#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
WBSCR17	64409	hgsc.bcm.edu	37	7	71175846	71175846	+	Missense_Mutation	SNP	G	G	A	rs373377222		TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr7:71175846G>A	ENST00000333538.5	+	10	2235	c.1601G>A	c.(1600-1602)cGg>cAg	p.R534Q	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	534	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R534Q(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TCCAAGAGTCGGCTGCCCCAG	0.612																																					p.R534Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1601A	7						.	G	GLN/ARG	0,4406		0,0,2203	61.0	57.0	58.0		1601	5.3	1.0	7		58	1,8599	1.2+/-3.3	0,1,4299	no	missense	WBSCR17	NM_022479.1	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	534/599	71175846	1,13005	2203	4300	6503	70813782	SO:0001583	missense	64409	exon10			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1601G>A	7.37:g.71175846G>A	ENSP00000329654:p.Arg534Gln		70813782	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425647	0.62733	0.0	1.16E-4	ENSG00000185274	ENST00000333538	T	0.29917	1.55	5.28	5.28	0.74379	Ricin B-related lectin (1);Ricin B lectin (3);	0.098275	0.64402	D	0.000001	T	0.29321	0.0730	L	0.48362	1.52	0.35805	D	0.823443	P	0.35192	0.489	B	0.39217	0.294	T	0.27157	-1.0082	10	0.29301	T	0.29	.	11.1188	0.48277	0.0839:0.0:0.9161:0.0	.	534	Q6IS24	GLTL3_HUMAN	Q	534	ENSP00000329654:R534Q	ENSP00000329654:R534Q	R	+	2	0	WBSCR17	70813782	0.999000	0.42202	0.962000	0.40283	0.803000	0.45373	4.833000	0.62766	2.746000	0.94184	0.655000	0.94253	CGG		0.612	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
LMTK2	22853	hgsc.bcm.edu	37	7	97822459	97822459	+	Silent	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr7:97822459G>A	ENST00000297293.5	+	11	2975	c.2682G>A	c.(2680-2682)ctG>ctA	p.L894L		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	894					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)	p.L894L(2)		NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					AGGAGACCCTGCGACTCACCG	0.542																																					p.L894L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2682A	7						.						50.0	48.0	48.0					7																	97822459		2203	4300	6503	97660395	SO:0001819	synonymous_variant	22853	exon11			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.2682G>A	7.37:g.97822459G>A			97660395	NM_014916	A4D272|Q75MG7|Q9UPS3	Silent	SNP	ENST00000297293.5	37	CCDS5654.1																																																																																				0.542	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
KEL	3792	hgsc.bcm.edu	37	7	142639969	142639969	+	Missense_Mutation	SNP	G	G	A	rs147851584		TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr7:142639969G>A	ENST00000355265.2	-	17	2408	c.1934C>T	c.(1933-1935)gCg>gTg	p.A645V		NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	645					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.A645V(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					TACCTGCAGCGCGATGGCTAG	0.488																																					p.A645V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1934T	7						.	G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	100.0	91.0	94.0		1934	4.6	0.4	7	dbSNP_134	94	0,8600		0,0,4300	no	missense	KEL	NM_000420.2	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	645/733	142639969	1,13005	2203	4300	6503	142350091	SO:0001583	missense	3792	exon17			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1934C>T	7.37:g.142639969G>A	ENSP00000347409:p.Ala645Val		142350091	NM_000420	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872296	0.51695	2.27E-4	0.0	ENSG00000197993	ENST00000355265	D	0.92299	-3.01	4.61	4.61	0.57282	Peptidase M13, neprilysin, C-terminal (2);	0.000000	0.51477	D	0.000083	D	0.96516	0.8863	M	0.91354	3.2	0.46521	D	0.999085	D	0.89917	1.0	D	0.87578	0.998	D	0.96998	0.9727	10	0.87932	D	0	-29.0515	12.8208	0.57692	0.0:0.0:1.0:0.0	.	645	P23276	KELL_HUMAN	V	645	ENSP00000347409:A645V	ENSP00000347409:A645V	A	-	2	0	KEL	142350091	0.941000	0.31946	0.426000	0.26672	0.055000	0.15305	4.864000	0.62990	2.382000	0.81193	0.655000	0.94253	GCG		0.488	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
AKAP6	9472	hgsc.bcm.edu	37	14	33291745	33291745	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr14:33291745G>T	ENST00000280979.4	+	13	4896	c.4726G>T	c.(4726-4728)Gat>Tat	p.D1576Y	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1576	Ser-rich.				action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.D1576Y(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TCCAGGGGGTGATTTATTTGG	0.408																																					p.D1576Y	Melanoma(49;821 1200 7288 13647 42351)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4726T	14						.						91.0	96.0	94.0					14																	33291745		2203	4299	6502	32361496	SO:0001583	missense	9472	exon13			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.4726G>T	14.37:g.33291745G>T	ENSP00000280979:p.Asp1576Tyr		32361496	NM_004274	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.841381	0.51057	.	.	ENSG00000151320	ENST00000280979	T	0.08634	3.07	5.79	3.91	0.45181	.	0.181563	0.49305	D	0.000156	T	0.19805	0.0476	M	0.62723	1.935	0.80722	D	1	D	0.64830	0.994	P	0.60173	0.87	T	0.00482	-1.1713	10	0.87932	D	0	-11.7891	9.4721	0.38849	0.075:0.1443:0.7808:0.0	.	1576	Q13023	AKAP6_HUMAN	Y	1576	ENSP00000280979:D1576Y	ENSP00000280979:D1576Y	D	+	1	0	AKAP6	32361496	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.570000	0.67398	1.411000	0.46957	0.650000	0.86243	GAT		0.408	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
GNB1L	54584	hgsc.bcm.edu	37	22	19776328	19776328	+	Silent	SNP	G	G	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr22:19776328G>T	ENST00000329517.6	-	8	1124	c.888C>A	c.(886-888)gcC>gcA	p.A296A	GNB1L_ENST00000405009.1_Intron|GNB1L_ENST00000460402.1_5'UTR|GNB1L_ENST00000403325.1_Silent_p.A296A	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like	296			A -> T (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)		p.A296A(1)		breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					ACTGGACAGCGGCGCTGTGGA	0.667																																					p.A296A												GNB1L,breast,NS,Substitution - Missense,-2	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C888A	22						.						31.0	30.0	30.0					22																	19776328		2198	4295	6493	18156328	SO:0001819	synonymous_variant	54584	exon8			AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.888C>A	22.37:g.19776328G>T			18156328	NM_053004	Q9H2S2|Q9H4M4	Silent	SNP	ENST00000329517.6	37	CCDS13768.1																																																																																				0.667	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075202.1		
EFCAB6	64800	hgsc.bcm.edu	37	22	44028057	44028057	+	Silent	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr22:44028057G>A	ENST00000262726.7	-	19	2413	c.2160C>T	c.(2158-2160)taC>taT	p.Y720Y	EFCAB6_ENST00000396231.2_Silent_p.Y568Y	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	720					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.Y720Y(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				GGCTGTTCACGTAACTTTTTG	0.527																																					p.Y568Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1704T	22						.						109.0	113.0	112.0					22																	44028057		2203	4300	6503	42359390	SO:0001819	synonymous_variant	64800	exon17			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.2160C>T	22.37:g.44028057G>A			42359390	NM_198856	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Silent	SNP	ENST00000262726.7	37	CCDS14049.1																																																																																				0.527	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
VAV1	7409	hgsc.bcm.edu	37	19	6848082	6848082	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr19:6848082C>T	ENST00000602142.1	+	23	2168	c.2086C>T	c.(2086-2088)Cgg>Tgg	p.R696W	VAV1_ENST00000304076.2_Missense_Mutation_p.R674W|VAV1_ENST00000599806.1_Missense_Mutation_p.R641W|VAV1_ENST00000596764.1_Missense_Mutation_p.R664W|VAV1_ENST00000539284.1_Missense_Mutation_p.R599W	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	696	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R696W(1)		biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						TTTCTTGGTGCGGCAGAGGGT	0.602																																					p.R696W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2086T	19						.						130.0	128.0	128.0					19																	6848082		2203	4300	6503	6799082	SO:0001583	missense	7409	exon23				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.2086C>T	19.37:g.6848082C>T	ENSP00000472929:p.Arg696Trp		6799082	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	C	18.37	3.609279	0.66558	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	D	0.99292	-5.7	3.68	3.68	0.42216	SH2 motif (5);	0.000000	0.64402	D	0.000003	D	0.99635	0.9866	H	0.99368	4.535	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97794	1.0240	10	0.87932	D	0	.	8.3952	0.32553	0.2337:0.7663:0.0:0.0	.	599;696;641;696	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	W	696;599	ENSP00000443242:R599W	ENSP00000302269:R696W	R	+	1	2	VAV1	6799082	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	1.955000	0.40372	1.890000	0.54733	0.313000	0.20887	CGG		0.602	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
ADAM7	8756	hgsc.bcm.edu	37	8	24365008	24365008	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr8:24365008G>T	ENST00000175238.6	+	21	2307	c.2224G>T	c.(2224-2226)Gat>Tat	p.D742Y	RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000380789.1_Missense_Mutation_p.D764Y|ADAM7_ENST00000520720.1_Intron|RP11-561E1.1_ENST00000519364.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	742						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D742Y(1)		NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TGCAAGTAAAGATTCAAGAGG	0.398																																					p.D742Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2224T	8						.						95.0	103.0	101.0					8																	24365008		2203	4300	6503	24420898	SO:0001583	missense	8756	exon21			AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.2224G>T	8.37:g.24365008G>T	ENSP00000175238:p.Asp742Tyr		24420898	NM_003817	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	ENST00000175238.6	37	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.991161	0.54041	.	.	ENSG00000069206	ENST00000175238;ENST00000380789	T;T	0.31510	1.55;1.49	4.08	4.08	0.47627	.	0.263793	0.27109	N	0.020899	T	0.43456	0.1248	L	0.47716	1.5	0.80722	D	1	D	0.71674	0.998	D	0.62955	0.909	T	0.23691	-1.0181	10	0.52906	T	0.07	.	12.0978	0.53765	0.0:0.0:1.0:0.0	.	742	Q9H2U9	ADAM7_HUMAN	Y	742;764	ENSP00000175238:D742Y;ENSP00000370166:D764Y	ENSP00000175238:D742Y	D	+	1	0	ADAM7	24420898	1.000000	0.71417	0.380000	0.26093	0.830000	0.47004	3.744000	0.55112	2.559000	0.86315	0.455000	0.32223	GAT		0.398	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	
STAR	6770	hgsc.bcm.edu	37	8	38003900	38003900	+	Silent	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr8:38003900G>A	ENST00000276449.4	-	4	818	c.372C>T	c.(370-372)gtC>gtT	p.V124V	RP11-90P5.2_ENST00000520598.1_RNA	NM_000349.2	NP_000340.2	P49675	STAR_HUMAN	steroidogenic acute regulatory protein	124	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid biosynthetic process (GO:0006699)|biphenyl metabolic process (GO:0018879)|brain development (GO:0007420)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth hormone stimulus (GO:0071378)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-alpha (GO:0035457)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to luteinizing hormone stimulus (GO:0071373)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cholesterol metabolic process (GO:0008203)|circadian sleep/wake cycle, REM sleep (GO:0042747)|dibenzo-p-dioxin metabolic process (GO:0018894)|diterpenoid metabolic process (GO:0016101)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|glucocorticoid metabolic process (GO:0008211)|insecticide metabolic process (GO:0017143)|intracellular cholesterol transport (GO:0032367)|male gonad development (GO:0008584)|negative regulation of neuron apoptotic process (GO:0043524)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of gene expression (GO:0010628)|positive regulation of neurogenesis (GO:0050769)|progesterone biosynthetic process (GO:0006701)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of steroid biosynthetic process (GO:0050810)|response to activity (GO:0014823)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to hydrogen peroxide (GO:0042542)|response to ionizing radiation (GO:0010212)|response to lead ion (GO:0010288)|response to leptin (GO:0044321)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytosol (GO:0005829)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	cholesterol binding (GO:0015485)	p.V124V(1)		breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)		READ - Rectum adenocarcinoma(644;0.188)		GGTCCACCACGACCTCCAGCC	0.557																																					p.V124V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C372T	8						.						88.0	82.0	84.0					8																	38003900		2203	4300	6503	38123057	SO:0001819	synonymous_variant	6770	exon4			BC010550	CCDS6102.1	8p11.2	2011-09-13	2007-05-15		ENSG00000147465	ENSG00000147465		"""StAR-related lipid transfer (START) domain containing"""	11359	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 1"""	600617	"""steroidogenic acute regulator"""			7761400	Standard	NM_000349		Approved	StAR, STARD1	uc003xkv.1	P49675	OTTHUMG00000164058	ENST00000276449.4:c.372C>T	8.37:g.38003900G>A			38123057	NM_000349	Q16396	Silent	SNP	ENST00000276449.4	37	CCDS6102.1	.	.	.	.	.	.	.	.	.	.	G	6.444	0.450015	0.12223	.	.	ENSG00000147465	ENST00000522050	.	.	.	5.72	3.01	0.34805	.	.	.	.	.	T	0.53981	0.1830	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44097	-0.9350	4	.	.	.	-33.2678	5.6585	0.17656	0.2567:0.5504:0.1275:0.0653	.	.	.	.	L	103	.	.	S	-	2	0	STAR	38123057	0.985000	0.35326	0.995000	0.50966	0.809000	0.45718	0.373000	0.20484	0.368000	0.24481	-1.911000	0.00521	TCG		0.557	STAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376990.2	NM_000349	
EIF3E	3646	hgsc.bcm.edu	37	8	109228666	109228666	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr8:109228666T>A	ENST00000220849.5	-	9	988	c.926A>T	c.(925-927)cAg>cTg	p.Q309L	EIF3E_ENST00000519517.1_5'UTR|EIF3E_ENST00000519030.1_Missense_Mutation_p.Q216L	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E									p.Q309L(1)	EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			CAGCTTTTTCTGAGCCCCATC	0.299																																					p.Q309L	GBM(15;360 410 8460 34179 52246)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A926T	8						.						71.0	74.0	73.0					8																	109228666		2202	4298	6500	109297842	SO:0001583	missense	3646	exon9			U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.926A>T	8.37:g.109228666T>A	ENSP00000220849:p.Gln309Leu		109297842	NM_001568		Missense_Mutation	SNP	ENST00000220849.5	37	CCDS6308.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.775047	0.90108	.	.	ENSG00000104408	ENST00000220849;ENST00000519030;ENST00000519627	T;T;T	0.41758	0.99;0.99;0.99	5.17	5.17	0.71159	Proteasome component (PCI) domain (1);	0.000000	0.85682	D	0.000000	T	0.71451	0.3341	M	0.91300	3.195	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.981	T	0.79245	-0.1883	10	0.87932	D	0	-10.2936	14.9962	0.71433	0.0:0.0:0.0:1.0	.	309;309	B2R806;P60228	.;EIF3E_HUMAN	L	309;216;182	ENSP00000220849:Q309L;ENSP00000428796:Q216L;ENSP00000430839:Q182L	ENSP00000220849:Q309L	Q	-	2	0	EIF3E	109297842	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.997000	0.88414	2.090000	0.63153	0.477000	0.44152	CAG		0.299	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380612.2	NM_001568	
NOTCH2	4853	hgsc.bcm.edu	37	1	120512256	120512256	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr1:120512256C>A	ENST00000256646.2	-	6	1205	c.986G>T	c.(985-987)gGc>gTc	p.G329V		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	329	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.G329V(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCACTCCAGCCGTTGACACA	0.557			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.G329V			Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G986T	1						.						157.0	110.0	126.0					1																	120512256		2203	4300	6503	120313779	SO:0001583	missense	4853	exon6	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.986G>T	1.37:g.120512256C>A	ENSP00000256646:p.Gly329Val		120313779	NM_024408	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862975	0.91511	.	.	ENSG00000134250	ENST00000256646;ENST00000539617	T	0.61158	0.13	5.73	5.73	0.89815	EGF-like region, conserved site (2);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.38548	U	0.001642	D	0.83830	0.5339	H	0.97491	4.015	0.80722	D	1	D;D;D	0.89917	0.99;0.998;1.0	D;D;D	0.97110	0.917;0.965;1.0	D	0.89037	0.3446	10	0.87932	D	0	.	18.8873	0.92383	0.0:1.0:0.0:0.0	.	290;329;329	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	V	329;290	ENSP00000256646:G329V	ENSP00000256646:G329V	G	-	2	0	NOTCH2	120313779	1.000000	0.71417	0.997000	0.53966	0.916000	0.54674	7.487000	0.81328	2.708000	0.92522	0.655000	0.94253	GGC		0.557	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
HAPLN2	60484	hgsc.bcm.edu	37	1	156595020	156595020	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr1:156595020G>T	ENST00000255039.1	+	7	1274	c.867G>T	c.(865-867)caG>caT	p.Q289H	HAPLN2_ENST00000494218.1_3'UTR	NM_021817.2	NP_068589.1	Q9GZV7	HPLN2_HUMAN	hyaluronan and proteoglycan link protein 2	289	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|establishment of blood-nerve barrier (GO:0008065)|extracellular matrix assembly (GO:0085029)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.Q289H(1)		NS(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	7	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCTAGACCAGTGCGACGGCG	0.711																																					p.Q289H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G867T	1						.						10.0	9.0	9.0					1																	156595020		2134	4208	6342	154861644	SO:0001583	missense	60484	exon7			AB049054	CCDS1148.1	1q23.1	2013-01-11			ENSG00000132702	ENSG00000132702		"""Immunoglobulin superfamily / V-set domain containing"""	17410	protein-coding gene	gene with protein product	"""brain link protein 1"""					11027579, 11873941	Standard	NM_021817		Approved	BRAL1	uc001fpn.1	Q9GZV7	OTTHUMG00000033205	ENST00000255039.1:c.867G>T	1.37:g.156595020G>T	ENSP00000255039:p.Gln289His		154861644	NM_021817	Q5T3J0	Missense_Mutation	SNP	ENST00000255039.1	37	CCDS1148.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.506280	0.44558	.	.	ENSG00000132702	ENST00000255039;ENST00000544775	T	0.30448	1.53	4.39	-7.23	0.01480	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.201166	0.43747	D	0.000536	T	0.05593	0.0147	L	0.27053	0.805	0.30759	N	0.744245	B	0.02656	0.0	B	0.06405	0.002	T	0.20505	-1.0273	10	0.42905	T	0.14	-8.3377	8.035	0.30486	0.5518:0.167:0.2812:0.0	.	289	Q9GZV7	HPLN2_HUMAN	H	289;262	ENSP00000255039:Q289H	ENSP00000255039:Q289H	Q	+	3	2	HAPLN2	154861644	0.005000	0.15991	0.933000	0.37362	0.979000	0.70002	-1.124000	0.03260	-1.067000	0.03160	0.455000	0.32223	CAG		0.711	HAPLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081039.1	NM_021817	
BRINP2	57795	hgsc.bcm.edu	37	1	177249794	177249794	+	Silent	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr1:177249794G>A	ENST00000361539.4	+	8	1794	c.1482G>A	c.(1480-1482)gaG>gaA	p.E494E	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	494					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)		p.E494E(1)									GCCGGCCAGAGGTGGCCGAGT	0.617																																					p.E494E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1482A	1						.						29.0	31.0	30.0					1																	177249794		2203	4299	6502	175516417	SO:0001819	synonymous_variant	57795	exon8				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1482G>A	1.37:g.177249794G>A			175516417	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	ENST00000361539.4	37	CCDS1320.1																																																																																				0.617	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
ACTN2	88	hgsc.bcm.edu	37	1	236902815	236902815	+	Missense_Mutation	SNP	G	G	A	rs572523462		TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr1:236902815G>A	ENST00000366578.4	+	10	1256	c.1090G>A	c.(1090-1092)Gag>Aag	p.E364K	ACTN2_ENST00000546208.1_Intron|ACTN2_ENST00000542672.1_Missense_Mutation_p.E364K|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	364					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.E364K(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CATGCCCTCCGAGGGCAAGAT	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		19107	0.001		0.0	False		,,,				2504	0.0				p.E364K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1090A	1						.						88.0	69.0	76.0					1																	236902815		2203	4300	6503	234969438	SO:0001583	missense	88	exon10			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1090G>A	1.37:g.236902815G>A	ENSP00000355537:p.Glu364Lys		234969438	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535141	0.85812	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.50813	0.73;0.73	5.51	5.51	0.81932	.	0.089323	0.85682	D	0.000000	T	0.77356	0.4118	M	0.92970	3.365	0.80722	D	1	P;P;D	0.58268	0.947;0.5;0.982	P;B;D	0.72982	0.554;0.23;0.979	T	0.82878	-0.0239	10	0.87932	D	0	.	19.4071	0.94651	0.0:0.0:1.0:0.0	.	364;134;364	B2RCS5;Q59FD9;P35609	.;.;ACTN2_HUMAN	K	364;364;133	ENSP00000443495:E364K;ENSP00000355537:E364K	ENSP00000355537:E364K	E	+	1	0	ACTN2	234969438	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.820000	0.99359	2.585000	0.87301	0.555000	0.69702	GAG		0.602	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
HIVEP3	59269	hgsc.bcm.edu	37	1	42047069	42047069	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr1:42047069G>A	ENST00000372583.1	-	4	4285	c.3400C>T	c.(3400-3402)Cat>Tat	p.H1134Y	HIVEP3_ENST00000372584.1_Missense_Mutation_p.H1134Y|HIVEP3_ENST00000247584.5_Missense_Mutation_p.H1134Y|HIVEP3_ENST00000429157.2_Missense_Mutation_p.H1134Y|HIVEP3_ENST00000460604.1_5'Flank	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1134					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H1134Y(1)		NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GGCTTCTCATGCAGGGGTGTC	0.612																																					p.H1134Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3400T	1						.						87.0	94.0	91.0					1																	42047069		2203	4300	6503	41819656	SO:0001583	missense	59269	exon4			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.3400C>T	1.37:g.42047069G>A	ENSP00000361664:p.His1134Tyr		41819656	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	37	CCDS463.1	.	.	.	.	.	.	.	.	.	.	G	2.345	-0.350146	0.05173	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.06142	3.34;3.34;3.34;3.34	4.24	4.24	0.50183	.	0.663319	0.13215	N	0.404835	T	0.05960	0.0155	N	0.19112	0.55	0.30769	N	0.743223	B;B	0.29716	0.255;0.165	B;B	0.25405	0.06;0.027	T	0.10730	-1.0617	10	0.49607	T	0.09	-7.3033	16.4051	0.83656	0.0:0.0:1.0:0.0	.	1134;1134	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	Y	1134	ENSP00000361665:H1134Y;ENSP00000361664:H1134Y;ENSP00000247584:H1134Y;ENSP00000410828:H1134Y	ENSP00000247584:H1134Y	H	-	1	0	HIVEP3	41819656	1.000000	0.71417	0.997000	0.53966	0.181000	0.23173	8.661000	0.91125	2.192000	0.70111	0.467000	0.42956	CAT		0.612	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
ACTN2	88	hgsc.bcm.edu	37	1	236908039	236908039	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr1:236908039C>T	ENST00000366578.4	+	12	1535	c.1369C>T	c.(1369-1371)Cgc>Tgc	p.R457C	ACTN2_ENST00000546208.1_5'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.R457C|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	457					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)	p.R457C(1)		endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GCACCAGGACCGCGTGGAGCA	0.642																																					p.R457C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1369T	1						.						61.0	53.0	56.0					1																	236908039		2203	4300	6503	234974662	SO:0001583	missense	88	exon12			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1369C>T	1.37:g.236908039C>T	ENSP00000355537:p.Arg457Cys		234974662	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.124656	0.77436	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.55588	0.51;0.51	5.17	4.23	0.50019	.	0.045259	0.85682	N	0.000000	T	0.80259	0.4590	H	0.95850	3.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.86099	0.1555	10	0.87932	D	0	.	13.2905	0.60269	0.346:0.654:0.0:0.0	.	242;457;227;457	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	C	457;457;226	ENSP00000443495:R457C;ENSP00000355537:R457C	ENSP00000355537:R457C	R	+	1	0	ACTN2	234974662	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.463000	0.35277	1.247000	0.43917	0.563000	0.77884	CGC		0.642	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
ARHGAP20	57569	hgsc.bcm.edu	37	11	110451569	110451569	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:110451569G>A	ENST00000260283.4	-	16	2385	c.2101C>T	c.(2101-2103)Cgg>Tgg	p.R701W	ARHGAP20_ENST00000533353.1_Missense_Mutation_p.R675W|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.R244W|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.R675W|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.R665W|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.R678W|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.R665W	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	701					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.R701W(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GAGCAACGCCGGTGTCGCCTC	0.542																																					p.R701W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2101T	11						.						69.0	66.0	67.0					11																	110451569		2201	4298	6499	109956779	SO:0001583	missense	57569	exon16			AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.2101C>T	11.37:g.110451569G>A	ENSP00000260283:p.Arg701Trp		109956779	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292923	0.40594	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.19669	2.18;2.18;2.13;2.18;2.19;2.18;2.19	5.71	1.24	0.21308	.	0.000000	0.85682	D	0.000000	T	0.19725	0.0474	M	0.77103	2.36	0.29493	N	0.855516	P;B;P	0.41710	0.76;0.399;0.534	B;B;B	0.32533	0.147;0.045;0.097	T	0.18555	-1.0333	10	0.87932	D	0	.	7.7355	0.28812	0.0844:0.0:0.3197:0.5959	.	675;701;678	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	W	701;675;244;678;665;675;665	ENSP00000260283:R701W;ENSP00000349660:R675W;ENSP00000437905:R244W;ENSP00000432076:R678W;ENSP00000436319:R665W;ENSP00000436522:R675W;ENSP00000431399:R665W	ENSP00000260283:R701W	R	-	1	2	ARHGAP20	109956779	0.998000	0.40836	0.323000	0.25347	0.200000	0.23975	1.157000	0.31724	0.330000	0.23485	0.655000	0.94253	CGG		0.542	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
UPK2	7379	hgsc.bcm.edu	37	11	118827113	118827113	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:118827113C>A	ENST00000264031.2	+	1	88	c.53C>A	c.(52-54)gCt>gAt	p.A18D	UPK2_ENST00000534788.1_Intron|RP11-158I9.7_ENST00000584831.1_RNA	NM_006760.3	NP_006751.1	O00526	UPK2_HUMAN	uroplakin 2	18					epithelial cell differentiation (GO:0030855)|membrane organization (GO:0061024)|multicellular organismal development (GO:0007275)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)		p.A18D(1)		kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.122)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)		ATTCTGCTGGCTCTGCTGTCC	0.652																																					p.A18D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C53A	11						.						81.0	69.0	73.0					11																	118827113		2200	4295	6495	118332323	SO:0001583	missense	7379	exon1			Y13645	CCDS8404.1	11q23	2008-07-21				ENSG00000110375			12579	protein-coding gene	gene with protein product	"""uroplakin II"", ""uroplakin-2"""	611558				9515818, 9846985	Standard	NM_006760		Approved	UP2, UPII, MGC138598	uc001puh.3	O00526		ENST00000264031.2:c.53C>A	11.37:g.118827113C>A	ENSP00000264031:p.Ala18Asp		118332323	NM_006760	B0YJ92|O00457|Q53YV0	Missense_Mutation	SNP	ENST00000264031.2	37	CCDS8404.1	.	.	.	.	.	.	.	.	.	.	C	9.773	1.173131	0.21704	.	.	ENSG00000110375	ENST00000264031	T	0.40225	1.04	5.75	1.31	0.21738	.	0.804730	0.11049	N	0.605283	T	0.36771	0.0979	L	0.47716	1.5	0.20403	N	0.999905	B	0.26577	0.153	B	0.34038	0.174	T	0.40117	-0.9580	10	0.52906	T	0.07	-0.1422	6.269	0.20943	0.0:0.5348:0.0:0.4652	.	18	O00526	UPK2_HUMAN	D	18	ENSP00000264031:A18D	ENSP00000264031:A18D	A	+	2	0	UPK2	118332323	0.158000	0.22850	0.291000	0.24904	0.152000	0.21847	0.203000	0.17315	0.362000	0.24319	-0.291000	0.09656	GCT		0.652	UPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389311.1	NM_006760	
SLC22A18	5002	hgsc.bcm.edu	37	11	2943404	2943404	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:2943404C>G	ENST00000380574.1	+	9	1368	c.937C>G	c.(937-939)Ctg>Gtg	p.L313V	SLC22A18_ENST00000441077.1_3'UTR|SLC22A18_ENST00000312221.5_Missense_Mutation_p.L313V|SLC22A18_ENST00000347936.2_Missense_Mutation_p.L313V|SLC22A18_ENST00000449793.2_Missense_Mutation_p.L215V			Q96BI1	S22AI_HUMAN	solute carrier family 22, member 18	313					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|excretion (GO:0007588)|organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|symporter activity (GO:0015293)|ubiquitin protein ligase binding (GO:0031625)	p.L313V(1)		central_nervous_system(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		GGCCAGCGTGCTGGTCTTCAT	0.657																																					p.L313V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C937G	11						.						80.0	88.0	85.0					11																	2943404		2202	4299	6501	2899980	SO:0001583	missense	5002	exon9			AF028738	CCDS7740.1	11p15.5	2013-05-22	2008-01-11	2004-01-21	ENSG00000110628	ENSG00000110628		"""Solute carriers"""	10964	protein-coding gene	gene with protein product		602631	"""solute carrier family 22 (organic cation transporter), member 1-like"""	ORCTL2, BWSCR1A, IMPT1, SLC22A1L		9499412, 9520460	Standard	NM_183233		Approved	BWR1A, TSSC5, ITM	uc001lwx.3	Q96BI1	OTTHUMG00000010037	ENST00000380574.1:c.937C>G	11.37:g.2943404C>G	ENSP00000369948:p.Leu313Val		2899980	NM_002555	O14906|O43562|O60485|O60680|Q7LDS5|Q7LGF7	Missense_Mutation	SNP	ENST00000380574.1	37	CCDS7740.1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.637199	0.29157	.	.	ENSG00000110628	ENST00000347936;ENST00000312221;ENST00000449793;ENST00000380574	T;T;T;T	0.59906	0.23;0.23;0.28;0.23	4.56	3.63	0.41609	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.195198	0.33670	N	0.004672	T	0.47655	0.1457	L	0.55103	1.725	0.36155	D	0.847737	B;B	0.30068	0.267;0.076	B;B	0.35039	0.194;0.07	T	0.45789	-0.9237	10	0.05959	T	0.93	-33.6705	10.123	0.42632	0.0:0.9018:0.0:0.0982	.	215;313	E9PRM7;Q96BI1	.;S22AI_HUMAN	V	313;313;215;313	ENSP00000307859:L313V;ENSP00000311139:L313V;ENSP00000392072:L215V;ENSP00000369948:L313V	ENSP00000311139:L313V	L	+	1	2	SLC22A18	2899980	0.778000	0.28640	0.998000	0.56505	0.545000	0.35147	0.339000	0.19875	2.101000	0.63845	0.549000	0.68633	CTG		0.657	SLC22A18-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027770.1	NM_183233	
SCUBE2	57758	hgsc.bcm.edu	37	11	9048931	9048931	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:9048931T>C	ENST00000309263.3	-	19	2666	c.2594A>G	c.(2593-2595)tAt>tGt	p.Y865C	SCUBE2_ENST00000457346.2_Missense_Mutation_p.Y894C|SCUBE2_ENST00000450649.2_Intron|RP11-467K18.2_ENST00000531592.1_RNA|SCUBE2_ENST00000520467.1_Missense_Mutation_p.Y837C			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	865	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.Y865C(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		CATCACCAGATAGTCCCCACA	0.582																																					p.Y837C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2510G	11						.						113.0	96.0	102.0					11																	9048931		2201	4296	6497	9005507	SO:0001583	missense	57758	exon19			AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.2594A>G	11.37:g.9048931T>C	ENSP00000310658:p.Tyr865Cys		9005507	NM_020974	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	ENST00000309263.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.346311|4.346311	0.82022|0.82022	.|.	.|.	ENSG00000175356|ENSG00000175356	ENST00000519202|ENST00000457346;ENST00000309263;ENST00000520467	.|T;T;T	.|0.39406	.|1.08;1.08;1.08	5.34|5.34	5.34|5.34	0.76211|0.76211	.|CUB (5);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68751|0.68751	0.3035|0.3035	M|M	0.88570|0.88570	2.965|2.965	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.995;0.999	.|D;D	.|0.67231	.|0.917;0.95	T|T	0.75693|0.75693	-0.3229|-0.3229	5|10	.|0.62326	.|D	.|0.03	.|.	15.3206|15.3206	0.74117|0.74117	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|837;865	.|Q9NQ36-2;Q9NQ36	.|.;SCUB2_HUMAN	V|C	48|894;865;837	.|ENSP00000390481:Y894C;ENSP00000310658:Y865C;ENSP00000429969:Y837C	.|ENSP00000310658:Y865C	I|Y	-|-	1|2	0|0	SCUBE2|SCUBE2	9005507|9005507	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	3.328000|3.328000	0.52052|0.52052	2.027000|2.027000	0.59764|0.59764	0.477000|0.477000	0.44152|0.44152	ATC|TAT		0.582	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000385812.2	NM_020974	
SLC6A5	9152	hgsc.bcm.edu	37	11	20676319	20676319	+	Missense_Mutation	SNP	G	G	A	rs16906628	byFrequency	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:20676319G>A	ENST00000525748.1	+	16	2572	c.2299G>A	c.(2299-2301)Ggg>Agg	p.G767R	SLC6A5_ENST00000528440.1_3'UTR	NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	767			G -> R (in dbSNP:rs16906628).		glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)	p.G767R(1)|p.G767W(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	TCAACACCGCGGGGAGCGTTA	0.542													G|||	91	0.0181709	0.0061	0.062	5008	,	,		19307	0.0119		0.0099	False		,,,				2504	0.0184				p.G767R												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G2299A	11	GRCh37	CM064281	SLC6A5	M	rs16906628	.	G	ARG/GLY	29,4377	34.3+/-65.2	0,29,2174	153.0	144.0	147.0		2299	5.9	1.0	11	dbSNP_123	147	77,8523	45.8+/-104.6	2,73,4225	yes	missense	SLC6A5	NM_004211.3	125	2,102,6399	AA,AG,GG		0.8953,0.6582,0.815	benign	767/798	20676319	106,12900	2203	4300	6503	20632895	SO:0001583	missense	9152	exon16			AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.2299G>A	11.37:g.20676319G>A	ENSP00000434364:p.Gly767Arg		20632895	NM_004211	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	37	CCDS7854.1	33	0.01510989010989011	2	0.0040650406504065045	14	0.03867403314917127	9	0.015734265734265736	8	0.010554089709762533	G	20.8	4.057552	0.76074	0.006582	0.008953	ENSG00000165970	ENST00000525748	T	0.71698	-0.59	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.26919	0.0659	N	0.19112	0.55	0.80722	D	1	P	0.52463	0.953	B	0.41135	0.348	T	0.47156	-0.9139	10	0.25106	T	0.35	.	20.1931	0.98233	0.0:0.0:1.0:0.0	rs16906628;rs52818485;rs16906628	767	Q9Y345	SC6A5_HUMAN	R	767	ENSP00000434364:G767R	ENSP00000434364:G767R	G	+	1	0	SLC6A5	20632895	1.000000	0.71417	0.993000	0.49108	0.981000	0.71138	9.414000	0.97362	2.771000	0.95319	0.563000	0.77884	GGG		0.542	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2	NM_004211	
OR5M9	390162	hgsc.bcm.edu	37	11	56229955	56229955	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:56229955A>G	ENST00000279791.1	-	1	922	c.923T>C	c.(922-924)gTg>gCg	p.V308A		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V308A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					TTACTGCCTCACATATGTCTT	0.358																																					p.V308A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T923C	11						.						119.0	108.0	112.0					11																	56229955		2201	4296	6497	55986531	SO:0001583	missense	390162	exon1			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.923T>C	11.37:g.56229955A>G	ENSP00000279791:p.Val308Ala		55986531	NM_001004743	Q6IEW5|Q96RB9	Missense_Mutation	SNP	ENST00000279791.1	37	CCDS31531.1	.	.	.	.	.	.	.	.	.	.	A	9.170	1.020819	0.19433	.	.	ENSG00000150269	ENST00000279791	T	0.00005	9.79	4.1	2.97	0.34412	.	0.316457	0.17630	N	0.167421	T	0.00039	0.0001	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.01508	-1.1337	10	0.44086	T	0.13	0.1491	5.5683	0.17182	0.7775:0.0:0.2225:0.0	.	308	Q8NGP3	OR5M9_HUMAN	A	308	ENSP00000279791:V308A	ENSP00000279791:V308A	V	-	2	0	OR5M9	55986531	0.000000	0.05858	0.003000	0.11579	0.002000	0.02628	0.242000	0.18087	0.746000	0.32786	0.391000	0.25812	GTG		0.358	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743	
NRXN2	9379	hgsc.bcm.edu	37	11	64457917	64457917	+	Silent	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:64457917G>A	ENST00000377551.1	-	4	1021	c.810C>T	c.(808-810)gcC>gcT	p.A270A	NRXN2_ENST00000409571.1_Silent_p.A270A|NRXN2_ENST00000377559.3_Intron|NRXN2_ENST00000265459.6_Silent_p.A270A			Q9P2S2	NRX2A_HUMAN	neurexin 2	270					adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.A270A(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CTCCTCTCCCGGCCCCCCCCT	0.637																																					p.A270A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C810T	11						.						38.0	38.0	38.0					11																	64457917		2201	4297	6498	64214493	SO:0001819	synonymous_variant	9379	exon5				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.810C>T	11.37:g.64457917G>A			64214493	NM_015080	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.89|10.89	1.478629|1.478629	0.26511|0.26511	.|.	.|.	ENSG00000110076|ENSG00000110076	ENST00000417749|ENST00000437746	.|.	.|.	.|.	4.58|4.58	4.58|4.58	0.56647|0.56647	.|.	.|.	.|.	.|.	.|.	T|T	0.64713|0.64713	0.2623|0.2623	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.63404|0.63404	-0.6645|-0.6645	4|4	.|.	.|.	.|.	.|.	13.2396|13.2396	0.59989|0.59989	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|W	31|60	.|.	.|.	P|R	-|-	2|1	0|2	NRXN2|NRXN2	64214493|64214493	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.739000|4.739000	0.62080|0.62080	2.288000|2.288000	0.76882|0.76882	0.442000|0.442000	0.29010|0.29010	CCG|CGG		0.637	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
DPF2	5977	hgsc.bcm.edu	37	11	65113796	65113796	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:65113796A>C	ENST00000528416.1	+	9	1116	c.983A>C	c.(982-984)aAa>aCa	p.K328T	DPF2_ENST00000415073.2_Intron|DPF2_ENST00000252268.4_Missense_Mutation_p.K342T	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	328					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)	p.K328T(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						ATCGAGTGCAAATGTTGCAAT	0.552																																					p.K328T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A983C	11						.						156.0	116.0	130.0					11																	65113796		2201	4297	6498	64870372	SO:0001583	missense	5977	exon9			U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.983A>C	11.37:g.65113796A>C	ENSP00000436901:p.Lys328Thr		64870372	NM_006268	A8K7C9|B4DT58	Missense_Mutation	SNP	ENST00000528416.1	37	CCDS8100.1	.	.	.	.	.	.	.	.	.	.	A	28.7	4.946034	0.92593	.	.	ENSG00000133884	ENST00000528416;ENST00000252268	D;D	0.87491	-2.26;-2.26	5.62	5.62	0.85841	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (2);	0.000000	0.39341	N	0.001400	D	0.95484	0.8533	H	0.96048	3.76	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.96668	0.9494	10	0.87932	D	0	-22.373	13.7721	0.63032	1.0:0.0:0.0:0.0	.	328	Q92785	REQU_HUMAN	T	328;342	ENSP00000436901:K328T;ENSP00000252268:K342T	ENSP00000252268:K342T	K	+	2	0	DPF2	64870372	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.197000	0.94985	2.155000	0.67459	0.459000	0.35465	AAA		0.552	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268	
DPF2	5977	hgsc.bcm.edu	37	11	65113823	65113823	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:65113823A>G	ENST00000528416.1	+	9	1143	c.1010A>G	c.(1009-1011)gAg>gGg	p.E337G	DPF2_ENST00000415073.2_Intron|DPF2_ENST00000252268.4_Missense_Mutation_p.E351G	NM_006268.4	NP_006259.1	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	337					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|zinc ion binding (GO:0008270)	p.E337G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)	23						GGCACCTCCGAGAATGACGTG	0.517																																					p.E337G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1010G	11						.						119.0	88.0	99.0					11																	65113823		2201	4297	6498	64870399	SO:0001583	missense	5977	exon9			U94585	CCDS8100.1	11q13.1	2014-05-13	2003-10-06	2003-10-08	ENSG00000133884	ENSG00000133884		"""Zinc fingers, PHD-type"""	9964	protein-coding gene	gene with protein product		601671	"""requiem, apoptosis response zinc finger gene"""	REQ		11845289	Standard	NM_006268		Approved	ubi-d4, BAF45d	uc001odm.3	Q92785	OTTHUMG00000165985	ENST00000528416.1:c.1010A>G	11.37:g.65113823A>G	ENSP00000436901:p.Glu337Gly		64870399	NM_006268	A8K7C9|B4DT58	Missense_Mutation	SNP	ENST00000528416.1	37	CCDS8100.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.910788	0.92178	.	.	ENSG00000133884	ENST00000528416;ENST00000252268	D;D	0.85171	-1.95;-1.95	5.62	5.62	0.85841	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.38005	N	0.001845	D	0.85141	0.5629	N	0.12746	0.255	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.88003	0.2757	10	0.87932	D	0	-32.4514	13.7721	0.63032	1.0:0.0:0.0:0.0	.	337	Q92785	REQU_HUMAN	G	337;351	ENSP00000436901:E337G;ENSP00000252268:E351G	ENSP00000252268:E351G	E	+	2	0	DPF2	64870399	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	9.197000	0.94985	2.155000	0.67459	0.459000	0.35465	GAG		0.517	DPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387293.3	NM_006268	
SF3B2	10992	hgsc.bcm.edu	37	11	65827381	65827381	+	Silent	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:65827381C>T	ENST00000322535.6	+	13	1579	c.1530C>T	c.(1528-1530)taC>taT	p.Y510Y	SF3B2_ENST00000528302.1_Silent_p.Y493Y	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	510					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)	p.Y510Y(1)		breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						AGCGCAAATACCTGCAGGGCA	0.582																																					p.Y510Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1530T	11						.						100.0	85.0	90.0					11																	65827381		2201	4295	6496	65583957	SO:0001819	synonymous_variant	10992	exon13			U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.1530C>T	11.37:g.65827381C>T			65583957	NM_006842	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Silent	SNP	ENST00000322535.6	37	CCDS31612.1																																																																																				0.582	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
HYOU1	10525	hgsc.bcm.edu	37	11	118922255	118922255	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr11:118922255C>T	ENST00000404233.3	-	13	1545	c.1421G>A	c.(1420-1422)gGg>gAg	p.G474E	HYOU1_ENST00000543287.1_Missense_Mutation_p.G387E|HYOU1_ENST00000529972.1_Missense_Mutation_p.G474E|HYOU1_ENST00000525859.1_Missense_Mutation_p.G474E	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	474					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.G474E(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		AGGGTAGGGCCCCATCCGAGA	0.547																																					p.G474E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1421A	11						.						237.0	187.0	204.0					11																	118922255		2200	4295	6495	118427465	SO:0001583	missense	10525	exon13			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.1421G>A	11.37:g.118922255C>T	ENSP00000384144:p.Gly474Glu		118427465	NM_006389	A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	ENST00000404233.3	37	CCDS8408.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350612	0.82132	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	T;T;T;T;T	0.01947	5.07;5.06;5.06;4.54;4.79	5.26	5.26	0.73747	.	0.048240	0.85682	D	0.000000	T	0.04724	0.0128	L	0.34521	1.04	0.48395	D	0.999647	P;D;P;P	0.54601	0.918;0.967;0.918;0.918	P;P;P;P	0.53266	0.601;0.722;0.601;0.601	T	0.44651	-0.9314	10	0.62326	D	0.03	-40.3491	13.1769	0.59633	0.0:0.7133:0.2867:0.0	.	465;518;474;474	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	E	474;465;474;474;323;474;517;387;474	ENSP00000384144:G474E;ENSP00000437313:G474E;ENSP00000433397:G474E;ENSP00000442727:G387E;ENSP00000431874:G474E	ENSP00000278752:G465E	G	-	2	0	HYOU1	118427465	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.540000	0.73861	2.735000	0.93741	0.655000	0.94253	GGG		0.547	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389	
ALDH5A1	7915	hgsc.bcm.edu	37	6	24528308	24528308	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr6:24528308C>A	ENST00000357578.3	+	8	1402	c.1257C>A	c.(1255-1257)ttC>ttA	p.F419L	ALDH5A1_ENST00000546278.1_Missense_Mutation_p.F331L|ALDH5A1_ENST00000491546.1_Missense_Mutation_p.F391L|ALDH5A1_ENST00000348925.2_Missense_Mutation_p.F432L	NM_001080.3	NP_001071.1	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5 family, member A1	419					acetate metabolic process (GO:0006083)|central nervous system development (GO:0007417)|galactosylceramide metabolic process (GO:0006681)|gamma-aminobutyric acid catabolic process (GO:0009450)|glucose metabolic process (GO:0006006)|glucosylceramide metabolic process (GO:0006678)|glutamate metabolic process (GO:0006536)|glutamine metabolic process (GO:0006541)|glutathione metabolic process (GO:0006749)|glycerophospholipid metabolic process (GO:0006650)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|respiratory electron transport chain (GO:0022904)|short-chain fatty acid metabolic process (GO:0046459)|succinate metabolic process (GO:0006105)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	protein homodimerization activity (GO:0042803)|succinate-semialdehyde dehydrogenase (NAD+) activity (GO:0004777)|succinate-semialdehyde dehydrogenase [NAD(P)+] activity (GO:0009013)	p.F432L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|skin(2)|urinary_tract(1)	20					Chlormerodrin(DB00534)|Succinic acid(DB00139)|Valproic Acid(DB00313)	GAAAAAATTTCTTTGAGCCTA	0.483																																					p.F432L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1296A	6						.						106.0	98.0	101.0					6																	24528308		2203	4300	6503	24636287	SO:0001583	missense	7915	exon9			L34820	CCDS4555.1, CCDS4556.1	6p22	2013-06-03	2008-07-31		ENSG00000112294	ENSG00000112294	1.2.1.24	"""Aldehyde dehydrogenases"""	408	protein-coding gene	gene with protein product	"""succinate-semialdehyde dehydrogenase"""	610045				7814412, 9059628	Standard	NM_001080		Approved	SSADH, SSDH	uc003nef.3	P51649	OTTHUMG00000014356	ENST00000357578.3:c.1257C>A	6.37:g.24528308C>A	ENSP00000350191:p.Phe419Leu		24636287	NM_170740	B2RD26|G5E949|Q546H9|Q8N3W6	Missense_Mutation	SNP	ENST00000357578.3	37	CCDS4555.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531691	0.85706	.	.	ENSG00000112294	ENST00000357578;ENST00000546278;ENST00000491546;ENST00000348925	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	4.83	3.88	0.44766	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.942753	0.08942	N	0.871446	D	0.85948	0.5816	M	0.79926	2.475	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.68483	0.958;0.93	D	0.84078	0.0383	10	0.87932	D	0	-17.87	13.6575	0.62346	0.0:0.9137:0.0:0.0863	.	419;432	P51649;G5E949	SSDH_HUMAN;.	L	419;331;391;432	ENSP00000350191:F419L;ENSP00000438193:F331L;ENSP00000417687:F391L;ENSP00000314649:F432L	ENSP00000314649:F432L	F	+	3	2	ALDH5A1	24636287	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.873000	0.56093	2.504000	0.84457	0.655000	0.94253	TTC		0.483	ALDH5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040007.2		
PMP22	5376	hgsc.bcm.edu	37	17	15134376	15134376	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr17:15134376G>A	ENST00000395938.2	-	5	535	c.341C>T	c.(340-342)gCg>gTg	p.A114V	PMP22_ENST00000494511.1_Silent_p.C54C|PMP22_ENST00000395936.1_3'UTR|PMP22_ENST00000312280.3_Missense_Mutation_p.A114V	NM_001281455.1|NM_153321.1	NP_001268384.1|NP_696996.1	Q01453	PMP22_HUMAN	peripheral myelin protein 22	114					cell death (GO:0008219)|peripheral nervous system development (GO:0007422)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A114V(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		GTAGATGGCCGCAGCACTCAT	0.642																																					p.A114V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C341T	17						.						53.0	47.0	49.0					17																	15134376		2203	4300	6503	15075101	SO:0001583	missense	5376	exon4			D11428	CCDS11168.1	17p12	2014-09-17			ENSG00000109099	ENSG00000109099			9118	protein-coding gene	gene with protein product		601097				8482547, 1497668	Standard	NM_001281456		Approved	HNPP, GAS-3, Sp110	uc002goj.3	Q01453	OTTHUMG00000058960	ENST00000395938.2:c.341C>T	17.37:g.15134376G>A	ENSP00000379269:p.Ala114Val		15075101	NM_153322	Q8WV01	Missense_Mutation	SNP	ENST00000395938.2	37	CCDS11168.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561919	0.86335	.	.	ENSG00000109099	ENST00000395938;ENST00000312280;ENST00000426385	D;D	0.88741	-2.42;-2.42	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.91801	0.7406	L	0.49455	1.56	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87361	0.2344	10	0.08179	T	0.78	-30.0018	18.4322	0.90630	0.0:0.0:1.0:0.0	.	114	Q01453	PMP22_HUMAN	V	114	ENSP00000379269:A114V;ENSP00000308937:A114V	ENSP00000308937:A114V	A	-	2	0	PMP22	15075101	1.000000	0.71417	0.582000	0.28627	0.926000	0.56050	7.485000	0.81204	2.692000	0.91855	0.563000	0.77884	GCG		0.642	PMP22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130378.1	NM_000304	
TP53	7157	hgsc.bcm.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr17:7577568C>T	ENST00000269305.4	-	7	902	c.713G>A	c.(712-714)tGt>tAt	p.C238Y	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.C238Y|TP53_ENST00000445888.2_Missense_Mutation_p.C238Y|TP53_ENST00000359597.4_Missense_Mutation_p.C238Y|TP53_ENST00000413465.2_Missense_Mutation_p.C238Y|TP53_ENST00000455263.2_Missense_Mutation_p.C238Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAACTGTTACACATGTAGTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C238Y	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,oesophagus,NS,Substitution - Missense,-2	.	158	Substitution - Missense(131)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)	breast(22)|ovary(17)|large_intestine(14)|haematopoietic_and_lymphoid_tissue(13)|endometrium(13)|lung(12)|upper_aerodigestive_tract(9)|pancreas(8)|soft_tissue(7)|urinary_tract(7)|oesophagus(7)|biliary_tract(6)|central_nervous_system(6)|liver(5)|bone(5)|stomach(4)|skin(2)|meninges(1)	c.G713A	17	GRCh37	CM034930	TP53	M		.						132.0	103.0	113.0					17																	7577568		2203	4300	6503	7518293	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713G>A	17.37:g.7577568C>T	ENSP00000269305:p.Cys238Tyr		7518293	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327056	0.81690	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95847	0.8871	10	0.87932	D	0	-18.536	14.6088	0.68501	0.0:1.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Y	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238Y;ENSP00000352610:C238Y;ENSP00000269305:C238Y;ENSP00000398846:C238Y;ENSP00000391127:C238Y;ENSP00000391478:C238Y;ENSP00000425104:C106Y;ENSP00000423862:C145Y	ENSP00000269305:C238Y	C	-	2	0	TP53	7518293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.564000	0.86499	0.462000	0.41574	TGT		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
HAP1	9001	hgsc.bcm.edu	37	17	39881284	39881284	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr17:39881284G>T	ENST00000310778.5	-	12	1694	c.1685C>A	c.(1684-1686)cCc>cAc	p.P562H	HAP1_ENST00000341193.5_Missense_Mutation_p.P493H|HAP1_ENST00000347901.4_Missense_Mutation_p.P510H|JUP_ENST00000540235.1_Intron|HAP1_ENST00000393939.2_Missense_Mutation_p.P485H			P54257	HAP1_HUMAN	huntingtin-associated protein 1	562	Glu-rich.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)	p.P510L(1)|p.P510H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CTCCTCCTGGGGCACGAACTC	0.637																																					p.P485H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1454A	17						.						187.0	194.0	192.0					17																	39881284		2203	4300	6503	37134810	SO:0001583	missense	9001	exon10			AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1685C>A	17.37:g.39881284G>T	ENSP00000309392:p.Pro562His		37134810	NM_001079871	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	ENST00000310778.5	37		.	.	.	.	.	.	.	.	.	.	G	15.88	2.964665	0.53507	.	.	ENSG00000173805	ENST00000458656;ENST00000442364;ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T;T;T	0.55234	0.6;0.53;2.02;2.52;2.09;2.07	3.19	3.19	0.36642	.	0.000000	0.39407	N	0.001380	T	0.59046	0.2165	L	0.29908	0.895	0.09310	N	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.997	T	0.51228	-0.8732	10	0.87932	D	0	-12.1389	12.6619	0.56820	0.0:0.0:1.0:0.0	.	485;493;510;562	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	H	17;37;485;562;510;493	ENSP00000404640:P17H;ENSP00000388981:P37H;ENSP00000377513:P485H;ENSP00000309392:P562H;ENSP00000334002:P510H;ENSP00000343170:P493H	ENSP00000309392:P562H	P	-	2	0	HAP1	37134810	0.037000	0.19845	0.015000	0.15790	0.003000	0.03518	0.698000	0.25571	2.064000	0.61679	0.609000	0.83330	CCC		0.637	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	NM_003949	
ACSM2A	123876	hgsc.bcm.edu	37	16	20486999	20486999	+	Silent	SNP	C	C	T	rs145558453	byFrequency	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr16:20486999C>T	ENST00000573854.1	+	8	1116	c.1002C>T	c.(1000-1002)tgC>tgT	p.C334C	ACSM2A_ENST00000575690.1_Silent_p.C334C|ACSM2A_ENST00000396104.2_Silent_p.C334C|ACSM2A_ENST00000417235.2_Silent_p.C255C|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000536134.1_Silent_p.C106C|ACSM2A_ENST00000219054.6_Silent_p.C334C	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	334					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)	p.C334C(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						TACAGAACTGCGTCACTGTAG	0.517													c|||	3	0.000599042	0.0	0.0029	5008	,	,		18604	0.0		0.0	False		,,,				2504	0.001				p.C334C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1002T	16						.	C		0,4406		0,0,2203	138.0	141.0	140.0		1002	2.8	0.0	16	dbSNP_134	140	12,8588	9.1+/-34.3	0,12,4288	no	coding-synonymous	ACSM2A	NM_001010845.2		0,12,6491	TT,TC,CC		0.1395,0.0,0.0923		334/578	20486999	12,12994	2203	4300	6503	20394500	SO:0001819	synonymous_variant	123876	exon9			AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1002C>T	16.37:g.20486999C>T			20394500	NM_001010845	B3KTT9|O75202	Silent	SNP	ENST00000573854.1	37	CCDS32401.1																																																																																				0.517	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	
SCNN1B	6338	hgsc.bcm.edu	37	16	23383110	23383110	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr16:23383110G>A	ENST00000343070.2	+	7	1234	c.1058G>A	c.(1057-1059)cGc>cAc	p.R353H	SCNN1B_ENST00000568085.1_Intron|SCNN1B_ENST00000568923.1_Missense_Mutation_p.R326H|SCNN1B_ENST00000307331.5_Missense_Mutation_p.R398H	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	353					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)	p.R353H(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	AAGCTTCAGCGCATGGGGGAG	0.562																																					p.R353H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1058A	16						.						159.0	146.0	150.0					16																	23383110		2197	4300	6497	23290611	SO:0001583	missense	6338	exon7			X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.1058G>A	16.37:g.23383110G>A	ENSP00000345751:p.Arg353His		23290611	NM_000336	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	37	CCDS10609.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.619503	0.28801	.	.	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.65364	-0.15;-0.15	4.64	4.64	0.57946	.	0.084930	0.51477	D	0.000089	T	0.54919	0.1888	L	0.49778	1.585	0.45087	D	0.998105	B	0.23650	0.089	B	0.25884	0.064	T	0.55198	-0.8178	10	0.44086	T	0.13	-13.7284	10.5194	0.44910	0.0893:0.0:0.9106:0.0	.	353	P51168	SCNNB_HUMAN	H	353;398	ENSP00000345751:R353H;ENSP00000302874:R398H	ENSP00000302874:R398H	R	+	2	0	SCNN1B	23290611	1.000000	0.71417	0.996000	0.52242	0.260000	0.26232	5.047000	0.64232	2.286000	0.76751	0.561000	0.74099	CGC		0.562	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
PMFBP1	83449	hgsc.bcm.edu	37	16	72159974	72159974	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr16:72159974G>T	ENST00000237353.10	-	15	2407	c.2146C>A	c.(2146-2148)Cag>Aag	p.Q716K	PMFBP1_ENST00000355636.6_Missense_Mutation_p.Q571K|PMFBP1_ENST00000537465.1_Missense_Mutation_p.Q721K|PMFBP1_ENST00000537792.1_5'Flank	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	721						cytoplasm (GO:0005737)		p.Q716K(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				TTCTCCTTCTGCAGAGCTTTG	0.542																																					p.Q571K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1711A	16						.						199.0	192.0	194.0					16																	72159974		2198	4300	6498	70717475	SO:0001583	missense	83449	exon16			AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.2146C>A	16.37:g.72159974G>T	ENSP00000237353:p.Gln716Lys		70717475	NM_001160213	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	37	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	G	4.005	-0.001719	0.07819	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.12255	2.71;2.71;2.7	3.65	0.36	0.16097	.	0.374505	0.19796	N	0.105871	T	0.12008	0.0292	M	0.63428	1.95	0.09310	N	1	B;B;B	0.16396	0.002;0.017;0.002	B;B;B	0.10450	0.004;0.005;0.004	T	0.30621	-0.9972	10	0.21540	T	0.41	-5.2705	6.7497	0.23480	0.0:0.3995:0.4144:0.1861	.	721;716;721	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	K	721;716;571	ENSP00000443817:Q721K;ENSP00000237353:Q716K;ENSP00000347854:Q571K	ENSP00000237353:Q716K	Q	-	1	0	PMFBP1	70717475	0.001000	0.12720	0.077000	0.20336	0.507000	0.33981	0.134000	0.15932	0.119000	0.18210	0.650000	0.86243	CAG		0.542	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293	
FANCA	2175	hgsc.bcm.edu	37	16	89815165	89815165	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr16:89815165G>A	ENST00000389301.3	-	33	3280	c.3250C>T	c.(3250-3252)Cgc>Tgc	p.R1084C	FANCA_ENST00000568369.1_Missense_Mutation_p.R1084C	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1084					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R1084C(2)		breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GAAGGCAGGCGGAGGAGGATC	0.582			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.R1084C		yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.C3250T	16						.						70.0	53.0	59.0					16																	89815165		2198	4300	6498	88342666	SO:0001583	missense	2175	exon33	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3250C>T	16.37:g.89815165G>A	ENSP00000373952:p.Arg1084Cys		88342666	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999181	0.35226	.	.	ENSG00000187741	ENST00000389301;ENST00000305699	D	0.84730	-1.89	4.63	-8.35	0.00984	.	0.932311	0.09033	N	0.858478	T	0.64681	0.2620	N	0.22421	0.69	0.09310	N	1	B;B;B	0.19073	0.003;0.033;0.033	B;B;B	0.08055	0.001;0.003;0.003	T	0.51204	-0.8735	10	0.35671	T	0.21	-0.8361	0.3315	0.00319	0.3446:0.2148:0.1318:0.3088	.	61;1084;1084	B7Z6Y4;B4DRI7;O15360	.;.;FANCA_HUMAN	C	1084;61	ENSP00000373952:R1084C	ENSP00000306281:R61C	R	-	1	0	FANCA	88342666	0.000000	0.05858	0.002000	0.10522	0.359000	0.29487	-0.857000	0.04286	-1.735000	0.01353	0.462000	0.41574	CGC		0.582	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
C3orf30	152405	hgsc.bcm.edu	37	3	118865757	118865757	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr3:118865757C>A	ENST00000295622.1	+	1	761	c.721C>A	c.(721-723)Cag>Aag	p.Q241K	IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000354673.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	241								p.Q241K(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		TCCTTCTGTACAGATTGACAG	0.463																																					p.Q241K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C721A	3						.						93.0	95.0	95.0					3																	118865757		2203	4300	6503	120348447	SO:0001583	missense	152405	exon1			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.721C>A	3.37:g.118865757C>A	ENSP00000295622:p.Gln241Lys		120348447	NM_152539	A1L4B7	Missense_Mutation	SNP	ENST00000295622.1	37	CCDS2984.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.45|16.45	3.127222|3.127222	0.56721|0.56721	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150;ENST00000473121	T|.	0.29397|.	1.57|.	3.21|3.21	3.21|3.21	0.36854|0.36854	.|.	0.586195|.	0.15404|.	N|.	0.264132|.	T|T	0.42877|0.42877	0.1222|0.1222	L|L	0.42245|0.42245	1.32|1.32	0.25430|0.25430	N|N	0.988198|0.988198	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.69479|.	0.964;0.964|.	T|T	0.27971|0.27971	-1.0058|-1.0058	10|5	0.21014|.	T|.	0.42|.	.|.	12.6766|12.6766	0.56897|0.56897	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	241;241|.	E9PFE5;Q96M34|.	.;CC030_HUMAN|.	K|K	241|204;33	ENSP00000295622:Q241K|.	ENSP00000295622:Q241K|.	Q|T	+|+	1|2	0|0	C3orf30|C3orf30	120348447|120348447	0.008000|0.008000	0.16893|0.16893	0.009000|0.009000	0.14445|0.14445	0.014000|0.014000	0.08584|0.08584	0.601000|0.601000	0.24119|0.24119	2.080000|2.080000	0.62538|0.62538	0.563000|0.563000	0.77884|0.77884	CAG|ACA		0.463	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539	
ZIC1	7545	hgsc.bcm.edu	37	3	147128622	147128622	+	Silent	SNP	G	G	A	rs150105356	byFrequency	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr3:147128622G>A	ENST00000282928.4	+	1	1452	c.723G>A	c.(721-723)tcG>tcA	p.S241S		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	241					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S241S(1)		central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						CCAAAAAGTCGTGCAACAAAA	0.582																																					p.S241S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G723A	3						.	G		4,4402	8.1+/-20.4	0,4,2199	85.0	79.0	81.0		723	1.8	1.0	3	dbSNP_134	81	0,8600		0,0,4300	no	coding-synonymous	ZIC1	NM_003412.3		0,4,6499	AA,AG,GG		0.0,0.0908,0.0308		241/448	147128622	4,13002	2203	4300	6503	148611312	SO:0001819	synonymous_variant	7545	exon1			D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.723G>A	3.37:g.147128622G>A			148611312	NM_003412	Q2M3N1	Silent	SNP	ENST00000282928.4	37	CCDS3136.1																																																																																				0.582	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
MED12L	116931	hgsc.bcm.edu	37	3	151097961	151097961	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr3:151097961A>T	ENST00000474524.1	+	30	4472	c.4434A>T	c.(4432-4434)caA>caT	p.Q1478H	MED12L_ENST00000273432.4_Missense_Mutation_p.Q1338H|P2RY12_ENST00000302632.3_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1478						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Q1478H(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTAAGGGACAAGATGAACAAA	0.373																																					p.Q1478H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4434T	3						.						121.0	122.0	122.0					3																	151097961		2203	4300	6503	152580651	SO:0001583	missense	116931	exon30			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.4434A>T	3.37:g.151097961A>T	ENSP00000417235:p.Gln1478His		152580651	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.121197	0.77436	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.34472	1.36;1.36	5.9	1.07	0.20283	.	0.000000	0.85682	D	0.000000	T	0.50599	0.1625	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	1.0;0.994;0.99	D;D;D	0.83275	0.996;0.986;0.979	T	0.49133	-0.8971	10	0.87932	D	0	-17.1242	7.7411	0.28841	0.5335:0.0:0.4665:0.0	.	1338;1477;1478	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	H	1478;1338	ENSP00000417235:Q1478H;ENSP00000273432:Q1338H	ENSP00000273432:Q1338H	Q	+	3	2	MED12L	152580651	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.312000	0.43726	0.492000	0.27815	0.528000	0.53228	CAA		0.373	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
SCN11A	11280	hgsc.bcm.edu	37	3	38888525	38888525	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr3:38888525C>T	ENST00000302328.3	-	26	5234	c.5036G>A	c.(5035-5037)cGc>cAc	p.R1679H	SCN11A_ENST00000450244.1_Missense_Mutation_p.R1679H|SCN11A_ENST00000456224.3_Missense_Mutation_p.R1641H	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1679					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R1679H(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCAGTGGAGGCGATCTTCACT	0.463																																					p.R1679H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5036A	3						.						98.0	100.0	99.0					3																	38888525		2203	4300	6503	38863529	SO:0001583	missense	11280	exon26			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.5036G>A	3.37:g.38888525C>T	ENSP00000307599:p.Arg1679His		38863529	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110215	0.56398	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.96459	-4.02;-4.02;-3.98	5.22	5.22	0.72569	.	0.172266	0.48767	D	0.000171	D	0.97532	0.9192	M	0.80746	2.51	0.26820	N	0.968814	D	0.89917	1.0	D	0.67548	0.952	D	0.93556	0.6891	10	0.87932	D	0	.	10.0219	0.42048	0.0:0.8755:0.0:0.1245	.	1679	Q9UI33	SCNBA_HUMAN	H	1679;1679;1641	ENSP00000307599:R1679H;ENSP00000400945:R1679H;ENSP00000416757:R1641H	ENSP00000307599:R1679H	R	-	2	0	SCN11A	38863529	0.543000	0.26434	0.352000	0.25734	0.996000	0.88848	2.011000	0.40922	2.427000	0.82271	0.650000	0.86243	CGC		0.463	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
LAMP3	27074	hgsc.bcm.edu	37	3	182853605	182853605	+	Silent	SNP	G	G	A	rs189726815		TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr3:182853605G>A	ENST00000265598.3	-	5	1272	c.1017C>T	c.(1015-1017)tgC>tgT	p.C339C	LAMP3_ENST00000466939.1_Silent_p.C315C	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	339					cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)		p.C339C(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			GTTCACTCACGCACTTGAAGG	0.463													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19747	0.0		0.0	False		,,,				2504	0.0				p.C339C												.	.	2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)	c.C1017T	3						.						289.0	275.0	279.0					3																	182853605		2203	4300	6503	184336299	SO:0001819	synonymous_variant	27074	exon5			AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.1017C>T	3.37:g.182853605G>A			184336299	NM_014398	D3DNS4|O94781|Q8NEC8	Silent	SNP	ENST00000265598.3	37	CCDS3242.1																																																																																				0.463	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350863.1		
MED13L	23389	hgsc.bcm.edu	37	12	116675399	116675399	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr12:116675399G>A	ENST00000281928.3	-	2	390	c.184C>T	c.(184-186)Cgc>Tgc	p.R62C	MED13L_ENST00000551197.1_5'UTR	NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	62						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.R62C(1)		NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TGCAGACAGCGGATGAAACTT	0.473																																					p.R62C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C184T	12						.						171.0	154.0	159.0					12																	116675399		2203	4300	6503	115159782	SO:0001583	missense	23389	exon2			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.184C>T	12.37:g.116675399G>A	ENSP00000281928:p.Arg62Cys		115159782	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.314859	0.81358	.	.	ENSG00000123066	ENST00000281928;ENST00000548743	T;T	0.79247	-1.25;-1.25	5.57	5.57	0.84162	Mediator complex, subunit Med13, N-terminal, metazoa/fungi (1);	0.000000	0.64402	D	0.000003	D	0.89217	0.6652	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90067	0.4160	10	0.87932	D	0	.	19.5396	0.95268	0.0:0.0:1.0:0.0	.	62	Q71F56	MD13L_HUMAN	C	62;52	ENSP00000281928:R62C;ENSP00000448553:R52C	ENSP00000281928:R62C	R	-	1	0	MED13L	115159782	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.893000	0.87330	2.628000	0.89032	0.561000	0.74099	CGC		0.473	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
SBNO1	55206	hgsc.bcm.edu	37	12	123782661	123782661	+	Silent	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr12:123782661G>A	ENST00000602398.1	-	31	4030	c.3903C>T	c.(3901-3903)tgC>tgT	p.C1301C	SBNO1_ENST00000267176.4_Silent_p.C1300C|SBNO1_ENST00000420886.2_Silent_p.C1301C|SBNO1_ENST00000602750.1_Silent_p.C1300C			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1301					regulation of transcription, DNA-templated (GO:0006355)			p.C1300C(1)		NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		AATATGTACGGCAACGAAGAC	0.418																																					p.C1300C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3900T	12						.						129.0	113.0	119.0					12																	123782661		2203	4300	6503	122348614	SO:0001819	synonymous_variant	55206	exon30			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.3903C>T	12.37:g.123782661G>A			122348614	NM_018183	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Silent	SNP	ENST00000602398.1	37	CCDS53844.1																																																																																				0.418	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
HOXC11	3227	hgsc.bcm.edu	37	12	54369081	54369081	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr12:54369081C>T	ENST00000546378.1	+	2	915	c.799C>T	c.(799-801)Cgg>Tgg	p.R267W	HOTAIR_ENST00000455246.1_RNA|HOTAIR_ENST00000424518.1_RNA|HOXC11_ENST00000243082.4_Missense_Mutation_p.P268L			O43248	HXC11_HUMAN	homeobox C11	267					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.R267W(2)		large_intestine(1)|ovary(1)	2						GCAGCTGTCCCGGATGCTGAA	0.483			T	NUP98	AML																																p.R267W			Dom	yes		12	12q13.3	3227	homeo box C11		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C799T	12						.						49.0	57.0	54.0					12																	54369081		2203	4300	6503	52655348	SO:0001583	missense	3227	exon2				CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.799C>T	12.37:g.54369081C>T	ENSP00000446680:p.Arg267Trp		52655348	NM_014212	A8K7D1|Q96DH2	Missense_Mutation	SNP	ENST00000546378.1	37	CCDS8867.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.35|16.35	3.098773|3.098773	0.56183|0.56183	.|.	.|.	ENSG00000123388|ENSG00000123388	ENST00000243082|ENST00000546378	T|D	0.28069|0.96396	1.63|-4.0	4.41|4.41	3.44|3.44	0.39384|0.39384	.|Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97785|0.97785	0.9273|0.9273	M|M	0.84773|0.84773	2.715|2.715	0.42761|0.42761	D|D	0.993803|0.993803	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.97869|0.97869	1.0285|1.0285	7|10	0.87932|0.87932	D|D	0|0	.|.	10.6524|10.6524	0.45655|0.45655	0.3191:0.6809:0.0:0.0|0.3191:0.6809:0.0:0.0	.|.	.|267	.|O43248	.|HXC11_HUMAN	L|W	268|267	ENSP00000243082:P268L|ENSP00000446680:R267W	ENSP00000243082:P268L|ENSP00000446680:R267W	P|R	+|+	2|1	0|2	HOXC11|HOXC11	52655348|52655348	0.478000|0.478000	0.25917|0.25917	0.989000|0.989000	0.46669|0.46669	0.996000|0.996000	0.88848|0.88848	0.883000|0.883000	0.28200|0.28200	2.180000|2.180000	0.69256|0.69256	0.555000|0.555000	0.69702|0.69702	CCG|CGG		0.483	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358869.2		
MYF6	4618	hgsc.bcm.edu	37	12	81101648	81101648	+	Silent	SNP	G	G	A	rs556819653		TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr12:81101648G>A	ENST00000228641.3	+	1	372	c.150G>A	c.(148-150)ccG>ccA	p.P50P		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	50					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P50P(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						AAATGCCCCCGGAAGCGGGGA	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		15952	0.0		0.0	False		,,,				2504	0.001				p.P50P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G150A	12						.						54.0	60.0	58.0					12																	81101648		2203	4300	6503	79625779	SO:0001819	synonymous_variant	4618	exon1				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.150G>A	12.37:g.81101648G>A			79625779	NM_002469	B2R898|Q53X80|Q6FHI9	Silent	SNP	ENST00000228641.3	37	CCDS9019.1																																																																																				0.612	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407756.1	NM_002469	
DDX55	57696	hgsc.bcm.edu	37	12	124101144	124101144	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr12:124101144A>G	ENST00000238146.4	+	10	1093	c.1043A>G	c.(1042-1044)aAt>aGt	p.N348S	DDX55_ENST00000538744.1_Intron|DDX55_ENST00000421670.3_5'Flank|SNORA9_ENST00000384170.1_RNA|DDX55_ENST00000541259.1_3'UTR	NM_020936.1	NP_065987.1	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	348	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.N348S(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		CCTCCCAGCAATGCAAGGTAT	0.453																																					p.N348S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1043G	12						.						158.0	154.0	155.0					12																	124101144		2203	4300	6503	122667097	SO:0001583	missense	57696	exon10			AB046815	CCDS9251.1	12q24.31	2003-06-13			ENSG00000111364	ENSG00000111364		"""DEAD-boxes"""	20085	protein-coding gene	gene with protein product						10997877	Standard	NM_020936		Approved	KIAA1595	uc001ufi.3	Q8NHQ9	OTTHUMG00000168695	ENST00000238146.4:c.1043A>G	12.37:g.124101144A>G	ENSP00000238146:p.Asn348Ser		122667097	NM_020936	Q658L6|Q8IYH0|Q9HCH7	Missense_Mutation	SNP	ENST00000238146.4	37	CCDS9251.1	.	.	.	.	.	.	.	.	.	.	A	10.01	1.234100	0.22626	.	.	ENSG00000111364	ENST00000238146;ENST00000538449	T	0.73047	-0.71	5.63	-10.5	0.00291	Helicase, C-terminal (3);	0.345936	0.39834	N	0.001259	T	0.44201	0.1282	N	0.16066	0.365	0.50467	D	0.999877	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.31024	-0.9958	10	0.12766	T	0.61	-17.0798	18.4183	0.90577	0.6976:0.0:0.3024:0.0	.	348;348	B4DVE4;Q8NHQ9	.;DDX55_HUMAN	S	348	ENSP00000238146:N348S	ENSP00000238146:N348S	N	+	2	0	DDX55	122667097	0.003000	0.15002	0.001000	0.08648	0.930000	0.56654	-0.041000	0.12084	-2.037000	0.00920	-0.993000	0.02533	AAT		0.453	DDX55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400616.2		
SNAP23	8773	hgsc.bcm.edu	37	15	42820588	42820588	+	Missense_Mutation	SNP	C	C	T	rs200612356		TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr15:42820588C>T	ENST00000249647.3	+	6	863	c.395C>T	c.(394-396)aCg>aTg	p.T132M	SNAP23_ENST00000564153.1_Intron|SNAP23_ENST00000349777.1_Intron|SNAP23_ENST00000397138.1_Intron	NM_003825.3	NP_003816.2	O00161	SNP23_HUMAN	synaptosomal-associated protein, 23kDa	132					exocytosis (GO:0006887)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle targeting (GO:0006903)	azurophil granule (GO:0042582)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|synapse (GO:0045202)		p.T132M(1)		large_intestine(1)|lung(1)	2		all_cancers(109;7.14e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;1.18e-08)|all_lung(180;4.2e-08)|Melanoma(134;0.0179)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;2.62e-06)		CAACCAACAACGGGAGCAGCC	0.453													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14686	0.0		0.0	False		,,,				2504	0.0				p.T132M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C395T	15						.	C	MET/THR,	2,4404	4.2+/-10.8	0,2,2201	76.0	64.0	68.0		395,	3.3	0.0	15		68	0,8598		0,0,4299	yes	missense,intron	SNAP23	NM_003825.3,NM_130798.2	81,	0,2,6500	TT,TC,CC		0.0,0.0454,0.0154	benign,	132/212,	42820588	2,13002	2203	4299	6502	40607880	SO:0001583	missense	8773	exon6			Y09567	CCDS10087.1, CCDS10088.1	15q14	2004-01-19	2002-08-29		ENSG00000092531	ENSG00000092531			11131	protein-coding gene	gene with protein product		602534	"""synaptosomal-associated protein, 23kD"""			9070898, 8663154	Standard	NM_003825		Approved	SNAP23A, SNAP23B, HsT17016	uc001zpz.2	O00161	OTTHUMG00000130625	ENST00000249647.3:c.395C>T	15.37:g.42820588C>T	ENSP00000249647:p.Thr132Met		40607880	NM_003825	O00162|Q13602|Q6IAE3	Missense_Mutation	SNP	ENST00000249647.3	37	CCDS10087.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.245805	0.22796	4.54E-4	0.0	ENSG00000092531	ENST00000249647	.	.	.	5.31	3.33	0.38152	SNAP-25 (1);	1.048490	0.07357	N	0.883419	T	0.32823	0.0842	L	0.33485	1.01	0.09310	N	1	P	0.52316	0.952	P	0.45538	0.484	T	0.15983	-1.0418	9	0.48119	T	0.1	-15.6453	8.5011	0.33159	0.2676:0.5439:0.1885:0.0	.	132	O00161	SNP23_HUMAN	M	132	.	ENSP00000249647:T132M	T	+	2	0	SNAP23	40607880	0.057000	0.20700	0.020000	0.16555	0.342000	0.28953	2.218000	0.42889	1.446000	0.47643	0.650000	0.86243	ACG		0.453	SNAP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253111.4	NM_003825	
SHC4	399694	hgsc.bcm.edu	37	15	49135723	49135723	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr15:49135723G>A	ENST00000332408.4	-	10	1794	c.1366C>T	c.(1366-1368)Cga>Tga	p.R456*	SHC4_ENST00000537958.1_Nonsense_Mutation_p.R170*|SHC4_ENST00000396535.3_Nonsense_Mutation_p.R213*	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	456	CH1.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.R456*(1)		breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		AGATCCACTCGGCACGTGTGC	0.463																																					p.R456X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1366T	15						.						140.0	125.0	130.0					15																	49135723		2197	4295	6492	46923015	SO:0001587	stop_gained	399694	exon10			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1366C>T	15.37:g.49135723G>A	ENSP00000329668:p.Arg456*		46923015	NM_203349	Q6UXQ3|Q8IYW3	Nonsense_Mutation	SNP	ENST00000332408.4	37	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	G	37	6.165088	0.97338	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	.	.	.	5.0	1.78	0.24846	.	0.554757	0.16037	N	0.232575	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-13.2224	7.7853	0.29089	0.0:0.1246:0.42:0.4554	.	.	.	.	X	456;213;170	.	ENSP00000329668:R456X	R	-	1	2	SHC4	46923015	0.177000	0.23109	0.335000	0.25508	0.189000	0.23516	1.245000	0.32790	0.662000	0.31006	0.650000	0.86243	CGA		0.463	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
SHC4	399694	hgsc.bcm.edu	37	15	49254793	49254793	+	Silent	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr15:49254793G>A	ENST00000332408.4	-	1	848	c.420C>T	c.(418-420)tcC>tcT	p.S140S		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	140	CH2.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)		p.S140S(1)		breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		GTGCAGTCCCGGACCTACTTA	0.627																																					p.S140S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C420T	15						.						62.0	58.0	59.0					15																	49254793		2197	4295	6492	47042085	SO:0001819	synonymous_variant	399694	exon1			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.420C>T	15.37:g.49254793G>A			47042085	NM_203349	Q6UXQ3|Q8IYW3	Silent	SNP	ENST00000332408.4	37	CCDS10130.1																																																																																				0.627	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
EPB42	2038	hgsc.bcm.edu	37	15	43500913	43500913	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr15:43500913G>A	ENST00000441366.2	-	7	1118	c.893C>T	c.(892-894)aCc>aTc	p.T298I	EPB42_ENST00000300215.3_Missense_Mutation_p.T328I|EPB42_ENST00000540029.1_Missense_Mutation_p.T220I|EPB42_ENST00000563128.1_5'Flank	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	298					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)	p.T328I(1)		endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		ACGCCCACCGGTGCCCTGTGC	0.582																																					p.T298I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C893T	15						.						86.0	90.0	89.0					15																	43500913		2203	4299	6502	41288205	SO:0001583	missense	2038	exon7			M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.893C>T	15.37:g.43500913G>A	ENSP00000396616:p.Thr298Ile		41288205	NM_001114134	Q4KKX0|Q4VB97	Missense_Mutation	SNP	ENST00000441366.2	37	CCDS45249.1	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550281	0.45383	.	.	ENSG00000166947	ENST00000300215;ENST00000540029;ENST00000441366;ENST00000397027	T;T;T	0.53857	0.6;0.6;0.6	5.15	5.15	0.70609	Transglutaminase-like (2);	0.048697	0.85682	D	0.000000	T	0.79639	0.4480	M	0.93283	3.4	0.40255	D	0.978111	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.91635	0.999;0.994;0.983;0.994	D	0.85355	0.1104	10	0.87932	D	0	-22.6173	16.1656	0.81754	0.0:0.0:1.0:0.0	.	220;298;328;298	F5H563;B7Z4C3;P16452-2;P16452	.;.;.;EPB42_HUMAN	I	328;220;298;298	ENSP00000300215:T328I;ENSP00000444699:T220I;ENSP00000396616:T298I	ENSP00000300215:T328I	T	-	2	0	EPB42	41288205	1.000000	0.71417	0.893000	0.35052	0.023000	0.10783	4.807000	0.62576	2.677000	0.91161	0.561000	0.74099	ACC		0.582	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432219.1	NM_000119	
IGDCC4	57722	hgsc.bcm.edu	37	15	65687570	65687570	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr15:65687570C>A	ENST00000352385.2	-	8	1647	c.1438G>T	c.(1438-1440)Gca>Tca	p.A480S		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	480	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A480S(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TTGTTCACTGCAAACTGGTAT	0.562																																					p.A480S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1438T	15						.						98.0	93.0	95.0					15																	65687570		2201	4299	6500	63474623	SO:0001583	missense	57722	exon8				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.1438G>T	15.37:g.65687570C>A	ENSP00000319623:p.Ala480Ser		63474623	NM_020962	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	C	35	5.471700	0.96274	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.54279	0.58	5.79	5.79	0.91817	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.72692	0.3492	M	0.70903	2.155	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67413	-0.5677	10	0.30078	T	0.28	-11.5442	20.0207	0.97499	0.0:1.0:0.0:0.0	.	480	Q8TDY8	IGDC4_HUMAN	S	480;209	ENSP00000319623:A480S	ENSP00000319623:A480S	A	-	1	0	IGDCC4	63474623	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.818000	0.86416	2.739000	0.93911	0.563000	0.77884	GCA		0.562	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
POLN	353497	hgsc.bcm.edu	37	4	2181169	2181169	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr4:2181169G>T	ENST00000511885.2	-	8	1398	c.1045C>A	c.(1045-1047)Ccc>Acc	p.P349T	POLN_ENST00000515357.1_5'UTR|POLN_ENST00000382865.1_Missense_Mutation_p.P349T			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	349					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.P349T(1)		kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			GCAATTCTGGGATCTAGCCCT	0.358								DNA polymerases (catalytic subunits)																													p.P349T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1045A	4						.						71.0	71.0	71.0					4																	2181169		2203	4300	6503	2150967	SO:0001583	missense	353497	exon6			AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.1045C>A	4.37:g.2181169G>T	ENSP00000435506:p.Pro349Thr		2150967	NM_181808	A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	ENST00000511885.2	37	CCDS3360.1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.443783	0.43429	.	.	ENSG00000130997	ENST00000511885;ENST00000382865;ENST00000253313	T;T	0.10288	2.89;2.89	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.22360	0.0539	M	0.71581	2.175	0.47698	D	0.999495	D;B	0.58620	0.983;0.04	P;B	0.57152	0.814;0.056	T	0.06899	-1.0801	10	0.02654	T	1	-19.2552	15.1521	0.72709	0.0:0.0:1.0:0.0	.	349;349	E7ERY2;Q7Z5Q5	.;DPOLN_HUMAN	T	349;349;40	ENSP00000435506:P349T;ENSP00000372316:P349T	ENSP00000253313:P40T	P	-	1	0	POLN	2150967	1.000000	0.71417	0.985000	0.45067	0.964000	0.63967	5.521000	0.67086	2.656000	0.90262	0.561000	0.74099	CCC		0.358	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205684.2	NM_181808	
GK2	2712	hgsc.bcm.edu	37	4	80329200	80329200	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr4:80329200C>A	ENST00000358842.3	-	1	172	c.155G>T	c.(154-156)tGg>tTg	p.W52L		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0	Substrate binding.				carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)	p.W52L(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						TTGTTCCACCCATCCTTCTTT	0.403																																					p.W52L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G155T	4						.						159.0	156.0	157.0					4																	80329200		2203	4300	6503	80548224	SO:0001583	missense	2712	exon1			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.155G>T	4.37:g.80329200C>A	ENSP00000351706:p.Trp52Leu		80548224	NM_033214	Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	.	.	.	.	.	.	.	.	.	.	C	17.18	3.323614	0.60634	.	.	ENSG00000196475	ENST00000358842	T	0.60920	0.15	3.73	3.73	0.42828	Carbohydrate kinase, FGGY, N-terminal (1);	0.061993	0.64402	D	0.000001	T	0.77718	0.4172	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82309	-0.0521	10	0.87932	D	0	-18.6861	13.8342	0.63400	0.0:1.0:0.0:0.0	.	52	Q14410	GLPK2_HUMAN	L	52	ENSP00000351706:W52L	ENSP00000351706:W52L	W	-	2	0	GK2	80548224	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	5.128000	0.64733	2.393000	0.81446	0.585000	0.79938	TGG		0.403	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214	
PJA1	64219	hgsc.bcm.edu	37	X	68382324	68382324	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chrX:68382324T>C	ENST00000361478.1	-	2	1135	c.758A>G	c.(757-759)gAa>gGa	p.E253G	PJA1_ENST00000477231.1_5'UTR|PJA1_ENST00000374571.4_Missense_Mutation_p.E198G|PJA1_ENST00000374583.1_Missense_Mutation_p.E253G|PJA1_ENST00000374584.3_Intron	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	253					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E253G(1)		endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						GACCACAGGTTCCTCTGCACT	0.478																																					p.E198G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A593G	X						.						64.0	55.0	58.0					X																	68382324		2203	4300	6503	68299049	SO:0001583	missense	64219	exon2			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.758A>G	X.37:g.68382324T>C	ENSP00000355014:p.Glu253Gly		68299049	NM_001032396	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	ENST00000361478.1	37	CCDS14393.1	.	.	.	.	.	.	.	.	.	.	t	12.45	1.941173	0.34283	.	.	ENSG00000181191	ENST00000396010;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T	0.06068	3.35;3.35;3.35	3.26	3.26	0.37387	.	0.000000	0.51477	U	0.000088	T	0.15955	0.0384	M	0.62723	1.935	0.20074	N	0.999935	D	0.69078	0.997	P	0.60682	0.878	T	0.01504	-1.1338	10	0.56958	D	0.05	-4.5488	9.3356	0.38049	0.0:0.0:0.0:1.0	.	253	Q8NG27	PJA1_HUMAN	G	168;253;253;198	ENSP00000363711:E253G;ENSP00000355014:E253G;ENSP00000363699:E198G	ENSP00000355014:E253G	E	-	2	0	PJA1	68299049	1.000000	0.71417	0.036000	0.18154	0.443000	0.32047	4.644000	0.61397	1.557000	0.49525	0.435000	0.28638	GAA		0.478	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119	
NHSL2	340527	hgsc.bcm.edu	37	X	71360136	71360136	+	Missense_Mutation	SNP	C	C	T	rs199696920		TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chrX:71360136C>T	ENST00000373677.1	+	2	2902	c.1640C>T	c.(1639-1641)gCg>gTg	p.A547V	NHSL2_ENST00000540800.1_Missense_Mutation_p.A913V|NHSL2_ENST00000535692.1_Missense_Mutation_p.A547V|NHSL2_ENST00000510661.1_Missense_Mutation_p.A682V			Q5HYW2	NHSL2_HUMAN	NHS-like 2	547								p.A913V(1)|p.A544V(1)		NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					ATTCAACATGCGAGACCACTC	0.557													C|||	3	0.000794702	0.0008	0.0	3775	,	,		13833	0.0		0.0	False		,,,				2504	0.002				p.A913V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2738T	X						.						97.0	74.0	82.0					X																	71360136		2203	4300	6503	71276861	SO:0001583	missense	340527	exon6					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.1640C>T	X.37:g.71360136C>T	ENSP00000362781:p.Ala547Val		71276861	NM_001013627	B2RN94	Missense_Mutation	SNP	ENST00000373677.1	37		.	.	.	.	.	.	.	.	.	.	C	0.037	-1.302794	0.01353	.	.	ENSG00000204131	ENST00000540800;ENST00000373677;ENST00000510661;ENST00000535692	T;T;T;T	0.42513	1.55;0.97;0.97;0.97	6.17	-2.7	0.06004	.	1.227940	0.05366	N	0.534589	T	0.21801	0.0525	N	0.22421	0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.14643	-1.0465	10	0.13108	T	0.6	3.9346	1.8895	0.03245	0.1481:0.3785:0.1671:0.3063	.	913;682;547	F5H593;D6RBM4;Q5HYW2	.;.;NHSL2_HUMAN	V	913;547;682;547	ENSP00000444617:A913V;ENSP00000362781:A547V;ENSP00000424079:A682V;ENSP00000444914:A547V	ENSP00000362781:A547V	A	+	2	0	NHSL2	71276861	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-0.353000	0.07691	-0.157000	0.11059	-1.474000	0.01003	GCG		0.557	NHSL2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057170.1	NM_001013627	
DACH2	117154	hgsc.bcm.edu	37	X	86069768	86069768	+	Missense_Mutation	SNP	C	C	T	rs375717534		TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chrX:86069768C>T	ENST00000373125.4	+	10	1615	c.1615C>T	c.(1615-1617)Cgc>Tgc	p.R539C	DACH2_ENST00000510272.1_Missense_Mutation_p.R320C|DACH2_ENST00000508860.1_Missense_Mutation_p.R372C|DACH2_ENST00000373131.1_Missense_Mutation_p.R526C	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	539					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R539C(2)|p.R526C(2)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						TGAATCAAAGCGCCGGGAGCA	0.438																																					p.R539C												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C1615T	X						.	C	CYS/ARG,CYS/ARG,CYS/ARG	0,3835		0,0,1632,571	59.0	54.0	55.0		1576,1114,1615	1.8	0.5	X		55	1,6727		0,1,2427,1872	no	missense,missense,missense	DACH2	NM_001139514.1,NM_001139515.1,NM_053281.3	180,180,180	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	benign,benign,benign	526/572,372/433,539/600	86069768	1,10562	2203	4300	6503	85956424	SO:0001583	missense	117154	exon10			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1615C>T	X.37:g.86069768C>T	ENSP00000362217:p.Arg539Cys		85956424	NM_053281	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.291759	0.40594	0.0	1.49E-4	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297;ENST00000484479	D;D	0.88664	-2.41;-2.38	4.76	1.79	0.24919	.	0.000000	0.64402	D	0.000011	D	0.85733	0.5765	M	0.73598	2.24	0.54753	D	0.999988	P;P;B;P	0.45531	0.515;0.86;0.412;0.545	B;B;B;B	0.39531	0.117;0.302;0.071;0.065	T	0.82376	-0.0488	10	0.72032	D	0.01	.	7.3365	0.26613	0.4253:0.4849:0.0:0.0898	.	405;539;526;539	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	C	539;526;539;372;320;372;204	ENSP00000362223:R526C;ENSP00000362217:R539C	ENSP00000345134:R539C	R	+	1	0	DACH2	85956424	1.000000	0.71417	0.501000	0.27601	0.909000	0.53808	1.148000	0.31614	0.280000	0.22209	0.415000	0.27848	CGC		0.438	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
DPP10	57628	hgsc.bcm.edu	37	2	116497469	116497469	+	Splice_Site	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr2:116497469G>A	ENST00000410059.1	+	9	1332	c.852G>A	c.(850-852)aaG>aaA	p.K284K	DPP10_ENST00000393147.2_Splice_Site_p.K288K|DPP10_ENST00000409163.1_Splice_Site_p.K234K|DPP10_ENST00000310323.8_Splice_Site_p.K277K	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	284						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)	p.K284K(1)|p.K277K(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CGTATCCTAAGGTAAGTAACA	0.423																																					p.K234K												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G702A	2						.						202.0	182.0	189.0					2																	116497469		2203	4300	6503	116213939	SO:0001630	splice_region_variant	57628	exon10			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.852+1G>A	2.37:g.116497469G>A			116213939	NM_001178036	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	37	CCDS46400.1																																																																																				0.423	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	Silent
LRP1B	53353	hgsc.bcm.edu	37	2	141528571	141528571	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr2:141528571G>T	ENST00000389484.3	-	34	6476	c.5505C>A	c.(5503-5505)agC>agA	p.S1835R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1835	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.S1835R(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGCAGGAATTGCTGCCTGCAT	0.299										TSP Lung(27;0.18)																											p.S1835R	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5505A	2						.						112.0	106.0	108.0					2																	141528571		2203	4300	6503	141245041	SO:0001583	missense	53353	exon34			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5505C>A	2.37:g.141528571G>T	ENSP00000374135:p.Ser1835Arg		141245041	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635229	0.29068	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95482	-3.72	5.77	1.7	0.24286	Six-bladed beta-propeller, TolB-like (1);	0.163547	0.53938	D	0.000044	D	0.87787	0.6265	N	0.12182	0.205	0.26254	N	0.978671	B	0.02656	0.0	B	0.04013	0.001	T	0.75811	-0.3186	10	0.28530	T	0.3	.	9.9513	0.41640	0.3507:0.0:0.6493:0.0	.	1835	Q9NZR2	LRP1B_HUMAN	R	1835;1773	ENSP00000374135:S1835R	ENSP00000374135:S1835R	S	-	3	2	LRP1B	141245041	1.000000	0.71417	0.997000	0.53966	0.328000	0.28507	0.759000	0.26461	0.029000	0.15352	0.591000	0.81541	AGC		0.299	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
STAM2	10254	hgsc.bcm.edu	37	2	152977272	152977272	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr2:152977272T>C	ENST00000263904.4	-	14	1743	c.1394A>G	c.(1393-1395)aAc>aGc	p.N465S		NM_005843.4	NP_005834.4	O75886	STAM2_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	465					endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.N465S(1)		endometrium(3)|large_intestine(4)|lung(8)|ovary(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.22)		TAGGTTAGAGTTCTGGTTCAT	0.363																																					p.N465S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1394G	2						.						157.0	144.0	148.0					2																	152977272		2203	4300	6503	152685518	SO:0001583	missense	10254	exon14			AF042274	CCDS2196.1	2q23.3	2009-04-29			ENSG00000115145	ENSG00000115145			11358	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	606244				10899310, 10993906	Standard	NM_005843		Approved	Hbp	uc002tyc.4	O75886	OTTHUMG00000131885	ENST00000263904.4:c.1394A>G	2.37:g.152977272T>C	ENSP00000263904:p.Asn465Ser		152685518	NM_005843	A8K8A0|D3DPA1|Q7LDQ0|Q9UF58	Missense_Mutation	SNP	ENST00000263904.4	37	CCDS2196.1	.	.	.	.	.	.	.	.	.	.	T	4.942	0.175039	0.09391	.	.	ENSG00000115145	ENST00000263904	T	0.17528	2.27	5.97	4.83	0.62350	.	0.412686	0.28459	N	0.015273	T	0.06645	0.0170	N	0.05124	-0.11	0.24457	N	0.994458	B	0.10296	0.003	B	0.10450	0.005	T	0.39901	-0.9591	10	0.05620	T	0.96	-10.984	7.8268	0.29320	0.0:0.2285:0.0:0.7715	.	465	O75886	STAM2_HUMAN	S	465	ENSP00000263904:N465S	ENSP00000263904:N465S	N	-	2	0	STAM2	152685518	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	0.711000	0.25764	1.099000	0.41499	0.533000	0.62120	AAC		0.363	STAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254835.2	NM_005843	
TTN	7273	hgsc.bcm.edu	37	2	179647149	179647149	+	Missense_Mutation	SNP	A	A	G	rs145940356	byFrequency	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr2:179647149A>G	ENST00000591111.1	-	20	3394	c.3170T>C	c.(3169-3171)gTt>gCt	p.V1057A	TTN_ENST00000342992.6_Missense_Mutation_p.V1057A|TTN_ENST00000342175.6_Missense_Mutation_p.V1011A|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.V1057A|TTN_ENST00000589042.1_Missense_Mutation_p.V1057A|TTN_ENST00000359218.5_Missense_Mutation_p.V1011A|TTN_ENST00000460472.2_Missense_Mutation_p.V1011A			Q8WZ42	TITIN_HUMAN	titin	32603					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V1011A(3)|p.V1057A(2)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTGACTCAACAAAGCTGGA	0.458													A|||	3	0.000599042	0.0023	0.0	5008	,	,		18465	0.0		0.0	False		,,,				2504	0.0				p.V1057A												.	.	5	Substitution - Missense(5)	large_intestine(5)	c.T3170C	2						.	A	ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL,ALA/VAL	6,4400	11.4+/-27.6	0,6,2197	44.0	47.0	46.0		3032,3032,3170,3170,3032	4.4	0.8	2	dbSNP_134	46	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133379.3,NM_133378.4,NM_003319.4	64,64,64,64,64	0,6,6497	GG,GA,AA		0.0,0.1362,0.0461	benign,benign,benign,benign,benign	1011/27119,1011/27052,1057/5605,1057/33424,1011/26927	179647149	6,13000	2203	4300	6503	179355394	SO:0001583	missense	7273	exon20			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3170T>C	2.37:g.179647149A>G	ENSP00000465570:p.Val1057Ala		179355394	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	A	12.62	1.993726	0.35131	0.001362	0.0	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.66638	-0.22;-0.05;-0.07;-0.06;0.23	5.6	4.45	0.53987	Ribonuclease H-like (1);	.	.	.	.	T	0.56307	0.1976	L	0.29908	0.895	0.21499	N	0.999664	B;B;B;B;B	0.30914	0.044;0.044;0.044;0.044;0.3	B;B;B;B;B	0.33454	0.024;0.024;0.024;0.024;0.164	T	0.53408	-0.8443	9	0.87932	D	0	.	10.2785	0.43526	0.9251:0.0:0.0749:0.0	.	1011;1011;1011;1057;1057	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	A	1057;1011;1011;1011;1011;1057	ENSP00000343764:V1057A;ENSP00000434586:V1011A;ENSP00000340554:V1011A;ENSP00000352154:V1011A;ENSP00000354117:V1057A	ENSP00000340554:V1011A	V	-	2	0	TTN	179355394	0.017000	0.18338	0.814000	0.32528	0.962000	0.63368	2.122000	0.41987	1.072000	0.40860	0.528000	0.53228	GTT		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
AKAP2	11217	hgsc.bcm.edu	37	9	112900134	112900134	+	Silent	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr9:112900134C>T	ENST00000259318.7	+	2	1824	c.1617C>T	c.(1615-1617)ggC>ggT	p.G539G	AKAP2_ENST00000434623.2_Silent_p.G628G|AKAP2_ENST00000510514.5_Silent_p.G770G|PALM2-AKAP2_ENST00000374530.3_Silent_p.G770G|AKAP2_ENST00000374525.1_Silent_p.G628G|AKAP2_ENST00000555236.1_Silent_p.G770G|PALM2-AKAP2_ENST00000302798.7_Silent_p.G770G	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	539								p.G628G(1)|p.G770G(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						GAGGAGAAGGCGTCTCCAAGT	0.537																																					p.G770G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2310T	9						.						77.0	72.0	74.0					9																	112900134		2203	4300	6503	111939955	SO:0001819	synonymous_variant	445815	exon8			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1617C>T	9.37:g.112900134C>T			111939955	NM_147150	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Silent	SNP	ENST00000259318.7	37	CCDS48003.1																																																																																				0.537	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065	
PAPPA	5069	hgsc.bcm.edu	37	9	119115107	119115107	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr9:119115107C>T	ENST00000328252.3	+	16	4456	c.4087C>T	c.(4087-4089)Cga>Tga	p.R1363*	PAPPA_ENST00000534838.1_Nonsense_Mutation_p.R401*	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1363	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R1363*(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CGCCCGGTGCCGAGAGAATAA	0.572																																					p.R1363X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C4087T	9						.						75.0	66.0	69.0					9																	119115107		2203	4300	6503	118154928	SO:0001587	stop_gained	5069	exon16				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.4087C>T	9.37:g.119115107C>T	ENSP00000330658:p.Arg1363*		118154928	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Nonsense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	46	12.455293	0.99669	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	.	.	.	5.85	3.0	0.34707	.	0.271211	0.38005	N	0.001856	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-1.329	10.0583	0.42259	0.2472:0.6887:0.0:0.0641	.	.	.	.	X	1363;401	.	ENSP00000330658:R1363X	R	+	1	2	PAPPA	118154928	1.000000	0.71417	0.914000	0.36105	0.792000	0.44763	2.623000	0.46435	0.372000	0.24591	-0.152000	0.13540	CGA		0.572	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
TRPC4	7223	hgsc.bcm.edu	37	13	38225516	38225516	+	Silent	SNP	A	A	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr13:38225516A>T	ENST00000379705.3	-	8	2822	c.1965T>A	c.(1963-1965)acT>acA	p.T655T	TRPC4_ENST00000447043.1_Silent_p.T655T|TRPC4_ENST00000358477.2_Silent_p.T655T|TRPC4_ENST00000355779.2_Silent_p.T655T|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000338947.5_Silent_p.T482T|TRPC4_ENST00000379679.1_Silent_p.T482T|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000379681.3_Silent_p.T655T			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	655	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.T655T(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CATTGAAGGGAGTAGGCAGAG	0.433																																					p.T655T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1965A	13						.						143.0	139.0	141.0					13																	38225516		2203	4300	6503	37123516	SO:0001819	synonymous_variant	7223	exon8			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1965T>A	13.37:g.38225516A>T			37123516	NM_001135957	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Silent	SNP	ENST00000379705.3	37	CCDS9365.1																																																																																				0.433	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
FREM2	341640	hgsc.bcm.edu	37	13	39262797	39262797	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr13:39262797C>T	ENST00000280481.7	+	1	1532	c.1316C>T	c.(1315-1317)cCg>cTg	p.P439L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	439					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P439L(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACAATGGCTCCGGTGGTCACC	0.542																																					p.P439L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1316T	13						.						69.0	77.0	74.0					13																	39262797		2203	4300	6503	38160797	SO:0001583	missense	341640	exon1			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1316C>T	13.37:g.39262797C>T	ENSP00000280481:p.Pro439Leu		38160797	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.118595	0.77323	.	.	ENSG00000150893	ENST00000280481	T	0.74315	-0.83	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.86602	0.5972	M	0.86028	2.79	0.80722	D	1	D	0.76494	0.999	P	0.58520	0.84	D	0.88151	0.2851	10	0.87932	D	0	.	19.9616	0.97254	0.0:1.0:0.0:0.0	.	439	Q5SZK8	FREM2_HUMAN	L	439	ENSP00000280481:P439L	ENSP00000280481:P439L	P	+	2	0	FREM2	38160797	1.000000	0.71417	0.252000	0.24328	0.984000	0.73092	7.780000	0.85658	2.724000	0.93272	0.561000	0.74099	CCG		0.542	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
PCDH17	27253	hgsc.bcm.edu	37	13	58208014	58208014	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr13:58208014G>A	ENST00000377918.3	+	1	1360	c.1334G>A	c.(1333-1335)cGg>cAg	p.R445Q		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	445	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R445Q(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		ATCGTGGCGCGGGACGGGGGC	0.582																																					p.R445Q	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1334A	13						.						53.0	40.0	44.0					13																	58208014		2201	4299	6500	57106015	SO:0001583	missense	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1334G>A	13.37:g.58208014G>A	ENSP00000367151:p.Arg445Gln		57106015	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.856093	0.51376	.	.	ENSG00000118946	ENST00000377918	T	0.52754	0.65	5.7	5.7	0.88788	Cadherin (5);Cadherin-like (1);	0.094031	0.64402	D	0.000001	T	0.53674	0.1811	L	0.41906	1.305	0.36972	D	0.893864	D;D	0.55800	0.967;0.973	P;P	0.52481	0.491;0.7	T	0.53940	-0.8367	9	.	.	.	.	19.8477	0.96722	0.0:0.0:1.0:0.0	.	445;445	O14917-2;O14917	.;PCD17_HUMAN	Q	445	ENSP00000367151:R445Q	.	R	+	2	0	PCDH17	57106015	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	5.347000	0.65998	2.704000	0.92352	0.650000	0.86243	CGG		0.582	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
PCDH9	5101	hgsc.bcm.edu	37	13	67802288	67802288	+	Silent	SNP	T	T	C			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr13:67802288T>C	ENST00000377865.2	-	1	419	c.285A>G	c.(283-285)gaA>gaG	p.E95E	PCDH9_ENST00000328454.5_Silent_p.E95E|PCDH9_ENST00000544246.1_Silent_p.E95E|PCDH9_ENST00000456367.1_Silent_p.E95E|PCDH9_ENST00000377861.3_Silent_p.E95E			Q9HC56	PCDH9_HUMAN	protocadherin 9	95	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E95E(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CACAGAGTTTTTCTCTGTCTA	0.448																																					p.E95E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A285G	13						.						52.0	49.0	50.0					13																	67802288		2203	4300	6503	66700289	SO:0001819	synonymous_variant	5101	exon2			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.285A>G	13.37:g.67802288T>C			66700289	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Silent	SNP	ENST00000377865.2	37	CCDS9444.1																																																																																				0.448	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
GPC6	10082	hgsc.bcm.edu	37	13	94482727	94482727	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr13:94482727G>A	ENST00000377047.4	+	3	1255	c.640G>A	c.(640-642)Gcc>Acc	p.A214T	GPC6-AS2_ENST00000445540.1_RNA	NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	214					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.A214T(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GGTTACCCGCGCCTTCATTGC	0.493																																					p.A214T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G640A	13						.						56.0	54.0	55.0					13																	94482727		2203	4300	6503	93280728	SO:0001583	missense	10082	exon3			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.640G>A	13.37:g.94482727G>A	ENSP00000366246:p.Ala214Thr		93280728	NM_005708	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	CCDS9469.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566736	0.86439	.	.	ENSG00000183098	ENST00000377047	T	0.59083	0.29	5.49	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.72526	0.3471	M	0.79258	2.445	0.46298	D	0.998978	D;P	0.60575	0.988;0.943	P;P	0.58130	0.833;0.694	T	0.76187	-0.3051	10	0.49607	T	0.09	.	16.1766	0.81857	0.0:0.0:0.8657:0.1343	.	214;214	B4E2M1;Q9Y625	.;GPC6_HUMAN	T	214	ENSP00000366246:A214T	ENSP00000366246:A214T	A	+	1	0	GPC6	93280728	1.000000	0.71417	0.976000	0.42696	0.867000	0.49689	7.583000	0.82559	1.477000	0.48234	-0.164000	0.13417	GCC		0.493	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	
COL4A1	1282	hgsc.bcm.edu	37	13	110838882	110838882	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr13:110838882C>A	ENST00000375820.4	-	26	1868	c.1747G>T	c.(1747-1749)Gga>Tga	p.G583*		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	583	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.G583*(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCACGCTCTCCTTTCAATCCT	0.547																																					p.G583X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1747T	13						.						29.0	33.0	31.0					13																	110838882		2203	4300	6503	109636883	SO:0001587	stop_gained	1282	exon26			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1747G>T	13.37:g.110838882C>A	ENSP00000364979:p.Gly583*		109636883	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Nonsense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	C	39	7.797315	0.98495	.	.	ENSG00000187498	ENST00000375820	.	.	.	4.12	4.12	0.48240	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.93	0.86188	0.0:1.0:0.0:0.0	.	.	.	.	X	583	.	ENSP00000364979:G583X	G	-	1	0	COL4A1	109636883	1.000000	0.71417	0.998000	0.56505	0.713000	0.41058	6.729000	0.74775	2.284000	0.76573	0.655000	0.94253	GGA		0.547	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
MYO3A	53904	hgsc.bcm.edu	37	10	26385320	26385320	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr10:26385320A>C	ENST00000265944.5	+	16	1739	c.1573A>C	c.(1573-1575)Aat>Cat	p.N525H	MYO3A_ENST00000543632.1_Missense_Mutation_p.N525H	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	525	Myosin motor.		N -> K (in an ovarian mucinous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N525H(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TGGAGAAAAAAATTTTCATAT	0.318																																					p.N525H												MYO3A,ovary,NS,Substitution - Missense,-2	.	1	Substitution - Missense(1)	ovary(1)	c.A1573C	10						.						30.0	33.0	32.0					10																	26385320		2194	4285	6479	26425326	SO:0001583	missense	53904	exon16			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1573A>C	10.37:g.26385320A>C	ENSP00000265944:p.Asn525His		26425326	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.228298	0.79576	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	T;D	0.89746	-1.09;-2.56	5.48	5.48	0.80851	Myosin head, motor domain (2);	0.042713	0.85682	D	0.000000	D	0.96605	0.8892	H	0.97659	4.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	D	0.98093	1.0410	10	0.87932	D	0	.	15.8746	0.79151	1.0:0.0:0.0:0.0	.	525;525;525	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	H	525	ENSP00000265944:N525H;ENSP00000445909:N525H	ENSP00000265944:N525H	N	+	1	0	MYO3A	26425326	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.910000	0.92685	2.205000	0.71048	0.533000	0.62120	AAT		0.318	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
ANXA11	311	hgsc.bcm.edu	37	10	81918886	81918886	+	Missense_Mutation	SNP	C	C	T	rs146683788	byFrequency	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr10:81918886C>T	ENST00000438331.1	-	14	1728	c.1246G>A	c.(1246-1248)Ggg>Agg	p.G416R	ANXA11_ENST00000422982.3_Missense_Mutation_p.G416R|ANXA11_ENST00000537102.1_Missense_Mutation_p.G383R|ANXA11_ENST00000535999.1_Missense_Mutation_p.G416R|ANXA11_ENST00000360615.4_Missense_Mutation_p.G416R|ANXA11_ENST00000265447.4_Missense_Mutation_p.G416R|ANXA11_ENST00000372231.3_Missense_Mutation_p.G416R	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	416					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)	p.G416R(1)		endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			TCCAGGTCCCCGGACATCTCC	0.557																																					p.G416R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1246A	10						.	C	ARG/GLY,ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	109.0	92.0	98.0		1246,1246,1246	4.2	0.8	10	dbSNP_134	98	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	ANXA11	NM_001157.2,NM_145868.1,NM_145869.1	125,125,125	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging,probably-damaging	416/506,416/506,416/506	81918886	2,13004	2203	4300	6503	81908866	SO:0001583	missense	311	exon14			L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.1246G>A	10.37:g.81918886C>T	ENSP00000398610:p.Gly416Arg		81908866	NM_145869	B4DVE7	Missense_Mutation	SNP	ENST00000438331.1	37	CCDS7364.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552073	0.86127	2.27E-4	1.16E-4	ENSG00000122359	ENST00000372231;ENST00000422982;ENST00000438331;ENST00000372234;ENST00000360615;ENST00000265447;ENST00000535999;ENST00000424188;ENST00000537102;ENST00000372219	T;T;T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19;2.19;2.19	5.14	4.23	0.50019	Annexin repeat, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.55768	0.1941	M	0.93638	3.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75484	0.986;0.91;0.91	T	0.68674	-0.5346	10	0.72032	D	0.01	.	13.7781	0.63066	0.0:0.8448:0.1552:0.0	.	516;416;416	B7Z6L0;Q5T0G8;P50995	.;.;ANX11_HUMAN	R	416;416;416;416;416;416;416;323;383;63	ENSP00000361305:G416R;ENSP00000404412:G416R;ENSP00000398610:G416R;ENSP00000353827:G416R;ENSP00000265447:G416R;ENSP00000441748:G416R;ENSP00000441400:G383R	ENSP00000265447:G416R	G	-	1	0	ANXA11	81908866	1.000000	0.71417	0.840000	0.33206	0.955000	0.61496	7.687000	0.84139	1.308000	0.44962	0.655000	0.94253	GGG		0.557	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049044.1	NM_145869	
SORCS1	114815	hgsc.bcm.edu	37	10	108458990	108458990	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr10:108458990G>C	ENST00000263054.6	-	9	1402	c.1395C>G	c.(1393-1395)atC>atG	p.I465M	SORCS1_ENST00000369698.1_De_novo_Start_InFrame|SORCS1_ENST00000344440.6_Missense_Mutation_p.I465M	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	465					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.I465M(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GGTCGATCATGATGTTGCCCT	0.542																																					p.I465M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1395G	10						.						231.0	177.0	195.0					10																	108458990		2203	4300	6503	108448980	SO:0001583	missense	114815	exon9			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1395C>G	10.37:g.108458990G>C	ENSP00000263054:p.Ile465Met		108448980	NM_052918	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	G	15.66	2.900309	0.52227	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.34859	1.34;1.34	6.16	6.16	0.99307	VPS10 (1);	0.424878	0.25543	N	0.029942	T	0.43765	0.1262	L	0.44542	1.39	0.34619	D	0.718365	B;P;B;B;B	0.36683	0.429;0.565;0.338;0.429;0.338	B;P;B;B;B	0.47299	0.24;0.543;0.419;0.24;0.419	T	0.47861	-0.9084	9	.	.	.	-10.2944	16.5188	0.84308	0.0:0.1647:0.8353:0.0	.	465;465;465;465;465	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	M	465	ENSP00000263054:I465M;ENSP00000345964:I465M	.	I	-	3	3	SORCS1	108448980	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	1.756000	0.38390	2.937000	0.99478	0.650000	0.86243	ATC		0.542	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
APC	324	hgsc.bcm.edu	37	5	112128191	112128191	+	Nonsense_Mutation	SNP	C	C	T	rs397515734		TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr5:112128191C>T	ENST00000457016.1	+	7	1074	c.694C>T	c.(694-696)Cga>Tga	p.R232*	APC_ENST00000257430.4_Nonsense_Mutation_p.R232*|APC_ENST00000508376.2_Nonsense_Mutation_p.R232*			P25054	APC_HUMAN	adenomatous polyposis coli	232	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R232*(13)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACTTCGTATACGACAGCTTTT	0.308		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R232X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0	.	13	Substitution - Nonsense(13)	large_intestine(13)	c.C694T	5	GRCh37	CM920029	APC	M		.						82.0	79.0	80.0					5																	112128191		2202	4300	6502	112156090	SO:0001587	stop_gained	324	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.694C>T	5.37:g.112128191C>T	ENSP00000413133:p.Arg232*		112156090	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	8.033640	0.98621	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.19	4.32	0.51571	.	0.206644	0.42682	D	0.000664	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.475	13.9715	0.64242	0.2757:0.7243:0.0:0.0	.	.	.	.	X	232	.	ENSP00000257430:R232X	R	+	1	2	APC	112156090	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.535000	0.36061	1.304000	0.44892	-0.158000	0.13435	CGA		0.308	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	hgsc.bcm.edu	37	5	112174745	112174745	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr5:112174745C>T	ENST00000457016.1	+	16	3834	c.3454C>T	c.(3454-3456)Cag>Tag	p.Q1152*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1152*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1152*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1152	Asp/Glu-rich (acidic).|Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1152*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGAAGAAGAACAGCATGAAGA	0.333		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1134X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.C3400T	5	GRCh37	CM970087	APC	M		.						61.0	60.0	60.0					5																	112174745		2202	4300	6502	112202644	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3454C>T	5.37:g.112174745C>T	ENSP00000413133:p.Gln1152*		112202644	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	6.700788	0.97772	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-8.5428	19.9738	0.97296	0.0:1.0:0.0:0.0	.	.	.	.	X	1152;1134;1152;1152;1152	.	ENSP00000257430:Q1152X	Q	+	1	0	APC	112202644	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.017000	0.64047	2.732000	0.93576	0.655000	0.94253	CAG		0.333	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
BRD9	65980	hgsc.bcm.edu	37	5	884151	884151	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr5:884151A>C	ENST00000467963.1	-	8	1034	c.868T>G	c.(868-870)Ttg>Gtg	p.L290V	BRD9_ENST00000483173.1_Missense_Mutation_p.L237V|BRD9_ENST00000435709.2_Missense_Mutation_p.L174V|BRD9_ENST00000323510.4_Missense_Mutation_p.L194V|BRD9_ENST00000494422.1_Intron|BRD9_ENST00000388890.4_Missense_Mutation_p.L174V	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	290					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)	p.L194V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			CTGTCCGTCAAGCTGCAGGCA	0.637																																					p.L290V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T868G	5						.						114.0	90.0	98.0					5																	884151		2203	4300	6503	937151	SO:0001583	missense	65980	exon8			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.868T>G	5.37:g.884151A>C	ENSP00000419765:p.Leu290Val		937151	NM_023924	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	ENST00000467963.1	37	CCDS34127.2	.	.	.	.	.	.	.	.	.	.	A	11.06	1.528527	0.27299	.	.	ENSG00000028310	ENST00000323510;ENST00000388890;ENST00000483173;ENST00000467963;ENST00000435709;ENST00000489093	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	5.03	2.26	0.28386	.	0.144113	0.47852	D	0.000213	T	0.36138	0.0956	M	0.65975	2.015	0.53688	D	0.99997	B;B;B;B	0.26577	0.153;0.059;0.048;0.107	B;B;B;B	0.25987	0.065;0.038;0.023;0.034	T	0.08289	-1.0729	10	0.20046	T	0.44	-12.4047	7.9669	0.30104	0.3251:0.0:0.6749:0.0	.	237;290;194;174	B4DMQ2;Q9H8M2;Q9H8M2-1;Q9H8M2-3	.;BRD9_HUMAN;.;.	V	194;174;237;290;174;194	ENSP00000323557:L194V;ENSP00000373542:L174V;ENSP00000419845:L237V;ENSP00000419765:L290V;ENSP00000402984:L174V;ENSP00000420722:L194V	ENSP00000323557:L194V	L	-	1	2	BRD9	937151	1.000000	0.71417	0.998000	0.56505	0.872000	0.50106	1.193000	0.32162	0.166000	0.19597	-0.231000	0.12243	TTG		0.637	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354113.1	NM_023924	
PCDHB5	26167	hgsc.bcm.edu	37	5	140515989	140515989	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3531-01A-01W-0831-10	TCGA-AA-3531-10A-01W-0831-10	g.chr5:140515989G>A	ENST00000231134.5	+	1	1190	c.973G>A	c.(973-975)Ggc>Agc	p.G325S		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	325	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G325S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGATGGTGGGGGCCTTTCAGG	0.473																																					p.G325S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G973A	5						.						108.0	117.0	114.0					5																	140515989		2203	4300	6503	140496173	SO:0001583	missense	26167	exon1			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.973G>A	5.37:g.140515989G>A	ENSP00000231134:p.Gly325Ser		140496173	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729180	0.48833	.	.	ENSG00000113209	ENST00000231134;ENST00000537936	T	0.52057	0.68	5.3	4.43	0.53597	Cadherin (6);Cadherin-like (1);	.	.	.	.	T	0.58409	0.2120	L	0.33245	0.995	0.24996	N	0.991508	D	0.71674	0.998	D	0.79108	0.992	T	0.53528	-0.8426	9	0.62326	D	0.03	.	14.2692	0.66140	0.0724:0.0:0.9276:0.0	.	325	Q9Y5E4	PCDB5_HUMAN	S	325;109	ENSP00000231134:G325S	ENSP00000231134:G325S	G	+	1	0	PCDHB5	140496173	0.837000	0.29446	0.025000	0.17156	0.669000	0.39330	1.934000	0.40163	1.383000	0.46405	0.505000	0.49811	GGC		0.473	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
