#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PIK3CG	5294	hgsc.bcm.edu	37	7	106513165	106513165	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr7:106513165G>T	ENST00000359195.3	+	4	2379	c.2069G>T	c.(2068-2070)aGa>aTa	p.R690I	PIK3CG_ENST00000440650.2_Missense_Mutation_p.R690I|PIK3CG_ENST00000496166.1_Missense_Mutation_p.R690I	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	690	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R690I(1)		breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						CAGAACAAAAGAATTGGTCAC	0.403																																					p.R690I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2069T	7						.						96.0	95.0	95.0					7																	106513165		2203	4300	6503	106300401	SO:0001583	missense	5294	exon4				CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.2069G>T	7.37:g.106513165G>T	ENSP00000352121:p.Arg690Ile		106300401	NM_002649	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	37	CCDS5739.1	.	.	.	.	.	.	.	.	.	.	G	34	5.332673	0.95733	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.63417	-0.04;-0.04;-0.04	5.92	5.92	0.95590	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75042	0.3796	L	0.60067	1.865	0.80722	D	1	P	0.51240	0.943	P	0.58130	0.833	T	0.74160	-0.3755	10	0.56958	D	0.05	-23.7298	20.3206	0.98668	0.0:0.0:1.0:0.0	.	690	P48736	PK3CG_HUMAN	I	690	ENSP00000392258:R690I;ENSP00000419260:R690I;ENSP00000352121:R690I	ENSP00000352121:R690I	R	+	2	0	PIK3CG	106300401	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.809000	0.96659	0.655000	0.94253	AGA		0.403	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1		
DYNC1H1	1778	hgsc.bcm.edu	37	14	102499675	102499675	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr14:102499675G>A	ENST00000360184.4	+	54	10431	c.10267G>A	c.(10267-10269)Gcc>Acc	p.A3423T	RP11-1017G21.4_ENST00000557551.1_RNA|DYNC1H1_ENST00000556791.1_3'UTR	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3423	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.A3423T(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GGAAGATGACGCCAAGGACAA	0.512																																					p.A3423T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10267A	14						.						102.0	100.0	101.0					14																	102499675		2203	4300	6503	101569428	SO:0001583	missense	1778	exon54			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10267G>A	14.37:g.102499675G>A	ENSP00000348965:p.Ala3423Thr		101569428	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	32	5.166834	0.94768	.	.	ENSG00000197102	ENST00000360184	T	0.74209	-0.82	5.77	5.77	0.91146	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.83862	0.5346	M	0.75085	2.285	0.80722	D	1	D	0.64830	0.994	P	0.55391	0.775	D	0.84295	0.0502	10	0.54805	T	0.06	.	19.9792	0.97320	0.0:0.0:1.0:0.0	.	3423	Q14204	DYHC1_HUMAN	T	3423	ENSP00000348965:A3423T	ENSP00000348965:A3423T	A	+	1	0	DYNC1H1	101569428	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.748000	0.98867	2.727000	0.93392	0.591000	0.81541	GCC		0.512	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
TMC4	147798	hgsc.bcm.edu	37	19	54664067	54664067	+	Silent	SNP	C	C	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr19:54664067C>A	ENST00000376591.4	-	15	2246	c.2115G>T	c.(2113-2115)ctG>ctT	p.L705L	TMC4_ENST00000416963.1_Silent_p.L287L|TMC4_ENST00000301187.4_Silent_p.L699L|LENG1_ENST00000222224.3_5'Flank	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	705					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.L699L(1)|p.L287L(1)		breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TGGTGGAGGTCAGCGCCACAG	0.582																																					p.L705L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2115T	19						.						84.0	94.0	91.0					19																	54664067		2203	4300	6503	59355879	SO:0001819	synonymous_variant	147798	exon15			AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.2115G>T	19.37:g.54664067C>A			59355879	NM_001145303	Q7Z5M3|Q8N5E4|Q8TBS7	Silent	SNP	ENST00000376591.4	37	CCDS46174.1																																																																																				0.582	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000156164.2		
PLAT	5327	hgsc.bcm.edu	37	8	42045526	42045526	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr8:42045526C>T	ENST00000220809.4	-	5	518	c.262G>A	c.(262-264)Gag>Aag	p.E88K	PLAT_ENST00000270189.6_Missense_Mutation_p.E88K|PLAT_ENST00000524009.1_Missense_Mutation_p.E88K|PLAT_ENST00000352041.3_Missense_Mutation_p.E42K|PLAT_ENST00000429710.2_Intron|PLAT_ENST00000429089.2_Missense_Mutation_p.E88K|PLAT_ENST00000519510.1_Missense_Mutation_p.E88K	NM_000930.3	NP_000921.1	P00750	TPA_HUMAN	plasminogen activator, tissue	88	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|fibrinolysis (GO:0042730)|negative regulation of proteolysis (GO:0045861)|plasminogen activation (GO:0031639)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of ovulation (GO:0060279)|proteolysis (GO:0006508)|regulation of synaptic plasticity (GO:0048167)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|smooth muscle cell migration (GO:0014909)|synaptic transmission, glutamatergic (GO:0035249)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|synapse (GO:0045202)	serine-type endopeptidase activity (GO:0004252)	p.E88K(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|skin(1)|soft_tissue(1)|urinary_tract(1)	27	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Aminocaproic Acid(DB00513)|Ibuprofen(DB01050)|Iloprost(DB01088)|Urokinase(DB00013)	CACCTTGGCTCGCTGCAACCT	0.542																																					p.E42K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G124A	8						.						63.0	60.0	61.0					8																	42045526		2203	4300	6503	42164683	SO:0001583	missense	5327	exon4				CCDS6126.1, CCDS6127.1	8p11.21	2012-10-02			ENSG00000104368	ENSG00000104368			9051	protein-coding gene	gene with protein product		173370					Standard	NM_033011		Approved		uc003xos.2	P00750	OTTHUMG00000164072	ENST00000220809.4:c.262G>A	8.37:g.42045526C>T	ENSP00000220809:p.Glu88Lys		42164683	NM_033011	A8K022|B2R8E8|Q15103|Q503B0|Q6PJA5|Q7Z7N2|Q86YK8|Q9BU99|Q9BZW1	Missense_Mutation	SNP	ENST00000220809.4	37	CCDS6126.1	.	.	.	.	.	.	.	.	.	.	C	7.959	0.746629	0.15710	.	.	ENSG00000104368	ENST00000270189;ENST00000429089;ENST00000220809;ENST00000352041;ENST00000519510;ENST00000524009;ENST00000520523;ENST00000521694	D;D;D;D;D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04	5.73	1.59	0.23543	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.389028	0.30473	N	0.009547	T	0.79528	0.4461	N	0.20610	0.595	0.09310	N	1	B;P;B;B	0.39696	0.006;0.683;0.221;0.382	B;B;B;B	0.36885	0.009;0.235;0.023;0.09	T	0.69483	-0.5133	10	0.15952	T	0.53	.	2.6211	0.04917	0.1331:0.434:0.2602:0.1727	.	88;88;42;88	B4DN26;B4DV92;P00750-3;P00750	.;.;.;TPA_HUMAN	K	88;88;88;42;88;88;88;88	ENSP00000270189:E88K;ENSP00000392045:E88K;ENSP00000220809:E88K;ENSP00000270188:E42K;ENSP00000428886:E88K;ENSP00000429401:E88K;ENSP00000428797:E88K;ENSP00000429801:E88K	ENSP00000220809:E88K	E	-	1	0	PLAT	42164683	0.062000	0.20869	0.000000	0.03702	0.000000	0.00434	1.653000	0.37323	0.317000	0.23160	-0.181000	0.13052	GAG		0.542	PLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377100.1	NM_000930	
SLCO5A1	81796	hgsc.bcm.edu	37	8	70591710	70591710	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr8:70591710G>A	ENST00000260126.4	-	8	2633	c.1927C>T	c.(1927-1929)Cgg>Tgg	p.R643W	SLCO5A1_ENST00000530307.1_Missense_Mutation_p.R588W|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.R643W	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	643						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.R643W(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TTGCAGGTCCGTTTACATTTC	0.458																																					p.R643W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1927T	8						.						200.0	204.0	203.0					8																	70591710		2203	4300	6503	70754264	SO:0001583	missense	81796	exon8			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1927C>T	8.37:g.70591710G>A	ENSP00000260126:p.Arg643Trp		70754264	NM_030958	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.212955	0.79352	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.40476	1.03;1.03;1.03	5.52	5.52	0.82312	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.067005	0.64402	D	0.000015	T	0.64681	0.2620	M	0.61703	1.905	0.49389	D	0.999783	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	T	0.66160	-0.5993	10	0.72032	D	0.01	.	19.4562	0.94892	0.0:0.0:1.0:0.0	.	588;643;643	E9PKK5;Q9H2Y9;G3V1C0	.;SO5A1_HUMAN;.	W	643;643;588	ENSP00000260126:R643W;ENSP00000434422:R643W;ENSP00000431611:R588W	ENSP00000260126:R643W	R	-	1	2	SLCO5A1	70754264	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	5.445000	0.66594	2.585000	0.87301	0.655000	0.94253	CGG		0.458	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
DCAF4L2	138009	hgsc.bcm.edu	37	8	88885863	88885863	+	Missense_Mutation	SNP	G	G	A	rs560566567		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr8:88885863G>A	ENST00000319675.3	-	1	433	c.337C>T	c.(337-339)Cgg>Tgg	p.R113W		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	113								p.R113W(2)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GGGTATACCCGGAGCTCAGGG	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		19040	0.0		0.001	False		,,,				2504	0.0				p.R113W												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C337T	8						.						134.0	129.0	131.0					8																	88885863		2203	4300	6503	88954979	SO:0001583	missense	138009	exon1			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.337C>T	8.37:g.88885863G>A	ENSP00000316496:p.Arg113Trp		88954979	NM_152418		Missense_Mutation	SNP	ENST00000319675.3	37	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	G	9.197	1.027510	0.19512	.	.	ENSG00000176566	ENST00000319675	T	0.62105	0.05	1.39	-2.79	0.05841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.604357	0.19009	N	0.125123	T	0.37598	0.1009	N	0.08118	0	0.09310	N	1	P	0.46395	0.877	P	0.44860	0.462	T	0.43196	-0.9406	10	0.66056	D	0.02	.	6.4276	0.21778	0.0:0.0:0.4796:0.5203	.	113	Q8NA75	DC4L2_HUMAN	W	113	ENSP00000316496:R113W	ENSP00000316496:R113W	R	-	1	2	DCAF4L2	88954979	1.000000	0.71417	0.002000	0.10522	0.002000	0.02628	1.618000	0.36954	-0.170000	0.10816	-0.706000	0.03657	CGG		0.537	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
RUNX1T1	862	hgsc.bcm.edu	37	8	92982954	92982954	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr8:92982954C>T	ENST00000523629.1	-	11	1925	c.1471G>A	c.(1471-1473)Gcc>Acc	p.A491T	RUNX1T1_ENST00000520724.1_Missense_Mutation_p.A454T|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.A464T|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.A491T|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.A454T|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.A464T|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.A454T|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.A502T	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	491					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A491T(2)|p.A454T(2)|p.A502T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TTGGCCTCGGCGACCGTGCGC	0.602																																					p.A491T												.	.	5	Substitution - Missense(5)	lung(3)|large_intestine(2)	c.G1471A	8						.						71.0	61.0	64.0					8																	92982954		2203	4300	6503	93052130	SO:0001583	missense	862	exon12			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1471G>A	8.37:g.92982954C>T	ENSP00000428543:p.Ala491Thr		93052130	NM_001198626	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	C	32	5.157358	0.94686	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.67154	0.2863	M	0.83603	2.65	0.58432	D	0.999996	D;D;D;D	0.67145	0.994;0.996;0.995;0.984	P;P;P;P	0.62184	0.82;0.899;0.838;0.773	T	0.68062	-0.5508	10	0.48119	T	0.1	-15.9301	19.9981	0.97395	0.0:1.0:0.0:0.0	.	502;454;491;464	E7EPN4;Q7Z4J5;Q06455;Q06455-2	.;.;MTG8_HUMAN;.	T	491;464;491;454;454;454;502;464	ENSP00000428543:A491T;ENSP00000379520:A464T;ENSP00000265814:A491T;ENSP00000353504:A454T;ENSP00000390137:A454T;ENSP00000428742:A454T;ENSP00000402257:A502T;ENSP00000430728:A464T	ENSP00000265814:A491T	A	-	1	0	RUNX1T1	93052130	1.000000	0.71417	0.954000	0.39281	0.838000	0.47535	5.999000	0.70665	2.729000	0.93468	0.655000	0.94253	GCC		0.602	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
SLA	6503	hgsc.bcm.edu	37	8	134062169	134062169	+	Missense_Mutation	SNP	A	A	G	rs536012943		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr8:134062169A>G	ENST00000338087.5	-	5	1045	c.226T>C	c.(226-228)Tgt>Cgt	p.C76R	SLA_ENST00000395352.3_Missense_Mutation_p.C93R|TG_ENST00000220616.4_Intron|SLA_ENST00000517648.1_Missense_Mutation_p.C93R|SLA_ENST00000518565.1_5'UTR|TG_ENST00000519543.1_Intron|TG_ENST00000542445.1_Intron|SLA_ENST00000427060.2_Missense_Mutation_p.C116R|TG_ENST00000377869.1_Intron|SLA_ENST00000524345.1_5'UTR	NM_001045556.2	NP_001039021.1	Q13239	SLAP1_HUMAN	Src-like-adaptor	76	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				positive regulation of signal transduction (GO:0009967)	endosome (GO:0005768)	SH3/SH2 adaptor activity (GO:0005070)	p.C76R(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(6)|prostate(1)|skin(1)	17	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			CTGGCCACACATATTCCAGGG	0.448																																					p.C76R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T226C	8						.						145.0	121.0	129.0					8																	134062169		2203	4300	6503	134131351	SO:0001583	missense	6503	exon5				CCDS6370.1, CCDS47922.1, CCDS47923.1, CCDS64977.1, CCDS64978.1	8q24.22	2013-09-19	2001-11-28		ENSG00000155926	ENSG00000155926		"""SH2 domain containing"""	10902	protein-coding gene	gene with protein product		601099	"""Src-like-adapter"""			8825655, 11179692	Standard	NM_001045556		Approved	SLA1	uc011ljd.2	Q13239	OTTHUMG00000164439	ENST00000338087.5:c.226T>C	8.37:g.134062169A>G	ENSP00000337548:p.Cys76Arg		134131351	NM_001045556	B7Z4J2|B7Z4L6|Q6FI01|Q9UMQ8	Missense_Mutation	SNP	ENST00000338087.5	37	CCDS6370.1	.	.	.	.	.	.	.	.	.	.	A	12.93	2.085187	0.36758	.	.	ENSG00000155926	ENST00000338087;ENST00000427060;ENST00000395352;ENST00000517648;ENST00000522119;ENST00000519341	T;T;T;D;D;T	0.92199	-1.15;-1.1;-1.1;-2.99;-2.99;1.27	5.65	5.65	0.86999	Src homology-3 domain (3);	0.138103	0.64402	D	0.000002	D	0.84960	0.5588	N	0.12182	0.205	0.58432	D	0.999998	P;B;B;B;B;B	0.43287	0.802;0.393;0.393;0.167;0.023;0.393	B;B;B;B;B;B	0.41036	0.346;0.085;0.085;0.029;0.075;0.085	D	0.85678	0.1299	10	0.36615	T	0.2	-12.7543	13.8223	0.63329	1.0:0.0:0.0:0.0	.	93;76;76;76;76;76	B7Z4J2;Q6FI01;Q5TZW1;E5RHT2;E5RJ69;Q13239	.;.;.;.;.;SLAP1_HUMAN	R	76;116;93;93;76;76	ENSP00000337548:C76R;ENSP00000394049:C116R;ENSP00000378759:C93R;ENSP00000428559:C93R;ENSP00000430596:C76R;ENSP00000429681:C76R	ENSP00000337548:C76R	C	-	1	0	SLA	134131351	1.000000	0.71417	0.946000	0.38457	0.942000	0.58702	5.485000	0.66850	2.151000	0.67156	0.533000	0.62120	TGT		0.448	SLA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378771.1		
ANKRD35	148741	hgsc.bcm.edu	37	1	145560919	145560919	+	Missense_Mutation	SNP	C	C	T	rs587664764	byFrequency	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr1:145560919C>T	ENST00000355594.4	+	9	863	c.776C>T	c.(775-777)gCa>gTa	p.A259V	ANKRD35_ENST00000544626.1_3'UTR	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	259								p.A259V(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCAGATCTCGCATCCCAGGTA	0.488																																					p.A259V	Melanoma(9;127 754 22988 51047)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C776T	1						.						135.0	135.0	135.0					1																	145560919		2203	4300	6503	144272276	SO:0001583	missense	148741	exon9			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.776C>T	1.37:g.145560919C>T	ENSP00000347802:p.Ala259Val		144272276	NM_144698	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	CCDS919.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380768	0.42207	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.68624	-0.34	5.39	3.47	0.39725	.	1.194980	0.06009	N	0.649256	T	0.34279	0.0892	L	0.32530	0.975	0.21675	N	0.999591	B	0.09022	0.002	B	0.06405	0.002	T	0.28267	-1.0049	10	0.38643	T	0.18	0.7151	6.9834	0.24715	0.0:0.7871:0.0:0.2129	.	259	Q8N283	ANR35_HUMAN	V	168;259	ENSP00000347802:A259V	ENSP00000347802:A259V	A	+	2	0	ANKRD35	144272276	0.188000	0.23250	0.097000	0.21041	0.345000	0.29048	0.347000	0.20014	0.786000	0.33708	0.655000	0.94253	GCA		0.488	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
SLAMF8	56833	hgsc.bcm.edu	37	1	159799767	159799767	+	Missense_Mutation	SNP	G	G	A	rs140969397		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr1:159799767G>A	ENST00000289707.5	+	2	301	c.152G>A	c.(151-153)cGa>cAa	p.R51Q	SLAMF8_ENST00000368104.4_Intron	NM_020125.2	NP_064510.1	Q9P0V8	SLAF8_HUMAN	SLAM family member 8	51					cellular response to drug (GO:0035690)|defense response to bacterium (GO:0042742)|phagosome acidification (GO:0090383)|regulation of kinase activity (GO:0043549)|regulation of NAD(P)H oxidase activity (GO:0033860)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R51Q(1)		endometrium(2)|large_intestine(4)|lung(6)	12	all_hematologic(112;0.0597)					GCTATCTGGCGATCTCTCTGG	0.612																																					p.R51Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G152A	1						.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	128.0	137.0	134.0		152	4.4	1.0	1	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLAMF8	NM_020125.2	43	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	51/286	159799767	2,13004	2203	4300	6503	158066391	SO:0001583	missense	56833	exon2			AF146761	CCDS1188.1	1q23.1	2013-01-11			ENSG00000158714	ENSG00000158714		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21391	protein-coding gene	gene with protein product		606620				11313408	Standard	NM_020125		Approved	BLAME, SBBI42, CD353	uc001fue.4	Q9P0V8	OTTHUMG00000035433	ENST00000289707.5:c.152G>A	1.37:g.159799767G>A	ENSP00000289707:p.Arg51Gln		158066391	NM_020125	Q32MC6|Q5VU15	Missense_Mutation	SNP	ENST00000289707.5	37	CCDS1188.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939945	0.73557	2.27E-4	1.16E-4	ENSG00000158714	ENST00000289707	T	0.22945	1.93	4.44	4.44	0.53790	.	0.328838	0.30043	N	0.010545	T	0.24812	0.0602	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.01757	-1.1280	10	0.23302	T	0.38	-9.4002	12.4262	0.55548	0.0:0.0:1.0:0.0	.	51	Q9P0V8	SLAF8_HUMAN	Q	51	ENSP00000289707:R51Q	ENSP00000289707:R51Q	R	+	2	0	SLAMF8	158066391	1.000000	0.71417	0.997000	0.53966	0.627000	0.37826	3.097000	0.50251	2.296000	0.77279	0.313000	0.20887	CGA		0.612	SLAMF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085983.1	NM_020125	
BRINP3	339479	hgsc.bcm.edu	37	1	190234181	190234181	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr1:190234181C>A	ENST00000367462.3	-	4	663	c.432G>T	c.(430-432)gaG>gaT	p.E144D	BRINP3_ENST00000534846.1_Missense_Mutation_p.E42D|RP11-547I7.1_ENST00000452178.1_RNA	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	144	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.E144D(1)									TGAGTGACTCCTCTCCTGCAT	0.378																																					p.E144D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G432T	1						.						69.0	59.0	63.0					1																	190234181		2203	4300	6503	188500804	SO:0001583	missense	339479	exon4			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.432G>T	1.37:g.190234181C>A	ENSP00000356432:p.Glu144Asp		188500804	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284960	0.59867	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	D;T	0.84589	-1.87;1.63	5.6	4.69	0.59074	Membrane attack complex component/perforin (MACPF) domain (2);	0.053917	0.64402	D	0.000001	D	0.85703	0.5758	M	0.76328	2.33	0.43808	D	0.996368	P;P	0.45827	0.745;0.867	B;B	0.41412	0.242;0.356	D	0.85799	0.1372	10	0.87932	D	0	.	15.4187	0.74995	0.0:0.9245:0.0:0.0755	.	42;144	B7Z260;Q76B58	.;FAM5C_HUMAN	D	144;42	ENSP00000356432:E144D;ENSP00000438022:E42D	ENSP00000356432:E144D	E	-	3	2	FAM5C	188500804	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	2.635000	0.46537	0.740000	0.32651	-1.128000	0.01989	GAG		0.378	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
OR52H1	390067	hgsc.bcm.edu	37	11	5566719	5566719	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr11:5566719A>G	ENST00000322653.4	-	1	60	c.35T>C	c.(34-36)cTg>cCg	p.L12P	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	12						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L12P(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTAACTGCTCAGGTTGAAAAT	0.443																																					p.L12P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T35C	11						.						94.0	91.0	92.0					11																	5566719		2201	4297	6498	5523295	SO:0001583	missense	390067	exon1			AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.35T>C	11.37:g.5566719A>G	ENSP00000326259:p.Leu12Pro		5523295	NM_001005289	B9EH26|Q6IF79	Missense_Mutation	SNP	ENST00000322653.4	37	CCDS31386.1	.	.	.	.	.	.	.	.	.	.	A	11.07	1.529822	0.27387	.	.	ENSG00000181616	ENST00000322653	T	0.03242	4.0	5.2	4.03	0.46877	.	0.614633	0.14156	N	0.337688	T	0.06962	0.0177	L	0.53249	1.67	0.09310	N	0.999998	P	0.52170	0.951	P	0.49192	0.602	T	0.31861	-0.9928	10	0.31617	T	0.26	.	7.7854	0.29089	0.6638:0.0:0.0:0.3362	.	12	Q8NGJ2	O52H1_HUMAN	P	12	ENSP00000326259:L12P	ENSP00000326259:L12P	L	-	2	0	OR52H1	5523295	0.000000	0.05858	0.297000	0.24988	0.809000	0.45718	0.115000	0.15540	0.768000	0.33290	0.533000	0.62120	CTG		0.443	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143400.1	NM_001005289	
LPXN	9404	hgsc.bcm.edu	37	11	58295069	58295069	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr11:58295069C>G	ENST00000395074.2	-	9	1107	c.1019G>C	c.(1018-1020)tGt>tCt	p.C340S	LPXN_ENST00000528954.1_Missense_Mutation_p.C345S|LPXN_ENST00000528489.1_Missense_Mutation_p.C320S	NM_004811.2	NP_004802.1	O60711	LPXN_HUMAN	leupaxin	340	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell adhesion (GO:0007162)|protein complex assembly (GO:0006461)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|podosome (GO:0002102)	transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)	p.C340S(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				GGCACTGATACAACGGCCAGT	0.537																																					p.C345S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1034C	11						.						102.0	84.0	90.0					11																	58295069		2201	4295	6496	58051645	SO:0001583	missense	9404	exon9			AF062075	CCDS7969.1, CCDS53635.1	11q12.1	2013-09-20			ENSG00000110031	ENSG00000110031			14061	protein-coding gene	gene with protein product		605390				9565592	Standard	NM_004811		Approved	LDPL	uc001nmw.3	O60711	OTTHUMG00000167466	ENST00000395074.2:c.1019G>C	11.37:g.58295069C>G	ENSP00000378512:p.Cys340Ser		58051645	NM_001143995	B2R8B4|B4DV71|Q53FW6|Q6FI07	Missense_Mutation	SNP	ENST00000395074.2	37	CCDS7969.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721598	0.89298	.	.	ENSG00000110031	ENST00000528954;ENST00000395074	D;D	0.86694	-2.16;-2.16	6.03	6.03	0.97812	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.92828	0.7719	M	0.63208	1.945	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.988	D;D;D	0.91635	0.998;0.999;0.954	D	0.92125	0.5707	10	0.54805	T	0.06	.	19.3467	0.94365	0.0:1.0:0.0:0.0	.	320;345;340	B7Z5P7;B4DV71;O60711	.;.;LPXN_HUMAN	S	345;340	ENSP00000431284:C345S;ENSP00000378512:C340S	ENSP00000378512:C340S	C	-	2	0	LPXN	58051645	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.818000	0.86416	2.868000	0.98415	0.557000	0.71058	TGT		0.537	LPXN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394709.1	NM_004811	
ALDH3B2	222	hgsc.bcm.edu	37	11	67430773	67430773	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr11:67430773T>G	ENST00000349015.3	-	10	1509	c.1071A>C	c.(1069-1071)ttA>ttC	p.L357F	ALDH3B2_ENST00000530069.1_Missense_Mutation_p.L357F	NM_000695.3	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3 family, member B2	357					alcohol metabolic process (GO:0006066)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)		3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)	p.L357F(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	18						GGATCTCCTTTAATTTCTCCA	0.637																																					p.L357F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1071C	11						.						86.0	82.0	83.0					11																	67430773		2200	4294	6494	67187349	SO:0001583	missense	222	exon10			U37519	CCDS31622.1	11q13.2	2014-09-04			ENSG00000132746	ENSG00000132746	1.2.1.5	"""Aldehyde dehydrogenases"""	411	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 8"", ""acetaldehyde dehydrogenase 8"""	601917		ALDH8		8890755, 9161417	Standard	NM_000695		Approved		uc001oms.3	P48448	OTTHUMG00000167284	ENST00000349015.3:c.1071A>C	11.37:g.67430773T>G	ENSP00000255084:p.Leu357Phe		67187349	NM_000695	Q53Y98|Q8NAL5|Q96IB2	Missense_Mutation	SNP	ENST00000349015.3	37	CCDS31622.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.689|9.689	1.151427|1.151427	0.21371|0.21371	.|.	.|.	ENSG00000132746|ENSG00000132746	ENST00000530069;ENST00000349015|ENST00000531248	D;D|.	0.81821|.	-1.54;-1.54|.	3.75|3.75	-4.54|-4.54	0.03452|0.03452	.|.	0.286088|.	0.26812|.	U|.	0.022366|.	T|.	0.32882|.	0.0844|.	L|L	0.27053|0.27053	0.805|0.805	0.40381|0.40381	D|D	0.979443|0.979443	B|.	0.21309|.	0.054|.	B|.	0.23018|.	0.043|.	T|.	0.22208|.	-1.0223|.	10|.	0.22706|.	T|.	0.39|.	.|.	2.8852|2.8852	0.05659|0.05659	0.1566:0.4279:0.1933:0.2222|0.1566:0.4279:0.1933:0.2222	.|.	357|.	P48448|.	AL3B2_HUMAN|.	F|S	357|86	ENSP00000431595:L357F;ENSP00000255084:L357F|.	ENSP00000255084:L357F|.	L|X	-|-	3|2	2|2	ALDH3B2|ALDH3B2	67187349|67187349	0.041000|0.041000	0.20044|0.20044	0.020000|0.020000	0.16555|0.16555	0.001000|0.001000	0.01503|0.01503	-0.376000|-0.376000	0.07465|0.07465	-1.091000|-1.091000	0.03065|0.03065	-0.677000|-0.677000	0.03784|0.03784	TTA|TAA		0.637	ALDH3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394004.1	NM_000695	
CCDC167	154467	hgsc.bcm.edu	37	6	37452635	37452635	+	Silent	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr6:37452635C>T	ENST00000373408.3	-	3	199	c.141G>A	c.(139-141)agG>agA	p.R47R		NM_138493.2	NP_612502.1	Q9P0B6	CC167_HUMAN	coiled-coil domain containing 167	47						integral component of membrane (GO:0016021)		p.R47R(1)		endometrium(1)|large_intestine(2)|lung(2)|skin(1)	6						TCTCCAGGGACCTCCTGTGAG	0.547																																					p.R47R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G141A	6						.						81.0	83.0	83.0					6																	37452635		2203	4300	6503	37560613	SO:0001819	synonymous_variant	154467	exon3				CCDS34441.1	6p21.2	2011-07-04	2011-07-04	2011-07-04	ENSG00000198937	ENSG00000198937			21239	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 129"""	C6orf129			Standard	NM_138493		Approved	dJ153P14.2	uc003ont.3	Q9P0B6	OTTHUMG00000014625	ENST00000373408.3:c.141G>A	6.37:g.37452635C>T			37560613	NM_138493	Q5T7F7|Q9BTQ9	Silent	SNP	ENST00000373408.3	37	CCDS34441.1																																																																																				0.547	CCDC167-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040417.1	NM_138493	
AGPAT4	56895	hgsc.bcm.edu	37	6	161587389	161587389	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr6:161587389C>T	ENST00000320285.4	-	3	451	c.239G>A	c.(238-240)cGc>cAc	p.R80H	AGPAT4_ENST00000366906.5_Missense_Mutation_p.R18H|AGPAT4_ENST00000366911.5_Intron|AGPAT4_ENST00000457520.2_Intron|AGPAT4_ENST00000366908.5_Missense_Mutation_p.R80H|AGPAT4_ENST00000366905.3_Missense_Mutation_p.R80H	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	80					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.R80H(1)		endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		GAGGTAGGCGCGCGGGTCCGT	0.527																																					p.R80H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G239A	6						.						91.0	79.0	83.0					6																	161587389		2203	4300	6503	161507379	SO:0001583	missense	56895	exon3			AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.239G>A	6.37:g.161587389C>T	ENSP00000314036:p.Arg80His		161507379	NM_020133	B4DSF9|Q5TEF0	Missense_Mutation	SNP	ENST00000320285.4	37	CCDS5280.1	.	.	.	.	.	.	.	.	.	.	C	8.534	0.871676	0.17322	.	.	ENSG00000026652	ENST00000320285;ENST00000366908;ENST00000366906;ENST00000366905	D;D	0.91295	-2.82;-2.82	4.74	-6.85	0.01681	.	0.839231	0.10647	N	0.650241	T	0.73984	0.3657	L	0.29908	0.895	0.09310	N	1	B;B	0.14805	0.006;0.011	B;B	0.08055	0.003;0.003	T	0.51293	-0.8724	10	0.72032	D	0.01	-8.4877	18.1622	0.89712	0.0:0.1901:0.0:0.8099	.	80;80	B4DHC0;Q9NRZ5	.;PLCD_HUMAN	H	80;80;18;80	ENSP00000314036:R80H;ENSP00000355873:R18H	ENSP00000314036:R80H	R	-	2	0	AGPAT4	161507379	0.004000	0.15560	0.216000	0.23742	0.014000	0.08584	0.093000	0.15086	-1.542000	0.01725	-0.806000	0.03193	CGC		0.527	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042983.1	NM_020133	
NLRP1	22861	hgsc.bcm.edu	37	17	5440172	5440172	+	Splice_Site	SNP	G	G	A	rs199748129		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr17:5440172G>A	ENST00000572272.1	-	8	2958	c.2959C>T	c.(2959-2961)Cgg>Tgg	p.R987W	NLRP1_ENST00000577119.1_Intron|NLRP1_ENST00000269280.4_Splice_Site_p.R987W|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000345221.3_Splice_Site_p.R987W|NLRP1_ENST00000354411.3_Intron|NLRP1_ENST00000262467.5_Splice_Site_p.R987W			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	987					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.R987W(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CCCCCTTACCGTCTGCTGAAG	0.587																																					p.R987W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2959T	17						.						74.0	61.0	65.0					17																	5440172		2203	4300	6503	5380896	SO:0001630	splice_region_variant	22861	exon8			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.2960+1C>T	17.37:g.5440172G>A			5380896	NM_014922	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	G	5.855	0.342015	0.11069	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000345221;ENST00000537069	T;T;T;T	0.71222	-0.55;-0.55;-0.54;-0.54	2.69	-5.38	0.02673	.	0.838313	0.09764	N	0.758830	T	0.37892	0.1020	N	0.03294	-0.36	0.09310	N	1	B;B;B;B	0.10296	0.003;0.0;0.002;0.001	B;B;B;B	0.06405	0.002;0.0;0.0;0.0	T	0.12502	-1.0545	10	0.49607	T	0.09	.	2.3958	0.04389	0.2437:0.1575:0.4437:0.1551	.	253;987;987;987	F5H042;Q9C000;Q9C000-2;E9PE50	.;NALP1_HUMAN;.;.	W	987;987;987;987;253	ENSP00000442029:R987W;ENSP00000262467:R987W;ENSP00000269280:R987W;ENSP00000324366:R987W	ENSP00000262467:R987W	R	-	1	2	NLRP1	5380896	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.179000	0.03090	-1.788000	0.01266	-2.377000	0.00234	CGG		0.587	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	Missense_Mutation
MCM3AP	8888	hgsc.bcm.edu	37	21	47705115	47705115	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr21:47705115G>A	ENST00000397708.1	-	2	340	c.86C>T	c.(85-87)cCg>cTg	p.P29L	YBEY_ENST00000397692.1_5'Flank|YBEY_ENST00000339195.6_5'Flank|YBEY_ENST00000397691.1_5'Flank|YBEY_ENST00000397694.1_5'Flank|YBEY_ENST00000397701.4_5'Flank|MCM3AP_ENST00000291688.1_Missense_Mutation_p.P29L|YBEY_ENST00000329319.3_5'Flank			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	29					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)	p.P29L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					TCGAAATGGCGGCTTAGATGG	0.453																																					p.P29L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C86T	21						.						73.0	76.0	75.0					21																	47705115		2203	4300	6503	46529543	SO:0001583	missense	8888	exon1			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.86C>T	21.37:g.47705115G>A	ENSP00000380820:p.Pro29Leu		46529543	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	G	7.755	0.704142	0.15172	.	.	ENSG00000160294	ENST00000397708;ENST00000291688;ENST00000426537	T;T	0.03607	3.87;3.87	5.57	3.7	0.42460	.	1.035820	0.07591	N	0.921976	T	0.03608	0.0103	L	0.27053	0.805	0.09310	N	1	B	0.32781	0.384	B	0.18871	0.023	T	0.47911	-0.9080	10	0.41790	T	0.15	-0.0543	12.131	0.53942	0.0:0.0:0.6877:0.3123	.	29	O60318	MCM3A_HUMAN	L	29	ENSP00000380820:P29L;ENSP00000291688:P29L	ENSP00000291688:P29L	P	-	2	0	MCM3AP	46529543	0.628000	0.27138	0.001000	0.08648	0.069000	0.16628	1.949000	0.40313	0.650000	0.30769	0.561000	0.74099	CCG		0.453	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
HS3ST2	9956	hgsc.bcm.edu	37	16	22926312	22926312	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr16:22926312C>T	ENST00000261374.3	+	2	967	c.533C>T	c.(532-534)aCg>aTg	p.T178M		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	178	Substrate binding. {ECO:0000250}.				carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)	p.T178M(1)		breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		CTGGAGAAGACGCCCAGCTAC	0.577																																					p.T178M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C533T	16						.						92.0	87.0	88.0					16																	22926312		2197	4300	6497	22833813	SO:0001583	missense	9956	exon2			AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.533C>T	16.37:g.22926312C>T	ENSP00000261374:p.Thr178Met		22833813	NM_006043	Q52LZ1	Missense_Mutation	SNP	ENST00000261374.3	37	CCDS10606.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.260916	0.80246	.	.	ENSG00000122254	ENST00000261374;ENST00000540146	T	0.47869	0.83	5.25	5.25	0.73442	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.80088	0.4559	H	0.96861	3.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87160	0.2214	10	0.87932	D	0	.	17.8721	0.88813	0.0:1.0:0.0:0.0	.	178	Q9Y278	HS3S2_HUMAN	M	178;186	ENSP00000261374:T178M	ENSP00000261374:T178M	T	+	2	0	HS3ST2	22833813	1.000000	0.71417	0.987000	0.45799	0.679000	0.39708	7.818000	0.86416	2.467000	0.83353	0.561000	0.74099	ACG		0.577	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211598.1	NM_006043	
IL21R	50615	hgsc.bcm.edu	37	16	27454357	27454357	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr16:27454357G>A	ENST00000337929.3	+	5	900	c.427G>A	c.(427-429)Gaa>Aaa	p.E143K	IL21R_ENST00000395754.4_Missense_Mutation_p.E143K|IL21R_ENST00000395755.1_Missense_Mutation_p.E143K|IL21R_ENST00000564089.1_Missense_Mutation_p.E143K	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	143	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)	p.E143K(1)		breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						CTCAGATTACGAAGACCCTGC	0.532			T	BCL6	NHL																																p.E165K			Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G493A	16						.						106.0	98.0	101.0					16																	27454357		2197	4300	6497	27361858	SO:0001583	missense	50615	exon6			AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.427G>A	16.37:g.27454357G>A	ENSP00000338010:p.Glu143Lys		27361858	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	37	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	G	4.965	0.179313	0.09443	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	D;D;D	0.96168	-3.93;-3.93;-3.93	4.7	2.69	0.31865	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.741846	0.13089	N	0.414700	D	0.85792	0.5779	N	0.17082	0.46	0.09310	N	1	P	0.38167	0.621	B	0.30782	0.12	T	0.77351	-0.2620	10	0.06099	T	0.92	.	7.0009	0.24809	0.2199:0.0:0.7801:0.0	.	143	Q9HBE5	IL21R_HUMAN	K	143	ENSP00000338010:E143K;ENSP00000379104:E143K;ENSP00000379103:E143K	ENSP00000338010:E143K	E	+	1	0	IL21R	27361858	0.029000	0.19370	0.001000	0.08648	0.018000	0.09664	0.874000	0.28065	0.379000	0.24794	0.484000	0.47621	GAA		0.532	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
ABCC12	94160	hgsc.bcm.edu	37	16	48177961	48177961	+	Silent	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr16:48177961C>T	ENST00000311303.3	-	2	480	c.135G>A	c.(133-135)ccG>ccA	p.P45P	ABCC12_ENST00000416054.1_Silent_p.P45P|ABCC12_ENST00000448542.1_Silent_p.P45P	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	45						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.P45P(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				CATCATCCACCGGGTTGGGTG	0.567																																					p.P45P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G135A	16						.						80.0	72.0	74.0					16																	48177961		2201	4300	6501	46735462	SO:0001819	synonymous_variant	94160	exon2			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.135G>A	16.37:g.48177961C>T			46735462	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Silent	SNP	ENST00000311303.3	37	CCDS10730.1																																																																																				0.567	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
HRH4	59340	hgsc.bcm.edu	37	18	22057130	22057130	+	Silent	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr18:22057130C>T	ENST00000256906.4	+	3	877	c.777C>T	c.(775-777)ctC>ctT	p.L259L	HRH4_ENST00000426880.2_Silent_p.L171L	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	259					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)	p.L259L(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	AGAGTAGTCTCATGTTTTCCT	0.418																																					p.L171L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C513T	18						.						114.0	113.0	113.0					18																	22057130		2203	4300	6503	20311128	SO:0001819	synonymous_variant	59340	exon2			AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.777C>T	18.37:g.22057130C>T			20311128	NM_001143828	B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Silent	SNP	ENST00000256906.4	37	CCDS11887.1																																																																																				0.418	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254904.1		
SLC9C1	285335	hgsc.bcm.edu	37	3	111873857	111873857	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr3:111873857C>A	ENST00000305815.5	-	27	3656	c.3404G>T	c.(3403-3405)aGa>aTa	p.R1135I	SLC9C1_ENST00000487372.1_Missense_Mutation_p.R1087I	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	1135					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.R1135I(1)									CTTAACATTTCTTTCTTCTTG	0.308																																					p.R1135I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3404T	3						.						121.0	120.0	120.0					3																	111873857		2203	4298	6501	113356547	SO:0001583	missense	285335	exon27			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.3404G>T	3.37:g.111873857C>A	ENSP00000306627:p.Arg1135Ile		113356547	NM_183061	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.565855	0.00903	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.78481	-1.17;-1.18	3.11	-6.22	0.02058	.	.	.	.	.	T	0.47911	0.1471	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25745	-1.0123	9	0.22109	T	0.4	.	2.0246	0.03516	0.2568:0.0985:0.1359:0.5088	.	1087;1135	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	I	1135;1087	ENSP00000306627:R1135I;ENSP00000420688:R1087I	ENSP00000306627:R1135I	R	-	2	0	SLC9A10	113356547	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.276000	0.02815	-2.844000	0.00334	-1.522000	0.00932	AGA		0.308	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
C3orf20	84077	hgsc.bcm.edu	37	3	14770152	14770152	+	Missense_Mutation	SNP	C	C	T	rs375606604		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr3:14770152C>T	ENST00000253697.3	+	12	2349	c.1897C>T	c.(1897-1899)Cgg>Tgg	p.R633W	C3orf20_ENST00000435614.1_Missense_Mutation_p.R511W|C3orf20_ENST00000412910.1_Missense_Mutation_p.R511W	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	633						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R633W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						GAGCCCAGTTCGGAAGACCAC	0.532																																					p.R511W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1531T	3						.	C	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	92.0	83.0	86.0		1897,1531,1531	1.4	0.0	3		86	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	C3orf20	NM_032137.4,NM_001184958.1,NM_001184957.1	101,101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	633/905,511/783,511/783	14770152	1,13005	2203	4300	6503	14745156	SO:0001583	missense	84077	exon12			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.1897C>T	3.37:g.14770152C>T	ENSP00000253697:p.Arg633Trp		14745156	NM_001184958	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	C	8.737	0.918005	0.17982	0.0	1.16E-4	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.10099	3.2;2.91;2.91	3.31	1.41	0.22369	.	1.134180	0.06799	N	0.788412	T	0.09379	0.0231	L	0.36672	1.1	0.09310	N	1	B;B	0.15930	0.015;0.015	B;B	0.12837	0.008;0.008	T	0.39440	-0.9614	10	0.87932	D	0	-5.9662	3.8697	0.09031	0.264:0.6067:0.0:0.1293	.	511;633	Q8ND61-2;Q8ND61	.;CC020_HUMAN	W	633;511;511	ENSP00000253697:R633W;ENSP00000402933:R511W;ENSP00000396081:R511W	ENSP00000253697:R633W	R	+	1	2	C3orf20	14745156	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.125000	0.15749	0.368000	0.24481	-0.444000	0.05651	CGG		0.532	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
SEMA5B	54437	hgsc.bcm.edu	37	3	122647881	122647881	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr3:122647881C>T	ENST00000357599.3	-	6	885	c.499G>A	c.(499-501)Gac>Aac	p.D167N	SEMA5B_ENST00000451055.2_Missense_Mutation_p.D221N|SEMA5B_ENST00000195173.4_Missense_Mutation_p.D167N|AC078794.1_ENST00000408284.1_RNA	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	167	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.D221N(1)|p.D167N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		CGGCGCGTGTCCTCACTGGAG	0.622																																					p.D167N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G499A	3						.						68.0	59.0	62.0					3																	122647881		2203	4300	6503	124130571	SO:0001583	missense	54437	exon6			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.499G>A	3.37:g.122647881C>T	ENSP00000350215:p.Asp167Asn		124130571	NM_001031702	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.575076	0.86542	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.11063	2.81;2.81;2.81;2.81	5.94	5.94	0.96194	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.219424	0.47852	D	0.000203	T	0.16811	0.0404	L	0.39467	1.215	0.54753	D	0.999983	B;P;P	0.37731	0.27;0.607;0.607	B;B;P	0.45913	0.258;0.395;0.497	T	0.01889	-1.1253	10	0.27082	T	0.32	.	17.8571	0.88767	0.0:1.0:0.0:0.0	.	109;167;167	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	N	167;167;109;221;167	ENSP00000350215:D167N;ENSP00000195173:D167N;ENSP00000389588:D221N;ENSP00000377208:D167N	ENSP00000195173:D167N	D	-	1	0	SEMA5B	124130571	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.024000	0.64090	2.826000	0.97356	0.561000	0.74099	GAC		0.622	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
ZIC1	7545	hgsc.bcm.edu	37	3	147131209	147131209	+	Silent	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr3:147131209G>A	ENST00000282928.4	+	3	1944	c.1215G>A	c.(1213-1215)acG>acA	p.T405T		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	405	Ser-rich.				adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T405T(1)		central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						AATCCTCCACGCCTCCCACCA	0.622																																					p.T405T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1215A	3						.						117.0	102.0	107.0					3																	147131209		2203	4300	6503	148613899	SO:0001819	synonymous_variant	7545	exon3			D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.1215G>A	3.37:g.147131209G>A			148613899	NM_003412	Q2M3N1	Silent	SNP	ENST00000282928.4	37	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235779	0.22626	.	.	ENSG00000152977	ENST00000488404	.	.	.	3.37	1.33	0.21861	.	.	.	.	.	T	0.54498	0.1862	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45338	-0.9268	4	.	.	.	.	7.0905	0.25282	0.0:0.3289:0.5413:0.1298	.	.	.	.	H	94	.	.	R	+	2	0	ZIC1	148613899	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	0.658000	0.24979	0.375000	0.24679	0.462000	0.41574	CGC		0.622	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
PLCL2	23228	hgsc.bcm.edu	37	3	17051489	17051489	+	Silent	SNP	G	G	A	rs372927646	byFrequency	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr3:17051489G>A	ENST00000418129.2	+	2	738	c.273G>A	c.(271-273)gcG>gcA	p.A91A	PLCL2_ENST00000460467.1_3'UTR|PLCL2_ENST00000396755.2_Silent_p.A91A|PLCL2_ENST00000432376.1_Silent_p.A91A	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	217					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.A91A(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						AAGATTGTGCGTTTTCCGTCA	0.418													G|||	2	0.000399361	0.0	0.0	5008	,	,		21596	0.002		0.0	False		,,,				2504	0.0				p.R211H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G632A	3						.	G	,	0,4406		0,0,2203	125.0	124.0	124.0		655,273	-10.5	0.4	3		124	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous	PLCL2	NM_001144382.1,NM_015184.5	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	217/1128,91/1002	17051489	1,13005	2203	4300	6503	17026493	SO:0001819	synonymous_variant	23228	exon3			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.273G>A	3.37:g.17051489G>A			17026493	NM_001144382	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Silent	SNP	ENST00000418129.2	37	CCDS33713.1																																																																																				0.418	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3		
CTNNB1	1499	hgsc.bcm.edu	37	3	41267186	41267186	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr3:41267186C>T	ENST00000349496.5	+	6	1050	c.770C>T	c.(769-771)aCa>aTa	p.T257I	CTNNB1_ENST00000396183.3_Missense_Mutation_p.T257I|CTNNB1_ENST00000396185.3_Missense_Mutation_p.T257I|CTNNB1_ENST00000453024.1_Missense_Mutation_p.T250I|CTNNB1_ENST00000405570.1_Missense_Mutation_p.T257I	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	257					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.T257I(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TATGCCATTACAACTCTCCAC	0.388		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.T257I	Colon(6;3 56 14213 18255)		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C770T	3						.						92.0	98.0	96.0					3																	41267186		2203	4300	6503	41242190	SO:0001583	missense	1499	exon6	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.770C>T	3.37:g.41267186C>T	ENSP00000344456:p.Thr257Ile		41242190	NM_001098210	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.473006	0.84640	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46	5.51	5.51	0.81932	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82600	0.5072	M	0.78223	2.4	0.80722	D	1	P;D	0.67145	0.907;0.996	P;D	0.70487	0.831;0.969	D	0.83910	0.0295	10	0.62326	D	0.03	-15.2608	19.4131	0.94683	0.0:1.0:0.0:0.0	.	185;257	B4DSW9;P35222	.;CTNB1_HUMAN	I	257;257;257;250;257	ENSP00000385604:T257I;ENSP00000379486:T257I;ENSP00000344456:T257I;ENSP00000411226:T250I;ENSP00000379488:T257I	ENSP00000344456:T257I	T	+	2	0	CTNNB1	41242190	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.588000	0.87417	0.591000	0.81541	ACA		0.388	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTNNB1	1499	hgsc.bcm.edu	37	3	41274911	41274911	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr3:41274911T>G	ENST00000349496.5	+	8	1441	c.1161T>G	c.(1159-1161)aaT>aaG	p.N387K	CTNNB1_ENST00000396183.3_Missense_Mutation_p.N387K|CTNNB1_ENST00000396185.3_Missense_Mutation_p.N387K|CTNNB1_ENST00000453024.1_Missense_Mutation_p.N380K|CTNNB1_ENST00000405570.1_Missense_Mutation_p.N387K	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	387					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.N387K(4)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CTCTCAGGAATCTTTCAGATG	0.393		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.N387K	Colon(6;3 56 14213 18255)		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	.	4	Substitution - Missense(4)	large_intestine(1)|prostate(1)|liver(1)|kidney(1)	c.T1161G	3						.						102.0	93.0	96.0					3																	41274911		2203	4300	6503	41249915	SO:0001583	missense	1499	exon8	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1161T>G	3.37:g.41274911T>G	ENSP00000344456:p.Asn387Lys		41249915	NM_001098210	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	18.91	3.723022	0.68959	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79	5.72	1.33	0.21861	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.90263	0.6955	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.88091	0.2813	10	0.54805	T	0.06	-10.1444	8.463	0.32938	0.0:0.3714:0.0:0.6286	.	315;387	B4DSW9;P35222	.;CTNB1_HUMAN	K	387;387;387;380;387	ENSP00000385604:N387K;ENSP00000379486:N387K;ENSP00000344456:N387K;ENSP00000411226:N380K;ENSP00000379488:N387K	ENSP00000344456:N387K	N	+	3	2	CTNNB1	41249915	0.995000	0.38212	0.998000	0.56505	0.998000	0.95712	0.358000	0.20216	0.227000	0.20999	0.533000	0.62120	AAT		0.393	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
SLITRK3	22865	hgsc.bcm.edu	37	3	164906887	164906887	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr3:164906887C>T	ENST00000475390.1	-	2	2175	c.1732G>A	c.(1732-1734)Gaa>Aaa	p.E578K	SLITRK3_ENST00000241274.3_Missense_Mutation_p.E578K			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	578	LRRCT 2.				axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.E578K(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CTGATGGTTTCGATCCACTGT	0.517										HNSCC(40;0.11)																											p.E578K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1732A	3						.						103.0	92.0	96.0					3																	164906887		2203	4300	6503	166389581	SO:0001583	missense	22865	exon2			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.1732G>A	3.37:g.164906887C>T	ENSP00000420091:p.Glu578Lys		166389581	NM_014926	Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294359	0.81025	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.50813	0.73;0.73	5.7	5.7	0.88788	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.38548	N	0.001659	T	0.54481	0.1861	M	0.67569	2.06	0.80722	D	1	D	0.56968	0.978	P	0.45099	0.469	T	0.58758	-0.7580	10	0.54805	T	0.06	-11.0287	19.7967	0.96487	0.0:1.0:0.0:0.0	.	578	O94933	SLIK3_HUMAN	K	578	ENSP00000420091:E578K;ENSP00000241274:E578K	ENSP00000241274:E578K	E	-	1	0	SLITRK3	166389581	1.000000	0.71417	0.951000	0.38953	0.996000	0.88848	7.772000	0.85439	2.836000	0.97738	0.655000	0.94253	GAA		0.517	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
PLEKHA5	54477	hgsc.bcm.edu	37	12	19422724	19422724	+	Silent	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr12:19422724G>A	ENST00000299275.6	+	9	738	c.732G>A	c.(730-732)cgG>cgA	p.R244R	PLEKHA5_ENST00000355397.3_Silent_p.R244R|PLEKHA5_ENST00000543806.1_Silent_p.R136R|PLEKHA5_ENST00000317589.4_Silent_p.R244R|PLEKHA5_ENST00000538714.1_Silent_p.R244R|PLEKHA5_ENST00000424268.1_Silent_p.R136R|PLEKHA5_ENST00000539256.1_Silent_p.R2R|PLEKHA5_ENST00000359180.3_Silent_p.R244R|PLEKHA5_ENST00000510738.2_3'UTR|PLEKHA5_ENST00000429027.2_Silent_p.R244R|PLEKHA5_ENST00000309364.4_Silent_p.R244R	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	244	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.R244R(2)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CAAACATGCGGACCTATTATT	0.368																																					p.R244R	Pancreas(196;329 2193 11246 14234 19524)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G732A	12						.						97.0	90.0	92.0					12																	19422724		2203	4300	6503	19313991	SO:0001819	synonymous_variant	54477	exon9			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.732G>A	12.37:g.19422724G>A			19313991	NM_019012	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Silent	SNP	ENST00000299275.6	37	CCDS8682.1																																																																																				0.368	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
SCAF11	9169	hgsc.bcm.edu	37	12	46321416	46321416	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr12:46321416C>T	ENST00000369367.3	-	11	2301	c.2068G>A	c.(2068-2070)Gaa>Aaa	p.E690K	SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000465950.1_Missense_Mutation_p.E375K|SCAF11_ENST00000419565.2_Missense_Mutation_p.E690K|SCAF11_ENST00000549162.1_Missense_Mutation_p.E498K	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	690					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E690K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						CTAGGATGTTCGGTCAGCGAT	0.323																																					p.E690K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2068A	12						.						163.0	165.0	164.0					12																	46321416		2203	4300	6503	44607683	SO:0001583	missense	9169	exon11			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2068G>A	12.37:g.46321416C>T	ENSP00000358374:p.Glu690Lys		44607683	NM_004719	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	ENST00000369367.3	37	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	C	9.488	1.099908	0.20552	.	.	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565;ENST00000547018	T;T;T;T;T	0.56611	1.14;1.86;1.13;1.86;0.45	5.52	3.71	0.42584	.	0.165315	0.42682	D	0.000679	T	0.37376	0.1001	L	0.36672	1.1	0.23144	N	0.998222	P;B	0.41710	0.76;0.195	B;B	0.31946	0.138;0.03	T	0.16630	-1.0396	10	0.41790	T	0.15	-13.0453	12.2475	0.54578	0.0:0.8623:0.0:0.1377	.	498;690	F8VXG7;Q99590	.;SCAFB_HUMAN	K	375;690;498;690;630	ENSP00000449812:E375K;ENSP00000358374:E690K;ENSP00000448864:E498K;ENSP00000413036:E690K;ENSP00000446746:E630K	ENSP00000358374:E690K	E	-	1	0	SCAF11	44607683	0.937000	0.31787	0.007000	0.13788	0.024000	0.10985	2.727000	0.47311	0.827000	0.34685	-0.251000	0.11542	GAA		0.323	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
NEDD1	121441	hgsc.bcm.edu	37	12	97328761	97328761	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr12:97328761G>A	ENST00000266742.4	+	7	836	c.497G>A	c.(496-498)cGg>cAg	p.R166Q	NEDD1_ENST00000411739.2_Missense_Mutation_p.R77Q|NEDD1_ENST00000555114.1_3'UTR|NEDD1_ENST00000557644.1_Missense_Mutation_p.R173Q|NEDD1_ENST00000429527.2_Missense_Mutation_p.R166Q|NEDD1_ENST00000457368.2_Missense_Mutation_p.R77Q	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	166					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)		p.R166Q(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						TAGTCTGTTCGGCACTTGAAG	0.333																																					p.R166Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G497A	12						.						87.0	86.0	86.0					12																	97328761		2203	4300	6503	95852892	SO:0001583	missense	121441	exon7				CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.497G>A	12.37:g.97328761G>A	ENSP00000266742:p.Arg166Gln		95852892	NM_152905	B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	ENST00000266742.4	37	CCDS9063.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778515	0.70107	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000411739;ENST00000553609;ENST00000557644;ENST00000457368	T;T;T;T;T;T	0.29917	1.56;1.56;1.55;1.56;1.56;1.55	5.71	5.71	0.89125	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.054670	0.85682	D	0.000000	T	0.57932	0.2087	M	0.70842	2.15	0.52501	D	0.999957	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.55496	-0.8132	10	0.49607	T	0.09	.	19.8594	0.96778	0.0:0.0:1.0:0.0	.	173;166	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	Q	166;166;77;77;173;77	ENSP00000266742:R166Q;ENSP00000404978:R166Q;ENSP00000411307:R77Q;ENSP00000451830:R77Q;ENSP00000451211:R173Q;ENSP00000407964:R77Q	ENSP00000266742:R166Q	R	+	2	0	NEDD1	95852892	1.000000	0.71417	0.994000	0.49952	0.183000	0.23260	7.045000	0.76585	2.691000	0.91804	0.650000	0.86243	CGG		0.333	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409792.1		
EVC2	132884	hgsc.bcm.edu	37	4	5687099	5687099	+	Missense_Mutation	SNP	G	G	A	rs114142742	byFrequency	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr4:5687099G>A	ENST00000344408.5	-	6	867	c.814C>T	c.(814-816)Cgg>Tgg	p.R272W	EVC2_ENST00000344938.1_Missense_Mutation_p.R272W|EVC2_ENST00000310917.2_Missense_Mutation_p.R192W	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	272					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R272W(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						GGTCATACCCGTGACGAGCTC	0.522													G|||	26	0.00519169	0.0189	0.0014	5008	,	,		20592	0.0		0.0	False		,,,				2504	0.0				p.R192W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C574T	4						.	G	TRP/ARG,TRP/ARG	71,4335	64.7+/-102.0	1,69,2133	147.0	138.0	141.0		574,814	4.5	0.0	4	dbSNP_132	141	0,8600		0,0,4300	yes	missense,missense	EVC2	NM_001166136.1,NM_147127.4	101,101	1,69,6433	AA,AG,GG		0.0,1.6114,0.5459	probably-damaging,probably-damaging	192/1229,272/1309	5687099	71,12935	2203	4300	6503	5738000	SO:0001583	missense	132884	exon6			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.814C>T	4.37:g.5687099G>A	ENSP00000342144:p.Arg272Trp		5738000	NM_001166136	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	8	0.003663003663003663	8	0.016260162601626018	0	0.0	0	0.0	0	0.0	G	16.95	3.264277	0.59431	0.016114	0.0	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.78003	-1.14;-1.14;-1.14	4.52	4.52	0.55395	.	0.402999	0.26963	N	0.021620	T	0.60830	0.2299	N	0.22421	0.69	0.09310	N	1	D	0.71674	0.998	P	0.54174	0.744	T	0.64170	-0.6470	10	0.66056	D	0.02	-2.819	13.1279	0.59366	0.0:0.0:1.0:0.0	.	272	Q86UK5	LBN_HUMAN	W	272;192;272	ENSP00000339954:R272W;ENSP00000311683:R192W;ENSP00000342144:R272W	ENSP00000311683:R192W	R	-	1	2	EVC2	5738000	0.001000	0.12720	0.004000	0.12327	0.007000	0.05969	0.955000	0.29188	2.225000	0.72522	0.655000	0.94253	CGG		0.522	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
LIMCH1	22998	hgsc.bcm.edu	37	4	41607950	41607950	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr4:41607950A>T	ENST00000313860.7	+	6	469	c.415A>T	c.(415-417)Agc>Tgc	p.S139C	LIMCH1_ENST00000508501.1_Missense_Mutation_p.S139C|LIMCH1_ENST00000503057.1_5'UTR|LIMCH1_ENST00000512632.1_Missense_Mutation_p.S139C|LIMCH1_ENST00000513024.1_5'UTR|LIMCH1_ENST00000509638.1_5'UTR|LIMCH1_ENST00000512820.1_Missense_Mutation_p.S139C|LIMCH1_ENST00000511496.1_5'UTR|LIMCH1_ENST00000512946.1_Missense_Mutation_p.S139C	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	139					actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)	p.S139C(1)		central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						AGCAGCAAACAGCTGCACATC	0.428																																					p.S139C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A415T	4						.						127.0	114.0	118.0					4																	41607950		2203	4300	6503	41302707	SO:0001583	missense	22998	exon6			AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.415A>T	4.37:g.41607950A>T	ENSP00000316891:p.Ser139Cys		41302707	NM_001112717	A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Missense_Mutation	SNP	ENST00000313860.7	37	CCDS33977.1	.	.	.	.	.	.	.	.	.	.	A	11.45	1.643177	0.29246	.	.	ENSG00000064042	ENST00000508501;ENST00000512946;ENST00000313860;ENST00000512632;ENST00000512820	T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13	5.56	5.56	0.83823	Calponin homology domain (2);	0.087917	0.42682	U	0.000670	T	0.71169	0.3308	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999	D;D;D;D;D	0.76071	0.969;0.987;0.97;0.987;0.97	T	0.73363	-0.4006	10	0.62326	D	0.03	.	15.7109	0.77626	1.0:0.0:0.0:0.0	.	139;139;139;139;139	D6RD46;Q9UPQ0-4;E9PHM7;Q9UPQ0-2;Q9UPQ0	.;.;.;.;LIMC1_HUMAN	C	139	ENSP00000424825:S139C;ENSP00000424645:S139C;ENSP00000316891:S139C;ENSP00000427045:S139C;ENSP00000424437:S139C	ENSP00000316891:S139C	S	+	1	0	LIMCH1	41302707	1.000000	0.71417	0.901000	0.35422	0.051000	0.14879	4.807000	0.62576	2.112000	0.64535	0.533000	0.62120	AGC		0.428	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	NM_014988	
YTHDC1	91746	hgsc.bcm.edu	37	4	69195720	69195720	+	Splice_Site	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr4:69195720C>T	ENST00000344157.4	-	9	1684	c.1349G>A	c.(1348-1350)aGg>aAg	p.R450K	YTHDC1_ENST00000579690.1_Splice_Site_p.R450K|YTHDC1_ENST00000355665.3_Splice_Site_p.R432K	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	450	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R450K(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						TATAATTTACCTGCAAATCCA	0.363																																					p.R450K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1349A	4						.						56.0	58.0	57.0					4																	69195720		2203	4300	6503	68878315	SO:0001630	splice_region_variant	91746	exon9			AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1349+1G>A	4.37:g.69195720C>T			68878315	NM_001031732	Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	ENST00000344157.4	37	CCDS33992.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541380	0.65085	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.27890	1.64;1.64	5.4	5.4	0.78164	YTH domain (2);	0.087802	0.85682	D	0.000000	T	0.44953	0.1318	N	0.21508	0.67	0.80722	D	1	P;B	0.38280	0.625;0.026	D;B	0.63488	0.915;0.087	T	0.24119	-1.0169	9	.	.	.	.	19.1696	0.93572	0.0:1.0:0.0:0.0	.	432;450	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	K	450;432	ENSP00000339245:R450K;ENSP00000347888:R432K	.	R	-	2	0	YTHDC1	68878315	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	7.419000	0.80179	2.544000	0.85801	0.561000	0.74099	AGG		0.363	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251437.1	NM_133370	Missense_Mutation
SLC25A14	9016	hgsc.bcm.edu	37	X	129474319	129474319	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chrX:129474319G>T	ENST00000218197.5	+	1	294	c.67G>T	c.(67-69)Gta>Tta	p.V23L	SLC25A14_ENST00000545805.1_Missense_Mutation_p.V23L|SLC25A14_ENST00000467496.1_3'UTR|SLC25A14_ENST00000361980.5_Splice_Site|SLC25A14_ENST00000339231.3_Splice_Site|SLC25A14_ENST00000543953.1_Intron	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14	23					aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)		p.V23L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						GGCCGTGATTGTAAGCGGAGT	0.483																																					p.V23L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G67T	X						.						80.0	84.0	83.0					X																	129474319		2203	4300	6503	129302000	SO:0001583	missense	9016	exon1			AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.67G>T	X.37:g.129474319G>T	ENSP00000218197:p.Val23Leu		129302000	NM_003951	D3DTG2|Q0VDH7|Q9HC60|Q9HC61	Missense_Mutation	SNP	ENST00000218197.5	37	CCDS14623.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.09|16.09	3.024989|3.024989	0.54683|0.54683	.|.	.|.	ENSG00000102078|ENSG00000102078	ENST00000361980;ENST00000339231|ENST00000424447;ENST00000545805;ENST00000218197	.|T;T;T	.|0.80738	.|-1.15;-1.41;-1.39	4.31|4.31	4.31|4.31	0.51392|0.51392	.|.	.|.	.|.	.|.	.|.	.|T	.|0.61937	.|0.2387	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B	.|0.24882	.|0.113	.|B	.|0.19946	.|0.027	.|T	.|0.59752	.|-0.7395	.|9	.|0.32370	.|T	.|0.25	.|.	11.0968|11.0968	0.48150|0.48150	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|23	.|O95258	.|UCP5_HUMAN	.|L	-1|23	.|ENSP00000402578:V23L;ENSP00000444642:V23L;ENSP00000218197:V23L	.|ENSP00000218197:V23L	.|V	+|+	.|1	.|0	SLC25A14|SLC25A14	129302000|129302000	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.404000|2.404000	0.44539|0.44539	2.387000|2.387000	0.81309|0.81309	0.594000|0.594000	0.82650|0.82650	.|GTA		0.483	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058253.1	NM_022810, NM_003951	
FAM47B	170062	hgsc.bcm.edu	37	X	34961267	34961267	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chrX:34961267C>A	ENST00000329357.5	+	1	355	c.319C>A	c.(319-321)Ctc>Atc	p.L107I		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	107								p.L107I(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						ATTTTCCGAGCTCTCGCCAGT	0.522																																					p.L107I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C319A	X						.						89.0	82.0	85.0					X																	34961267		2202	4300	6502	34871188	SO:0001583	missense	170062	exon1			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.319C>A	X.37:g.34961267C>A	ENSP00000328307:p.Leu107Ile		34871188	NM_152631	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.703513	0.30232	.	.	ENSG00000189132	ENST00000329357	T	0.20881	2.04	0.843	0.843	0.18935	.	.	.	.	.	T	0.40979	0.1139	M	0.82323	2.585	0.09310	N	1	D	0.76494	0.999	D	0.81914	0.995	T	0.15235	-1.0444	9	0.46703	T	0.11	.	3.0451	0.06151	0.0:0.6677:0.0:0.3323	.	107	Q8NA70	FA47B_HUMAN	I	107	ENSP00000328307:L107I	ENSP00000328307:L107I	L	+	1	0	FAM47B	34871188	0.002000	0.14202	0.016000	0.15963	0.004000	0.04260	0.245000	0.18142	0.695000	0.31675	0.292000	0.19580	CTC		0.522	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
MED14	9282	hgsc.bcm.edu	37	X	40522178	40522178	+	Splice_Site	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chrX:40522178G>A	ENST00000324817.1	-	26	3801	c.3683C>T	c.(3682-3684)aCg>aTg	p.T1228M		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1228					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.T1228M(1)		NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TACCCATACCGTTTCTTGTTG	0.433																																					p.T1228M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3683T	X						.						47.0	37.0	40.0					X																	40522178		2202	4300	6502	40407122	SO:0001630	splice_region_variant	9282	exon26			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.3684+1C>T	X.37:g.40522178G>A			40407122	NM_004229	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	37	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188710	0.57909	.	.	ENSG00000180182	ENST00000324817;ENST00000433003	T;T	0.56275	0.47;0.47	5.59	5.59	0.84812	.	0.092711	0.85682	D	0.000000	T	0.45316	0.1336	L	0.34521	1.04	0.80722	D	1	B;B	0.16396	0.017;0.017	B;B	0.08055	0.003;0.003	T	0.24693	-1.0153	10	0.33940	T	0.23	.	18.6702	0.91508	0.0:0.0:1.0:0.0	.	1228;1228	A8KAK5;O60244	.;MED14_HUMAN	M	1228;127	ENSP00000323720:T1228M;ENSP00000411357:T127M	ENSP00000323720:T1228M	T	-	2	0	MED14	40407122	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	8.702000	0.91338	2.353000	0.79882	0.529000	0.55759	ACG		0.433	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229	Missense_Mutation
NDUFB11	54539	hgsc.bcm.edu	37	X	47001818	47001818	+	Silent	SNP	G	G	A	rs199726768		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chrX:47001818G>A	ENST00000377811.3	-	3	1184	c.360C>T	c.(358-360)cgC>cgT	p.R120R	RBM10_ENST00000345781.6_5'Flank|RBM10_ENST00000377604.3_5'Flank|NDUFB11_ENST00000276062.8_Silent_p.R130R|RBM10_ENST00000329236.7_5'Flank	NM_001135998.2	NP_001129470.1	Q9NX14	NDUBB_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa	120					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)		p.R130R(2)		endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	7						TCTCAGCTTCGCGGCGGGACC	0.547													G|||	1	0.000264901	0.0	0.0014	3775	,	,		14081	0.0		0.0	False		,,,				2504	0.0				p.R130R	Ovarian(77;454 1296 7908 21551 37072)											.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C390T	X						.						88.0	67.0	74.0					X																	47001818		2203	4300	6503	46886762	SO:0001819	synonymous_variant	54539	exon3			AF044213	CCDS14273.1, CCDS48100.1	Xp11.3	2011-07-04			ENSG00000147123	ENSG00000147123		"""Mitochondrial respiratory chain complex / Complex I"""	20372	protein-coding gene	gene with protein product	"""complex I NP17.3 subunit"""	300403				10544803, 12381726	Standard	NM_019056		Approved	ESSS, NP17.3, Np15	uc004dhc.3	Q9NX14	OTTHUMG00000021433	ENST00000377811.3:c.360C>T	X.37:g.47001818G>A			46886762	NM_019056	Q5JRR3|Q5JRR4|Q6IAB6|Q8WZ96|Q9BXX9	Silent	SNP	ENST00000377811.3	37	CCDS48100.1																																																																																				0.547	NDUFB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056382.1	NM_019056	
WDR45	11152	hgsc.bcm.edu	37	X	48933108	48933108	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chrX:48933108C>A	ENST00000376372.3	-	9	923	c.742G>T	c.(742-744)Gac>Tac	p.D248Y	WDR45_ENST00000356463.3_Missense_Mutation_p.D249Y|PRAF2_ENST00000491199.1_5'Flank|WDR45_ENST00000396681.4_Intron|WDR45_ENST00000553851.1_Missense_Mutation_p.D146Y|AF196779.12_ENST00000376358.3_Missense_Mutation_p.D146Y|WDR45_ENST00000473974.1_Intron|WDR45_ENST00000376368.2_Missense_Mutation_p.D249Y|WDR45_ENST00000465431.1_5'Flank|PRAF2_ENST00000376390.4_5'Flank|WDR45_ENST00000485908.1_Missense_Mutation_p.D213Y|WDR45_ENST00000322995.8_Missense_Mutation_p.D259Y|PRAF2_ENST00000376386.3_5'Flank	NM_001029896.1	NP_001025067.1	Q9Y484	WIPI4_HUMAN	WD repeat domain 45	248					autophagy (GO:0006914)|cell death (GO:0008219)			p.D249Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	19						AAGGAGGAGTCGTGGCTGAAG	0.552																																					p.D248Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G742T	X						.						72.0	60.0	64.0					X																	48933108		2203	4300	6503	48820052	SO:0001583	missense	11152	exon9			BC003037	CCDS14318.1, CCDS35250.1	Xp11.23	2013-06-06	2004-09-02	2004-09-03	ENSG00000196998	ENSG00000196998		"""WD repeat domain containing"""	28912	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 5"""	300526	"""WD repeat domain, X-linked 1"""	WDRX1		12477932	Standard	NM_007075		Approved	JM5, WIPI4, NBIA5	uc004dmk.1	Q9Y484	OTTHUMG00000034500	ENST00000376372.3:c.742G>T	X.37:g.48933108C>A	ENSP00000365551:p.Asp248Tyr		48820052	NM_001029896	A6NGH5|B7WPI2|Q5MNZ5|Q6IBS7|Q6NT94|Q96H03	Missense_Mutation	SNP	ENST00000376372.3	37	CCDS35250.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.37|18.37	3.609690|3.609690	0.66558|0.66558	.|.	.|.	ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000250232|ENSG00000196998	ENST00000553851;ENST00000376372;ENST00000322995;ENST00000356463;ENST00000485908;ENST00000376368;ENST00000475977;ENST00000376358|ENST00000367375	T;T;T;T;T;T;T;T|.	0.72505|.	1.88;0.14;0.14;0.14;0.31;0.14;-0.66;1.88|.	3.69|3.69	3.69|3.69	0.42338|0.42338	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84804|0.84804	0.5553|0.5553	M|M	0.93808|0.93808	3.46|3.46	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.87578|.	0.998;0.997;0.997;0.993;0.994|.	D|D	0.89338|0.89338	0.3652|0.3652	10|5	0.87932|.	D|.	0|.	-14.7523|-14.7523	14.2949|14.2949	0.66304|0.66304	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	146;259;213;249;248|.	A6NM71;Q9Y484-2;C9JYH8;Q9Y484-3;Q9Y484|.	.;.;.;.;WIPI4_HUMAN|.	Y|L	146;248;259;249;213;249;76;146|174	ENSP00000451962:D146Y;ENSP00000365551:D248Y;ENSP00000365543:D259Y;ENSP00000348848:D249Y;ENSP00000419897:D213Y;ENSP00000365546:D249Y;ENSP00000417754:D76Y;ENSP00000365536:D146Y|.	ENSP00000365536:D146Y|.	D|R	-|-	1|2	0|0	AF196779.12;WDR45|WDR45	48820052|48820052	1.000000|1.000000	0.71417|0.71417	0.935000|0.935000	0.37517|0.37517	0.955000|0.955000	0.61496|0.61496	7.225000|7.225000	0.78051|0.78051	1.796000|1.796000	0.52611|0.52611	0.409000|0.409000	0.27619|0.27619	GAC|CGA		0.552	WDR45-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083418.2	NM_007075	
POU3F4	5456	hgsc.bcm.edu	37	X	82764090	82764090	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chrX:82764090A>G	ENST00000373200.2	+	1	822	c.758A>G	c.(757-759)aAc>aGc	p.N253S	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	253	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N253S(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						CCCCTGCTGAACAAGTGGCTG	0.572																																					p.N253S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A758G	X						.						43.0	38.0	40.0					X																	82764090		2203	4300	6503	82650746	SO:0001583	missense	5456	exon1			X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.758A>G	X.37:g.82764090A>G	ENSP00000362296:p.Asn253Ser		82650746	NM_000307	B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	CCDS14450.1	.	.	.	.	.	.	.	.	.	.	A	17.28	3.349295	0.61183	.	.	ENSG00000196767	ENST00000373200	T	0.66995	-0.24	5.07	5.07	0.68467	POU-specific (3);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.85682	D	0.000000	T	0.45337	0.1337	N	0.01576	-0.805	0.48975	D	0.999732	B	0.33549	0.417	B	0.42062	0.374	T	0.52238	-0.8602	10	0.24483	T	0.36	.	13.8382	0.63421	1.0:0.0:0.0:0.0	.	253	P49335	PO3F4_HUMAN	S	253	ENSP00000362296:N253S	ENSP00000362296:N253S	N	+	2	0	POU3F4	82650746	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.047000	0.93823	1.797000	0.52628	0.427000	0.28365	AAC		0.572	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307	
HDX	139324	hgsc.bcm.edu	37	X	83723538	83723538	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chrX:83723538G>T	ENST00000297977.5	-	3	1304	c.1193C>A	c.(1192-1194)tCt>tAt	p.S398Y	HDX_ENST00000373177.2_Missense_Mutation_p.S398Y|HDX_ENST00000506585.2_Missense_Mutation_p.S340Y	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	398						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S398Y(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						AAAATGAGGAGAAAAATTACT	0.318																																					p.S398Y	Pancreas(53;231 1169 36156 43751 51139)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1193A	X						.						122.0	102.0	109.0					X																	83723538		2202	4300	6502	83610194	SO:0001583	missense	139324	exon4			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.1193C>A	X.37:g.83723538G>T	ENSP00000297977:p.Ser398Tyr		83610194	NM_001177479	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	ENST00000297977.5	37	CCDS35342.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160342	0.38119	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585	T;T;T	0.35789	1.35;1.29;1.35	5.19	5.19	0.71726	.	0.397620	0.26026	N	0.026783	T	0.45498	0.1345	L	0.56769	1.78	0.37683	D	0.923547	D	0.54964	0.969	P	0.50970	0.655	T	0.55335	-0.8157	10	0.66056	D	0.02	-37.9437	12.8832	0.58028	0.0:0.0:0.8375:0.1625	.	398	Q7Z353	HDX_HUMAN	Y	398;340;398	ENSP00000297977:S398Y;ENSP00000362272:S340Y;ENSP00000423670:S398Y	ENSP00000297977:S398Y	S	-	2	0	HDX	83610194	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	3.598000	0.54038	2.144000	0.66660	0.415000	0.27848	TCT		0.318	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	NM_144657	
PABPC5	140886	hgsc.bcm.edu	37	X	90690624	90690624	+	Silent	SNP	C	C	G			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chrX:90690624C>G	ENST00000312600.3	+	2	262	c.48C>G	c.(46-48)ctC>ctG	p.L16L	PABPC5_ENST00000373105.1_Intron|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	16						mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L16L(2)		central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						AGAAGTATCTCAAGGCCGCTC	0.527																																					p.L16L												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C48G	X						.						82.0	63.0	70.0					X																	90690624		2203	4300	6503	90577280	SO:0001819	synonymous_variant	140886	exon2			AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.48C>G	X.37:g.90690624C>G			90577280	NM_080832	A8K240|Q5JQF4|Q6P529|Q9UFE5	Silent	SNP	ENST00000312600.3	37	CCDS14460.1																																																																																				0.527	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832	
GAB3	139716	hgsc.bcm.edu	37	X	153928304	153928304	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chrX:153928304C>T	ENST00000369575.3	-	5	1128	c.1097G>A	c.(1096-1098)cGa>cAa	p.R366Q	GAB3_ENST00000424127.2_Missense_Mutation_p.R367Q|GAB3_ENST00000496390.1_5'UTR	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	366					macrophage differentiation (GO:0030225)			p.R366Q(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCGCTTGTCTCGGTGTCTTAA	0.388																																					p.R367Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1100A	X						.						160.0	143.0	149.0					X																	153928304		2203	4300	6503	153581498	SO:0001583	missense	139716	exon5			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1097G>A	X.37:g.153928304C>T	ENSP00000358588:p.Arg366Gln		153581498	NM_001081573	A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.236168	0.39498	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.26373	1.74;1.74;1.74	5.76	3.99	0.46301	.	0.871922	0.09643	N	0.774794	T	0.22551	0.0544	L	0.52759	1.655	0.31057	N	0.714563	B;B;B	0.30193	0.272;0.272;0.272	B;B;B	0.17979	0.02;0.02;0.02	T	0.16867	-1.0388	10	0.27082	T	0.32	-7.1472	9.5872	0.39524	0.0:0.8252:0.0:0.1748	.	367;367;366	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	Q	366;367;367	ENSP00000358588:R366Q;ENSP00000358581:R367Q;ENSP00000399588:R367Q	ENSP00000358581:R367Q	R	-	2	0	GAB3	153581498	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.677000	0.54619	0.592000	0.29728	0.468000	0.43344	CGA		0.388	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573	
TMEM178A	130733	hgsc.bcm.edu	37	2	39931272	39931272	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr2:39931272G>A	ENST00000281961.2	+	2	508	c.452G>A	c.(451-453)cGc>cAc	p.R151H	TMEM178A_ENST00000482239.1_3'UTR	NM_152390.2	NP_689603.2	Q8NBL3	T178A_HUMAN	transmembrane protein 178A	151						integral component of membrane (GO:0016021)		p.R151H(1)									CAGCCCATCCGCTTGCGAAAC	0.448																																					p.R151H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G452A	2						.						109.0	97.0	101.0					2																	39931272		2203	4300	6503	39784776	SO:0001583	missense	130733	exon2			BC029530	CCDS1804.1	2p22.1	2012-06-29	2012-06-29	2012-06-29	ENSG00000152154	ENSG00000152154			28517	protein-coding gene	gene with protein product			"""transmembrane protein 178"""	TMEM178		12975309	Standard	NM_001167959		Approved	MGC33926	uc002rrt.3	Q8NBL3	OTTHUMG00000128591	ENST00000281961.2:c.452G>A	2.37:g.39931272G>A	ENSP00000281961:p.Arg151His		39784776	NM_152390	Q6UWI6|Q8N6N4	Missense_Mutation	SNP	ENST00000281961.2	37	CCDS1804.1	.	.	.	.	.	.	.	.	.	.	G	33	5.270385	0.95429	.	.	ENSG00000152154	ENST00000281961	T	0.46819	0.86	5.64	5.64	0.86602	.	0.050919	0.85682	D	0.000000	T	0.64886	0.2639	L	0.54323	1.7	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.61471	-0.7056	9	.	.	.	-21.5683	17.2112	0.86930	0.0:0.0:1.0:0.0	.	151	Q8NBL3	TM178_HUMAN	H	151	ENSP00000281961:R151H	.	R	+	2	0	TMEM178	39784776	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.680000	0.54641	2.653000	0.90120	0.655000	0.94253	CGC		0.448	TMEM178A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250445.2	NM_152390	
CCDC88A	55704	hgsc.bcm.edu	37	2	55589525	55589525	+	Silent	SNP	C	C	T	rs143776239	byFrequency	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr2:55589525C>T	ENST00000436346.1	-	7	1387	c.546G>A	c.(544-546)tcG>tcA	p.S182S	CCDC88A_ENST00000336838.6_Silent_p.S182S|CCDC88A_ENST00000413716.2_Silent_p.S182S|CCDC88A_ENST00000263630.8_Silent_p.S182S	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	182					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)	p.S182S(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TGTCCTCCTGCGACATATCAG	0.358																																					p.S182S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G546A	2						.	C	,	3,4403	6.2+/-15.9	0,3,2200	108.0	103.0	105.0		546,546	0.7	1.0	2	dbSNP_134	105	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CCDC88A	NM_001135597.1,NM_018084.4	,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,	182/1871,182/1844	55589525	3,13003	2203	4300	6503	55443029	SO:0001819	synonymous_variant	55704	exon7			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.546G>A	2.37:g.55589525C>T			55443029	NM_001135597	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Silent	SNP	ENST00000436346.1	37																																																																																					0.358	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
CLEC4F	165530	hgsc.bcm.edu	37	2	71044115	71044115	+	Missense_Mutation	SNP	G	G	A	rs555202980		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr2:71044115G>A	ENST00000272367.2	-	4	474	c.398C>T	c.(397-399)tCg>tTg	p.S133L	CLEC4F_ENST00000426626.1_Missense_Mutation_p.S133L	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	133					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.S133L(1)		endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CTGGAGCTGCGAATTGACATT	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		21485	0.0		0.0	False		,,,				2504	0.001				p.S133L	Colon(107;10 2157 6841 26035)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C398T	2						.						132.0	116.0	121.0					2																	71044115		2203	4300	6503	70897623	SO:0001583	missense	165530	exon4			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.398C>T	2.37:g.71044115G>A	ENSP00000272367:p.Ser133Leu		70897623	NM_173535	A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	G	6.624	0.483560	0.12581	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.04862	3.85;3.54	5.15	3.31	0.37934	.	0.170274	0.28521	N	0.015049	T	0.04543	0.0124	L	0.27053	0.805	0.23838	N	0.996701	B;B	0.30937	0.301;0.301	B;B	0.20577	0.03;0.03	T	0.37150	-0.9718	10	0.39692	T	0.17	.	10.1647	0.42873	0.1765:0.0:0.8235:0.0	.	133;133	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	L	133	ENSP00000272367:S133L;ENSP00000390581:S133L	ENSP00000272367:S133L	S	-	2	0	CLEC4F	70897623	1.000000	0.71417	1.000000	0.80357	0.054000	0.15201	1.300000	0.33436	0.695000	0.31675	-1.595000	0.00837	TCG		0.463	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
RHBDD1	84236	hgsc.bcm.edu	37	2	227732001	227732001	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr2:227732001T>G	ENST00000341329.3	+	3	775	c.533T>G	c.(532-534)gTc>gGc	p.V178G	RHBDD1_ENST00000392062.2_Missense_Mutation_p.V178G	NM_032276.3	NP_115652.2	Q8TEB9	RHBL4_HUMAN	rhomboid domain containing 1	178					apoptotic process (GO:0006915)|cellular response to unfolded protein (GO:0034620)|cellular response to UV (GO:0034644)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|membrane protein intracellular domain proteolysis (GO:0031293)|membrane protein proteolysis (GO:0033619)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein processing (GO:0010954)|positive regulation of secretion (GO:0051047)|post-translational protein modification (GO:0043687)|spermatid differentiation (GO:0048515)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.V178G(1)		breast(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		GCTTGTTGGGTCGAACTTGTG	0.398																																					p.V178G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T533G	2						.						256.0	247.0	250.0					2																	227732001		2203	4300	6503	227440245	SO:0001583	missense	84236	exon5			AK074258	CCDS2464.1	2q36.3	2012-07-09			ENSG00000144468	ENSG00000144468			23081	protein-coding gene	gene with protein product						12838346	Standard	NM_032276		Approved	DKFZp547E052	uc002voi.3	Q8TEB9	OTTHUMG00000133178	ENST00000341329.3:c.533T>G	2.37:g.227732001T>G	ENSP00000344779:p.Val178Gly		227440245	NM_001167608	Q495B9|Q53S43|Q5EBM8|Q6P5V8|Q8IV60|Q9H057	Missense_Mutation	SNP	ENST00000341329.3	37	CCDS2464.1	.	.	.	.	.	.	.	.	.	.	T	19.47	3.833375	0.71258	.	.	ENSG00000144468	ENST00000341329;ENST00000392062	T;T	0.16324	2.35;2.35	5.89	1.55	0.23275	Peptidase S54, rhomboid domain (1);	0.320544	0.37053	N	0.002276	T	0.21227	0.0511	L	0.53249	1.67	0.58432	D	0.999995	P	0.46395	0.877	P	0.49387	0.609	T	0.01283	-1.1396	10	0.49607	T	0.09	-3.6241	7.7836	0.29078	0.0:0.4969:0.0:0.5031	.	178	Q8TEB9	RHBD1_HUMAN	G	178	ENSP00000344779:V178G;ENSP00000375914:V178G	ENSP00000344779:V178G	V	+	2	0	RHBDD1	227440245	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	1.453000	0.35167	0.392000	0.25172	-0.472000	0.04984	GTC		0.398	RHBDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256885.2		
COL15A1	1306	hgsc.bcm.edu	37	9	101777749	101777749	+	Silent	SNP	G	G	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr9:101777749G>T	ENST00000375001.3	+	10	1827	c.1404G>T	c.(1402-1404)gtG>gtT	p.V468V		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	468	4 X tandem repeats.|Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)	p.V468V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				CAACCGAAGTGTCCCTCAGTA	0.582																																					p.V468V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1404T	9						.						82.0	74.0	77.0					9																	101777749		2203	4300	6503	100817570	SO:0001819	synonymous_variant	1306	exon10			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1404G>T	9.37:g.101777749G>T			100817570	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Silent	SNP	ENST00000375001.3	37	CCDS35081.1																																																																																				0.582	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
CNTRL	11064	hgsc.bcm.edu	37	9	123904531	123904531	+	Nonsense_Mutation	SNP	C	C	T	rs144941298		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr9:123904531C>T	ENST00000373855.1	+	19	3114	c.2854C>T	c.(2854-2856)Cga>Tga	p.R952*	CNTRL_ENST00000373850.1_Nonsense_Mutation_p.R400*|CNTRL_ENST00000373847.1_Nonsense_Mutation_p.R400*|CNTRL_ENST00000238341.5_Nonsense_Mutation_p.R952*			Q7Z7A1	CNTRL_HUMAN	centriolin	952					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.R952*(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GGCCCAACTCCGAGAGTTAGA	0.458																																					p.R952X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2854T	9						.	C	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	42.0	42.0	42.0		2854	3.6	1.0	9	dbSNP_134	42	0,8600		0,0,4300	no	stop-gained	CNTRL	NM_007018.4		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		952/2326	123904531	1,13005	2203	4300	6503	122944352	SO:0001587	stop_gained	11064	exon17			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.2854C>T	9.37:g.123904531C>T	ENSP00000362962:p.Arg952*		122944352	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Nonsense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	C	37	6.508164	0.97624	2.27E-4	0.0	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	.	.	.	5.49	3.56	0.40772	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	9.9548	0.41660	0.1191:0.6664:0.2145:0.0	.	.	.	.	X	952;952;952;434;400;400	.	ENSP00000238341:R952X	R	+	1	2	CNTRL	122944352	0.993000	0.37304	0.998000	0.56505	0.992000	0.81027	1.832000	0.39151	1.282000	0.44496	0.563000	0.77884	CGA		0.458	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
ZCCHC6	79670	hgsc.bcm.edu	37	9	88937854	88937854	+	Missense_Mutation	SNP	T	T	A	rs58050565|rs77621374|rs397759922	byFrequency	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr9:88937854T>A	ENST00000375963.3	-	13	2983	c.2811A>T	c.(2809-2811)aaA>aaT	p.K937N	ZCCHC6_ENST00000375961.2_Missense_Mutation_p.K937N|ZCCHC6_ENST00000469004.1_5'Flank|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.K226N|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.K814N	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	937				Missing (in Ref. 1; CAI45944/CAH56219). {ECO:0000305}.	RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						CAGGTGAATTTTTTTCTTCAC	0.343																																					p.K937N												.	.	0			c.A2811T	9						.						29.0	32.0	31.0					9																	88937854		2059	4076	6135	88127674	SO:0001583	missense	79670	exon13			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2811A>T	9.37:g.88937854T>A	ENSP00000365130:p.Lys937Asn		88127674	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	-	4.685	0.127420	0.08981	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375963	T;T;T;T	0.56611	0.45;0.9;0.87;0.88	5.24	2.89	0.33648	.	0.839607	0.08576	U	0.925223	T	0.32285	0.0824	N	0.08118	0	0.09310	N	1	B;P	0.39094	0.003;0.659	B;B	0.42959	0.0;0.403	T	0.17167	-1.0378	10	0.19590	T	0.45	.	3.5944	0.08001	0.2793:0.1598:0.0:0.5609	.	814;937	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	N	226;814;937;937	ENSP00000277141:K226N;ENSP00000365127:K814N;ENSP00000365128:K937N;ENSP00000365130:K937N	ENSP00000277141:K226N	K	-	3	2	ZCCHC6	88127674	0.000000	0.05858	0.997000	0.53966	0.445000	0.32107	-0.165000	0.09968	0.453000	0.26858	0.528000	0.53228	AAA		0.343	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
SEMA4D	10507	hgsc.bcm.edu	37	9	92003589	92003589	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr9:92003589G>A	ENST00000450295.1	-	11	1845	c.1069C>T	c.(1069-1071)Cgc>Tgc	p.R357C	SEMA4D_ENST00000438547.2_Missense_Mutation_p.R357C|SEMA4D_ENST00000339861.4_Missense_Mutation_p.R357C|SEMA4D_ENST00000422704.2_Missense_Mutation_p.R357C|SEMA4D_ENST00000356444.2_Missense_Mutation_p.R357C|SEMA4D_ENST00000455551.2_Missense_Mutation_p.R357C|SEMA4D_ENST00000420987.1_Missense_Mutation_p.R357C|SEMA4D_ENST00000343780.4_Missense_Mutation_p.R357C			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	357	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.R357C(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						CCATTATAGCGCACCCACTTG	0.647																																					p.R357C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1069T	9						.						70.0	54.0	59.0					9																	92003589		2203	4300	6503	91193409	SO:0001583	missense	10507	exon13			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.1069C>T	9.37:g.92003589G>A	ENSP00000416523:p.Arg357Cys		91193409	NM_001142287	B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	ENST00000450295.1	37	CCDS6685.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337765	0.81911	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000455551;ENST00000343780;ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	T;T;T;T;T;T;T;T	0.11604	2.76;2.76;2.76;2.76;2.76;2.76;2.76;2.76	4.66	2.75	0.32379	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.103824	0.64402	D	0.000005	T	0.32793	0.0841	M	0.85945	2.785	0.80722	D	1	D;D	0.67145	0.983;0.996	P;D	0.63381	0.792;0.914	T	0.30179	-0.9987	10	0.72032	D	0.01	.	13.5135	0.61526	0.0:0.0:0.715:0.285	.	357;357	Q92854-2;Q92854	.;SEM4D_HUMAN	C	357	ENSP00000344923:R357C;ENSP00000391733:R357C;ENSP00000411981:R357C;ENSP00000343418:R357C;ENSP00000416523:R357C;ENSP00000405102:R357C;ENSP00000348822:R357C;ENSP00000388768:R357C	ENSP00000344923:R357C	R	-	1	0	SEMA4D	91193409	1.000000	0.71417	0.999000	0.59377	0.873000	0.50193	2.642000	0.46596	0.636000	0.30508	0.561000	0.74099	CGC		0.647	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1	NM_006378	
VAV2	7410	hgsc.bcm.edu	37	9	136637120	136637120	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr9:136637120C>A	ENST00000371850.3	-	26	2215	c.2184G>T	c.(2182-2184)tgG>tgT	p.W728C	VAV2_ENST00000406606.3_Missense_Mutation_p.W718C|VAV2_ENST00000371851.1_Missense_Mutation_p.W718C	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	728	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.W718C(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		TGATGTGGATCCAGTTGTCCT	0.622																																					p.W728C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2184T	9						.						320.0	266.0	284.0					9																	136637120		2203	4300	6503	135626941	SO:0001583	missense	7410	exon26				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.2184G>T	9.37:g.136637120C>A	ENSP00000360916:p.Trp728Cys		135626941	NM_001134398	A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	ENST00000371850.3	37	CCDS48053.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.104713	0.56291	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	D;D;D	0.88277	-2.36;-2.36;-2.36	3.98	3.98	0.46160	SH2 motif (4);	0.124361	0.64402	D	0.000016	D	0.84781	0.5548	N	0.01874	-0.695	0.80722	D	1	B;D;B	0.89917	0.001;1.0;0.001	B;D;B	0.78314	0.012;0.991;0.012	D	0.87077	0.2163	10	0.33940	T	0.23	.	15.055	0.71908	0.0:1.0:0.0:0.0	.	718;728;718	P52735-2;P52735;P52735-3	.;VAV2_HUMAN;.	C	728;718;718;718	ENSP00000360916:W728C;ENSP00000360917:W718C;ENSP00000385362:W718C	ENSP00000317258:W718C	W	-	3	0	VAV2	135626941	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	7.253000	0.78320	1.775000	0.52247	0.313000	0.20887	TGG		0.622	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1		
PCDH9	5101	hgsc.bcm.edu	37	13	67800217	67800217	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr13:67800217C>A	ENST00000377865.2	-	1	2490	c.2356G>T	c.(2356-2358)Gac>Tac	p.D786Y	PCDH9_ENST00000328454.5_Missense_Mutation_p.D786Y|PCDH9_ENST00000544246.1_Missense_Mutation_p.D786Y|PCDH9_ENST00000377861.3_Missense_Mutation_p.D786Y|PCDH9_ENST00000456367.1_Missense_Mutation_p.D786Y			Q9HC56	PCDH9_HUMAN	protocadherin 9	786					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D786Y(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CGGATCAAGTCATAGATATAG	0.458																																					p.D786Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2356T	13						.						154.0	149.0	151.0					13																	67800217		2203	4300	6503	66698218	SO:0001583	missense	5101	exon2			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.2356G>T	13.37:g.67800217C>A	ENSP00000367096:p.Asp786Tyr		66698218	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.704170	0.48412	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47	5.93	5.93	0.95920	Protocadherin (1);	0.000000	0.85682	D	0.000000	T	0.44561	0.1299	N	0.22421	0.69	0.80722	D	1	D;D;D;D	0.69078	0.994;0.997;0.997;0.997	D;D;D;D	0.71656	0.916;0.961;0.956;0.974	T	0.30679	-0.9970	10	0.49607	T	0.09	.	20.3409	0.98764	0.0:1.0:0.0:0.0	.	786;786;786;786	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	Y	786	ENSP00000442186:D786Y;ENSP00000367096:D786Y;ENSP00000401699:D786Y;ENSP00000332060:D786Y;ENSP00000367092:D786Y	ENSP00000332060:D786Y	D	-	1	0	PCDH9	66698218	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.772000	0.62324	2.814000	0.96858	0.655000	0.94253	GAC		0.458	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
ABCC4	10257	hgsc.bcm.edu	37	13	95858880	95858880	+	Missense_Mutation	SNP	G	G	T	rs11568701	byFrequency	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr13:95858880G>T	ENST00000376887.4	-	8	1181	c.1067C>A	c.(1066-1068)aCg>aAg	p.T356K	ABCC4_ENST00000538287.1_3'UTR|ABCC4_ENST00000536256.1_Missense_Mutation_p.T281K|ABCC4_ENST00000431522.1_Missense_Mutation_p.T356K|ABCC4_ENST00000412704.1_Missense_Mutation_p.T356K	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	356	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.		T -> M (in dbSNP:rs11568701).		blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.T356K(2)		breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	CCCATACAGCGTCACTGCCAC	0.547																																					p.T356K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1067A	13						.						113.0	97.0	102.0					13																	95858880		2203	4300	6503	94656881	SO:0001583	missense	10257	exon8			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.1067C>A	13.37:g.95858880G>T	ENSP00000366084:p.Thr356Lys		94656881	NM_001105515	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	ENST00000376887.4	37	CCDS9474.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.125320	0.56721	.	.	ENSG00000125257	ENST00000412704;ENST00000376887;ENST00000536256;ENST00000431522	D;D;D;D	0.94613	-2.62;-2.62;-3.47;-2.62	5.34	5.34	0.76211	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.396541	0.30151	N	0.010292	D	0.96614	0.8895	M	0.84948	2.725	0.41685	D	0.98931	P;P;B;P;B	0.42357	0.777;0.524;0.142;0.524;0.302	P;P;B;P;B	0.50378	0.639;0.462;0.232;0.462;0.342	D	0.97487	1.0051	10	0.87932	D	0	.	18.6246	0.91333	0.0:0.0:1.0:0.0	.	281;356;356;356;356	B7Z3Q7;A8K2Q2;O15439-2;Q8IVZ4;O15439	.;.;.;.;MRP4_HUMAN	K	356;356;281;356	ENSP00000388657:T356K;ENSP00000366084:T356K;ENSP00000442024:T281K;ENSP00000398562:T356K	ENSP00000366084:T356K	T	-	2	0	ABCC4	94656881	1.000000	0.71417	0.063000	0.19743	0.004000	0.04260	4.978000	0.63799	2.471000	0.83476	0.655000	0.94253	ACG		0.547	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	
ITGBL1	9358	hgsc.bcm.edu	37	13	102367975	102367975	+	Missense_Mutation	SNP	G	G	A	rs144243522		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr13:102367975G>A	ENST00000376180.3	+	11	1675	c.1456G>A	c.(1456-1458)Gaa>Aaa	p.E486K	ITGBL1_ENST00000376162.3_Missense_Mutation_p.E393K|RP11-397O8.7_ENST00000606869.1_lincRNA|ITGBL1_ENST00000545560.2_Missense_Mutation_p.E345K	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	486	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)		p.E486K(1)		breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AAATGCATGTGAAATCTGGCT	0.378																																					p.E486K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1456A	13						.						256.0	246.0	250.0					13																	102367975		2203	4300	6503	101165976	SO:0001583	missense	9358	exon11			AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.1456G>A	13.37:g.102367975G>A	ENSP00000365351:p.Glu486Lys		101165976	NM_004791	A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Missense_Mutation	SNP	ENST00000376180.3	37	CCDS9499.1	.	.	.	.	.	.	.	.	.	.	G	35	5.478015	0.96291	.	.	ENSG00000198542	ENST00000376180;ENST00000537118;ENST00000539955;ENST00000545560;ENST00000376162	D;D;D	0.92647	-3.08;-3.08;-3.08	5.83	5.83	0.93111	.	0.095039	0.64402	D	0.000001	D	0.96128	0.8738	M	0.79123	2.44	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.79784	0.985;0.993	D	0.95029	0.8167	10	0.42905	T	0.14	.	20.1219	0.97964	0.0:0.0:1.0:0.0	.	345;486	B3KTP1;O95965	.;ITGBL_HUMAN	K	486;394;345;345;393	ENSP00000365351:E486K;ENSP00000439903:E345K;ENSP00000365332:E393K	ENSP00000365332:E393K	E	+	1	0	ITGBL1	101165976	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.224000	0.95209	2.758000	0.94735	0.650000	0.86243	GAA		0.378	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791	
CUTC	51076	hgsc.bcm.edu	37	10	101515475	101515475	+	Silent	SNP	C	C	T	rs370349081		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr10:101515475C>T	ENST00000370476.5	+	9	930	c.801C>T	c.(799-801)atC>atT	p.I267I		NM_015960.2	NP_057044.2	Q9NTM9	CUTC_HUMAN	cutC copper transporter	267					copper ion homeostasis (GO:0055070)|copper ion transport (GO:0006825)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	copper ion binding (GO:0005507)	p.I267I(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Colorectal(252;0.234)		Epithelial(162;3e-10)|all cancers(201;2.37e-08)		TGAATGCTATCGCAAAGAACA	0.413																																					p.I267I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C801T	10						.	C		0,4406		0,0,2203	84.0	80.0	82.0		801	3.2	1.0	10		82	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CUTC	NM_015960.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		267/274	101515475	1,13005	2203	4300	6503	101505465	SO:0001819	synonymous_variant	51076	exon9			AF132966	CCDS7483.1	10q24.31	2013-07-31	2013-07-31		ENSG00000119929	ENSG00000119929			24271	protein-coding gene	gene with protein product		610101	"""cutC copper transporter homolog (E. coli)"""			16182249	Standard	NM_015960		Approved	CGI-32	uc001kqd.4	Q9NTM9	OTTHUMG00000018889	ENST00000370476.5:c.801C>T	10.37:g.101515475C>T			101505465	NM_015960	Q5TCZ8|Q9Y321	Silent	SNP	ENST00000370476.5	37	CCDS7483.1																																																																																				0.413	CUTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049811.1	NM_015960	
SVIL	6840	hgsc.bcm.edu	37	10	29839609	29839609	+	Silent	SNP	G	G	A	rs555046554		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr10:29839609G>A	ENST00000355867.4	-	6	1496	c.744C>T	c.(742-744)caC>caT	p.H248H	SVIL_ENST00000375400.3_Silent_p.H248H|SVIL_ENST00000375398.2_Silent_p.H248H	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	248					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.H248H(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				AGCTGTGGGCGTGCTTGGGGG	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		15084	0.0		0.0	False		,,,				2504	0.001				p.H248H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C744T	10						.						51.0	54.0	53.0					10																	29839609		2203	4300	6503	29879615	SO:0001819	synonymous_variant	6840	exon8			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.744C>T	10.37:g.29839609G>A			29879615	NM_003174	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	CCDS7164.1																																																																																				0.647	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
ADAM12	8038	hgsc.bcm.edu	37	10	127806756	127806756	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr10:127806756C>G	ENST00000368679.4	-	6	772	c.463G>C	c.(463-465)Gaa>Caa	p.E155Q	ADAM12_ENST00000368676.4_Missense_Mutation_p.E155Q	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	155					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.E155Q(2)		biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TTCATTGGTTCTAAGACATAG	0.383																																					p.E155Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G463C	10						.						112.0	97.0	102.0					10																	127806756		2203	4300	6503	127796746	SO:0001583	missense	8038	exon6			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.463G>C	10.37:g.127806756C>G	ENSP00000357668:p.Glu155Gln		127796746	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	37	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	C	17.44	3.390622	0.62066	.	.	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	T;T;T	0.09911	2.93;2.93;2.93	5.03	5.03	0.67393	Peptidase M12B, propeptide (1);	0.000000	0.85682	D	0.000000	T	0.33876	0.0878	M	0.73753	2.245	0.50813	D	0.999898	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;1.0	T	0.02275	-1.1184	10	0.52906	T	0.07	.	16.3287	0.82997	0.0:1.0:0.0:0.0	.	152;152;155;152;155	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	Q	155;155;152	ENSP00000357668:E155Q;ENSP00000357665:E155Q;ENSP00000391268:E152Q	ENSP00000357665:E155Q	E	-	1	0	ADAM12	127796746	1.000000	0.71417	0.611000	0.29010	0.724000	0.41520	4.192000	0.58378	2.620000	0.88729	0.655000	0.94253	GAA		0.383	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
DNAH5	1767	hgsc.bcm.edu	37	5	13901560	13901560	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr5:13901560C>T	ENST00000265104.4	-	14	1957	c.1853G>A	c.(1852-1854)cGa>cAa	p.R618Q		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	618	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R618Q(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGGCTGGTTTCGAGCCAGAGG	0.473									Kartagener syndrome																												p.R618Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1853A	5						.						64.0	61.0	62.0					5																	13901560		2203	4300	6503	13954560	SO:0001583	missense	1767	exon14	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.1853G>A	5.37:g.13901560C>T	ENSP00000265104:p.Arg618Gln		13954560	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	31	5.082111	0.94050	.	.	ENSG00000039139	ENST00000265104	T	0.59224	0.28	5.55	5.55	0.83447	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.77253	0.4103	M	0.87900	2.915	0.58432	D	0.999997	D	0.61697	0.99	P	0.57324	0.818	T	0.80935	-0.1160	10	0.62326	D	0.03	.	19.4947	0.95067	0.0:1.0:0.0:0.0	.	618	Q8TE73	DYH5_HUMAN	Q	618	ENSP00000265104:R618Q	ENSP00000265104:R618Q	R	-	2	0	DNAH5	13954560	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.750000	0.62162	2.622000	0.88805	0.491000	0.48974	CGA		0.473	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
PCDHB5	26167	hgsc.bcm.edu	37	5	140515899	140515899	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr5:140515899G>A	ENST00000231134.5	+	1	1100	c.883G>A	c.(883-885)Gag>Aag	p.E295K		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	295	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E295K(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTAATAGACGAGAAAACAGC	0.458																																					p.E295K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G883A	5						.						95.0	98.0	97.0					5																	140515899		2203	4300	6503	140496083	SO:0001583	missense	26167	exon1			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.883G>A	5.37:g.140515899G>A	ENSP00000231134:p.Glu295Lys		140496083	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	G	3.621	-0.077576	0.07184	.	.	ENSG00000113209	ENST00000231134;ENST00000537936	T	0.51574	0.7	5.37	-1.05	0.10036	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.27967	0.0689	N	0.21448	0.665	0.09310	N	1	B	0.13145	0.007	B	0.13407	0.009	T	0.24476	-1.0159	9	0.17832	T	0.49	.	7.5572	0.27831	0.282:0.3279:0.3902:0.0	.	295	Q9Y5E4	PCDB5_HUMAN	K	295;79	ENSP00000231134:E295K	ENSP00000231134:E295K	E	+	1	0	PCDHB5	140496083	0.000000	0.05858	0.002000	0.10522	0.118000	0.20060	-1.431000	0.02432	-0.118000	0.11851	-0.273000	0.10243	GAG		0.458	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
CDH9	1007	hgsc.bcm.edu	37	5	26885905	26885905	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr5:26885905G>A	ENST00000231021.4	-	11	1872	c.1700C>T	c.(1699-1701)cCg>cTg	p.P567L		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	567	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P567L(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GATTAAAATCGGCAATAAGTA	0.408																																					p.P567L	Melanoma(8;187 585 15745 40864 52829)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1700T	5						.						69.0	63.0	65.0					5																	26885905		2203	4300	6503	26921662	SO:0001583	missense	1007	exon11			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1700C>T	5.37:g.26885905G>A	ENSP00000231021:p.Pro567Leu		26921662	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245393	0.80024	.	.	ENSG00000113100	ENST00000231021	T	0.50813	0.73	5.79	5.79	0.91817	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.72399	0.3455	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.96;0.993	T	0.73814	-0.3864	9	.	.	.	.	18.5999	0.91246	0.0:0.0:1.0:0.0	.	160;567	B4DFP0;Q9ULB4	.;CADH9_HUMAN	L	567	ENSP00000231021:P567L	.	P	-	2	0	CDH9	26921662	1.000000	0.71417	0.656000	0.29637	0.487000	0.33371	9.820000	0.99359	2.740000	0.93945	0.563000	0.77884	CCG		0.408	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
VCAN	1462	hgsc.bcm.edu	37	5	82816858	82816858	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr5:82816858C>G	ENST00000265077.3	+	7	3298	c.2733C>G	c.(2731-2733)agC>agG	p.S911R	VCAN_ENST00000512590.2_Missense_Mutation_p.S863R|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Missense_Mutation_p.S911R|VCAN_ENST00000343200.5_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	911	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.S911R(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CTATCACAAGCACTGAAGGCC	0.408																																					p.S911R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2733G	5						.						105.0	103.0	104.0					5																	82816858		2203	4300	6503	82852614	SO:0001583	missense	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.2733C>G	5.37:g.82816858C>G	ENSP00000265077:p.Ser911Arg		82852614	NM_001164098	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	C	6.812	0.518950	0.13005	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.24350	1.86;1.86;1.86	5.57	3.62	0.41486	.	0.439089	0.24180	N	0.040813	T	0.24736	0.0600	M	0.65975	2.015	0.29723	N	0.838517	B;B	0.18461	0.01;0.028	B;B	0.14578	0.011;0.009	T	0.20672	-1.0268	10	0.56958	D	0.05	.	5.7641	0.18217	0.3887:0.5062:0.0:0.1051	.	911;911	P13611-3;P13611	.;CSPG2_HUMAN	R	911;911;863	ENSP00000265077:S911R;ENSP00000342768:S911R;ENSP00000425959:S863R	ENSP00000265077:S911R	S	+	3	2	VCAN	82852614	0.001000	0.12720	0.686000	0.30086	0.423000	0.31445	0.757000	0.26433	0.769000	0.33313	0.655000	0.94253	AGC		0.408	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
PDGFRB	5159	hgsc.bcm.edu	37	5	149515232	149515232	+	Missense_Mutation	SNP	C	C	T	rs80162387		TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3534-01A-01W-0831-10	TCGA-AA-3534-10A-01W-0831-10	g.chr5:149515232C>T	ENST00000261799.4	-	3	719	c.250G>A	c.(250-252)Gtg>Atg	p.V84M		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	84	Ig-like C2-type 1.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)	p.V84M(2)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGTGTGAGCACGCTGGAGAAG	0.597			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""								C|||	1	0.000199681	0.0	0.0	5008	,	,		20010	0.001		0.0	False		,,,				2504	0.0				p.V84M			Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	.	.	2	Substitution - Missense(2)	urinary_tract(1)|large_intestine(1)	c.G250A	5						.	C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	101.0	89.0	93.0		250	-5.7	0.0	5	dbSNP_131	93	0,8600		0,0,4300	yes	missense	PDGFRB	NM_002609.3	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	84/1107	149515232	1,13005	2203	4300	6503	149495425	SO:0001583	missense	5159	exon3			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.250G>A	5.37:g.149515232C>T	ENSP00000261799:p.Val84Met		149495425	NM_002609	B5A957|Q8N5L4	Missense_Mutation	SNP	ENST00000261799.4	37	CCDS4303.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	7.214	0.596054	0.13875	2.27E-4	0.0	ENSG00000113721	ENST00000261799;ENST00000517488;ENST00000517957	T;T;T	0.44482	2.02;0.92;2.02	5.36	-5.7	0.02421	Immunoglobulin subtype (1);Tyrosine-protein kinase, vascular endothelial growth factor receptor (VEGFR), N-terminal (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	1.618420	0.03219	N	0.177259	T	0.30008	0.0751	L	0.47016	1.485	0.09310	N	1	P;B	0.42375	0.778;0.1	B;B	0.32342	0.144;0.041	T	0.45086	-0.9285	10	0.59425	D	0.04	.	8.1212	0.30971	0.0:0.4411:0.119:0.4399	.	84;84	B5A957;P09619	.;PGFRB_HUMAN	M	84;20;84	ENSP00000261799:V84M;ENSP00000429218:V20M;ENSP00000430715:V84M	ENSP00000261799:V84M	V	-	1	0	PDGFRB	149495425	0.003000	0.15002	0.000000	0.03702	0.039000	0.13416	-0.185000	0.09684	-1.376000	0.02126	-0.424000	0.05967	GTG		0.597	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609	
