#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SND1	27044	hgsc.bcm.edu	37	7	127721535	127721535	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr7:127721535G>A	ENST00000354725.3	+	18	2286	c.2092G>A	c.(2092-2094)Gtg>Atg	p.V698M	MIR593_ENST00000384856.1_RNA	NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	698					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)	p.V698M(1)		central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						GCACTTCTACGTGCAGGATGT	0.627																																					p.V698M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2092A	7						.						112.0	79.0	90.0					7																	127721535		2203	4300	6503	127508771	SO:0001583	missense	27044	exon18				CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2092G>A	7.37:g.127721535G>A	ENSP00000346762:p.Val698Met		127508771	NM_014390	Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.970939	0.74246	.	.	ENSG00000197157	ENST00000354725;ENST00000438400;ENST00000486037	T;T	0.12774	2.65;2.65	5.54	5.54	0.83059	Maternal tudor protein (1);	0.224142	0.47093	D	0.000253	T	0.35038	0.0918	M	0.87758	2.905	0.37698	D	0.924094	D	0.69078	0.997	P	0.57468	0.821	T	0.41342	-0.9514	10	0.66056	D	0.02	-19.7734	10.729	0.46085	0.0869:0.0:0.9131:0.0	.	698	Q7KZF4	SND1_HUMAN	M	698;688;184	ENSP00000346762:V698M;ENSP00000419327:V184M	ENSP00000346762:V698M	V	+	1	0	SND1	127508771	1.000000	0.71417	0.982000	0.44146	0.991000	0.79684	4.269000	0.58890	2.768000	0.95171	0.561000	0.74099	GTG		0.627	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390	
C20orf197	284756	hgsc.bcm.edu	37	20	58645712	58645712	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr20:58645712G>A	ENST00000313426.1	+	4	436	c.130G>A	c.(130-132)Ggc>Agc	p.G44S		NM_173644.1	NP_775915.1	Q8N268	CT197_HUMAN	chromosome 20 open reading frame 197	44								p.G44S(1)		large_intestine(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	5			BRCA - Breast invasive adenocarcinoma(7;2.33e-09)			CTCTAATCTCGGCCCCCAATT	0.413																																					p.G44S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G130A	20						.						107.0	97.0	100.0					20																	58645712		2203	4300	6503	58079107	SO:0001583	missense	284756	exon4			AK091179	CCDS13487.1	20q13.33	2006-07-07			ENSG00000176659	ENSG00000176659			26601	protein-coding gene	gene with protein product						12975309	Standard	NM_173644		Approved	FLJ33860	uc002ybj.1	Q8N268	OTTHUMG00000032880	ENST00000313426.1:c.130G>A	20.37:g.58645712G>A	ENSP00000316457:p.Gly44Ser		58079107	NM_173644	Q08EQ0	Missense_Mutation	SNP	ENST00000313426.1	37	CCDS13487.1	.	.	.	.	.	.	.	.	.	.	G	8.873	0.949690	0.18431	.	.	ENSG00000176659	ENST00000313426	.	.	.	2.29	-4.57	0.03421	.	.	.	.	.	T	0.11879	0.0289	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26052	-1.0114	8	0.11182	T	0.66	.	1.1193	0.01721	0.2086:0.3442:0.2764:0.1708	.	44	Q8N268	CT197_HUMAN	S	44	.	ENSP00000316457:G44S	G	+	1	0	C20orf197	58079107	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.027000	0.03592	-1.624000	0.01556	-0.573000	0.04149	GGC		0.413	C20orf197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079944.1	NM_173644	
LILRB1	10859	hgsc.bcm.edu	37	19	55147017	55147017	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr19:55147017T>C	ENST00000396331.1	+	14	1964	c.1607T>C	c.(1606-1608)gTg>gCg	p.V536A	LILRB1_ENST00000396315.1_Missense_Mutation_p.V537A|LILRB1_ENST00000396321.2_Missense_Mutation_p.V536A|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000324602.7_Missense_Mutation_p.V537A|LILRB1_ENST00000427581.2_Missense_Mutation_p.V586A|LILRB1_ENST00000396332.4_Missense_Mutation_p.V536A|LILRB1_ENST00000418536.2_Missense_Mutation_p.V520A|LILRB1_ENST00000434867.2_Missense_Mutation_p.V536A|LILRB1_ENST00000448689.1_Nonstop_Mutation_p.*511R|LILRB1_ENST00000396327.3_Missense_Mutation_p.V537A|LILRB1_ENST00000396317.1_Missense_Mutation_p.V520A	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	536					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.V536A(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GATGCTGCCGTGAAGCACACA	0.627										HNSCC(37;0.09)																											p.V536A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1607C	19						.						110.0	114.0	113.0					19																	55147017		2203	4300	6503	59838829	SO:0001583	missense	10859	exon13			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1607T>C	19.37:g.55147017T>C	ENSP00000379622:p.Val536Ala		59838829	NM_001081639	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.695|0.695	-0.793079|-0.793079	0.02862|0.02862	.|.	.|.	ENSG00000104972|ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315|ENST00000448689	T;T;T;T;T;T;T;T;T;T|.	0.00581|.	6.69;6.42;6.69;6.61;6.77;6.69;6.91;6.78;6.42;6.77|.	1.82|1.82	0.654|0.654	0.17833|0.17833	.|.	.|.	.|.	.|.	.|.	T|.	0.60077|.	0.2241|.	M|M	0.90759|0.90759	3.145|3.145	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B|.	0.26935|.	0.001;0.001;0.164;0.126;0.164;0.102|.	B;B;B;B;B;B|.	0.25506|.	0.002;0.004;0.061;0.04;0.041;0.028|.	T|.	0.55153|.	-0.8185|.	9|.	0.72032|.	D|.	0.01|.	.|.	3.7718|3.7718	0.08645|0.08645	0.3332:0.0:0.0:0.6668|0.3332:0.0:0.0:0.6668	.|.	520;536;537;536;537;536|.	A8MVE2;D9IDM5;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6|.	.;.;.;.;.;LIRB1_HUMAN|.	A|R	536;520;536;537;537;536;536;586;520;537|511	ENSP00000379614:V536A;ENSP00000391514:V520A;ENSP00000379622:V536A;ENSP00000379618:V537A;ENSP00000315997:V537A;ENSP00000405243:V536A;ENSP00000379623:V536A;ENSP00000395004:V586A;ENSP00000379610:V520A;ENSP00000379608:V537A|.	ENSP00000315997:V537A|.	V|X	+|+	2|1	0|0	LILRB1|LILRB1	59838829|59838829	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.024000|0.024000	0.10985|0.10985	-0.458000|-0.458000	0.06737|0.06737	0.096000|0.096000	0.17463|0.17463	0.172000|0.172000	0.16884|0.16884	GTG|TGA		0.627	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
C3	718	hgsc.bcm.edu	37	19	6686184	6686184	+	Missense_Mutation	SNP	C	C	T	rs571907143		TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr19:6686184C>T	ENST00000245907.6	-	29	3853	c.3761G>A	c.(3760-3762)cGt>cAt	p.R1254H		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1254					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.R1254H(1)		breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	ATTGAGCCAACGCACGACGGG	0.572													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20315	0.0		0.0	False		,,,				2504	0.0				p.R1254H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3761A	19						.						208.0	190.0	196.0					19																	6686184		2203	4300	6503	6637184	SO:0001583	missense	718	exon29			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.3761G>A	19.37:g.6686184C>T	ENSP00000245907:p.Arg1254His		6637184	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	C	12.31	1.900262	0.33535	.	.	ENSG00000125730	ENST00000245907	T	0.39787	1.06	6.16	4.06	0.47325	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.277370	0.42964	D	0.000625	T	0.52917	0.1764	M	0.65498	2.005	0.36454	D	0.866252	D	0.71674	0.998	P	0.58520	0.84	T	0.58451	-0.7634	10	0.27082	T	0.32	.	10.2032	0.43097	0.0:0.7866:0.0:0.2134	.	1254	P01024	CO3_HUMAN	H	1254	ENSP00000245907:R1254H	ENSP00000245907:R1254H	R	-	2	0	C3	6637184	0.565000	0.26610	0.966000	0.40874	0.028000	0.11728	0.631000	0.24568	0.947000	0.37659	-0.142000	0.14014	CGT		0.572	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
KIR3DL3	115653	hgsc.bcm.edu	37	19	55241211	55241211	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr19:55241211C>T	ENST00000291860.1	+	5	926	c.908C>T	c.(907-909)gCg>gTg	p.A303V	KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A303V(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		CTGCCCCACGCGTGGTCAGAC	0.582																																					p.A303V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C908T	19						.																																			59933023	SO:0001583	missense	115653	exon5			AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.908C>T	19.37:g.55241211C>T	ENSP00000291860:p.Ala303Val		59933023	NM_153443	A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Missense_Mutation	SNP	ENST00000291860.1	37	CCDS12903.1	.	.	.	.	.	.	.	.	.	.	-	1.334	-0.595990	0.03771	.	.	ENSG00000242019	ENST00000291860	T	0.00678	5.87	1.37	-1.6	0.08426	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00241	0.0007	N	0.00086	-2.195	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.42172	-0.9467	9	0.23302	T	0.38	.	2.1757	0.03862	0.4888:0.1827:0.0:0.3285	.	303	Q8N743	KI3L3_HUMAN	V	303	ENSP00000291860:A303V	ENSP00000291860:A303V	A	+	2	0	KIR3DL3	59933023	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-9.679000	0.00010	-2.511000	0.00503	-3.537000	0.00031	GCG		0.582	KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141147.1	NM_153443	
PLAG1	5324	hgsc.bcm.edu	37	8	57079489	57079489	+	Silent	SNP	T	T	C			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr8:57079489T>C	ENST00000316981.3	-	5	1295	c.816A>G	c.(814-816)ttA>ttG	p.L272L	PLAG1_ENST00000423799.2_Silent_p.L190L|PLAG1_ENST00000429357.2_Silent_p.L272L	NM_001114634.1|NM_002655.2	NP_001108106.1|NP_002646.2	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1	272	Activates transcription; Inhibition of nuclear import due to lack of NLS and KPNA2 interaction.|Repression domain; contains 3 sumoylation motifs and massively decrease transcription activity.				gland morphogenesis (GO:0022612)|multicellular organism growth (GO:0035264)|negative regulation of gene expression (GO:0010629)|organ growth (GO:0035265)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L272L(2)	CTNNB1/PLAG1(60)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|FGFR1_ENST00000447712/PLAG1(28)|COL1A2/PLAG1(3)|CHCHD7/PLAG1(12)|TCEA1_ENST00000521604/PLAG1(3)	breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			CACTGGAAGGTAAGGACATCA	0.463			T	"""TCEA1, LIFR, CTNNB1, CHCHD7"""	salivary adenoma																																p.L190L			Dom	yes		8	8q12	5324	pleiomorphic adenoma gene 1		E	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A570G	8						.						222.0	216.0	218.0					8																	57079489		2203	4300	6503	57242043	SO:0001819	synonymous_variant	5324	exon3			U65002	CCDS6165.1, CCDS47860.1	8q12	2010-07-30				ENSG00000181690		"""Zinc fingers, C2H2-type"""	9045	protein-coding gene	gene with protein product		603026				9268638	Standard	NM_002655		Approved	ZNF912	uc010lyi.3	Q6DJT9		ENST00000316981.3:c.816A>G	8.37:g.57079489T>C			57242043	NM_001114635	B4DLC2|Q59GH8|Q9Y4L2	Silent	SNP	ENST00000316981.3	37	CCDS6165.1																																																																																				0.463	PLAG1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378212.1	NM_002655	
SLCO5A1	81796	hgsc.bcm.edu	37	8	70617289	70617289	+	Silent	SNP	G	G	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr8:70617289G>A	ENST00000260126.4	-	6	2305	c.1599C>T	c.(1597-1599)ggC>ggT	p.G533G	SLCO5A1_ENST00000524945.1_Silent_p.G533G|SLCO5A1_ENST00000530307.1_Silent_p.G478G	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	533						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.G533G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GGATGTTTATGCCCCCTAGAT	0.443																																					p.G533G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1599T	8						.						130.0	119.0	122.0					8																	70617289		2203	4300	6503	70779843	SO:0001819	synonymous_variant	81796	exon6			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1599C>T	8.37:g.70617289G>A			70779843	NM_030958	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Silent	SNP	ENST00000260126.4	37	CCDS6205.1																																																																																				0.443	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
DCAF4L2	138009	hgsc.bcm.edu	37	8	88885043	88885043	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr8:88885043C>T	ENST00000319675.3	-	1	1253	c.1157G>A	c.(1156-1158)cGg>cAg	p.R386Q		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	386								p.R386Q(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						AAGGTCCTCCCGGACAGCCAT	0.547																																					p.R386Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1157A	8						.						41.0	46.0	44.0					8																	88885043		2203	4300	6503	88954159	SO:0001583	missense	138009	exon1			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.1157G>A	8.37:g.88885043C>T	ENSP00000316496:p.Arg386Gln		88954159	NM_152418		Missense_Mutation	SNP	ENST00000319675.3	37	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.356857	0.41801	.	.	ENSG00000176566	ENST00000319675	T	0.26518	1.73	0.841	0.841	0.18918	.	0.579100	0.18356	N	0.143715	T	0.13415	0.0325	L	0.31294	0.92	0.19300	N	0.999976	B	0.17465	0.022	B	0.13407	0.009	T	0.16012	-1.0417	10	0.23891	T	0.37	.	3.1068	0.06345	0.0:0.6895:0.0:0.3105	.	386	Q8NA75	DC4L2_HUMAN	Q	386	ENSP00000316496:R386Q	ENSP00000316496:R386Q	R	-	2	0	DCAF4L2	88954159	0.937000	0.31787	0.204000	0.23530	0.391000	0.30476	0.364000	0.20325	0.735000	0.32537	0.467000	0.42956	CGG		0.547	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
OLFM3	118427	hgsc.bcm.edu	37	1	102296332	102296332	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr1:102296332C>A	ENST00000338858.5	-	3	327	c.328G>T	c.(328-330)Gat>Tat	p.D110Y	OLFM3_ENST00000370103.4_Missense_Mutation_p.D90Y|OLFM3_ENST00000536598.1_Missense_Mutation_p.D15Y|OLFM3_ENST00000359814.3_Missense_Mutation_p.D110Y|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	110					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)		p.D90Y(1)|p.D110Y(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		TATTGGAAATCTCTCTGAGTT	0.358																																					p.D90Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G268T	1						.						130.0	131.0	131.0					1																	102296332		2203	4300	6503	102068920	SO:0001583	missense	118427	exon3			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.328G>T	1.37:g.102296332C>A	ENSP00000345192:p.Asp110Tyr		102068920	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	37		.	.	.	.	.	.	.	.	.	.	C	26.6	4.750500	0.89753	.	.	ENSG00000118733	ENST00000370103;ENST00000338858;ENST00000536598;ENST00000359814	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.72471	0.3464	M	0.75777	2.31	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.986;0.998	T	0.65656	-0.6115	10	0.11794	T	0.64	.	20.0172	0.97481	0.0:1.0:0.0:0.0	.	90;110	Q5T3V6;Q96PB7	.;NOE3_HUMAN	Y	90;110;15;110	ENSP00000359121:D90Y;ENSP00000345192:D110Y;ENSP00000443471:D15Y;ENSP00000352867:D110Y	ENSP00000345192:D110Y	D	-	1	0	OLFM3	102068920	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.750000	0.85110	2.814000	0.96858	0.585000	0.79938	GAT		0.358	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
ADAR	103	hgsc.bcm.edu	37	1	154562260	154562260	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr1:154562260T>C	ENST00000368474.4	-	8	2840	c.2641A>G	c.(2641-2643)Atg>Gtg	p.M881V	ADAR_ENST00000368471.3_Missense_Mutation_p.M586V|ADAR_ENST00000292205.5_Missense_Mutation_p.M924V	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	881					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.M881V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		ACGACACCCATGTCCTCAGAG	0.582																																					p.M836V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2506G	1						.						68.0	65.0	66.0					1																	154562260		2203	4300	6503	152828884	SO:0001583	missense	103	exon8			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2641A>G	1.37:g.154562260T>C	ENSP00000357459:p.Met881Val		152828884	NM_015841	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.340364	0.41498	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	T;T;T;T	0.13196	2.82;2.83;2.61;2.83	5.18	4.19	0.49359	Adenosine deaminase/editase (1);	0.191863	0.45361	D	0.000362	T	0.02193	0.0068	N	0.14661	0.345	0.30828	N	0.737055	B;B;B	0.17465	0.007;0.007;0.022	B;B;B	0.17979	0.02;0.02;0.011	T	0.40776	-0.9545	10	0.32370	T	0.25	-10.5519	4.5724	0.12216	0.2023:0.0:0.4817:0.3159	.	836;855;881	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	V	924;881;586;850	ENSP00000292205:M924V;ENSP00000357459:M881V;ENSP00000357456:M586V;ENSP00000431794:M850V	ENSP00000292205:M924V	M	-	1	0	ADAR	152828884	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	1.903000	0.39858	1.218000	0.43458	0.460000	0.39030	ATG		0.582	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
ZNF362	149076	hgsc.bcm.edu	37	1	33760594	33760594	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr1:33760594T>C	ENST00000539719.1	+	7	1135	c.965T>C	c.(964-966)tTc>tCc	p.F322S	ZNF362_ENST00000373428.5_Missense_Mutation_p.F322S	NM_152493.2	NP_689706.2	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F322S(1)		endometrium(3)|kidney(1)|large_intestine(4)|lung(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GAGAAGGCTTTCACTCAGCTC	0.617											OREG0013342	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F322S	Pancreas(162;1431 2676 35353 38425)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T965C	1						.						116.0	91.0	100.0					1																	33760594		2203	4300	6503	33533181	SO:0001583	missense	149076	exon7				CCDS377.1	1p35.1	2013-01-08			ENSG00000160094	ENSG00000160094		"""Zinc fingers, C2H2-type"""	18079	protein-coding gene	gene with protein product	"""rotund homolog (Drosophila)"""						Standard	NM_152493		Approved	FLJ25476, lin-29, RN	uc001bxc.1	Q5T0B9	OTTHUMG00000004124	ENST00000539719.1:c.965T>C	1.37:g.33760594T>C	ENSP00000446335:p.Phe322Ser	842	33533181	NM_152493	Q8WYU4	Missense_Mutation	SNP	ENST00000539719.1	37	CCDS377.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.472325	0.84533	.	.	ENSG00000160094	ENST00000539719;ENST00000373428	T;T	0.44482	0.92;0.92	4.27	4.27	0.50696	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000122	T	0.63827	0.2544	M	0.81179	2.53	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.68965	-0.5270	10	0.87932	D	0	-28.0022	11.3772	0.49735	0.0:0.0:0.0:1.0	.	322	Q5T0B9	ZN362_HUMAN	S	322	ENSP00000446335:F322S;ENSP00000362527:F322S	ENSP00000362527:F322S	F	+	2	0	ZNF362	33533181	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.477000	0.81069	1.785000	0.52413	0.379000	0.24179	TTC		0.617	ZNF362-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011857.2	NM_152493	
THRAP3	9967	hgsc.bcm.edu	37	1	36757056	36757056	+	Silent	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr1:36757056C>T	ENST00000354618.5	+	6	2051	c.1827C>T	c.(1825-1827)tcC>tcT	p.S609S	THRAP3_ENST00000469141.2_Silent_p.S609S|THRAP3_ENST00000466743.1_3'UTR	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	609	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.S609S(1)		breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AGTTTCGTTCCATTTTCCAGC	0.458			T	USP6	aneurysmal bone cysts																																p.S609S	Pancreas(129;785 1795 20938 23278 32581)		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1827T	1						.						121.0	110.0	114.0					1																	36757056		2203	4300	6503	36529643	SO:0001819	synonymous_variant	9967	exon6			AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.1827C>T	1.37:g.36757056C>T			36529643	NM_005119	D3DPS5|Q5VTK6	Silent	SNP	ENST00000354618.5	37	CCDS405.1																																																																																				0.458	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
BRINP3	339479	hgsc.bcm.edu	37	1	190067271	190067271	+	Silent	SNP	G	G	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr1:190067271G>A	ENST00000367462.3	-	8	2409	c.2178C>T	c.(2176-2178)tgC>tgT	p.C726C	BRINP3_ENST00000534846.1_Silent_p.C624C	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	726					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.C726C(1)									GACGAAGCAAGCAAGAGAAAA	0.463																																					p.C726C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2178T	1						.						115.0	110.0	112.0					1																	190067271		2203	4300	6503	188333894	SO:0001819	synonymous_variant	339479	exon8			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2178C>T	1.37:g.190067271G>A			188333894	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	37	CCDS1373.1																																																																																				0.463	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
GTF2H1	2965	hgsc.bcm.edu	37	11	18379502	18379502	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr11:18379502C>T	ENST00000265963.4	+	12	1424	c.1264C>T	c.(1264-1266)Ctc>Ttc	p.L422F	GTF2H1_ENST00000530496.2_Missense_Mutation_p.L110F|GTF2H1_ENST00000526630.2_Missense_Mutation_p.L12F|GTF2H1_ENST00000534641.1_Missense_Mutation_p.L306F|GTF2H1_ENST00000453096.2_Missense_Mutation_p.L422F	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	422					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.L422F(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						TTTTCAGGTTCTCTCAAGTAG	0.433								Nucleotide excision repair (NER)																													p.L422F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1264T	11						.						70.0	62.0	64.0					11																	18379502		2198	4293	6491	18336078	SO:0001583	missense	2965	exon13				CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.1264C>T	11.37:g.18379502C>T	ENSP00000265963:p.Leu422Phe		18336078	NM_001142307	B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Missense_Mutation	SNP	ENST00000265963.4	37	CCDS7838.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.462359	0.63513	.	.	ENSG00000110768	ENST00000453096;ENST00000534641;ENST00000265963;ENST00000530496;ENST00000526630	T;T;T;T;T	0.56776	1.75;1.74;1.75;0.49;0.44	5.15	5.15	0.70609	.	0.125412	0.56097	D	0.000036	T	0.53514	0.1801	L	0.55481	1.735	0.58432	D	0.999994	P	0.40578	0.722	B	0.43658	0.426	T	0.52852	-0.8520	10	0.38643	T	0.18	-8.7236	14.6979	0.69134	0.1457:0.8543:0.0:0.0	.	422	P32780	TF2H1_HUMAN	F	422;306;422;110;12	ENSP00000393638:L422F;ENSP00000435375:L306F;ENSP00000265963:L422F;ENSP00000433133:L110F;ENSP00000439774:L12F	ENSP00000265963:L422F	L	+	1	0	GTF2H1	18336078	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.610000	0.46325	2.558000	0.86282	0.462000	0.41574	CTC		0.433	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395627.2	NM_005316	
CAPRIN1	4076	hgsc.bcm.edu	37	11	34120852	34120852	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr11:34120852C>T	ENST00000341394.4	+	19	2257	c.2068C>T	c.(2068-2070)Cgt>Tgt	p.R690C	CAPRIN1_ENST00000532820.1_Missense_Mutation_p.R690C|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.R609C|CAPRIN1_ENST00000533657.1_3'UTR	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	690					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R690C(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				TCTTCTAGGTCGTGGAGGGCC	0.408																																					p.R690C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2068T	11						.						71.0	69.0	70.0					11																	34120852		2202	4298	6500	34077428	SO:0001583	missense	4076	exon19			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.2068C>T	11.37:g.34120852C>T	ENSP00000340329:p.Arg690Cys		34077428	NM_005898	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	ENST00000341394.4	37	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157186	0.38119	.	.	ENSG00000135387	ENST00000341394;ENST00000532820;ENST00000529307	T;T;T	0.16457	2.34;2.34;2.34	5.93	5.02	0.67125	.	0.473375	0.24580	N	0.037312	T	0.11750	0.0286	N	0.14661	0.345	0.80722	D	1	B	0.15473	0.013	B	0.08055	0.003	T	0.09530	-1.0670	10	0.38643	T	0.18	-5.0642	15.5303	0.75956	0.0:0.9327:0.0:0.0673	.	690	Q14444	CAPR1_HUMAN	C	690;690;609	ENSP00000340329:R690C;ENSP00000434150:R690C;ENSP00000431581:R609C	ENSP00000340329:R690C	R	+	1	0	CAPRIN1	34077428	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.082000	0.57635	2.810000	0.96702	0.655000	0.94253	CGT		0.408	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
PIWIL4	143689	hgsc.bcm.edu	37	11	94352981	94352981	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr11:94352981G>A	ENST00000299001.6	+	18	2435	c.2224G>A	c.(2224-2226)Gaa>Aaa	p.E742K	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA|PIWIL4_ENST00000537419.1_Missense_Mutation_p.E93K	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	742	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)	p.E742K(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				ATTCTTTACCGAAATGAACCG	0.433																																					p.E742K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2224A	11						.						140.0	121.0	127.0					11																	94352981		2201	4298	6499	93992629	SO:0001583	missense	143689	exon18			AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.2224G>A	11.37:g.94352981G>A	ENSP00000299001:p.Glu742Lys		93992629	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	37	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.381316	0.24944	.	.	ENSG00000134627	ENST00000299001;ENST00000537419	T;T	0.28895	1.59;1.59	5.16	3.26	0.37387	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.094831	0.44285	D	0.000464	T	0.18299	0.0439	L	0.43923	1.385	0.09310	N	1	P	0.37176	0.586	B	0.32583	0.148	T	0.13548	-1.0505	10	0.13108	T	0.6	-20.8053	5.1243	0.14876	0.0804:0.1446:0.6257:0.1494	.	742	Q7Z3Z4	PIWL4_HUMAN	K	742;93	ENSP00000299001:E742K;ENSP00000439710:E93K	ENSP00000299001:E742K	E	+	1	0	PIWIL4	93992629	0.387000	0.25188	0.001000	0.08648	0.002000	0.02628	2.291000	0.43540	0.537000	0.28751	0.655000	0.94253	GAA		0.433	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
KCTD20	222658	hgsc.bcm.edu	37	6	36442821	36442821	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr6:36442821C>T	ENST00000373731.2	+	3	807	c.416C>T	c.(415-417)cCg>cTg	p.P139L	KCTD20_ENST00000536244.1_Intron|KCTD20_ENST00000449081.2_Intron|KCTD20_ENST00000474988.1_Intron|KCTD20_ENST00000544295.1_Intron	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	139	BTB.				protein homooligomerization (GO:0051260)			p.P139L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						ACTGCTCATCCGGATACCATG	0.388																																					p.P139L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C416T	6						.						112.0	109.0	110.0					6																	36442821		2203	4300	6503	36550799	SO:0001583	missense	222658	exon3			BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.416C>T	6.37:g.36442821C>T	ENSP00000362836:p.Pro139Leu		36550799	NM_173562	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Missense_Mutation	SNP	ENST00000373731.2	37	CCDS4821.1	.	.	.	.	.	.	.	.	.	.	C	33	5.204064	0.95033	.	.	ENSG00000112078	ENST00000373731	T	0.56103	0.48	5.26	5.26	0.73747	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	D	0.000001	T	0.77425	0.4128	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82610	-0.0372	10	0.87932	D	0	-13.5767	19.0748	0.93156	0.0:1.0:0.0:0.0	.	139	Q7Z5Y7	KCD20_HUMAN	L	139	ENSP00000362836:P139L	ENSP00000362836:P139L	P	+	2	0	KCTD20	36550799	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.651000	0.83577	2.733000	0.93635	0.655000	0.94253	CCG		0.388	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562	
KRT33B	3884	hgsc.bcm.edu	37	17	39521771	39521771	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr17:39521771C>T	ENST00000251646.3	-	4	672	c.623G>A	c.(622-624)cGc>cAc	p.R208H		NM_002279.4	NP_002270.1	Q14525	KT33B_HUMAN	keratin 33B	208	Linker 12.|Rod.				aging (GO:0007568)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R208H(2)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(6)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000496)				CACGTTGAGGCGGTCTCCAAG	0.527																																					p.R208H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G623A	17						.						57.0	57.0	57.0					17																	39521771		2191	4300	6491	36775297	SO:0001583	missense	3884	exon4			X82634	CCDS11389.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131738	ENSG00000131738		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6451	protein-coding gene	gene with protein product	"""hard keratin type I 3II"""	602762	"""keratin, hair, acidic, 3B"""	KRTHA3B		7565656, 16831889	Standard	NM_002279		Approved	Ha-3II	uc002hwl.4	Q14525	OTTHUMG00000133429	ENST00000251646.3:c.623G>A	17.37:g.39521771C>T	ENSP00000251646:p.Arg208His		36775297	NM_002279	O76010	Missense_Mutation	SNP	ENST00000251646.3	37	CCDS11389.1	.	.	.	.	.	.	.	.	.	.	c	15.18	2.758311	0.49468	.	.	ENSG00000131738	ENST00000251646	D	0.88664	-2.41	4.51	4.51	0.55191	Filament (1);	0.000000	0.64402	D	0.000011	D	0.85682	0.5753	L	0.49640	1.575	0.25640	N	0.986213	P	0.34977	0.478	B	0.41723	0.365	T	0.79512	-0.1773	10	0.72032	D	0.01	.	4.956	0.14041	0.0:0.6405:0.1862:0.1733	.	208	Q14525	KT33B_HUMAN	H	208	ENSP00000251646:R208H	ENSP00000251646:R208H	R	-	2	0	KRT33B	36775297	0.000000	0.05858	1.000000	0.80357	0.975000	0.68041	0.312000	0.19397	2.474000	0.83562	0.650000	0.86243	CGC		0.527	KRT33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257292.1	NM_002279	
CCDC101	112869	hgsc.bcm.edu	37	16	28596289	28596289	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr16:28596289G>A	ENST00000317058.3	+	3	318	c.131G>A	c.(130-132)cGg>cAg	p.R44Q		NM_138414.2	NP_612423.1	Q96ES7	SGF29_HUMAN	coiled-coil domain containing 101	44					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|SAGA-type complex (GO:0070461)	methylated histone binding (GO:0035064)	p.R44Q(1)		central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)	10						ACCCATGAGCGGATGCAGACA	0.542																																					p.R44Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G131A	16						.						73.0	64.0	67.0					16																	28596289		2197	4300	6497	28503790	SO:0001583	missense	112869	exon3			AK057008	CCDS10635.1	16p11.2	2010-08-03			ENSG00000176476	ENSG00000176476			25156	protein-coding gene	gene with protein product	"""SAGA-associated factor 29 homolog (yeast)"""	613374				17334388	Standard	NM_138414		Approved	FLJ32446, SGF29	uc002dqf.3	Q96ES7	OTTHUMG00000131763	ENST00000317058.3:c.131G>A	16.37:g.28596289G>A	ENSP00000316114:p.Arg44Gln		28503790	NM_138414	Q96MF5	Missense_Mutation	SNP	ENST00000317058.3	37	CCDS10635.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186850	0.78789	.	.	ENSG00000176476	ENST00000317058	.	.	.	5.25	5.25	0.73442	.	0.254010	0.31010	N	0.008436	T	0.52256	0.1723	L	0.29908	0.895	0.49483	D	0.999797	B	0.15930	0.015	B	0.06405	0.002	T	0.48305	-0.9047	9	0.51188	T	0.08	.	16.3808	0.83460	0.0:0.0:1.0:0.0	.	44	Q96ES7	SGF29_HUMAN	Q	44	.	ENSP00000316114:R44Q	R	+	2	0	CCDC101	28503790	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	8.163000	0.89659	2.737000	0.93849	0.563000	0.77884	CGG		0.542	CCDC101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254691.1	NM_138414	
HCLS1	3059	hgsc.bcm.edu	37	3	121356066	121356068	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	CTC	CTC	CTC	-	CTC	CTC	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr3:121356066_121356068delCTC	ENST00000314583.3	-	7	581_583	c.490_492delGAG	c.(490-492)gagdel	p.E164del	HCLS1_ENST00000473883.1_5'UTR|HCLS1_ENST00000428394.2_Intron	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	164					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)	p.E164delE(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		ATTTATCCTTCTCCACCCCGTAC	0.567																																					p.164_164del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.490_492del	3						.																																			122838758	SO:0001651	inframe_deletion	3059	exon7				CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.490_492delGAG	3.37:g.121356066_121356068delCTC	ENSP00000320176:p.Glu164del		122838756	NM_005335	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	In_Frame_Del	DEL	ENST00000314583.3	37	CCDS3003.1																																																																																				0.567	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355144.1	NM_005335	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
SYT10	341359	hgsc.bcm.edu	37	12	33535327	33535327	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr12:33535327C>T	ENST00000228567.3	-	5	1623	c.1327G>A	c.(1327-1329)Gtg>Atg	p.V443M	SYT10_ENST00000535526.1_Missense_Mutation_p.V262M	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	443	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.V443M(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					ACCTGGTCCACGTTCTCTGGA	0.443																																					p.V443M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1327A	12						.						233.0	205.0	214.0					12																	33535327		2203	4300	6503	33426594	SO:0001583	missense	341359	exon5			AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.1327G>A	12.37:g.33535327C>T	ENSP00000228567:p.Val443Met		33426594	NM_198992	Q495U2	Missense_Mutation	SNP	ENST00000228567.3	37	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	C	4.797	0.148219	0.09134	.	.	ENSG00000110975	ENST00000228567;ENST00000535526	T;T	0.72505	-0.66;-0.66	3.97	3.08	0.35506	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.199439	0.24081	N	0.041722	T	0.46386	0.1390	N	0.25825	0.765	0.48341	D	0.999632	P	0.35208	0.49	B	0.22601	0.04	T	0.38090	-0.9677	10	0.10111	T	0.7	.	8.4465	0.32845	0.0:0.8189:0.0:0.1811	.	443	Q6XYQ8	SYT10_HUMAN	M	443;262	ENSP00000228567:V443M;ENSP00000438691:V262M	ENSP00000228567:V443M	V	-	1	0	SYT10	33426594	0.988000	0.35896	0.983000	0.44433	0.982000	0.71751	2.690000	0.47001	1.281000	0.44480	-0.196000	0.12772	GTG		0.443	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992	
LUM	4060	hgsc.bcm.edu	37	12	91498015	91498015	+	Missense_Mutation	SNP	C	C	T	rs139919924		TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr12:91498015C>T	ENST00000266718.4	-	3	1398	c.944G>A	c.(943-945)cGc>cAc	p.R315H	LUM_ENST00000548071.1_5'UTR	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	315					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.R315H(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						TTCTGAGATGCGATTGCCATC	0.378																																					p.R315H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G944A	12						.	C	HIS/ARG	0,4406		0,0,2203	113.0	108.0	110.0		944	-2.7	0.0	12	dbSNP_134	110	2,8598	2.2+/-6.3	0,2,4298	no	missense	LUM	NM_002345.3	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	315/339	91498015	2,13004	2203	4300	6503	90022146	SO:0001583	missense	4060	exon3			BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.944G>A	12.37:g.91498015C>T	ENSP00000266718:p.Arg315His		90022146	NM_002345	B2R6R5|Q96QM7	Missense_Mutation	SNP	ENST00000266718.4	37	CCDS9038.1	.	.	.	.	.	.	.	.	.	.	C	9.430	1.085209	0.20390	0.0	2.33E-4	ENSG00000139329	ENST00000266718	T	0.19105	2.17	5.19	-2.69	0.06022	.	0.653207	0.14512	N	0.315075	T	0.06462	0.0166	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.22243	-1.0222	10	0.48119	T	0.1	-2.8615	1.8815	0.03229	0.1355:0.1948:0.172:0.4977	.	315	P51884	LUM_HUMAN	H	315	ENSP00000266718:R315H	ENSP00000266718:R315H	R	-	2	0	LUM	90022146	0.003000	0.15002	0.036000	0.18154	0.059000	0.15707	0.008000	0.13197	-0.126000	0.11682	0.591000	0.81541	CGC		0.378	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2	NM_002345	
APAF1	317	hgsc.bcm.edu	37	12	99061305	99061305	+	Silent	SNP	G	G	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr12:99061305G>A	ENST00000551964.1	+	10	2113	c.1377G>A	c.(1375-1377)aaG>aaA	p.K459K	APAF1_ENST00000339433.3_Silent_p.K459K|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000549007.1_Silent_p.K459K|APAF1_ENST00000547045.1_Silent_p.K459K|APAF1_ENST00000357310.1_Silent_p.K459K|APAF1_ENST00000550527.1_Silent_p.K448K|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000359972.2_Silent_p.K448K	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	459					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)	p.K459K(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	TACATAAGAAGATAATCACTC	0.398																																					p.K448K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1344A	12						.						142.0	135.0	138.0					12																	99061305		2203	4300	6503	97585436	SO:0001819	synonymous_variant	317	exon10			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.1377G>A	12.37:g.99061305G>A			97585436	NM_013229	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Silent	SNP	ENST00000551964.1	37	CCDS9069.1																																																																																				0.398	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1	
ZNF609	23060	hgsc.bcm.edu	37	15	64966422	64966422	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr15:64966422T>G	ENST00000326648.3	+	4	1497	c.1369T>G	c.(1369-1371)Tcc>Gcc	p.S457A	RNU6-549P_ENST00000384433.1_RNA|ZNF609_ENST00000559364.1_3'UTR	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	457						nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.S457A(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTCAGAGGACTCCAAAGGGAG	0.532																																					p.S457A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1369G	15						.						63.0	64.0	64.0					15																	64966422		2203	4299	6502	62753475	SO:0001583	missense	23060	exon4			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.1369T>G	15.37:g.64966422T>G	ENSP00000316527:p.Ser457Ala		62753475	NM_015042	Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	37	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	T	12.50	1.956410	0.34565	.	.	ENSG00000180357	ENST00000326648	T	0.44083	0.93	5.4	5.4	0.78164	.	0.095447	0.64402	D	0.000001	T	0.44286	0.1286	L	0.40543	1.245	0.45150	D	0.998162	P	0.50443	0.935	P	0.50970	0.655	T	0.18745	-1.0327	10	0.18276	T	0.48	-17.1016	15.4412	0.75184	0.0:0.0:0.0:1.0	.	457	O15014	ZN609_HUMAN	A	457	ENSP00000316527:S457A	ENSP00000316527:S457A	S	+	1	0	ZNF609	62753475	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.942000	0.56614	2.045000	0.60652	0.528000	0.53228	TCC		0.532	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833	
HCN4	10021	hgsc.bcm.edu	37	15	73622100	73622100	+	Silent	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr15:73622100C>T	ENST00000261917.3	-	4	2397	c.1404G>A	c.(1402-1404)gcG>gcA	p.A468A		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	468					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.A468A(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		CCTTGAAGAGCGCGTAGGAGT	0.607																																					p.A468A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1404A	15						.						97.0	90.0	93.0					15																	73622100		2198	4297	6495	71409153	SO:0001819	synonymous_variant	10021	exon4			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1404G>A	15.37:g.73622100C>T			71409153	NM_005477	Q9UMQ7	Silent	SNP	ENST00000261917.3	37	CCDS10248.1																																																																																				0.607	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
ARAP2	116984	hgsc.bcm.edu	37	4	36085001	36085001	+	Silent	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr4:36085001C>T	ENST00000303965.4	-	29	4986	c.4497G>A	c.(4495-4497)aaG>aaA	p.K1499K		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1499	PH 5. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)	p.K1499K(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TTGTTGGAGGCTTCATTTTCT	0.323																																					p.K1499K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4497A	4						.						85.0	79.0	81.0					4																	36085001		2201	4298	6499	35761396	SO:0001819	synonymous_variant	116984	exon29			AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.4497G>A	4.37:g.36085001C>T			35761396	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	ENST00000303965.4	37	CCDS3441.1																																																																																				0.323	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
SCARB2	950	hgsc.bcm.edu	37	4	77089574	77089574	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr4:77089574T>C	ENST00000264896.2	-	9	1518	c.1169A>G	c.(1168-1170)aAa>aGa	p.K390R	SCARB2_ENST00000452464.2_Missense_Mutation_p.K247R	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	390					cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)	p.K390R(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			ATCTAATTTTTTGACATAAAT	0.393																																					p.K390R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1169G	4						.						148.0	155.0	152.0					4																	77089574		2203	4300	6503	77308598	SO:0001583	missense	950	exon9			D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.1169A>G	4.37:g.77089574T>C	ENSP00000264896:p.Lys390Arg		77308598	NM_005506	B4DKD8|E7EM68|Q53Y63	Missense_Mutation	SNP	ENST00000264896.2	37	CCDS3577.1	.	.	.	.	.	.	.	.	.	.	T	0.536	-0.855808	0.02630	.	.	ENSG00000138760	ENST00000264896;ENST00000452464	T;T	0.72725	-0.68;-0.68	5.19	-2.49	0.06403	.	0.646937	0.17392	N	0.175884	T	0.43787	0.1263	N	0.04994	-0.135	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.22417	-1.0217	10	0.17832	T	0.49	.	12.8955	0.58098	0.0:0.6352:0.0:0.3648	.	247;390	E7EM68;Q14108	.;SCRB2_HUMAN	R	390;247	ENSP00000264896:K390R;ENSP00000399154:K247R	ENSP00000264896:K390R	K	-	2	0	SCARB2	77308598	0.013000	0.17824	0.041000	0.18516	0.811000	0.45836	-0.125000	0.10579	-0.703000	0.05049	0.477000	0.44152	AAA		0.393	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252403.1	NM_005506	
UTP14A	10813	hgsc.bcm.edu	37	X	129045802	129045802	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chrX:129045802G>A	ENST00000394422.3	+	6	470	c.442G>A	c.(442-444)Gtc>Atc	p.V148I	UTP14A_ENST00000425117.2_Intron|RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000371042.3_5'Flank|UTP14A_ENST00000371051.5_Missense_Mutation_p.V94I	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	148					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.V148I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						GGACCCTGTCGTCCTGAAGAA	0.522													g|||	1	0.000264901	0.0008	0.0	3775	,	,		12137	0.0		0.0	False		,,,				2504	0.0				p.V148I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G442A	X						.						102.0	97.0	99.0					X																	129045802		2203	4300	6503	128873483	SO:0001583	missense	10813	exon6			AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.442G>A	X.37:g.129045802G>A	ENSP00000377944:p.Val148Ile		128873483	NM_006649	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Missense_Mutation	SNP	ENST00000394422.3	37	CCDS14615.1	.	.	.	.	.	.	.	.	.	.	G	5.130	0.209647	0.09757	.	.	ENSG00000156697	ENST00000394422;ENST00000371051	T;T	0.32988	1.43;1.43	5.43	3.68	0.42216	.	0.232409	0.44483	N	0.000459	T	0.25717	0.0626	L	0.45352	1.415	0.24440	N	0.99453	B;B	0.22800	0.061;0.075	B;B	0.17433	0.011;0.018	T	0.13045	-1.0524	10	0.36615	T	0.2	-2.353	11.6822	0.51463	0.1484:0.0:0.8516:0.0	.	94;148	F8WD00;Q9BVJ6	.;UT14A_HUMAN	I	148;94	ENSP00000377944:V148I;ENSP00000360090:V94I	ENSP00000360090:V94I	V	+	1	0	UTP14A	128873483	1.000000	0.71417	0.003000	0.11579	0.072000	0.16883	3.340000	0.52143	0.496000	0.27904	-0.465000	0.05216	GTC		0.522	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649	
AMER1	139285	hgsc.bcm.edu	37	X	63412095	63412095	+	Nonsense_Mutation	SNP	G	G	A	rs137852217		TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chrX:63412095G>A	ENST00000330258.3	-	2	1344	c.1072C>T	c.(1072-1074)Cga>Tga	p.R358*	AMER1_ENST00000374869.3_Nonsense_Mutation_p.R358*|AMER1_ENST00000403336.1_Nonsense_Mutation_p.R358*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	358					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.R358*(9)									CAGGAACTTCGCTTGGTCCCA	0.527																																					p.R358X												.	.	76	Whole gene deletion(67)|Substitution - Nonsense(9)	kidney(70)|large_intestine(5)|ovary(1)	c.C1072T	X	GRCh37	CM090019	FAM123B	M	rs137852217	.						153.0	136.0	142.0					X																	63412095		2203	4300	6503	63328820	SO:0001587	stop_gained	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1072C>T	X.37:g.63412095G>A	ENSP00000329117:p.Arg358*		63328820	NM_152424	A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	38	7.185009	0.98121	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	5.18	1.24	0.21308	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3576	13.9688	0.64225	0.0:0.0:0.3525:0.6475	.	.	.	.	X	358	.	ENSP00000329117:R358X	R	-	1	2	FAM123B	63328820	0.081000	0.21417	0.853000	0.33588	0.996000	0.88848	0.184000	0.16939	-0.004000	0.14419	0.529000	0.55759	CGA		0.527	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
BRWD3	254065	hgsc.bcm.edu	37	X	79946598	79946598	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chrX:79946598T>G	ENST00000373275.4	-	31	3772	c.3556A>C	c.(3556-3558)Act>Cct	p.T1186P	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1186	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)			p.T1186P(1)		breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TTGAGGTCAGTTGGATAAGCA	0.358																																					p.T1186P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3556C	X						.						78.0	74.0	76.0					X																	79946598		2202	4300	6502	79833254	SO:0001583	missense	254065	exon31				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.3556A>C	X.37:g.79946598T>G	ENSP00000362372:p.Thr1186Pro		79833254	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	T	19.86	3.906141	0.72868	.	.	ENSG00000165288	ENST00000373275	T	0.19105	2.17	4.81	3.61	0.41365	Bromodomain (5);	0.000000	0.85682	D	0.000000	T	0.48786	0.1519	M	0.86805	2.84	0.52501	D	0.999952	D	0.89917	1.0	D	0.87578	0.998	T	0.50734	-0.8793	9	.	.	.	-14.1795	10.7705	0.46319	0.0:0.0:0.1571:0.8429	.	1186	Q6RI45	BRWD3_HUMAN	P	1186	ENSP00000362372:T1186P	.	T	-	1	0	BRWD3	79833254	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.525000	0.81892	0.633000	0.30452	0.486000	0.48141	ACT		0.358	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
SLITRK4	139065	hgsc.bcm.edu	37	X	142718314	142718314	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chrX:142718314C>T	ENST00000381779.4	-	2	836	c.611G>A	c.(610-612)cGt>cAt	p.R204H	SLITRK4_ENST00000338017.4_Missense_Mutation_p.R204H|SLITRK4_ENST00000356928.1_Missense_Mutation_p.R204H	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	204						integral component of membrane (GO:0016021)		p.R204H(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TTCAACGACACGGCCAATGTG	0.428																																					p.R204H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G611A	X						.						86.0	82.0	84.0					X																	142718314		2203	4300	6503	142545980	SO:0001583	missense	139065	exon2			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.611G>A	X.37:g.142718314C>T	ENSP00000371198:p.Arg204His		142545980	NM_173078	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.908800	0.52439	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.52526	0.66;0.66;0.66	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.54581	0.1867	N	0.17764	0.52	0.80722	D	1	D	0.76494	0.999	D	0.67725	0.953	T	0.59139	-0.7510	10	0.59425	D	0.04	-6.3467	17.313	0.87214	0.0:1.0:0.0:0.0	.	204	Q8IW52	SLIK4_HUMAN	H	204	ENSP00000371198:R204H;ENSP00000349400:R204H;ENSP00000336627:R204H	ENSP00000336627:R204H	R	-	2	0	SLITRK4	142545980	1.000000	0.71417	0.840000	0.33206	0.462000	0.32619	7.818000	0.86416	2.412000	0.81896	0.597000	0.82753	CGT		0.428	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
FLT1	2321	hgsc.bcm.edu	37	13	28979917	28979917	+	Splice_Site	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr13:28979917C>T	ENST00000282397.4	-	11	1802	c.1551G>A	c.(1549-1551)aaG>aaA	p.K517K	FLT1_ENST00000541932.1_Splice_Site_p.K517K|FLT1_ENST00000539099.1_Splice_Site_p.K517K	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	517	Ig-like C2-type 5.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.K517K(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAAACAATACCTTATTCTTTC	0.383																																					p.K517K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1551A	13						.						169.0	160.0	163.0					13																	28979917		2203	4300	6503	27877917	SO:0001630	splice_region_variant	2321	exon11			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1551+1G>A	13.37:g.28979917C>T			27877917	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Silent	SNP	ENST00000282397.4	37	CCDS9330.1																																																																																				0.383	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		Silent
PIK3AP1	118788	hgsc.bcm.edu	37	10	98369596	98369596	+	Silent	SNP	G	G	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr10:98369596G>A	ENST00000339364.5	-	14	2162	c.2043C>T	c.(2041-2043)caC>caT	p.H681H	PIK3AP1_ENST00000371109.3_Silent_p.H280H|PIK3AP1_ENST00000371110.2_Silent_p.H503H	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	681					negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)	p.H681H(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		GGTGCTGTGAGTGCCGAATTG	0.537																																					p.H681H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2043T	10						.						219.0	221.0	220.0					10																	98369596		2203	4300	6503	98359586	SO:0001819	synonymous_variant	118788	exon14			AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.2043C>T	10.37:g.98369596G>A			98359586	NM_152309	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Silent	SNP	ENST00000339364.5	37	CCDS31259.1																																																																																				0.537	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309	
PKD2L1	9033	hgsc.bcm.edu	37	10	102056789	102056789	+	Missense_Mutation	SNP	C	C	T	rs202172386		TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr10:102056789C>T	ENST00000318222.3	-	6	1515	c.1133G>A	c.(1132-1134)cGg>cAg	p.R378Q	PKD2L1_ENST00000338519.3_Missense_Mutation_p.R303Q|PKD2L1_ENST00000353274.3_Missense_Mutation_p.R378Q	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	378			R -> W (in dbSNP:rs7909153).		cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)	p.R378Q(1)		NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		GTAGCGAAGCCGGTGAATGTG	0.517																																					p.R378Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1133A	10						.						117.0	104.0	108.0					10																	102056789		2203	4300	6503	102046779	SO:0001583	missense	9033	exon6			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.1133G>A	10.37:g.102056789C>T	ENSP00000325296:p.Arg378Gln		102046779	NM_016112	O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	ENST00000318222.3	37	CCDS7492.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.849797	0.71603	.	.	ENSG00000107593	ENST00000338519;ENST00000353274;ENST00000318222;ENST00000339977	T;T;T	0.74315	-0.83;-0.83;-0.83	4.71	3.8	0.43715	Polycystin cation channel, PKD1/PKD2 (1);	0.352946	0.31134	N	0.008193	T	0.78266	0.4256	M	0.77103	2.36	0.34809	D	0.737541	D;D	0.54397	0.966;0.964	P;P	0.53035	0.52;0.716	T	0.81883	-0.0728	10	0.37606	T	0.19	-15.7551	7.8928	0.29688	0.0:0.7736:0.0:0.2264	.	331;378	Q1L4F0;Q9P0L9	.;PK2L1_HUMAN	Q	303;378;378;376	ENSP00000345068:R303Q;ENSP00000266049:R378Q;ENSP00000325296:R378Q	ENSP00000325296:R378Q	R	-	2	0	PKD2L1	102046779	0.724000	0.28038	0.999000	0.59377	0.886000	0.51366	0.944000	0.29043	2.614000	0.88457	0.561000	0.74099	CGG		0.517	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049863.2	NM_016112	
APC	324	hgsc.bcm.edu	37	5	112173704	112173704	+	Nonsense_Mutation	SNP	C	C	T	rs587779783		TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr5:112173704C>T	ENST00000457016.1	+	16	2793	c.2413C>T	c.(2413-2415)Cga>Tga	p.R805*	APC_ENST00000257430.4_Nonsense_Mutation_p.R805*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.R805*			P25054	APC_HUMAN	adenomatous polyposis coli	805	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R805*(10)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGACACCAATCGACATGATGA	0.373		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R787X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,0	.	11	Substitution - Nonsense(10)|Unknown(1)	large_intestine(10)|skin(1)	c.C2359T	5	GRCh37	CM960067	APC	M		.						77.0	78.0	78.0					5																	112173704		2202	4300	6502	112201603	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2413C>T	5.37:g.112173704C>T	ENSP00000413133:p.Arg805*		112201603	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.853935	0.97030	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.16	4.36	0.52297	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-10.8016	14.7295	0.69372	0.4961:0.5038:0.0:0.0	.	.	.	.	X	805;787;805;805;805	.	ENSP00000257430:R805X	R	+	1	2	APC	112201603	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.615000	0.36922	0.896000	0.36366	-0.188000	0.12872	CGA		0.373	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHA2	56146	hgsc.bcm.edu	37	5	140176361	140176361	+	Silent	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr5:140176361C>T	ENST00000526136.1	+	1	1812	c.1812C>T	c.(1810-1812)aaC>aaT	p.N604N	PCDHA2_ENST00000520672.2_Silent_p.N604N|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Silent_p.N604N|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	604	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.N604N(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGCTACAACGCGTGGCTTT	0.657																																					p.N604N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1812T	5						.						154.0	139.0	144.0					5																	140176361		2203	4300	6503	140156545	SO:0001819	synonymous_variant	56146	exon1			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1812C>T	5.37:g.140176361C>T			140156545	NM_018905	O75287|Q9BTV3	Silent	SNP	ENST00000526136.1	37	CCDS54914.1																																																																																				0.657	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHAC2	56134	hgsc.bcm.edu	37	5	140348558	140348558	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr5:140348558C>T	ENST00000289269.5	+	1	2739	c.2207C>T	c.(2206-2208)gCg>gTg	p.A736V	PCDHA13_ENST00000409494.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	736					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A736V(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCTACACTGCGTATGGCACT	0.418																																					p.A736V	Melanoma(190;638 2083 3390 11909 52360)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2207T	5						.						86.0	83.0	84.0					5																	140348558		2203	4300	6503	140328742	SO:0001583	missense	56134	exon1			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.2207C>T	5.37:g.140348558C>T	ENSP00000289269:p.Ala736Val		140328742	NM_018899	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	ENST00000289269.5	37	CCDS4242.1	.	.	.	.	.	.	.	.	.	.	C	8.295	0.818566	0.16607	.	.	ENSG00000243232	ENST00000289269	T	0.47177	0.85	5.66	5.66	0.87406	.	0.000000	0.41823	D	0.000811	T	0.35307	0.0927	L	0.47190	1.495	0.80722	D	1	P;P	0.39624	0.681;0.491	B;B	0.36666	0.23;0.041	T	0.15607	-1.0431	10	0.25751	T	0.34	.	5.9244	0.19101	0.1867:0.6997:0.0:0.1136	.	736;736	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	V	736	ENSP00000289269:A736V	ENSP00000289269:A736V	A	+	2	0	PCDHAC2	140328742	0.994000	0.37717	0.957000	0.39632	0.990000	0.78478	2.547000	0.45786	2.680000	0.91292	0.561000	0.74099	GCG		0.418	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
RXFP3	51289	hgsc.bcm.edu	37	5	33937182	33937182	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr5:33937182C>T	ENST00000330120.3	+	1	692	c.337C>T	c.(337-339)Cgc>Tgc	p.R113C		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	113					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)	p.R113C(2)		endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						GCAGGGCTGGCGCAAGTCCTC	0.592																																					p.R113C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C337T	5						.						111.0	103.0	106.0					5																	33937182		2203	4300	6503	33972939	SO:0001583	missense	51289	exon1			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.337C>T	5.37:g.33937182C>T	ENSP00000328708:p.Arg113Cys		33972939	NM_016568	Q14DA5	Missense_Mutation	SNP	ENST00000330120.3	37	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	C	18.73	3.685466	0.68157	.	.	ENSG00000182631	ENST00000330120	T	0.46063	0.88	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.153499	0.53938	D	0.000047	T	0.65606	0.2707	M	0.83223	2.63	0.54753	D	0.999988	D	0.89917	1.0	D	0.72625	0.978	T	0.69544	-0.5117	10	0.72032	D	0.01	-20.2284	12.6926	0.56982	0.2731:0.7269:0.0:0.0	.	113	Q9NSD7	RL3R1_HUMAN	C	113	ENSP00000328708:R113C	ENSP00000328708:R113C	R	+	1	0	RXFP3	33972939	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.411000	0.59781	2.700000	0.92200	0.650000	0.86243	CGC		0.592	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
DOCK2	1794	hgsc.bcm.edu	37	5	169108785	169108785	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3548-01A-01W-0831-10	TCGA-AA-3548-10A-01W-0831-10	g.chr5:169108785G>A	ENST00000256935.8	+	7	588	c.508G>A	c.(508-510)Gga>Aga	p.G170R		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	170					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.G170R(3)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGATGAAGACGGAAATATCTT	0.413																																					p.G170R												.	.	3	Substitution - Missense(3)	large_intestine(2)|prostate(1)	c.G508A	5						.						161.0	151.0	155.0					5																	169108785		2203	4300	6503	169041363	SO:0001583	missense	1794	exon7			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.508G>A	5.37:g.169108785G>A	ENSP00000256935:p.Gly170Arg		169041363	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852928	0.91355	.	.	ENSG00000134516	ENST00000256935	T	0.61859	0.07	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.80844	0.4701	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84909	0.0847	10	0.56958	D	0.05	.	18.0283	0.89275	0.0:0.0:1.0:0.0	.	170	Q92608	DOCK2_HUMAN	R	170	ENSP00000256935:G170R	ENSP00000256935:G170R	G	+	1	0	DOCK2	169041363	1.000000	0.71417	0.995000	0.50966	0.843000	0.47879	9.412000	0.97347	2.323000	0.78572	0.655000	0.94253	GGA		0.413	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
