#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ELK3	2004	hgsc.bcm.edu	37	12	96641028	96641029	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr12:96641028_96641029insC	ENST00000228741.3	+	3	844_845	c.518_519insC	c.(517-522)agccccfs	p.SP173fs	ELK3_ENST00000552142.1_Intron	NM_005230.2	NP_005221.2	P41970	ELK3_HUMAN	ELK3, ETS-domain protein (SRF accessory protein 2)	173					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|wound healing (GO:0042060)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.V176fs*14(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(5)|ovary(2)|prostate(1)|stomach(2)	20	all_cancers(2;0.00173)					CCCGAAGACAGCCCCCCCGTGG	0.579																																					p.S173fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.518_519insC	12						.																																			95165160	SO:0001589	frameshift_variant	2004	exon3			BC017371	CCDS9060.1	12q23	2006-12-30				ENSG00000111145			3325	protein-coding gene	gene with protein product		600247				7851904	Standard	NM_005230		Approved	ERP, NET, SAP2	uc001teo.1	P41970		ENST00000228741.3:c.525dupC	12.37:g.96641035_96641035dupC	ENSP00000228741:p.Ser173fs		95165159	NM_005230	B2R6S6|Q6FG57|Q6GU29|Q9UD17	Frame_Shift_Ins	INS	ENST00000228741.3	37	CCDS9060.1																																																																																				0.579	ELK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408694.1	NM_005230	
MLPH	79083	hgsc.bcm.edu	37	2	238449538	238449539	+	Frame_Shift_Ins	INS	-	-	AA	rs538560359		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr2:238449538_238449539insAA	ENST00000264605.3	+	11	1678_1679	c.1384_1385insAA	c.(1384-1386)ctgfs	p.L462fs	MLPH_ENST00000410032.1_Frame_Shift_Ins_p.L319fs|MLPH_ENST00000409373.1_Intron|MLPH_ENST00000468178.1_3'UTR|MLPH_ENST00000338530.4_Frame_Shift_Ins_p.L434fs|MLPH_ENST00000445024.2_Frame_Shift_Ins_p.L462fs	NM_024101.5	NP_077006.1	Q9BV36	MELPH_HUMAN	melanophilin	462					melanocyte differentiation (GO:0030318)|melanosome localization (GO:0032400)|protein targeting (GO:0006605)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|microtubule plus-end (GO:0035371)|stress fiber (GO:0001725)	metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		AGATGAGGAGCTGTCAGAGCTG	0.594																																					p.L434fs												.	.	0			c.1300_1301insAA	2						.																																			238114278	SO:0001589	frameshift_variant	79083	exon10			AY358857	CCDS2518.1, CCDS42836.1, CCDS63172.1, CCDS63173.1	2q37.2	2014-09-17			ENSG00000115648	ENSG00000115648			29643	protein-coding gene	gene with protein product		606526				11980908, 11504925	Standard	NM_024101		Approved	l1Rk3, l(1)-3Rk, Slac-2a, ln, exophilin-3	uc002vwt.3	Q9BV36	OTTHUMG00000133298	Exception_encountered	2.37:g.238449538_238449539insAA	ENSP00000264605:p.Leu462fs		238114277	NM_001042467	B3KSS2|B4DKW7|G5E9G5|Q9HA71	Frame_Shift_Ins	INS	ENST00000264605.3	37	CCDS2518.1																																																																																				0.594	MLPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257083.2	NM_024101	
DYSF	8291	hgsc.bcm.edu	37	2	71839796	71839797	+	Frame_Shift_Ins	INS	-	-	C	rs398123786		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr2:71839796_71839797insC	ENST00000258104.3	+	39	4470_4471	c.4193_4194insC	c.(4192-4197)tgccccfs	p.CP1398fs	DYSF_ENST00000410041.1_Frame_Shift_Ins_p.CP1416fs|DYSF_ENST00000409582.3_Frame_Shift_Ins_p.CP1415fs|DYSF_ENST00000409366.1_Frame_Shift_Ins_p.CP1399fs|DYSF_ENST00000394120.2_Frame_Shift_Ins_p.CP1399fs|DYSF_ENST00000429174.2_Frame_Shift_Ins_p.CP1398fs|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000410020.3_Frame_Shift_Ins_p.CP1416fs|DYSF_ENST00000409762.1_Frame_Shift_Ins_p.CP1415fs|DYSF_ENST00000413539.2_Frame_Shift_Ins_p.CP1429fs|DYSF_ENST00000409744.1_Frame_Shift_Ins_p.CP1385fs|DYSF_ENST00000409651.1_Frame_Shift_Ins_p.CP1430fs	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1398	C2 5. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GAGCTCTACTGCCCCCCCATCA	0.619																																					p.C1415fs												.	.	0			c.4244_4245insC	2	GRCh37	CM053841	DYSF	M		.																																			71693305	SO:0001589	frameshift_variant	8291	exon39			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.4200dupC	2.37:g.71839803_71839803dupC	ENSP00000258104:p.Cys1398fs		71693304	NM_001130981	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Frame_Shift_Ins	INS	ENST00000258104.3	37	CCDS1918.1																																																																																				0.619	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
MYL10	93408	hgsc.bcm.edu	37	7	101259514	101259514	+	Silent	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr7:101259514G>A	ENST00000223167.4	-	6	696	c.519C>T	c.(517-519)ttC>ttT	p.F173F		NM_138403.4	NP_612412.2	Q9BUA6	MYL10_HUMAN	myosin, light chain 10, regulatory	173	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)	p.F173F(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	12						CGGCCTTGACGAAACCTTTCC	0.562																																					p.F173F	Esophageal Squamous(24;575 709 17516 40384 51639)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C519T	7						.						112.0	91.0	98.0					7																	101259514		2203	4300	6503	101046234	SO:0001819	synonymous_variant	93408	exon6			BC002778	CCDS34713.1	7q22.1	2013-01-10			ENSG00000106436	ENSG00000106436		"""Myosins / Light chain"", ""EF-hand domain containing"""	29825	protein-coding gene	gene with protein product						1628631	Standard	NM_138403		Approved	MGC3479, MYLC2PL, PLRLC	uc003uyr.3	Q9BUA6	OTTHUMG00000157137	ENST00000223167.4:c.519C>T	7.37:g.101259514G>A			101046234	NM_138403		Silent	SNP	ENST00000223167.4	37	CCDS34713.1																																																																																				0.562	MYL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347575.1	NM_138403	
CARD11	84433	hgsc.bcm.edu	37	7	2974121	2974121	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr7:2974121G>A	ENST00000396946.4	-	10	1887	c.1484C>T	c.(1483-1485)cCg>cTg	p.P495L		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	495					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.P488L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GCGCTGGGGCGGATGGTAGGG	0.632			Mis		DLBCL																																p.P495L			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1484T	7						.						83.0	71.0	75.0					7																	2974121		2203	4300	6503	2940647	SO:0001583	missense	84433	exon10			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1484C>T	7.37:g.2974121G>A	ENSP00000380150:p.Pro495Leu		2940647	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	11.62	1.691952	0.30052	.	.	ENSG00000198286	ENST00000396946	T	0.53423	0.62	5.22	5.22	0.72569	.	0.124671	0.56097	D	0.000035	T	0.27489	0.0675	N	0.22421	0.69	0.54753	D	0.999984	P	0.42375	0.778	B	0.27170	0.077	T	0.10660	-1.0620	10	0.22109	T	0.4	-31.1137	14.2037	0.65721	0.0:0.1615:0.8385:0.0	.	495	Q9BXL7	CAR11_HUMAN	L	495	ENSP00000380150:P495L	ENSP00000380150:P495L	P	-	2	0	CARD11	2940647	1.000000	0.71417	0.959000	0.39883	0.597000	0.36814	3.354000	0.52254	2.458000	0.83093	0.561000	0.74099	CCG		0.632	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
GUSB	2990	hgsc.bcm.edu	37	7	65445385	65445385	+	Silent	SNP	G	G	A	rs140016611	byFrequency	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr7:65445385G>A	ENST00000304895.4	-	2	352	c.222C>T	c.(220-222)acC>acT	p.T74T	GUSB_ENST00000476486.1_5'UTR|GUSB_ENST00000345660.6_Silent_p.T74T|GUSB_ENST00000421103.1_Silent_p.T74T	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	74					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)	p.T74T(1)		breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						GCATGTCCACGGTGGGGCCTG	0.632													G|||	6	0.00119808	0.0015	0.0029	5008	,	,		16155	0.0		0.002	False		,,,				2504	0.0				p.T74T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C222T	7						.	G		4,4402	8.1+/-20.4	0,4,2199	49.0	42.0	45.0		222	0.7	0.9	7	dbSNP_134	45	23,8577	16.0+/-53.3	0,23,4277	no	coding-synonymous	GUSB	NM_000181.3		0,27,6476	AA,AG,GG		0.2674,0.0908,0.2076		74/652	65445385	27,12979	2203	4300	6503	65082820	SO:0001819	synonymous_variant	2990	exon2			M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.222C>T	7.37:g.65445385G>A			65082820	NM_000181	B4E1F6|E9PCV0|Q549U0|Q96CL9	Silent	SNP	ENST00000304895.4	37	CCDS5530.1																																																																																				0.632	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3	NM_000181	
GTPBP10	85865	hgsc.bcm.edu	37	7	90001521	90001521	+	Missense_Mutation	SNP	C	C	A	rs147840858	byFrequency	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr7:90001521C>A	ENST00000222511.6	+	5	583	c.517C>A	c.(517-519)Cct>Act	p.P173T	GTPBP10_ENST00000257659.8_Missense_Mutation_p.P94T	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	173	OBG-type G. {ECO:0000255|PROSITE- ProRule:PRU01047}.				ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)	p.P173T(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						TCATGCAAAACCTGCAATTGC	0.294													C|||	6	0.00119808	0.0	0.0014	5008	,	,		16694	0.0		0.005	False		,,,				2504	0.0				p.P173T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C517A	7						.	C	THR/PRO,THR/PRO	1,4405	2.1+/-5.4	0,1,2202	71.0	66.0	68.0		280,517	5.9	1.0	7	dbSNP_134	68	20,8578	14.6+/-50.1	0,20,4279	yes	missense,missense	GTPBP10	NM_001042717.2,NM_033107.3	38,38	0,21,6481	AA,AC,CC		0.2326,0.0227,0.1615	probably-damaging,probably-damaging	94/309,173/388	90001521	21,12983	2203	4299	6502	89839457	SO:0001583	missense	85865	exon5				CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.517C>A	7.37:g.90001521C>A	ENSP00000222511:p.Pro173Thr		89839457	NM_033107	B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Missense_Mutation	SNP	ENST00000222511.6	37	CCDS5617.1	4	0.0018315018315018315	0	0.0	0	0.0	0	0.0	4	0.005277044854881266	C	27.8	4.859684	0.91433	2.27E-4	0.002326	ENSG00000105793	ENST00000426366;ENST00000450619;ENST00000257659;ENST00000222511	T;T;T;T	0.17528	2.31;2.31;2.27;2.27	5.91	5.91	0.95273	GTP1/OBG (1);GTP-binding domain, HSR1-related (1);	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	M	0.84683	2.71	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.987;0.988;0.996	T	0.42916	-0.9423	9	.	.	.	10.7131	20.2985	0.98592	0.0:1.0:0.0:0.0	.	94;173;164;190	A4D1E9-2;A4D1E9;C9J8R7;C9JNI1	.;GTPBA_HUMAN;.;.	T	164;190;94;173	ENSP00000405697:P164T;ENSP00000389510:P190T;ENSP00000257659:P94T;ENSP00000222511:P173T	.	P	+	1	0	GTPBP10	89839457	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.559000	0.73946	2.793000	0.96121	0.655000	0.94253	CCT		0.294	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059976.3	NM_033107	
LAMB4	22798	hgsc.bcm.edu	37	7	107703327	107703329	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	GCC	GCC	GCC	GCC	GCC	GCC	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr7:107703327_107703329delGCC	ENST00000388781.3	-	23	3255_3257	c.3172_3174delGGC	c.(3172-3174)ggcdel	p.G1058del	LAMB4_ENST00000388780.3_In_Frame_Del_p.G1058del|LAMB4_ENST00000205386.4_In_Frame_Del_p.G1058del	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1058	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						CACAGGCCAGGCCTGTGACATTC	0.581																																					p.1058_1058del												.	.	0			c.3172_3174del	7						.																																			107490565	SO:0001651	inframe_deletion	22798	exon23			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.3172_3174delGGC	7.37:g.107703327_107703329delGCC	ENSP00000373433:p.Gly1058del		107490563	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	In_Frame_Del	DEL	ENST00000388781.3	37	CCDS34732.1																																																																																				0.581	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
NUP205	23165	hgsc.bcm.edu	37	7	135258511	135258511	+	Missense_Mutation	SNP	C	C	A	rs148613242	byFrequency	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr7:135258511C>A	ENST00000285968.6	+	3	307	c.281C>A	c.(280-282)gCc>gAc	p.A94D	NUP205_ENST00000489493.1_3'UTR|NUP205_ENST00000440390.2_5'UTR	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	94					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.A94D(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						ATTAAAGAAGCCTTTATTCTC	0.428																																					p.A94D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C281A	7						.						106.0	98.0	101.0					7																	135258511		2203	4300	6503	134909051	SO:0001583	missense	23165	exon3			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.281C>A	7.37:g.135258511C>A	ENSP00000285968:p.Ala94Asp		134909051	NM_015135	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	C	33	5.201287	0.94997	.	.	ENSG00000155561	ENST00000285968	T	0.38077	1.16	5.1	5.1	0.69264	.	0.047245	0.85682	D	0.000000	T	0.62319	0.2418	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.67130	-0.5748	10	0.87932	D	0	0.0962	18.4985	0.90874	0.0:1.0:0.0:0.0	.	94	Q92621	NU205_HUMAN	D	94	ENSP00000285968:A94D	ENSP00000285968:A94D	A	+	2	0	NUP205	134909051	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.873000	0.69644	2.373000	0.80994	0.484000	0.47621	GCC		0.428	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
NSFL1C	55968	hgsc.bcm.edu	37	20	1445068	1445068	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr20:1445068C>T	ENST00000216879.4	-	2	976	c.109G>A	c.(109-111)Gcg>Acg	p.A37T	NSFL1C_ENST00000381658.4_Intron|NSFL1C_ENST00000353088.2_Missense_Mutation_p.A37T|NSFL1C_ENST00000476071.1_Missense_Mutation_p.A37T|NSFL1C_ENST00000350991.4_Missense_Mutation_p.A37T	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	37						chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.A37T(1)		breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						CTCGCTAGCGCGATCTGAAAC	0.522																																					p.A37T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G109A	20						.						117.0	105.0	109.0					20																	1445068		2203	4300	6503	1393068	SO:0001583	missense	55968	exon2			AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.109G>A	20.37:g.1445068C>T	ENSP00000216879:p.Ala37Thr		1393068	NM_016143	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Missense_Mutation	SNP	ENST00000216879.4	37	CCDS13015.1	.	.	.	.	.	.	.	.	.	.	C	32	5.115020	0.94339	.	.	ENSG00000088833	ENST00000353088;ENST00000476071;ENST00000216879;ENST00000350991	T;T;T;T	0.67345	-0.26;0.06;0.09;0.07	4.87	4.87	0.63330	UBA-like (1);	0.000000	0.85682	D	0.000000	D	0.84257	0.5432	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.77557	0.982;0.99	D	0.87465	0.2410	10	0.87932	D	0	-8.3537	16.375	0.83382	0.0:1.0:0.0:0.0	.	37;37	Q9UNZ2-4;Q9UNZ2	.;NSF1C_HUMAN	T	37	ENSP00000338643:A37T;ENSP00000418529:A37T;ENSP00000216879:A37T;ENSP00000202584:A37T	ENSP00000216879:A37T	A	-	1	0	NSFL1C	1393068	1.000000	0.71417	0.998000	0.56505	0.948000	0.59901	6.041000	0.70988	2.526000	0.85167	0.591000	0.81541	GCG		0.522	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077525.2	NM_016143	
SIRPD	128646	hgsc.bcm.edu	37	20	1517840	1517840	+	Missense_Mutation	SNP	C	C	T	rs143061754		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr20:1517840C>T	ENST00000381623.3	-	3	1727	c.538G>A	c.(538-540)Gtc>Atc	p.V180I	SIRPD_ENST00000381621.1_Missense_Mutation_p.V181I			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	180						extracellular region (GO:0005576)		p.V180I(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						CAGGGTTGGACGAAATAGTTT	0.612													c|||	1	0.000199681	0.0	0.0	5008	,	,		17006	0.001		0.0	False		,,,				2504	0.0				p.V180I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G538A	20						.	T	ILE/VAL	0,4406		0,0,2203	141.0	124.0	129.0		538	-2.6	0.0	20	dbSNP_134	129	1,8599	1.2+/-3.3	0,1,4299	no	missense	SIRPD	NM_178460.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	180/198	1517840	1,13005	2203	4300	6503	1465840	SO:0001583	missense	128646	exon3			AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.538G>A	20.37:g.1517840C>T	ENSP00000371036:p.Val180Ile		1465840	NM_178460	B3KS88|Q5TFQ6	Missense_Mutation	SNP	ENST00000381623.3	37	CCDS13018.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	0.027	-1.359757	0.01245	0.0	1.16E-4	ENSG00000125900	ENST00000381623;ENST00000381621	T;T	0.01963	4.53;4.58	2.8	-2.58	0.06228	.	7.689020	0.02608	N	0.101778	T	0.01353	0.0044	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45687	-0.9244	10	0.35671	T	0.21	.	1.4512	0.02376	0.258:0.4123:0.1072:0.2224	.	180	Q9H106	SIRPD_HUMAN	I	180;181	ENSP00000371036:V180I;ENSP00000371034:V181I	ENSP00000371034:V181I	V	-	1	0	SIRPD	1465840	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.098000	0.03346	-1.183000	0.02723	-4.364000	0.00006	GTC		0.612	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460	
TTPAL	79183	hgsc.bcm.edu	37	20	43118080	43118080	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr20:43118080C>G	ENST00000372904.3	+	6	1070	c.927C>G	c.(925-927)gaC>gaG	p.D309E	TTPAL_ENST00000262605.4_Missense_Mutation_p.D309E|TTPAL_ENST00000372906.2_3'UTR	NM_024331.4	NP_077307.2	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	309						intracellular (GO:0005622)|membrane (GO:0016020)	transporter activity (GO:0005215)	p.D309E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|skin(5)	18						CTGCCTGTGACAGCATCCTGG	0.587																																					p.D309E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C927G	20						.						63.0	60.0	61.0					20																	43118080		2203	4300	6503	42551494	SO:0001583	missense	79183	exon5			BC003071	CCDS13332.2	20q13.12	2008-06-23	2008-06-23	2008-06-23	ENSG00000124120	ENSG00000124120			16114	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 121"""	C20orf121			Standard	NM_024331		Approved	dJ179M20.3	uc002xmd.2	Q9BTX7	OTTHUMG00000032536	ENST00000372904.3:c.927C>G	20.37:g.43118080C>G	ENSP00000361995:p.Asp309Glu		42551494	NM_001039199	E1P5X3|Q5QPC1|Q9H1G2|Q9NQG8	Missense_Mutation	SNP	ENST00000372904.3	37	CCDS13332.2	.	.	.	.	.	.	.	.	.	.	C	12.54	1.968415	0.34754	.	.	ENSG00000124120	ENST00000262605;ENST00000372904;ENST00000456317	T;T;D	0.86627	-1.15;-1.15;-2.15	6.17	2.74	0.32292	.	0.366026	0.33670	N	0.004680	T	0.66790	0.2825	N	0.03608	-0.345	0.80722	D	1	B;B	0.15473	0.013;0.002	B;B	0.12837	0.008;0.001	T	0.55698	-0.8100	10	0.11794	T	0.64	-28.1901	7.8815	0.29624	0.1177:0.6754:0.0:0.2069	.	246;309	B2RA57;Q9BTX7	.;TTPAL_HUMAN	E	309;309;275	ENSP00000262605:D309E;ENSP00000361995:D309E;ENSP00000412720:D275E	ENSP00000262605:D309E	D	+	3	2	TTPAL	42551494	1.000000	0.71417	0.890000	0.34922	0.312000	0.27988	1.828000	0.39111	0.911000	0.36747	0.655000	0.94253	GAC		0.587	TTPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106886.2	NM_024331	
PLCB1	23236	hgsc.bcm.edu	37	20	8696935	8696935	+	Silent	SNP	G	G	A	rs143366963	byFrequency	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr20:8696935G>A	ENST00000338037.6	+	13	1302	c.1275G>A	c.(1273-1275)gcG>gcA	p.A425A	PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378637.2_Silent_p.A425A|PLCB1_ENST00000378641.3_Silent_p.A425A	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	425	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.A425A(2)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						CCAAGATGGCGGAGTACTGCC	0.468																																					p.A425A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1275A	20						.	G	,	0,4406		0,0,2203	106.0	97.0	100.0		1275,1275	-12.0	0.1	20	dbSNP_134	100	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	PLCB1	NM_015192.2,NM_182734.1	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	425/1217,425/1174	8696935	2,13004	2203	4300	6503	8644935	SO:0001819	synonymous_variant	23236	exon13			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1275G>A	20.37:g.8696935G>A			8644935	NM_182734	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Silent	SNP	ENST00000338037.6	37	CCDS13102.1																																																																																				0.468	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
TSHZ2	128553	hgsc.bcm.edu	37	20	51872385	51872385	+	Silent	SNP	C	C	T	rs370696928		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr20:51872385C>T	ENST00000371497.5	+	2	3275	c.2388C>T	c.(2386-2388)gcC>gcT	p.A796A	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Silent_p.A793A|TSHZ2_ENST00000329613.6_Silent_p.A793A	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	796					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A796A(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CTGACATCGCCGACATGGTCA	0.567																																					p.A796A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2388T	20						.	C	,	0,4406		0,0,2203	104.0	97.0	99.0		2379,2388	-1.1	1.0	20		99	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TSHZ2	NM_001193421.1,NM_173485.5	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	793/1032,796/1035	51872385	1,13005	2203	4300	6503	51305792	SO:0001819	synonymous_variant	128553	exon2			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2388C>T	20.37:g.51872385C>T			51305792	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	ENST00000371497.5	37	CCDS33490.1																																																																																				0.567	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
COCH	1690	hgsc.bcm.edu	37	14	31355233	31355233	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr14:31355233G>A	ENST00000396618.3	+	11	1248	c.1192G>A	c.(1192-1194)Gaa>Aaa	p.E398K	RP11-829H16.3_ENST00000556786.1_RNA|COCH_ENST00000216361.4_Missense_Mutation_p.E398K|COCH_ENST00000382493.4_Missense_Mutation_p.E249K|COCH_ENST00000475087.1_Missense_Mutation_p.E398K|RP11-829H16.3_ENST00000555421.1_RNA|RP11-829H16.3_ENST00000555108.1_RNA|RP11-829H16.3_ENST00000468444.2_RNA|COCH_ENST00000460581.2_Missense_Mutation_p.E286K	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	398	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.E398K(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		CAAGACTTTTGAAATCTCGGA	0.433																																					p.E398K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1192A	14						.						111.0	98.0	102.0					14																	31355233		2203	4300	6503	30424984	SO:0001583	missense	1690	exon11				CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.1192G>A	14.37:g.31355233G>A	ENSP00000379862:p.Glu398Lys		30424984	NM_004086	A8K9K9|D3DS84|Q96IU6	Missense_Mutation	SNP	ENST00000396618.3	37	CCDS9640.1	.	.	.	.	.	.	.	.	.	.	G	33	5.262176	0.95368	.	.	ENSG00000100473	ENST00000216361;ENST00000396618;ENST00000475087;ENST00000460581;ENST00000382493	T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12	6.02	6.02	0.97574	von Willebrand factor, type A (3);	0.091774	0.85682	D	0.000000	D	0.85358	0.5678	L	0.47078	1.49	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.994	D;P;D	0.67382	0.951;0.871;0.926	D	0.84934	0.0861	10	0.62326	D	0.03	-25.8188	20.547	0.99278	0.0:0.0:1.0:0.0	.	249;398;398	E7EN67;Q96IU6;O43405	.;.;COCH_HUMAN	K	398;398;398;286;249	ENSP00000216361:E398K;ENSP00000379862:E398K;ENSP00000451528:E398K;ENSP00000451713:E286K;ENSP00000371933:E249K	ENSP00000216361:E398K	E	+	1	0	COCH	30424984	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.827000	0.99397	2.850000	0.98022	0.650000	0.86243	GAA		0.433	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1	NM_004086	
EGLN3	112399	hgsc.bcm.edu	37	14	34398399	34398399	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr14:34398399C>T	ENST00000250457.3	-	3	825	c.497G>A	c.(496-498)cGg>cAg	p.R166Q	EGLN3_ENST00000553215.1_Missense_Mutation_p.R72Q	NM_022073.3	NP_071356.1	Q9H6Z9	EGLN3_HUMAN	egl-9 family hypoxia-inducible factor 3	166	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein hydroxylation (GO:0018126)|regulation of cell proliferation (GO:0042127)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|peptidyl-proline 4-dioxygenase activity (GO:0031545)	p.R166Q(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|upper_aerodigestive_tract(1)	15	Breast(36;0.0303)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	Vitamin C(DB00126)	TGGAAATATCCGCAGGATCCC	0.438																																					p.R166Q	Esophageal Squamous(161;245 1904 13895 22565 30076)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G497A	14						.						85.0	79.0	81.0					14																	34398399		2203	4300	6503	33468150	SO:0001583	missense	112399	exon3			AJ310545	CCDS9646.1	14q12	2013-08-21	2013-08-21		ENSG00000129521	ENSG00000129521			14661	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 3"""	606426	"""EGL nine (C.elegans) homolog 3"", ""egl nine homolog 3 (C. elegans)"""				Standard	NM_022073		Approved	PHD3, HIFPH3	uc001wsa.4	Q9H6Z9	OTTHUMG00000029498	ENST00000250457.3:c.497G>A	14.37:g.34398399C>T	ENSP00000250457:p.Arg166Gln		33468150	NM_022073	Q2TA79|Q3B8N4|Q6P1R2	Missense_Mutation	SNP	ENST00000250457.3	37	CCDS9646.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449533	0.84101	.	.	ENSG00000129521	ENST00000250457;ENST00000539567;ENST00000553215;ENST00000487915	T;T;T	0.59083	0.29;0.29;0.29	5.48	5.48	0.80851	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.73289	0.3568	M	0.73598	2.24	0.80722	D	1	D;D	0.71674	0.998;0.966	P;P	0.59221	0.854;0.461	T	0.70795	-0.4775	10	0.33940	T	0.23	-6.4109	19.6977	0.96034	0.0:1.0:0.0:0.0	.	166;72	Q9H6Z9;F8W1G2	EGLN3_HUMAN;.	Q	166;166;72;48	ENSP00000250457:R166Q;ENSP00000447470:R72Q;ENSP00000451316:R48Q	ENSP00000250457:R166Q	R	-	2	0	EGLN3	33468150	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.951000	0.56684	2.733000	0.93635	0.563000	0.77884	CGG		0.438	EGLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276647.1		
EP300	2033	hgsc.bcm.edu	37	22	41536193	41536193	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr22:41536193C>G	ENST00000263253.7	+	9	3029	c.1810C>G	c.(1810-1812)Cgg>Ggg	p.R604G		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	604	KIX. {ECO:0000255|PROSITE- ProRule:PRU00311}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.R604G(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						AAAAGACAGACGGATGGAAAA	0.403			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.R604G			Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1810G	22						.						144.0	142.0	142.0					22																	41536193		2203	4300	6503	39866139	SO:0001583	missense	2033	exon9	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.1810C>G	22.37:g.41536193C>G	ENSP00000263253:p.Arg604Gly		39866139	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238520	0.79800	.	.	ENSG00000100393	ENST00000263253	D	0.90563	-2.69	5.08	2.76	0.32466	Coactivator CBP, KIX (4);	0.000000	0.44483	D	0.000446	D	0.94013	0.8082	M	0.66939	2.045	0.47737	D	0.999504	D	0.89917	1.0	D	0.91635	0.999	D	0.94505	0.7713	10	0.87932	D	0	-15.8855	14.2028	0.65716	0.2691:0.7309:0.0:0.0	.	604	Q09472	EP300_HUMAN	G	604	ENSP00000263253:R604G	ENSP00000263253:R604G	R	+	1	2	EP300	39866139	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.902000	0.56310	1.201000	0.43203	0.467000	0.42956	CGG		0.403	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
KDELR1	10945	hgsc.bcm.edu	37	19	48892816	48892816	+	Silent	SNP	A	A	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr19:48892816A>G	ENST00000330720.2	-	3	539	c.345T>C	c.(343-345)ccT>ccC	p.P115P	KDELR1_ENST00000597017.1_Silent_p.P53P	NM_006801.2	NP_006792.1	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1	115					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	KDEL sequence binding (GO:0005046)	p.P115P(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|pancreas(1)|urinary_tract(1)	11		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		CTACCTCCAGAGGGGTGAAGT	0.542																																					p.P115P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T345C	19						.						121.0	105.0	111.0					19																	48892816		2203	4300	6503	53584628	SO:0001819	synonymous_variant	10945	exon3			X55885	CCDS12718.1	19q13.3	2008-05-02				ENSG00000105438			6304	protein-coding gene	gene with protein product		131235				2172835	Standard	NM_006801		Approved	ERD2.1, ERD2, HDEL	uc002pjb.1	P24390		ENST00000330720.2:c.345T>C	19.37:g.48892816A>G			53584628	NM_006801	B2R6N4|Q54A39|Q8NBW7	Silent	SNP	ENST00000330720.2	37	CCDS12718.1																																																																																				0.542	KDELR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465708.1		
ZNF350	59348	hgsc.bcm.edu	37	19	52468777	52468777	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr19:52468777C>T	ENST00000243644.4	-	5	1156	c.929G>A	c.(928-930)cGa>cAa	p.R310Q	HCCAT3_ENST00000595010.1_RNA|HCCAT3_ENST00000600253.1_RNA|ZNF350_ENST00000600703.1_5'Flank	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	310					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R310Q(2)		breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		TGTATGAATTCGCTGGTGTAC	0.398																																					p.R310Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G929A	19						.						106.0	101.0	103.0					19																	52468777		2203	4300	6503	57160589	SO:0001583	missense	59348	exon5			AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.929G>A	19.37:g.52468777C>T	ENSP00000243644:p.Arg310Gln		57160589	NM_021632	Q96G73|Q9HAQ4	Missense_Mutation	SNP	ENST00000243644.4	37	CCDS12845.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.776487	0.31411	.	.	ENSG00000256683	ENST00000243644	T	0.24723	1.84	3.41	2.35	0.29111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.30392	N	0.009737	T	0.27832	0.0685	L	0.45698	1.435	0.24446	N	0.994505	D	0.65815	0.995	P	0.51895	0.683	T	0.08452	-1.0721	10	0.87932	D	0	.	5.5794	0.17241	0.2002:0.6896:0.0:0.1102	.	310	Q9GZX5	ZN350_HUMAN	Q	310	ENSP00000243644:R310Q	ENSP00000243644:R310Q	R	-	2	0	ZNF350	57160589	0.000000	0.05858	0.194000	0.23346	0.014000	0.08584	-0.195000	0.09546	0.618000	0.30179	-0.282000	0.10007	CGA		0.398	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462278.1	NM_021632	
STAP2	55620	hgsc.bcm.edu	37	19	4332051	4332052	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	TT	TT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr19:4332051_4332052delTT	ENST00000594605.1	-	4	444_445	c.321_322delAA	c.(319-324)gaaatgfs	p.EM107fs	STAP2_ENST00000600324.1_Frame_Shift_Del_p.EM107fs	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	107	PH.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.E107fs*30(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTTTCCACATTTCCCGACACT	0.475																																					p.107_108del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.321_322del	19						.																																			4283052	SO:0001589	frameshift_variant	55620	exon4			AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.321_322delAA	19.37:g.4332051_4332052delTT	ENSP00000471052:p.Glu107fs		4283051	NM_001013841	A6NKK3|Q9NXI2	Frame_Shift_Del	DEL	ENST00000594605.1	37	CCDS45926.1																																																																																				0.475	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458114.2	NM_001013841	
PEG3	5178	hgsc.bcm.edu	37	19	57327050	57327050	+	Silent	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr19:57327050G>A	ENST00000326441.9	-	10	3123	c.2760C>T	c.(2758-2760)ggC>ggT	p.G920G	PEG3_ENST00000598410.1_Silent_p.G796G|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Silent_p.G920G|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Silent_p.G794G	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	920					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G920G(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CAGAGAATTCGCCATCCTTCT	0.438																																					p.G920G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2760T	19						.						120.0	118.0	119.0					19																	57327050		2203	4300	6503	62018862	SO:0001819	synonymous_variant	5178	exon7			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2760C>T	19.37:g.57327050G>A			62018862	NM_001146186	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	ENST00000326441.9	37	CCDS12948.1																																																																																				0.438	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
CTSB	1508	hgsc.bcm.edu	37	8	11703251	11703251	+	Missense_Mutation	SNP	G	G	T	rs145252189		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr8:11703251G>T	ENST00000353047.6	-	9	1094	c.841C>A	c.(841-843)Cgc>Agc	p.R281S	CTSB_ENST00000534510.1_Missense_Mutation_p.R281S|RP11-589N15.2_ENST00000602711.1_RNA|CTSB_ENST00000533455.1_Missense_Mutation_p.R281S|CTSB_ENST00000453527.2_Missense_Mutation_p.R281S|CTSB_ENST00000434271.1_Missense_Mutation_p.R281S|CTSB_ENST00000415599.2_3'UTR|CTSB_ENST00000531089.1_Missense_Mutation_p.R281S|CTSB_ENST00000345125.3_Missense_Mutation_p.R281S|CTSB_ENST00000530640.2_Missense_Mutation_p.R281S|CTSB_ENST00000525076.1_5'Flank	NM_001908.3	NP_001899.1	P07858	CATB_HUMAN	cathepsin B	281					cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|decidualization (GO:0046697)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of apoptotic process (GO:0042981)|regulation of catalytic activity (GO:0050790)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|proteoglycan binding (GO:0043394)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(1)	16	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		CCCAGGATGCGGATGGCATGG	0.612																																					p.R281S												.	.	0			c.C841A	8						.						130.0	85.0	100.0					8																	11703251		2203	4300	6503	11740660	SO:0001583	missense	1508	exon10			M14221	CCDS5986.1	8p23.1	2012-10-02			ENSG00000164733	ENSG00000164733	3.4.22.1	"""Cathepsins"""	2527	protein-coding gene	gene with protein product		116810				8112600, 3463996	Standard	XM_006716244		Approved		uc003wuq.3	P07858	OTTHUMG00000090799	ENST00000353047.6:c.841C>A	8.37:g.11703251G>T	ENSP00000345672:p.Arg281Ser		11740660	NM_147781	B3KQR5|B3KRR5|Q503A6|Q96D87	Missense_Mutation	SNP	ENST00000353047.6	37	CCDS5986.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.674289	0.88445	.	.	ENSG00000164733	ENST00000434271;ENST00000540571;ENST00000353047;ENST00000530640;ENST00000531089;ENST00000453527;ENST00000345125;ENST00000533455;ENST00000534510;ENST00000541328	D;D;D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.43	5.43	0.79202	Peptidase C1A, papain C-terminal (3);	0.055373	0.85682	D	0.000000	D	0.90442	0.7007	M	0.79011	2.435	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.87578	0.998;0.98;0.978;0.998	D	0.90911	0.4776	10	0.87932	D	0	.	13.3641	0.60674	0.0:0.0:0.8427:0.1573	.	218;281;281;218	B3KUJ8;A8K2H4;P07858;F5H2P9	.;.;CATB_HUMAN;.	S	281;218;281;281;281;281;281;281;281;187	ENSP00000415889:R281S;ENSP00000345672:R281S;ENSP00000435105:R281S;ENSP00000433215:R281S;ENSP00000409917:R281S;ENSP00000342070:R281S;ENSP00000432244:R281S;ENSP00000434217:R281S	ENSP00000342070:R281S	R	-	1	0	CTSB	11740660	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.622000	0.54217	2.825000	0.97269	0.655000	0.94253	CGC		0.612	CTSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207586.3	NM_147780	
TEX15	56154	hgsc.bcm.edu	37	8	30702748	30702748	+	Silent	SNP	C	C	T	rs112301482	byFrequency	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr8:30702748C>T	ENST00000256246.2	-	1	3860	c.3786G>A	c.(3784-3786)gcG>gcA	p.A1262A		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1262					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.A1262A(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CGTCAGTTTTCGCCTTTGTGT	0.313																																					p.A1262A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3786A	8						.						100.0	94.0	96.0					8																	30702748		2203	4299	6502	30822290	SO:0001819	synonymous_variant	56154	exon1			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.3786G>A	8.37:g.30702748C>T			30822290	NM_031271		Silent	SNP	ENST00000256246.2	37	CCDS6080.1																																																																																				0.313	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
CRISPLD1	83690	hgsc.bcm.edu	37	8	75941648	75941648	+	Silent	SNP	A	A	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr8:75941648A>G	ENST00000262207.4	+	14	1815	c.1347A>G	c.(1345-1347)gtA>gtG	p.V449V	CRISPLD1_ENST00000517786.1_Silent_p.V263V|RP11-300E4.2_ENST00000520778.1_RNA|CRISPLD1_ENST00000523524.1_Silent_p.V261V	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	449	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.V449V(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			GAGCAGCAGTACATGCTGGAG	0.418																																					p.V449V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1347G	8						.						95.0	85.0	88.0					8																	75941648		2203	4300	6503	76104203	SO:0001819	synonymous_variant	83690	exon14			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.1347A>G	8.37:g.75941648A>G			76104203	NM_031461	B2RA60|B7Z929	Silent	SNP	ENST00000262207.4	37	CCDS6219.1																																																																																				0.418	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
SPEN	23013	hgsc.bcm.edu	37	1	16258296	16258296	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:16258296G>A	ENST00000375759.3	+	11	5765	c.5561G>A	c.(5560-5562)cGg>cAg	p.R1854Q		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1854					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.R1854Q(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AAACTCAAGCGGTCCAATTCT	0.498																																					p.R1854Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5561A	1						.						63.0	66.0	65.0					1																	16258296		2203	4300	6503	16130883	SO:0001583	missense	23013	exon11				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.5561G>A	1.37:g.16258296G>A	ENSP00000364912:p.Arg1854Gln		16130883	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114334	0.77210	.	.	ENSG00000065526	ENST00000375759	T	0.31769	1.48	5.27	5.27	0.74061	.	.	.	.	.	T	0.55721	0.1938	M	0.71581	2.175	0.58432	D	0.999998	D	0.76494	0.999	D	0.74674	0.984	T	0.52170	-0.8611	9	0.35671	T	0.21	-14.9115	18.8764	0.92338	0.0:0.0:1.0:0.0	.	1854	Q96T58	MINT_HUMAN	Q	1854	ENSP00000364912:R1854Q	ENSP00000364912:R1854Q	R	+	2	0	SPEN	16130883	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	7.273000	0.78527	2.466000	0.83321	0.467000	0.42956	CGG		0.498	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
CRP	1401	hgsc.bcm.edu	37	1	159683566	159683566	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:159683566C>A	ENST00000255030.5	-	2	527	c.424G>T	c.(424-426)Gga>Tga	p.G142*	CRP_ENST00000368111.1_Intron|CRP_ENST00000368112.1_Intron|CRP_ENST00000368110.1_Intron|CRP_ENST00000437342.1_5'UTR|CRP_ENST00000343919.2_Intron|CRP_ENST00000473196.1_5'Flank	NM_000567.2	NP_000558.2	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related	142	Pentaxin.				acute-phase response (GO:0006953)|aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|complement activation, classical pathway (GO:0006958)|defense response to Gram-positive bacterium (GO:0050830)|inflammatory response (GO:0006954)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|opsonization (GO:0008228)|positive regulation of dendrite development (GO:1900006)|protein polymerization (GO:0051258)|regulation of interleukin-8 secretion (GO:2000482)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lead ion (GO:0010288)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)	calcium ion binding (GO:0005509)|cholesterol binding (GO:0015485)|choline binding (GO:0033265)|complement component C1q binding (GO:0001849)|low-density lipoprotein particle binding (GO:0030169)			breast(1)|endometrium(3)|kidney(1)|lung(15)|ovary(1)|skin(1)	22	all_hematologic(112;0.0429)				inhaled insulin(DB05278)	ACAGTGTATCCCTTCTTCAGA	0.552																																					p.G142X												.	.	0			c.G424T	1						.						238.0	241.0	240.0					1																	159683566		2203	4300	6503	157950190	SO:0001587	stop_gained	1401	exon2			M11725	CCDS30911.1	1q23.2	2013-05-13			ENSG00000132693	ENSG00000132693			2367	protein-coding gene	gene with protein product	"""pentraxin 1"""	123260				3840479, 6857266	Standard	NM_000567		Approved	PTX1	uc001ftw.3	P02741	OTTHUMG00000035344	ENST00000255030.5:c.424G>T	1.37:g.159683566C>A	ENSP00000255030:p.Gly142*		157950190	NM_000567	A8K078|D3DVD9|D3DVE0|Q08AK3|Q8WW75	Nonsense_Mutation	SNP	ENST00000255030.5	37	CCDS30911.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095735	0.76870	.	.	ENSG00000132693	ENST00000255030	.	.	.	4.73	3.82	0.43975	.	0.060247	0.64402	D	0.000003	.	.	.	.	.	.	0.19300	N	0.99998	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-15.9263	10.6594	0.45694	0.0:0.9054:0.0:0.0946	.	.	.	.	X	142	.	ENSP00000255030:G142X	G	-	1	0	CRP	157950190	0.963000	0.33076	0.004000	0.12327	0.361000	0.29550	6.991000	0.76232	0.972000	0.38314	0.650000	0.86243	GGA		0.552	CRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085553.1	NM_000567	
CFHR5	81494	hgsc.bcm.edu	37	1	196952052	196952052	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:196952052T>A	ENST00000256785.4	+	2	205	c.96T>A	c.(94-96)ttT>ttA	p.F32L	CFHR5_ENST00000367414.5_Missense_Mutation_p.F56L			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	32	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)		p.F32L(1)		NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						ACCATGGATTTCTGTATGATG	0.328																																					p.F32L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T96A	1						.						96.0	99.0	98.0					1																	196952052		2203	4300	6503	195218675	SO:0001583	missense	81494	exon2			AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.96T>A	1.37:g.196952052T>A	ENSP00000256785:p.Phe32Leu		195218675	NM_030787	Q2NKK2	Missense_Mutation	SNP	ENST00000256785.4	37	CCDS1387.1	.	.	.	.	.	.	.	.	.	.	.	7.475	0.647407	0.14516	.	.	ENSG00000134389	ENST00000367414;ENST00000256785	T;T	0.63580	-0.05;-0.05	2.45	-4.89	0.03103	Complement control module (2);Sushi/SCR/CCP (2);	.	.	.	.	T	0.30541	0.0768	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.13899	-1.0492	9	0.11485	T	0.65	.	4.4224	0.11486	0.5785:0.2286:0.0:0.1929	.	32	Q9BXR6	FHR5_HUMAN	L	56;32	ENSP00000356384:F56L;ENSP00000256785:F32L	ENSP00000256785:F32L	F	+	3	2	CFHR5	195218675	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.484000	0.06528	-2.655000	0.00422	0.254000	0.18369	TTT		0.328	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088814.2	NM_030787	
PLEKHA6	22874	hgsc.bcm.edu	37	1	204216507	204216507	+	Missense_Mutation	SNP	T	T	G	rs550853268		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:204216507T>G	ENST00000272203.3	-	13	2222	c.1906A>C	c.(1906-1908)Aat>Cat	p.N636H	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.N656H	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	636								p.N636H(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GTGTCCAAATTGAGCTGCTCC	0.572																																					p.N636H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1906C	1						.						73.0	60.0	64.0					1																	204216507		2203	4300	6503	202483130	SO:0001583	missense	22874	exon13			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.1906A>C	1.37:g.204216507T>G	ENSP00000272203:p.Asn636His		202483130	NM_014935	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.186857	0.78789	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.32515	1.45;1.45	5.1	5.1	0.69264	.	0.044369	0.85682	D	0.000000	T	0.32071	0.0817	L	0.52364	1.645	0.51767	D	0.999935	P	0.42123	0.771	B	0.43575	0.424	T	0.04565	-1.0942	10	0.17369	T	0.5	-19.3371	14.8325	0.70159	0.0:0.0:0.0:1.0	.	636	Q9Y2H5	PKHA6_HUMAN	H	636;656	ENSP00000272203:N636H;ENSP00000402046:N656H	ENSP00000272203:N636H	N	-	1	0	PLEKHA6	202483130	1.000000	0.71417	0.977000	0.42913	0.855000	0.48748	6.961000	0.76042	2.049000	0.60858	0.533000	0.62120	AAT		0.572	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
CATSPER4	378807	hgsc.bcm.edu	37	1	26517792	26517792	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:26517792G>A	ENST00000456354.2	+	2	295	c.228G>A	c.(226-228)atG>atA	p.M76I		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	76					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.M76I(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGGGACATGCAGGAGTTCA	0.582																																					p.M76I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G228A	1						.						76.0	62.0	67.0					1																	26517792		2203	4300	6503	26390379	SO:0001583	missense	378807	exon2			BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.228G>A	1.37:g.26517792G>A	ENSP00000390423:p.Met76Ile		26390379	NM_198137	A1A4W6|Q5VY71	Missense_Mutation	SNP	ENST00000456354.2	37	CCDS30645.1	.	.	.	.	.	.	.	.	.	.	G	6.910	0.537533	0.13188	.	.	ENSG00000188782	ENST00000338855;ENST00000456354	D;D	0.97279	-4.32;-4.31	5.54	0.902	0.19290	.	0.194833	0.35772	N	0.002981	D	0.90933	0.7150	L	0.29908	0.895	0.22684	N	0.998852	B	0.02656	0.0	B	0.01281	0.0	T	0.76780	-0.2833	10	0.05833	T	0.94	-10.3382	8.4201	0.32694	0.3564:0.0:0.6436:0.0	.	76	Q7RTX7	CTSR4_HUMAN	I	76	ENSP00000341006:M76I;ENSP00000390423:M76I	ENSP00000341006:M76I	M	+	3	0	CATSPER4	26390379	1.000000	0.71417	0.938000	0.37757	0.023000	0.10783	0.581000	0.23819	-0.093000	0.12396	0.462000	0.41574	ATG		0.582	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019849.2	NM_198137	
SZT2	23334	hgsc.bcm.edu	37	1	43907961	43907961	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:43907961C>G	ENST00000562955.1	+	56	7725	c.7725C>G	c.(7723-7725)ttC>ttG	p.F2575L	SZT2_ENST00000372442.1_Missense_Mutation_p.F1733L	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2632					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)		p.F1733L(2)		NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						TGCAGCGCTTCGAGCCAGGAG	0.607																																					p.F1733L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5199G	1						.						31.0	33.0	32.0					1																	43907961		2203	4300	6503	43680548	SO:0001583	missense	23334	exon42			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.7725C>G	1.37:g.43907961C>G	ENSP00000457168:p.Phe2575Leu		43680548	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470227	0.43942	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.15	-8.17	0.01057	.	0.000000	0.85682	D	0.000000	T	0.57784	0.2077	L	0.54323	1.7	0.23023	N	0.99842	D	0.71674	0.998	D	0.77004	0.989	T	0.66964	-0.5790	9	0.87932	D	0	.	18.8126	0.92064	0.0:0.1463:0.0:0.8537	.	2575	Q5T011-5	.	L	1733	.	ENSP00000361519:F1733L	F	+	3	2	SZT2	43680548	0.130000	0.22417	0.740000	0.30986	0.972000	0.66771	-0.866000	0.04245	-1.770000	0.01295	-0.150000	0.13652	TTC		0.607	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
CYP4A22	284541	hgsc.bcm.edu	37	1	47606489	47606489	+	Missense_Mutation	SNP	G	G	A	rs201122681		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:47606489G>A	ENST00000371891.3	+	2	264	c.233G>A	c.(232-234)cGg>cAg	p.R78Q	CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000371890.3_Missense_Mutation_p.R78Q|CYP4A22_ENST00000294337.3_Missense_Mutation_p.R78Q|CYP4A22_ENST00000485117.1_3'UTR	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	78						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R78Q(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATTCAGGAACGGGTGAAGACA	0.478																																					p.R78Q	Pancreas(88;1240 1470 2099 14214 37557)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G233A	1						.						172.0	151.0	158.0					1																	47606489		2203	4300	6503	47379076	SO:0001583	missense	284541	exon2				CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.233G>A	1.37:g.47606489G>A	ENSP00000360958:p.Arg78Gln		47379076	NM_001010969	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	37	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	g	15.22	2.768244	0.49680	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	T;T;T	0.68765	-0.27;-0.35;-0.35	1.36	1.36	0.22044	.	0.492745	0.23813	N	0.044310	T	0.66934	0.2840	L	0.53617	1.68	0.09310	N	1	P;P	0.42785	0.494;0.79	B;P	0.49853	0.05;0.624	T	0.59611	-0.7422	10	0.54805	T	0.06	.	10.2886	0.43581	0.0:0.0:1.0:0.0	.	78;78	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	Q	78	ENSP00000360957:R78Q;ENSP00000360958:R78Q;ENSP00000294337:R78Q	ENSP00000294337:R78Q	R	+	2	0	CYP4A22	47379076	0.967000	0.33354	0.020000	0.16555	0.007000	0.05969	3.064000	0.49986	1.072000	0.40860	0.436000	0.28706	CGG		0.478	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
HOOK1	51361	hgsc.bcm.edu	37	1	60325969	60325969	+	Missense_Mutation	SNP	C	C	A	rs575996483		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:60325969C>A	ENST00000371208.3	+	15	1758	c.1501C>A	c.(1501-1503)Cgt>Agt	p.R501S	HOOK1_ENST00000465876.1_3'UTR|HOOK1_ENST00000395561.2_Missense_Mutation_p.R459S	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	501	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)	p.R501S(2)		biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					ACAGAAACACCGTAAAATGAA	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		11174	0.001		0.0	False		,,,				2504	0.0				p.R501S												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1501A	1						.						138.0	145.0	142.0					1																	60325969		2203	4300	6503	60098557	SO:0001583	missense	51361	exon15			AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1501C>A	1.37:g.60325969C>A	ENSP00000360252:p.Arg501Ser		60098557	NM_015888	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	ENST00000371208.3	37	CCDS612.1	.	.	.	.	.	.	.	.	.	.	C	18.59	3.657233	0.67586	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.19250	2.16;2.16	5.05	5.05	0.67936	.	0.281498	0.37906	N	0.001886	T	0.27697	0.0681	L	0.53249	1.67	0.48087	D	0.999589	P	0.37466	0.596	P	0.47134	0.539	T	0.01276	-1.1398	10	0.08179	T	0.78	.	14.2933	0.66295	0.0:0.9261:0.0:0.0739	.	501	Q9UJC3	HOOK1_HUMAN	S	501;459	ENSP00000360252:R501S;ENSP00000378928:R459S	ENSP00000360252:R501S	R	+	1	0	HOOK1	60098557	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	4.004000	0.57068	2.789000	0.95967	0.655000	0.94253	CGT		0.393	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024934.1	NM_015888	
GBP4	115361	hgsc.bcm.edu	37	1	89659035	89659035	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:89659035C>T	ENST00000355754.6	-	4	521	c.424G>A	c.(424-426)Gtc>Atc	p.V142I		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	142	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.V142I(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		CTGTTATAGACAAAGCTGCTG	0.478																																					p.V142I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G424A	1						.						130.0	124.0	126.0					1																	89659035		2203	4300	6503	89431623	SO:0001583	missense	115361	exon4			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.424G>A	1.37:g.89659035C>T	ENSP00000359490:p.Val142Ile		89431623	NM_052941	B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	CCDS721.1	.	.	.	.	.	.	.	.	.	.	C	13.02	2.112279	0.37242	.	.	ENSG00000162654	ENST00000355754	T	0.77229	-1.08	4.93	-0.217	0.13149	Guanylate-binding protein, N-terminal (1);	0.143965	0.44688	N	0.000424	T	0.40956	0.1138	L	0.31065	0.9	0.24373	N	0.994829	P	0.38223	0.623	B	0.36244	0.22	T	0.46020	-0.9221	10	0.21540	T	0.41	.	9.0346	0.36280	0.0:0.6044:0.0:0.3956	.	142	Q96PP9	GBP4_HUMAN	I	142	ENSP00000359490:V142I	ENSP00000359490:V142I	V	-	1	0	GBP4	89431623	0.908000	0.30866	0.233000	0.24025	0.726000	0.41606	0.178000	0.16820	-0.105000	0.12132	-0.123000	0.14984	GTC		0.478	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941	
PLPPR5	163404	hgsc.bcm.edu	37	1	99380460	99380460	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:99380460T>A	ENST00000263177.4	-	5	1036	c.815A>T	c.(814-816)aAt>aTt	p.N272I	LPPR5_ENST00000370188.3_Missense_Mutation_p.N272I	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		272						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.N272I(1)									TTTGAAATTATTCACCACGCA	0.393																																					p.N272I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A815T	1						.						165.0	158.0	160.0					1																	99380460		2203	4300	6503	99153048	SO:0001583	missense	163404	exon5																														ENST00000263177.4:c.815A>T	1.37:g.99380460T>A	ENSP00000263177:p.Asn272Ile		99153048	NM_001037317	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Missense_Mutation	SNP	ENST00000263177.4	37	CCDS30778.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.258570	0.80246	.	.	ENSG00000117598	ENST00000370188;ENST00000263177	T;T	0.74842	-0.88;-0.88	5.98	4.86	0.63082	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.156609	0.56097	D	0.000025	T	0.76033	0.3931	M	0.67953	2.075	0.42532	D	0.99304	P;P	0.49090	0.9;0.919	P;P	0.58780	0.759;0.845	T	0.79736	-0.1678	10	0.87932	D	0	.	11.3042	0.49325	0.0:0.0706:0.0:0.9294	.	272;272	Q32ZL2-2;Q32ZL2	.;LPPR5_HUMAN	I	272	ENSP00000359207:N272I;ENSP00000263177:N272I	ENSP00000263177:N272I	N	-	2	0	AL161744.1	99153048	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.186000	0.65082	1.086000	0.41228	0.528000	0.53228	AAT		0.393	LPPR5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393221.1		
CRP	1401	hgsc.bcm.edu	37	1	159683350	159683352	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	CTT	CTT	CTT	CTT	CTT	CTT	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:159683350_159683352delCTT	ENST00000255030.5	-	2	741_743	c.638_640delAAG	c.(637-642)caaggc>cgc	p.213_214QG>R	CRP_ENST00000368111.1_In_Frame_Del_p.91_92QG>R|CRP_ENST00000368112.1_In_Frame_Del_p.80_81QG>R|CRP_ENST00000368110.1_In_Frame_Del_p.91_92QG>R|CRP_ENST00000437342.1_In_Frame_Del_p.35_36QG>R|CRP_ENST00000343919.2_In_Frame_Del_p.91_92QG>R|CRP_ENST00000473196.1_5'UTR	NM_000567.2	NP_000558.2	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related	213	Pentaxin.				acute-phase response (GO:0006953)|aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|complement activation, classical pathway (GO:0006958)|defense response to Gram-positive bacterium (GO:0050830)|inflammatory response (GO:0006954)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|opsonization (GO:0008228)|positive regulation of dendrite development (GO:1900006)|protein polymerization (GO:0051258)|regulation of interleukin-8 secretion (GO:2000482)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lead ion (GO:0010288)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)	calcium ion binding (GO:0005509)|cholesterol binding (GO:0015485)|choline binding (GO:0033265)|complement component C1q binding (GO:0001849)|low-density lipoprotein particle binding (GO:0030169)	p.G214C(1)		breast(1)|endometrium(3)|kidney(1)|lung(15)|ovary(1)|skin(1)	22	all_hematologic(112;0.0429)				inhaled insulin(DB05278)	AACACTTCGCCTTGCACTTCATA	0.557																																					p.213_214del												.	.	1	Substitution - Missense(1)	lung(1)	c.638_640del	1						.																																			157949976	SO:0001651	inframe_deletion	1401	exon2			M11725	CCDS30911.1	1q23.2	2013-05-13			ENSG00000132693	ENSG00000132693			2367	protein-coding gene	gene with protein product	"""pentraxin 1"""	123260				3840479, 6857266	Standard	NM_000567		Approved	PTX1	uc001ftw.3	P02741	OTTHUMG00000035344	ENST00000255030.5:c.638_640delAAG	1.37:g.159683350_159683352delCTT	ENSP00000255030:p.Gln213_Gly214delinsArg		157949974	NM_000567	A8K078|D3DVD9|D3DVE0|Q08AK3|Q8WW75	In_Frame_Del	DEL	ENST00000255030.5	37	CCDS30911.1																																																																																				0.557	CRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085553.1	NM_000567	
SPATA17	128153	hgsc.bcm.edu	37	1	217955553	217955553	+	Missense_Mutation	SNP	G	G	A	rs145637899		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr1:217955553G>A	ENST00000366933.4	+	8	816	c.761G>A	c.(760-762)cGc>cAc	p.R254H	RP11-415L24.1_ENST00000415765.1_RNA	NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	254						cytoplasm (GO:0005737)		p.R254H(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TTAGAACAACGCTACAGGCCT	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		14104	0.0		0.001	False		,,,				2504	0.0				p.R254H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G761A	1						.	G	HIS/ARG	0,4406		0,0,2203	87.0	90.0	89.0		761	4.7	1.0	1	dbSNP_134	89	8,8590	6.4+/-24.3	0,8,4291	yes	missense	SPATA17	NM_138796.2	29	0,8,6494	AA,AG,GG		0.093,0.0,0.0615	probably-damaging	254/362	217955553	8,12996	2203	4299	6502	216022176	SO:0001583	missense	128153	exon8			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.761G>A	1.37:g.217955553G>A	ENSP00000355900:p.Arg254His		216022176	NM_138796	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	CCDS1519.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	30	5.057593	0.93846	0.0	9.3E-4	ENSG00000162814	ENST00000366933	T	0.56941	0.43	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.74809	0.3765	M	0.81942	2.565	0.49915	D	0.99983	D	0.89917	1.0	D	0.85130	0.997	T	0.79572	-0.1748	10	0.87932	D	0	-17.8856	18.0694	0.89400	0.0:0.0:1.0:0.0	.	254	Q96L03	SPT17_HUMAN	H	254	ENSP00000355900:R254H	ENSP00000355900:R254H	R	+	2	0	SPATA17	216022176	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.046000	0.71029	2.346000	0.79739	0.650000	0.86243	CGC		0.453	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796	
RAB39A	54734	hgsc.bcm.edu	37	11	107832788	107832788	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr11:107832788T>C	ENST00000320578.2	+	2	410	c.344T>C	c.(343-345)gTa>gCa	p.V115A		NM_017516.1	NP_059986.1	Q14964	RB39A_HUMAN	RAB39A, member RAS oncogene family	115					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.V115A(1)									AAAATGTATGTACAGCCATTT	0.378																																					p.V115A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T344C	11						.						79.0	75.0	76.0					11																	107832788		2201	4298	6499	107337998	SO:0001583	missense	54734	exon2			X99962	CCDS8338.1	11q22.3	2011-11-22	2011-11-22	2011-11-22	ENSG00000179331	ENSG00000179331		"""RAB, member RAS oncogene"""	16521	protein-coding gene	gene with protein product	"""rab-related GTP-binding protein"""		"""RAB39, member RAS oncogene family"""	RAB39		9119394	Standard	NM_017516		Approved		uc001pjt.3	Q14964	OTTHUMG00000166367	ENST00000320578.2:c.344T>C	11.37:g.107832788T>C	ENSP00000322594:p.Val115Ala		107337998	NM_017516	A8KAA4|Q8N6W2	Missense_Mutation	SNP	ENST00000320578.2	37	CCDS8338.1	.	.	.	.	.	.	.	.	.	.	T	8.780	0.927918	0.18056	.	.	ENSG00000179331	ENST00000320578	T	0.75589	-0.95	5.21	5.21	0.72293	Small GTP-binding protein domain (1);	0.000000	0.51477	D	0.000093	T	0.35508	0.0934	N	0.00327	-1.64	0.42162	D	0.991608	B	0.19073	0.033	B	0.22152	0.038	T	0.52117	-0.8618	10	0.02654	T	1	.	10.4376	0.44445	0.0:0.0757:0.0:0.9242	.	115	Q14964	RB39A_HUMAN	A	115	ENSP00000322594:V115A	ENSP00000322594:V115A	V	+	2	0	RAB39	107337998	1.000000	0.71417	0.897000	0.35233	0.658000	0.38924	5.702000	0.68332	2.174000	0.68829	0.533000	0.62120	GTA		0.378	RAB39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389423.1	NM_017516	
ATM	472	hgsc.bcm.edu	37	11	108150283	108150283	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr11:108150283A>C	ENST00000452508.2	+	24	3539	c.3350A>C	c.(3349-3351)cAa>cCa	p.Q1117P	ATM_ENST00000278616.4_Missense_Mutation_p.Q1117P			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1117					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.Q1117P(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AAGCTTCAGCAAACAGCTTTT	0.358			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.Q1117P		yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3350C	11						.						96.0	91.0	93.0					11																	108150283		2201	4298	6499	107655493	SO:0001583	missense	472	exon23	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3350A>C	11.37:g.108150283A>C	ENSP00000388058:p.Gln1117Pro		107655493	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.990667	0.74589	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.71698	-0.59;-0.59;-0.59	5.73	4.61	0.57282	Armadillo-type fold (1);	0.051849	0.85682	D	0.000000	T	0.67363	0.2885	M	0.70275	2.135	0.45452	D	0.998428	P	0.44478	0.836	B	0.38712	0.28	T	0.68307	-0.5443	10	0.48119	T	0.1	.	11.4207	0.49980	0.9297:0.0:0.0703:0.0	.	1117	Q13315	ATM_HUMAN	P	1117	ENSP00000435747:Q1117P;ENSP00000278616:Q1117P;ENSP00000388058:Q1117P	ENSP00000278616:Q1117P	Q	+	2	0	ATM	107655493	1.000000	0.71417	0.980000	0.43619	0.932000	0.56968	6.529000	0.73812	1.006000	0.39211	0.477000	0.44152	CAA		0.358	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
TECTA	7007	hgsc.bcm.edu	37	11	120996380	120996380	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr11:120996380G>A	ENST00000392793.1	+	8	1844	c.1573G>A	c.(1573-1575)Ggc>Agc	p.G525S	TECTA_ENST00000264037.2_Missense_Mutation_p.G525S			O75443	TECTA_HUMAN	tectorin alpha	525	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.G525S(2)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGACTACTGCGGCTTCCTCAA	0.592																																					p.G525S												.	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.G1573A	11						.						131.0	134.0	133.0					11																	120996380		2203	4299	6502	120501590	SO:0001583	missense	7007	exon7			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.1573G>A	11.37:g.120996380G>A	ENSP00000376543:p.Gly525Ser		120501590	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	32	5.171422	0.94807	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.75821	-0.97;-0.97	4.91	4.91	0.64330	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	0.000000	0.85682	D	0.000000	D	0.82582	0.5068	L	0.42245	1.32	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.84426	0.0574	10	0.72032	D	0.01	.	18.4676	0.90761	0.0:0.0:1.0:0.0	.	525	O75443	TECTA_HUMAN	S	525	ENSP00000376543:G525S;ENSP00000264037:G525S	ENSP00000264037:G525S	G	+	1	0	TECTA	120501590	1.000000	0.71417	0.992000	0.48379	0.975000	0.68041	9.705000	0.98719	2.453000	0.82957	0.563000	0.77884	GGC		0.592	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
OLFML1	283298	hgsc.bcm.edu	37	11	7531160	7531160	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr11:7531160C>T	ENST00000329293.3	+	3	1344	c.950C>T	c.(949-951)gCt>gTt	p.A317V	OLFML1_ENST00000530135.1_Missense_Mutation_p.A317V|OLFML1_ENST00000528758.1_3'UTR|CTD-2516F10.2_ENST00000530201.1_RNA	NM_198474.3	NP_940876.2	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1	317	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.					extracellular region (GO:0005576)		p.A317V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(3)|prostate(2)	24				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		AGCCAGGATGCTGAAGCCTCA	0.557																																					p.A317V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C950T	11						.						96.0	87.0	90.0					11																	7531160		2201	4296	6497	7487736	SO:0001583	missense	283298	exon3			AY358591	CCDS7779.1	11p15	2008-02-05			ENSG00000183801	ENSG00000183801			24473	protein-coding gene	gene with protein product							Standard	NM_198474		Approved	UNQ564	uc001mfi.3	Q6UWY5	OTTHUMG00000165527	ENST00000329293.3:c.950C>T	11.37:g.7531160C>T	ENSP00000332511:p.Ala317Val		7487736	NM_198474	B4DP03|Q569G4	Missense_Mutation	SNP	ENST00000329293.3	37	CCDS7779.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491119	0.84962	.	.	ENSG00000183801	ENST00000530135;ENST00000329293	D;D	0.89485	-2.52;-2.52	5.51	4.6	0.57074	Olfactomedin-like (3);	0.053949	0.64402	D	0.000001	D	0.89259	0.6664	L	0.39085	1.19	0.80722	D	1	D;D	0.67145	0.989;0.996	P;P	0.60345	0.873;0.873	D	0.88807	0.3289	10	0.52906	T	0.07	.	11.3602	0.49638	0.0:0.9129:0.0:0.0871	.	181;317	B4DN61;Q6UWY5	.;OLFL1_HUMAN	V	317	ENSP00000433455:A317V;ENSP00000332511:A317V	ENSP00000332511:A317V	A	+	2	0	OLFML1	7487736	1.000000	0.71417	0.958000	0.39756	0.960000	0.62799	4.620000	0.61226	2.595000	0.87683	0.563000	0.77884	GCT		0.557	OLFML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384656.1	NM_198474	
ABCC8	6833	hgsc.bcm.edu	37	11	17464336	17464336	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr11:17464336G>A	ENST00000389817.3	-	10	1629	c.1561C>T	c.(1561-1563)Cgg>Tgg	p.R521W	ABCC8_ENST00000528202.1_5'UTR|ABCC8_ENST00000302539.4_Missense_Mutation_p.R521W			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	521	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)	p.R521W(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GTCTCCACCCGCGTGCGGAAG	0.597																																					p.R521W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1561T	11						.						98.0	87.0	90.0					11																	17464336		2200	4293	6493	17420912	SO:0001583	missense	6833	exon10			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.1561C>T	11.37:g.17464336G>A	ENSP00000374467:p.Arg521Trp		17420912	NM_000352	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882350	0.72294	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.91577	-2.87;-2.87	6.02	3.01	0.34805	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.118844	0.56097	D	0.000031	D	0.93419	0.7901	M	0.79123	2.44	0.09310	N	0.999999	D;B	0.64830	0.994;0.359	P;B	0.55011	0.766;0.067	D	0.88215	0.2893	10	0.72032	D	0.01	.	15.5077	0.75753	0.0:0.0:0.3347:0.6653	.	520;521	B7Z4N0;Q09428	.;ABCC8_HUMAN	W	521;521;535	ENSP00000374467:R521W;ENSP00000303960:R521W	ENSP00000303960:R521W	R	-	1	2	ABCC8	17420912	0.856000	0.29760	0.227000	0.23927	0.986000	0.74619	2.535000	0.45685	0.363000	0.24346	-0.152000	0.13540	CGG		0.597	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
OR4A5	81318	hgsc.bcm.edu	37	11	51411697	51411697	+	Silent	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr11:51411697G>A	ENST00000319760.6	-	1	751	c.699C>T	c.(697-699)gcC>gcT	p.A233A		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A233A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				AGGTAGACAAGGCTTTACCCC	0.413																																					p.A233A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C699T	11						.						65.0	64.0	65.0					11																	51411697		2201	4295	6496	51268273	SO:0001819	synonymous_variant	81318	exon1			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.699C>T	11.37:g.51411697G>A			51268273	NM_001005272	Q6IF84	Silent	SNP	ENST00000319760.6	37	CCDS31497.1																																																																																				0.413	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
C11orf63	79864	hgsc.bcm.edu	37	11	122817362	122817362	+	Silent	SNP	G	G	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr11:122817362G>T	ENST00000531316.1	+	5	1883	c.1791G>T	c.(1789-1791)ctG>ctT	p.L597L	C11orf63_ENST00000227349.2_Silent_p.L597L			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	597					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)			p.L597L(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		CACCTATACTGTCAAGGGTAG	0.498																																					p.L597L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1791T	11						.						73.0	69.0	70.0					11																	122817362		2202	4299	6501	122322572	SO:0001819	synonymous_variant	79864	exon6			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.1791G>T	11.37:g.122817362G>T			122322572	NM_024806	A8K6G0|Q96GB5|Q9H5D6	Silent	SNP	ENST00000531316.1	37	CCDS8438.1																																																																																				0.498	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387511.1	NM_024806	
SIM1	6492	hgsc.bcm.edu	37	6	100841491	100841491	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr6:100841491G>A	ENST00000369208.3	-	11	2224	c.1442C>T	c.(1441-1443)aCg>aTg	p.T481M	SIM1_ENST00000262901.4_Missense_Mutation_p.T481M			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	481	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.T481M(1)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		GGCCTGCGGCGTTCCCAGGAA	0.622																																					p.T481M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1442T	6						.						64.0	65.0	65.0					6																	100841491		2203	4300	6503	100948212	SO:0001583	missense	6492	exon10			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1442C>T	6.37:g.100841491G>A	ENSP00000358210:p.Thr481Met		100948212	NM_005068	Q5TDP7	Missense_Mutation	SNP	ENST00000369208.3	37	CCDS5045.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.818094	0.71028	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.55234	0.53;0.53	5.78	4.92	0.64577	Single-minded, C-terminal (2);	0.280189	0.45361	N	0.000374	T	0.45498	0.1345	L	0.32530	0.975	0.21627	N	0.999612	D	0.89917	1.0	D	0.68192	0.956	T	0.42716	-0.9435	10	0.56958	D	0.05	.	10.4773	0.44672	0.0701:0.1332:0.7968:0.0	.	481	P81133	SIM1_HUMAN	M	481	ENSP00000358210:T481M;ENSP00000262901:T481M	ENSP00000262901:T481M	T	-	2	0	SIM1	100948212	0.987000	0.35691	0.534000	0.28014	0.936000	0.57629	5.349000	0.66010	1.450000	0.47717	0.655000	0.94253	ACG		0.622	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068	
CAP2	10486	hgsc.bcm.edu	37	6	17514133	17514133	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr6:17514133T>G	ENST00000229922.2	+	7	1116	c.584T>G	c.(583-585)cTt>cGt	p.L195R	CAP2_ENST00000489374.1_Intron|CAP2_ENST00000465994.1_Intron|CAP2_ENST00000493172.1_Intron|CAP2_ENST00000378990.2_Missense_Mutation_p.L169R	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	195					activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)		p.L195R(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			TGGAGTGAACTTCAAGCATAC	0.433																																					p.L195R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T584G	6						.						119.0	100.0	107.0					6																	17514133		2203	4300	6503	17622112	SO:0001583	missense	10486	exon7			BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.584T>G	6.37:g.17514133T>G	ENSP00000229922:p.Leu195Arg		17622112	NM_006366	B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Missense_Mutation	SNP	ENST00000229922.2	37	CCDS4539.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.818701	0.90790	.	.	ENSG00000112186	ENST00000229922;ENST00000378990	T;T	0.53640	0.61;0.61	6.08	6.08	0.98989	Adenylate cyclase-associated CAP, N-terminal (2);	0.112709	0.64402	D	0.000009	T	0.72851	0.3512	M	0.93241	3.395	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.79784	0.993;0.973	T	0.81093	-0.1089	10	0.87932	D	0	-22.2042	16.3044	0.82842	0.0:0.0:0.0:1.0	.	169;195	E9PDI2;P40123	.;CAP2_HUMAN	R	195;169	ENSP00000229922:L195R;ENSP00000368275:L169R	ENSP00000229922:L195R	L	+	2	0	CAP2	17622112	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	8.040000	0.89188	2.330000	0.79161	0.533000	0.62120	CTT		0.433	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039952.2		
ITPR3	3710	hgsc.bcm.edu	37	6	33635679	33635679	+	Silent	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr6:33635679G>A	ENST00000374316.5	+	17	2884	c.1824G>A	c.(1822-1824)aaG>aaA	p.K608K	ITPR3_ENST00000605930.1_Silent_p.K608K			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	608					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.K608K(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TCCTGGAAAAGCACATCACCA	0.627																																					p.K608K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1824A	6						.						192.0	147.0	162.0					6																	33635679		2203	4300	6503	33743657	SO:0001819	synonymous_variant	3710	exon16			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.1824G>A	6.37:g.33635679G>A			33743657	NM_002224	Q14649|Q5TAQ2	Silent	SNP	ENST00000374316.5	37	CCDS4783.1																																																																																				0.627	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
BAI3	577	hgsc.bcm.edu	37	6	69646475	69646475	+	Silent	SNP	G	G	A	rs149792384		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr6:69646475G>A	ENST00000370598.1	+	5	1754	c.933G>A	c.(931-933)tcG>tcA	p.S311S		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	311	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S311S(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GTCAAGGGTCGCAGGTGCGAA	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18990	0.0		0.0	False		,,,				2504	0.0				p.S311S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G933A	6						.	G		2,4404	4.2+/-10.8	0,2,2201	127.0	104.0	112.0		933	5.4	1.0	6	dbSNP_134	112	0,8600		0,0,4300	no	coding-synonymous	BAI3	NM_001704.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		311/1523	69646475	2,13004	2203	4300	6503	69703196	SO:0001819	synonymous_variant	577	exon5			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.933G>A	6.37:g.69646475G>A			69703196	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	ENST00000370598.1	37	CCDS4968.1																																																																																				0.493	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
AGPAT4	56895	hgsc.bcm.edu	37	6	161567600	161567600	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr6:161567600C>T	ENST00000320285.4	-	7	1011	c.799G>A	c.(799-801)Gat>Aat	p.D267N	AGPAT4_ENST00000366911.5_3'UTR|AGPAT4_ENST00000457520.2_Missense_Mutation_p.D105N|AGPAT4_ENST00000366908.5_3'UTR	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	267					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.D267N(1)		endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		CACTCGTCATCGTCTTCAGGG	0.587																																					p.D267N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G799A	6						.						129.0	103.0	112.0					6																	161567600		2203	4300	6503	161487590	SO:0001583	missense	56895	exon7			AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.799G>A	6.37:g.161567600C>T	ENSP00000314036:p.Asp267Asn		161487590	NM_020133	B4DSF9|Q5TEF0	Missense_Mutation	SNP	ENST00000320285.4	37	CCDS5280.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.882223	0.51908	.	.	ENSG00000026652	ENST00000320285;ENST00000457520	D	0.93133	-3.17	4.95	4.08	0.47627	.	0.218908	0.46442	D	0.000282	D	0.86020	0.5833	L	0.50333	1.59	0.80722	D	1	P;B	0.51791	0.948;0.256	B;B	0.39503	0.301;0.035	D	0.87004	0.2118	10	0.87932	D	0	-19.6025	11.5771	0.50869	0.0:0.9118:0.0:0.0882	.	105;267	B4DSF9;Q9NRZ5	.;PLCD_HUMAN	N	267;105	ENSP00000314036:D267N	ENSP00000314036:D267N	D	-	1	0	AGPAT4	161487590	1.000000	0.71417	0.000000	0.03702	0.009000	0.06853	7.277000	0.78572	1.217000	0.43442	-0.291000	0.09656	GAT		0.587	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042983.1	NM_020133	
MAP2K3	5606	hgsc.bcm.edu	37	17	21216846	21216846	+	Silent	SNP	G	G	C	rs1657688	byFrequency	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr17:21216846G>C	ENST00000342679.4	+	11	1206	c.957G>C	c.(955-957)ctG>ctC	p.L319L	MAP2K3_ENST00000316920.6_Silent_p.L290L|MAP2K3_ENST00000361818.5_Silent_p.L290L	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	319	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.L323L(1)							COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		ACCTGGAGCTGATGGTGAGTA	0.642																																					p.L290L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G870C	17						.																																			21157439	SO:0001819	synonymous_variant	5606	exon11			L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.957G>C	17.37:g.21216846G>C			21157439	NM_002756	B3KSK7|Q99441|Q9UE71|Q9UE72	Silent	SNP	ENST00000342679.4	37	CCDS11217.1																																																																																				0.642	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109	
ARSG	22901	hgsc.bcm.edu	37	17	66391304	66391304	+	Silent	SNP	G	G	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr17:66391304G>T	ENST00000448504.2	+	10	1978	c.1182G>T	c.(1180-1182)gtG>gtT	p.V394V	ARSG_ENST00000452479.2_Silent_p.V230V|ARSG_ENST00000582154.1_3'UTR	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	394					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.V394V(1)		NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCTCCGAGGTGCTCTTTGGCC	0.587																																					p.V394V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1182T	17						.						138.0	111.0	120.0					17																	66391304		2203	4300	6503	63902899	SO:0001819	synonymous_variant	22901	exon10			AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.1182G>T	17.37:g.66391304G>T			63902899	NM_014960	Q6UXF2|Q9Y2K4	Silent	SNP	ENST00000448504.2	37	CCDS11676.1																																																																																				0.587	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448369.1	NM_014960	
SOX9	6662	hgsc.bcm.edu	37	17	70120244	70120244	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr17:70120244C>T	ENST00000245479.2	+	3	1618	c.1246C>T	c.(1246-1248)Caa>Taa	p.Q416*		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	416					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q416*(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			GCACTCGCCCCAACAGATCGC	0.642																																					p.Q416X	Pancreas(42;83 1041 2320 35205 39456)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1246T	17						.						222.0	204.0	210.0					17																	70120244		2203	4300	6503	67631839	SO:0001587	stop_gained	6662	exon3			S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.1246C>T	17.37:g.70120244C>T	ENSP00000245479:p.Gln416*		67631839	NM_000346	Q53Y80	Nonsense_Mutation	SNP	ENST00000245479.2	37	CCDS11689.1	.	.	.	.	.	.	.	.	.	.	C	41	9.023418	0.99038	.	.	ENSG00000125398	ENST00000245479;ENST00000455872	.	.	.	4.17	4.17	0.49024	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	15.2649	0.73654	0.0:1.0:0.0:0.0	.	.	.	.	X	416;352	.	ENSP00000245479:Q416X	Q	+	1	0	SOX9	67631839	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	5.507000	0.66999	1.865000	0.54081	0.455000	0.32223	CAA		0.642	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
BRWD1	54014	hgsc.bcm.edu	37	21	40582819	40582819	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr21:40582819A>G	ENST00000333229.2	-	35	4264	c.3937T>C	c.(3937-3939)Tat>Cat	p.Y1313H	BRWD1_ENST00000380800.3_Missense_Mutation_p.Y1313H|BRWD1_ENST00000342449.3_Missense_Mutation_p.Y1313H	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1313					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Y1313H(2)		cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CTTTCAACATAGTTCGTAGCT	0.348																																					p.Y1313H	Melanoma(170;988 1986 4794 16843 39731)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T3937C	21						.						108.0	100.0	103.0					21																	40582819		2203	4300	6503	39504689	SO:0001583	missense	54014	exon35			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3937T>C	21.37:g.40582819A>G	ENSP00000330753:p.Tyr1313His		39504689	NM_033656	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	A	15.39	2.819144	0.50633	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.18502	2.21;2.21;2.21	5.36	2.81	0.32909	Bromodomain (1);	0.538685	0.18175	N	0.149327	T	0.20129	0.0484	L	0.54323	1.7	0.21325	N	0.999728	P;P	0.44006	0.824;0.679	P;B	0.48488	0.579;0.188	T	0.06445	-1.0826	10	0.21540	T	0.41	0.6023	7.1164	0.25418	0.7968:0.0:0.072:0.1312	.	1313;1313	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	H	1313	ENSP00000330753:Y1313H;ENSP00000344333:Y1313H;ENSP00000370178:Y1313H	ENSP00000330753:Y1313H	Y	-	1	0	BRWD1	39504689	0.845000	0.29573	0.362000	0.25862	0.989000	0.77384	1.939000	0.40213	0.970000	0.38263	0.477000	0.44152	TAT		0.348	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
IFT140	9742	hgsc.bcm.edu	37	16	1634323	1634323	+	Silent	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr16:1634323G>A	ENST00000426508.2	-	11	1617	c.1254C>T	c.(1252-1254)gcC>gcT	p.A418A	IFT140_ENST00000439987.2_5'UTR|LA16c-395F10.2_ENST00000563162.1_RNA	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	418					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)		p.A418A(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CCTGCATGGCGGCCACTTGCT	0.612																																					p.A418A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1254T	16						.						46.0	37.0	40.0					16																	1634323		2199	4300	6499	1574324	SO:0001819	synonymous_variant	9742	exon11			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1254C>T	16.37:g.1634323G>A			1574324	NM_014714	A2A2A8|D3DU75|O60332|Q9UG52	Silent	SNP	ENST00000426508.2	37	CCDS10439.1																																																																																				0.612	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
PLK1	5347	hgsc.bcm.edu	37	16	23703610	23703610	+	IGR	SNP	A	A	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr16:23703610A>T	ENST00000300093.4	+	0	2227				ERN2_ENST00000457008.2_Missense_Mutation_p.Y663N|ERN2_ENST00000256797.4_Missense_Mutation_p.Y763N	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1						activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.Y763N(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		GAAAGCACGTAGTAGAACACG	0.567																																					p.Y763N	Colon(12;240 564 27038 33155)											.	.	1	Substitution - Missense(1)	ovary(1)	c.T2287A	16						.						75.0	73.0	74.0					16																	23703610		2197	4300	6497	23611111	SO:0001628	intergenic_variant	10595	exon18				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984		16.37:g.23703610A>T			23611111	NM_033266	Q15153|Q99746	Missense_Mutation	SNP	ENST00000300093.4	37	CCDS10616.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.655775	0.88056	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.50001	0.76;0.76	5.65	5.65	0.86999	.	0.137817	0.50627	D	0.000113	T	0.64940	0.2644	L	0.60012	1.86	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67883	-0.5555	10	0.87932	D	0	.	13.8429	0.63451	1.0:0.0:0.0:0.0	.	663;715	E7ETG2;A5YM65	.;.	N	763;663	ENSP00000256797:Y763N;ENSP00000413812:Y663N	ENSP00000256797:Y763N	Y	-	1	0	ERN2	23611111	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	8.905000	0.92613	2.146000	0.66826	0.533000	0.62120	TAC		0.567	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214057.2	NM_005030	
PRKCB	5579	hgsc.bcm.edu	37	16	24043503	24043503	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr16:24043503C>T	ENST00000321728.7	+	4	510	c.335C>T	c.(334-336)cCc>cTc	p.P112L	PRKCB_ENST00000303531.7_Missense_Mutation_p.P112L	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	112					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.P112L(2)		central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TACTCCAGCCCCACGTTTTGT	0.527																																					p.P112L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C335T	16						.						115.0	98.0	104.0					16																	24043503		2197	4300	6497	23951004	SO:0001583	missense	5579	exon4			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.335C>T	16.37:g.24043503C>T	ENSP00000318315:p.Pro112Leu		23951004	NM_212535	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	37	CCDS10618.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457646	0.84317	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	D;D	0.93547	-3.24;-3.24	4.91	4.91	0.64330	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.96725	0.8931	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.77557	0.948;0.99	D	0.97228	0.9882	10	0.62326	D	0.03	.	16.6542	0.85224	0.0:1.0:0.0:0.0	.	112;112	P05771-2;P05771	.;KPCB_HUMAN	L	112	ENSP00000318315:P112L;ENSP00000305355:P112L	ENSP00000305355:P112L	P	+	2	0	PRKCB	23951004	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.461000	0.80834	2.248000	0.74166	0.462000	0.41574	CCC		0.527	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535	
SLC5A11	115584	hgsc.bcm.edu	37	16	24888598	24888598	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr16:24888598C>T	ENST00000347898.3	+	7	1119	c.497C>T	c.(496-498)gCc>gTc	p.A166V	SLC5A11_ENST00000539472.1_Missense_Mutation_p.A102V|SLC5A11_ENST00000565769.1_Missense_Mutation_p.A102V|SLC5A11_ENST00000449109.2_Missense_Mutation_p.A102V|SLC5A11_ENST00000568579.1_Missense_Mutation_p.A96V|SLC5A11_ENST00000424767.2_Missense_Mutation_p.A131V|SLC5A11_ENST00000545376.1_Missense_Mutation_p.A96V|SLC5A11_ENST00000569071.1_Missense_Mutation_p.A102V|SLC5A11_ENST00000567758.1_Missense_Mutation_p.A131V	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11									p.A166V(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		TATGCAGGTGCCATCTTCATC	0.478																																					p.A166V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C497T	16						.						398.0	329.0	353.0					16																	24888598		2197	4300	6497	24796099	SO:0001583	missense	115584	exon7			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.497C>T	16.37:g.24888598C>T	ENSP00000289932:p.Ala166Val		24796099	NM_052944		Missense_Mutation	SNP	ENST00000347898.3	37	CCDS10625.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851210	0.91277	.	.	ENSG00000158865	ENST00000347898;ENST00000449109;ENST00000424767;ENST00000545376;ENST00000539472	D;D;D;D;D	0.93076	-3.16;-3.16;-3.16;-3.16;-3.16	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.97473	0.9173	M	0.94063	3.49	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.986;0.999	D;D;D;D	0.77004	0.989;0.981;0.91;0.985	D	0.98492	1.0610	10	0.87932	D	0	.	16.0109	0.80402	0.0:1.0:0.0:0.0	.	96;131;166;102	B7Z329;Q8WWX8-2;Q8WWX8;Q05BF1	.;.;SC5AB_HUMAN;.	V	166;102;131;96;102	ENSP00000289932:A166V;ENSP00000389606:A102V;ENSP00000416782:A131V;ENSP00000441384:A96V;ENSP00000441018:A102V	ENSP00000289932:A166V	A	+	2	0	SLC5A11	24796099	1.000000	0.71417	0.996000	0.52242	0.923000	0.55619	5.309000	0.65774	2.431000	0.82371	0.555000	0.69702	GCC		0.478	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3	NM_052944	
SLX4	84464	hgsc.bcm.edu	37	16	3647829	3647829	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr16:3647829A>C	ENST00000294008.3	-	6	1975	c.1335T>G	c.(1333-1335)agT>agG	p.S445R		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	445	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)	p.S445R(1)		breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CAGAAAAGGCACTTTCCAGCC	0.617								Direct reversal of damage																													p.S445R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1335G	16						.						69.0	66.0	67.0					16																	3647829		2197	4300	6497	3587830	SO:0001583	missense	84464	exon6			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1335T>G	16.37:g.3647829A>C	ENSP00000294008:p.Ser445Arg		3587830	NM_032444	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	A	11.61	1.690131	0.29962	.	.	ENSG00000188827	ENST00000294008	T	0.21191	2.02	4.95	-7.09	0.01553	.	1.023960	0.07758	N	0.949653	T	0.14442	0.0349	L	0.39898	1.24	0.09310	N	1	B	0.15473	0.013	B	0.14023	0.01	T	0.36866	-0.9730	10	0.56958	D	0.05	.	7.7941	0.29138	0.5666:0.1872:0.2462:0.0	.	445	Q8IY92	SLX4_HUMAN	R	445	ENSP00000294008:S445R	ENSP00000294008:S445R	S	-	3	2	SLX4	3587830	0.000000	0.05858	0.000000	0.03702	0.301000	0.27625	-0.710000	0.05024	-1.486000	0.01851	0.533000	0.62120	AGT		0.617	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
KAT8	84148	hgsc.bcm.edu	37	16	31131665	31131665	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr16:31131665C>T	ENST00000543774.2	+	4	627	c.292C>T	c.(292-294)Cgg>Tgg	p.R98W	KAT8_ENST00000448516.2_Missense_Mutation_p.R98W|KAT8_ENST00000219797.4_Missense_Mutation_p.R98W|RP11-196G11.4_ENST00000576336.1_RNA			Q9H7Z6	KAT8_HUMAN	K(lysine) acetyltransferase 8	98	Chromo.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|myeloid cell differentiation (GO:0030099)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	histone acetyltransferase complex (GO:0000123)|kinetochore (GO:0000776)|MLL1 complex (GO:0071339)|MSL complex (GO:0072487)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|transcription factor binding (GO:0008134)	p.R98W(2)									TACAGTTAACCGGCGGCTGGA	0.577																																					p.R98W												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C292T	16						.						79.0	76.0	77.0					16																	31131665		2197	4300	6497	31039166	SO:0001583	missense	84148	exon3			AF217501	CCDS10706.1, CCDS45468.1	16p11.1	2013-01-10	2011-07-21	2011-07-21	ENSG00000103510	ENSG00000103510	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17933	protein-coding gene	gene with protein product		609912	"""MYST histone acetyltransferase 1"""	MYST1		10786633	Standard	NM_032188		Approved	MOF, FLJ14040, hMOF, ZC2HC8	uc002eax.3	Q9H7Z6	OTTHUMG00000132410	ENST00000543774.2:c.292C>T	16.37:g.31131665C>T	ENSP00000456933:p.Arg98Trp		31039166	NM_032188	A8K4Z1|G5E9P2|Q659G0|Q7LC17|Q8IY59|Q8WYB4|Q8WZ14|Q9HAC5|Q9NR35	Missense_Mutation	SNP	ENST00000543774.2	37	CCDS10706.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266161	0.80358	.	.	ENSG00000103510	ENST00000219797;ENST00000448516	T;T	0.50548	0.74;0.74	5.83	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.73606	0.3608	M	0.89968	3.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79916	-0.1601	10	0.87932	D	0	-33.3908	13.8716	0.63622	0.1825:0.8174:0.0:0.0	.	98;98	Q9H7Z6;G5E9P2	KAT8_HUMAN;.	W	98	ENSP00000219797:R98W;ENSP00000406037:R98W	ENSP00000219797:R98W	R	+	1	2	KAT8	31039166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.752000	0.38349	1.377000	0.46286	0.655000	0.94253	CGG		0.577	KAT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000255546.3	NM_032188	
TLDC1	57707	hgsc.bcm.edu	37	16	84516275	84516275	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr16:84516275C>A	ENST00000343629.6	-	6	1182	c.1000G>T	c.(1000-1002)Gct>Tct	p.A334S	TLDC1_ENST00000535580.1_Missense_Mutation_p.A307S	NM_020947.3	NP_065998.3	Q6P9B6	TLDC1_HUMAN	TBC/LysM-associated domain containing 1	334	TLD.					lysosomal membrane (GO:0005765)		p.A334S(1)									GTGTACACAGCCATGCTGGGG	0.572																																					p.A334S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1000T	16						.						164.0	123.0	137.0					16																	84516275		2200	4300	6500	83073776	SO:0001583	missense	57707	exon6			AB046829	CCDS32498.1	16q24.1	2013-03-14	2013-03-14	2013-03-14	ENSG00000140950	ENSG00000140950			29325	protein-coding gene	gene with protein product	"""TLD domain containing 1"""		"""KIAA1609"""	KIAA1609		10997877	Standard	NM_020947		Approved		uc002fib.3	Q6P9B6	OTTHUMG00000176739	ENST00000343629.6:c.1000G>T	16.37:g.84516275C>A	ENSP00000343635:p.Ala334Ser		83073776	NM_020947	Q8IZ64|Q9HCG3|Q9NTE8	Missense_Mutation	SNP	ENST00000343629.6	37	CCDS32498.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130909	0.37630	.	.	ENSG00000140950	ENST00000343629;ENST00000545792;ENST00000535580	T;T	0.43294	0.95;0.95	5.37	5.37	0.77165	TLDc (2);	0.249822	0.40908	D	0.000994	T	0.44138	0.1279	L	0.37897	1.145	0.40538	D	0.980994	D;B	0.55605	0.972;0.389	P;B	0.51550	0.673;0.407	T	0.16600	-1.0397	10	0.14252	T	0.57	-20.3387	18.1009	0.89505	0.0:1.0:0.0:0.0	.	307;334	F5GWS3;Q6P9B6	.;K1609_HUMAN	S	334;2;307	ENSP00000343635:A334S;ENSP00000441997:A307S	ENSP00000343635:A334S	A	-	1	0	KIAA1609	83073776	1.000000	0.71417	0.927000	0.36925	0.066000	0.16364	2.856000	0.48341	2.516000	0.84829	0.655000	0.94253	GCT		0.572	TLDC1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433421.1	NM_020947	
LAMA1	284217	hgsc.bcm.edu	37	18	6976058	6976058	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr18:6976058C>G	ENST00000389658.3	-	45	6460	c.6367G>C	c.(6367-6369)Gac>Cac	p.D2123H		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2123	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.D2123H(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CAATCTCTGTCTGCAGACACG	0.453																																					p.D2123H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6367C	18						.						124.0	124.0	124.0					18																	6976058		2203	4300	6503	6966058	SO:0001583	missense	284217	exon45			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.6367G>C	18.37:g.6976058C>G	ENSP00000374309:p.Asp2123His		6966058	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613585	0.87359	.	.	ENSG00000101680	ENST00000389658	T	0.50813	0.73	5.64	5.64	0.86602	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin II (1);	0.000000	0.85682	D	0.000000	T	0.69015	0.3064	M	0.76574	2.34	0.58432	D	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.62096	-0.6926	10	0.22109	T	0.4	.	20.0634	0.97698	0.0:1.0:0.0:0.0	.	2123	P25391	LAMA1_HUMAN	H	2123	ENSP00000374309:D2123H	ENSP00000374309:D2123H	D	-	1	0	LAMA1	6966058	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.650000	0.67944	2.817000	0.96982	0.643000	0.83706	GAC		0.453	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
PCCB	5096	hgsc.bcm.edu	37	3	136046014	136046014	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr3:136046014G>A	ENST00000251654.4	+	12	1286	c.1216G>A	c.(1216-1218)Ggg>Agg	p.G406R	PCCB_ENST00000462637.1_Missense_Mutation_p.G383R|PCCB_ENST00000483687.1_Missense_Mutation_p.G387R|PCCB_ENST00000471595.1_Missense_Mutation_p.G406R|PCCB_ENST00000490504.1_Missense_Mutation_p.G349R|PCCB_ENST00000466072.1_Missense_Mutation_p.G426R|PCCB_ENST00000474833.1_Intron|PCCB_ENST00000469217.1_Missense_Mutation_p.G426R|PCCB_ENST00000468777.1_Missense_Mutation_p.G437R|PCCB_ENST00000482086.1_Missense_Mutation_p.G290R|PCCB_ENST00000478469.1_Intron	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide	406	Carboxyltransferase.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)	p.G406R(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	ACAGGAATACGGGGGCATCAT	0.522																																					p.G426R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1276A	3						.						96.0	88.0	91.0					3																	136046014		2203	4300	6503	137528704	SO:0001583	missense	5096	exon13				CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.1216G>A	3.37:g.136046014G>A	ENSP00000251654:p.Gly406Arg		137528704	NM_001178014	B7Z2Z4|Q16813|Q96CX0	Missense_Mutation	SNP	ENST00000251654.4	37	CCDS3089.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880930	0.91740	.	.	ENSG00000114054	ENST00000251654;ENST00000490504;ENST00000483687;ENST00000468777;ENST00000462637;ENST00000466072;ENST00000482086;ENST00000471595;ENST00000469217	D;D;D;D;D;D;D;D;D	0.97831	-4.56;-4.56;-4.56;-4.56;-4.56;-4.56;-4.56;-4.56;-4.56	5.59	5.59	0.84812	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.000000	0.85682	D	0.000000	D	0.97714	0.9250	M	0.70595	2.14	0.80722	D	1	P;D;D	0.55385	0.891;0.971;0.971	P;P;P	0.49252	0.537;0.604;0.604	D	0.98393	1.0564	10	0.87932	D	0	.	19.6017	0.95566	0.0:0.0:1.0:0.0	.	426;406;406	B7Z2Z4;E9PDR0;P05166	.;.;PCCB_HUMAN	R	406;349;387;437;383;426;290;406;426	ENSP00000251654:G406R;ENSP00000418307:G349R;ENSP00000420639:G387R;ENSP00000419129:G437R;ENSP00000420391:G383R;ENSP00000420158:G426R;ENSP00000417253:G290R;ENSP00000417549:G406R;ENSP00000419027:G426R	ENSP00000251654:G406R	G	+	1	0	PCCB	137528704	1.000000	0.71417	0.965000	0.40720	0.831000	0.47069	9.378000	0.97191	2.637000	0.89404	0.462000	0.41574	GGG		0.522	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000357335.1		
RBP1	5947	hgsc.bcm.edu	37	3	139236506	139236506	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr3:139236506C>T	ENST00000232219.2	-	4	667	c.557G>A	c.(556-558)gGt>gAt	p.G186D	RP11-319G6.1_ENST00000515247.1_RNA	NM_002899.3	NP_002890.2	P09455	RET1_HUMAN	retinol binding protein 1, cellular	124					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)	p.G124D(1)		endometrium(1)|large_intestine(2)|lung(1)|prostate(1)	5					Acitretin(DB00459)|Vitamin A(DB00162)	GCAGACCACACCTTCCACTCT	0.493																																					p.G186D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G557A	3						.						222.0	177.0	192.0					3																	139236506		2203	4300	6503	140719196	SO:0001583	missense	5947	exon4				CCDS3110.2, CCDS46925.1, CCDS46926.1	3q21-q23	2013-03-01	2001-11-28		ENSG00000114115	ENSG00000114115		"""Fatty acid binding protein family"""	9919	protein-coding gene	gene with protein product		180260	"""retinol-binding protein 1, cellular"""			1654334, 9858824	Standard	NM_002899		Approved	CRABP-I, CRBP1, CRBP, RBPC, CRBPI	uc003eti.2	P09455	OTTHUMG00000155751	ENST00000232219.2:c.557G>A	3.37:g.139236506C>T	ENSP00000232219:p.Gly186Asp		140719196	NM_002899	A8K2Q0|B7Z7A0|E7EWV0|F2Z2F2|Q6FGX8	Missense_Mutation	SNP	ENST00000232219.2	37	CCDS3110.2	.	.	.	.	.	.	.	.	.	.	C	6.981	0.551123	0.13374	.	.	ENSG00000114115	ENST00000232219	T	0.21361	2.01	5.77	5.77	0.91146	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.063356	0.64402	D	0.000009	T	0.07728	0.0194	N	0.02685	-0.53	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.20806	-1.0264	10	0.05351	T	0.99	.	10.8452	0.46739	0.0:0.9148:0.0:0.0852	.	124	P09455	RET1_HUMAN	D	186	ENSP00000232219:G186D	ENSP00000232219:G186D	G	-	2	0	RBP1	140719196	0.998000	0.40836	0.999000	0.59377	0.995000	0.86356	3.616000	0.54174	2.726000	0.93360	0.655000	0.94253	GGT		0.493	RBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341495.1	NM_002899	
STT3B	201595	hgsc.bcm.edu	37	3	31638319	31638319	+	Missense_Mutation	SNP	T	T	G	rs199996092		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr3:31638319T>G	ENST00000295770.2	+	4	950	c.741T>G	c.(739-741)ttT>ttG	p.F247L	STT3B_ENST00000453168.1_3'UTR	NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	247					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						GGTCAGTTTTTTGGACAATGT	0.299																																					p.F247L												.	.	0			c.T741G	3						.						130.0	128.0	129.0					3																	31638319		2202	4296	6498	31613323	SO:0001583	missense	201595	exon4			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.741T>G	3.37:g.31638319T>G	ENSP00000295770:p.Phe247Leu		31613323	NM_178862	Q96JZ4|Q96KY7	Missense_Mutation	SNP	ENST00000295770.2	37	CCDS2650.1	.	.	.	.	.	.	.	.	.	.	T	12.75	2.030842	0.35797	.	.	ENSG00000163527	ENST00000295770	.	.	.	5.62	1.77	0.24775	.	0.049579	0.85682	D	0.000000	T	0.39708	0.1088	L	0.31845	0.965	0.58432	D	0.999991	B	0.12630	0.006	B	0.16289	0.015	T	0.10847	-1.0612	9	0.13853	T	0.58	-3.7746	8.8252	0.35050	0.0:0.3783:0.0:0.6217	.	247	Q8TCJ2	STT3B_HUMAN	L	247	.	ENSP00000295770:F247L	F	+	3	2	STT3B	31613323	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.728000	0.38105	0.376000	0.24707	0.533000	0.62120	TTT		0.299	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253166.2	NM_178862	
CHST2	9435	hgsc.bcm.edu	37	3	142840962	142840962	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr3:142840962C>G	ENST00000309575.3	+	2	2688	c.1304C>G	c.(1303-1305)aCa>aGa	p.T435R		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	435					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						CCCGTCAAGACACTACGGAGA	0.607																																					p.T435R												.	.	0			c.C1304G	3						.						77.0	70.0	72.0					3																	142840962		2203	4300	6503	144323652	SO:0001583	missense	9435	exon2			BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1304C>G	3.37:g.142840962C>G	ENSP00000307911:p.Thr435Arg		144323652	NM_004267	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.244642	0.59103	.	.	ENSG00000175040	ENST00000309575	D	0.81908	-1.55	4.33	4.33	0.51752	Sulfotransferase domain (1);	0.128707	0.51477	D	0.000096	D	0.85927	0.5811	L	0.38175	1.15	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.82337	-0.0507	10	0.16896	T	0.51	-12.3906	17.011	0.86406	0.0:1.0:0.0:0.0	.	435	Q9Y4C5	CHST2_HUMAN	R	435	ENSP00000307911:T435R	ENSP00000307911:T435R	T	+	2	0	CHST2	144323652	0.998000	0.40836	0.987000	0.45799	0.990000	0.78478	3.890000	0.56220	2.233000	0.73108	0.407000	0.27541	ACA		0.607	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
KRAS	3845	hgsc.bcm.edu	37	12	25398282	25398282	+	Missense_Mutation	SNP	C	C	A	rs121913535		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr12:25398282C>A	ENST00000256078.4	-	2	100	c.37G>T	c.(37-39)Ggc>Tgc	p.G13C	KRAS_ENST00000556131.1_Missense_Mutation_p.G13C|KRAS_ENST00000311936.3_Missense_Mutation_p.G13C|KRAS_ENST00000557334.1_Missense_Mutation_p.G13C	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	13			G -> D (in a breast carcinoma cell line and GASC; somatic mutation). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:3627975}.|G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway). {ECO:0000269|PubMed:16247081}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G13C(213)|p.G13S(59)|p.G13R(43)|p.G12_G13insG(3)|p.G13N(1)|p.G13I(1)|p.G12_G13insA(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TTGCCTACGCCACCAGCTCCA	0.343	G13C(MORCPR_LUNG)|G13C(NCIH1355_LUNG)|G13C(NCIH1734_LUNG)|G13C(TOV21G_OVARY)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G13C	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,-2	.	321	Substitution - Missense(317)|Insertion - In frame(4)	large_intestine(126)|lung(111)|stomach(14)|thyroid(13)|biliary_tract(13)|endometrium(9)|ovary(8)|haematopoietic_and_lymphoid_tissue(5)|pancreas(5)|soft_tissue(4)|upper_aerodigestive_tract(4)|prostate(3)|oesophagus(2)|urinary_tract(1)|salivary_gland(1)|thymus(1)|liver(1)	c.G37T	12						.						89.0	79.0	83.0					12																	25398282		2203	4300	6503	25289549	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.37G>T	12.37:g.25398282C>A	ENSP00000256078:p.Gly13Cys		25289549	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686065	0.88639	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	D;T;T;T	0.83755	-1.76;-0.81;-0.81;-0.81	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.92740	0.7692	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.981;0.997	D	0.93619	0.6946	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	13;13	P01116-2;P01116	.;RASK_HUMAN	C	13	ENSP00000308495:G13C;ENSP00000452512:G13C;ENSP00000256078:G13C;ENSP00000451856:G13C	ENSP00000256078:G13C	G	-	1	0	KRAS	25289549	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGC		0.343	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TROAP	10024	hgsc.bcm.edu	37	12	49725164	49725164	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr12:49725164A>T	ENST00000257909.3	+	14	2342	c.2266A>T	c.(2266-2268)Aca>Tca	p.T756S	TROAP_ENST00000551245.1_Missense_Mutation_p.T846S|TROAP_ENST00000547923.1_Missense_Mutation_p.T435S	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	756					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)		p.T756S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						CCCTGTGGCTACATTACTCGA	0.632											OREG0021792	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T756S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2266T	12						.						53.0	51.0	52.0					12																	49725164		2203	4300	6503	48011431	SO:0001583	missense	10024	exon14			U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.2266A>T	12.37:g.49725164A>T	ENSP00000257909:p.Thr756Ser	964	48011431	NM_005480	F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	ENST00000257909.3	37	CCDS8784.1	.	.	.	.	.	.	.	.	.	.	A	17.52	3.410189	0.62399	.	.	ENSG00000135451	ENST00000551245;ENST00000257909;ENST00000547923	.	.	.	5.93	3.57	0.40892	.	0.098898	0.44285	D	0.000472	T	0.36413	0.0966	L	0.46157	1.445	0.19575	N	0.999965	P;P;P	0.49559	0.925;0.925;0.827	P;P;P	0.49752	0.621;0.621;0.526	T	0.19192	-1.0313	9	0.59425	D	0.04	-0.4741	6.1343	0.20223	0.7547:0.1628:0.0825:0.0	.	846;435;756	F8W130;F8W1U0;Q12815	.;.;TROAP_HUMAN	S	846;756;435	.	ENSP00000257909:T756S	T	+	1	0	TROAP	48011431	0.276000	0.24211	0.227000	0.23927	0.977000	0.68977	1.223000	0.32527	0.490000	0.27771	0.459000	0.35465	ACA		0.632	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480	
SLC16A7	9194	hgsc.bcm.edu	37	12	60165049	60165049	+	Silent	SNP	G	G	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr12:60165049G>C	ENST00000261187.4	+	3	431	c.267G>C	c.(265-267)gtG>gtC	p.V89V	SLC16A7_ENST00000543448.1_5'UTR|SLC16A7_ENST00000547379.1_Silent_p.V89V|SLC16A7_ENST00000552432.1_Silent_p.V89V|SLC16A7_ENST00000552024.1_Silent_p.V89V	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	89					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.V89V(1)		endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	GGCCGGTGGTGATAGCAGGAG	0.453																																					p.V89V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G267C	12						.						214.0	192.0	199.0					12																	60165049		2203	4300	6503	58451316	SO:0001819	synonymous_variant	9194	exon3			AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.267G>C	12.37:g.60165049G>C			58451316	NM_004731	Q8NEM3|Q9UPB3	Silent	SNP	ENST00000261187.4	37	CCDS8961.1																																																																																				0.453	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731	
ACACB	32	hgsc.bcm.edu	37	12	109698370	109698370	+	Silent	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr12:109698370G>A	ENST00000338432.7	+	48	6701	c.6582G>A	c.(6580-6582)ccG>ccA	p.P2194P	ACACB_ENST00000543201.1_3'UTR|ACACB_ENST00000377854.5_Silent_p.P2124P|ACACB_ENST00000377848.3_Silent_p.P2194P			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	2194	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.P2194P(1)		NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	TCTATATCCCGCCCTATGCGG	0.522																																					p.P2194P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G6582A	12						.						159.0	157.0	158.0					12																	109698370		2203	4300	6503	108182753	SO:0001819	synonymous_variant	32	exon47			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.6582G>A	12.37:g.109698370G>A			108182753	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	ENST00000338432.7	37	CCDS31898.1																																																																																				0.522	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
GABRB3	2562	hgsc.bcm.edu	37	15	26806305	26806305	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr15:26806305G>A	ENST00000311550.5	-	8	965	c.854C>T	c.(853-855)aCa>aTa	p.T285I	GABRB3_ENST00000541819.2_Missense_Mutation_p.T341I|GABRB3_ENST00000400188.3_Missense_Mutation_p.T214I|GABRB3_ENST00000299267.4_Missense_Mutation_p.T285I|GABRB3_ENST00000545868.1_Missense_Mutation_p.T200I	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	285					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)	p.T285I(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGTTGTCATTGTCAGCACAGT	0.438																																					p.T285I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C854T	15						.						169.0	156.0	160.0					15																	26806305		2203	4300	6503	24357398	SO:0001583	missense	2562	exon8				CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.854C>T	15.37:g.26806305G>A	ENSP00000308725:p.Thr285Ile		24357398	NM_021912	B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	37	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293317	0.80914	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868	D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3	4.9	4.9	0.64082	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.93926	0.8056	M	0.87269	2.87	0.80722	D	1	D;D;D	0.76494	0.984;0.997;0.999	P;D;D	0.67382	0.868;0.919;0.951	D	0.95064	0.8198	10	0.87932	D	0	.	17.0894	0.86618	0.0:0.0:1.0:0.0	.	341;285;285	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	I	285;341;285;214;200	ENSP00000308725:T285I;ENSP00000442408:T341I;ENSP00000299267:T285I;ENSP00000383049:T214I;ENSP00000439169:T200I	ENSP00000299267:T285I	T	-	2	0	GABRB3	24357398	1.000000	0.71417	0.994000	0.49952	0.929000	0.56500	9.724000	0.98775	2.261000	0.74972	0.591000	0.81541	ACA		0.438	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2		
BLM	641	hgsc.bcm.edu	37	15	91333945	91333945	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr15:91333945G>A	ENST00000355112.3	+	15	3008	c.2890G>A	c.(2890-2892)Gca>Aca	p.A964T	BLM_ENST00000560136.1_3'UTR|BLM_ENST00000560509.1_Missense_Mutation_p.A964T	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	964	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)	p.A964T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TGTGATTCATGCATCTCTCCC	0.408			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.A964T		yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2890A	15						.						168.0	157.0	161.0					15																	91333945		2198	4298	6496	89134949	SO:0001583	missense	641	exon15	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.2890G>A	15.37:g.91333945G>A	ENSP00000347232:p.Ala964Thr		89134949	NM_000057	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	37	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.636154	0.47049	.	.	ENSG00000197299	ENST00000355112;ENST00000536925;ENST00000543977	T	0.74632	-0.86	5.43	4.43	0.53597	Helicase, C-terminal (3);	0.056344	0.64402	D	0.000001	T	0.68311	0.2987	L	0.48362	1.52	0.58432	D	0.999998	B;B;B	0.26512	0.151;0.068;0.151	B;B;B	0.30646	0.118;0.102;0.118	T	0.63972	-0.6516	10	0.24483	T	0.36	-21.8912	14.4702	0.67512	0.0:0.0:0.8428:0.1572	.	964;589;964	B2RAN0;B7ZKN7;P54132	.;.;BLM_HUMAN	T	964;594;151	ENSP00000347232:A964T	ENSP00000347232:A964T	A	+	1	0	BLM	89134949	1.000000	0.71417	0.984000	0.44739	0.987000	0.75469	6.596000	0.74113	2.536000	0.85505	0.585000	0.79938	GCA		0.408	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
UNC45A	55898	hgsc.bcm.edu	37	15	91488203	91488203	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr15:91488203G>A	ENST00000418476.2	+	9	1149	c.1109G>A	c.(1108-1110)aGc>aAc	p.S370N	UNC45A_ENST00000394275.2_Missense_Mutation_p.S355N	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	370					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			AGCCGCATGAGCGCCTCTATT	0.507																																					p.S355N												.	.	0			c.G1064A	15						.						73.0	76.0	75.0					15																	91488203		2198	4298	6496	89289207	SO:0001583	missense	55898	exon12				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.1109G>A	15.37:g.91488203G>A	ENSP00000407487:p.Ser370Asn		89289207	NM_001039675	A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	ENST00000418476.2	37	CCDS10367.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819558	0.50633	.	.	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.43688	0.94;0.94	5.71	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.32315	0.0825	L	0.36672	1.1	0.47819	D	0.999525	B;B	0.10296	0.003;0.001	B;B	0.17722	0.019;0.013	T	0.08764	-1.0706	10	0.27082	T	0.32	-12.195	10.7753	0.46346	0.0718:0.1316:0.7966:0.0	.	370;355	Q9H3U1;A8K6F7	UN45A_HUMAN;.	N	355;370	ENSP00000377816:S355N;ENSP00000407487:S370N	ENSP00000377816:S355N	S	+	2	0	UNC45A	89289207	1.000000	0.71417	0.969000	0.41365	0.959000	0.62525	3.267000	0.51577	1.430000	0.47334	0.650000	0.86243	AGC		0.507	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671	
SLC10A6	345274	hgsc.bcm.edu	37	4	87746674	87746674	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr4:87746674A>C	ENST00000273905.6	-	5	965	c.818T>G	c.(817-819)aTg>aGg	p.M273R	SLC10A6_ENST00000505535.1_5'UTR	NM_197965.2	NP_932069.1	Q3KNW5	SOAT_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 6	273					sodium-dependent organic anion transport (GO:0043251)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)|sodium-dependent organic anion transmembrane transporter activity (GO:0043250)	p.M273R(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	9		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		TAACTGGAGCATGGTGATGCA	0.423																																					p.M273R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T818G	4						.						89.0	80.0	83.0					4																	87746674		2203	4300	6503	87965698	SO:0001583	missense	345274	exon5			AJ583502	CCDS3614.1	4q22.1	2013-07-18	2013-07-18		ENSG00000145283	ENSG00000145283		"""Solute carriers"""	30603	protein-coding gene	gene with protein product		613366				15020217, 17491011	Standard	NM_197965		Approved	SOAT	uc003hqd.2	Q3KNW5	OTTHUMG00000130596	ENST00000273905.6:c.818T>G	4.37:g.87746674A>C	ENSP00000273905:p.Met273Arg		87965698	NM_197965	Q70EX7	Missense_Mutation	SNP	ENST00000273905.6	37	CCDS3614.1	.	.	.	.	.	.	.	.	.	.	A	13.92	2.381016	0.42207	.	.	ENSG00000145283	ENST00000273905	T	0.63255	-0.03	5.28	5.28	0.74379	.	0.127680	0.56097	D	0.000028	T	0.71459	0.3342	M	0.63843	1.955	0.42767	D	0.99382	D	0.64830	0.994	P	0.56278	0.795	T	0.75806	-0.3188	10	0.87932	D	0	-29.1637	13.4518	0.61176	1.0:0.0:0.0:0.0	.	273	Q3KNW5	SOAT_HUMAN	R	273	ENSP00000273905:M273R	ENSP00000273905:M273R	M	-	2	0	SLC10A6	87965698	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.601000	0.74136	2.127000	0.65507	0.533000	0.62120	ATG		0.423	SLC10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253043.2	NM_197965	
DRD5	1816	hgsc.bcm.edu	37	4	9784687	9784687	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr4:9784687T>C	ENST00000304374.2	+	1	1430	c.1034T>C	c.(1033-1035)gTc>gCc	p.V345A		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	345					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GACGTCTTCGTCTGGTTCGGC	0.587																																					p.V345A												.	.	0			c.T1034C	4						.						92.0	90.0	91.0					4																	9784687		2203	4300	6503	9393785	SO:0001583	missense	1816	exon1			X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1034T>C	4.37:g.9784687T>C	ENSP00000306129:p.Val345Ala		9393785	NM_000798	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	t	20.4	3.984814	0.74474	.	.	ENSG00000169676	ENST00000304374	T	0.38560	1.13	4.59	4.59	0.56863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.64046	0.2563	M	0.83012	2.62	0.53688	D	0.999971	D	0.71674	0.998	D	0.71870	0.975	T	0.65319	-0.6197	10	0.31617	T	0.26	.	13.3213	0.60434	0.0:0.0:0.0:1.0	.	345	P21918	DRD5_HUMAN	A	345	ENSP00000306129:V345A	ENSP00000306129:V345A	V	+	2	0	DRD5	9393785	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.506000	0.81665	1.926000	0.55796	0.377000	0.23210	GTC		0.587	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
HSD17B13	345275	hgsc.bcm.edu	37	4	88238247	88238247	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr4:88238247A>C	ENST00000328546.4	-	3	511	c.447T>G	c.(445-447)ttT>ttG	p.F149L	HSD17B13_ENST00000302219.6_Missense_Mutation_p.F113L|RP11-529H2.2_ENST00000508163.1_RNA	NM_178135.3	NP_835236.2	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	149						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)	p.F149L(1)		endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	8		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)		CACTCACCCAAAAATGTCCTA	0.423																																					p.F113L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T339G	4						.						161.0	154.0	156.0					4																	88238247		2203	4300	6503	88457271	SO:0001583	missense	345275	exon2				CCDS3618.1, CCDS47097.1	4q22.1	2011-09-20			ENSG00000170509	ENSG00000170509	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18685	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 3"""	612127				19027726	Standard	NM_178135		Approved	SCDR9, SDR16C3	uc003hqo.2	Q7Z5P4	OTTHUMG00000130602	ENST00000328546.4:c.447T>G	4.37:g.88238247A>C	ENSP00000333300:p.Phe149Leu		88457271	NM_001136230	A8K9R9|Q2M1L5|Q86W22|Q86W23	Missense_Mutation	SNP	ENST00000328546.4	37	CCDS3618.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.313634	0.60414	.	.	ENSG00000170509	ENST00000302219;ENST00000328546	D;D	0.90069	-2.61;-2.61	4.93	3.74	0.42951	NAD(P)-binding domain (1);	0.081906	0.50627	D	0.000102	D	0.90885	0.7136	M	0.66297	2.02	0.34536	D	0.709733	P;D	0.62365	0.894;0.991	P;P	0.61874	0.461;0.895	D	0.91462	0.5190	10	0.51188	T	0.08	.	5.5009	0.16829	0.6934:0.1483:0.1583:0.0	.	113;149	Q7Z5P4-2;Q7Z5P4	.;DHB13_HUMAN	L	113;149	ENSP00000305438:F113L;ENSP00000333300:F149L	ENSP00000305438:F113L	F	-	3	2	HSD17B13	88457271	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.903000	0.28475	0.992000	0.38840	-0.297000	0.09499	TTT		0.423	HSD17B13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253052.1	NM_178135	
ACSL4	2182	hgsc.bcm.edu	37	X	108926672	108926672	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:108926672A>G	ENST00000469796.2	-	3	440	c.44T>C	c.(43-45)gTc>gCc	p.V15A	ACSL4_ENST00000348502.6_Intron|ACSL4_ENST00000340800.2_Missense_Mutation_p.V15A			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	15					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.V15A(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	TAACAAGTGGACAGGCAGCAA	0.343																																					p.V15A	Pancreas(188;358 2127 38547 41466 45492)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T44C	X						.						91.0	89.0	90.0					X																	108926672		2203	4298	6501	108813328	SO:0001583	missense	2182	exon4			BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.44T>C	X.37:g.108926672A>G	ENSP00000419171:p.Val15Ala		108813328	NM_022977	D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	ENST00000469796.2	37	CCDS14548.1	.	.	.	.	.	.	.	.	.	.	A	15.97	2.989170	0.53934	.	.	ENSG00000068366	ENST00000469796;ENST00000340800;ENST00000502391;ENST00000508092;ENST00000504980;ENST00000469857	T;T	0.36340	1.26;1.26	5.3	5.3	0.74995	.	0.137681	0.50627	D	0.000115	T	0.33323	0.0859	L	0.44542	1.39	0.58432	D	0.999999	B	0.16396	0.017	B	0.18263	0.021	T	0.07751	-1.0756	10	0.46703	T	0.11	-1.5221	14.3459	0.66662	1.0:0.0:0.0:0.0	.	15	O60488	ACSL4_HUMAN	A	15	ENSP00000419171:V15A;ENSP00000339787:V15A	ENSP00000339787:V15A	V	-	2	0	ACSL4	108813328	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.882000	0.92420	1.766000	0.52107	0.412000	0.27726	GTC		0.343	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2	NM_004458	
KLHL34	257240	hgsc.bcm.edu	37	X	21674365	21674365	+	Silent	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:21674365G>A	ENST00000379499.2	-	1	2083	c.1542C>T	c.(1540-1542)acC>acT	p.T514T		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	514						extracellular space (GO:0005615)		p.T514T(1)		cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						CGAAACGTGCGGTGCCCATGG	0.652																																					p.T514T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1542T	X						.						39.0	23.0	28.0					X																	21674365		2201	4297	6498	21584286	SO:0001819	synonymous_variant	257240	exon1			AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.1542C>T	X.37:g.21674365G>A			21584286	NM_153270		Silent	SNP	ENST00000379499.2	37	CCDS14199.1																																																																																				0.652	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1	NM_153270	
IL1RAPL1	11141	hgsc.bcm.edu	37	X	29301325	29301325	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:29301325G>A	ENST00000378993.1	+	3	1026	c.353G>A	c.(352-354)tGt>tAt	p.C118Y	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.C118Y	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	118	Ig-like C2-type 1.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.C118Y(1)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						CTCTACGCCTGTGTCATCAGG	0.433																																					p.C118Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G353A	X						.						79.0	69.0	72.0					X																	29301325		2202	4300	6502	29211246	SO:0001583	missense	11141	exon3			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.353G>A	X.37:g.29301325G>A	ENSP00000368278:p.Cys118Tyr		29211246	NM_014271	A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.809993	0.70797	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	D;D	0.89552	-2.53;-2.53	5.81	5.81	0.92471	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.95500	0.8538	M	0.88570	2.965	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.96048	0.9029	10	0.87932	D	0	.	17.9294	0.88992	0.0:0.0:1.0:0.0	.	118	Q9NZN1	IRPL1_HUMAN	Y	118	ENSP00000368278:C118Y;ENSP00000305200:C118Y	ENSP00000305200:C118Y	C	+	2	0	IL1RAPL1	29211246	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	9.476000	0.97823	2.454000	0.82982	0.600000	0.82982	TGT		0.433	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271	
GATA1	2623	hgsc.bcm.edu	37	X	48650312	48650312	+	Silent	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:48650312C>T	ENST00000376670.3	+	3	393	c.282C>T	c.(280-282)gcC>gcT	p.A94A	GATA1_ENST00000376665.3_Silent_p.A94A	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	94					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.?(2)|p.V77_A120>A(1)|p.A94A(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						CACCATATGCCGGCTGGGCCT	0.597			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome																																p.A94A	Pancreas(9;429 505 11287 29617)		Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	.	.	4	Unknown(2)|Complex - deletion inframe(1)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)	c.C282T	X						.						50.0	50.0	50.0					X																	48650312		2203	4300	6503	48535256	SO:0001819	synonymous_variant	2623	exon3			X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.282C>T	X.37:g.48650312C>T			48535256	NM_002049	Q96GB8	Silent	SNP	ENST00000376670.3	37	CCDS14305.1																																																																																				0.597	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056517.1	NM_002049	
PQBP1	10084	hgsc.bcm.edu	37	X	48755810	48755810	+	Silent	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:48755810G>A	ENST00000376563.1	+	2	218	c.18G>A	c.(16-18)gcG>gcA	p.A6A	TIMM17B_ENST00000376582.3_5'Flank|TIMM17B_ENST00000495490.2_5'Flank|PQBP1_ENST00000376548.5_Silent_p.A6A|TIMM17B_ENST00000472645.1_5'Flank|PQBP1_ENST00000447146.2_Silent_p.A6A|PQBP1_ENST00000247140.4_Silent_p.A6A|TIMM17B_ENST00000396779.3_5'Flank|PQBP1_ENST00000218224.4_Silent_p.A6A|PQBP1_ENST00000473764.1_3'UTR|PQBP1_ENST00000396763.1_Silent_p.A6A|PQBP1_ENST00000376566.4_Silent_p.A6A|TIMM17B_ENST00000465150.2_5'Flank	NM_001032381.1|NM_001032382.1|NM_001032383.1|NM_001167989.1	NP_001027553.1|NP_001027554.1|NP_001027555.1|NP_001161461.1	O60828	PQBP1_HUMAN	polyglutamine binding protein 1	6					alternative mRNA splicing, via spliceosome (GO:0000380)|neuron projection development (GO:0031175)|regulation of dendrite morphogenesis (GO:0048814)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|neuronal ribonucleoprotein granule (GO:0071598)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ribonucleoprotein complex binding (GO:0043021)|transcription coactivator activity (GO:0003713)	p.A6A(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	11						TGCCCGTTGCGCTGCAGACCC	0.542																																					p.A6A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G18A	X						.						120.0	91.0	101.0					X																	48755810		2203	4300	6503	48640754	SO:0001819	synonymous_variant	10084	exon1			AJ005893	CCDS14309.1, CCDS55412.1	Xp11.23	2014-01-31			ENSG00000102103	ENSG00000102103			9330	protein-coding gene	gene with protein product		300463	"""Sutherland-Haan X-linked mental retardation syndrome"", ""mental retardation, X-linked 55"", ""mental retardation, X-linked 2 (non-dysmorphic)"""	RENS1, MRXS8, SHS, MRX55, MRX2		9875212, 15024694, 14634649	Standard	NM_144495		Approved		uc004dlg.3	O60828	OTTHUMG00000024128	ENST00000376563.1:c.18G>A	X.37:g.48755810G>A			48640754	NM_001167992	Q4VY25|Q4VY26|Q4VY27|Q4VY29|Q4VY30|Q4VY34|Q4VY35|Q4VY36|Q4VY37|Q4VY38|Q9GZP2|Q9GZU4|Q9GZZ4	Silent	SNP	ENST00000376563.1	37	CCDS14309.1																																																																																				0.542	PQBP1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060777.1	NM_001032381.1	
GRIPAP1	56850	hgsc.bcm.edu	37	X	48847416	48847416	+	Silent	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:48847416C>T	ENST00000376441.1	-	7	598	c.564G>A	c.(562-564)ccG>ccA	p.P188P	GRIPAP1_ENST00000376444.3_Silent_p.P143P|GRIPAP1_ENST00000473581.1_5'UTR|GRIPAP1_ENST00000376423.4_Silent_p.P135P|GRIPAP1_ENST00000376425.3_Silent_p.P188P	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	188						blood microparticle (GO:0072562)|endosome (GO:0005768)		p.P135P(2)|p.P188P(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						CCTCTGCCAACGGCATGGGGG	0.597																																					p.P188P												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G564A	X						.						67.0	63.0	64.0					X																	48847416		2203	4300	6503	48732360	SO:0001819	synonymous_variant	56850	exon7			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.564G>A	X.37:g.48847416C>T			48732360	NM_020137	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Silent	SNP	ENST00000376441.1	37	CCDS35248.1																																																																																				0.597	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
AMER1	139285	hgsc.bcm.edu	37	X	63412095	63412095	+	Nonsense_Mutation	SNP	G	G	A	rs137852217		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:63412095G>A	ENST00000330258.3	-	2	1344	c.1072C>T	c.(1072-1074)Cga>Tga	p.R358*	AMER1_ENST00000403336.1_Nonsense_Mutation_p.R358*|AMER1_ENST00000374869.3_Nonsense_Mutation_p.R358*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	358					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.R358*(9)									CAGGAACTTCGCTTGGTCCCA	0.527																																					p.R358X												.	.	76	Whole gene deletion(67)|Substitution - Nonsense(9)	kidney(70)|large_intestine(5)|ovary(1)	c.C1072T	X	GRCh37	CM090019	FAM123B	M	rs137852217	.						153.0	136.0	142.0					X																	63412095		2203	4300	6503	63328820	SO:0001587	stop_gained	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1072C>T	X.37:g.63412095G>A	ENSP00000329117:p.Arg358*		63328820	NM_152424	A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	38	7.185009	0.98121	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	5.18	1.24	0.21308	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3576	13.9688	0.64225	0.0:0.0:0.3525:0.6475	.	.	.	.	X	358	.	ENSP00000329117:R358X	R	-	1	2	FAM123B	63328820	0.081000	0.21417	0.853000	0.33588	0.996000	0.88848	0.184000	0.16939	-0.004000	0.14419	0.529000	0.55759	CGA		0.527	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
AR	367	hgsc.bcm.edu	37	X	66941716	66941716	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:66941716G>A	ENST00000374690.3	+	6	2884	c.2360G>A	c.(2359-2361)cGa>cAa	p.R787Q	AR_ENST00000396043.2_Missense_Mutation_p.R255Q|AR_ENST00000396044.3_Intron	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	786	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.		M -> V (in AIS). {ECO:0000269|PubMed:1569163}.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R597Q(1)|p.R787Q(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CAGTGTGTCCGAATGAGGCAC	0.498									Androgen Insensitivity Syndrome																												p.R255Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G764A	X						.						138.0	105.0	117.0					X																	66941716		2203	4300	6503	66858441	SO:0001583	missense	367	exon6	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2360G>A	X.37:g.66941716G>A	ENSP00000363822:p.Arg787Gln		66858441	NM_001011645	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	g	11.76	1.734105	0.30684	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000396043	D;D	0.96554	-4.05;-4.05	4.75	4.75	0.60458	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.059485	0.64402	D	0.000002	D	0.90992	0.7167	N	0.25485	0.75	0.80722	D	1	P;P	0.51147	0.659;0.942	B;B	0.35413	0.181;0.202	D	0.91331	0.5090	10	0.41790	T	0.15	.	14.0239	0.64573	0.0:0.0:1.0:0.0	.	255;786	F1D8N5;P10275	.;ANDR_HUMAN	Q	597;787;255	ENSP00000363822:R787Q;ENSP00000379358:R255Q	ENSP00000363822:R787Q	R	+	2	0	AR	66858441	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.420000	0.66441	2.178000	0.69098	0.594000	0.82650	CGA		0.498	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
ATRX	546	hgsc.bcm.edu	37	X	76814235	76814235	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:76814235C>T	ENST00000373344.5	-	29	6623	c.6409G>A	c.(6409-6411)Gct>Act	p.A2137T	ATRX_ENST00000395603.3_Missense_Mutation_p.A2099T|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2137	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with MECP2.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.A2137T(2)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTCCAAGAAGCGTCGAATATA	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.A2137T			Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	.	3	Substitution - Missense(2)|Unknown(1)	large_intestine(2)|bone(1)	c.G6409A	X						.						78.0	76.0	77.0					X																	76814235		2203	4295	6498	76700891	SO:0001583	missense	546	exon29			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6409G>A	X.37:g.76814235C>T	ENSP00000362441:p.Ala2137Thr		76700891	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932515	0.73442	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	T;T	0.75821	-0.97;-0.97	5.21	5.21	0.72293	Helicase, C-terminal (3);	0.000000	0.64402	U	0.000001	D	0.83557	0.5280	L	0.49513	1.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.85501	0.1191	10	0.87932	D	0	-9.3111	17.8291	0.88676	0.0:1.0:0.0:0.0	.	2099;2137	P46100-4;P46100	.;ATRX_HUMAN	T	2137;2099	ENSP00000362441:A2137T;ENSP00000378967:A2099T	ENSP00000362441:A2137T	A	-	1	0	ATRX	76700891	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.487000	0.81328	2.141000	0.66446	0.600000	0.82982	GCT		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
CYLC1	1538	hgsc.bcm.edu	37	X	83128982	83128982	+	Silent	SNP	A	A	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:83128982A>G	ENST00000329312.4	+	4	1303	c.1266A>G	c.(1264-1266)gaA>gaG	p.E422E		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	422					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.E421E(3)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						AGAAAGATGAAAAAAAGGATA	0.338																																					p.E422E												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.A1266G	X						.						20.0	16.0	17.0					X																	83128982		2186	4262	6448	83015638	SO:0001819	synonymous_variant	1538	exon4			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1266A>G	X.37:g.83128982A>G			83015638	NM_021118	A0AVQ8|Q5JQQ9	Silent	SNP	ENST00000329312.4	37	CCDS35341.1																																																																																				0.338	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
FAM133A	286499	hgsc.bcm.edu	37	X	92964458	92964458	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:92964458A>T	ENST00000355813.5	+	4	566	c.40A>T	c.(40-42)Ata>Tta	p.I14L	FAM133A_ENST00000322139.4_Missense_Mutation_p.I14L|FAM133A_ENST00000332647.4_Missense_Mutation_p.I14L|FAM133A_ENST00000538690.1_Missense_Mutation_p.I14L	NM_001171109.1|NM_173698.2	NP_001164580.1|NP_775969.1	Q8N9E0	F133A_HUMAN	family with sequence similarity 133, member A	14								p.I14L(1)		breast(2)|endometrium(2)|large_intestine(8)|lung(7)|upper_aerodigestive_tract(1)	20						TATGAATCCTATAGCAATGGC	0.478																																					p.I14L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A40T	X						.						25.0	24.0	24.0					X																	92964458		2203	4298	6501	92851114	SO:0001583	missense	286499	exon5			AK094978	CCDS14466.1	Xq21.32	2010-05-04			ENSG00000179083	ENSG00000179083			26748	protein-coding gene	gene with protein product	"""cancer/testis antigen 115"""						Standard	NM_173698		Approved	RP1-32F7.2, FLJ37659, CT115	uc022bzv.1	Q8N9E0	OTTHUMG00000021975	ENST00000355813.5:c.40A>T	X.37:g.92964458A>T	ENSP00000348067:p.Ile14Leu		92851114	NM_001171110		Missense_Mutation	SNP	ENST00000355813.5	37	CCDS14466.1	.	.	.	.	.	.	.	.	.	.	a	13.00	2.107112	0.37145	.	.	ENSG00000179083	ENST00000538690;ENST00000355813;ENST00000322139;ENST00000332647	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	3.27	0.606	0.17559	.	0.000000	0.85682	D	0.000000	T	0.24044	0.0582	L	0.39692	1.235	0.22880	N	0.998617	B	0.21520	0.057	B	0.18871	0.023	T	0.15350	-1.0440	10	0.56958	D	0.05	-8.2465	5.0308	0.14409	0.7177:0.0:0.2823:0.0	.	14	Q8N9E0	F133A_HUMAN	L	14	ENSP00000441389:I14L;ENSP00000348067:I14L;ENSP00000318974:I14L;ENSP00000362169:I14L	ENSP00000318974:I14L	I	+	1	0	FAM133A	92851114	0.995000	0.38212	0.963000	0.40424	0.924000	0.55760	1.365000	0.34182	0.020000	0.15106	0.478000	0.44815	ATA		0.478	FAM133A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057452.1	NM_173698	
MAGEA8	4107	hgsc.bcm.edu	37	X	149013286	149013286	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chrX:149013286G>T	ENST00000542674.1	+	3	761	c.240G>T	c.(238-240)tgG>tgT	p.W80C	MAGEA8_ENST00000493910.1_3'UTR|MAGEA8_ENST00000286482.1_Missense_Mutation_p.W80C|MAGEA8_ENST00000535454.1_Missense_Mutation_p.W80C	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	80								p.W80C(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					GCACTCTGTGGAGCCAATCCG	0.602																																					p.W80C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G240T	X						.						66.0	61.0	63.0					X																	149013286		2203	4298	6501	148773944	SO:0001583	missense	4107	exon3				CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.240G>T	X.37:g.149013286G>T	ENSP00000443776:p.Trp80Cys		148773944	NM_001166401	Q9BUN9	Missense_Mutation	SNP	ENST00000542674.1	37	CCDS14692.1	.	.	.	.	.	.	.	.	.	.	.	4.238	0.043048	0.08196	.	.	ENSG00000156009	ENST00000535454;ENST00000542674;ENST00000286482	T;T;T	0.04119	3.7;3.7;3.7	0.805	0.805	0.18703	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.12305	0.0299	L	0.56340	1.77	0.09310	N	0.999999	D	0.71674	0.998	D	0.65443	0.935	T	0.19910	-1.0291	8	0.33141	T	0.24	.	.	.	.	.	80	P43361	MAGA8_HUMAN	C	80	ENSP00000438293:W80C;ENSP00000443776:W80C;ENSP00000286482:W80C	ENSP00000286482:W80C	W	+	3	0	MAGEA8	148773944	0.002000	0.14202	0.025000	0.17156	0.019000	0.09904	-0.021000	0.12504	0.659000	0.30945	0.190000	0.17370	TGG		0.602	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058728.1	NM_005364	
ARHGEF4	50649	hgsc.bcm.edu	37	2	131799462	131799462	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr2:131799462G>T	ENST00000326016.5	+	10	1931	c.1412G>T	c.(1411-1413)aGa>aTa	p.R471I	ARHGEF4_ENST00000409303.1_Missense_Mutation_p.R411I|ARHGEF4_ENST00000392953.3_Missense_Mutation_p.R471I|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000525839.1_Missense_Mutation_p.R471I|ARHGEF4_ENST00000355771.3_Missense_Mutation_p.R400I	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	471					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.R471I(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CGGAAGCGGAGACTTGAGAAC	0.567																																					p.R471I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1412T	2						.						59.0	55.0	56.0					2																	131799462		2203	4300	6503	131515932	SO:0001583	missense	50649	exon10			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.1412G>T	2.37:g.131799462G>T	ENSP00000316845:p.Arg471Ile		131515932	NM_015320	Q9HDC6|Q9UPP0	Missense_Mutation	SNP	ENST00000326016.5	37	CCDS2165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.356972|5.356972	0.95854|0.95854	.|.	.|.	ENSG00000136002|ENSG00000136002	ENST00000532720|ENST00000326016;ENST00000392953;ENST00000525839;ENST00000409303;ENST00000355771	.|T;T;T;T;T	.|0.69040	.|-0.37;-0.37;-0.37;1.49;-0.37	5.47|5.47	5.47|5.47	0.80525|0.80525	.|Dbl homology (DH) domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81346|0.81346	0.4803|0.4803	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.997;0.999;0.998	T|T	0.83107|0.83107	-0.0125|-0.0125	5|10	.|0.87932	.|D	.|0	.|.	16.8115|16.8115	0.85722|0.85722	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|411;471;471	.|E9PEM0;Q9NR80-4;Q9NR80	.|.;.;ARHG4_HUMAN	D|I	87|471;471;471;411;400	.|ENSP00000316845:R471I;ENSP00000376680:R471I;ENSP00000432267:R471I;ENSP00000387285:R411I;ENSP00000348017:R400I	.|ENSP00000316845:R471I	E|R	+|+	3|2	2|0	ARHGEF4|ARHGEF4	131515932|131515932	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.971000|0.971000	0.66376|0.66376	9.192000|9.192000	0.94947|0.94947	2.584000|2.584000	0.87258|0.87258	0.462000|0.462000	0.41574|0.41574	GAG|AGA		0.567	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
PGAP1	80055	hgsc.bcm.edu	37	2	197737199	197737199	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr2:197737199A>C	ENST00000354764.4	-	18	1808	c.1694T>G	c.(1693-1695)tTt>tGt	p.F565C	PGAP1_ENST00000409475.1_Missense_Mutation_p.F565C	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	565					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)	p.F565C(3)		breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						GTACATTTTAAATAATGCCAC	0.323																																					p.F565C												.	.	3	Substitution - Missense(3)	ovary(2)|large_intestine(1)	c.T1694G	2						.						106.0	104.0	104.0					2																	197737199		2203	4300	6503	197445444	SO:0001583	missense	80055	exon18				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.1694T>G	2.37:g.197737199A>C	ENSP00000346809:p.Phe565Cys		197445444	NM_024989	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	ENST00000354764.4	37	CCDS2318.1	.	.	.	.	.	.	.	.	.	.	A	14.38	2.518077	0.44763	.	.	ENSG00000197121	ENST00000422382;ENST00000354764;ENST00000409475	.	.	.	5.06	5.06	0.68205	.	0.078689	0.53938	D	0.000060	T	0.36386	0.0965	N	0.08118	0	0.80722	D	1	B;B	0.32507	0.373;0.187	B;B	0.36418	0.224;0.121	T	0.44329	-0.9335	9	0.87932	D	0	-6.0755	13.1918	0.59715	1.0:0.0:0.0:0.0	.	565;565	Q75T13-3;Q75T13	.;PGAP1_HUMAN	C	345;565;565	.	ENSP00000346809:F565C	F	-	2	0	PGAP1	197445444	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	5.462000	0.66707	2.141000	0.66446	0.477000	0.44152	TTT		0.323	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256103.5	NM_024989	
ABCA12	26154	hgsc.bcm.edu	37	2	215809744	215809744	+	Missense_Mutation	SNP	C	C	T	rs148434996|rs387906284		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr2:215809744C>T	ENST00000272895.7	-	49	7543	c.7324G>A	c.(7324-7326)Gtc>Atc	p.V2442I	ABCA12_ENST00000389661.4_Missense_Mutation_p.V2124I|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2442	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.V2442I(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GTGAGGATGACGGAACATTTG	0.428																																					p.V2442I	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7324A	2						.	C	ILE/VAL,ILE/VAL	3,4403	6.2+/-15.9	0,3,2200	120.0	100.0	107.0		6370,7324	5.5	1.0	2	dbSNP_134	107	0,8600		0,0,4300	no	missense,missense	ABCA12	NM_015657.3,NM_173076.2	29,29	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	probably-damaging,probably-damaging	2124/2278,2442/2596	215809744	3,13003	2203	4300	6503	215517989	SO:0001583	missense	26154	exon49			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7324G>A	2.37:g.215809744C>T	ENSP00000272895:p.Val2442Ile		215517989	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.590830	0.86851	6.81E-4	0.0	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.98567	-5.0;-5.0	5.49	5.49	0.81192	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.64402	D	0.000014	D	0.97185	0.9080	N	0.05510	-0.035	0.80722	D	1	D;D	0.69078	0.986;0.997	D;P	0.63877	0.919;0.873	D	0.99075	1.0835	10	0.72032	D	0.01	.	19.7382	0.96215	0.0:1.0:0.0:0.0	.	2442;2124	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	I	2442;2124	ENSP00000272895:V2442I;ENSP00000374312:V2124I	ENSP00000272895:V2442I	V	-	1	0	ABCA12	215517989	1.000000	0.71417	0.967000	0.41034	0.935000	0.57460	7.720000	0.84759	2.744000	0.94065	0.650000	0.86243	GTC		0.428	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
ABCA12	26154	hgsc.bcm.edu	37	2	215884116	215884116	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr2:215884116G>A	ENST00000272895.7	-	13	1820	c.1601C>T	c.(1600-1602)cCg>cTg	p.P534L	AC072062.3_ENST00000437897.3_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.P216L	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	534					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.P534R(1)|p.P534L(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTCTATGATCGGTATTAACTG	0.358																																					p.P534L	Ovarian(66;664 1488 5121 34295)											.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1601T	2						.						114.0	111.0	112.0					2																	215884116		2202	4300	6502	215592361	SO:0001583	missense	26154	exon13			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.1601C>T	2.37:g.215884116G>A	ENSP00000272895:p.Pro534Leu		215592361	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	g	2.408	-0.336080	0.05278	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.52754	0.65;0.65	5.93	3.2	0.36748	.	0.271882	0.32503	N	0.006012	T	0.26122	0.0637	N	0.24115	0.695	0.23304	N	0.997947	P;B	0.51351	0.944;0.22	B;B	0.31751	0.135;0.022	T	0.10567	-1.0624	10	0.54805	T	0.06	.	9.9297	0.41514	0.2126:0.0:0.7874:0.0	.	534;216	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	L	534;216	ENSP00000272895:P534L;ENSP00000374312:P216L	ENSP00000272895:P534L	P	-	2	0	ABCA12	215592361	0.957000	0.32711	0.026000	0.17262	0.045000	0.14185	1.525000	0.35953	0.423000	0.26033	-0.735000	0.03563	CCG		0.358	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
ACVR2A	92	hgsc.bcm.edu	37	2	148683686	148683687	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	AA	AA	AA	AA	AA	AA	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr2:148683686_148683687delAA	ENST00000241416.7	+	10	1939_1940	c.1303_1304delAA	c.(1303-1305)aaafs	p.K437fs	ACVR2A_ENST00000404590.1_Frame_Shift_Del_p.K437fs|ACVR2A_ENST00000495775.1_3'UTR|ACVR2A_ENST00000535787.1_Frame_Shift_Del_p.K329fs	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	437	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.K437fs*5(3)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TGTTGTGCATAAAAAAAAGAGG	0.366																																					p.435_435del												.	.	3	Deletion - Frameshift(3)	large_intestine(2)|ovary(1)	c.1303_1304del	2						.																																			148400157	SO:0001589	frameshift_variant	92	exon10				CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1303_1304delAA	2.37:g.148683692_148683693delAA	ENSP00000241416:p.Lys437fs		148400156	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Frame_Shift_Del	DEL	ENST00000241416.7	37	CCDS33301.1																																																																																				0.366	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
ASB1	51665	hgsc.bcm.edu	37	2	239342300	239342300	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr2:239342300C>T	ENST00000264607.4	+	2	402	c.155C>T	c.(154-156)aCc>aTc	p.T52I	ASB1_ENST00000409297.1_Missense_Mutation_p.T52I|ASB1_ENST00000469885.1_3'UTR	NM_001040445.1	NP_001035535.1	Q9Y576	ASB1_HUMAN	ankyrin repeat and SOCS box containing 1	52					intracellular signal transduction (GO:0035556)|male genitalia development (GO:0030539)|negative regulation of cytokine biosynthetic process (GO:0042036)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)		p.T52I(1)		breast(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)		GACCTCCAGACCCTCAGGAGC	0.597																																					p.T52I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C155T	2						.						59.0	56.0	57.0					2																	239342300		2203	4300	6503	239007039	SO:0001583	missense	51665	exon2			AF156777	CCDS33416.1	2q37	2013-01-10	2011-01-25		ENSG00000065802	ENSG00000065802		"""Ankyrin repeat domain containing"""	16011	protein-coding gene	gene with protein product		605758	"""ankyrin repeat and SOCS box-containing 1"""				Standard	XR_241235		Approved	ASB-1	uc002vyg.3	Q9Y576	OTTHUMG00000152866	ENST00000264607.4:c.155C>T	2.37:g.239342300C>T	ENSP00000264607:p.Thr52Ile		239007039	NM_001040445	A6NL50|Q4ZG29|Q9ULS4	Missense_Mutation	SNP	ENST00000264607.4	37	CCDS33416.1	.	.	.	.	.	.	.	.	.	.	C	9.653	1.142195	0.21205	.	.	ENSG00000065802	ENST00000264607;ENST00000409297	T;T	0.61627	0.79;0.09	5.27	5.27	0.74061	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.53094	0.1775	N	0.02296	-0.605	0.24160	N	0.995669	D	0.76494	0.999	D	0.70227	0.968	T	0.58194	-0.7679	10	0.32370	T	0.25	-17.5244	18.485	0.90825	0.0:1.0:0.0:0.0	.	52	Q9Y576	ASB1_HUMAN	I	52	ENSP00000264607:T52I;ENSP00000387025:T52I	ENSP00000264607:T52I	T	+	2	0	ASB1	239007039	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.808000	0.75206	2.473000	0.83533	0.561000	0.74099	ACC		0.597	ASB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328294.1	NM_001040445	
NELFB	25920	hgsc.bcm.edu	37	9	140161504	140161504	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr9:140161504T>C	ENST00000343053.4	+	9	1541	c.1204T>C	c.(1204-1206)Tca>Cca	p.S402P		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	402					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AGCCCCAGTCTCATATCCAAA	0.567																																					p.S402P												.	.	0			c.T1204C	9						.						87.0	68.0	75.0					9																	140161504		2203	4300	6503	139281325	SO:0001583	missense	25920	exon9			AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.1204T>C	9.37:g.140161504T>C	ENSP00000339495:p.Ser402Pro		139281325	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	T	10.13	1.265050	0.23136	.	.	ENSG00000188986	ENST00000343053	.	.	.	5.45	-9.55	0.00569	.	1.186920	0.05707	N	0.595204	T	0.10121	0.0248	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19844	-1.0293	9	0.35671	T	0.21	-4.6966	2.812	0.05444	0.2715:0.1446:0.399:0.1849	.	402	Q8WX92	NELFB_HUMAN	P	402	.	ENSP00000339495:S402P	S	+	1	0	COBRA1	139281325	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.572000	0.05881	-1.719000	0.01382	-0.698000	0.03680	TCA		0.567	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
TRPM3	80036	hgsc.bcm.edu	37	9	73477878	73477878	+	Silent	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr9:73477878C>T	ENST00000377111.2	-	3	651	c.408G>A	c.(406-408)acG>acA	p.T136T	TRPM3_ENST00000377101.1_5'UTR|TRPM3_ENST00000377110.3_Silent_p.T136T|TRPM3_ENST00000437699.3_5'UTR|TRPM3_ENST00000357533.2_Silent_p.T138T|TRPM3_ENST00000358082.3_5'Flank|TRPM3_ENST00000396285.1_5'Flank|TRPM3_ENST00000396280.5_5'Flank|TRPM3_ENST00000423814.3_Silent_p.T138T|TRPM3_ENST00000360823.2_5'UTR|TRPM3_ENST00000396292.4_5'Flank|TRPM3_ENST00000361823.5_5'UTR|TRPM3_ENST00000377097.3_5'UTR|TRPM3_ENST00000377106.1_5'UTR|TRPM3_ENST00000396283.1_5'UTR|TRPM3_ENST00000408909.2_5'Flank|TRPM3_ENST00000377105.1_5'UTR	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	136					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)	p.T138T(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CAAAAGCATCCGTAGGGCTGA	0.468																																					p.T136T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G408A	9						.						195.0	193.0	194.0					9																	73477878		2203	4300	6503	72667698	SO:0001819	synonymous_variant	80036	exon3			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.408G>A	9.37:g.73477878C>T			72667698	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	37		.	.	.	.	.	.	.	.	.	.	C	7.852	0.724175	0.15439	.	.	ENSG00000083067	ENST00000377097	.	.	.	5.95	-11.9	0.00025	.	.	.	.	.	T	0.33673	0.0871	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47873	-0.9083	4	.	.	.	-9.9904	3.8052	0.08774	0.254:0.4589:0.132:0.1551	.	.	.	.	Q	26	.	.	R	-	2	0	TRPM3	72667698	0.000000	0.05858	0.020000	0.16555	0.951000	0.60555	-4.325000	0.00252	-3.322000	0.00187	-1.145000	0.01858	CGG		0.468	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
RORB	6096	hgsc.bcm.edu	37	9	77300486	77300486	+	Silent	SNP	G	G	A	rs556182039		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr9:77300486G>A	ENST00000396204.2	+	10	1365	c.1365G>A	c.(1363-1365)ccG>ccA	p.P455P	RORB_ENST00000376896.3_Silent_p.P444P			Q92753	RORB_HUMAN	RAR-related orphan receptor B	455	Ligand-binding. {ECO:0000255}.				amacrine cell differentiation (GO:0035881)|cellular response to retinoic acid (GO:0071300)|eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.P444P(1)		breast(2)|large_intestine(4)|lung(1)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	12					Melatonin(DB01065)	TGTTTCCTCCGTTATACAAGG	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		17087	0.0		0.0	False		,,,				2504	0.001				p.P444P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1332A	9						.						158.0	144.0	149.0					9																	77300486		2203	4300	6503	76490306	SO:0001819	synonymous_variant	6096	exon10			Y08639	CCDS6646.1	9q22	2013-01-16			ENSG00000198963	ENSG00000198963		"""Nuclear hormone receptors"""	10259	protein-coding gene	gene with protein product		601972				7926749	Standard	NM_006914		Approved	RZRB, NR1F2, ROR-BETA	uc004ajh.3	Q92753	OTTHUMG00000020026	ENST00000396204.2:c.1365G>A	9.37:g.77300486G>A			76490306	NM_006914	Q8WX73	Silent	SNP	ENST00000396204.2	37																																																																																					0.458	RORB-201	KNOWN	basic	protein_coding	protein_coding			
NELFB	25920	hgsc.bcm.edu	37	9	140161508	140161508	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr9:140161508A>T	ENST00000343053.4	+	9	1545	c.1208A>T	c.(1207-1209)tAt>tTt	p.Y403F		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	403					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.Y403F(1)									CCAGTCTCATATCCAAACACA	0.567																																					p.Y403F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1208T	9						.						85.0	68.0	74.0					9																	140161508		2203	4300	6503	139281329	SO:0001583	missense	25920	exon9			AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.1208A>T	9.37:g.140161508A>T	ENSP00000339495:p.Tyr403Phe		139281329	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	A	9.101	1.004059	0.19199	.	.	ENSG00000188986	ENST00000343053	.	.	.	5.45	5.45	0.79879	.	0.054223	0.85682	N	0.000000	T	0.51770	0.1694	L	0.57536	1.79	0.58432	D	0.999995	B	0.32010	0.351	B	0.28465	0.09	T	0.49532	-0.8930	9	0.21540	T	0.41	-24.9788	14.3751	0.66867	1.0:0.0:0.0:0.0	.	403	Q8WX92	NELFB_HUMAN	F	403	.	ENSP00000339495:Y403F	Y	+	2	0	COBRA1	139281329	1.000000	0.71417	0.621000	0.29145	0.012000	0.07955	7.260000	0.78391	2.075000	0.62263	0.472000	0.43445	TAT		0.567	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
FGF14	2259	hgsc.bcm.edu	37	13	102375254	102375254	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr13:102375254G>A	ENST00000376143.4	-	5	670	c.671C>T	c.(670-672)aCg>aTg	p.T224M	FGF14_ENST00000376131.4_Missense_Mutation_p.T229M|ITGBL1_ENST00000415285.1_3'UTR	NM_004115.3	NP_004106.1	Q92915	FGF14_HUMAN	fibroblast growth factor 14	224					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|JNK cascade (GO:0007254)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)	p.T224M(1)|p.T229M(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)	29	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTTACTTGGCGTCACCCCAGG	0.473																																					p.T229M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C686T	13						.						267.0	201.0	224.0					13																	102375254		2203	4300	6503	101173255	SO:0001583	missense	2259	exon5				CCDS9500.1, CCDS9501.1	13q34	2008-02-05			ENSG00000102466	ENSG00000102466			3671	protein-coding gene	gene with protein product		601515				8790420, 17236779	Standard	NM_175929		Approved	FHF4, SCA27	uc001vpf.2	Q92915	OTTHUMG00000017303	ENST00000376143.4:c.671C>T	13.37:g.102375254G>A	ENSP00000365313:p.Thr224Met		101173255	NM_175929	Q86YN7|Q96QX6	Missense_Mutation	SNP	ENST00000376143.4	37	CCDS9501.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925108	0.73213	.	.	ENSG00000102466	ENST00000376131;ENST00000376143	T;T	0.79454	-1.27;-1.19	5.65	5.65	0.86999	.	0.181513	0.52532	D	0.000065	T	0.82268	0.5000	L	0.32530	0.975	0.54753	D	0.999989	D;D	0.76494	0.999;0.982	P;P	0.61397	0.888;0.684	D	0.83575	0.0114	10	0.66056	D	0.02	.	19.7432	0.96238	0.0:0.0:1.0:0.0	.	229;224	Q92915-2;Q92915	.;FGF14_HUMAN	M	229;224	ENSP00000365301:T229M;ENSP00000365313:T224M	ENSP00000365301:T229M	T	-	2	0	FGF14	101173255	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.663000	0.90544	0.563000	0.77884	ACG		0.473	FGF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045679.2		
MYO16	23026	hgsc.bcm.edu	37	13	109379845	109379845	+	Missense_Mutation	SNP	G	G	A	rs199688942		TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr13:109379845G>A	ENST00000357550.2	+	3	396	c.355G>A	c.(355-357)Gtc>Atc	p.V119I	MYO16_ENST00000251041.5_Missense_Mutation_p.V119I|MYO16_ENST00000356711.2_Missense_Mutation_p.V119I	NM_001198950.1	NP_001185879.1			myosin XVI									p.V119I(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			AGGAGTCAACGTCAACCACCA	0.403																																					p.V141I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G421A	13						.						205.0	183.0	190.0					13																	109379845		2203	4300	6503	108177846	SO:0001583	missense	23026	exon4				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.355G>A	13.37:g.109379845G>A	ENSP00000350160:p.Val119Ile		108177846	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.419049	0.62622	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041	T;T;T	0.54279	0.58;0.58;0.58	4.59	4.59	0.56863	Ankyrin repeat-containing domain (4);	0.000000	0.32901	U	0.005511	T	0.54367	0.1854	N	0.20807	0.61	0.80722	D	1	D;D	0.76494	0.997;0.999	P;P	0.60886	0.695;0.88	T	0.53662	-0.8407	9	.	.	.	.	16.7617	0.85514	0.0:0.0:1.0:0.0	.	119;119	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	I	119	ENSP00000349145:V119I;ENSP00000350160:V119I;ENSP00000251041:V119I	.	V	+	1	0	MYO16	108177846	1.000000	0.71417	0.925000	0.36789	0.512000	0.34134	5.506000	0.66993	2.262000	0.75019	0.462000	0.41574	GTC		0.403	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
IDI2	91734	hgsc.bcm.edu	37	10	1065458	1065458	+	Silent	SNP	C	C	T	rs17851563	byFrequency	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr10:1065458C>T	ENST00000277517.1	-	5	747	c.683G>A	c.(682-684)tGa>tAa	p.*228*	GTPBP4_ENST00000360803.4_3'UTR	NM_033261.2	NP_150286.1	Q9BXS1	IDI2_HUMAN	isopentenyl-diphosphate delta isomerase 2	0					cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isopentenyl diphosphate metabolic process (GO:0046490)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|metal ion binding (GO:0046872)	p.*228*(1)		kidney(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.143)	Epithelial(11;0.067)|OV - Ovarian serous cystadenocarcinoma(14;0.169)|all cancers(11;0.192)		CCCTGCCTCTCACACTCTGTG	0.542													C|||	55	0.0109824	0.0015	0.0159	5008	,	,		19684	0.0		0.0408	False		,,,				2504	0.001				p.X228X												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G683A	10						.	C		29,4377	36.0+/-67.5	0,29,2174	39.0	39.0	39.0		683	-0.8	0.0	10	dbSNP_123	39	310,8290	109.0+/-169.6	5,300,3995	no	coding-synonymous	IDI2	NM_033261.2		5,329,6169	TT,TC,CC		3.6047,0.6582,2.6065		228/228	1065458	339,12667	2203	4300	6503	1055458	SO:0001819	synonymous_variant	91734	exon5			AF271725	CCDS7055.1	10p15.3	2003-11-19			ENSG00000148377	ENSG00000148377			23487	protein-coding gene	gene with protein product		615389				12477932	Standard	NM_033261		Approved	IPPI2	uc001ifv.1	Q9BXS1	OTTHUMG00000017537	ENST00000277517.1:c.683G>A	10.37:g.1065458C>T			1055458	NM_033261		Silent	SNP	ENST00000277517.1	37	CCDS7055.1																																																																																				0.542	IDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046411.1	NM_033261	
NOLC1	9221	hgsc.bcm.edu	37	10	103921665	103921665	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr10:103921665A>T	ENST00000605788.1	+	12	2159	c.1924A>T	c.(1924-1926)Aac>Tac	p.N642Y	NOLC1_ENST00000603742.1_Missense_Mutation_p.N361Y|NOLC1_ENST00000405356.1_Missense_Mutation_p.N652Y|NOLC1_ENST00000488254.2_Missense_Mutation_p.N643Y|NOLC1_ENST00000477977.1_3'UTR	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	642					cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		AGTTGCGGACAACTCCTTTGA	0.488																																					p.N642Y												.	.	0			c.A1924T	10						.						70.0	69.0	69.0					10																	103921665		2203	4300	6503	103911655	SO:0001583	missense	9221	exon12			Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.1924A>T	10.37:g.103921665A>T	ENSP00000474710:p.Asn642Tyr		103911655	NM_004741	Q15030|Q5VV70|Q9BUV3	Missense_Mutation	SNP	ENST00000605788.1	37	CCDS7530.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.614716	0.87359	.	.	ENSG00000166197	ENST00000405356;ENST00000370007	T	0.63744	-0.06	5.84	5.84	0.93424	SRP40, C-terminal (1);	0.080350	0.52532	D	0.000068	D	0.85062	0.5611	H	0.95151	3.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.89403	0.3697	10	0.87932	D	0	-27.9538	14.7877	0.69816	1.0:0.0:0.0:0.0	.	643;652;642	Q14978-3;Q14978-2;Q14978	.;.;NOLC1_HUMAN	Y	652;642	ENSP00000385410:N652Y	ENSP00000359024:N642Y	N	+	1	0	NOLC1	103911655	1.000000	0.71417	0.997000	0.53966	0.952000	0.60782	8.719000	0.91436	2.234000	0.73211	0.460000	0.39030	AAC		0.488	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050012.2	NM_004741	
ANK3	288	hgsc.bcm.edu	37	10	61834258	61834258	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr10:61834258G>C	ENST00000280772.2	-	37	6572	c.6381C>G	c.(6379-6381)gaC>gaG	p.D2127E	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2127					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.D2127E(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CAAAGCCACTGTCAGACAAGG	0.418																																					p.D2127E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6381G	10						.						102.0	96.0	98.0					10																	61834258		2203	4300	6503	61504264	SO:0001583	missense	288	exon37			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.6381C>G	10.37:g.61834258G>C	ENSP00000280772:p.Asp2127Glu		61504264	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511896	0.44660	.	.	ENSG00000151150	ENST00000280772	T	0.57907	0.37	5.8	4.89	0.63831	.	0.000000	0.44688	D	0.000436	T	0.63965	0.2556	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	P	0.61070	0.883	T	0.63435	-0.6638	10	0.48119	T	0.1	.	11.4452	0.50118	0.1385:0.0:0.8615:0.0	.	2127	Q12955	ANK3_HUMAN	E	2127	ENSP00000280772:D2127E	ENSP00000280772:D2127E	D	-	3	2	ANK3	61504264	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.445000	0.44899	2.755000	0.94549	0.655000	0.94253	GAC		0.418	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
EGR2	1959	hgsc.bcm.edu	37	10	64573892	64573892	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr10:64573892G>A	ENST00000242480.3	-	2	831	c.506C>T	c.(505-507)cCg>cTg	p.P169L	EGR2_ENST00000411732.1_Missense_Mutation_p.P119L|EGR2_ENST00000493899.2_5'Flank|EGR2_ENST00000439032.1_Missense_Mutation_p.P169L	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	169					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.P169L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					AGGAGGAGGCGGTGGCGGAGA	0.632																																					p.P169L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C506T	10						.						87.0	89.0	88.0					10																	64573892		2203	4300	6503	64243898	SO:0001583	missense	1959	exon2			BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.506C>T	10.37:g.64573892G>A	ENSP00000242480:p.Pro169Leu		64243898	NM_000399	B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Missense_Mutation	SNP	ENST00000242480.3	37	CCDS7267.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861687	0.71949	.	.	ENSG00000122877	ENST00000242480;ENST00000439032;ENST00000411732;ENST00000432380	T;T;T	0.14266	2.52;2.52;2.59	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.32041	0.0816	L	0.48362	1.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.01262	-1.1402	10	0.87932	D	0	-9.1074	16.5631	0.84572	0.0:0.0:1.0:0.0	.	119;169	P11161-2;P11161	.;EGR2_HUMAN	L	169;169;119;182	ENSP00000242480:P169L;ENSP00000402040:P169L;ENSP00000387634:P119L	ENSP00000242480:P169L	P	-	2	0	EGR2	64243898	1.000000	0.71417	0.898000	0.35279	0.962000	0.63368	6.553000	0.73918	2.656000	0.90262	0.650000	0.86243	CCG		0.632	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2	NM_000399	
PLEKHS1	79949	hgsc.bcm.edu	37	10	115528608	115528608	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr10:115528608T>A	ENST00000369310.3	+	5	938	c.376T>A	c.(376-378)Tca>Aca	p.S126T	PLEKHS1_ENST00000369312.4_Missense_Mutation_p.S44T|PLEKHS1_ENST00000361048.1_Missense_Mutation_p.S132T|PLEKHS1_ENST00000369309.1_5'Flank	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	126	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.							p.S44T(1)|p.S132T(1)									CTTCATGTCATCATTTCGCCA	0.418																																					p.S44T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T130A	10						.						136.0	126.0	129.0					10																	115528608		2203	4300	6503	115518598	SO:0001583	missense	79949	exon4			AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.376T>A	10.37:g.115528608T>A	ENSP00000358316:p.Ser126Thr		115518598	NM_001193435	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Missense_Mutation	SNP	ENST00000369310.3	37	CCDS53580.1	.	.	.	.	.	.	.	.	.	.	T	14.82	2.648293	0.47258	.	.	ENSG00000148735	ENST00000361048;ENST00000369312;ENST00000369310	T;T;T	0.32272	1.46;1.46;1.46	5.61	0.0861	0.14444	.	0.586195	0.17650	N	0.166725	T	0.28995	0.0720	L	0.42245	1.32	0.22354	N	0.999171	D;D;D	0.60575	0.988;0.986;0.976	P;P;P	0.57911	0.829;0.797;0.652	T	0.17899	-1.0354	10	0.14656	T	0.56	-37.9195	1.6592	0.02787	0.2856:0.0823:0.1479:0.4842	.	126;126;132	Q5SXH7-5;Q5SXH7-2;Q5SXH7-4	.;.;.	T	132;44;126	ENSP00000354332:S132T;ENSP00000358318:S44T;ENSP00000358316:S126T	ENSP00000354332:S132T	S	+	1	0	C10orf81	115518598	0.984000	0.35163	0.695000	0.30226	0.405000	0.30901	0.785000	0.26830	0.109000	0.17891	0.533000	0.62120	TCA		0.418	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889	
APC	324	hgsc.bcm.edu	37	5	112174973	112174973	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr5:112174973C>T	ENST00000457016.1	+	16	4062	c.3682C>T	c.(3682-3684)Cag>Tag	p.Q1228*	APC_ENST00000508376.2_Nonsense_Mutation_p.Q1228*|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1228*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1228	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1228*(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGCCAAGAGGCAGAATCAGCT	0.418		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1210X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	3	Substitution - Nonsense(1)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(1)|soft_tissue(1)|skin(1)	c.C3628T	5	GRCh37	CM970089	APC	M		.						64.0	61.0	62.0					5																	112174973		2202	4300	6502	112202872	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3682C>T	5.37:g.112174973C>T	ENSP00000413133:p.Gln1228*		112202872	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	39	7.589706	0.98378	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.91	5.91	0.95273	.	0.189531	0.48767	D	0.000162	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.6457	20.2983	0.98569	0.0:1.0:0.0:0.0	.	.	.	.	X	1228	.	.	Q	+	1	0	APC	112202872	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.063000	0.76714	2.802000	0.96397	0.655000	0.94253	CAG		0.418	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SLC45A2	51151	hgsc.bcm.edu	37	5	33944813	33944813	+	Silent	SNP	C	C	T	rs373174326	byFrequency	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr5:33944813C>T	ENST00000296589.4	-	7	1679	c.1533G>A	c.(1531-1533)gcG>gcA	p.A511A	SLC45A2_ENST00000342059.3_Silent_p.A452A	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	511					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.A511A(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						CCACCGCAGACGCTGTGATCA	0.537													C|||	2	0.000399361	0.0	0.0	5008	,	,		20038	0.0		0.0	False		,,,				2504	0.002				p.A511A	Ovarian(31;380 859 8490 22203 49048)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1533A	5						.						84.0	70.0	74.0					5																	33944813		2203	4300	6503	33980570	SO:0001819	synonymous_variant	51151	exon7			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.1533G>A	5.37:g.33944813C>T			33980570	NM_016180	Q6P2P0|Q9BTM3	Silent	SNP	ENST00000296589.4	37	CCDS3901.1																																																																																				0.537	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207443.2	NM_016180	
KDM3B	51780	hgsc.bcm.edu	37	5	137708447	137708447	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr5:137708447G>A	ENST00000314358.5	+	2	477	c.277G>A	c.(277-279)Gaa>Aaa	p.E93K		NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	93					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.E93K(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GCTTCTGCTGGAAGGGTCTCT	0.498																																					p.E93K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G277A	5						.						97.0	92.0	93.0					5																	137708447		2203	4300	6503	137736346	SO:0001583	missense	51780	exon2			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.277G>A	5.37:g.137708447G>A	ENSP00000326563:p.Glu93Lys		137736346	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	G	32	5.178359	0.94846	.	.	ENSG00000120733	ENST00000314358	D	0.83914	-1.78	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.90672	0.7074	M	0.75615	2.305	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	D	0.91691	0.5366	10	0.87932	D	0	-4.3034	18.3858	0.90466	0.0:0.0:1.0:0.0	.	93	Q7LBC6	KDM3B_HUMAN	K	93	ENSP00000326563:E93K	ENSP00000326563:E93K	E	+	1	0	KDM3B	137736346	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.908000	0.75730	2.582000	0.87167	0.563000	0.77884	GAA		0.498	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
ECHS1	1892	hgsc.bcm.edu	37	10	135178161	135178161	+	Splice_Site	SNP	C	C	G			TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3527-01A-01W-0831-10	TCGA-AA-3527-10A-01W-0831-10	g.chr10:135178161C>G	ENST00000368547.3	-	7	1163		c.e7+1			NM_004092.3	NP_004083.3	P30084	ECHM_HUMAN	enoyl CoA hydratase, short chain, 1, mitochondrial						cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enoyl-CoA hydratase activity (GO:0004300)	p.?(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)	10		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;1.62e-06)|OV - Ovarian serous cystadenocarcinoma(35;5.75e-06)|Epithelial(32;7.58e-06)		TGTTTACTCACAGTGGCAAAG	0.358																																					.	GBM(132;1720 1771 5373 10277 21402)											.	.	1	Unknown(1)	large_intestine(1)	.	10						.						117.0	108.0	111.0					10																	135178161		2201	4300	6501	135028151	SO:0001630	splice_region_variant	1892	.				CCDS7681.1	10q26.2-q26.3	2010-05-04	2010-04-30		ENSG00000127884	ENSG00000127884	4.2.1.17		3151	protein-coding gene	gene with protein product		602292	"""enoyl Coenzyme A hydratase, short chain, 1, mitochondrial"""			8012501	Standard	NM_004092		Approved	SCEH	uc001lmu.3	P30084	OTTHUMG00000019320	ENST00000368547.3:c.807+1G>C	10.37:g.135178161C>G			135028151	.	O00739|Q5VWY1|Q96H54	Splice_Site	SNP	ENST00000368547.3	37	CCDS7681.1	.	.	.	.	.	.	.	.	.	.	c	11.88	1.771857	0.31320	.	.	ENSG00000127884	ENST00000368547	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9698	0.71223	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ECHS1	135028151	1.000000	0.71417	0.954000	0.39281	0.049000	0.14656	6.272000	0.72575	2.599000	0.87857	0.550000	0.68814	.		0.358	ECHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051156.1		Intron
