#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NOD1	10392	hgsc.bcm.edu	37	7	30492626	30492627	+	Frame_Shift_Ins	INS	-	-	A	rs547986895		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr7:30492626_30492627insA	ENST00000222823.4	-	6	931_932	c.406_407insT	c.(406-408)catfs	p.H136fs	NOD1_ENST00000423334.2_Frame_Shift_Ins_p.H136fs	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	136					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						ACGGCCCAGATGGTGTCGCAGC	0.594																																					p.H136fs												.	.	0			c.407_408insT	7						.																																			30459152	SO:0001589	frameshift_variant	10392	exon6			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.406_407insT	7.37:g.30492626_30492627insA	ENSP00000222823:p.His136fs		30459151	NM_006092	B4DTU3|Q549U4|Q8IWF5	Frame_Shift_Ins	INS	ENST00000222823.4	37	CCDS5427.1																																																																																				0.594	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2		
SH3D21	79729	hgsc.bcm.edu	37	1	36786349	36786350	+	In_Frame_Ins	INS	-	-	GAG			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr1:36786349_36786350insGAG	ENST00000426732.2	+	13	2022_2023	c.1737_1738insGAG	c.(1738-1740)gag>GAGgag	p.580_580E>EE	RP11-268J15.5_ENST00000373137.2_5'Flank|SH3D21_ENST00000312808.4_In_Frame_Ins_p.342_342E>EE|SH3D21_ENST00000474766.1_3'UTR|SH3D21_ENST00000505871.1_In_Frame_Ins_p.585_585E>EE|EVA1B_ENST00000490466.1_5'Flank|SH3D21_ENST00000453908.2_In_Frame_Ins_p.696_696E>EE			A4FU49	SH321_HUMAN	SH3 domain containing 21	580						extracellular vesicular exosome (GO:0070062)		p.G341_E342insE(1)|p.G695_E696insE(1)		endometrium(1)|large_intestine(6)|lung(4)|pancreas(1)	12						CGCTGAGGGGCGAGGTGGAGTC	0.614																																					p.G695delinsGE												.	.	2	Insertion - In frame(2)	large_intestine(2)	c.2085_2086insGAG	1						.																																			36558937	SO:0001652	inframe_insertion	79729	exon14			AK056459	CCDS30674.1, CCDS30674.2	1p34.3	2011-02-21	2011-02-21	2011-02-21	ENSG00000214193	ENSG00000214193			26236	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 113"""	C1orf113		12477932	Standard	NM_024676		Approved	FLJ22938	uc010oia.1	A4FU49	OTTHUMG00000007868	ENST00000426732.2:c.1738_1740dupGAG	1.37:g.36786350_36786352dupGAG	ENSP00000408613:p.Glu580dup		36558936	NM_001162530	B4DLI6|D3DPS6|J3KQM5|Q5VTK7|Q86XZ6|Q8N445|Q96DN4|Q9H5W5	In_Frame_Ins	INS	ENST00000426732.2	37																																																																																					0.614	SH3D21-202	KNOWN	basic	protein_coding	protein_coding		NM_024676	
OPN1SW	611	hgsc.bcm.edu	37	7	128415050	128415050	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr7:128415050C>A	ENST00000249389.2	-	2	510	c.511G>T	c.(511-513)Ggc>Tgc	p.G171C		NM_001708.2	NP_001699.1	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	171					phototransduction (GO:0007602)|phototransduction, visible light (GO:0007603)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)|receptor activity (GO:0004872)	p.G171C(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|stomach(1)	19						CGGCTCCAGCCAAAGAAGGGT	0.537																																					p.G171C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G511T	7						.						66.0	55.0	59.0					7																	128415050		2203	4300	6503	128202286	SO:0001583	missense	611	exon2			U53874	CCDS5806.1	7q31.3-q32	2013-01-08	2008-04-16		ENSG00000128617	ENSG00000128617		"""GPCR / Class A : Opsin receptors"""	1012	protein-coding gene	gene with protein product	"""color blindness, tritan"", ""blue-sensitive opsin"""	613522	"""blue cone photoreceptor pigment"""	BCP		2937147, 8270261	Standard	NM_001708		Approved	BOP, CBT	uc003vnt.4	P03999	OTTHUMG00000158311	ENST00000249389.2:c.511G>T	7.37:g.128415050C>A	ENSP00000249389:p.Gly171Cys		128202286	NM_001708	Q13877	Missense_Mutation	SNP	ENST00000249389.2	37	CCDS5806.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558509	0.86231	.	.	ENSG00000128617	ENST00000249389	T	0.40756	1.02	4.92	4.92	0.64577	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.78780	0.4337	H	0.98866	4.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87369	0.2349	10	0.87932	D	0	.	15.6713	0.77279	0.0:1.0:0.0:0.0	.	171	P03999	OPSB_HUMAN	C	171	ENSP00000249389:G171C	ENSP00000249389:G171C	G	-	1	0	OPN1SW	128202286	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.591000	0.82666	2.567000	0.86603	0.655000	0.94253	GGC		0.537	OPN1SW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350655.1	NM_001708	
AKR1B10	57016	hgsc.bcm.edu	37	7	134217821	134217821	+	Silent	SNP	G	G	A	rs73724971	byFrequency	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr7:134217821G>A	ENST00000359579.4	+	4	737	c.417G>A	c.(415-417)ttG>ttA	p.L139L	AKR1B10_ENST00000475559.1_3'UTR	NM_020299.4	NP_064695.3	O60218	AK1BA_HUMAN	aldo-keto reductase family 1, member B10 (aldose reductase)	139					cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aldo-keto reductase (NADP) activity (GO:0004033)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|retinal dehydrogenase activity (GO:0001758)	p.L139L(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(9)|skin(5)	20						CAACGTTCTTGGATGCCTGGG	0.463													.|||	15	0.00299521	0.0106	0.0014	5008	,	,		19880	0.0		0.0	False		,,,				2504	0.0				p.L139L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G417A	7						.	G		55,4351	54.9+/-90.9	0,55,2148	167.0	159.0	162.0		417	1.8	0.1	7	dbSNP_130	162	0,8600		0,0,4300	no	coding-synonymous	AKR1B10	NM_020299.4		0,55,6448	AA,AG,GG		0.0,1.2483,0.4229		139/317	134217821	55,12951	2203	4300	6503	133868361	SO:0001819	synonymous_variant	57016	exon4			AF052577	CCDS5832.1	7q33	2010-04-08			ENSG00000198074	ENSG00000198074		"""Aldo-keto reductases"""	382	protein-coding gene	gene with protein product	"""aldose reductase-like 1"", ""aldo-keto reductase family 1, member B11 (aldose reductase-like)"", ""aldose reductase-like peptide"", ""aldose reductase-related protein"", ""small intestine reductase"""	604707		AKR1B11		9765596, 9565553	Standard	NM_020299		Approved	AKR1B12, ARL-1, HIS, ARL1, HSI, ALDRLn	uc003vrr.3	O60218	OTTHUMG00000155356	ENST00000359579.4:c.417G>A	7.37:g.134217821G>A			133868361	NM_020299	A4D1P1|O75890|Q6FHF3|Q8IWZ1	Silent	SNP	ENST00000359579.4	37	CCDS5832.1																																																																																				0.463	AKR1B10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339615.1	NM_020299	
AP4M1	9179	hgsc.bcm.edu	37	7	99703137	99703137	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr7:99703137G>C	ENST00000359593.4	+	11	1062	c.904G>C	c.(904-906)Gtg>Ctg	p.V302L	AP4M1_ENST00000422582.1_Missense_Mutation_p.V174L|AP4M1_ENST00000429084.1_Missense_Mutation_p.V309L|AP4M1_ENST00000421755.1_Missense_Mutation_p.V302L	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	302	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)	p.V302L(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTTCCCCTCTGTGCAGTGGGA	0.557																																					p.V302L	Pancreas(174;1182 2812 29595 49511)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G904C	7						.						86.0	71.0	76.0					7																	99703137		2203	4300	6503	99541073	SO:0001583	missense	9179	exon11			Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.904G>C	7.37:g.99703137G>C	ENSP00000352603:p.Val302Leu		99541073	NM_004722	D6W5U1|Q8WV65|Q9UHK9	Missense_Mutation	SNP	ENST00000359593.4	37	CCDS5685.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916665	0.52546	.	.	ENSG00000221838	ENST00000438383;ENST00000429084;ENST00000359593;ENST00000439416;ENST00000421755;ENST00000422582;ENST00000450807	T;T;T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14;2.14;2.14	5.27	5.27	0.74061	Clathrin adaptor, mu subunit, C-terminal (3);	0.215397	0.41001	D	0.000964	T	0.19604	0.0471	L	0.45422	1.42	0.42572	D	0.993187	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.0	T	0.02179	-1.1200	10	0.56958	D	0.05	-8.7781	12.0237	0.53358	0.0:0.1734:0.8266:0.0	.	258;309;302	C9JMG3;C9JC87;O00189	.;.;AP4M1_HUMAN	L	234;309;302;258;302;174;54	ENSP00000401613:V234L;ENSP00000403663:V309L;ENSP00000352603:V302L;ENSP00000414286:V258L;ENSP00000412185:V302L;ENSP00000406676:V174L;ENSP00000391585:V54L	ENSP00000352603:V302L	V	+	1	0	AP4M1	99541073	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.717000	0.37991	2.735000	0.93741	0.655000	0.94253	GTG		0.557	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336772.4	NM_004722	
CRYGN	155051	hgsc.bcm.edu	37	7	151135319	151135319	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr7:151135319A>T	ENST00000337323.2	-	2	159	c.33T>A	c.(31-33)taT>taA	p.Y11*	RP4-555L14.4_ENST00000465549.1_RNA|CRYGN_ENST00000476631.1_5'UTR|CRYGN_ENST00000491928.1_Nonsense_Mutation_p.Y11*	NM_144727.1	NP_653328.1	Q8WXF5	CRGN_HUMAN	crystallin, gamma N	11	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.							p.Y11*(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(1)|lung(4)	8			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTTGCCTTCATAGAGAGTGA	0.577																																					p.Y11X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T33A	7						.						56.0	53.0	54.0					7																	151135319		2203	4300	6503	150766252	SO:0001587	stop_gained	155051	exon2			AF445455	CCDS5926.1	7q36.1	2003-02-25			ENSG00000127377	ENSG00000127377			20458	protein-coding gene	gene with protein product		609603					Standard	NM_144727		Approved		uc003wke.3	Q8WXF5	OTTHUMG00000157353	ENST00000337323.2:c.33T>A	7.37:g.151135319A>T	ENSP00000338613:p.Tyr11*		150766252	NM_144727	Q496G6	Nonsense_Mutation	SNP	ENST00000337323.2	37	CCDS5926.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.065378	0.76187	.	.	ENSG00000127377	ENST00000337323	.	.	.	5.05	-4.86	0.03132	.	0.111130	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.2765	0.87116	0.1983:0.0:0.8017:0.0	.	.	.	.	X	11	.	ENSP00000338613:Y11X	Y	-	3	2	CRYGN	150766252	0.677000	0.27577	0.059000	0.19551	0.697000	0.40408	-0.062000	0.11674	-0.725000	0.04901	0.379000	0.24179	TAT		0.577	CRYGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348553.1		
CDH4	1002	hgsc.bcm.edu	37	20	60448910	60448910	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr20:60448910G>A	ENST00000360469.5	+	7	1092	c.1004G>A	c.(1003-1005)aGc>aAc	p.S335N	CDH4_ENST00000543233.1_Missense_Mutation_p.S261N	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	335	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S335N(1)		NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			ACCATCAACAGCGAGACTGGA	0.642																																					p.S335N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1004A	20						.						172.0	140.0	151.0					20																	60448910		2203	4300	6503	59882305	SO:0001583	missense	1002	exon7			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1004G>A	20.37:g.60448910G>A	ENSP00000353656:p.Ser335Asn		59882305	NM_001794	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	37	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	G	3.717	-0.058351	0.07317	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.52526	0.66;0.66	4.92	4.92	0.64577	Cadherin (4);Cadherin-like (1);	0.085471	0.85682	D	0.000000	T	0.56688	0.2002	L	0.46614	1.455	0.44771	D	0.997775	P	0.52463	0.953	P	0.55222	0.771	T	0.54132	-0.8339	9	.	.	.	.	18.1708	0.89744	0.0:0.0:1.0:0.0	.	335	P55283	CADH4_HUMAN	N	335;243;261	ENSP00000353656:S335N;ENSP00000443301:S261N	.	S	+	2	0	CDH4	59882305	0.999000	0.42202	1.000000	0.80357	0.340000	0.28889	2.936000	0.48971	2.282000	0.76494	0.585000	0.79938	AGC		0.642	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
LARGE	9215	hgsc.bcm.edu	37	22	33700433	33700433	+	Silent	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr22:33700433G>A	ENST00000354992.2	-	13	2083	c.1512C>T	c.(1510-1512)taC>taT	p.Y504Y	LARGE_ENST00000452586.2_Silent_p.Y303Y|LARGE_ENST00000397394.2_Silent_p.Y504Y|LARGE_ENST00000437602.2_Silent_p.Y504Y|LARGE_ENST00000337431.2_Silent_p.Y452Y|LARGE_ENST00000402320.1_Silent_p.Y452Y	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	504					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)	p.Y504Y(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				CGTCTGACAGGTAGAGGGCCA	0.647																																					p.Y504Y	Colon(70;397 1175 4573 19089 45288)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1512T	22						.						41.0	36.0	38.0					22																	33700433		2203	4300	6503	32030433	SO:0001819	synonymous_variant	9215	exon12			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.1512C>T	22.37:g.33700433G>A			32030433	NM_133642	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Silent	SNP	ENST00000354992.2	37	CCDS13912.1																																																																																				0.647	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320515.2	NM_133642	
QTRT1	81890	hgsc.bcm.edu	37	19	10812845	10812845	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr19:10812845G>T	ENST00000250237.5	+	3	376	c.366G>T	c.(364-366)gaG>gaT	p.E122D	QTRT1_ENST00000585885.1_3'UTR	NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	122					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)	p.E122D(1)		large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			AGGTGACGGAGGAGGGCGTCC	0.637																																					p.E122D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G366T	19						.						68.0	66.0	67.0					19																	10812845		2203	4300	6503	10673845	SO:0001583	missense	81890	exon3			AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.366G>T	19.37:g.10812845G>T	ENSP00000250237:p.Glu122Asp		10673845	NM_031209	B4DFM7|Q96BQ4|Q9BXQ9	Missense_Mutation	SNP	ENST00000250237.5	37	CCDS12248.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.616297	0.66672	.	.	ENSG00000213339	ENST00000250237;ENST00000421333	.	.	.	5.37	3.26	0.37387	.	0.000000	0.64402	U	0.000004	T	0.71204	0.3312	M	0.75615	2.305	0.54753	D	0.999983	D	0.76494	0.999	D	0.91635	0.999	T	0.70648	-0.4814	9	0.72032	D	0.01	-9.958	7.4414	0.27185	0.265:0.0:0.735:0.0	.	122	Q9BXR0	TGT_HUMAN	D	122	.	ENSP00000250237:E122D	E	+	3	2	QTRT1	10673845	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	1.225000	0.32551	0.670000	0.31165	0.650000	0.86243	GAG		0.637	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209	
FSD1	79187	hgsc.bcm.edu	37	19	4311908	4311908	+	Missense_Mutation	SNP	G	G	T	rs545061368		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr19:4311908G>T	ENST00000221856.6	+	7	707	c.560G>T	c.(559-561)cGc>cTc	p.R187L	FSD1_ENST00000598010.1_3'UTR|FSD1_ENST00000597590.1_Missense_Mutation_p.R187L	NM_024333.2	NP_077309.1	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing 1	187	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.R187L(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGTGTGGCGCATGCCGGAT	0.642																																					p.R187L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G560T	19						.						138.0	104.0	116.0					19																	4311908		2203	4300	6503	4262908	SO:0001583	missense	79187	exon7			AF316829	CCDS12127.1	19p13.3	2013-02-11	2005-03-01			ENSG00000105255		"""Fibronectin type III domain containing"""	13745	protein-coding gene	gene with protein product		609828	"""fibronectin type 3 and SPRY domain containing 1"""			11267680	Standard	NM_024333		Approved	MGC3213, MIR1	uc002lzy.2	Q9BTV5		ENST00000221856.6:c.560G>T	19.37:g.4311908G>T	ENSP00000221856:p.Arg187Leu		4262908	NM_024333	B2RDT0|Q9BXN0|Q9HAG4	Missense_Mutation	SNP	ENST00000221856.6	37	CCDS12127.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454860	0.43634	.	.	ENSG00000105255	ENST00000221856	T	0.56776	0.44	5.33	3.2	0.36748	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.213055	0.39615	N	0.001304	T	0.51075	0.1653	L	0.48935	1.535	0.24973	N	0.991655	B	0.24882	0.113	B	0.40101	0.319	T	0.52895	-0.8514	10	0.59425	D	0.04	.	8.4299	0.32750	0.193:0.0:0.807:0.0	.	187	Q9BTV5	FSD1_HUMAN	L	187	ENSP00000221856:R187L	ENSP00000221856:R187L	R	+	2	0	FSD1	4262908	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	1.801000	0.38843	1.218000	0.43458	0.561000	0.74099	CGC		0.642	FSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458091.1	NM_024333	
MAG	4099	hgsc.bcm.edu	37	19	35793484	35793484	+	Silent	SNP	G	G	A	rs140483946	byFrequency	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr19:35793484G>A	ENST00000392213.3	+	7	1263	c.1104G>A	c.(1102-1104)acG>acA	p.T368T	MAG_ENST00000361922.4_Silent_p.T368T|MAG_ENST00000537831.2_Silent_p.T343T	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	368	Ig-like C2-type 3.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)	p.T368T(2)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TCCTGTCCACGGTCATCTACG	0.587													G|||	11	0.00219649	0.0068	0.0029	5008	,	,		18557	0.0		0.0	False		,,,				2504	0.0				p.T343T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1029A	19						.	G	,,	25,4381	31.7+/-61.6	0,25,2178	118.0	98.0	105.0		1029,1104,1104	-9.1	0.9	19	dbSNP_134	105	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	MAG	NM_001199216.1,NM_002361.3,NM_080600.2	,,	0,27,6476	AA,AG,GG		0.0233,0.5674,0.2076	,,	343/602,368/627,368/583	35793484	27,12979	2203	4300	6503	40485324	SO:0001819	synonymous_variant	4099	exon7			M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1104G>A	19.37:g.35793484G>A			40485324	NM_001199216	B7Z2E5|F5GYC0|Q567S4	Silent	SNP	ENST00000392213.3	37	CCDS12455.1																																																																																				0.587	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600	
ZNF543	125919	hgsc.bcm.edu	37	19	57839852	57839852	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr19:57839852G>A	ENST00000321545.4	+	4	1367	c.1022G>A	c.(1021-1023)tGc>tAc	p.C341Y		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C341Y(1)		breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CCCTATGAGTGCATTGAGTGT	0.498																																					p.C341Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1022A	19						.						76.0	75.0	76.0					19																	57839852		2203	4300	6503	62531664	SO:0001583	missense	125919	exon4			AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.1022G>A	19.37:g.57839852G>A	ENSP00000322545:p.Cys341Tyr		62531664	NM_213598	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	ENST00000321545.4	37	CCDS33130.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320217	0.23994	.	.	ENSG00000178229	ENST00000321545	D	0.85088	-1.94	3.0	1.93	0.25924	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93671	0.7978	H	0.95645	3.7	0.24248	N	0.995334	D	0.89917	1.0	D	0.97110	1.0	D	0.84606	0.0675	9	0.87932	D	0	.	9.263	0.37623	0.1149:0.0:0.8851:0.0	.	341	Q08ER8	ZN543_HUMAN	Y	341	ENSP00000322545:C341Y	ENSP00000322545:C341Y	C	+	2	0	ZNF543	62531664	1.000000	0.71417	0.004000	0.12327	0.005000	0.04900	8.839000	0.92120	0.570000	0.29347	-0.291000	0.09656	TGC		0.498	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	XM_064865	
ODF1	4956	hgsc.bcm.edu	37	8	103572687	103572687	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr8:103572687A>G	ENST00000285402.3	+	2	484	c.328A>G	c.(328-330)Aga>Gga	p.R110G	ODF1_ENST00000518835.1_5'Flank	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	110					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)		p.R110G(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			CAGACTGAGAAGAACAACAAA	0.428																																					p.R110G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A328G	8						.						92.0	89.0	90.0					8																	103572687		2203	4300	6503	103641863	SO:0001583	missense	4956	exon2			M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.328A>G	8.37:g.103572687A>G	ENSP00000285402:p.Arg110Gly		103641863	NM_024410	Q3SX72	Missense_Mutation	SNP	ENST00000285402.3	37	CCDS6293.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.979533	0.74360	.	.	ENSG00000155087	ENST00000285402	T	0.47528	0.84	5.53	5.53	0.82687	.	0.000000	0.56097	D	0.000032	T	0.45597	0.1350	N	0.08118	0	0.80722	D	1	P	0.48350	0.909	P	0.60789	0.879	T	0.55315	-0.8160	10	0.87932	D	0	-20.8115	12.0536	0.53522	1.0:0.0:0.0:0.0	.	110	Q14990	ODFP1_HUMAN	G	110	ENSP00000285402:R110G	ENSP00000285402:R110G	R	+	1	2	ODF1	103641863	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.722000	0.61958	2.095000	0.63458	0.528000	0.53228	AGA		0.428	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1		
TNFRSF10B	8795	hgsc.bcm.edu	37	8	22880198	22880198	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr8:22880198A>T	ENST00000276431.4	-	9	1593	c.1309T>A	c.(1309-1311)Tct>Act	p.S437T	TNFRSF10B_ENST00000347739.3_Missense_Mutation_p.S408T|TNFRSF10B_ENST00000542226.1_Missense_Mutation_p.S257T	NM_003842.4|NM_147187.2	NP_003833.4|NP_671716.2	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily, member 10b	437					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to endoplasmic reticulum stress (GO:0034976)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|TRAIL binding (GO:0045569)			NS(1)|endometrium(2)|large_intestine(7)|liver(1)|lung(3)|skin(1)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		GACATGGCAGAGTCTGCATTA	0.473																																					p.S437T	GBM(94;1064 1342 1839 21060 42553)											.	.	0			c.T1309A	8						.						88.0	83.0	85.0					8																	22880198		2203	4300	6503	22936143	SO:0001583	missense	8795	exon9			AF012628	CCDS6035.1, CCDS6036.1	8p22-p21	2006-02-22			ENSG00000120889	ENSG00000120889		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11905	protein-coding gene	gene with protein product		603612				9285725, 9311998	Standard	NM_003842		Approved	DR5, KILLER, TRICK2A, TRAIL-R2, TRICKB, CD262	uc003xcu.2	O14763	OTTHUMG00000097826	ENST00000276431.4:c.1309T>A	8.37:g.22880198A>T	ENSP00000276431:p.Ser437Thr		22936143	NM_003842	O14720|O15508|O15517|O15531|Q6UXM8|Q7Z360|Q9BVE0	Missense_Mutation	SNP	ENST00000276431.4	37	CCDS6035.1	.	.	.	.	.	.	.	.	.	.	a	14.04	2.415932	0.42817	.	.	ENSG00000120889	ENST00000276431;ENST00000347739;ENST00000542226	D;D;T	0.86366	-1.91;-2.11;2.67	3.56	-1.82	0.07857	.	1.922250	0.04513	U	0.383253	D	0.88625	0.6487	M	0.61703	1.905	0.09310	N	1	P;P;P;D;D	0.58268	0.948;0.882;0.882;0.982;0.979	B;B;B;P;P	0.58013	0.431;0.332;0.332;0.831;0.549	T	0.75241	-0.3387	10	0.39692	T	0.17	.	3.1101	0.06355	0.4736:0.0:0.3369:0.1895	.	257;437;437;408;202	B7Z588;B5BU36;O14763;O14763-2;Q7Z2I8	.;.;TR10B_HUMAN;.;.	T	437;408;257	ENSP00000276431:S437T;ENSP00000317859:S408T;ENSP00000443386:S257T	ENSP00000276431:S437T	S	-	1	0	TNFRSF10B	22936143	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.584000	0.05800	-0.310000	0.08766	-0.296000	0.09543	TCT		0.473	TNFRSF10B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215099.2	NM_147187	
IMPA1	3612	hgsc.bcm.edu	37	8	82592988	82592988	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr8:82592988T>A	ENST00000256108.5	-	3	559	c.94A>T	c.(94-96)Aat>Tat	p.N32Y	IMPA1_ENST00000523710.1_5'UTR|IMPA1_ENST00000449740.2_Missense_Mutation_p.N91Y|IMPA1_ENST00000311489.4_Missense_Mutation_p.N32Y	NM_005536.3	NP_005527.1	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1	32					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|inositol monophosphate phosphatase activity (GO:0052834)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein homodimerization activity (GO:0042803)	p.N32Y(1)		NS(1)|cervix(1)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|stomach(1)	18					Lithium(DB01356)	AGCATAACATTCATTTCATTT	0.299																																					p.N32Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A94T	8						.						84.0	84.0	84.0					8																	82592988		2203	4300	6503	82755543	SO:0001583	missense	3612	exon3				CCDS6231.1, CCDS47883.1, CCDS47884.1	8q21.1-q21.3	2008-01-28			ENSG00000133731	ENSG00000133731	3.1.3.25		6050	protein-coding gene	gene with protein product		602064		IMPA		1377913	Standard	NM_005536		Approved		uc011lfq.1	P29218	OTTHUMG00000164682	ENST00000256108.5:c.94A>T	8.37:g.82592988T>A	ENSP00000256108:p.Asn32Tyr		82755543	NM_001144879	B2R733|B4DLN3|B7Z6Q4|J3KQT7|Q9UK71	Missense_Mutation	SNP	ENST00000256108.5	37	CCDS6231.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.04|11.04	1.520545|1.520545	0.27211|0.27211	.|.	.|.	ENSG00000133731|ENSG00000133731	ENST00000523942|ENST00000256108;ENST00000311489;ENST00000449740;ENST00000519964;ENST00000521360;ENST00000522997;ENST00000518202	.|T;T;T;T;T;T;T	.|0.53640	.|0.61;0.9;0.61;0.9;0.9;0.9;0.9	4.71|4.71	0.661|0.661	0.17874|0.17874	.|.	.|0.737577	.|0.13232	.|N	.|0.403603	T|T	0.51753|0.51753	0.1693|0.1693	M|M	0.77313|0.77313	2.365|2.365	0.25308|0.25308	N|N	0.989224|0.989224	.|P;D;P	.|0.56968	.|0.936;0.978;0.931	.|P;P;B	.|0.50860	.|0.652;0.652;0.435	T|T	0.45716|0.45716	-0.9242|-0.9242	5|10	.|0.66056	.|D	.|0.02	-5.7579|-5.7579	3.754|3.754	0.08578|0.08578	0.3176:0.4131:0.0:0.2693|0.3176:0.4131:0.0:0.2693	.|.	.|32;91;32	.|B4DLN3;B7Z6Q4;P29218	.|.;.;IMPA1_HUMAN	V|Y	56|32;32;91;24;32;91;32	.|ENSP00000256108:N32Y;ENSP00000311803:N32Y;ENSP00000408526:N91Y;ENSP00000429322:N24Y;ENSP00000430283:N32Y;ENSP00000430081:N91Y;ENSP00000429516:N32Y	.|ENSP00000256108:N32Y	E|N	-|-	2|1	0|0	IMPA1|IMPA1	82755543|82755543	0.990000|0.990000	0.36364|0.36364	0.998000|0.998000	0.56505|0.56505	0.512000|0.512000	0.34134|0.34134	0.647000|0.647000	0.24812|0.24812	0.264000|0.264000	0.21851|0.21851	0.443000|0.443000	0.29094|0.29094	GAA|AAT		0.299	IMPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379723.1		
COL14A1	7373	hgsc.bcm.edu	37	8	121354669	121354669	+	Silent	SNP	C	C	T	rs150301131		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr8:121354669C>T	ENST00000297848.3	+	44	5142	c.4872C>T	c.(4870-4872)tgC>tgT	p.C1624C	COL14A1_ENST00000247781.3_Silent_p.C1529C|COL14A1_ENST00000309791.4_Silent_p.C1624C	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.C1624C(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GTCAAGTATGCGAACAGCTCA	0.478													C|||	1	0.000199681	0.0	0.0	5008	,	,		21383	0.001		0.0	False		,,,				2504	0.0				p.C1624C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4872T	8						.	C		0,4406		0,0,2203	193.0	160.0	171.0		4872	-0.4	1.0	8	dbSNP_134	171	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	COL14A1	NM_021110.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1624/1797	121354669	1,13005	2203	4300	6503	121423850	SO:0001819	synonymous_variant	7373	exon44				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.4872C>T	8.37:g.121354669C>T			121423850	NM_021110		Silent	SNP	ENST00000297848.3	37	CCDS34938.1																																																																																				0.478	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
SLC6A17	388662	hgsc.bcm.edu	37	1	110734758	110734758	+	Silent	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr1:110734758G>A	ENST00000331565.4	+	7	1514	c.1029G>A	c.(1027-1029)acG>acA	p.T343T		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	343					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)	p.T343T(1)		breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		ACTTCTTCACGTCAGTGTTGG	0.537																																					p.T343T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1029A	1						.						192.0	136.0	155.0					1																	110734758		2203	4300	6503	110536281	SO:0001819	synonymous_variant	388662	exon7				CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1029G>A	1.37:g.110734758G>A			110536281	NM_001010898	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Silent	SNP	ENST00000331565.4	37	CCDS30799.1																																																																																				0.537	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
NRAS	4893	hgsc.bcm.edu	37	1	115256530	115256530	+	Missense_Mutation	SNP	G	G	T	rs121913254		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr1:115256530G>T	ENST00000369535.4	-	3	434	c.181C>A	c.(181-183)Caa>Aaa	p.Q61K		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61K(595)|p.Q61E(9)|p.Q61L(3)|p.Q61R(2)|p.G60>?(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACTCTTCTTGTCCAGCTGTA	0.458	Q61K(CHP212_AUTONOMIC_GANGLIA)|Q61K(HCC15_LUNG)|Q61K(HS936T_SKIN)|Q61K(HS944T_SKIN)|Q61K(HT1080_SOFT_TISSUE)|Q61K(HUT78_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(M07E_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(NCIH1299_LUNG)|Q61K(NCIH2087_LUNG)|Q61K(OCILY19_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(SKNAS_AUTONOMIC_GANGLIA)|Q61K(SKNSH_AUTONOMIC_GANGLIA)|Q61K(TYKNU_OVARY)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61K			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	610	Substitution - Missense(609)|Complex(1)	skin(372)|haematopoietic_and_lymphoid_tissue(73)|thyroid(55)|NS(29)|large_intestine(28)|soft_tissue(16)|lung(12)|autonomic_ganglia(6)|liver(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|cervix(2)|endometrium(2)|pancreas(2)|meninges(1)|kidney(1)|biliary_tract(1)|stomach(1)|ovary(1)|bone(1)	c.C181A	1						.						180.0	156.0	164.0					1																	115256530		2203	4300	6503	115058053	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.181C>A	1.37:g.115256530G>T	ENSP00000358548:p.Gln61Lys		115058053	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	G	33	5.255564	0.95336	.	.	ENSG00000213281	ENST00000369535	D	0.83506	-1.73	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.91845	0.7419	H	0.95850	3.73	0.80722	D	1	P	0.51791	0.948	P	0.54759	0.76	D	0.93711	0.7024	10	0.62326	D	0.03	.	18.6626	0.91477	0.0:0.0:1.0:0.0	.	61	P01111	RASN_HUMAN	K	61	ENSP00000358548:Q61K	ENSP00000358548:Q61K	Q	-	1	0	NRAS	115058053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.520000	0.98027	2.624000	0.88883	0.655000	0.94253	CAA		0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
UBE2Q1	55585	hgsc.bcm.edu	37	1	154525511	154525511	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr1:154525511T>G	ENST00000292211.4	-	5	805	c.726A>C	c.(724-726)ttA>ttC	p.L242F	UBE2Q1_ENST00000497453.1_5'UTR|UBE2Q1-AS1_ENST00000441613.1_RNA	NM_017582.6	NP_060052.3	Q7Z7E8	UB2Q1_HUMAN	ubiquitin-conjugating enzyme E2Q family member 1	242					embryo implantation (GO:0007566)|fertilization (GO:0009566)|mating behavior (GO:0007617)|prolactin secretion (GO:0070459)|protein ubiquitination (GO:0016567)|reproductive system development (GO:0061458)|suckling behavior (GO:0001967)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)	p.L242F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CACGTACATTTAAGTAATCTT	0.458																																					p.L242F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A726C	1						.						188.0	182.0	184.0					1																	154525511		2203	4300	6503	152792135	SO:0001583	missense	55585	exon5			AJ243666	CCDS1069.1	1q22	2008-05-02	2008-05-02	2005-08-05	ENSG00000160714	ENSG00000160714		"""Ubiquitin-conjugating enzymes E2"""	15698	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2Q (putative)"""	UBE2Q			Standard	NM_017582		Approved	PRO3094, NICE-5	uc001fff.1	Q7Z7E8	OTTHUMG00000037265	ENST00000292211.4:c.726A>C	1.37:g.154525511T>G	ENSP00000292211:p.Leu242Phe		152792135	NM_017582	B4DF92|Q3B841|Q5I0X2|Q6IS04|Q6P7P2|Q96MV4|Q9BVX5|Q9UGL6	Missense_Mutation	SNP	ENST00000292211.4	37	CCDS1069.1	.	.	.	.	.	.	.	.	.	.	T	15.84	2.951290	0.53186	.	.	ENSG00000160714	ENST00000292211	.	.	.	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000003	T	0.36358	0.0964	L	0.52573	1.65	0.47341	D	0.999391	B	0.29085	0.232	B	0.29598	0.104	T	0.46555	-0.9183	9	0.56958	D	0.05	-5.5049	8.9651	0.35872	0.0:0.0824:0.0:0.9176	.	242	Q7Z7E8	UB2Q1_HUMAN	F	242	.	ENSP00000292211:L242F	L	-	3	2	UBE2Q1	152792135	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.869000	0.48444	2.272000	0.75746	0.459000	0.35465	TTA		0.458	UBE2Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090704.1	NM_017582	
PRKCZ	5590	hgsc.bcm.edu	37	1	2082365	2082365	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr1:2082365A>C	ENST00000400921.2	+	6	958	c.275A>C	c.(274-276)gAc>gCc	p.D92A	PRKCZ_ENST00000479263.1_3'UTR|PRKCZ_ENST00000400920.1_Missense_Mutation_p.D92A	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	275	Interaction with SQSTM1. {ECO:0000250}.|OPR.				actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	AAGAAGAATGACCAAATTTAC	0.577																																					p.D275A												.	.	0			c.A824C	1						.						79.0	76.0	77.0					1																	2082365		2203	4300	6503	2072225	SO:0001583	missense	5590	exon9			BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.275A>C	1.37:g.2082365A>C	ENSP00000383712:p.Asp92Ala		2072225	NM_002744	A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Missense_Mutation	SNP	ENST00000400921.2	37	CCDS41229.1	.	.	.	.	.	.	.	.	.	.	A	15.07	2.723672	0.48728	.	.	ENSG00000067606	ENST00000378567;ENST00000400921;ENST00000461106;ENST00000470596;ENST00000400920;ENST00000486681;ENST00000470986;ENST00000497183	T;T;T;T;T;T;T;T	0.25414	1.8;1.8;1.8;1.92;1.8;3.09;3.09;3.09	4.8	3.68	0.42216	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.221723	0.44688	D	0.000427	T	0.21921	0.0528	L	0.41415	1.275	0.51012	D	0.999907	B;B;B	0.25743	0.059;0.133;0.101	B;B;B	0.29663	0.045;0.105;0.072	T	0.04723	-1.0931	10	0.59425	D	0.04	.	9.3228	0.37975	0.9156:0.0:0.0844:0.0	.	171;99;275	E9PCW2;B3KUN5;Q05513	.;.;KPCZ_HUMAN	A	275;92;171;92;92;88;92;88	ENSP00000367830:D275A;ENSP00000383712:D92A;ENSP00000426412:D171A;ENSP00000424228:D92A;ENSP00000383711:D92A;ENSP00000424763:D88A;ENSP00000421219:D92A;ENSP00000422764:D88A	ENSP00000367830:D275A	D	+	2	0	PRKCZ	2072225	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	6.731000	0.74785	0.880000	0.35969	0.482000	0.46254	GAC		0.577	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000098533.3	NM_002744	
TMCC2	9911	hgsc.bcm.edu	37	1	205238939	205238939	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr1:205238939A>T	ENST00000358024.3	+	3	1998	c.1609A>T	c.(1609-1611)Atg>Ttg	p.M537L	TMCC2_ENST00000329800.7_Missense_Mutation_p.M297L|TMCC2_ENST00000495538.1_3'UTR|TMCC2_ENST00000330675.7_Missense_Mutation_p.M312L|TMCC2_ENST00000545499.1_Missense_Mutation_p.M459L	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	537						integral component of membrane (GO:0016021)		p.M537L(1)|p.M312L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GGAGGACTCCATGGAAGACCT	0.582																																					p.M537L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1609T	1						.						123.0	111.0	115.0					1																	205238939		2203	4300	6503	203505562	SO:0001583	missense	9911	exon3			AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.1609A>T	1.37:g.205238939A>T	ENSP00000350718:p.Met537Leu		203505562	NM_014858	A2RRH3|B7Z1P7|Q6ZN09	Missense_Mutation	SNP	ENST00000358024.3	37	CCDS30984.1	.	.	.	.	.	.	.	.	.	.	A	8.407	0.843393	0.16963	.	.	ENSG00000133069	ENST00000358024;ENST00000545499;ENST00000330675;ENST00000329800	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	5.5	1.59	0.23543	.	0.162847	0.64402	N	0.000002	T	0.14399	0.0348	N	0.02403	-0.565	0.42902	D	0.994231	B;B;B;B	0.06786	0.0;0.001;0.001;0.001	B;B;B;B	0.12156	0.002;0.001;0.002;0.007	T	0.11251	-1.0595	10	0.08837	T	0.75	.	7.9786	0.30170	0.6071:0.2657:0.0:0.1272	.	333;297;312;537	Q8IW47;G5E963;B2RAX5;O75069	.;.;.;TMCC2_HUMAN	L	537;459;312;297	ENSP00000350718:M537L;ENSP00000437943:M459L;ENSP00000331842:M312L;ENSP00000329436:M297L	ENSP00000329436:M297L	M	+	1	0	TMCC2	203505562	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.846000	0.48262	0.352000	0.24053	0.459000	0.35465	ATG		0.582	TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090383.1	NM_014858	
PTPRF	5792	hgsc.bcm.edu	37	1	44056664	44056664	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr1:44056664A>C	ENST00000359947.4	+	9	1311	c.971A>C	c.(970-972)gAt>gCt	p.D324A	PTPRF_ENST00000422171.2_5'Flank|PTPRF_ENST00000372413.3_Missense_Mutation_p.D324A|PTPRF_ENST00000372414.3_Missense_Mutation_p.D324A|PTPRF_ENST00000438120.1_Missense_Mutation_p.D324A	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	324	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.D314A(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCTCCGATTGATCTTGTGGTG	0.547																																					p.D324A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A971C	1						.						104.0	102.0	103.0					1																	44056664		2203	4300	6503	43829251	SO:0001583	missense	5792	exon9			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.971A>C	1.37:g.44056664A>C	ENSP00000353030:p.Asp324Ala		43829251	NM_130440	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	.	.	.	.	.	.	.	.	.	.	A	16.08	3.020388	0.54576	.	.	ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.34	5.34	0.76211	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.35805	N	0.002969	T	0.49779	0.1577	L	0.41906	1.305	0.80722	D	1	B;B	0.30511	0.073;0.282	B;B	0.40982	0.059;0.345	T	0.39210	-0.9625	10	0.10636	T	0.68	.	15.6403	0.76993	1.0:0.0:0.0:0.0	.	324;324	P10586-2;P10586	.;PTPRF_HUMAN	A	324	ENSP00000353030:D324A;ENSP00000398822:D324A;ENSP00000361491:D324A;ENSP00000361490:D324A	ENSP00000353030:D324A	D	+	2	0	PTPRF	43829251	0.995000	0.38212	0.995000	0.50966	0.918000	0.54935	2.076000	0.41548	2.172000	0.68678	0.379000	0.24179	GAT		0.547	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
SLC44A5	204962	hgsc.bcm.edu	37	1	75685007	75685007	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr1:75685007G>C	ENST00000370855.5	-	16	1314	c.1201C>G	c.(1201-1203)Cct>Gct	p.P401A	SLC44A5_ENST00000535611.1_Missense_Mutation_p.P271A|SLC44A5_ENST00000370859.3_Missense_Mutation_p.P401A	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	401					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P401A(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						TTGTATACAGGTACCCCCGAT	0.383																																					p.P401A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1201G	1						.						100.0	93.0	95.0					1																	75685007		2203	4300	6503	75457595	SO:0001583	missense	204962	exon16			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1201C>G	1.37:g.75685007G>C	ENSP00000359892:p.Pro401Ala		75457595	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	G	1.997	-0.430447	0.04669	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.23552	1.9;1.9;1.9	5.04	4.08	0.47627	.	0.104481	0.64402	N	0.000003	T	0.08537	0.0212	N	0.25426	0.745	0.47374	D	0.999402	B;B;B;B;B	0.25667	0.047;0.096;0.047;0.131;0.038	B;B;B;B;B	0.34093	0.123;0.163;0.163;0.175;0.075	T	0.04017	-1.0984	10	0.02654	T	1	-11.2995	16.1399	0.81515	0.0:0.1333:0.8667:0.0	.	395;440;401;401;440	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	A	401;440;401;271;394	ENSP00000359896:P401A;ENSP00000359892:P401A;ENSP00000443090:P271A	ENSP00000359892:P401A	P	-	1	0	SLC44A5	75457595	1.000000	0.71417	0.153000	0.22517	0.004000	0.04260	4.371000	0.59523	2.504000	0.84457	0.655000	0.94253	CCT		0.383	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
ADAM15	8751	hgsc.bcm.edu	37	1	155033252	155033252	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr1:155033252G>A	ENST00000356955.2	+	19	2322	c.2221G>A	c.(2221-2223)Ggt>Agt	p.G741S	EFNA3_ENST00000505139.1_5'Flank|ADAM15_ENST00000355956.2_Missense_Mutation_p.G741S|EFNA4_ENST00000368409.3_5'Flank|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000271836.6_Missense_Mutation_p.G741S|ADAM15_ENST00000368410.2_Missense_Mutation_p.G447S|ADAM15_ENST00000449910.2_Missense_Mutation_p.G741S|EFNA3_ENST00000556931.1_5'Flank|ADAM15_ENST00000360674.4_Intron|ADAM15_ENST00000368413.1_Missense_Mutation_p.G447S|ADAM15_ENST00000531455.1_Missense_Mutation_p.G751S|ADAM15_ENST00000359280.4_Missense_Mutation_p.G741S|EFNA4_ENST00000427683.2_5'Flank|ADAM15_ENST00000368412.3_Intron|EFNA4_ENST00000359751.4_5'Flank	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	741					angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			AGCCCAATCTGGTCCCTCTGA	0.612																																					p.G741S												ADAM15,central_nervous_system,brain,Substitution - Missense,-1	.	0			c.G2221A	1						.						88.0	89.0	89.0					1																	155033252		2203	4300	6503	153299876	SO:0001583	missense	8751	exon19			U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.2221G>A	1.37:g.155033252G>A	ENSP00000349436:p.Gly741Ser		153299876	NM_207195	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Missense_Mutation	SNP	ENST00000356955.2	37	CCDS1087.1	.	.	.	.	.	.	.	.	.	.	G	8.030	0.761631	0.15914	.	.	ENSG00000143537	ENST00000356955;ENST00000449910;ENST00000359280;ENST00000355956;ENST00000368410;ENST00000271836;ENST00000368413;ENST00000531455	T;T;T;T;T;T;T;T	0.02032	5.82;5.81;5.82;5.85;4.5;5.82;4.49;5.84	4.78	1.88	0.25563	.	0.904243	0.09227	N	0.831023	T	0.00468	0.0015	N	0.11560	0.145	0.09310	N	1	B;B;B;B;P;P;P;B;P	0.38420	0.301;0.301;0.426;0.426;0.58;0.58;0.58;0.444;0.63	B;B;B;B;B;B;B;B;B	0.42030	0.15;0.15;0.234;0.234;0.373;0.287;0.373;0.206;0.354	T	0.33854	-0.9852	10	0.08599	T	0.76	.	4.0336	0.09719	0.1958:0.0:0.6186:0.1856	.	751;758;741;741;741;741;741;741;738	E9PN65;B7Z390;Q13444-7;Q13444-2;Q13444-4;Q13444-5;Q13444-3;Q13444;Q59GF2	.;.;.;.;.;.;.;ADA15_HUMAN;.	S	741;741;741;741;447;741;447;751	ENSP00000349436:G741S;ENSP00000403843:G741S;ENSP00000352226:G741S;ENSP00000348227:G741S;ENSP00000357395:G447S;ENSP00000271836:G741S;ENSP00000357398:G447S;ENSP00000432927:G751S	ENSP00000271836:G741S	G	+	1	0	ADAM15	153299876	0.000000	0.05858	0.001000	0.08648	0.081000	0.17604	0.348000	0.20031	0.235000	0.21160	0.655000	0.94253	GGT		0.612	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387168.1	NM_003815	
HEATR1	55127	hgsc.bcm.edu	37	1	236734746	236734746	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr1:236734746C>T	ENST00000366582.3	-	28	3967	c.3853G>A	c.(3853-3855)Gtg>Atg	p.V1285M	HEATR1_ENST00000366581.2_Missense_Mutation_p.V1204M	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1285					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.V1285M(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ATCAACTCCACGTTGAACTTC	0.438																																					p.V1285M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3853A	1						.						78.0	78.0	78.0					1																	236734746		2203	4300	6503	234801369	SO:0001583	missense	55127	exon28			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.3853G>A	1.37:g.236734746C>T	ENSP00000355541:p.Val1285Met		234801369	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008119	0.75046	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.67865	-0.23;-0.29	5.36	5.36	0.76844	Armadillo-like helical (1);Armadillo-type fold (1);	0.064498	0.64402	D	0.000007	T	0.67524	0.2902	L	0.43152	1.355	0.80722	D	1	P;D	0.58970	0.898;0.984	B;P	0.47786	0.265;0.557	T	0.69327	-0.5174	10	0.48119	T	0.1	.	19.0871	0.93209	0.0:1.0:0.0:0.0	.	1204;1285	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	M	1285;1204	ENSP00000355541:V1285M;ENSP00000355540:V1204M	ENSP00000355540:V1204M	V	-	1	0	HEATR1	234801369	1.000000	0.71417	0.998000	0.56505	0.942000	0.58702	5.743000	0.68655	2.504000	0.84457	0.585000	0.79938	GTG		0.438	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
OR51B2	79345	hgsc.bcm.edu	37	11	5344906	5344906	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr11:5344906C>T	ENST00000328813.2	-	1	676	c.622G>A	c.(622-624)Gac>Aac	p.D208N	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D208N(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCAGACAGTCTAGGAAGATT	0.398																																					p.D208N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G622A	11						.						68.0	68.0	68.0					11																	5344906		2201	4297	6498	5301482	SO:0001583	missense	79345	exon1			AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.622G>A	11.37:g.5344906C>T	ENSP00000327540:p.Asp208Asn		5301482	NM_033180	Q96RD4	Missense_Mutation	SNP	ENST00000328813.2	37	CCDS31377.1	.	.	.	.	.	.	.	.	.	.	C	13.54	2.266565	0.40095	.	.	ENSG00000184881	ENST00000328813	T	0.37411	1.2	4.28	4.28	0.50868	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40144	U	0.001173	T	0.67230	0.2871	M	0.91300	3.195	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.64976	-0.6280	10	0.87932	D	0	.	15.6397	0.76989	0.0:1.0:0.0:0.0	.	208	Q9Y5P1	O51B2_HUMAN	N	208	ENSP00000327540:D208N	ENSP00000327540:D208N	D	-	1	0	OR51B2	5301482	0.608000	0.26966	0.072000	0.20136	0.355000	0.29361	1.415000	0.34748	2.251000	0.74343	0.644000	0.83932	GAC		0.398	OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142983.1	NM_033180	
SIK3	23387	hgsc.bcm.edu	37	11	116768001	116768001	+	Missense_Mutation	SNP	G	G	T	rs141095523		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr11:116768001G>T	ENST00000292055.4	-	5	510	c.475C>A	c.(475-477)Cag>Aag	p.Q159K	SIK3_ENST00000375288.1_5'UTR|SIK3_ENST00000375300.1_Missense_Mutation_p.Q217K|SIK3_ENST00000542607.1_Missense_Mutation_p.Q159K|SIK3_ENST00000446921.2_Missense_Mutation_p.Q217K|SIK3_ENST00000434315.2_Missense_Mutation_p.Q58K	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	159	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.Q217K(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						TTCAGCAGCTGCCCAGGAGTG	0.428																																					p.Q159K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C475A	11						.	G	LYS/GLN	2,4400	4.2+/-10.8	0,2,2199	72.0	67.0	68.0		475	5.6	1.0	11	dbSNP_134	68	0,8592		0,0,4296	no	missense	SIK3	NM_025164.3	53	0,2,6495	TT,TG,GG		0.0,0.0454,0.0154	possibly-damaging	159/1264	116768001	2,12992	2201	4296	6497	116273211	SO:0001583	missense	23387	exon5			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.475C>A	11.37:g.116768001G>T	ENSP00000292055:p.Gln159Lys		116273211	NM_025164	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	ENST00000292055.4	37	CCDS8379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.115285|5.115285	0.94339|0.94339	4.54E-4|4.54E-4	0.0|0.0	ENSG00000160584|ENSG00000160584	ENST00000445177;ENST00000446921;ENST00000413553|ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315	.|T;T;T;T	.|0.64618	.|-0.11;-0.11;-0.11;-0.11	5.61|5.61	5.61|5.61	0.85477|0.85477	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.39341	.|U	.|0.001389	T|T	0.67031|0.67031	0.2850|0.2850	N|N	0.17922|0.17922	0.545|0.545	0.80722|0.80722	D|D	1|1	.|P;B;D	.|0.71674	.|0.515;0.132;0.998	.|P;B;D	.|0.65684	.|0.479;0.316;0.937	T|T	0.68390|0.68390	-0.5421|-0.5421	5|10	.|0.45353	.|T	.|0.12	.|.	18.3787|18.3787	0.90443|0.90443	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|159;58;159	.|A1A5A8;A1A5A9;Q9Y2K2	.|.;.;SIK3_HUMAN	E|K	210;181;119|217;159;159;58	.|ENSP00000364449:Q217K;ENSP00000292055:Q159K;ENSP00000438108:Q159K;ENSP00000415873:Q58K	.|ENSP00000292055:Q159K	A|Q	-|-	2|1	0|0	SIK3|SIK3	116273211|116273211	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.786000|9.786000	0.99046|0.99046	2.644000|2.644000	0.89710|0.89710	0.650000|0.650000	0.86243|0.86243	GCA|CAG		0.428	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164	
BTNL2	56244	hgsc.bcm.edu	37	6	32363886	32363886	+	Silent	SNP	G	G	A	rs548150573		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr6:32363886G>A	ENST00000374993.1	-	5	1007	c.1008C>T	c.(1006-1008)gaC>gaT	p.D336D	BTNL2_ENST00000544175.1_Silent_p.D59D|BTNL2_ENST00000429232.2_Silent_p.D243D|BTNL2_ENST00000454136.3_Silent_p.D336D|BTNL2_ENST00000540315.1_Silent_p.D126D|HCG23_ENST00000426643.1_RNA|BTNL2_ENST00000374995.3_Silent_p.D242D|BTNL2_ENST00000414363.1_Silent_p.D126D	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	336	Ig-like V-type 3.					integral component of membrane (GO:0016021)		p.D336D(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						GGTACTGCCCGTCGTCCGAAG	0.493													g|||	1	0.000199681	0.0008	0.0	5008	,	,		20171	0.0		0.0	False		,,,				2504	0.0				p.D336D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1008T	6						.						122.0	106.0	112.0					6																	32363886		1510	2709	4219	32471864	SO:0001819	synonymous_variant	56244	exon5			AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.1008C>T	6.37:g.32363886G>A			32471864	NM_019602	A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Silent	SNP	ENST00000374993.1	37																																																																																					0.493	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_019602	
ITPR3	3710	hgsc.bcm.edu	37	6	33630743	33630743	+	Missense_Mutation	SNP	G	G	A	rs560642079		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr6:33630743G>A	ENST00000374316.5	+	10	1974	c.914G>A	c.(913-915)cGc>cAc	p.R305H	ITPR3_ENST00000605930.1_Missense_Mutation_p.R305H			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	305	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.R305H(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GGCTTGTACCGCTTCAAGCAC	0.632													g|||	1	0.000199681	0.0	0.0	5008	,	,		18822	0.0		0.0	False		,,,				2504	0.001				p.R305H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G914A	6						.						78.0	65.0	69.0					6																	33630743		2203	4299	6502	33738721	SO:0001583	missense	3710	exon9			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.914G>A	6.37:g.33630743G>A	ENSP00000363435:p.Arg305His		33738721	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	g	27.8	4.861046	0.91433	.	.	ENSG00000096433	ENST00000374316	D	0.97688	-4.49	5.34	5.34	0.76211	MIR motif (2);MIR (2);	0.000000	0.85682	D	0.000000	D	0.98817	0.9601	M	0.91300	3.195	0.46396	D	0.999029	D	0.89917	1.0	D	0.97110	1.0	D	0.99581	1.0973	10	0.72032	D	0.01	-24.8138	13.3522	0.60607	0.0758:0.0:0.9242:0.0	.	305	Q14573	ITPR3_HUMAN	H	305	ENSP00000363435:R305H	ENSP00000363435:R305H	R	+	2	0	ITPR3	33738721	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.939000	0.87685	2.494000	0.84150	0.306000	0.20318	CGC		0.632	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
MED23	9439	hgsc.bcm.edu	37	6	131939618	131939618	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr6:131939618T>C	ENST00000368068.3	-	9	888	c.709A>G	c.(709-711)Att>Gtt	p.I237V	MED23_ENST00000368058.1_Missense_Mutation_p.I237V|MED23_ENST00000368053.4_Missense_Mutation_p.I237V|MED23_ENST00000354577.4_Missense_Mutation_p.I237V|MED23_ENST00000403834.3_Missense_Mutation_p.I237V|MED23_ENST00000540546.1_Missense_Mutation_p.I237V|MED23_ENST00000368060.3_Missense_Mutation_p.I237V|MED23_ENST00000539158.1_Missense_Mutation_p.I237V	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	237					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)	p.I237V(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		GAATTACAAATGGCACCCGAA	0.358																																					p.I237V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A709G	6						.						96.0	87.0	90.0					6																	131939618		2203	4300	6503	131981311	SO:0001583	missense	9439	exon9			AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.709A>G	6.37:g.131939618T>C	ENSP00000357047:p.Ile237Val		131981311	NM_015979	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Missense_Mutation	SNP	ENST00000368068.3	37	CCDS5147.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.125373	0.56721	.	.	ENSG00000112282	ENST00000354577;ENST00000368068;ENST00000403834;ENST00000368060;ENST00000368058;ENST00000368053;ENST00000540546;ENST00000539158	T;T;T;T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04;-1.04;-1.04;-1.04	5.49	5.49	0.81192	.	0.088496	0.85682	D	0.000000	T	0.43411	0.1246	N	0.03608	-0.345	0.58432	D	0.999999	B;B;B	0.25609	0.026;0.13;0.106	B;B;B	0.25291	0.025;0.059;0.035	T	0.48854	-0.8998	10	0.31617	T	0.26	1.1739	15.5908	0.76526	0.0:0.0:0.0:1.0	.	237;237;237	Q9ULK4-2;Q9ULK4;Q9ULK4-3	.;MED23_HUMAN;.	V	237	ENSP00000346588:I237V;ENSP00000357047:I237V;ENSP00000384536:I237V;ENSP00000357039:I237V;ENSP00000357037:I237V;ENSP00000357032:I237V;ENSP00000437818:I237V;ENSP00000445072:I237V	ENSP00000346588:I237V	I	-	1	0	MED23	131981311	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	8.040000	0.89188	2.088000	0.63022	0.528000	0.53228	ATT		0.358	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1		
PRPF8	10594	hgsc.bcm.edu	37	17	1579906	1579906	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr17:1579906T>G	ENST00000572621.1	-	15	2546	c.2281A>C	c.(2281-2283)Atc>Ctc	p.I761L	PRPF8_ENST00000304992.6_Missense_Mutation_p.I761L			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	761					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CCTCGGCGGATCCGTTCTCGG	0.572																																					p.I761L												.	.	0			c.A2281C	17						.						207.0	215.0	212.0					17																	1579906		2203	4300	6503	1526656	SO:0001583	missense	10594	exon16			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.2281A>C	17.37:g.1579906T>G	ENSP00000460348:p.Ile761Leu		1526656	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.991636	0.74703	.	.	ENSG00000174231	ENST00000304992	D	0.83755	-1.76	6.06	6.06	0.98353	PROCN (1);	0.000000	0.85682	D	0.000000	D	0.89719	0.6796	M	0.92219	3.285	0.80722	D	1	B	0.34349	0.45	B	0.42653	0.394	D	0.90675	0.4601	10	0.87932	D	0	-13.6804	15.1837	0.72982	0.0:0.0:0.0:1.0	.	761	Q6P2Q9	PRP8_HUMAN	L	761	ENSP00000304350:I761L	ENSP00000304350:I761L	I	-	1	0	PRPF8	1526656	1.000000	0.71417	0.996000	0.52242	0.937000	0.57800	8.013000	0.88655	2.322000	0.78497	0.528000	0.53228	ATC		0.572	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
SRR	63826	hgsc.bcm.edu	37	17	2224624	2224624	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr17:2224624G>A	ENST00000344595.5	+	5	742	c.424G>A	c.(424-426)Gtt>Att	p.V142I	SRR_ENST00000576848.1_Intron	NM_021947.1	NP_068766.1	Q9GZT4	SRR_HUMAN	serine racemase	142					aging (GO:0007568)|brain development (GO:0007420)|D-serine biosynthetic process (GO:0070179)|D-serine metabolic process (GO:0070178)|L-serine metabolic process (GO:0006563)|protein homotetramerization (GO:0051289)|pyruvate biosynthetic process (GO:0042866)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|serine family amino acid metabolic process (GO:0009069)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|D-serine ammonia-lyase activity (GO:0008721)|glycine binding (GO:0016594)|L-serine ammonia-lyase activity (GO:0003941)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|serine racemase activity (GO:0030378)|threonine racemase activity (GO:0018114)	p.V142I(1)		NS(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;3.24e-06)|READ - Rectum adenocarcinoma(1115;0.0649)	L-Serine(DB00133)	TGCAAAAAGAGTTACAGAAGA	0.408																																					p.V142I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G424A	17						.						103.0	111.0	108.0					17																	2224624		2203	4300	6503	2171374	SO:0001583	missense	63826	exon5			AF169974	CCDS11017.1	17p13	2007-01-18			ENSG00000167720	ENSG00000167720			14398	protein-coding gene	gene with protein product		606477				17067558, 15953485, 15193426	Standard	NM_021947		Approved	ILV1, ISO1	uc002fue.1	Q9GZT4	OTTHUMG00000090583	ENST00000344595.5:c.424G>A	17.37:g.2224624G>A	ENSP00000339435:p.Val142Ile		2171374	NM_021947	D3DTI5|Q6IA55	Missense_Mutation	SNP	ENST00000344595.5	37	CCDS11017.1	.	.	.	.	.	.	.	.	.	.	G	1.468	-0.560611	0.03939	.	.	ENSG00000167720	ENST00000344595	D	0.96685	-4.09	5.86	1.14	0.20703	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.340712	0.33327	N	0.005024	D	0.86875	0.6038	N	0.05414	-0.055	0.09310	N	1	B	0.02656	0.0	B	0.13407	0.009	T	0.75113	-0.3432	10	0.14252	T	0.57	-4.6367	5.2192	0.15360	0.5453:0.1466:0.3081:0.0	.	142	Q9GZT4	SRR_HUMAN	I	142	ENSP00000339435:V142I	ENSP00000339435:V142I	V	+	1	0	SRR	2171374	0.689000	0.27690	0.778000	0.31720	0.077000	0.17291	1.261000	0.32980	0.117000	0.18138	-0.471000	0.05019	GTT		0.408	SRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207129.2	NM_021947	
MSI2	124540	hgsc.bcm.edu	37	17	55729502	55729502	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr17:55729502T>A	ENST00000284073.2	+	11	979	c.770T>A	c.(769-771)gTg>gAg	p.V257E	MSI2_ENST00000442934.2_Missense_Mutation_p.V196E|MSI2_ENST00000416426.2_Missense_Mutation_p.V235E|MSI2_ENST00000579505.1_3'UTR	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2	257	Poly-Ala.					cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)	p.V257E(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		GCAGCGGCGGTGGCGGCAGCA	0.627			T	HOXA9	CML																																p.V257E			Dom	yes		17	17q23.2	124540	musashi homolog 2 (Drosophila)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T770A	17						.						70.0	69.0	69.0					17																	55729502		2203	4300	6503	53084501	SO:0001583	missense	124540	exon11			BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.770T>A	17.37:g.55729502T>A	ENSP00000284073:p.Val257Glu		53084501	NM_138962	Q7Z6M7|Q8N9T4	Missense_Mutation	SNP	ENST00000284073.2	37	CCDS11596.1	.	.	.	.	.	.	.	.	.	.	T	14.60	2.584198	0.46110	.	.	ENSG00000153944	ENST00000416426;ENST00000284073;ENST00000442934	D;D;D	0.86297	-1.72;-2.1;-2.1	4.92	4.92	0.64577	.	0.062489	0.64402	D	0.000005	D	0.84893	0.5573	N	0.08118	0	0.80722	D	1	D;B	0.61697	0.99;0.136	D;B	0.70487	0.969;0.05	D	0.84706	0.0731	10	0.30078	T	0.28	.	13.1246	0.59346	0.0:0.0:0.0:1.0	.	235;257	B4DHE8;Q96DH6	.;MSI2H_HUMAN	E	235;257;196	ENSP00000414671:V235E;ENSP00000284073:V257E;ENSP00000392607:V196E	ENSP00000284073:V257E	V	+	2	0	MSI2	53084501	1.000000	0.71417	0.988000	0.46212	0.819000	0.46315	7.018000	0.76406	1.841000	0.53522	0.533000	0.62120	GTG		0.627	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441813.1		
TP53	7157	hgsc.bcm.edu	37	17	7578403	7578403	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr17:7578403C>A	ENST00000269305.4	-	5	716	c.527G>T	c.(526-528)tGc>tTc	p.C176F	TP53_ENST00000413465.2_Missense_Mutation_p.C176F|TP53_ENST00000359597.4_Missense_Mutation_p.C176F|TP53_ENST00000445888.2_Missense_Mutation_p.C176F|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.C176F|TP53_ENST00000455263.2_Missense_Mutation_p.C176F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176F(129)|p.C176Y(63)|p.C83F(9)|p.C44F(9)|p.C176S(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C44Y(3)|p.C83Y(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGGGGGCAGCGCCTCAC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C176F	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0	.	267	Substitution - Missense(224)|Deletion - Frameshift(18)|Deletion - In frame(13)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	lung(42)|large_intestine(38)|upper_aerodigestive_tract(36)|oesophagus(26)|breast(26)|liver(20)|ovary(19)|haematopoietic_and_lymphoid_tissue(13)|stomach(10)|central_nervous_system(9)|bone(9)|urinary_tract(7)|genital_tract(2)|skin(2)|pancreas(2)|prostate(2)|adrenal_gland(1)|vulva(1)|biliary_tract(1)|endometrium(1)	c.G527T	17						.						49.0	49.0	49.0					17																	7578403		2203	4300	6503	7519128	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.527G>T	17.37:g.7578403C>A	ENSP00000269305:p.Cys176Phe		7519128	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.433429	0.83776	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.994;0.996;0.998;0.997;0.995;0.997	D	0.96187	0.9135	10	0.87932	D	0	-18.1821	13.8336	0.63395	0.1543:0.8457:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176F;ENSP00000352610:C176F;ENSP00000269305:C176F;ENSP00000398846:C176F;ENSP00000391127:C176F;ENSP00000391478:C176F;ENSP00000425104:C44F;ENSP00000423862:C83F	ENSP00000269305:C176F	C	-	2	0	TP53	7519128	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.775000	0.85489	1.472000	0.48140	0.655000	0.94253	TGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CD300C	10871	hgsc.bcm.edu	37	17	72539058	72539058	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr17:72539058C>A	ENST00000330793.1	-	3	829	c.469G>T	c.(469-471)Gtg>Ttg	p.V157L		NM_006678.3	NP_006669.1	Q08708	CLM6_HUMAN	CD300c molecule	157	Pro-rich.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.V157L(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|skin(2)|upper_aerodigestive_tract(1)	21						CAGGTGTGCACGGGCAGCTTC	0.662																																					p.V157L	Esophageal Squamous(66;421 1121 20537 25337 27468)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G469T	17						.						97.0	84.0	89.0					17																	72539058		2203	4300	6503	70050653	SO:0001583	missense	10871	exon3			BC022279	CCDS11701.1	17q25.2	2014-05-15	2006-03-28		ENSG00000167850	ENSG00000167850		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19320	protein-coding gene	gene with protein product		606786	"""CD300c antigen"""			1349532, 10746781	Standard	NM_006678		Approved	CMRF35, LIR, CMRF-35A, CMRF35A, IGSF16	uc002jky.2	Q08708	OTTHUMG00000067608	ENST00000330793.1:c.469G>T	17.37:g.72539058C>A	ENSP00000329507:p.Val157Leu		70050653	NM_006678		Missense_Mutation	SNP	ENST00000330793.1	37	CCDS11701.1	.	.	.	.	.	.	.	.	.	.	C	8.938	0.965021	0.18583	.	.	ENSG00000167850	ENST00000330793	T	0.03386	3.95	3.32	-1.82	0.07857	.	1.604190	0.04183	N	0.326788	T	0.03220	0.0094	L	0.55481	1.735	0.09310	N	1	P	0.46142	0.873	B	0.33254	0.16	T	0.43829	-0.9367	10	0.27785	T	0.31	.	1.9199	0.03305	0.2109:0.3231:0.3457:0.1203	.	157	Q08708	CLM6_HUMAN	L	157	ENSP00000329507:V157L	ENSP00000329507:V157L	V	-	1	0	CD300C	70050653	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	0.627000	0.24506	-0.258000	0.09446	0.306000	0.20318	GTG		0.662	CD300C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145084.1	NM_006678	
PFAS	5198	hgsc.bcm.edu	37	17	8159851	8159851	+	Silent	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr17:8159851G>A	ENST00000314666.6	+	8	964	c.831G>A	c.(829-831)caG>caA	p.Q277Q	PFAS_ENST00000545834.1_5'UTR	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	277					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)	p.Q277Q(1)		central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	GTGCAATCCAGGGAAAGGAAG	0.597																																					p.Q277Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G831A	17						.						81.0	70.0	73.0					17																	8159851		2203	4300	6503	8100576	SO:0001819	synonymous_variant	5198	exon8			AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.831G>A	17.37:g.8159851G>A			8100576	NM_012393	A6H8V8	Silent	SNP	ENST00000314666.6	37	CCDS11136.1																																																																																				0.597	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2		
RNF213	57674	hgsc.bcm.edu	37	17	78314093	78314093	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr17:78314093G>A	ENST00000582970.1	+	26	6069	c.5926G>A	c.(5926-5928)Gcg>Acg	p.A1976T	RNF213_ENST00000508628.2_Missense_Mutation_p.A2025T|RNF213_ENST00000336301.6_Missense_Mutation_p.A49T	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1976					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GACCCTGTCGGCGGCAGCCGT	0.662																																					p.A2025T												.	.	0			c.G6073A	17						.						36.0	30.0	32.0					17																	78314093		2202	4300	6502	75928688	SO:0001583	missense	57674	exon27			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.5926G>A	17.37:g.78314093G>A	ENSP00000464087:p.Ala1976Thr		75928688	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	9.727	1.161279	0.21538	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.33654	1.4	5.02	4.02	0.46733	.	0.065564	0.64402	N	0.000012	T	0.49575	0.1565	M	0.74258	2.255	0.32731	N	0.509039	D	0.59357	0.985	P	0.53649	0.731	T	0.66040	-0.6022	10	0.66056	D	0.02	.	11.0915	0.48119	0.0:0.1393:0.7162:0.1445	.	49	Q63HN8	RN213_HUMAN	T	1976;2025;49	ENSP00000338218:A49T	ENSP00000338218:A49T	A	+	1	0	RNF213	75928688	1.000000	0.71417	0.045000	0.18777	0.045000	0.14185	5.964000	0.70379	1.276000	0.44395	0.557000	0.71058	GCG		0.662	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
HSF2BP	11077	hgsc.bcm.edu	37	21	44949684	44949684	+	Missense_Mutation	SNP	C	C	T	rs142483325	byFrequency	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr21:44949684C>T	ENST00000291560.2	-	9	1286	c.955G>A	c.(955-957)Gca>Aca	p.A319T	HSF2BP_ENST00000542962.1_Missense_Mutation_p.A244T	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	319					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)		p.A319T(1)		kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		TCCTGGGCTGCGGTTTGCAGG	0.602													C|||	11	0.00219649	0.0083	0.0	5008	,	,		16923	0.0		0.0	False		,,,				2504	0.0				p.A319T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G955A	21						.	C	THR/ALA	22,4384	28.1+/-56.4	0,22,2181	56.0	58.0	57.0		955	3.7	0.0	21	dbSNP_134	57	0,8600		0,0,4300	yes	missense	HSF2BP	NM_007031.1	58	0,22,6481	TT,TC,CC		0.0,0.4993,0.1692	benign	319/335	44949684	22,12984	2203	4300	6503	43774112	SO:0001583	missense	11077	exon9			AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.955G>A	21.37:g.44949684C>T	ENSP00000291560:p.Ala319Thr		43774112	NM_007031	B4DX36	Missense_Mutation	SNP	ENST00000291560.2	37	CCDS13697.1	.	.	.	.	.	.	.	.	.	.	C	5.065	0.197607	0.09652	0.004993	0.0	ENSG00000160207	ENST00000291560;ENST00000542962	T;T	0.69926	-0.44;0.66	5.57	3.68	0.42216	Armadillo-like helical (1);Armadillo-type fold (1);	0.593958	0.18378	N	0.143052	T	0.48892	0.1525	N	0.20986	0.625	0.09310	N	1	B	0.14438	0.01	B	0.13407	0.009	T	0.20571	-1.0271	10	0.23891	T	0.37	-9.924	10.361	0.43994	0.1178:0.6777:0.2045:0.0	.	319	O75031	HSF2B_HUMAN	T	319;244	ENSP00000291560:A319T;ENSP00000443367:A244T	ENSP00000291560:A319T	A	-	1	0	HSF2BP	43774112	0.019000	0.18553	0.013000	0.15412	0.009000	0.06853	0.922000	0.28734	2.633000	0.89246	0.563000	0.77884	GCA		0.602	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195620.1	NM_007031	
MCM3AP	8888	hgsc.bcm.edu	37	21	47692566	47692566	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr21:47692566C>T	ENST00000397708.1	-	9	2628	c.2374G>A	c.(2374-2376)Gac>Aac	p.D792N	MCM3AP_ENST00000291688.1_Missense_Mutation_p.D792N			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	792	SAC3 homology.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					TTTCTCAGGTCCTGGTACATC	0.498																																					p.D792N												.	.	0			c.G2374A	21						.						189.0	166.0	173.0					21																	47692566		2203	4300	6503	46516994	SO:0001583	missense	8888	exon8			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.2374G>A	21.37:g.47692566C>T	ENSP00000380820:p.Asp792Asn		46516994	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150376	0.78001	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.34072	1.38;1.38	5.93	5.93	0.95920	.	0.087185	0.85682	D	0.000000	T	0.70780	0.3263	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76211	-0.3042	10	0.87932	D	0	-20.3176	20.3539	0.98825	0.0:1.0:0.0:0.0	.	792	O60318	MCM3A_HUMAN	N	792	ENSP00000380820:D792N;ENSP00000291688:D792N	ENSP00000291688:D792N	D	-	1	0	MCM3AP	46516994	1.000000	0.71417	0.997000	0.53966	0.015000	0.08874	7.559000	0.82265	2.826000	0.97356	0.655000	0.94253	GAC		0.498	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
PRKCB	5579	hgsc.bcm.edu	37	16	23999852	23999852	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr16:23999852C>T	ENST00000321728.7	+	3	404	c.229C>T	c.(229-231)Cgg>Tgg	p.R77W	PRKCB_ENST00000303531.7_Missense_Mutation_p.R77W	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	77					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.R77W(2)		central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	GGTGCACAAGCGGTGCCATGA	0.512																																					p.R77W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C229T	16						.						146.0	129.0	135.0					16																	23999852		2197	4300	6497	23907353	SO:0001583	missense	5579	exon3			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.229C>T	16.37:g.23999852C>T	ENSP00000318315:p.Arg77Trp		23907353	NM_212535	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	37	CCDS10618.1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896414	0.72639	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	D;D	0.93811	-3.29;-3.29	5.58	2.08	0.27032	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.97362	0.9137	H	0.94222	3.51	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98113	1.0421	10	0.87932	D	0	.	14.5598	0.68128	0.2633:0.7367:0.0:0.0	.	77;77	P05771-2;P05771	.;KPCB_HUMAN	W	77	ENSP00000318315:R77W;ENSP00000305355:R77W	ENSP00000305355:R77W	R	+	1	2	PRKCB	23907353	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	0.504000	0.22626	0.653000	0.30826	0.561000	0.74099	CGG		0.512	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535	
SLX4	84464	hgsc.bcm.edu	37	16	3647834	3647834	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr16:3647834C>G	ENST00000294008.3	-	6	1970	c.1330G>C	c.(1330-1332)Gaa>Caa	p.E444Q		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	444	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						AAGGCACTTTCCAGCCTGAGC	0.622								Direct reversal of damage																													p.E444Q												.	.	0			c.G1330C	16						.						67.0	64.0	65.0					16																	3647834		2197	4300	6497	3587835	SO:0001583	missense	84464	exon6			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1330G>C	16.37:g.3647834C>G	ENSP00000294008:p.Glu444Gln		3587835	NM_032444	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	C	11.81	1.751145	0.31046	.	.	ENSG00000188827	ENST00000294008	T	0.19806	2.12	4.95	3.99	0.46301	.	0.807356	0.10928	N	0.618712	T	0.23330	0.0564	L	0.39898	1.24	0.09310	N	1	P	0.50272	0.933	P	0.46479	0.518	T	0.09058	-1.0692	10	0.14656	T	0.56	.	14.5248	0.67881	0.0:0.8531:0.1469:0.0	.	444	Q8IY92	SLX4_HUMAN	Q	444	ENSP00000294008:E444Q	ENSP00000294008:E444Q	E	-	1	0	SLX4	3587835	0.045000	0.20229	0.226000	0.23910	0.262000	0.26303	2.646000	0.46630	1.052000	0.40392	0.655000	0.94253	GAA		0.622	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
ORAI3	93129	hgsc.bcm.edu	37	16	30965080	30965080	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr16:30965080G>A	ENST00000318663.4	+	2	1027	c.803G>A	c.(802-804)cGc>cAc	p.R268H	ORAI3_ENST00000566237.1_Intron|ORAI3_ENST00000562699.1_Intron|AC135048.13_ENST00000566056.1_RNA	NM_152288.2	NP_689501.1	Q9BRQ5	ORAI3_HUMAN	ORAI calcium release-activated calcium modulator 3	268					store-operated calcium entry (GO:0002115)	integral component of membrane (GO:0016021)		p.R268H(1)		endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	6						CATTTCTACCGCTCCTTGGTG	0.607											OREG0023742	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R268H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G803A	16						.						45.0	48.0	47.0					16																	30965080		2197	4300	6497	30872581	SO:0001583	missense	93129	exon2			BC006126	CCDS10697.1	16p11.2	2007-08-14	2007-08-14	2007-08-14	ENSG00000175938	ENSG00000175938		"""ORAI calcium release-activated calcium modulators"""	28185	protein-coding gene	gene with protein product		610930	"""transmembrane protein 142C"""	TMEM142C		16582901	Standard	NM_152288		Approved	MGC13024	uc002eac.3	Q9BRQ5	OTTHUMG00000132409	ENST00000318663.4:c.803G>A	16.37:g.30965080G>A	ENSP00000322249:p.Arg268His	821	30872581	NM_152288	Q96BI8	Missense_Mutation	SNP	ENST00000318663.4	37	CCDS10697.1	.	.	.	.	.	.	.	.	.	.	g	24.8	4.568187	0.86439	.	.	ENSG00000175938	ENST00000318663	T	0.51071	0.72	5.64	5.64	0.86602	.	0.000000	0.56097	D	0.000030	T	0.61961	0.2389	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.60000	-0.7348	10	0.48119	T	0.1	-13.5466	18.5037	0.90890	0.0:0.0:1.0:0.0	.	268	Q9BRQ5	ORAI3_HUMAN	H	268	ENSP00000322249:R268H	ENSP00000322249:R268H	R	+	2	0	ORAI3	30872581	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.639000	0.74314	2.673000	0.90976	0.645000	0.84053	CGC		0.607	ORAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255545.20	NM_152288	
QARS	5859	hgsc.bcm.edu	37	3	49136341	49136341	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr3:49136341T>C	ENST00000306125.6	-	19	2177	c.1840A>G	c.(1840-1842)Att>Gtt	p.I614V	QARS_ENST00000414533.1_Missense_Mutation_p.I603V|QARS_ENST00000470225.1_5'Flank			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	614					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)	p.I614V(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	GTCCTCTCAATGAAGACAATG	0.522																																					p.I614V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1840G	3						.						101.0	100.0	101.0					3																	49136341		2203	4300	6503	49111345	SO:0001583	missense	5859	exon19			X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.1840A>G	3.37:g.49136341T>C	ENSP00000307567:p.Ile614Val		49111345	NM_005051	B4DWJ2	Missense_Mutation	SNP	ENST00000306125.6	37	CCDS2788.1	.	.	.	.	.	.	.	.	.	.	T	31	5.104496	0.94245	.	.	ENSG00000172053	ENST00000453392;ENST00000306125;ENST00000414533	T;T	0.40225	1.04;1.05	5.88	5.88	0.94601	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain (1);Ribosomal protein L25/Gln-tRNA synthetase, beta-barrel domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, anti-codon binding domain (1);	0.133094	0.64402	D	0.000002	T	0.62672	0.2447	M	0.87758	2.905	0.80722	D	1	P;P	0.38129	0.619;0.619	P;P	0.48304	0.573;0.573	T	0.68243	-0.5460	10	0.87932	D	0	-3.3709	16.2987	0.82793	0.0:0.0:0.0:1.0	.	603;614	B4DWJ2;P47897	.;SYQ_HUMAN	V	134;614;603	ENSP00000307567:I614V;ENSP00000390015:I603V	ENSP00000307567:I614V	I	-	1	0	QARS	49111345	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.498000	0.81546	2.257000	0.74773	0.459000	0.35465	ATT		0.522	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051	
GNL3	26354	hgsc.bcm.edu	37	3	52727258	52727258	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr3:52727258T>C	ENST00000418458.1	+	11	1273	c.1100T>C	c.(1099-1101)gTg>gCg	p.V367A	SNORD69_ENST00000391150.1_RNA|GNL3_ENST00000394799.2_Missense_Mutation_p.V355A|SNORD19B_ENST00000459623.1_RNA|GLT8D1_ENST00000463827.1_5'Flank|SNORD19_ENST00000410413.1_RNA	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)	367	Intermediate. {ECO:0000250}.		V -> M (in dbSNP:rs2289247). {ECO:0000269|PubMed:11085516, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16012751, ECO:0000269|PubMed:21269460}.		cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.V367A(1)		breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		TTTTTTACTGTGCTTGCTCAG	0.423																																					p.V355A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1064C	3						.						116.0	124.0	121.0					3																	52727258		2203	4300	6503	52702298	SO:0001583	missense	26354	exon11			AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.1100T>C	3.37:g.52727258T>C	ENSP00000395772:p.Val367Ala		52702298	NM_206825	B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Missense_Mutation	SNP	ENST00000418458.1	37	CCDS2861.1	.	.	.	.	.	.	.	.	.	.	T	12.32	1.903078	0.33628	.	.	ENSG00000163938	ENST00000418458;ENST00000394799	T;T	0.29397	1.57;1.57	6.0	-8.3	0.01005	.	1.319570	0.04466	N	0.375284	T	0.08223	0.0205	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22347	-1.0219	10	0.06625	T	0.88	.	5.9852	0.19430	0.2445:0.384:0.0:0.3715	.	367	Q9BVP2	GNL3_HUMAN	A	367;355	ENSP00000395772:V367A;ENSP00000378278:V355A	ENSP00000378278:V355A	V	+	2	0	GNL3	52702298	0.000000	0.05858	0.000000	0.03702	0.863000	0.49368	0.126000	0.15769	-1.760000	0.01312	-0.336000	0.08194	GTG		0.423	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352032.1	NM_014366	
LAMP3	27074	hgsc.bcm.edu	37	3	182871826	182871826	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr3:182871826G>A	ENST00000265598.3	-	2	658	c.403C>T	c.(403-405)Cca>Tca	p.P135S	LAMP3_ENST00000466939.1_Missense_Mutation_p.P111S	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	135	Thr-rich.				cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)		p.P135S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			ATGGTGGGTGGCAGTGAATAA	0.547																																					p.P135S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C403T	3						.						311.0	309.0	309.0					3																	182871826		2203	4300	6503	184354520	SO:0001583	missense	27074	exon2			AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.403C>T	3.37:g.182871826G>A	ENSP00000265598:p.Pro135Ser		184354520	NM_014398	D3DNS4|O94781|Q8NEC8	Missense_Mutation	SNP	ENST00000265598.3	37	CCDS3242.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.524754	0.27299	.	.	ENSG00000078081	ENST00000265598;ENST00000466939;ENST00000476015;ENST00000470251	T;T;T;T	0.50277	1.49;1.49;0.76;0.75	5.44	-4.09	0.03951	.	0.734252	0.12107	N	0.498900	T	0.33323	0.0859	M	0.68317	2.08	0.09310	N	1	B	0.14012	0.009	B	0.18871	0.023	T	0.33523	-0.9865	10	0.21014	T	0.42	-0.6562	0.6169	0.00771	0.3918:0.1271:0.2235:0.2576	.	135	Q9UQV4	LAMP3_HUMAN	S	135;111;135;111	ENSP00000265598:P135S;ENSP00000418912:P111S;ENSP00000419059:P135S;ENSP00000420589:P111S	ENSP00000265598:P135S	P	-	1	0	LAMP3	184354520	0.002000	0.14202	0.000000	0.03702	0.008000	0.06430	0.413000	0.21148	-0.324000	0.08589	-0.169000	0.13324	CCA		0.547	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350863.1		
IPO8	10526	hgsc.bcm.edu	37	12	30792667	30792667	+	Silent	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr12:30792667G>A	ENST00000256079.4	-	21	2609	c.2271C>T	c.(2269-2271)tgC>tgT	p.C757C	IPO8_ENST00000544829.1_Silent_p.C552C	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	757					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)	p.C757C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					AGAGTGGAATGCACTAGAAGA	0.408																																					p.C757C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2271T	12						.						76.0	73.0	74.0					12																	30792667		2203	4300	6503	30683934	SO:0001819	synonymous_variant	10526	exon21			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2271C>T	12.37:g.30792667G>A			30683934	NM_006390	B7Z7M3	Silent	SNP	ENST00000256079.4	37	CCDS8719.1																																																																																				0.408	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
PDZRN4	29951	hgsc.bcm.edu	37	12	41966808	41966808	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr12:41966808G>A	ENST00000402685.2	+	10	2235	c.2227G>A	c.(2227-2229)Gag>Aag	p.E743K	PDZRN4_ENST00000539469.2_Missense_Mutation_p.E485K|PDZRN4_ENST00000298919.7_Missense_Mutation_p.E483K	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	743							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E485K(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CAACACAGCTGAGAGCTGCAG	0.458																																					p.E743K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2227A	12						.						107.0	105.0	106.0					12																	41966808		2203	4300	6503	40253075	SO:0001583	missense	29951	exon10			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2227G>A	12.37:g.41966808G>A	ENSP00000384197:p.Glu743Lys		40253075	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.882109	0.91740	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	D;T;T	0.83419	-1.72;2.82;2.8	4.99	4.99	0.66335	.	0.081432	0.50627	D	0.000102	D	0.92479	0.7612	M	0.86953	2.85	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.991;0.994	D	0.93428	0.6783	10	0.87932	D	0	-32.5336	19.1701	0.93574	0.0:0.0:1.0:0.0	.	743;483;485	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	K	743;485;483	ENSP00000384197:E743K;ENSP00000439990:E485K;ENSP00000298919:E483K	ENSP00000298919:E483K	E	+	1	0	PDZRN4	40253075	1.000000	0.71417	0.914000	0.36105	0.978000	0.69477	9.813000	0.99286	2.706000	0.92434	0.650000	0.86243	GAG		0.458	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
ERBB3	2065	hgsc.bcm.edu	37	12	56481368	56481368	+	Silent	SNP	C	C	A	rs372292404		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr12:56481368C>A	ENST00000267101.3	+	5	995	c.555C>A	c.(553-555)ccC>ccA	p.P185P	ERBB3_ENST00000415288.2_Silent_p.P126P|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	185					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.P185P(1)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CAGGTCCCCCCTGTCATGAGG	0.512																																					p.P185P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C555A	12						.	C		0,4406		0,0,2203	112.0	103.0	106.0		555	-4.4	0.3	12		106	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ERBB3	NM_001982.3		0,1,6502	AA,AC,CC		0.0116,0.0,0.0077		185/1343	56481368	1,13005	2203	4300	6503	54767635	SO:0001819	synonymous_variant	2065	exon5			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.555C>A	12.37:g.56481368C>A			54767635	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Silent	SNP	ENST00000267101.3	37	CCDS31833.1																																																																																				0.512	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
SHMT2	6472	hgsc.bcm.edu	37	12	57626246	57626246	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr12:57626246G>T	ENST00000328923.3	+	6	1057	c.605G>T	c.(604-606)gGc>gTc	p.G202V	SHMT2_ENST00000553474.1_Missense_Mutation_p.G181V|SHMT2_ENST00000393827.4_Missense_Mutation_p.G106V|SHMT2_ENST00000449049.3_Missense_Mutation_p.G181V|SHMT2_ENST00000414700.3_Missense_Mutation_p.G181V|SHMT2_ENST00000557487.1_Intron|SHMT2_ENST00000554600.1_3'UTR	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	202					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	CCCAAAACTGGCCTCATTGAC	0.582																																					p.G181V	Esophageal Squamous(150;1369 2416 49071 49364)											.	.	0			c.G542T	12						.						103.0	101.0	102.0					12																	57626246		2203	4300	6503	55912513	SO:0001583	missense	6472	exon6			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.605G>T	12.37:g.57626246G>T	ENSP00000333667:p.Gly202Val		55912513	NM_001166359	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	37	CCDS8934.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.657825|4.657825	0.88154|0.88154	.|.	.|.	ENSG00000182199|ENSG00000182199	ENST00000328923;ENST00000555634;ENST00000414700;ENST00000553474;ENST00000554975;ENST00000449049;ENST00000393827|ENST00000557529	T;T;T;T;T;T;T|.	0.49720|.	0.77;0.77;0.77;0.77;0.77;0.77;0.77|.	4.82|4.82	4.82|4.82	0.62117|0.62117	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88373|0.88373	0.6419|0.6419	H|H	0.97265|0.97265	3.97|3.97	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0|.	D|D	0.92307|0.92307	0.5854|0.5854	10|5	0.87932|.	D|.	0|.	-8.03|-8.03	17.2132|17.2132	0.86936|0.86936	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	211;106;133;202|.	B4DWA7;B4DLV4;B4DP88;P34897|.	.;.;.;GLYM_HUMAN|.	V|C	202;41;181;181;181;181;106|1	ENSP00000333667:G202V;ENSP00000450930:G41V;ENSP00000406881:G181V;ENSP00000452419:G181V;ENSP00000452404:G181V;ENSP00000413770:G181V;ENSP00000377413:G106V|.	ENSP00000333667:G202V|.	G|W	+|+	2|3	0|0	SHMT2|SHMT2	55912513|55912513	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.881000|0.881000	0.50899|0.50899	7.702000|7.702000	0.84576|0.84576	2.667000|2.667000	0.90743|0.90743	0.563000|0.563000	0.77884|0.77884	GGC|TGG		0.582	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
SHMT2	6472	hgsc.bcm.edu	37	12	57626605	57626605	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr12:57626605A>T	ENST00000328923.3	+	7	1288	c.836A>T	c.(835-837)cAc>cTc	p.H279L	SHMT2_ENST00000553474.1_Missense_Mutation_p.H258L|SHMT2_ENST00000393827.4_Missense_Mutation_p.H183L|SHMT2_ENST00000449049.3_Missense_Mutation_p.H258L|SHMT2_ENST00000414700.3_Missense_Mutation_p.H258L|SHMT2_ENST00000557487.1_Missense_Mutation_p.H269L	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	279					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	ACCACTACTCACAAGACTCTT	0.617																																					p.H258L	Esophageal Squamous(150;1369 2416 49071 49364)											.	.	0			c.A773T	12						.						81.0	68.0	72.0					12																	57626605		2203	4300	6503	55912872	SO:0001583	missense	6472	exon7			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.836A>T	12.37:g.57626605A>T	ENSP00000333667:p.His279Leu		55912872	NM_001166359	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	37	CCDS8934.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.185724	0.57909	.	.	ENSG00000182199	ENST00000328923;ENST00000557487;ENST00000555634;ENST00000414700;ENST00000553474;ENST00000449049;ENST00000393827	T;T;T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26;0.26;0.26	4.97	3.79	0.43588	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.052974	0.85682	D	0.000000	D	0.82765	0.5108	H	0.97707	4.06	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0	D	0.86588	0.1858	10	0.87932	D	0	-3.2599	11.2078	0.48780	0.846:0.154:0.0:0.0	.	288;269;183;210;279	B4DWA7;Q8N1A5;B4DLV4;B4DP88;P34897	.;.;.;.;GLYM_HUMAN	L	279;269;118;258;258;258;183	ENSP00000333667:H279L;ENSP00000452315:H269L;ENSP00000450930:H118L;ENSP00000406881:H258L;ENSP00000452419:H258L;ENSP00000413770:H258L;ENSP00000377413:H183L	ENSP00000333667:H279L	H	+	2	0	SHMT2	55912872	1.000000	0.71417	1.000000	0.80357	0.023000	0.10783	9.139000	0.94554	0.988000	0.38734	0.460000	0.39030	CAC		0.617	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
DUSP6	1848	hgsc.bcm.edu	37	12	89743038	89743038	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr12:89743038G>A	ENST00000279488.7	-	3	2370	c.1139C>T	c.(1138-1140)tCt>tTt	p.S380F	DUSP6_ENST00000547291.1_Missense_Mutation_p.S255F|DUSP6_ENST00000308385.6_Missense_Mutation_p.S234F|DUSP6_ENST00000547140.1_5'Flank	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	380	Tyrosine-protein phosphatase.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)	p.S380F(2)		large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						CTTTCACGTAGATTGCAGAGA	0.542																																					p.S234F	Colon(132;3456 5224)											.	.	2	Substitution - Missense(2)	large_intestine(1)|skin(1)	c.C701T	12						.						125.0	123.0	124.0					12																	89743038		2203	4300	6503	88267169	SO:0001583	missense	1848	exon2			BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.1139C>T	12.37:g.89743038G>A	ENSP00000279488:p.Ser380Phe		88267169	NM_022652	O75109|Q53Y75|Q9BSH6	Missense_Mutation	SNP	ENST00000279488.7	37	CCDS9033.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.161745	0.57368	.	.	ENSG00000139318	ENST00000279488;ENST00000308385;ENST00000547291	T;T;T	0.08282	4.12;3.11;3.96	5.98	5.98	0.97165	.	0.098651	0.64402	D	0.000001	T	0.23330	0.0564	L	0.36672	1.1	0.80722	D	1	D;P	0.69078	0.997;0.593	D;B	0.78314	0.991;0.085	T	0.00097	-1.2072	10	0.62326	D	0.03	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	234;380	Q16828-2;Q16828	.;DUS6_HUMAN	F	380;234;255	ENSP00000279488:S380F;ENSP00000307835:S234F;ENSP00000449838:S255F	ENSP00000279488:S380F	S	-	2	0	DUSP6	88267169	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.970000	0.88000	2.835000	0.97688	0.650000	0.86243	TCT		0.542	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	NM_001946, NM_022652	
TCHP	84260	hgsc.bcm.edu	37	12	110352295	110352295	+	Nonsense_Mutation	SNP	C	C	T	rs141600308		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr12:110352295C>T	ENST00000312777.5	+	11	1397	c.1183C>T	c.(1183-1185)Cga>Tga	p.R395*	TCHP_ENST00000405876.4_Nonsense_Mutation_p.R395*	NM_032300.4	NP_115676.1			trichoplein, keratin filament binding									p.R395*(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(2)	22						TGAGCAGAACCGACGGGCACA	0.483																																					p.R395X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1183T	12						.	C	stop/ARG,stop/ARG	0,4406		0,0,2203	99.0	96.0	97.0		1183,1183	4.4	1.0	12	dbSNP_134	97	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained	TCHP	NM_001143852.1,NM_032300.4	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	395/499,395/499	110352295	1,13005	2203	4300	6503	108836678	SO:0001587	stop_gained	84260	exon11			AK092736	CCDS9137.1	12q24.11	2011-08-25	2006-01-27			ENSG00000139437			28135	protein-coding gene	gene with protein product	"""mitostatin"""	612654				15731013, 20930847	Standard	NM_032300		Approved	MGC10854, TpMs	uc001tpn.3	Q9BT92		ENST00000312777.5:c.1183C>T	12.37:g.110352295C>T	ENSP00000324404:p.Arg395*		108836678	NM_001143852		Nonsense_Mutation	SNP	ENST00000312777.5	37	CCDS9137.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947589	0.73787	0.0	1.16E-4	ENSG00000139437	ENST00000405876;ENST00000312777;ENST00000551627	.	.	.	5.3	4.4	0.53042	.	0.139185	0.45361	D	0.000372	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.1728	13.1243	0.59344	0.1613:0.8387:0.0:0.0	.	.	.	.	X	395;395;39	.	ENSP00000324404:R395X	R	+	1	2	TCHP	108836678	0.997000	0.39634	0.979000	0.43373	0.968000	0.65278	0.994000	0.29693	1.226000	0.43582	0.561000	0.74099	CGA		0.483	TCHP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403289.1	NM_032300	
GPC3	2719	hgsc.bcm.edu	37	X	132826435	132826435	+	Silent	SNP	G	G	A	rs150766741		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chrX:132826435G>A	ENST00000370818.3	-	5	1699	c.1254C>T	c.(1252-1254)aaC>aaT	p.N418N	GPC3_ENST00000543339.1_Silent_p.N364N|GPC3_ENST00000394299.2_Silent_p.N441N	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	418					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)	p.N418N(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					AAAGGGTGTCGTTTTCCGCCA	0.388			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome				G|||	2	0.000529801	0.0015	0.0	3775	,	,		12910	0.0		0.0	False		,,,				2504	0.0				p.N402N		yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1206T	X						.	G	,,,	3,3832		0,2,1,1630,570	100.0	92.0	94.0		1323,1206,1092,1254	-5.9	0.9	X	dbSNP_134	94	3,6725		0,3,0,2425,1872	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	GPC3	NM_001164617.1,NM_001164618.1,NM_001164619.1,NM_004484.3	,,,	0,5,1,4055,2442	AA,AG,A,GG,G		0.0446,0.0782,0.0568	,,,	441/604,402/565,364/527,418/581	132826435	6,10557	2203	4300	6503	132654101	SO:0001819	synonymous_variant	2719	exon5	Familial Cancer Database	SGBS	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.1254C>T	X.37:g.132826435G>A			132654101	NM_001164618	C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	ENST00000370818.3	37	CCDS14638.1	3	0.0018083182640144665	2	0.004081632653061225	0	0.0	0	0.0	0	0.0	g	7.591	0.670714	0.14776	7.82E-4	4.46E-4	ENSG00000147257	ENST00000406757	.	.	.	5.07	-5.88	0.02290	.	.	.	.	.	T	0.54822	0.1882	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57866	-0.7737	4	.	.	.	.	12.3276	0.55020	0.7345:0.0:0.2655:0.0	.	.	.	.	M	148	.	.	T	-	2	0	GPC3	132654101	0.165000	0.22948	0.942000	0.38095	0.991000	0.79684	-0.923000	0.04000	-1.222000	0.02587	-0.513000	0.04457	ACG		0.388	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484	
PTCHD1	139411	hgsc.bcm.edu	37	X	23412188	23412188	+	Silent	SNP	C	C	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chrX:23412188C>T	ENST00000379361.4	+	3	3413	c.2553C>T	c.(2551-2553)ccC>ccT	p.P851P		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	851					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)	p.P746P(1)		NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						TCCTGCCACCCTCTAAGAAAA	0.408																																					p.P851P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2553T	X						.						102.0	102.0	102.0					X																	23412188		2203	4300	6503	23322109	SO:0001819	synonymous_variant	139411	exon3			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.2553C>T	X.37:g.23412188C>T			23322109	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Silent	SNP	ENST00000379361.4	37	CCDS35215.2																																																																																				0.408	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
ZNF41	7592	hgsc.bcm.edu	37	X	47307383	47307383	+	Missense_Mutation	SNP	C	C	T	rs555581955		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chrX:47307383C>T	ENST00000377065.4	-	5	2425	c.1786G>A	c.(1786-1788)Gtg>Atg	p.V596M	ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000397050.2_Missense_Mutation_p.V606M|ZNF41_ENST00000313116.7_Missense_Mutation_p.V596M	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	638					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V596M(1)		breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				CTCTGATGCACGCTTAGTGTT	0.453																																					p.V596M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1786A	X						.						92.0	71.0	78.0					X																	47307383		2203	4300	6503	47192327	SO:0001583	missense	7592	exon5			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.1786G>A	X.37:g.47307383C>T	ENSP00000366265:p.Val596Met		47192327	NM_153380	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	ENST00000377065.4	37	CCDS14279.1	.	.	.	.	.	.	.	.	.	.	C	6.154	0.396537	0.11638	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.18338	2.22;2.22;2.22	3.98	3.11	0.35812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.32147	N	0.006510	T	0.08626	0.0214	N	0.25201	0.72	0.09310	N	1	P;P;B;P;P	0.47910	0.741;0.741;0.223;0.88;0.902	B;B;B;B;B	0.37239	0.112;0.112;0.014;0.157;0.244	T	0.24154	-1.0168	10	0.66056	D	0.02	.	4.3239	0.11031	0.2226:0.6575:0.0:0.1199	.	596;598;606;630;638	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	M	596;596;606	ENSP00000315173:V596M;ENSP00000366265:V596M;ENSP00000380243:V606M	ENSP00000315173:V596M	V	-	1	0	ZNF41	47192327	0.000000	0.05858	0.206000	0.23566	0.958000	0.62258	-0.956000	0.03865	1.042000	0.40150	0.600000	0.82982	GTG		0.453	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056429.1	NM_153380	
RBMX	27316	hgsc.bcm.edu	37	X	135956467	135956467	+	Missense_Mutation	SNP	C	C	T	rs35899675		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chrX:135956467C>T	ENST00000320676.7	-	9	1164	c.1010G>A	c.(1009-1011)aGt>aAt	p.S337N	RBMX_ENST00000496459.2_5'Flank|RBMX_ENST00000565438.1_Missense_Mutation_p.S209N|RBMX_ENST00000562646.1_3'UTR|RBMX_ENST00000570135.1_Missense_Mutation_p.S202N|RBMX_ENST00000431446.3_Intron	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	337	Necessary for RNA-binding.				cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S337N(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					ATCACGACCACTTGAGTAGAG	0.527																																					p.S337N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1010A	X						.						126.0	116.0	119.0					X																	135956467		2203	4300	6503	135784133	SO:0001583	missense	27316	exon9				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.1010G>A	X.37:g.135956467C>T	ENSP00000359645:p.Ser337Asn		135784133	NM_002139	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Missense_Mutation	SNP	ENST00000320676.7	37	CCDS14661.1	.	.	.	.	.	.	.	.	.	.	.	14.40	2.523817	0.44866	.	.	ENSG00000147274	ENST00000320676;ENST00000449161	T	0.77229	-1.08	5.4	5.4	0.78164	.	0.134440	0.49916	U	0.000121	D	0.83959	0.5367	L	0.43152	1.355	0.23661	P	0.99717437	D	0.57899	0.981	D	0.67900	0.954	D	0.83628	0.0143	9	0.44086	T	0.13	.	18.4308	0.90624	0.0:1.0:0.0:0.0	rs55701431	337	P38159	HNRPG_HUMAN	N	337;324	ENSP00000359645:S337N	ENSP00000359645:S337N	S	-	2	0	RBMX	135784133	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.933000	0.63484	2.380000	0.81148	0.600000	0.82982	AGT		0.527	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139	
CHRNA1	1134	hgsc.bcm.edu	37	2	175613340	175613340	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr2:175613340C>G	ENST00000261007.5	-	9	1351	c.1285G>C	c.(1285-1287)Gag>Cag	p.E429Q	CHRNA1_ENST00000348749.5_Missense_Mutation_p.E404Q|CHRNA1_ENST00000409219.1_Intron|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Missense_Mutation_p.E322Q	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	429					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)	p.E429Q(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	TTCATGGTCTCTGCGATGTAC	0.502											OREG0015079	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E404Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1210C	2						.						119.0	106.0	111.0					2																	175613340		2203	4300	6503	175321586	SO:0001583	missense	1134	exon8			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.1285G>C	2.37:g.175613340C>G	ENSP00000261007:p.Glu429Gln	1924	175321586	NM_000079	B4DRV6|D3DPE8	Missense_Mutation	SNP	ENST00000261007.5	37	CCDS33331.1	.	.	.	.	.	.	.	.	.	.	c	19.68	3.872971	0.72180	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542	D;D;D	0.82619	-1.63;-1.63;-1.63	5.5	5.5	0.81552	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.133714	0.64402	D	0.000002	D	0.86518	0.5952	L	0.45137	1.4	0.80722	D	1	D;B	0.64830	0.994;0.001	P;B	0.61722	0.893;0.026	T	0.81936	-0.0705	10	0.18276	T	0.48	.	19.771	0.96366	0.0:1.0:0.0:0.0	.	404;429	Q53SH4;P02708	.;ACHA_HUMAN	Q	404;429;322	ENSP00000261008:E404Q;ENSP00000261007:E429Q;ENSP00000387026:E322Q	ENSP00000261007:E429Q	E	-	1	0	CHRNA1	175321586	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.773000	0.85462	2.742000	0.94016	0.651000	0.88453	GAG		0.502	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1		
HECW2	57520	hgsc.bcm.edu	37	2	197085594	197085594	+	Silent	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr2:197085594G>A	ENST00000260983.3	-	25	4400	c.4218C>T	c.(4216-4218)atC>atT	p.I1406I	HECW2_ENST00000409111.1_Silent_p.I1050I	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1406	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.I1406I(1)		biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CCATCCTCTCGATGTACTCCT	0.433																																					p.I1406I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4218T	2						.						302.0	254.0	270.0					2																	197085594		2203	4300	6503	196793839	SO:0001819	synonymous_variant	57520	exon25			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4218C>T	2.37:g.197085594G>A			196793839	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Silent	SNP	ENST00000260983.3	37	CCDS33354.1																																																																																				0.433	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
APOB	338	hgsc.bcm.edu	37	2	21231230	21231230	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr2:21231230G>A	ENST00000233242.1	-	26	8637	c.8510C>T	c.(8509-8511)aCg>aTg	p.T2837M		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2837					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.T2837M(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCATGCTCCGTTCTCAGGTA	0.408																																					p.T2837M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8510T	2						.						127.0	133.0	131.0					2																	21231230		2203	4300	6503	21084735	SO:0001583	missense	338	exon26			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8510C>T	2.37:g.21231230G>A	ENSP00000233242:p.Thr2837Met		21084735	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	8.272	0.813674	0.16537	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00678	5.87	5.36	1.94	0.25998	.	0.337936	0.22398	N	0.060593	T	0.00552	0.0018	N	0.20986	0.625	0.09310	N	0.999995	P	0.35155	0.487	B	0.18871	0.023	T	0.53718	-0.8399	10	0.30078	T	0.28	.	8.8263	0.35057	0.4875:0.0:0.5125:0.0	.	2837	P04114	APOB_HUMAN	M	2837	ENSP00000233242:T2837M	ENSP00000233242:T2837M	T	-	2	0	APOB	21084735	0.001000	0.12720	0.048000	0.18961	0.566000	0.35808	1.370000	0.34238	0.048000	0.15891	0.555000	0.69702	ACG		0.408	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
TRAK2	66008	hgsc.bcm.edu	37	2	202245452	202245452	+	Silent	SNP	T	T	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr2:202245452T>C	ENST00000332624.3	-	16	2987	c.2559A>G	c.(2557-2559)caA>caG	p.Q853Q		NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	853					protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)	p.Q853Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						TTCCATTCTCTTGGGCACCAG	0.483																																					p.Q853Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2559G	2						.						80.0	85.0	83.0					2																	202245452		2203	4300	6503	201953697	SO:0001819	synonymous_variant	66008	exon16			AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.2559A>G	2.37:g.202245452T>C			201953697	NM_015049	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Silent	SNP	ENST00000332624.3	37	CCDS2347.1	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.530325	0.00951	.	.	ENSG00000115993	ENST00000542292	.	.	.	6.08	2.1	0.27182	.	.	.	.	.	T	0.16085	0.0387	.	.	.	0.24090	N	0.995913	.	.	.	.	.	.	T	0.26052	-1.0114	5	0.11794	T	0.64	.	3.6173	0.08082	0.1261:0.4943:0.2444:0.1353	.	.	.	.	R	759	.	ENSP00000445053:K759R	K	-	2	0	TRAK2	201953697	0.002000	0.14202	0.106000	0.21319	0.092000	0.18411	0.884000	0.28214	0.446000	0.26666	-0.462000	0.05337	AAG		0.483	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049	
FN1	2335	hgsc.bcm.edu	37	2	216248139	216248139	+	Silent	SNP	C	C	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr2:216248139C>A	ENST00000359671.1	-	30	4954	c.4689G>T	c.(4687-4689)ctG>ctT	p.L1563L	FN1_ENST00000354785.4_Silent_p.L1654L|FN1_ENST00000323926.6_Silent_p.L1654L|FN1_ENST00000336916.4_Silent_p.L1563L|FN1_ENST00000432072.2_Silent_p.L1654L|FN1_ENST00000346544.3_Silent_p.L1563L|FN1_ENST00000357009.2_Silent_p.L1563L|FN1_ENST00000421182.1_Silent_p.L1563L|FN1_ENST00000345488.5_Silent_p.L1563L|FN1_ENST00000356005.4_Silent_p.L1563L|FN1_ENST00000357867.4_Silent_p.L1563L|FN1_ENST00000446046.1_Silent_p.L1563L|FN1_ENST00000443816.1_Silent_p.L1563L|FN1_ENST00000490833.1_5'UTR			P02751	FINC_HUMAN	fibronectin 1	1563	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.L1563L(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	AACTTGAAGGCAGCCACTTGA	0.448																																					p.L1563L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4689T	2						.						237.0	195.0	210.0					2																	216248139		2203	4300	6503	215956384	SO:0001819	synonymous_variant	2335	exon30				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.4689G>T	2.37:g.216248139C>A			215956384	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	ENST00000359671.1	37																																																																																					0.448	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
SNX17	9784	hgsc.bcm.edu	37	2	27599497	27599497	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr2:27599497C>T	ENST00000233575.2	+	15	1546	c.1324C>T	c.(1324-1326)Cgg>Tgg	p.R442W	SNX17_ENST00000543024.1_Missense_Mutation_p.R228W|SNX17_ENST00000542478.1_Missense_Mutation_p.R228W|ZNF513_ENST00000491924.1_5'Flank|SNX17_ENST00000537606.1_Missense_Mutation_p.R417W	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	442					cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGTGAGCTTGCGGGGAATTGG	0.552																																					p.R442W												.	.	0			c.C1324T	2						.						131.0	117.0	122.0					2																	27599497		2203	4300	6503	27453001	SO:0001583	missense	9784	exon15			D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.1324C>T	2.37:g.27599497C>T	ENSP00000233575:p.Arg442Trp		27453001	NM_014748	B4DQM7|Q53HN7|Q6IAS3	Missense_Mutation	SNP	ENST00000233575.2	37	CCDS1750.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267565	0.80469	.	.	ENSG00000115234	ENST00000233575;ENST00000543024;ENST00000537606;ENST00000542478	T;T;T;T	0.35048	1.77;1.33;1.35;1.33	5.41	5.41	0.78517	.	0.114329	0.64402	D	0.000012	T	0.49508	0.1561	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.76494	0.997;0.997;0.997;0.999	B;B;B;P	0.53689	0.446;0.446;0.446;0.732	T	0.50491	-0.8822	10	0.87932	D	0	-9.7236	16.7269	0.85424	0.0:1.0:0.0:0.0	.	417;430;422;442	B4DQM7;B4DTB8;B4DQ37;Q15036	.;.;.;SNX17_HUMAN	W	442;228;417;228	ENSP00000233575:R442W;ENSP00000441779:R228W;ENSP00000439208:R417W;ENSP00000442567:R228W	ENSP00000233575:R442W	R	+	1	2	SNX17	27453001	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.824000	0.55723	2.815000	0.96918	0.561000	0.74099	CGG		0.552	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215024.1	NM_014748	
GKN2	200504	hgsc.bcm.edu	37	2	69174289	69174289	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr2:69174289T>C	ENST00000328895.4	-	4	413	c.305A>G	c.(304-306)tAt>tGt	p.Y102C	GKN2_ENST00000481498.1_Missense_Mutation_p.Y102C	NM_182536.2	NP_872342.2	Q86XP6	GKN2_HUMAN	gastrokine 2	102	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.					extracellular region (GO:0005576)		p.Y102C(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(1)	15						CTGTTTCTCATAGATGTACCA	0.458																																					p.Y102C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A305G	2						.						159.0	143.0	149.0					2																	69174289		2203	4300	6503	69027793	SO:0001583	missense	200504	exon4			AF494509	CCDS33215.1	2p14	2012-10-10			ENSG00000183607	ENSG00000183607		"""BRICHOS domain containing"""	24588	protein-coding gene	gene with protein product	"""down regulated in gastric cancer GDDR"", ""BRICHOS domain containing 1B"""					15774165, 15924415, 16888721	Standard	NM_182536		Approved	TFIZ1, PRO813, VLTI465, blottin, GDDR, BRICD1B	uc002sfa.3	Q86XP6	OTTHUMG00000152655	ENST00000328895.4:c.305A>G	2.37:g.69174289T>C	ENSP00000329292:p.Tyr102Cys		69027793	NM_182536	Q6UWS6	Missense_Mutation	SNP	ENST00000328895.4	37	CCDS33215.1	.	.	.	.	.	.	.	.	.	.	T	9.939	1.217036	0.22373	.	.	ENSG00000183607	ENST00000328895;ENST00000481498	T;T	0.79033	-1.23;-1.23	5.2	2.75	0.32379	BRICHOS (2);	0.588807	0.16300	N	0.220498	D	0.83050	0.5170	M	0.63428	1.95	0.31833	N	0.624452	D;D	0.76494	0.993;0.999	P;D	0.69479	0.87;0.964	T	0.80852	-0.1197	10	0.49607	T	0.09	-23.602	7.6671	0.28437	0.3602:0.0:0.0:0.6398	.	102;102	E5RHQ8;Q86XP6	.;GKN2_HUMAN	C	102	ENSP00000329292:Y102C;ENSP00000428538:Y102C	ENSP00000329292:Y102C	Y	-	2	0	GKN2	69027793	0.848000	0.29623	0.643000	0.29450	0.039000	0.13416	1.093000	0.30939	0.403000	0.25479	0.533000	0.62120	TAT		0.458	GKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327191.1	NM_182536	
KCNIP3	30818	hgsc.bcm.edu	37	2	96047357	96047357	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr2:96047357G>C	ENST00000295225.5	+	6	596	c.461G>C	c.(460-462)gGc>gCc	p.G154A	KCNIP3_ENST00000468529.1_Missense_Mutation_p.G128A|KCNIP3_ENST00000360990.3_Missense_Mutation_p.G132A|KCNIP3_ENST00000377181.2_3'UTR	NM_013434.4	NP_038462.1	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3, calsenilin	154	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				apoptotic process (GO:0006915)|behavioral response to pain (GO:0048266)|intracellular protein transport (GO:0006886)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	axon terminus (GO:0043679)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|voltage-gated ion channel activity (GO:0005244)	p.G154A(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	16				READ - Rectum adenocarcinoma(193;0.13)		TTTGTGGTTGGCCTCTCCATC	0.507																																					p.G128A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G383C	2						.						149.0	139.0	142.0					2																	96047357		2203	4300	6503	95411084	SO:0001583	missense	30818	exon5			AF199599	CCDS2013.1, CCDS33245.1	2q21.1	2013-01-10	2006-02-11	2006-02-11	ENSG00000115041	ENSG00000115041		"""EF-hand domain containing"""	15523	protein-coding gene	gene with protein product		604662	"""calsenilin, presenilin-binding protein, EF hand transcription factor"""	CSEN		9771752, 10078534	Standard	NM_013434		Approved	DREAM, KCHIP3, calsenilin	uc002sup.3	Q9Y2W7	OTTHUMG00000130392	ENST00000295225.5:c.461G>C	2.37:g.96047357G>C	ENSP00000295225:p.Gly154Ala		95411084	NM_001034914	H7BY46|Q3YAC3|Q3YAC4|Q53TJ5|Q96T40|Q9UJ84|Q9UJ85	Missense_Mutation	SNP	ENST00000295225.5	37	CCDS2013.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432117	0.62844	.	.	ENSG00000115041	ENST00000295225;ENST00000360990;ENST00000468529	T;T;T	0.77358	-1.09;-1.09;-1.09	5.39	5.39	0.77823	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.71400	0.3335	N	0.21240	0.645	0.80722	D	1	P;P	0.47191	0.505;0.891	B;P	0.45506	0.243;0.483	T	0.75414	-0.3326	10	0.56958	D	0.05	.	16.6473	0.85179	0.0:0.0:1.0:0.0	.	128;154	Q9Y2W7-3;Q9Y2W7	.;CSEN_HUMAN	A	154;132;128	ENSP00000295225:G154A;ENSP00000354261:G132A;ENSP00000417499:G128A	ENSP00000295225:G154A	G	+	2	0	KCNIP3	95411084	1.000000	0.71417	0.952000	0.39060	0.503000	0.33858	7.954000	0.87848	2.537000	0.85549	0.462000	0.41574	GGC		0.507	KCNIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252770.1	NM_013434	
NMUR1	10316	hgsc.bcm.edu	37	2	232389969	232389969	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr2:232389969A>G	ENST00000305141.4	-	3	1199	c.1066T>C	c.(1066-1068)Tat>Cat	p.Y356H		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	356					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		ATGAGGCTATAGAGCACGGGG	0.652																																					p.Y356H												.	.	0			c.T1066C	2						.						60.0	62.0	61.0					2																	232389969		2203	4300	6503	232098213	SO:0001583	missense	10316	exon3			AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.1066T>C	2.37:g.232389969A>G	ENSP00000305877:p.Tyr356His		232098213	NM_006056	O43664|Q7LDP6|Q8NE20	Missense_Mutation	SNP	ENST00000305141.4	37	CCDS2486.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.622057	0.87460	.	.	ENSG00000171596	ENST00000305141	D	0.93247	-3.19	4.79	4.79	0.61399	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98239	0.9417	H	0.99368	4.535	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.99100	1.0843	10	0.87932	D	0	-38.0329	13.7181	0.62710	1.0:0.0:0.0:0.0	.	356	Q9HB89	NMUR1_HUMAN	H	356	ENSP00000305877:Y356H	ENSP00000305877:Y356H	Y	-	1	0	NMUR1	232098213	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.300000	0.78841	2.036000	0.60181	0.454000	0.30748	TAT		0.652	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
COL27A1	85301	hgsc.bcm.edu	37	9	116971965	116971965	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr9:116971965G>A	ENST00000356083.3	+	11	2670	c.2279G>A	c.(2278-2280)gGg>gAg	p.G760E	MIR455_ENST00000384993.1_RNA	NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	760	Collagen-like 3.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.G760E(1)		central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGCTACATTGGGCTCCCAGGG	0.587																																					p.G760E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2279A	9						.						130.0	132.0	132.0					9																	116971965		2203	4300	6503	116011786	SO:0001583	missense	85301	exon11			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.2279G>A	9.37:g.116971965G>A	ENSP00000348385:p.Gly760Glu		116011786	NM_032888	Q66K43|Q96JF7	Missense_Mutation	SNP	ENST00000356083.3	37	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.547344	0.65311	.	.	ENSG00000196739	ENST00000356083;ENST00000357257;ENST00000374106;ENST00000451716	D;D	0.99353	-5.77;-5.77	4.36	4.36	0.52297	.	.	.	.	.	D	0.99708	0.9888	H	0.99498	4.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96920	0.9673	9	0.87932	D	0	.	14.778	0.69743	0.0:0.0:1.0:0.0	.	760;656	Q8IZC6;Q5T1U7	CORA1_HUMAN;.	E	760;760;656;656	ENSP00000348385:G760E;ENSP00000391328:G656E	ENSP00000348385:G760E	G	+	2	0	COL27A1	116011786	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.167000	0.94773	2.424000	0.82194	0.650000	0.86243	GGG		0.587	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
CNTRL	11064	hgsc.bcm.edu	37	9	123937345	123937345	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr9:123937345G>A	ENST00000373855.1	+	43	7057	c.6797G>A	c.(6796-6798)gGa>gAa	p.G2266E	CNTRL_ENST00000238341.5_Missense_Mutation_p.G2266E|CNTRL_ENST00000373850.1_Missense_Mutation_p.G1714E|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	2266	Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)		p.G2266E(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TTAATTAAAGGAAAGCGGCAG	0.453																																					p.G2266E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6797A	9						.						138.0	142.0	141.0					9																	123937345		2203	4300	6503	122977166	SO:0001583	missense	11064	exon41			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6797G>A	9.37:g.123937345G>A	ENSP00000362962:p.Gly2266Glu		122977166	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.597757	0.66332	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000394368;ENST00000373850;ENST00000373845	T;T;T	0.32988	1.71;1.71;1.43	5.59	5.59	0.84812	.	.	.	.	.	T	0.45377	0.1339	L	0.59436	1.845	0.42790	D	0.993892	D	0.89917	1.0	D	0.72075	0.976	T	0.36601	-0.9741	9	0.02654	T	1	.	14.2265	0.65863	0.0:0.149:0.851:0.0	.	2266	Q7Z7A1	CNTRL_HUMAN	E	2266;2266;2266;423;1714;948	ENSP00000362962:G2266E;ENSP00000238341:G2266E;ENSP00000362956:G1714E	ENSP00000238341:G2266E	G	+	2	0	CNTRL	122977166	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	5.917000	0.69989	2.629000	0.89072	0.555000	0.69702	GGA		0.453	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
KDM4C	23081	hgsc.bcm.edu	37	9	6805609	6805609	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr9:6805609C>T	ENST00000381309.3	+	3	720	c.155C>T	c.(154-156)cCt>cTt	p.P52L	KDM4C_ENST00000535193.1_Missense_Mutation_p.P74L|KDM4C_ENST00000442236.2_Intron|KDM4C_ENST00000543771.1_Missense_Mutation_p.P52L|KDM4C_ENST00000536108.1_5'UTR|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000381306.3_Missense_Mutation_p.P52L|KDM4C_ENST00000401787.3_Missense_Mutation_p.P52L	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	52	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)	p.P52L(1)		breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						GTGATTCCTCCTAAGGAGTGG	0.353																																					p.P74L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C221T	9						.						64.0	61.0	62.0					9																	6805609		2203	4300	6503	6795609	SO:0001583	missense	23081	exon3			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.155C>T	9.37:g.6805609C>T	ENSP00000370710:p.Pro52Leu		6795609	NM_001146696	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	37	CCDS6471.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.031631	0.93575	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000401787;ENST00000381309;ENST00000381306	T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53	5.72	5.72	0.89469	Transcription factor jumonji, JmjN (2);	0.058147	0.64402	D	0.000001	D	0.84092	0.5396	H	0.98133	4.155	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.996;0.998;0.999;0.997;0.999	D	0.89459	0.3735	10	0.72032	D	0.01	-30.6787	19.9401	0.97155	0.0:1.0:0.0:0.0	.	52;52;52;74;52;52	F5H347;B4E1Y4;B0QZ60;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;.;KDM4C_HUMAN;.	L	74;52;52;52;52	ENSP00000442382:P74L;ENSP00000445427:P52L;ENSP00000383990:P52L;ENSP00000370710:P52L;ENSP00000370707:P52L	ENSP00000370707:P52L	P	+	2	0	KDM4C	6795609	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.699000	0.84547	2.712000	0.92718	0.650000	0.86243	CCT		0.353	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
NELFB	25920	hgsc.bcm.edu	37	9	140166584	140166584	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr9:140166584C>T	ENST00000343053.4	+	11	1734	c.1397C>T	c.(1396-1398)aCg>aTg	p.T466M		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	466					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.T466M(2)									CACCTGCTCACGGGCAACCTT	0.617																																					p.T466M												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C1397T	9						.						175.0	139.0	151.0					9																	140166584		2203	4300	6503	139286405	SO:0001583	missense	25920	exon11			AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.1397C>T	9.37:g.140166584C>T	ENSP00000339495:p.Thr466Met		139286405	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	c	11.71	1.719744	0.30503	.	.	ENSG00000188986	ENST00000343053	.	.	.	4.76	2.82	0.32997	.	0.147632	0.64402	N	0.000010	T	0.41213	0.1149	L	0.31294	0.92	0.44380	D	0.997283	B	0.19445	0.036	B	0.19148	0.024	T	0.28586	-1.0039	9	0.48119	T	0.1	-24.2188	7.2495	0.26142	0.0:0.7801:0.0:0.2199	.	466	Q8WX92	NELFB_HUMAN	M	466	.	ENSP00000339495:T466M	T	+	2	0	COBRA1	139286405	0.746000	0.28272	0.832000	0.32986	0.485000	0.33311	1.437000	0.34991	0.937000	0.37394	0.479000	0.44913	ACG		0.617	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
ARMC4	55130	hgsc.bcm.edu	37	10	28229562	28229562	+	Missense_Mutation	SNP	C	C	T	rs148908705		TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr10:28229562C>T	ENST00000305242.5	-	13	2008	c.1916G>A	c.(1915-1917)cGg>cAg	p.R639Q	ARMC4_ENST00000537576.1_Missense_Mutation_p.R331Q|ARMC4_ENST00000545014.1_Missense_Mutation_p.R164Q	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	639					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.R639Q(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						CTTCAGCAGCCGAGCCAACAG	0.532																																					p.R639Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1916A	10						.	C	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	114.0	100.0	105.0		1916	-0.9	0.0	10	dbSNP_134	105	0,8600		0,0,4300	no	missense	ARMC4	NM_018076.2	43	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	639/1045	28229562	2,13004	2203	4300	6503	28269568	SO:0001583	missense	55130	exon13			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1916G>A	10.37:g.28229562C>T	ENSP00000306410:p.Arg639Gln		28269568	NM_018076	A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	ENST00000305242.5	37	CCDS7157.1	.	.	.	.	.	.	.	.	.	.	C	7.143	0.582255	0.13749	4.54E-4	0.0	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000545014	T;T;T	0.67865	-0.29;-0.29;-0.29	5.24	-0.932	0.10435	Armadillo-like helical (1);Armadillo-type fold (2);	0.376195	0.30347	N	0.009821	T	0.50137	0.1598	L	0.40543	1.245	0.09310	N	0.999999	B;B	0.27416	0.178;0.004	B;B	0.21708	0.036;0.008	T	0.35375	-0.9791	10	0.20046	T	0.44	-2.1552	11.6701	0.51396	0.0:0.4794:0.0:0.5206	.	164;639	B7Z7I1;Q5T2S8	.;ARMC4_HUMAN	Q	331;639;164	ENSP00000443208:R331Q;ENSP00000306410:R639Q;ENSP00000441076:R164Q	ENSP00000306410:R639Q	R	-	2	0	ARMC4	28269568	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.014000	0.12656	-0.143000	0.11334	-0.137000	0.14449	CGG		0.532	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047339.1	NM_018076	
TET1	80312	hgsc.bcm.edu	37	10	70333239	70333239	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr10:70333239G>A	ENST00000373644.4	+	2	1353	c.1144G>A	c.(1144-1146)Gac>Aac	p.D382N		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	382					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TCCTGGTGCTGACCCAGTTCA	0.498																																					p.D382N												.	.	0			c.G1144A	10						.						143.0	152.0	149.0					10																	70333239		2203	4300	6503	70003245	SO:0001583	missense	80312	exon2			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.1144G>A	10.37:g.70333239G>A	ENSP00000362748:p.Asp382Asn		70003245	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	G	0.676	-0.800126	0.02841	.	.	ENSG00000138336	ENST00000373644	T	0.05513	3.43	4.98	2.71	0.32032	.	0.564466	0.16015	N	0.233594	T	0.01730	0.0055	N	0.01576	-0.805	0.24696	N	0.993281	B	0.02656	0.0	B	0.01281	0.0	T	0.46289	-0.9202	10	0.02654	T	1	.	5.184	0.15174	0.7025:0.0:0.2975:0.0	.	382	Q8NFU7	TET1_HUMAN	N	382	ENSP00000362748:D382N	ENSP00000362748:D382N	D	+	1	0	TET1	70003245	0.966000	0.33281	0.982000	0.44146	0.862000	0.49288	1.325000	0.33724	0.998000	0.38996	-0.471000	0.05019	GAC		0.498	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
APC	324	hgsc.bcm.edu	37	5	112175520	112175520	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr5:112175520G>C	ENST00000457016.1	+	16	4609	c.4229G>C	c.(4228-4230)tGc>tCc	p.C1410S	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Missense_Mutation_p.C1410S|APC_ENST00000257430.4_Missense_Mutation_p.C1410S			P25054	APC_HUMAN	adenomatous polyposis coli	1410	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.C1410S(1)|p.Y1376fs*41(1)|p.K1192fs*3(1)|p.?(1)|p.P1409fs*6(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGTGAACCATGCAGTGGAATG	0.483		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.C1392S	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,-1	.	5	Deletion - Frameshift(3)|Substitution - Missense(1)|Unknown(1)	large_intestine(3)|soft_tissue(1)|skin(1)	c.G4175C	5						.						117.0	108.0	111.0					5																	112175520		2202	4300	6502	112203419	SO:0001583	missense	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4229G>C	5.37:g.112175520G>C	ENSP00000413133:p.Cys1410Ser		112203419	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.040545	0.55003	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.90261	-2.64;-2.64;-2.64	6.07	6.07	0.98685	.	0.087975	0.85682	D	0.000000	D	0.94775	0.8313	M	0.62723	1.935	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	D	0.93197	0.6588	9	.	.	.	-8.2962	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1412;1410	Q4LE70;P25054	.;APC_HUMAN	S	1410	ENSP00000413133:C1410S;ENSP00000257430:C1410S;ENSP00000427089:C1410S	.	C	+	2	0	APC	112203419	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.574000	0.82434	2.884000	0.98904	0.655000	0.94253	TGC		0.483	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ANKHD1	54882	hgsc.bcm.edu	37	5	139876718	139876718	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr5:139876718A>C	ENST00000360839.2	+	15	3013	c.2859A>C	c.(2857-2859)aaA>aaC	p.K953N	ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.K953N|ANKHD1_ENST00000297183.6_Missense_Mutation_p.K953N|ANKHD1_ENST00000462121.1_3'UTR	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	953						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.K953N(2)		breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACTTCAGAAAGTATCAGGTA	0.413																																					p.K953N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2859C	5						.						131.0	132.0	132.0					5																	139876718		2203	4300	6503	139856902	SO:0001583	missense	404734	exon15			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.2859A>C	5.37:g.139876718A>C	ENSP00000354085:p.Lys953Asn		139856902	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	A	12.68	2.010398	0.35511	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000421134;ENST00000532219	T;T;T;T	0.67171	-0.21;-0.25;-0.2;-0.25	5.77	4.61	0.57282	Ankyrin repeat-containing domain (1);	0.153286	0.53938	D	0.000046	T	0.58708	0.2141	L	0.36672	1.1	0.35680	D	0.813978	P;P;P	0.47106	0.873;0.89;0.608	P;B;B	0.47346	0.544;0.272;0.202	T	0.62863	-0.6764	10	0.25751	T	0.34	.	8.4988	0.33146	0.8497:0.0:0.1503:0.0	.	953;953;953	Q8IWZ3-4;Q8IWZ2;Q8IWZ3	.;.;ANKH1_HUMAN	N	953;986;953;953;487;972;953	ENSP00000354085:K953N;ENSP00000297183:K953N;ENSP00000394489:K972N;ENSP00000432016:K953N	ENSP00000432016:K953N	K	+	3	2	ANKHD1-EIF4EBP3;ANKHD1	139856902	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.763000	0.47605	1.012000	0.39366	0.482000	0.46254	AAA		0.413	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
PCDHA1	56147	hgsc.bcm.edu	37	5	140166166	140166166	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr5:140166166G>C	ENST00000504120.2	+	1	291	c.291G>C	c.(289-291)caG>caC	p.Q97H	PCDHA1_ENST00000394633.3_Missense_Mutation_p.Q97H|PCDHA1_ENST00000378133.3_Missense_Mutation_p.Q97H	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	97	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTGTGCCAGTGGAGCGCGG	0.537																																					p.Q97H												.	.	0			c.G291C	5						.						83.0	88.0	87.0					5																	140166166		2203	4300	6503	140146350	SO:0001583	missense	56147	exon1			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.291G>C	5.37:g.140166166G>C	ENSP00000420840:p.Gln97His		140146350	NM_031410	O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	g	4.844	0.156992	0.09236	.	.	ENSG00000204970	ENST00000504120;ENST00000394633;ENST00000378133	T;T;T	0.27720	1.65;1.65;1.65	4.31	-0.03	0.13916	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.165039	0.27886	U	0.017448	T	0.16896	0.0406	L	0.45352	1.415	0.09310	N	1	P;B;P	0.40083	0.7;0.062;0.702	B;B;B	0.32465	0.146;0.072;0.141	T	0.18681	-1.0329	10	0.87932	D	0	.	2.1123	0.03706	0.0987:0.2318:0.2776:0.3919	.	97;97;97	Q9Y5I3;Q9Y5I3-2;Q9Y5I3-3	PCDA1_HUMAN;.;.	H	97	ENSP00000420840:Q97H;ENSP00000378129:Q97H;ENSP00000367373:Q97H	ENSP00000367373:Q97H	Q	+	3	2	PCDHA1	140146350	0.000000	0.05858	0.958000	0.39756	0.107000	0.19398	-0.060000	0.11712	0.371000	0.24564	0.650000	0.86243	CAG		0.537	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900	
PCDHB4	56131	hgsc.bcm.edu	37	5	140501762	140501762	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr5:140501762G>A	ENST00000194152.1	+	1	182	c.182G>A	c.(181-183)cGg>cAg	p.R61Q	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	61	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R61Q(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGGCCTCCCGGTCAGCCCGG	0.562																																					p.R61Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G182A	5						.						68.0	70.0	69.0					5																	140501762		2203	4300	6503	140481946	SO:0001583	missense	56131	exon1			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.182G>A	5.37:g.140501762G>A	ENSP00000194152:p.Arg61Gln		140481946	NM_018938	Q4V761	Missense_Mutation	SNP	ENST00000194152.1	37	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.959237	0.53400	.	.	ENSG00000081818	ENST00000194152	T	0.40225	1.04	4.66	4.66	0.58398	Cadherin, N-terminal (1);Cadherin-like (1);	.	.	.	.	T	0.75737	0.3890	H	0.97186	3.955	0.09310	N	1	D	0.65815	0.995	D	0.63488	0.915	T	0.72997	-0.4121	9	0.72032	D	0.01	.	17.7061	0.88310	0.0:0.0:1.0:0.0	.	61	Q9Y5E5	PCDB4_HUMAN	Q	61	ENSP00000194152:R61Q	ENSP00000194152:R61Q	R	+	2	0	PCDHB4	140481946	1.000000	0.71417	0.133000	0.22050	0.146000	0.21551	7.673000	0.83973	2.570000	0.86706	0.655000	0.94253	CGG		0.562	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
KCTD16	57528	hgsc.bcm.edu	37	5	143853421	143853421	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr5:143853421G>A	ENST00000507359.3	+	3	2122	c.1031G>A	c.(1030-1032)cGt>cAt	p.R344H	KCTD16_ENST00000512467.1_Missense_Mutation_p.R344H	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	344					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)		p.R344H(1)		large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			ACTCTGGACCGTCCCATCAAG	0.587																																					p.R344H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1031A	5						.						76.0	74.0	74.0					5																	143853421		2203	4300	6503	143833614	SO:0001583	missense	57528	exon4			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1031G>A	5.37:g.143853421G>A	ENSP00000426548:p.Arg344His		143833614	NM_020768	Q9P2M9	Missense_Mutation	SNP	ENST00000507359.3	37	CCDS34260.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.966455	0.92855	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.52526	0.66;0.66	6.17	6.17	0.99709	.	0.067878	0.52532	D	0.000065	T	0.62986	0.2473	L	0.36672	1.1	0.54753	D	0.999983	D	0.76494	0.999	D	0.73380	0.98	T	0.62129	-0.6919	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	344	Q68DU8	KCD16_HUMAN	H	344	ENSP00000424151:R344H;ENSP00000426548:R344H	ENSP00000426548:R344H	R	+	2	0	KCTD16	143833614	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.363000	0.97131	2.941000	0.99782	0.655000	0.94253	CGT		0.587	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368	
IQGAP2	10788	hgsc.bcm.edu	37	5	75885529	75885529	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr5:75885529G>A	ENST00000274364.6	+	7	913	c.616G>A	c.(616-618)Gaa>Aaa	p.E206K	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	206					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)	p.E206K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TCTGGCCAATGAACTGTCCGT	0.378																																					p.E206K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G616A	5						.						81.0	78.0	79.0					5																	75885529		2203	4300	6503	75921285	SO:0001583	missense	10788	exon7			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.616G>A	5.37:g.75885529G>A	ENSP00000274364:p.Glu206Lys		75921285	NM_006633	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	36	5.649339	0.96714	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	T;T;T	0.06294	3.32;3.32;3.32	6.06	6.06	0.98353	.	0.104580	0.64402	D	0.000005	T	0.25005	0.0607	M	0.66939	2.045	0.80722	D	1	D	0.69078	0.997	D	0.64877	0.93	T	0.00009	-1.2469	10	0.62326	D	0.03	-33.1279	20.6208	0.99490	0.0:0.0:1.0:0.0	.	206	Q13576	IQGA2_HUMAN	K	206;179;156	ENSP00000274364:E206K;ENSP00000423672:E179K;ENSP00000421097:E156K	ENSP00000274364:E206K	E	+	1	0	IQGAP2	75921285	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.837000	0.99465	2.882000	0.98803	0.655000	0.94253	GAA		0.378	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
GEMIN5	25929	hgsc.bcm.edu	37	5	154268966	154268966	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3549-01A-02W-0831-10	TCGA-AA-3549-10A-01W-0831-10	g.chr5:154268966T>C	ENST00000285873.7	-	27	4349	c.4274A>G	c.(4273-4275)aAa>aGa	p.K1425R		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	1425					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)	p.K1425R(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGGCTCATTTTTTTCTTCTTT	0.353																																					p.K1425R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4274G	5						.						69.0	70.0	70.0					5																	154268966		2203	4300	6503	154249159	SO:0001583	missense	25929	exon27			AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.4274A>G	5.37:g.154268966T>C	ENSP00000285873:p.Lys1425Arg		154249159	NM_015465	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	37	CCDS4330.1	.	.	.	.	.	.	.	.	.	.	T	8.690	0.907127	0.17833	.	.	ENSG00000082516	ENST00000285873	T	0.70045	-0.45	6.01	-0.947	0.10382	.	0.723288	0.14115	N	0.340418	T	0.33089	0.0851	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.12041	-1.0563	10	0.12103	T	0.63	-6.2721	0.6272	0.00788	0.2235:0.2775:0.1271:0.372	.	1424;1425	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	R	1425	ENSP00000285873:K1425R	ENSP00000285873:K1425R	K	-	2	0	GEMIN5	154249159	0.385000	0.25172	0.064000	0.19789	0.971000	0.66376	0.066000	0.14489	0.164000	0.19529	0.528000	0.53228	AAA		0.353	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		
