163S	ENSP00000260702:P163S	P	-	1	0	LOXL4	100010844	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.612000	0.98347	2.825000	0.97269	0.655000	0.94253	CCC		0.672	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049766.1	NM_032211	
CPN1	1369	hgsc.bcm.edu	37	10	101823465	101823465	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:101823465G>A	ENST00000370418.3	-	5	1028	c.777C>T	c.(775-777)tcC>tcT	p.S259S		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	259	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.S259S(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		CATGTGCATAGGAGTAGACCT	0.493																																					p.S259S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C777T	10						.						100.0	91.0	94.0					10																	101823465		2203	4300	6503	101813455	SO:0001819	synonymous_variant	1369	exon5			X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.777C>T	10.37:g.101823465G>A			101813455	NM_001308	B1AP59	Silent	SNP	ENST00000370418.3	37	CCDS7486.1																																																																																				0.493	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049828.1	NM_001308	
CNNM2	54805	hgsc.bcm.edu	37	10	104679597	104679597	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:104679597C>T	ENST00000369878.4	+	1	1548	c.1360C>T	c.(1360-1362)Cgg>Tgg	p.R454W	CNNM2_ENST00000369875.3_Missense_Mutation_p.R454W|CNNM2_ENST00000433628.2_Missense_Mutation_p.R454W	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	454	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)	p.R454R(2)|p.R454W(2)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GACCCCACTCCGGGACTGCTT	0.577																																					p.R454W												.	.	4	Substitution - Missense(2)|Substitution - coding silent(2)	large_intestine(2)|lung(2)	c.C1360T	10						.						70.0	63.0	66.0					10																	104679597		2203	4300	6503	104669587	SO:0001583	missense	54805	exon1			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1360C>T	10.37:g.104679597C>T	ENSP00000358894:p.Arg454Trp		104669587	NM_199077	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	ENST00000369878.4	37	CCDS44474.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972756	0.53614	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369875;ENST00000369878;ENST00000345419;ENST00000541201	T;T;T	0.78364	-1.17;-1.17;-1.17	4.81	3.87	0.44632	Cystathionine beta-synthase, core (1);	0.107611	0.64402	D	0.000006	T	0.81997	0.4941	L	0.41236	1.265	0.54753	D	0.999982	D;D;D	0.76494	0.993;0.988;0.999	D;P;D	0.67103	0.913;0.821;0.949	T	0.83056	-0.0150	10	0.66056	D	0.02	.	13.8351	0.63404	0.1592:0.8408:0.0:0.0	.	454;454;454	Q9H8M5-2;Q9H8M5;F5H1I3	.;CNNM2_HUMAN;.	W	454	ENSP00000392875:R454W;ENSP00000358891:R454W;ENSP00000358894:R454W	ENSP00000286899:R454W	R	+	1	2	CNNM2	104669587	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.165000	0.50778	0.926000	0.37118	0.555000	0.69702	CGG		0.577	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649	
MXI1	4601	hgsc.bcm.edu	37	10	112044669	112044669	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:112044669A>G	ENST00000239007.7	+	6	829	c.611A>G	c.(610-612)gAc>gGc	p.D204G	MXI1_ENST00000485566.1_3'UTR|MXI1_ENST00000369612.1_Missense_Mutation_p.D168G|MXI1_ENST00000393134.1_Missense_Mutation_p.D194G|MXI1_ENST00000361248.4_Missense_Mutation_p.D158G|MXI1_ENST00000332674.5_Missense_Mutation_p.D271G	NM_005962.4	NP_005953.4	P50539	MXI1_HUMAN	MAX interactor 1, dimerization protein	204					cytoplasmic sequestering of transcription factor (GO:0042994)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)	p.D271G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(1)	10		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)		GACATTGATGACCACAGCAGC	0.468																																					p.D271G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A812G	10						.						142.0	113.0	123.0					10																	112044669		2203	4300	6503	112034659	SO:0001583	missense	4601	exon6			BC016678	CCDS7563.1, CCDS7564.2, CCDS31284.1	10q24-q25	2012-11-15	2012-11-15		ENSG00000119950	ENSG00000119950		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7534	protein-coding gene	gene with protein product		600020	"""MAX interacting protein 1"", ""MAX interactor 1"""			7959753	Standard	NM_130439		Approved	MXD2, MAD2, MXI, bHLHc11	uc001kyy.3	P50539	OTTHUMG00000019033	ENST00000239007.7:c.611A>G	10.37:g.112044669A>G	ENSP00000239007:p.Asp204Gly		112034659	NM_130439	B1ANN7|D3DR25|D3DRA9|Q15887|Q6FHW2|Q96E53	Missense_Mutation	SNP	ENST00000239007.7	37	CCDS7564.2	.	.	.	.	.	.	.	.	.	.	A	18.96	3.733771	0.69189	.	.	ENSG00000119950	ENST00000332674;ENST00000361248;ENST00000239007;ENST00000369619;ENST00000393134;ENST00000369614;ENST00000369613;ENST00000369612	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.57695	0.2071	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	0.997;0.998;0.997;1.0	D;D;D;D	0.87578	0.989;0.995;0.989;0.998	T	0.61417	-0.7067	10	0.87932	D	0	-7.662	16.4439	0.83910	1.0:0.0:0.0:0.0	.	194;168;204;271	B1ANN8;P50539-2;P50539;P50539-3	.;.;MXI1_HUMAN;.	G	271;158;204;194;194;168;168;168	ENSP00000331152:D271G;ENSP00000354606:D158G;ENSP00000239007:D204G;ENSP00000376842:D194G;ENSP00000358625:D168G	ENSP00000239007:D204G	D	+	2	0	MXI1	112034659	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.923000	0.92808	2.282000	0.76494	0.533000	0.62120	GAC		0.468	MXI1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050316.1	NM_130439	
VTI1A	143187	hgsc.bcm.edu	37	10	114428745	114428745	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:114428745G>T	ENST00000393077.2	+	7	664	c.548G>T	c.(547-549)gGg>gTg	p.G183V	RP11-25C19.3_ENST00000443652.1_RNA|VTI1A_ENST00000432306.1_Missense_Mutation_p.G183V	NM_145206.2	NP_660207.2	Q96AJ9	VTI1A_HUMAN	vesicle transport through interaction with t-SNAREs 1A	183					intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNAP receptor activity (GO:0005484)	p.G183V(1)	VTI1A/TCF7L2(8)	breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		ATTCTGACAGGGATGTTGCGA	0.358			T	TCF7L2	colorectal																																p.G183V			Dom	yes		10	10q25.2	143187	vesicle transport through interaction with t-SNAREs homolog 1A		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G548T	10						.						162.0	159.0	160.0					10																	114428745		2203	4300	6503	114418735	SO:0001583	missense	143187	exon7			BC017052	CCDS7575.2	10q25.2	2012-12-10	2012-12-10		ENSG00000151532	ENSG00000151532			17792	protein-coding gene	gene with protein product		614316	"""vesicle transport through interaction with t-SNAREs homolog 1A (yeast)"""			9446565	Standard	NM_145206		Approved	MVti1, Vti1a, Vti1-rp2	uc001kzz.3	Q96AJ9	OTTHUMG00000019063	ENST00000393077.2:c.548G>T	10.37:g.114428745G>T	ENSP00000376792:p.Gly183Val		114418735	NM_145206	A2A307|B4E137|Q5W0D7	Missense_Mutation	SNP	ENST00000393077.2	37	CCDS7575.2	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916602	0.52546	.	.	ENSG00000151532	ENST00000393077;ENST00000432306	T;T	0.76186	-1.0;-1.0	5.74	5.74	0.90152	Target SNARE coiled-coil domain (1);	0.000000	0.85682	D	0.000000	T	0.72669	0.3489	L	0.47190	1.495	0.80722	D	1	P;B	0.37207	0.587;0.146	B;B	0.39027	0.288;0.178	T	0.69705	-0.5073	10	0.34782	T	0.22	-38.8262	20.2982	0.98569	0.0:0.0:1.0:0.0	.	183;183	Q5W0D7;Q96AJ9	.;VTI1A_HUMAN	V	183	ENSP00000376792:G183V;ENSP00000395017:G183V	ENSP00000376792:G183V	G	+	2	0	VTI1A	114418735	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.132000	0.94455	2.873000	0.98535	0.563000	0.77884	GGG		0.358	VTI1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050397.2		
NSMCE4A	54780	hgsc.bcm.edu	37	10	123727219	123727219	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:123727219C>T	ENST00000369023.3	-	4	655	c.604G>A	c.(604-606)Ggc>Agc	p.G202S	NSMCE4A_ENST00000538652.1_Missense_Mutation_p.G43S|NSMCE4A_ENST00000369017.5_Missense_Mutation_p.G202S|NSMCE4A_ENST00000489266.1_5'UTR	NM_001167865.1|NM_017615.2	NP_001161337.1|NP_060085.2	Q9NXX6	NSE4A_HUMAN	non-SMC element 4 homolog A (S. cerevisiae)	202					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of response to DNA damage stimulus (GO:2001022)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)		p.G202S(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	6		all_neural(114;0.138)|Glioma(114;0.222)				GCTGTTCTGCCTGTTATCTTC	0.358																																					p.G202S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G604A	10						.						198.0	193.0	195.0					10																	123727219		2203	4300	6503	123717209	SO:0001583	missense	54780	exon4			AF258584	CCDS7624.1	10q26.13	2007-05-17	2006-11-24	2006-11-24	ENSG00000107672	ENSG00000107672			25935	protein-coding gene	gene with protein product		612987	"""chromosome 10 open reading frame 86"""	C10orf86		15752197	Standard	NM_017615		Approved	FLJ20003, bA500G22.3, NSE4A	uc001lfs.3	Q9NXX6	OTTHUMG00000019180	ENST00000369023.3:c.604G>A	10.37:g.123727219C>T	ENSP00000358019:p.Gly202Ser		123717209	NM_001167865	Q5SQQ5|Q6P673|Q8WY66|Q9BS90	Missense_Mutation	SNP	ENST00000369023.3	37	CCDS7624.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.582365	0.86748	.	.	ENSG00000107672	ENST00000369023;ENST00000538652;ENST00000369017	T;T	0.64618	-0.11;1.5	5.4	4.48	0.54585	.	0.097819	0.64402	D	0.000001	T	0.76926	0.4056	M	0.73962	2.25	0.47511	D	0.999448	D;D;D	0.69078	0.987;0.997;0.972	P;D;P	0.64144	0.843;0.922;0.794	T	0.80650	-0.1288	10	0.72032	D	0.01	-9.696	15.3037	0.73976	0.0:0.8589:0.1411:0.0	.	43;202;202	B4DWS2;Q9NXX6-2;Q9NXX6	.;.;NSE4A_HUMAN	S	202;43;202	ENSP00000358019:G202S;ENSP00000358013:G202S	ENSP00000358013:G202S	G	-	1	0	NSMCE4A	123717209	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.766000	0.68843	1.390000	0.46547	0.591000	0.81541	GGC		0.358	NSMCE4A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050749.1	NM_017615	
CPXM2	119587	hgsc.bcm.edu	37	10	125558632	125558632	+	Splice_Site	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:125558632A>G	ENST00000241305.3	-	5	891	c.737T>C	c.(736-738)aTg>aCg	p.M246T	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	246	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.M246T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		GAGACTCACCATGTCTCCAGA	0.453																																					p.M246T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T737C	10						.						232.0	192.0	206.0					10																	125558632		2203	4300	6503	125548622	SO:0001630	splice_region_variant	119587	exon5			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.738+1T>C	10.37:g.125558632A>G			125548622	NM_198148	B4E3Q2	Missense_Mutation	SNP	ENST00000241305.3	37	CCDS7637.1	.	.	.	.	.	.	.	.	.	.	A	14.42	2.530743	0.45073	.	.	ENSG00000121898	ENST00000241305;ENST00000540123;ENST00000418782	D	0.97209	-4.29	4.96	4.96	0.65561	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.422697	0.27105	N	0.020920	D	0.94069	0.8099	L	0.28776	0.89	0.80722	D	1	B	0.32862	0.387	B	0.33960	0.173	D	0.93818	0.7116	10	0.62326	D	0.03	-7.2079	14.6331	0.68671	1.0:0.0:0.0:0.0	.	246	Q8N436	CPXM2_HUMAN	T	246;79;246	ENSP00000241305:M246T	ENSP00000241305:M246T	M	-	2	0	CPXM2	125548622	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.720000	0.68470	1.871000	0.54225	0.528000	0.53228	ATG		0.453	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148	Missense_Mutation
FANK1	92565	hgsc.bcm.edu	37	10	127696982	127696982	+	Missense_Mutation	SNP	G	G	A	rs373547952		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:127696982G>A	ENST00000368693.1	+	8	816	c.712G>A	c.(712-714)Gtc>Atc	p.V238I	FANK1_ENST00000477963.1_3'UTR|FANK1_ENST00000368695.1_Missense_Mutation_p.V232I			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	238						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V238I(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				ACAGGTAGACGTCGTGGACAC	0.478																																					p.V238I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G712A	10						.	G	ILE/VAL	0,4406		0,0,2203	113.0	113.0	113.0		712	4.7	0.0	10		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	FANK1	NM_145235.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	238/346	127696982	1,13005	2203	4300	6503	127686972	SO:0001583	missense	92565	exon8			BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.712G>A	10.37:g.127696982G>A	ENSP00000357682:p.Val238Ile		127686972	NM_145235	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	ENST00000368693.1	37	CCDS31309.1	.	.	.	.	.	.	.	.	.	.	G	5.893	0.348822	0.11126	0.0	1.16E-4	ENSG00000203780	ENST00000368695;ENST00000368693;ENST00000368691;ENST00000368692	T;T;T	0.64618	0.66;0.66;-0.11	5.62	4.72	0.59763	Ankyrin repeat-containing domain (3);	0.521465	0.17776	N	0.162434	T	0.42675	0.1213	N	0.21617	0.685	0.18873	N	0.999985	B;P;B	0.34815	0.007;0.47;0.331	B;B;B	0.28784	0.003;0.057;0.094	T	0.26430	-1.0103	10	0.34782	T	0.22	-6.2673	8.3776	0.32453	0.0785:0.2997:0.6218:0.0	.	264;238;238	Q8TC84-3;Q8TC84-2;Q8TC84	.;.;FANK1_HUMAN	I	232;238;216;264	ENSP00000357684:V232I;ENSP00000357682:V238I;ENSP00000357680:V216I	ENSP00000357680:V216I	V	+	1	0	FANK1	127686972	0.001000	0.12720	0.034000	0.17996	0.110000	0.19582	0.838000	0.27572	1.362000	0.46000	0.655000	0.94253	GTC		0.478	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
DIP2C	22982	hgsc.bcm.edu	37	10	390977	390979	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	GCC	GCC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:390977_390979delGCC	ENST00000280886.6	-	27	3390_3392	c.3303_3305delGGC	c.(3301-3306)gcggct>gct	p.1101_1102AA>A		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1101						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.A1102delA(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GACGTCCACAGCCGCCGCCGCCT	0.596																																					p.1101_1102del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.3303_3305del	10						.																																			380979	SO:0001651	inframe_deletion	22982	exon27			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3303_3305delGGC	10.37:g.390986_390988delGCC	ENSP00000280886:p.Ala1102del		380977	NM_014974	B4DPI5|Q5SS78	In_Frame_Del	DEL	ENST00000280886.6	37	CCDS7054.1																																																																																				0.596	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
DIP2C	22982	hgsc.bcm.edu	37	10	460003	460003	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:460003G>T	ENST00000280886.6	-	8	994	c.907C>A	c.(907-909)Ctg>Atg	p.L303M	DIP2C_ENST00000381496.3_Missense_Mutation_p.L196M	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	303						nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.L303M(1)		breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CGCATGGCCAGCATCTGGGCC	0.597																																					p.L303M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C907A	10						.						45.0	48.0	47.0					10																	460003		2203	4300	6503	450003	SO:0001583	missense	22982	exon8			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.907C>A	10.37:g.460003G>T	ENSP00000280886:p.Leu303Met		450003	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.819535	0.32145	.	.	ENSG00000151240	ENST00000280886;ENST00000381496	T;T	0.48522	0.81;0.81	5.41	3.28	0.37604	.	0.142496	0.47852	D	0.000214	T	0.25419	0.0618	N	0.11427	0.14	0.36671	D	0.878501	B	0.02656	0.0	B	0.09377	0.004	T	0.08554	-1.0716	10	0.49607	T	0.09	-21.3726	6.2961	0.21087	0.5957:0.0:0.4043:0.0	.	303	Q9Y2E4	DIP2C_HUMAN	M	303;196	ENSP00000280886:L303M;ENSP00000370907:L196M	ENSP00000280886:L303M	L	-	1	2	DIP2C	450003	0.975000	0.34042	1.000000	0.80357	0.922000	0.55478	0.286000	0.18902	0.490000	0.27771	0.655000	0.94253	CTG		0.597	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
ITIH5	80760	hgsc.bcm.edu	37	10	7621894	7621894	+	Silent	SNP	C	C	T	rs145737784	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:7621894C>T	ENST00000256861.6	-	9	1320	c.1242G>A	c.(1240-1242)acG>acA	p.T414T	ITIH5_ENST00000298441.6_Silent_p.T200T|ITIH5_ENST00000446830.2_Silent_p.T196T|ITIH5_ENST00000397145.2_Silent_p.T414T|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000397146.2_Silent_p.T414T	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	414	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.T414T(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TGAGGGTGTGCGTCTCCCCGA	0.612													C|||	18	0.00359425	0.0121	0.0014	5008	,	,		18384	0.0		0.001	False		,,,				2504	0.0				p.T414T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1242A	10						.	C	,,	21,4385	28.1+/-56.4	0,21,2182	133.0	118.0	123.0		1242,1242,600	1.2	0.4	10	dbSNP_134	123	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	ITIH5	NM_001001851.2,NM_030569.6,NM_032817.5	,,	0,21,6482	TT,TC,CC		0.0,0.4766,0.1615	,,	414/703,414/943,200/729	7621894	21,12985	2203	4300	6503	7661900	SO:0001819	synonymous_variant	80760	exon9					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1242G>A	10.37:g.7621894C>T			7661900	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37																																																																																					0.612	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
CUBN	8029	hgsc.bcm.edu	37	10	16967384	16967384	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:16967384G>A	ENST00000377833.4	-	43	6567	c.6502C>T	c.(6502-6504)Ccc>Tcc	p.P2168S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2168	CUB 15. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.P2168S(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCTCCAGGGGGTCCCAAGGGT	0.393																																					p.P2168S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6502T	10						.						56.0	58.0	57.0					10																	16967384		2203	4300	6503	17007390	SO:0001583	missense	8029	exon43			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6502C>T	10.37:g.16967384G>A	ENSP00000367064:p.Pro2168Ser		17007390	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	4.922	0.171246	0.09391	.	.	ENSG00000107611	ENST00000377833	T	0.75050	-0.9	5.02	0.934	0.19477	CUB (5);	0.146245	0.32015	N	0.006703	T	0.49029	0.1533	N	0.16130	0.375	0.09310	N	0.999999	B	0.24092	0.097	B	0.27076	0.076	T	0.33929	-0.9849	10	0.08179	T	0.78	.	5.8654	0.18773	0.206:0.0:0.4751:0.3189	.	2168	O60494	CUBN_HUMAN	S	2168	ENSP00000367064:P2168S	ENSP00000367064:P2168S	P	-	1	0	CUBN	17007390	0.003000	0.15002	0.071000	0.20095	0.725000	0.41563	0.444000	0.21661	-0.102000	0.12197	-0.797000	0.03246	CCC		0.393	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
YME1L1	10730	hgsc.bcm.edu	37	10	27409420	27409420	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:27409420A>G	ENST00000326799.3	-	14	1674	c.1526T>C	c.(1525-1527)gTa>gCa	p.V509A	YME1L1_ENST00000376016.3_Missense_Mutation_p.V452A|YME1L1_ENST00000375972.3_Missense_Mutation_p.V419A	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	509					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.V509A(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						TCGACCTTTTACATCTGGCCT	0.308																																					p.V452A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1355C	10						.						97.0	94.0	95.0					10																	27409420		2203	4300	6503	27449426	SO:0001583	missense	10730	exon13			AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.1526T>C	10.37:g.27409420A>G	ENSP00000318480:p.Val509Ala		27449426	NM_014263	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	ENST00000326799.3	37	CCDS7152.1	.	.	.	.	.	.	.	.	.	.	A	14.80	2.644616	0.47258	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000546122	T;T;T	0.78003	-1.14;-1.14;-1.14	5.72	3.38	0.38709	Peptidase M41, FtsH (2);	0.106917	0.64402	D	0.000006	T	0.81908	0.4922	L	0.48935	1.535	0.58432	D	0.999996	D;D;D	0.64830	0.994;0.991;0.972	D;D;P	0.70716	0.97;0.916;0.599	T	0.80894	-0.1178	10	0.87932	D	0	-7.1225	9.3516	0.38142	0.7512:0.1275:0.0:0.1213	.	419;452;509	B4DNM1;Q96TA2-2;Q96TA2	.;.;YMEL1_HUMAN	A	452;509;509;419;255	ENSP00000365184:V452A;ENSP00000318480:V509A;ENSP00000365139:V419A	ENSP00000318480:V509A	V	-	2	0	YME1L1	27449426	1.000000	0.71417	0.646000	0.29493	0.053000	0.15095	9.236000	0.95360	0.521000	0.28445	-1.137000	0.01932	GTA		0.308	YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1	NM_139312	
ZEB1	6935	hgsc.bcm.edu	37	10	31809248	31809248	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:31809248C>T	ENST00000320985.10	+	7	1095	c.985C>T	c.(985-987)Cgg>Tgg	p.R329W	ZEB1_ENST00000560721.2_Missense_Mutation_p.R309W|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000446923.2_Missense_Mutation_p.R313W|ZEB1_ENST00000542815.3_Missense_Mutation_p.R262W|ZEB1_ENST00000361642.5_Missense_Mutation_p.R330W			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	329					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R329W(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				ACCACAGATACGGCAAAAGAT	0.438																																					p.R309W	Ovarian(40;423 959 14296 36701 49589)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C925T	10						.						119.0	120.0	119.0					10																	31809248		2203	4300	6503	31849254	SO:0001583	missense	6935	exon6			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.985C>T	10.37:g.31809248C>T	ENSP00000319248:p.Arg329Trp		31849254	NM_001174093	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	37	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	C	17.14	3.314593	0.60524	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000543514;ENST00000446923	T;T;T;T;T	0.15487	2.73;2.42;2.48;2.42;2.47	5.62	4.71	0.59529	.	0.000000	0.56097	D	0.000038	T	0.39436	0.1078	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.991;0.999;0.999;0.998;0.999;0.999	T	0.28522	-1.0041	10	0.87932	D	0	-13.3496	15.9924	0.80217	0.1357:0.8643:0.0:0.0	.	262;329;313;329;329;309;330;329	F5H4I8;F5H1R1;E9PCM7;B2RBI8;A0JLS9;Q5VZ84;Q2KJ05;P37275	.;.;.;.;.;.;.;ZEB1_HUMAN	W	111;329;330;329;262;329;309;188;220;313	ENSP00000444282:R111W;ENSP00000354487:R330W;ENSP00000444891:R262W;ENSP00000319248:R329W;ENSP00000391612:R313W	ENSP00000319248:R329W	R	+	1	2	ZEB1	31849254	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	2.581000	0.46077	1.357000	0.45904	0.655000	0.94253	CGG		0.438	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
VSTM4	196740	hgsc.bcm.edu	37	10	50311825	50311825	+	Intron	SNP	C	C	T	rs150667147		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:50311825C>T	ENST00000332853.4	-	2	481				VSTM4_ENST00000298454.3_Missense_Mutation_p.A180T	NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A180T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						GTTAAGTCTGCGGTGAAGGGC	0.498																																					p.A180T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G538A	10						.	T	,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	113.0	104.0	107.0		,538	-1.0	0.0	10	dbSNP_134	107	0,8600		0,0,4300	no	intron,missense	VSTM4	NM_001031746.3,NM_144984.2	,58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	,180/192	50311825	1,13005	2203	4300	6503	49981831	SO:0001627	intron_variant	196740	exon3			BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.457+3813G>A	10.37:g.50311825C>T			49981831	NM_144984	B4DNI6|Q96MX7	Missense_Mutation	SNP	ENST00000332853.4	37	CCDS31198.1	.	.	.	.	.	.	.	.	.	.	c	0.016	-1.532577	0.00951	2.27E-4	0.0	ENSG00000165633	ENST00000298454	T	0.14266	2.52	2.75	-1.02	0.10135	.	.	.	.	.	T	0.04679	0.0127	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42899	-0.9424	8	0.02654	T	1	.	7.1874	0.25806	0.0:0.4156:0.0:0.5844	.	180	Q8IW00-2	.	T	180	ENSP00000298454:A180T	ENSP00000298454:A180T	A	-	1	0	VSTM4	49981831	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.897000	0.00339	-0.618000	0.05656	-1.849000	0.00571	GCA		0.498	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047966.2	NM_144984	
CSTF2T	23283	hgsc.bcm.edu	37	10	53458365	53458365	+	Silent	SNP	A	A	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:53458365A>C	ENST00000331173.4	-	1	990	c.945T>G	c.(943-945)ccT>ccG	p.P315P	PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373980.4_Intron|PRKG1_ENST00000373985.1_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	315	Gly-rich.				mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P315P(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		CGGGTCCGCGAGGTATAGGAG	0.572																																					p.P315P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T945G	10						.						73.0	70.0	71.0					10																	53458365		2203	4300	6503	53128371	SO:0001819	synonymous_variant	23283	exon1			AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.945T>G	10.37:g.53458365A>C			53128371	NM_015235	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Silent	SNP	ENST00000331173.4	37	CCDS7245.1																																																																																				0.572	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048097.1	NM_015235	
HERC4	26091	hgsc.bcm.edu	37	10	69793760	69793760	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:69793760C>T	ENST00000395198.3	-	6	894	c.647G>A	c.(646-648)cGc>cAc	p.R216H	HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000373700.4_Missense_Mutation_p.R216H|HERC4_ENST00000277817.6_Missense_Mutation_p.R106H|HERC4_ENST00000412272.2_Missense_Mutation_p.R216H	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	216					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R216H(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						AAACTTGTTGCGTCCCCATCC	0.408																																					p.R216H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G647A	10						.						87.0	77.0	80.0					10																	69793760		2203	4300	6503	69463766	SO:0001583	missense	26091	exon6			AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.647G>A	10.37:g.69793760C>T	ENSP00000378624:p.Arg216His		69463766	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.850531	0.91277	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700;ENST00000513996	D;D;D;D;T	0.86497	-2.13;-2.13;-2.13;-2.13;-1.46	5.46	5.46	0.80206	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.052018	0.85682	D	0.000000	D	0.92424	0.7595	L	0.58583	1.82	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.72075	0.966;0.976;0.921;0.969	D	0.92815	0.6267	10	0.72032	D	0.01	.	19.2988	0.94134	0.0:1.0:0.0:0.0	.	216;216;216;216	Q5GLZ8-3;A8K9U4;Q5GLZ8-2;Q5GLZ8	.;.;.;HERC4_HUMAN	H	106;216;216;216;240	ENSP00000277817:R106H;ENSP00000416504:R216H;ENSP00000378624:R216H;ENSP00000362804:R216H;ENSP00000427191:R240H	ENSP00000277817:R106H	R	-	2	0	HERC4	69463766	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.570000	0.60872	2.543000	0.85770	0.563000	0.77884	CGC		0.408	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
MYPN	84665	hgsc.bcm.edu	37	10	69902841	69902841	+	Silent	SNP	A	A	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:69902841A>T	ENST00000358913.5	+	3	1535	c.1047A>T	c.(1045-1047)acA>acT	p.T349T	MYPN_ENST00000373675.3_Silent_p.T349T|MYPN_ENST00000540630.1_Silent_p.T349T|MYPN_ENST00000354393.2_Silent_p.T74T	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	349	Ig-like 1.|Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.T349T(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						TCTATGGGACAGATTCGACTT	0.378																																					p.T349T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1047T	10						.						96.0	90.0	92.0					10																	69902841		2203	4300	6503	69572847	SO:0001819	synonymous_variant	84665	exon3			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1047A>T	10.37:g.69902841A>T			69572847	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Silent	SNP	ENST00000358913.5	37	CCDS7275.1																																																																																				0.378	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
DDX50	79009	hgsc.bcm.edu	37	10	70670879	70670879	+	Silent	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:70670879T>C	ENST00000373585.3	+	4	623	c.516T>C	c.(514-516)taT>taC	p.Y172Y	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	172	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.Y172Y(1)		breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						GTCCTGTATATGAAGGAAAAG	0.353																																					p.Y172Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T516C	10						.						134.0	140.0	138.0					10																	70670879		2203	4300	6503	70340885	SO:0001819	synonymous_variant	79009	exon4			AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.516T>C	10.37:g.70670879T>C			70340885	NM_024045	Q5VX37|Q8WV76|Q9BWI8	Silent	SNP	ENST00000373585.3	37	CCDS7283.1																																																																																				0.353	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
SAMD8	142891	hgsc.bcm.edu	37	10	76910647	76910647	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:76910647G>A	ENST00000542569.1	+	2	464	c.361G>A	c.(361-363)Gga>Aga	p.G121R	SAMD8_ENST00000372690.3_Missense_Mutation_p.G184R|SAMD8_ENST00000372687.4_Missense_Mutation_p.G121R	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8	121					ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.G184R(1)|p.G121R(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					TGACTGTGACGGACCCATAAC	0.448																																					p.G121R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G361A	10						.						99.0	92.0	94.0					10																	76910647		2203	4300	6503	76580653	SO:0001583	missense	142891	exon2			AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515	ENST00000542569.1:c.361G>A	10.37:g.76910647G>A	ENSP00000438042:p.Gly121Arg		76580653	NM_001174156	Q5JSC5|Q5JSC8|Q66K52	Missense_Mutation	SNP	ENST00000542569.1	37	CCDS53543.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476930	0.44044	.	.	ENSG00000156671	ENST00000447533;ENST00000372690;ENST00000542569;ENST00000372687	.	.	.	5.7	5.7	0.88788	.	0.097410	0.64402	D	0.000001	T	0.59715	0.2214	L	0.47716	1.5	0.53005	D	0.99996	D;P	0.54397	0.966;0.585	P;B	0.48815	0.591;0.05	T	0.52518	-0.8565	9	0.17832	T	0.49	-6.4061	19.8333	0.96644	0.0:0.0:1.0:0.0	.	121;121	Q96LT4-2;Q96LT4	.;SAMD8_HUMAN	R	121;184;121;121	.	ENSP00000361772:G121R	G	+	1	0	SAMD8	76580653	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.984000	0.70548	2.698000	0.92095	0.491000	0.48974	GGA		0.448	SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_144660	
COMTD1	118881	hgsc.bcm.edu	37	10	76993890	76993890	+	Silent	SNP	T	T	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:76993890T>G	ENST00000372538.3	-	7	812	c.730A>C	c.(730-732)Agg>Cgg	p.R244R	COMTD1_ENST00000460899.1_5'UTR	NM_144589.2	NP_653190.2	Q86VU5	CMTD1_HUMAN	catechol-O-methyltransferase domain containing 1	244						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	O-methyltransferase activity (GO:0008171)	p.R244R(1)		central_nervous_system(1)|large_intestine(1)|lung(1)	3	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)					ATGTAGACCCTGACGTCCCGC	0.652																																					p.R244R	Colon(106;1192 2596 47278)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A730C	10						.						78.0	70.0	73.0					10																	76993890		2203	4300	6503	76663896	SO:0001819	synonymous_variant	118881	exon7				CCDS7349.1	10q22.2	2013-09-20			ENSG00000165644	ENSG00000165644			26309	protein-coding gene	gene with protein product						12975309	Standard	NM_144589		Approved	FLJ23841	uc001jxb.3	Q86VU5	OTTHUMG00000018518	ENST00000372538.3:c.730A>C	10.37:g.76993890T>G			76663896	NM_144589	Q8TE79	Silent	SNP	ENST00000372538.3	37	CCDS7349.1	.	.	.	.	.	.	.	.	.	.	T	13.22	2.172483	0.38315	.	.	ENSG00000165644	ENST00000536650	.	.	.	4.96	-0.987	0.10249	.	.	.	.	.	T	0.68531	0.3011	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72404	-0.4304	5	0.87932	D	0	-22.7718	11.6264	0.51147	0.0:0.0:0.5836:0.4164	.	.	.	.	P	232	.	ENSP00000444168:Q232P	Q	-	2	0	COMTD1	76663896	0.994000	0.37717	0.999000	0.59377	0.996000	0.88848	1.119000	0.31258	0.206000	0.20587	0.459000	0.35465	CAG		0.652	COMTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048802.1	NM_144589	
MAT1A	4143	hgsc.bcm.edu	37	10	82036245	82036245	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:82036245G>A	ENST00000372213.3	-	6	915	c.655C>T	c.(655-657)Cgc>Tgc	p.R219C	MAT1A_ENST00000485270.1_5'Flank	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	219					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)	p.R219C(1)		endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	AGGGCCCTGCGCATCTCCTCC	0.587																																					p.R219C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C655T	10						.						153.0	126.0	135.0					10																	82036245		2203	4300	6503	82026225	SO:0001583	missense	4143	exon6				CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.655C>T	10.37:g.82036245G>A	ENSP00000361287:p.Arg219Cys		82026225	NM_000429	D3DWD5|Q5QP09	Missense_Mutation	SNP	ENST00000372213.3	37	CCDS7365.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324913	0.81580	.	.	ENSG00000151224	ENST00000372213;ENST00000372206	D	0.84442	-1.85	4.84	4.84	0.62591	S-adenosylmethionine synthetase, central domain (1);S-adenosylmethionine synthetase superfamily (1);	0.374740	0.32769	N	0.005670	D	0.94604	0.8261	H	0.96805	3.885	0.80722	D	1	D	0.71674	0.998	D	0.66351	0.943	D	0.96052	0.9032	10	0.87932	D	0	-23.3135	15.8349	0.78791	0.0:0.0:1.0:0.0	.	219	Q00266	METK1_HUMAN	C	219	ENSP00000361287:R219C	ENSP00000361280:R219C	R	-	1	0	MAT1A	82026225	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	1.887000	0.39698	2.677000	0.91161	0.655000	0.94253	CGC		0.587	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429	
GRID1	2894	hgsc.bcm.edu	37	10	87407041	87407041	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:87407041G>A	ENST00000327946.7	-	13	2196	c.2111C>T	c.(2110-2112)aCg>aTg	p.T704M	RN7SKP238_ENST00000516483.1_RNA|RP11-93H12.4_ENST00000474115.2_RNA|GRID1_ENST00000536331.1_Missense_Mutation_p.T275M	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	704					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.T704M(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TTCAGCAAACGTGCTGTCCTG	0.562										Multiple Myeloma(13;0.14)																											p.T704M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2111T	10						.						270.0	250.0	257.0					10																	87407041		2203	4300	6503	87397021	SO:0001583	missense	2894	exon13			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2111C>T	10.37:g.87407041G>A	ENSP00000330148:p.Thr704Met		87397021	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556960	0.65425	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.24723	1.84;1.84	5.7	5.7	0.88788	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.48466	0.1501	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.14476	-1.0471	10	0.27082	T	0.32	.	18.8232	0.92106	0.0:0.0:1.0:0.0	.	704	Q9ULK0	GRID1_HUMAN	M	704;275	ENSP00000330148:T704M;ENSP00000444455:T275M	ENSP00000330148:T704M	T	-	2	0	GRID1	87397021	1.000000	0.71417	0.958000	0.39756	0.860000	0.49131	9.476000	0.97823	2.693000	0.91896	0.650000	0.86243	ACG		0.562	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
IFIT5	24138	hgsc.bcm.edu	37	10	91177126	91177126	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:91177126T>C	ENST00000371795.4	+	2	383	c.170T>C	c.(169-171)tTg>tCg	p.L57S	IFIT5_ENST00000416601.1_Missense_Mutation_p.L57S|LIPA_ENST00000371837.1_5'Flank	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	57					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)	p.L57S(1)		endometrium(1)|large_intestine(4)|lung(4)	9						TATAACCTATTGGCCTATGTG	0.378																																					p.L57S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T170C	10						.						74.0	78.0	77.0					10																	91177126		2203	4300	6503	91167106	SO:0001583	missense	24138	exon2			U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.170T>C	10.37:g.91177126T>C	ENSP00000360860:p.Leu57Ser		91167106	NM_012420	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Missense_Mutation	SNP	ENST00000371795.4	37	CCDS7403.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.391513	0.62066	.	.	ENSG00000152778	ENST00000371795;ENST00000416601	D;D	0.96459	-4.02;-4.02	6.03	6.03	0.97812	.	0.245199	0.35615	N	0.003083	D	0.98460	0.9487	M	0.91249	3.19	0.37926	D	0.931867	D;D	0.89917	1.0;1.0	D;D	0.79784	0.99;0.993	D	0.99956	1.1623	10	0.87932	D	0	-5.874	15.7393	0.77876	0.0:0.0:0.0:1.0	.	57;57	Q13325;B4DDV1	IFIT5_HUMAN;.	S	57	ENSP00000360860:L57S;ENSP00000414042:L57S	ENSP00000360860:L57S	L	+	2	0	IFIT5	91167106	0.802000	0.28943	0.857000	0.33713	0.991000	0.79684	3.703000	0.54808	2.308000	0.77769	0.533000	0.62120	TTG		0.378	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049303.1	NM_012420	
MARCH5	54708	hgsc.bcm.edu	37	10	94110875	94110875	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:94110875G>T	ENST00000358935.2	+	6	1080	c.748G>T	c.(748-750)Gga>Tga	p.G250*		NM_017824.4	NP_060294.1	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5	250					negative regulation of cell aging (GO:0090344)|positive regulation of mitochondrial fission (GO:0090141)|protein autoubiquitination (GO:0051865)|protein localization to mitochondrion (GO:0070585)|protein polyubiquitination (GO:0000209)|regulation of mitochondrial fission (GO:0090140)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	GTPase binding (GO:0051020)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G250*(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						TGCCATAAAAGGAGCATTTAA	0.303																																					p.G250X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G748T	10						.						72.0	71.0	71.0					10																	94110875		2203	4300	6503	94100855	SO:0001587	stop_gained	54708	exon6			BC015480	CCDS7420.1	10q23.32-q23.33	2013-01-09	2005-01-26	2005-01-27	ENSG00000198060	ENSG00000198060		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26025	protein-coding gene	gene with protein product		610637	"""ring finger protein 153"""	RNF153		14722266	Standard	XM_005269923		Approved	FLJ20445, MARCH-V	uc001khx.1	Q9NX47	OTTHUMG00000018757	ENST00000358935.2:c.748G>T	10.37:g.94110875G>T	ENSP00000351813:p.Gly250*		94100855	NM_017824		Nonsense_Mutation	SNP	ENST00000358935.2	37	CCDS7420.1	.	.	.	.	.	.	.	.	.	.	G	38	6.879662	0.97904	.	.	ENSG00000198060	ENST00000358935	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.3505	19.6604	0.95864	0.0:0.0:1.0:0.0	.	.	.	.	X	250	.	ENSP00000351813:G250X	G	+	1	0	MARCH5	94100855	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.378000	0.97191	2.648000	0.89879	0.655000	0.94253	GGA		0.303	MARCH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049388.1	NM_017824	
SORBS1	10580	hgsc.bcm.edu	37	10	97096778	97096778	+	Nonsense_Mutation	SNP	G	G	A	rs555941537		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:97096778G>A	ENST00000361941.3	-	28	3165	c.3139C>T	c.(3139-3141)Cga>Tga	p.R1047*	SORBS1_ENST00000371246.2_Intron|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000371247.2_Nonsense_Mutation_p.R1047*|SORBS1_ENST00000371227.4_Nonsense_Mutation_p.R1001*|SORBS1_ENST00000353505.5_Intron|SORBS1_ENST00000277982.5_Intron|SORBS1_ENST00000354106.3_Intron|SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000347291.4_Intron|SORBS1_ENST00000393949.1_Intron|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000371245.3_Intron|SORBS1_ENST00000607232.1_Intron	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1									p.R1047*(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		GCTACTGATCGTGGGGTGGGA	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		18248	0.0		0.0	False		,,,				2504	0.001				p.R1047X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3139T	10						.						146.0	124.0	131.0					10																	97096778		2203	4300	6503	97086768	SO:0001587	stop_gained	10580	exon28			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.3139C>T	10.37:g.97096778G>A	ENSP00000355136:p.Arg1047*		97086768	NM_001034954		Nonsense_Mutation	SNP	ENST00000361941.3	37	CCDS31255.1	.	.	.	.	.	.	.	.	.	.	G	36	5.714810	0.96830	.	.	ENSG00000095637	ENST00000371247;ENST00000371227;ENST00000361941	.	.	.	5.43	2.35	0.29111	.	0.945187	0.08689	N	0.908245	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	1.3653	3.0308	0.06105	0.094:0.1159:0.4395:0.3505	.	.	.	.	X	1047;1001;1047	.	ENSP00000355136:R1047X	R	-	1	2	SORBS1	97086768	0.053000	0.20554	0.002000	0.10522	0.119000	0.20118	0.750000	0.26334	1.304000	0.44892	0.561000	0.74099	CGA		0.557	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1		
C10orf90	118611	hgsc.bcm.edu	37	10	128192694	128192694	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr10:128192694C>T	ENST00000284694.7	-	3	1195	c.1075G>A	c.(1075-1077)Gct>Act	p.A359T	C10orf90_ENST00000356858.3_Missense_Mutation_p.A312T|C10orf90_ENST00000392694.1_Missense_Mutation_p.A312T|C10orf90_ENST00000454341.1_Missense_Mutation_p.A359T|C10orf90_ENST00000544758.1_Missense_Mutation_p.A456T|C10orf90_ENST00000368674.1_5'UTR	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	359					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.A359T(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		CAAGGACAAGCGCCGGTCCCC	0.512											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A359T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1075A	10						.						88.0	82.0	84.0					10																	128192694		2203	4300	6503	128182684	SO:0001583	missense	118611	exon3			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1075G>A	10.37:g.128192694C>T	ENSP00000284694:p.Ala359Thr	1563	128182684	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	37	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	C	1.204	-0.631730	0.03584	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642;ENST00000368674;ENST00000392694	T;T;T;T;T	0.20881	2.37;2.35;2.35;2.36;2.04	4.95	-9.9	0.00461	.	1.096250	0.06933	N	0.811378	T	0.05640	0.0148	N	0.02539	-0.55	0.09310	N	1	B;B;B;B;B	0.10296	0.0;0.002;0.002;0.001;0.003	B;B;B;B;B	0.06405	0.001;0.001;0.002;0.001;0.001	T	0.37244	-0.9714	10	0.02654	T	1	0.9946	11.5758	0.50860	0.0:0.4554:0.4091:0.1354	.	456;456;312;359;359	F5GZL2;B4DMQ6;Q5T024;Q96M02;Q96M02-2	.;.;.;CJ090_HUMAN;.	T	312;359;359;456;359;312;312	ENSP00000284694:A359T;ENSP00000398786:A359T;ENSP00000444369:A456T;ENSP00000405995:A359T;ENSP00000376459:A312T	ENSP00000284694:A359T	A	-	1	0	C10orf90	128182684	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.910000	0.00699	-2.446000	0.00546	-1.358000	0.01219	GCT		0.512	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
DNAH5	1767	hgsc.bcm.edu	37	5	13776686	13776686	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:13776686G>A	ENST00000265104.4	-	55	9339	c.9235C>T	c.(9235-9237)Cga>Tga	p.R3079*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3079	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3079*(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGGTTCTGTCGGACCCGACTC	0.463									Kartagener syndrome																												p.R3079X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C9235T	5						.						111.0	102.0	105.0					5																	13776686		2203	4300	6503	13829686	SO:0001587	stop_gained	1767	exon55	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9235C>T	5.37:g.13776686G>A	ENSP00000265104:p.Arg3079*		13829686	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	52	18.634352	0.99908	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.97	4.13	0.48395	.	0.199012	0.43919	D	0.000512	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4411	0.50096	0.0653:0.0:0.8089:0.1259	.	.	.	.	X	3079	.	ENSP00000265104:R3079X	R	-	1	2	DNAH5	13829686	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.996000	0.49449	1.532000	0.49169	0.655000	0.94253	CGA		0.463	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
MCC	4163	hgsc.bcm.edu	37	5	112403844	112403844	+	Silent	SNP	C	C	T	rs144615351		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:112403844C>T	ENST00000302475.4	-	11	1955	c.1392G>A	c.(1390-1392)gcG>gcA	p.A464A	MCC_ENST00000408903.3_Silent_p.A654A|MCC_ENST00000515367.2_Silent_p.A401A|MCC_ENST00000514701.3_5'UTR	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	464					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.A654A(1)|p.A464A(1)		endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TCTCTGCCAGCGCCAGGAGGA	0.617																																					p.A654A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1962A	5						.	C	,	0,4404		0,0,2202	60.0	60.0	60.0		1962,1392	-10.2	0.1	5	dbSNP_134	60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	MCC	NM_001085377.1,NM_002387.2	,	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	,	654/1020,464/830	112403844	1,13003	2202	4300	6502	112431743	SO:0001819	synonymous_variant	4163	exon13				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.1392G>A	5.37:g.112403844C>T			112431743	NM_001085377	D3DT05|Q6ZR04	Silent	SNP	ENST00000302475.4	37	CCDS4111.1																																																																																				0.617	MCC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250736.3	NM_001085377	
APBB3	10307	hgsc.bcm.edu	37	5	139940278	139940278	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:139940278C>A	ENST00000357560.4	-	11	1421	c.978G>T	c.(976-978)tgG>tgT	p.W326C	APBB3_ENST00000412920.3_Missense_Mutation_p.W324C|APBB3_ENST00000511201.2_Intron|APBB3_ENST00000354402.5_Missense_Mutation_p.W333C|APBB3_ENST00000358580.5_Intron|SRA1_ENST00000336283.6_5'Flank|APBB3_ENST00000508496.2_Missense_Mutation_p.W103C|APBB3_ENST00000507279.1_5'Flank|APBB3_ENST00000356738.2_Missense_Mutation_p.W331C	NM_006051.3|NM_133173.2	NP_006042.3|NP_573419.2	O95704	APBB3_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 3	326	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.W333C(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGGGGACCCAGGCATTCC	0.592																																					p.W324C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G972T	5						.						64.0	60.0	61.0					5																	139940278		2203	4300	6503	139920462	SO:0001583	missense	10307	exon10			AB018247	CCDS4227.1, CCDS4228.1, CCDS4229.1, CCDS47279.1	5q31	2008-02-05			ENSG00000113108	ENSG00000113108			20708	protein-coding gene	gene with protein product		602711				9407065	Standard	NM_133172		Approved	FE65L2	uc003lgd.1	O95704	OTTHUMG00000129504	ENST00000357560.4:c.978G>T	5.37:g.139940278C>A	ENSP00000350171:p.Trp326Cys		139920462	NM_133174	B3KQN9|Q08AG4|Q96Q18|Q9BYD4|Q9NYX6|Q9NYX7|Q9NYX8	Missense_Mutation	SNP	ENST00000357560.4	37	CCDS4229.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.491101	0.64074	.	.	ENSG00000113108	ENST00000356738;ENST00000354402;ENST00000357560;ENST00000508496;ENST00000412920	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.56292	0.1975	M	0.72479	2.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.55623	-0.8112	9	.	.	.	-8.7614	18.3998	0.90513	0.0:1.0:0.0:0.0	.	324;331	O95704-2;O95704-3	.;.	C	331;333;326;103;324	ENSP00000349177:W331C;ENSP00000346378:W333C;ENSP00000350171:W326C;ENSP00000444013:W103C;ENSP00000402591:W324C	.	W	-	3	0	APBB3	139920462	1.000000	0.71417	0.998000	0.56505	0.834000	0.47266	7.458000	0.80787	2.579000	0.87056	0.655000	0.94253	TGG		0.592	APBB3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251677.2	NM_006051	
HARS2	23438	hgsc.bcm.edu	37	5	140075140	140075140	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:140075140A>G	ENST00000230771.3	+	5	670	c.447A>G	c.(445-447)aaA>aaG	p.K149K	HARS2_ENST00000448069.2_Intron|HARS2_ENST00000437649.2_Intron|HARS2_ENST00000435019.2_Silent_p.K109K|HARS2_ENST00000508522.1_Silent_p.K124K|HARS2_ENST00000432671.2_Intron|HARS2_ENST00000502303.1_3'UTR	NM_012208.2	NP_036340.1	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2, mitochondrial	149					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)|poly(A) RNA binding (GO:0044822)	p.K149K(1)		NS(1)|endometrium(3)|large_intestine(5)|lung(10)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAAGATGAAACGTTATCATG	0.488																																					p.K149K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A447G	5						.						216.0	206.0	210.0					5																	140075140		2203	4300	6503	140055324	SO:0001819	synonymous_variant	23438	exon5			U18937	CCDS4238.1, CCDS64267.1	5q31.3	2012-07-20	2012-07-20	2007-02-23	ENSG00000112855	ENSG00000112855	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4817	protein-coding gene	gene with protein product	"""histidine tRNA ligase 2, mitochondrial (putative)"""	600783	"""histidyl-tRNA synthetase-like"""	HARSL		7755634, 21464306	Standard	NM_012208		Approved	HO3, HARSR	uc003lgx.3	P49590	OTTHUMG00000129500	ENST00000230771.3:c.447A>G	5.37:g.140075140A>G			140055324	NM_012208	B4DDY8	Silent	SNP	ENST00000230771.3	37	CCDS4238.1																																																																																				0.488	HARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251670.2	NM_012208	
PCDHB2	56133	hgsc.bcm.edu	37	5	140474545	140474545	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:140474545G>T	ENST00000194155.4	+	1	319	c.171G>T	c.(169-171)gaG>gaT	p.E57D		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	57	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E57D(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGGGCTGGAGATAGGAGAAC	0.502																																					p.E57D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G171T	5						.						60.0	67.0	64.0					5																	140474545		2203	4300	6503	140454729	SO:0001583	missense	56133	exon1			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.171G>T	5.37:g.140474545G>T	ENSP00000194155:p.Glu57Asp		140454729	NM_018936	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	37	CCDS4244.1	.	.	.	.	.	.	.	.	.	.	G	0.427	-0.905529	0.02453	.	.	ENSG00000112852	ENST00000194155	T	0.27720	1.65	5.37	-1.17	0.09648	Cadherin, N-terminal (1);Cadherin (1);	.	.	.	.	T	0.14141	0.0342	N	0.25245	0.725	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.30208	-0.9986	9	0.20519	T	0.43	.	0.0634	0.00016	0.2712:0.2169:0.1863:0.3256	.	57	Q9Y5E7	PCDB2_HUMAN	D	57	ENSP00000194155:E57D	ENSP00000194155:E57D	E	+	3	2	PCDHB2	140454729	0.000000	0.05858	0.086000	0.20670	0.172000	0.22775	-1.070000	0.03440	0.051000	0.15978	-0.136000	0.14681	GAG		0.502	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
PCDHB3	56132	hgsc.bcm.edu	37	5	140480646	140480646	+	Missense_Mutation	SNP	T	T	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:140480646T>A	ENST00000231130.2	+	1	413	c.413T>A	c.(412-414)aTg>aAg	p.M138K	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	138	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.M138K(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAAAATGAAATGCATCTGAAA	0.398																																					p.M138K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T413A	5						.						83.0	87.0	86.0					5																	140480646		2203	4300	6503	140460830	SO:0001583	missense	56132	exon1			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.413T>A	5.37:g.140480646T>A	ENSP00000231130:p.Met138Lys		140460830	NM_018937	B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	T	16.59	3.164592	0.57476	.	.	ENSG00000113205	ENST00000231130	T	0.19806	2.12	5.08	5.08	0.68730	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.31513	0.0799	L	0.41906	1.305	0.09310	N	1	P	0.38565	0.637	P	0.49502	0.613	T	0.18241	-1.0343	9	0.87932	D	0	.	14.8517	0.70300	0.0:0.0:0.0:1.0	.	138	Q9Y5E6	PCDB3_HUMAN	K	138	ENSP00000231130:M138K	ENSP00000231130:M138K	M	+	2	0	PCDHB3	140460830	0.229000	0.23729	0.997000	0.53966	0.997000	0.91878	1.769000	0.38522	2.036000	0.60181	0.533000	0.62120	ATG		0.398	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PCDHB3	56132	hgsc.bcm.edu	37	5	140480648	140480648	+	Missense_Mutation	SNP	C	C	A	rs550788519		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:140480648C>A	ENST00000231130.2	+	1	415	c.415C>A	c.(415-417)Cat>Aat	p.H139N	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	139	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.H139N(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAATGAAATGCATCTGAAAAT	0.393																																					p.H139N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C415A	5						.						83.0	87.0	85.0					5																	140480648		2203	4300	6503	140460832	SO:0001583	missense	56132	exon1			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.415C>A	5.37:g.140480648C>A	ENSP00000231130:p.His139Asn		140460832	NM_018937	B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	C	6.550	0.469749	0.12461	.	.	ENSG00000113205	ENST00000231130	T	0.19669	2.13	5.08	2.97	0.34412	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.11324	0.0276	N	0.11201	0.11	0.09310	N	1	B	0.20052	0.041	B	0.25987	0.065	T	0.34800	-0.9814	9	0.18276	T	0.48	.	9.3196	0.37955	0.3901:0.4977:0.1122:0.0	.	139	Q9Y5E6	PCDB3_HUMAN	N	139	ENSP00000231130:H139N	ENSP00000231130:H139N	H	+	1	0	PCDHB3	140460832	0.000000	0.05858	0.947000	0.38551	0.995000	0.86356	-1.315000	0.02713	1.249000	0.43950	0.655000	0.94253	CAT		0.393	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PCDHB16	57717	hgsc.bcm.edu	37	5	140562798	140562798	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:140562798C>T	ENST00000361016.2	+	1	1819	c.664C>T	c.(664-666)Cga>Tga	p.R222*		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	222	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R222*(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCTCCACCGCGATCTGGAAC	0.512																																					p.R222X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C664T	5						.						64.0	63.0	63.0					5																	140562798		2203	4300	6503	140542982	SO:0001587	stop_gained	57717	exon1			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.664C>T	5.37:g.140562798C>T	ENSP00000354293:p.Arg222*		140542982	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Nonsense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	C	42	9.586077	0.99211	.	.	ENSG00000196963	ENST00000361016	.	.	.	4.6	-1.83	0.07833	.	0.286513	0.18471	N	0.140225	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.3142	0.87218	0.8575:0.1425:0.0:0.0	.	.	.	.	X	222	.	ENSP00000354293:R222X	R	+	1	2	PCDHB16	140542982	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.007000	0.12810	-0.784000	0.04528	-0.282000	0.10007	CGA		0.512	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
NR3C1	2908	hgsc.bcm.edu	37	5	142661520	142661520	+	Silent	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:142661520G>T	ENST00000343796.2	-	9	3261	c.2268C>A	c.(2266-2268)atC>atA	p.I756I	NR3C1_ENST00000424646.2_Silent_p.I730I|NR3C1_ENST00000231509.3_Silent_p.I757I|NR3C1_ENST00000504572.1_Silent_p.I757I|NR3C1_ENST00000415690.2_Intron|NR3C1_ENST00000416954.2_Silent_p.I359I|NR3C1_ENST00000394464.2_Silent_p.I756I|NR3C1_ENST00000394466.2_Silent_p.I757I|NR3C1_ENST00000503201.1_Silent_p.I756I	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	756	Interaction with CLOCK.|Steroid-binding.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)	p.I757I(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	GATTGGTGATGATTTCAGCTA	0.338																																					p.I756I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2268A	5						.						118.0	118.0	118.0					5																	142661520		2203	4300	6503	142641713	SO:0001819	synonymous_variant	2908	exon9			X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.2268C>A	5.37:g.142661520G>T			142641713	NM_001018074	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Silent	SNP	ENST00000343796.2	37	CCDS4278.1																																																																																				0.338	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1		
PPP2R2B	5521	hgsc.bcm.edu	37	5	146030183	146030183	+	Silent	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:146030183G>A	ENST00000394413.3	-	5	1122	c.552C>T	c.(550-552)gaC>gaT	p.D184D	PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000504198.1_Silent_p.D190D|PPP2R2B_ENST00000453001.1_Silent_p.D184D|PPP2R2B_ENST00000394409.3_Silent_p.D242D|PPP2R2B_ENST00000394410.2_Silent_p.D173D|PPP2R2B_ENST00000508545.2_Silent_p.D173D|PPP2R2B_ENST00000394414.1_Silent_p.D250D|PPP2R2B_ENST00000336640.6_Silent_p.D187D|PPP2R2B_ENST00000356826.3_Silent_p.D184D|PPP2R2B_ENST00000394411.4_Silent_p.D184D			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	184					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.D187D(1)		endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGTTTCATAGTCGCTGTTGA	0.438																																					p.D184D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C552T	5						.						222.0	184.0	197.0					5																	146030183		2203	4300	6503	146010376	SO:0001819	synonymous_variant	5521	exon6			M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.552C>T	5.37:g.146030183G>A			146010376	NM_001127381	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Silent	SNP	ENST00000394413.3	37	CCDS4284.1																																																																																				0.438	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251893.2	NM_181678	
JAKMIP2	9832	hgsc.bcm.edu	37	5	147040794	147040794	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:147040794T>C	ENST00000265272.5	-	3	811	c.344A>G	c.(343-345)aAg>aGg	p.K115R	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.K73R|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.K115R	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	115						Golgi apparatus (GO:0005794)		p.K115R(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGAGCAGACTTGAGCCTCTG	0.562																																					p.K115R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A344G	5						.						158.0	152.0	154.0					5																	147040794		2203	4300	6503	147020987	SO:0001583	missense	9832	exon3			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.344A>G	5.37:g.147040794T>C	ENSP00000265272:p.Lys115Arg		147020987	NM_014790	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	T	11.89	1.774065	0.31411	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.08370	3.1;3.1;3.1	4.67	4.67	0.58626	.	0.046061	0.85682	D	0.000000	T	0.07548	0.0190	L	0.27053	0.805	0.42869	D	0.994134	B;B;B;B	0.13594	0.008;0.004;0.004;0.002	B;B;B;B	0.09377	0.004;0.002;0.002;0.002	T	0.22417	-1.0217	10	0.39692	T	0.17	.	14.8123	0.70006	0.0:0.0:0.0:1.0	.	73;115;115;115	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	R	115;115;73;115	ENSP00000421398:K115R;ENSP00000265272:K115R;ENSP00000328989:K73R	ENSP00000265272:K115R	K	-	2	0	JAKMIP2	147020987	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	4.869000	0.63028	2.046000	0.60703	0.460000	0.39030	AAG		0.562	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
G3BP1	10146	hgsc.bcm.edu	37	5	151175085	151175085	+	Missense_Mutation	SNP	C	C	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:151175085C>A	ENST00000394123.3	+	6	633	c.488C>A	c.(487-489)cCt>cAt	p.P163H	G3BP1_ENST00000356245.3_Missense_Mutation_p.P163H|G3BP1_ENST00000543466.1_5'UTR			Q13283	G3BP1_HUMAN	GTPase activating protein (SH3 domain) binding protein 1	163	Glu-rich.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Ras protein signal transduction (GO:0007265)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.P163H(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|skin(3)|urinary_tract(2)	29		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			CAGCAAACACCTGAGGTGGTA	0.383																																					p.P163H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C488A	5						.						159.0	168.0	165.0					5																	151175085		2203	4300	6503	151155278	SO:0001583	missense	10146	exon6			BC006997	CCDS4319.1	5q33.1	2013-02-12	2006-11-01		ENSG00000145907	ENSG00000145907		"""RNA binding motif (RRM) containing"""	30292	protein-coding gene	gene with protein product	"""Ras-GTPase-activating protein SH3-domain-binding protein"""	608431				8649363, 9889278	Standard	NM_005754		Approved	HDH-VIII, G3BP	uc003lum.3	Q13283	OTTHUMG00000130123	ENST00000394123.3:c.488C>A	5.37:g.151175085C>A	ENSP00000377681:p.Pro163His		151155278	NM_005754	Q5HYE9	Missense_Mutation	SNP	ENST00000394123.3	37	CCDS4319.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.556229	0.86231	.	.	ENSG00000145907	ENST00000394123;ENST00000356245;ENST00000274596	T;T	0.75821	-0.97;-0.97	4.99	4.99	0.66335	.	0.049295	0.85682	D	0.000000	D	0.85712	0.5760	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.87370	0.2350	10	0.87932	D	0	-20.0627	18.6571	0.91458	0.0:1.0:0.0:0.0	.	163	Q13283	G3BP1_HUMAN	H	163;163;71	ENSP00000377681:P163H;ENSP00000348578:P163H	ENSP00000274596:P71H	P	+	2	0	G3BP1	151155278	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.088000	0.71371	2.475000	0.83589	0.555000	0.69702	CCT		0.383	G3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252431.1	NM_005754	
TIMD4	91937	hgsc.bcm.edu	37	5	156349138	156349138	+	Silent	SNP	G	G	A	rs200813433		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:156349138G>A	ENST00000274532.2	-	7	1040	c.984C>T	c.(982-984)ttC>ttT	p.F328F	TIMD4_ENST00000407087.3_Silent_p.F300F|TIMD4_ENST00000406964.1_Silent_p.F30F	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	328						integral component of membrane (GO:0016021)		p.F328F(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CAAACAATGCGAAGAGCACAA	0.522																																					p.F328F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C984T	5						.	G	,	0,4406		0,0,2203	158.0	143.0	148.0		900,984	-0.2	0.0	5		148	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TIMD4	NM_001146726.1,NM_138379.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	300/351,328/379	156349138	1,13005	2203	4300	6503	156281716	SO:0001819	synonymous_variant	91937	exon7			BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.984C>T	5.37:g.156349138G>A			156281716	NM_138379	B5MCL9	Silent	SNP	ENST00000274532.2	37	CCDS4332.1																																																																																				0.522	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252568.1	NM_138379	
ITK	3702	hgsc.bcm.edu	37	5	156672793	156672793	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:156672793A>G	ENST00000422843.3	+	14	1659	c.1507A>G	c.(1507-1509)Atg>Gtg	p.M503V	ITK_ENST00000519749.1_Intron	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	503	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.M503V(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	TGACTTTGGGATGACAAGGTA	0.517			T	SYK	peripheral T-cell lymphoma																																p.M503V	Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1507G	5						.						104.0	100.0	101.0					5																	156672793		2203	4300	6503	156605371	SO:0001583	missense	3702	exon14			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1507A>G	5.37:g.156672793A>G	ENSP00000398655:p.Met503Val		156605371	NM_005546	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.381744	0.82792	.	.	ENSG00000113263	ENST00000422843	D	0.82711	-1.64	5.78	5.78	0.91487	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88463	0.6443	L	0.46741	1.465	0.80722	D	1	D	0.69078	0.997	D	0.76575	0.988	D	0.89527	0.3782	10	0.87932	D	0	.	16.1138	0.81283	1.0:0.0:0.0:0.0	.	503	Q08881	ITK_HUMAN	V	503	ENSP00000398655:M503V	ENSP00000398655:M503V	M	+	1	0	ITK	156605371	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	6.002000	0.70693	2.220000	0.72140	0.533000	0.62120	ATG		0.517	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2		
PANK3	79646	hgsc.bcm.edu	37	5	167986122	167986122	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:167986122A>G	ENST00000239231.6	-	6	1293	c.977T>C	c.(976-978)gTc>gCc	p.V326A	MIR103A1_ENST00000362165.1_RNA|PANK3_ENST00000520504.1_5'UTR	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	326					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)	p.V326A(1)		NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		GAGGGTATTGACACGTAAAAA	0.299																																					p.V326A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T977C	5						.						85.0	82.0	83.0					5																	167986122		2202	4300	6502	167918700	SO:0001583	missense	79646	exon6			AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.977T>C	5.37:g.167986122A>G	ENSP00000239231:p.Val326Ala		167918700	NM_024594	D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	ENST00000239231.6	37	CCDS4368.1	.	.	.	.	.	.	.	.	.	.	A	15.97	2.991085	0.54041	.	.	ENSG00000120137	ENST00000239231	D	0.99060	-5.38	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.98324	0.9444	M	0.71036	2.16	0.58432	D	0.999994	B	0.27679	0.185	B	0.41174	0.349	D	0.99924	1.1275	10	0.08381	T	0.77	-10.7969	14.9416	0.70997	1.0:0.0:0.0:0.0	.	326	Q9H999	PANK3_HUMAN	A	326	ENSP00000239231:V326A	ENSP00000239231:V326A	V	-	2	0	PANK3	167918700	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	2.117000	0.64856	0.533000	0.62120	GTC		0.299	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252793.2	NM_024594	
SLIT3	6586	hgsc.bcm.edu	37	5	168310300	168310300	+	Missense_Mutation	SNP	G	G	A	rs373741690		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:168310300G>A	ENST00000519560.1	-	5	874	c.455C>T	c.(454-456)gCg>gTg	p.A152V	SLIT3_ENST00000332966.8_Missense_Mutation_p.A152V|SLIT3_ENST00000404867.3_Missense_Mutation_p.A152V	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	152					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.A152V(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCCGCGGAACGCCTTCCTCGG	0.498																																					p.A152V	Ovarian(29;311 847 10864 17279 24903)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C455T	5						.	G	VAL/ALA	0,4406		0,0,2203	122.0	103.0	109.0		455	5.0	1.0	5		109	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLIT3	NM_003062.2	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	152/1524	168310300	1,13005	2203	4300	6503	168242878	SO:0001583	missense	6586	exon5			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.455C>T	5.37:g.168310300G>A	ENSP00000430333:p.Ala152Val		168242878	NM_003062	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	37	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907873	0.72868	0.0	1.16E-4	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.60040	0.22;0.22;0.22	4.97	4.97	0.65823	.	0.209087	0.38720	N	0.001594	T	0.56077	0.1961	N	0.25825	0.765	0.47949	D	0.999554	P;D	0.54207	0.843;0.965	B;P	0.51079	0.132;0.658	T	0.55095	-0.8194	10	0.33141	T	0.24	.	18.2459	0.89985	0.0:0.0:1.0:0.0	.	152;152	O75094-2;O75094	.;SLIT3_HUMAN	V	152	ENSP00000430333:A152V;ENSP00000332164:A152V;ENSP00000384890:A152V	ENSP00000332164:A152V	A	-	2	0	SLIT3	168242878	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	7.901000	0.87382	2.288000	0.76882	0.655000	0.94253	GCG		0.498	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
BOD1	91272	hgsc.bcm.edu	37	5	173036270	173036270	+	Missense_Mutation	SNP	G	G	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:173036270G>T	ENST00000311086.4	-	3	753	c.530C>A	c.(529-531)cCt>cAt	p.P177H	BOD1_ENST00000471339.1_5'Flank|BOD1_ENST00000480951.1_Intron|BOD1_ENST00000285908.5_Intron	NM_138369.2	NP_612378.1	Q96IK1	BOD1_HUMAN	biorientation of chromosomes in cell division 1	177					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|kinetochore (GO:0000776)		p.P177H(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(2)	7						TGGAGCTGGAGGGTCCTGGCC	0.512																																					p.P177H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C530A	5						.						97.0	94.0	95.0					5																	173036270		2203	4300	6503	172968876	SO:0001583	missense	91272	exon3			AY303777	CCDS4389.1, CCDS54951.1	5q35.2	2013-10-11	2009-03-04	2009-03-04	ENSG00000145919	ENSG00000145919			25114	protein-coding gene	gene with protein product	"""biorientation defective 1"""		"""family with sequence similarity 44, member B"""	FAM44B		17938248	Standard	NM_138369		Approved		uc003mcq.2	Q96IK1	OTTHUMG00000130540	ENST00000311086.4:c.530C>A	5.37:g.173036270G>T	ENSP00000309644:p.Pro177His		172968876	NM_138369	B4DXH8|Q9BTW1	Missense_Mutation	SNP	ENST00000311086.4	37	CCDS4389.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861027	0.71949	.	.	ENSG00000145919	ENST00000311086	.	.	.	5.86	4.1	0.47936	.	0.393126	0.31381	N	0.007756	T	0.43299	0.1241	L	0.43152	1.355	0.80722	D	1	P	0.51791	0.948	B	0.39185	0.293	T	0.44513	-0.9323	9	0.72032	D	0.01	-0.108	12.4877	0.55883	0.1345:0.0:0.8655:0.0	.	177	Q96IK1	BOD1_HUMAN	H	177	.	ENSP00000309644:P177H	P	-	2	0	BOD1	172968876	1.000000	0.71417	0.549000	0.28204	0.854000	0.48673	7.115000	0.77110	0.840000	0.34995	-0.136000	0.14681	CCT		0.512	BOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252963.1	NM_138369	
SFXN1	94081	hgsc.bcm.edu	37	5	174938472	174938472	+	Silent	SNP	C	C	T	rs184377169		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:174938472C>T	ENST00000321442.5	+	5	707	c.453C>T	c.(451-453)taC>taT	p.Y151Y	SFXN1_ENST00000502393.1_Silent_p.Y151Y	NM_022754.5	NP_073591.2	Q9H9B4	SFXN1_HUMAN	sideroflexin 1	151					erythrocyte differentiation (GO:0030218)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)	p.Y151Y(1)		endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(3)	15	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GAACAGCTTACGTTTCTGCAA	0.398													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20460	0.0		0.0	False		,,,				2504	0.0				p.Y151Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C453T	5						.						214.0	200.0	205.0					5																	174938472		2203	4300	6503	174871078	SO:0001819	synonymous_variant	94081	exon5			AF327346	CCDS4394.1	5q35.3	2008-02-05			ENSG00000164466	ENSG00000164466		"""Sideroflexins"""	16085	protein-coding gene	gene with protein product		615569					Standard	NM_022754		Approved	FLJ12876	uc003mda.2	Q9H9B4	OTTHUMG00000130555	ENST00000321442.5:c.453C>T	5.37:g.174938472C>T			174871078	NM_022754	B3KPW3|D3DQN2|Q9HA53	Silent	SNP	ENST00000321442.5	37	CCDS4394.1																																																																																				0.398	SFXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252980.2	NM_022754	
PDCD6	10016	hgsc.bcm.edu	37	5	314554	314554	+	Missense_Mutation	SNP	G	G	A	rs139334790	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:314554G>A	ENST00000264933.4	+	6	600	c.500G>A	c.(499-501)cGt>cAt	p.R167H	AHRR_ENST00000316418.5_Intron|AHRR_ENST00000512529.1_Intron|PDCD6_ENST00000507528.1_Missense_Mutation_p.R165H|PDCD6_ENST00000511482.1_3'UTR|PDCD6_ENST00000505221.1_3'UTR|AHRR_ENST00000505113.1_Intron	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	167	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.R167H(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			ATATTCAGACGTTACGACACG	0.502													G|||	2	0.000399361	0.0015	0.0	5008	,	,		22951	0.0		0.0	False		,,,				2504	0.0				p.R167H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G500A	5						.	G	,HIS/ARG,	1,4403	2.1+/-5.4	0,1,2201	174.0	139.0	151.0		,500,	4.4	1.0	5	dbSNP_134	151	0,8600		0,0,4300	yes	intron,missense,intron	PDCD6,AHRR	NM_001242412.1,NM_013232.3,NM_020731.4	,29,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,benign,	,167/192,	314554	1,13003	2202	4300	6502	367554	SO:0001583	missense	10016	exon6			AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.500G>A	5.37:g.314554G>A	ENSP00000264933:p.Arg167His		367554	NM_013232	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	ENST00000264933.4	37	CCDS3854.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	g	12.48	1.951423	0.34471	2.27E-4	0.0	ENSG00000249915	ENST00000264933;ENST00000507528;ENST00000507473;ENST00000502359	T;T;T	0.30182	1.54;1.54;3.12	5.29	4.43	0.53597	EF-hand-like domain (1);	.	.	.	.	T	0.31358	0.0794	M	0.70275	2.135	0.80722	D	1	B;B	0.29253	0.239;0.082	B;B	0.14578	0.011;0.011	T	0.15492	-1.0435	9	0.54805	T	0.06	.	11.729	0.51726	0.0848:0.0:0.9152:0.0	.	165;167	Q2YDC2;O75340	.;PDCD6_HUMAN	H	167;165;80;61	ENSP00000264933:R167H;ENSP00000423815:R165H;ENSP00000425370:R80H	ENSP00000264933:R167H	R	+	2	0	PDCD6	367554	1.000000	0.71417	0.994000	0.49952	0.951000	0.60555	5.971000	0.70440	1.471000	0.48121	0.650000	0.86243	CGT		0.502	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
CDH18	1016	hgsc.bcm.edu	37	5	19544055	19544055	+	Missense_Mutation	SNP	C	C	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:19544055C>G	ENST00000507958.1	-	11	2303	c.1313G>C	c.(1312-1314)gGg>gCg	p.G438A	CDH18_ENST00000502796.1_Missense_Mutation_p.G438A|CDH18_ENST00000511273.1_Missense_Mutation_p.G438A|CDH18_ENST00000506372.1_Missense_Mutation_p.G438A|CDH18_ENST00000382275.1_Missense_Mutation_p.G438A|CDH18_ENST00000274170.4_Missense_Mutation_p.G438A			Q13634	CAD18_HUMAN	cadherin 18, type 2	438	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G438A(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CCTAATGGTCCCAGTATTGGC	0.353																																					p.G438A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1313C	5						.						132.0	125.0	127.0					5																	19544055		2203	4300	6503	19579812	SO:0001583	missense	1016	exon9			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1313G>C	5.37:g.19544055C>G	ENSP00000425093:p.Gly438Ala		19579812	NM_004934	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318704	0.81469	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	D;D;D;D;D;T;D	0.91407	-2.84;-2.84;-2.84;-2.84;-2.84;1.47;-2.84	5.27	5.27	0.74061	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.97216	0.9090	H	0.97587	4.035	0.54753	D	0.999989	D;D	0.89917	1.0;0.995	D;D	0.97110	1.0;0.976	D	0.98652	1.0680	9	.	.	.	.	17.46	0.87618	0.0:1.0:0.0:0.0	.	438;438	B4DHG6;Q13634	.;CAD18_HUMAN	A	438;438;438;438;438;438;384;438	ENSP00000371710:G438A;ENSP00000425093:G438A;ENSP00000274170:G438A;ENSP00000424931:G438A;ENSP00000422138:G438A;ENSP00000427383:G384A;ENSP00000425854:G438A	.	G	-	2	0	CDH18	19579812	1.000000	0.71417	0.996000	0.52242	0.926000	0.56050	6.447000	0.73465	2.480000	0.83734	0.467000	0.42956	GGG		0.353	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
DNAJC21	134218	hgsc.bcm.edu	37	5	34933997	34933997	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:34933997C>T	ENST00000342382.4	+	2	402	c.175C>T	c.(175-177)Cct>Tct	p.P59S	DNAJC21_ENST00000303525.7_Missense_Mutation_p.P59S|DNAJC21_ENST00000382021.2_Missense_Mutation_p.P59S			Q5F1R6	DJC21_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 21	59	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				protein folding (GO:0006457)	ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P59S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			GTTGAGTGACCCTCAGGAAAG	0.378																																					p.P59S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C175T	5						.						106.0	90.0	95.0					5																	34933997		2203	4300	6503	34969754	SO:0001583	missense	134218	exon2				CCDS3907.2, CCDS34144.1	5p13-p12	2012-10-05			ENSG00000168724	ENSG00000168724		"""Heat shock proteins / DNAJ (HSP40)"""	27030	protein-coding gene	gene with protein product	"""JJJ1 DnaJ domain protein homolog (S. cerevisiae)"""					15067379	Standard	XM_005248250		Approved	GS3, DNAJA5, JJJ1	uc003jjc.3	Q5F1R6	OTTHUMG00000074103	ENST00000342382.4:c.175C>T	5.37:g.34933997C>T	ENSP00000343728:p.Pro59Ser		34969754	NM_194283	Q3B7J9|Q6P086|Q6ZS43|Q86VC6	Missense_Mutation	SNP	ENST00000342382.4	37	CCDS34144.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.674815	0.88445	.	.	ENSG00000168724	ENST00000342382;ENST00000382021;ENST00000303525	T;T;T	0.35236	1.32;1.32;1.32	5.18	5.18	0.71444	Heat shock protein DnaJ, N-terminal (5);Heat shock protein DnaJ, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.52256	0.1723	L	0.43701	1.375	0.80722	D	1	P;P	0.50943	0.94;0.864	P;P	0.62298	0.9;0.86	T	0.52245	-0.8601	10	0.59425	D	0.04	-8.9264	18.6928	0.91589	0.0:1.0:0.0:0.0	.	59;59	Q5F1R6;Q5F1R6-2	DJC21_HUMAN;.	S	59	ENSP00000343728:P59S;ENSP00000371451:P59S;ENSP00000306289:P59S	ENSP00000306289:P59S	P	+	1	0	DNAJC21	34969754	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	7.250000	0.78287	2.412000	0.81896	0.313000	0.20887	CCT		0.378	DNAJC21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157337.1	NM_194283	
IL7R	3575	hgsc.bcm.edu	37	5	35874603	35874603	+	Silent	SNP	C	C	T	rs201268331	byFrequency	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:35874603C>T	ENST00000303115.3	+	6	888	c.759C>T	c.(757-759)gtC>gtT	p.V253V	IL7R_ENST00000343305.4_Intron|IL7R_ENST00000506850.1_Intron	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	253					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.S252_A254>WN(1)|p.F250_V253>PLGE(1)|p.V253_A254insVLC(1)|p.V253V(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TTTTCTCTGTCGCTCTGTTGG	0.438			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency						C|||	3	0.000599042	0.0008	0.0	5008	,	,		20221	0.002		0.0	False		,,,				2504	0.0				p.V253V			Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	.	.	4	Insertion - In frame(1)|Complex - deletion inframe(1)|Complex - compound substitution(1)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)	c.C759T	5						.						240.0	209.0	220.0					5																	35874603		2203	4300	6503	35910360	SO:0001819	synonymous_variant	3575	exon6			M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.759C>T	5.37:g.35874603C>T			35910360	NM_002185	B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Silent	SNP	ENST00000303115.3	37	CCDS3911.1																																																																																				0.438	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2		
NIPBL	25836	hgsc.bcm.edu	37	5	37044528	37044528	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:37044528A>G	ENST00000282516.8	+	35	6687	c.6188A>G	c.(6187-6189)gAa>gGa	p.E2063G	NIPBL_ENST00000448238.2_Missense_Mutation_p.E2063G	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2063					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)	p.E2063G(2)		autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			CATCCAAGTGAAACTTTTCTT	0.348																																					p.E2063G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A6188G	5						.						89.0	87.0	88.0					5																	37044528		2203	4300	6503	37080285	SO:0001583	missense	25836	exon35			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6188A>G	5.37:g.37044528A>G	ENSP00000282516:p.Glu2063Gly		37080285	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	37	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.818146	0.90790	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	T;T	0.65916	-0.18;-0.18	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78136	0.4236	M	0.80982	2.52	0.80722	D	1	D;D	0.62365	0.985;0.991	P;P	0.61592	0.78;0.891	T	0.81243	-0.1021	10	0.62326	D	0.03	-9.0815	15.4716	0.75443	1.0:0.0:0.0:0.0	.	2063;2063	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	G	2063	ENSP00000282516:E2063G;ENSP00000406266:E2063G	ENSP00000282516:E2063G	E	+	2	0	NIPBL	37080285	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.065000	0.76727	2.124000	0.65301	0.477000	0.44152	GAA		0.348	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
GDNF	2668	hgsc.bcm.edu	37	5	37834848	37834848	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:37834848C>T	ENST00000326524.2	-	2	250	c.51G>A	c.(49-51)gcG>gcA	p.A17A	GDNF_ENST00000427982.1_Silent_p.A34A|GDNF_ENST00000515058.1_Silent_p.A17A|GDNF_ENST00000344622.4_Silent_p.A17A|GDNF_ENST00000381826.4_Silent_p.A34A	NM_000514.3	NP_000505.1	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor	17					adult locomotory behavior (GO:0008344)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|enteric nervous system development (GO:0048484)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|metanephros development (GO:0001656)|mRNA stabilization (GO:0048255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neuron projection development (GO:0031175)|organ induction (GO:0001759)|peristalsis (GO:0030432)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|postganglionic parasympathetic nervous system development (GO:0021784)|postsynaptic membrane organization (GO:0001941)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of morphogenesis of a branching structure (GO:0060688)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|ureteric bud formation (GO:0060676)	extracellular region (GO:0005576)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.A17A(1)		NS(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(8)|skin(2)	15	all_lung(31;0.00118)					GGAAGGCGGACGCGGTGTGGA	0.721																																					p.A34A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G102A	5						.						22.0	24.0	23.0					5																	37834848		2200	4296	6496	37870605	SO:0001819	synonymous_variant	2668	exon2				CCDS3922.1, CCDS3923.1, CCDS54845.1, CCDS54846.1, CCDS75237.1	5p13.1-p12	2014-01-30			ENSG00000168621	ENSG00000168621		"""Endogenous ligands"""	4232	protein-coding gene	gene with protein product	"""astrocyte-derived trophic factor"", ""glial cell line derived neurotrophic factor"", ""glial derived neurotrophic factor"""	600837				8493557	Standard	NM_199231		Approved	ATF1, ATF2, HFB1-GDNF	uc011cpg.2	P39905	OTTHUMG00000090809	ENST00000326524.2:c.51G>A	5.37:g.37834848C>T			37870605	NM_001190468	B7WPK7|O95448|O95449|O95986|Q6FH33|Q96L44|Q9UD32|Q9UD33|Q9UMV2|Q9UP67|Q9UP97	Missense_Mutation	SNP	ENST00000326524.2	37	CCDS3922.1																																																																																				0.721	GDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207606.1	NM_000514	
HSPB3	8988	hgsc.bcm.edu	37	5	53751772	53751772	+	Silent	SNP	G	G	A	rs139714539		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:53751772G>A	ENST00000302005.1	+	1	328	c.153G>A	c.(151-153)gcG>gcA	p.A51A		NM_006308.2	NP_006299.1	Q12988	HSPB3_HUMAN	heat shock 27kDa protein 3	51					cell death (GO:0008219)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A51A(1)		breast(1)|large_intestine(4)|prostate(3)	8		Lung NSC(810;0.00104)				CCAGGGCAGCGCAGTCTCCTC	0.562													g|||	1	0.000199681	0.0008	0.0	5008	,	,		19917	0.0		0.0	False		,,,				2504	0.0				p.A51A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G153A	5						.	A		3,4403	6.2+/-15.9	0,3,2200	69.0	65.0	66.0		153	-2.9	0.0	5	dbSNP_134	66	0,8600		0,0,4300	no	coding-synonymous	HSPB3	NM_006308.2		0,3,6500	AA,AG,GG		0.0,0.0681,0.0231		51/151	53751772	3,13003	2203	4300	6503	53787529	SO:0001819	synonymous_variant	8988	exon1			Y17782	CCDS3961.1	5q11.2	2011-09-02	2002-08-29		ENSG00000169271	ENSG00000169271		"""Heat shock proteins / HSPB"""	5248	protein-coding gene	gene with protein product		604624	"""heat shock 27kD protein 3"""			8972725, 9858786	Standard	NM_006308		Approved	HSPL27	uc003jph.2	Q12988	OTTHUMG00000096995	ENST00000302005.1:c.153G>A	5.37:g.53751772G>A			53787529	NM_006308		Silent	SNP	ENST00000302005.1	37	CCDS3961.1																																																																																				0.562	HSPB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214074.2		
DHX29	54505	hgsc.bcm.edu	37	5	54570786	54570786	+	Missense_Mutation	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:54570786T>C	ENST00000251636.5	-	15	2628	c.2480A>G	c.(2479-2481)cAa>cGa	p.Q827R	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	827						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)	p.Q827R(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				GCTGTACTTTTGGTAAAATGG	0.358																																					p.Q827R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2480G	5						.						91.0	93.0	92.0					5																	54570786		2203	4300	6503	54606543	SO:0001583	missense	54505	exon15			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.2480A>G	5.37:g.54570786T>C	ENSP00000251636:p.Gln827Arg		54606543	NM_019030	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	ENST00000251636.5	37	CCDS34158.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.306987	0.40795	.	.	ENSG00000067248	ENST00000251636	T	0.13657	2.57	5.1	5.1	0.69264	.	0.106561	0.64402	D	0.000005	T	0.11495	0.0280	L	0.33189	0.99	0.39961	D	0.97466	B	0.02656	0.0	B	0.08055	0.003	T	0.09684	-1.0663	10	0.32370	T	0.25	.	12.3391	0.55083	0.0:0.0:0.1406:0.8594	.	827	Q7Z478	DHX29_HUMAN	R	827	ENSP00000251636:Q827R	ENSP00000251636:Q827R	Q	-	2	0	DHX29	54606543	0.990000	0.36364	0.969000	0.41365	0.979000	0.70002	2.227000	0.42972	2.054000	0.61138	0.460000	0.39030	CAA		0.358	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	
MIER3	166968	hgsc.bcm.edu	37	5	56229132	56229132	+	Missense_Mutation	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:56229132C>T	ENST00000381199.3	-	8	699	c.689G>A	c.(688-690)gGc>gAc	p.G230D	MIER3_ENST00000381226.3_Missense_Mutation_p.G235D|MIER3_ENST00000381213.3_Missense_Mutation_p.G230D|MIER3_ENST00000409421.1_Missense_Mutation_p.G167D			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	230	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.G230D(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		TTTTTCACTGCCAGTCCTTAA	0.393																																					p.G230D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G689A	5						.						231.0	220.0	224.0					5																	56229132		2203	4300	6503	56264889	SO:0001583	missense	166968	exon8			BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.689G>A	5.37:g.56229132C>T	ENSP00000370596:p.Gly230Asp		56264889	NM_152622	B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Missense_Mutation	SNP	ENST00000381199.3	37		.	.	.	.	.	.	.	.	.	.	C	19.93	3.918535	0.73098	.	.	ENSG00000155545	ENST00000381226;ENST00000381213;ENST00000381199;ENST00000409421	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.5	5.5	0.81552	ELM2 domain (1);	0.179817	0.49916	D	0.000123	T	0.51839	0.1698	L	0.48986	1.54	0.58432	D	0.999999	D;D;P	0.58620	0.983;0.98;0.69	P;P;B	0.52856	0.656;0.711;0.32	T	0.40905	-0.9538	10	0.32370	T	0.25	-20.6965	19.3737	0.94500	0.0:1.0:0.0:0.0	.	230;235;230	Q7Z3K6;Q7Z3K6-2;Q7Z3K6-3	MIER3_HUMAN;.;.	D	235;230;230;167	ENSP00000370624:G235D;ENSP00000370611:G230D;ENSP00000370596:G230D;ENSP00000386584:G167D	ENSP00000370596:G230D	G	-	2	0	MIER3	56264889	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.181000	0.42547	2.585000	0.87301	0.655000	0.94253	GGC		0.393	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000132523.2	NM_152622	
ELOVL7	79993	hgsc.bcm.edu	37	5	60050614	60050614	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:60050614A>G	ENST00000508821.1	-	9	997	c.683T>C	c.(682-684)aTg>aCg	p.M228T	ELOVL7_ENST00000425382.1_Missense_Mutation_p.M228T|ELOVL7_ENST00000438340.1_Missense_Mutation_p.M228T|ELOVL7_ENST00000505959.1_Missense_Mutation_p.M215T	NM_024930.2	NP_079206.2	A1L3X0	ELOV7_HUMAN	ELOVL fatty acid elongase 7	228					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.M228T(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	9		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				GCAATCCTCCATGAAAAAGAA	0.368																																					p.M228T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T683C	5						.						99.0	91.0	94.0					5																	60050614		2203	4300	6503	60086371	SO:0001583	missense	79993	exon9			AK027216	CCDS34164.1	5q12	2011-05-25	2011-05-25			ENSG00000164181			26292	protein-coding gene	gene with protein product		614451	"""ELOVL family member 7, elongation of long chain fatty acids (yeast)"""			19826053	Standard	NM_024930		Approved	FLJ23563	uc010iwk.3	A1L3X0		ENST00000508821.1:c.683T>C	5.37:g.60050614A>G	ENSP00000424123:p.Met228Thr		60086371	NM_024930	Q589T3|Q9H5D0|Q9NT66	Missense_Mutation	SNP	ENST00000508821.1	37	CCDS34164.1	.	.	.	.	.	.	.	.	.	.	A	12.47	1.946617	0.34377	.	.	ENSG00000164181	ENST00000508821;ENST00000438340;ENST00000425382;ENST00000505959	T;T;T;T	0.20881	2.04;2.04;2.04;2.04	5.89	4.72	0.59763	.	0.163737	0.64402	D	0.000004	T	0.21509	0.0518	L	0.42529	1.33	0.47778	D	0.999516	P;P	0.42337	0.776;0.661	B;P	0.45794	0.41;0.493	T	0.02161	-1.1203	10	0.13108	T	0.6	-16.2278	12.1286	0.53930	0.9323:0.0:0.0677:0.0	.	215;228	D6RHD0;A1L3X0	.;ELOV7_HUMAN	T	228;228;228;215	ENSP00000424123:M228T;ENSP00000411255:M228T;ENSP00000402634:M228T;ENSP00000421043:M215T	ENSP00000402634:M228T	M	-	2	0	ELOVL7	60086371	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.009000	0.76347	2.245000	0.73994	0.454000	0.30748	ATG		0.368	ELOVL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368195.1		
CD180	4064	hgsc.bcm.edu	37	5	66479322	66479322	+	Missense_Mutation	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:66479322A>G	ENST00000256447.4	-	3	1506	c.1349T>C	c.(1348-1350)cTg>cCg	p.L450P	CTD-2306M10.1_ENST00000602471.1_lincRNA	NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	450					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L450P(1)		cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		AGTGAGATTCAGAACCTGAAG	0.438																																					p.L450P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1349C	5						.						155.0	163.0	160.0					5																	66479322		2203	4300	6503	66515078	SO:0001583	missense	4064	exon3			D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.1349T>C	5.37:g.66479322A>G	ENSP00000256447:p.Leu450Pro		66515078	NM_005582	B2R7Z7|Q32MM5	Missense_Mutation	SNP	ENST00000256447.4	37	CCDS3992.1	.	.	.	.	.	.	.	.	.	.	A	15.22	2.767557	0.49574	.	.	ENSG00000134061	ENST00000256447	D	0.81908	-1.55	5.0	5.0	0.66597	.	0.116925	0.34986	N	0.003534	D	0.91092	0.7196	H	0.98996	4.395	0.80722	D	1	D	0.60160	0.987	P	0.47915	0.561	D	0.93439	0.6792	10	0.87932	D	0	.	10.8913	0.46998	0.924:0.0:0.076:0.0	.	450	Q99467	CD180_HUMAN	P	450	ENSP00000256447:L450P	ENSP00000256447:L450P	L	-	2	0	CD180	66515078	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	6.327000	0.72910	2.101000	0.63845	0.460000	0.39030	CTG		0.438	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253973.2	NM_005582	
TMEM174	134288	hgsc.bcm.edu	37	5	72469355	72469355	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:72469355G>A	ENST00000296776.5	+	1	334	c.285G>A	c.(283-285)atG>atA	p.M95I	TMEM174_ENST00000511737.1_3'UTR	NM_153217.2	NP_694949.1	Q8WUU8	TM174_HUMAN	transmembrane protein 174	95						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.M95I(1)		endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		AGTTCAAAATGCTCTCCTGCC	0.522																																					p.M95I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G285A	5						.						88.0	89.0	88.0					5																	72469355		2203	4300	6503	72505111	SO:0001583	missense	134288	exon1			BC019346	CCDS4018.1	5q13.2	2008-02-05			ENSG00000164325	ENSG00000164325			28187	protein-coding gene	gene with protein product		614909				12477932	Standard	NM_153217		Approved	MGC13034, FLJ31268	uc010izc.3	Q8WUU8	OTTHUMG00000131268	ENST00000296776.5:c.285G>A	5.37:g.72469355G>A	ENSP00000296776:p.Met95Ile		72505111	NM_153217	B2RDA0|Q96N81	Missense_Mutation	SNP	ENST00000296776.5	37	CCDS4018.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.788930	0.90367	.	.	ENSG00000164325	ENST00000296776	.	.	.	6.02	6.02	0.97574	.	0.043299	0.85682	D	0.000000	T	0.57888	0.2084	L	0.32530	0.975	0.52501	D	0.999959	P	0.52316	0.952	P	0.47299	0.543	T	0.59984	-0.7351	9	0.66056	D	0.02	-2.9516	20.5407	0.99260	0.0:0.0:1.0:0.0	.	95	Q8WUU8	TM174_HUMAN	I	95	.	ENSP00000296776:M95I	M	+	3	0	TMEM174	72505111	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.206000	0.58473	2.865000	0.98341	0.655000	0.94253	ATG		0.522	TMEM174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254036.1	NM_153217	
ARSB	411	hgsc.bcm.edu	37	5	78076339	78076339	+	Missense_Mutation	SNP	C	C	T	rs138643812		TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:78076339C>T	ENST00000264914.4	-	8	2019	c.1483G>A	c.(1483-1485)Gtc>Atc	p.V495I		NM_000046.3	NP_000037.2	P15848	ARSB_HUMAN	arylsulfatase B	495					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|lysosomal transport (GO:0007041)|lysosome organization (GO:0007040)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|rough endoplasmic reticulum (GO:0005791)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)	p.V495I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		AGCTTTGTGACGATGTGAGGA	0.537																																					p.V495I	Melanoma(169;563 1968 25780 26156 52266)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1483A	5						.	C	ILE/VAL	0,4406		0,0,2203	114.0	96.0	102.0		1483	4.7	0.0	5	dbSNP_134	102	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ARSB	NM_000046.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	495/534	78076339	1,13005	2203	4300	6503	78112095	SO:0001583	missense	411	exon8			M32373	CCDS4043.1, CCDS43334.1	5q14.1	2013-02-14			ENSG00000113273	ENSG00000113273	3.1.6.1	"""Arylsulfatase family"""	714	protein-coding gene	gene with protein product		611542				2303452	Standard	NM_000046		Approved		uc003kfq.3	P15848	OTTHUMG00000108129	ENST00000264914.4:c.1483G>A	5.37:g.78076339C>T	ENSP00000264914:p.Val495Ile		78112095	NM_000046	B2RC20|Q8N322|Q9UDI9	Missense_Mutation	SNP	ENST00000264914.4	37	CCDS4043.1	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410938	0.42817	0.0	1.16E-4	ENSG00000113273	ENST00000264914	D	0.97505	-4.41	5.58	4.68	0.58851	Alkaline-phosphatase-like, core domain (1);	0.588069	0.18004	N	0.154793	D	0.96861	0.8975	M	0.91196	3.185	0.80722	D	1	P	0.41947	0.766	B	0.38020	0.263	D	0.96234	0.9170	10	0.72032	D	0.01	.	11.526	0.50580	0.0:0.9091:0.0:0.0909	.	495	P15848	ARSB_HUMAN	I	495	ENSP00000264914:V495I	ENSP00000264914:V495I	V	-	1	0	ARSB	78112095	0.998000	0.40836	0.009000	0.14445	0.418000	0.31294	3.861000	0.56002	1.263000	0.44181	0.555000	0.69702	GTC		0.537	ARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226932.2	NM_000046	
VCAN	1462	hgsc.bcm.edu	37	5	82832971	82832971	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:82832971A>G	ENST00000265077.3	+	8	4714	c.4149A>G	c.(4147-4149)ctA>ctG	p.L1383L	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000343200.5_Silent_p.L396L|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000512090.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1383	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.L1383L(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AAATAGACCTATACCACAGTg	0.388																																					p.L396L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1188G	5						.						56.0	59.0	58.0					5																	82832971		2203	4300	6503	82868727	SO:0001819	synonymous_variant	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.4149A>G	5.37:g.82832971A>G			82868727	NM_001164097	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																				0.388	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
VCAN	1462	hgsc.bcm.edu	37	5	82836265	82836265	+	Silent	SNP	A	A	G			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:82836265A>G	ENST00000265077.3	+	8	8008	c.7443A>G	c.(7441-7443)ggA>ggG	p.G2481G	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000343200.5_Silent_p.G1494G|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN-AS1_ENST00000512090.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2481	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.G2481G(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CTGCTGATGGATTCCCAACAG	0.473																																					p.G1494G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A4482G	5						.						87.0	84.0	85.0					5																	82836265		2203	4300	6503	82872021	SO:0001819	synonymous_variant	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7443A>G	5.37:g.82836265A>G			82872021	NM_001164097	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																				0.473	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
NR2F1	7025	hgsc.bcm.edu	37	5	92929488	92929488	+	Silent	SNP	C	C	T			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:92929488C>T	ENST00000327111.3	+	3	2899	c.1212C>T	c.(1210-1212)cgC>cgT	p.R404R	NR2F1_ENST00000506162.1_3'UTR	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	404					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.R404R(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		CTCTCATCCGCGATATGTTAC	0.582																																					p.R404R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1212T	5						.						132.0	122.0	126.0					5																	92929488		2203	4300	6503	92955244	SO:0001819	synonymous_variant	7025	exon3			BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.1212C>T	5.37:g.92929488C>T			92955244	NM_005654		Silent	SNP	ENST00000327111.3	37	CCDS4068.1																																																																																				0.582	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239293.2	NM_005654	
FAF2	23197	hgsc.bcm.edu	37	5	175927074	175927074	+	Missense_Mutation	SNP	G	G	A			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr5:175927074G>A	ENST00000261942.6	+	10	1135	c.1082G>A	c.(1081-1083)aGt>aAt	p.S361N		NM_014613.2	NP_055428.1	Q96CS3	FAF2_HUMAN	Fas associated factor family member 2	361	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.				lipid particle organization (GO:0034389)|negative regulation of catalytic activity (GO:0043086)|response to unfolded protein (GO:0006986)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	lipase binding (GO:0035473)|lipase inhibitor activity (GO:0055102)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.S361N(1)		breast(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						GACCCTGAAAGTGTCAAGATC	0.443																																					p.S361N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1082A	5						.						115.0	112.0	113.0					5																	175927074		2203	4300	6503	175859680	SO:0001583	missense	23197	exon10			BC015791	CCDS34296.1	5q35.2	2011-06-28	2008-07-25	2008-07-25	ENSG00000113194	ENSG00000113194		"""UBX domain containing"""	24666	protein-coding gene	gene with protein product	"""expressed in T cells and eosinophils in atopic dermatitis"", ""UBX domain protein 3B"""		"""UBX domain containing 8"""	UBXD8		10048485, 12372427	Standard	NM_014613		Approved	ETEA, KIAA0887, UBXN3B	uc003mej.4	Q96CS3	OTTHUMG00000163228	ENST00000261942.6:c.1082G>A	5.37:g.175927074G>A	ENSP00000261942:p.Ser361Asn		175859680	NM_014613	O94963|Q8IUF2|Q9BRP2|Q9BVM7	Missense_Mutation	SNP	ENST00000261942.6	37	CCDS34296.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947485	0.53186	.	.	ENSG00000113194	ENST00000261942	.	.	.	5.26	5.26	0.73747	UBX (2);	0.078317	0.85682	D	0.000000	T	0.44180	0.1281	N	0.25485	0.75	0.48341	D	0.999637	B	0.12630	0.006	B	0.19391	0.025	T	0.30880	-0.9963	9	0.29301	T	0.29	-5.8549	12.2557	0.54623	0.0781:0.0:0.9219:0.0	.	361	Q96CS3	FAF2_HUMAN	N	361	.	ENSP00000261942:S361N	S	+	2	0	FAF2	175859680	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	7.606000	0.82863	2.447000	0.82792	0.650000	0.86243	AGT		0.443	FAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372194.1	NM_014613	
PSMD9	5715	hgsc.bcm.edu	37	12	122326902	122326902	+	Splice_Site	SNP	T	T	C			TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-A6-2672-01A-01W-0833-10	TCGA-A6-2672-10A-01W-0833-10	g.chr12:122326902T>C	ENST00000541212.1	+	1	264		c.e1+2		RP11-87C12.2_ENST00000546333.1_Splice_Site|PSMD9_ENST00000542602.1_Splice_Site|PSMD9_ENST00000261817.2_Splice_Site|PSMD9_ENST00000340175.5_Splice_Site			O00233	PSMD9_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 9						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion (GO:0046676)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome regulatory particle (GO:0005838)	bHLH transcription factor binding (GO:0043425)|transcription coactivator activity (GO:0003713)	p.?(1)		endometrium(1)|large_intestine(1)|lung(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000117)|Epithelial(86;0.000415)|BRCA - Breast invasive adenocarcinoma(302;0.231)		CTGGAAAGCGTGAGTGTGGGT	0.652											OREG0022209	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.												.	.	1	Unknown(1)	large_intestine(1)	.	12						.						41.0	23.0	29.0					12																	122326902		2199	4293	6492	120811285	SO:0001630	splice_region_variant	5715	.			AB003177	CCDS9225.1, CCDS58284.1	12q24.31-q24.32	2008-05-22			ENSG00000110801	ENSG00000110801		"""Proteasome (prosome, macropain) subunits"""	9567	protein-coding gene	gene with protein product		603146				9653651	Standard	NM_002813		Approved	p27, Rpn4	uc001ubl.4	O00233	OTTHUMG00000168945	ENST00000541212.1:c.138+2T>C	12.37:g.122326902T>C		1518	120811285	.	B2RD35|G3V1Q6|Q9BQ42	Splice_Site	SNP	ENST00000541212.1	37	CCDS9225.1	.	.	.	.	.	.	.	.	.	.	T	17.46	3.394525	0.62066	.	.	ENSG00000110801;ENSG00000110801;ENSG00000110801;ENSG00000110801;ENSG00000256950	ENST00000541212;ENST00000340175;ENST00000261817;ENST00000538613;ENST00000542602	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8753	0.57988	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RP11-87C12.2;PSMD9	120811285	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	4.512000	0.60469	2.107000	0.64212	0.459000	0.35465	.		0.652	PSMD9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401686.1	NM_002813	Intron
