#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NUP205	23165	hgsc.bcm.edu	37	7	135261807	135261807	+	Silent	SNP	T	T	C	rs571627058		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:135261807T>C	ENST00000285968.6	+	5	605	c.579T>C	c.(577-579)atT>atC	p.I193I	NUP205_ENST00000440390.2_5'UTR	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	193					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.I193I(1)		breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TGTCACAGATTGATGTGAATA	0.418																																					p.I193I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T579C	7						.						137.0	130.0	133.0					7																	135261807		2203	4300	6503	134912347	SO:0001819	synonymous_variant	23165	exon5			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.579T>C	7.37:g.135261807T>C			134912347	NM_015135	A6H8X3|Q86YC1	Silent	SNP	ENST00000285968.6	37	CCDS34759.1																																																																																				0.418	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
CASP2	835	hgsc.bcm.edu	37	7	142991714	142991714	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:142991714C>T	ENST00000310447.5	+	6	836	c.595C>T	c.(595-597)Cgt>Tgt	p.R199C	CASP2_ENST00000493642.1_3'UTR	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase	199					aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.R199C(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					GTCTCGGCCTCGTGGCCTAGC	0.502																																					p.R199C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C595T	7						.						131.0	114.0	120.0					7																	142991714		2203	4300	6503	142701836	SO:0001583	missense	835	exon6			AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.595C>T	7.37:g.142991714C>T	ENSP00000312664:p.Arg199Cys		142701836	NM_032982	A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Missense_Mutation	SNP	ENST00000310447.5	37	CCDS5879.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443200	0.83993	.	.	ENSG00000106144	ENST00000310447;ENST00000392923	T	0.34275	1.37	5.78	4.87	0.63330	Peptidase C14, caspase precursor p45, core (2);Peptidase C14, ICE, catalytic subunit p20 (1);	0.000000	0.85682	D	0.000000	T	0.58395	0.2119	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60367	-0.7277	10	0.72032	D	0.01	.	15.3504	0.74380	0.2861:0.7139:0.0:0.0	.	199	P42575	CASP2_HUMAN	C	199;168	ENSP00000312664:R199C	ENSP00000312664:R199C	R	+	1	0	CASP2	142701836	0.980000	0.34600	0.998000	0.56505	0.996000	0.88848	2.519000	0.45546	2.752000	0.94435	0.555000	0.69702	CGT		0.502	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059962.3	NM_032982	
PDIA4	9601	hgsc.bcm.edu	37	7	148701169	148701169	+	Missense_Mutation	SNP	G	G	A	rs202039947		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:148701169G>A	ENST00000286091.4	-	10	1887	c.1655C>T	c.(1654-1656)gCg>gTg	p.A552V		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	552	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)	p.A552V(1)		large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			GCACCATGGCGCGTAGAACTC	0.577													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17497	0.0		0.0	False		,,,				2504	0.0				p.A552V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1655T	7						.						154.0	141.0	146.0					7																	148701169		2203	4300	6503	148332102	SO:0001583	missense	9601	exon10			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1655C>T	7.37:g.148701169G>A	ENSP00000286091:p.Ala552Val		148332102	NM_004911	A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	37	CCDS5893.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	24.0	4.487479	0.84854	.	.	ENSG00000155660	ENST00000286091	T	0.10192	2.9	5.81	5.81	0.92471	Thioredoxin domain (1);Thioredoxin, conserved site (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.000000	0.85682	D	0.000000	T	0.51261	0.1664	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67608	-0.5627	10	0.87932	D	0	.	20.0734	0.97734	0.0:0.0:1.0:0.0	.	552	P13667	PDIA4_HUMAN	V	552	ENSP00000286091:A552V	ENSP00000286091:A552V	A	-	2	0	PDIA4	148332102	1.000000	0.71417	0.966000	0.40874	0.213000	0.24496	9.553000	0.98118	2.751000	0.94390	0.555000	0.69702	GCG		0.577	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911	
GIMAP8	155038	hgsc.bcm.edu	37	7	150174326	150174326	+	Missense_Mutation	SNP	G	G	A	rs199561369		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:150174326G>A	ENST00000307271.3	+	5	2030	c.1456G>A	c.(1456-1458)Gga>Aga	p.G486R		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	486	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.G486R(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GACATGGGACGGACAGGAGGT	0.597																																					p.G486R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1456A	7						.						79.0	73.0	75.0					7																	150174326		2203	4300	6503	149805259	SO:0001583	missense	155038	exon5			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1456G>A	7.37:g.150174326G>A	ENSP00000305107:p.Gly486Arg		149805259	NM_175571		Missense_Mutation	SNP	ENST00000307271.3	37	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.128405	0.77549	.	.	ENSG00000171115	ENST00000307271	T	0.09911	2.93	4.42	-0.231	0.13086	AIG1 (1);	0.956881	0.08574	N	0.925633	T	0.19127	0.0459	M	0.76170	2.325	0.09310	N	1	D	0.64830	0.994	P	0.53954	0.738	T	0.18935	-1.0321	10	0.31617	T	0.26	.	3.5737	0.07926	0.105:0.1301:0.5563:0.2086	.	486	Q8ND71	GIMA8_HUMAN	R	486	ENSP00000305107:G486R	ENSP00000305107:G486R	G	+	1	0	GIMAP8	149805259	0.000000	0.05858	0.002000	0.10522	0.584000	0.36387	-0.345000	0.07770	0.014000	0.14944	0.643000	0.83706	GGA		0.597	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571	
HEATR2	54919	hgsc.bcm.edu	37	7	819747	819747	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:819747C>T	ENST00000297440.6	+	12	2417	c.2397C>T	c.(2395-2397)gaC>gaT	p.D799D	HEATR2_ENST00000313147.5_Silent_p.D799D|HEATR2_ENST00000403952.3_Silent_p.D224D	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	799						cytoplasm (GO:0005737)		p.D799D(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		TTCACCTTGACGATCCAGAGA	0.562																																					p.D799D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2397T	7						.						123.0	106.0	112.0					7																	819747		2203	4300	6503	786273	SO:0001819	synonymous_variant	54919	exon12			AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.2397C>T	7.37:g.819747C>T			786273	NM_017802	Q69YL1|Q96FI9|Q9NX75	Silent	SNP	ENST00000297440.6	37	CCDS34580.1	.	.	.	.	.	.	.	.	.	.	C	0.593	-0.832384	0.02713	.	.	ENSG00000164818	ENST00000440747	.	.	.	4.25	-5.43	0.02632	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.4986	12.631	0.56657	0.0:0.4648:0.0:0.5352	.	.	.	.	X	601	.	.	R	+	1	2	HEATR2	786273	0.924000	0.31332	0.907000	0.35723	0.050000	0.14768	-0.260000	0.08708	-0.970000	0.03569	-1.191000	0.01696	CGA		0.562	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1	NM_017802	
WIPI2	26100	hgsc.bcm.edu	37	7	5256747	5256747	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:5256747G>A	ENST00000288828.4	+	6	737	c.505G>A	c.(505-507)Gac>Aac	p.D169N	WIPI2_ENST00000382384.2_Missense_Mutation_p.D151N|WIPI2_ENST00000404704.3_Missense_Mutation_p.D169N|WIPI2_ENST00000401525.3_Missense_Mutation_p.D151N|WIPI2_ENST00000484262.1_Missense_Mutation_p.D110N	NM_001033518.1|NM_001278299.1|NM_015610.3	NP_001028690.1|NP_001265228.1|NP_056425.1	Q9Y4P8	WIPI2_HUMAN	WD repeat domain, phosphoinositide interacting 2	169					autophagic vacuole assembly (GO:0000045)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|protein complex (GO:0043234)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)	p.D169N(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)	16		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)		AATCAACAACGACAACTGCTA	0.507																																					p.D110N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G328A	7						.						174.0	133.0	147.0					7																	5256747		2203	4300	6503	5223273	SO:0001583	missense	26100	exon3				CCDS5339.1, CCDS34593.1, CCDS47531.1, CCDS47532.1, CCDS47533.1	7p22.1	2014-02-12			ENSG00000157954	ENSG00000157954		"""WD repeat domain containing"""	32225	protein-coding gene	gene with protein product		609225				15602573	Standard	NM_001278299		Approved	Atg21, CGI-50, FLJ12979, FLJ14217, FLJ42984, DKFZP434J154, DKFZp686P02188, ATG18B	uc003snv.3	Q9Y4P8	OTTHUMG00000121179	ENST00000288828.4:c.505G>A	7.37:g.5256747G>A	ENSP00000288828:p.Asp169Asn		5223273	NM_001033520	B3KNC2|Q5MNZ8|Q6FI96|Q75L50|Q96IE4|Q9Y364	Missense_Mutation	SNP	ENST00000288828.4	37	CCDS5339.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.714423	0.68730	.	.	ENSG00000157954	ENST00000288828;ENST00000401525;ENST00000404704;ENST00000382384;ENST00000484262;ENST00000315176	T;T;T;T;T	0.69561	0.51;0.51;0.51;0.51;-0.41	5.6	5.6	0.85130	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.046236	0.85682	D	0.000000	T	0.72228	0.3434	L	0.54863	1.705	0.58432	D	0.99999	D;B;D;B;B;B	0.65815	0.995;0.412;0.995;0.197;0.384;0.265	P;B;P;B;B;B	0.56700	0.712;0.147;0.804;0.052;0.083;0.038	T	0.67925	-0.5544	10	0.24483	T	0.36	-63.3708	14.4503	0.67379	0.0:0.0:0.8528:0.1472	.	163;110;151;151;169;169	E7EVF6;Q9Y4P8-3;Q9Y4P8-2;Q9Y4P8-4;Q9Y4P8-6;Q9Y4P8	.;.;.;.;.;WIPI2_HUMAN	N	169;151;169;151;110;163	ENSP00000288828:D169N;ENSP00000384945:D151N;ENSP00000385297:D169N;ENSP00000371821:D151N;ENSP00000429654:D110N	ENSP00000288828:D169N	D	+	1	0	WIPI2	5223273	1.000000	0.71417	0.999000	0.59377	0.938000	0.57974	5.152000	0.64882	2.622000	0.88805	0.555000	0.69702	GAC		0.507	WIPI2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241669.2	NM_015610	
CHN2	1124	hgsc.bcm.edu	37	7	29548998	29548998	+	Missense_Mutation	SNP	G	G	A	rs201722294		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:29548998G>A	ENST00000222792.6	+	12	1741	c.1211G>A	c.(1210-1212)cGg>cAg	p.R404Q	CHN2_ENST00000421775.2_Missense_Mutation_p.R210Q|CHN2_ENST00000439711.2_Missense_Mutation_p.R222Q|CHN2_ENST00000539389.1_Missense_Mutation_p.R260Q|CHN2_ENST00000409041.4_Missense_Mutation_p.R268Q|CHN2_ENST00000495789.2_Missense_Mutation_p.R417Q|CHN2_ENST00000424025.2_Missense_Mutation_p.R223Q|CHN2_ENST00000539406.1_Missense_Mutation_p.R479Q|CHN2_ENST00000410098.1_3'UTR|CHN2_ENST00000546235.1_Missense_Mutation_p.R389Q|CHN2_ENST00000435288.2_Missense_Mutation_p.R128Q	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	404	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)	p.R404Q(1)		breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						GAAACCCTCCGGTACCTAATG	0.507													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20972	0.0		0.0	False		,,,				2504	0.0				p.R268Q	Ovarian(1;44 48 13232 18918 31480)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G803A	7						.	G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	132.0	117.0	122.0		803,1211	5.6	0.9	7		122	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CHN2	NM_001039936.1,NM_004067.2	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	268/333,404/469	29548998	1,13005	2203	4300	6503	29515523	SO:0001583	missense	1124	exon6			L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.1211G>A	7.37:g.29548998G>A	ENSP00000222792:p.Arg404Gln		29515523	NM_001039936	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	ENST00000222792.6	37	CCDS5420.1	1|1	4.578754578754579E-4|4.578754578754579E-4	1|1	0.0020325203252032522|0.0020325203252032522	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	24.3|24.3	4.512282|4.512282	0.85389|0.85389	0.0|0.0	1.16E-4|1.16E-4	ENSG00000106069|ENSG00000106069	ENST00000433720|ENST00000539406;ENST00000222792;ENST00000435288;ENST00000495789;ENST00000539389;ENST00000546235;ENST00000409041;ENST00000424025;ENST00000439711;ENST00000421775	.|T;T;T;T;T;T;T;T;T;T	.|0.19938	.|2.11;2.11;2.11;2.11;2.11;2.11;2.11;2.11;2.11;2.11	5.57|5.57	5.57|5.57	0.84162|0.84162	.|Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.38348|0.38348	0.1037|0.1037	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	.|P;P;D;D;D;D;D;D;B;P;P;D;D;D	.|0.89917	.|0.668;0.879;1.0;1.0;0.981;0.979;1.0;0.997;0.269;0.879;0.587;0.999;0.991;0.999	.|B;B;D;D;B;P;D;D;B;B;B;D;P;D	.|0.77557	.|0.023;0.18;0.99;0.983;0.364;0.711;0.978;0.941;0.067;0.262;0.03;0.974;0.547;0.974	T|T	0.02698|0.02698	-1.1122|-1.1122	5|10	.|0.15066	.|T	.|0.55	.|.	19.1359|19.1359	0.93428|0.93428	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|197;389;417;479;223;177;196;164;222;210;260;404;268;404	.|B7Z215;B7Z1W9;B7Z1V0;F5H003;B3VCF1;B3VCF2;B3VCF5;B3VCF4;B3VCF7;B3VCF3;B3VCG1;A4D1A2;E9PGE0;P52757	.|.;.;.;.;.;.;.;.;.;.;.;.;.;CHIO_HUMAN	S|Q	83|479;404;128;417;260;389;268;223;222;210	.|ENSP00000444063:R479Q;ENSP00000222792:R404Q;ENSP00000400282:R128Q;ENSP00000438587:R417Q;ENSP00000440526:R260Q;ENSP00000442812:R389Q;ENSP00000386849:R268Q;ENSP00000406337:R223Q;ENSP00000387425:R222Q;ENSP00000394284:R210Q	.|ENSP00000222792:R404Q	G|R	+|+	1|2	0|0	CHN2|CHN2	29515523|29515523	1.000000|1.000000	0.71417|0.71417	0.940000|0.940000	0.37924|0.37924	0.989000|0.989000	0.77384|0.77384	9.869000|9.869000	0.99810|0.99810	2.627000|2.627000	0.88993|0.88993	0.650000|0.650000	0.86243|0.86243	GGT|CGG		0.507	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067	
INMT	11185	hgsc.bcm.edu	37	7	30793463	30793463	+	Missense_Mutation	SNP	C	C	T	rs377250791		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:30793463C>T	ENST00000013222.5	+	2	287	c.271C>T	c.(271-273)Cgg>Tgg	p.R91W	INMT_ENST00000484180.1_3'UTR|INMT-FAM188B_ENST00000458257.1_Missense_Mutation_p.R90W|INMT_ENST00000409539.1_Missense_Mutation_p.R90W	NM_001199219.1|NM_006774.4	NP_001186148.1|NP_006765.4	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	91					amine metabolic process (GO:0009308)|methylation (GO:0032259)|response to toxic substance (GO:0009636)	cytosol (GO:0005829)	amine N-methyltransferase activity (GO:0030748)|thioether S-methyltransferase activity (GO:0004790)	p.R91W(2)		kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|stomach(1)	23						CGACCGCAACCGGGAGGAGCT	0.557																																					p.R91W												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C271T	7						.	C	TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	151.0	153.0	152.0		268,271	2.8	0.3	7		152	0,8600		0,0,4300	no	missense,missense	INMT	NM_001199219.1,NM_006774.4	101,101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging	90/263,91/264	30793463	2,13004	2203	4300	6503	30759988	SO:0001583	missense	11185	exon2				CCDS5430.1, CCDS56479.1	7p14.3	2011-08-30			ENSG00000241644	ENSG00000241644	2.1.1.49		6069	protein-coding gene	gene with protein product		604854				10552930	Standard	NM_001199219		Approved		uc003tbs.1	O95050	OTTHUMG00000167163	ENST00000013222.5:c.271C>T	7.37:g.30793463C>T	ENSP00000013222:p.Arg91Trp		30759988	NM_006774	B8ZZ69|Q3KP49|Q9P1Y2|Q9UBY4|Q9UHQ0	Missense_Mutation	SNP	ENST00000013222.5	37	CCDS5430.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.857709	0.32791	4.54E-4	0.0	ENSG00000241644	ENST00000013222;ENST00000409539	T;T	0.10288	2.89;2.89	3.69	2.77	0.32553	.	0.334565	0.21689	N	0.070611	T	0.31327	0.0793	M	0.80183	2.485	0.50171	D	0.999855	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.994	T	0.03761	-1.1006	10	0.62326	D	0.03	-16.0083	10.1672	0.42888	0.201:0.799:0.0:0.0	.	90;91	B8ZZ69;O95050	.;INMT_HUMAN	W	91;90	ENSP00000013222:R91W;ENSP00000386961:R90W	ENSP00000013222:R91W	R	+	1	2	INMT	30759988	0.983000	0.35010	0.280000	0.24747	0.027000	0.11550	1.444000	0.35068	0.832000	0.34804	0.561000	0.74099	CGG		0.557	INMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214993.3	NM_006774	
ADCYAP1R1	117	hgsc.bcm.edu	37	7	31125024	31125024	+	Silent	SNP	G	G	A	rs148336460		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:31125024G>A	ENST00000304166.4	+	9	925	c.636G>A	c.(634-636)gcG>gcA	p.A212A	ADCYAP1R1_ENST00000396211.2_Silent_p.A212A|ADCYAP1R1_ENST00000409363.1_Silent_p.A191A|ADCYAP1R1_ENST00000409489.1_Silent_p.A212A	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	212					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)	p.A212A(1)		endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						TTCTGTATGCGGAGCAGGACA	0.552																																					p.A212A	Ovarian(44;225 1186 2158 11092)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G636A	7						.	G	,,,	1,4405	2.1+/-5.4	0,1,2202	168.0	134.0	146.0		636,636,636,573	-11.6	0.0	7	dbSNP_134	146	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ADCYAP1R1	NM_001118.4,NM_001199635.1,NM_001199636.1,NM_001199637.1	,,,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,,,	212/469,212/497,212/496,191/448	31125024	2,13004	2203	4300	6503	31091549	SO:0001819	synonymous_variant	117	exon9				CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.636G>A	7.37:g.31125024G>A			31091549	NM_001199636	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Silent	SNP	ENST00000304166.4	37	CCDS5433.1																																																																																				0.552	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118	
PDE1C	5137	hgsc.bcm.edu	37	7	31862737	31862737	+	Missense_Mutation	SNP	G	G	A	rs148019533		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:31862737G>A	ENST00000396191.1	-	14	1987	c.1532C>T	c.(1531-1533)aCg>aTg	p.T511M	PDE1C_ENST00000396182.2_Missense_Mutation_p.T511M|PDE1C_ENST00000321453.7_Missense_Mutation_p.T511M|PDE1C_ENST00000479980.1_5'Flank|PDE1C_ENST00000396193.1_Missense_Mutation_p.T571M|PDE1C_ENST00000396184.3_Missense_Mutation_p.T511M	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	511	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.T511M(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	CACCACTTCCGTCCAAGTAGC	0.488													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18957	0.0		0.0	False		,,,				2504	0.0				p.T511M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1532T	7						.	G	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	3,4403	6.2+/-15.9	0,3,2200	185.0	160.0	168.0		1532,1532,1712,1532,1532	5.8	1.0	7	dbSNP_134	168	0,8600		0,0,4300	yes	missense,missense,missense,missense,missense	PDE1C	NM_001191056.1,NM_001191057.1,NM_001191058.1,NM_001191059.1,NM_005020.2	81,81,81,81,81	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign,benign,benign,benign,benign	511/635,511/710,571/770,511/710,511/635	31862737	3,13003	2203	4300	6503	31829262	SO:0001583	missense	5137	exon14			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1532C>T	7.37:g.31862737G>A	ENSP00000379494:p.Thr511Met		31829262	NM_001191056	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	37	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626243	0.28978	6.81E-4	0.0	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.72615	-0.67;-0.66;-0.66;-0.64;-0.64	5.79	5.79	0.91817	.	0.676943	0.15219	N	0.274059	T	0.68026	0.2956	N	0.24115	0.695	0.44136	D	0.996928	P;P;D	0.63046	0.727;0.658;0.992	B;B;P	0.53689	0.145;0.074;0.732	T	0.62690	-0.6801	10	0.27082	T	0.32	.	14.4606	0.67445	0.0:0.0:0.8528:0.1472	.	511;571;511	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	M	571;511;511;511;511	ENSP00000379496:T571M;ENSP00000379494:T511M;ENSP00000318105:T511M;ENSP00000379487:T511M;ENSP00000379485:T511M	ENSP00000318105:T511M	T	-	2	0	PDE1C	31829262	1.000000	0.71417	0.964000	0.40570	0.531000	0.34715	6.502000	0.73695	2.739000	0.93911	0.563000	0.77884	ACG		0.488	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
BMPER	168667	hgsc.bcm.edu	37	7	34118474	34118474	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:34118474G>A	ENST00000297161.2	+	13	1458	c.1084G>A	c.(1084-1086)Ggc>Agc	p.G362S	BMPER_ENST00000426693.1_Missense_Mutation_p.G362S	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	362					blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.G362S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CGCAGAGCCCGGCGTTTGCAC	0.527																																					p.G362S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1084A	7						.						55.0	60.0	58.0					7																	34118474		2203	4300	6503	34084999	SO:0001583	missense	168667	exon12				CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1084G>A	7.37:g.34118474G>A	ENSP00000297161:p.Gly362Ser		34084999	NM_133468	A8K1P8|Q8TF36	Missense_Mutation	SNP	ENST00000297161.2	37	CCDS5442.1	.	.	.	.	.	.	.	.	.	.	G	35	5.576871	0.96565	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.21361	2.01;2.01	5.76	5.76	0.90799	von Willebrand factor, type D domain (1);	0.000000	0.85682	D	0.000000	T	0.46190	0.1380	L	0.58583	1.82	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.16719	-1.0393	10	0.49607	T	0.09	.	19.9664	0.97271	0.0:0.0:1.0:0.0	.	362	Q8N8U9	BMPER_HUMAN	S	362	ENSP00000297161:G362S;ENSP00000393950:G362S	ENSP00000297161:G362S	G	+	1	0	BMPER	34084999	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.476000	0.97823	2.718000	0.92993	0.655000	0.94253	GGC		0.527	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
MAGI2	9863	hgsc.bcm.edu	37	7	77885570	77885570	+	Silent	SNP	G	G	A	rs142555732		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:77885570G>A	ENST00000354212.4	-	10	1990	c.1737C>T	c.(1735-1737)gaC>gaT	p.D579D	MAGI2_ENST00000535697.1_Silent_p.D416D|MAGI2_ENST00000522391.1_Silent_p.D579D|MAGI2_ENST00000536571.1_Silent_p.D411D|MAGI2_ENST00000419488.1_Silent_p.D579D	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	579					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.D579D(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GATACGTGCCGTCTAGCTGAC	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		19056	0.0		0.001	False		,,,				2504	0.0				p.D579D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1737T	7						.	G		0,4406		0,0,2203	110.0	94.0	99.0		1737	4.7	1.0	7	dbSNP_134	99	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	MAGI2	NM_012301.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		579/1456	77885570	2,13004	2203	4300	6503	77723506	SO:0001819	synonymous_variant	9863	exon10			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1737C>T	7.37:g.77885570G>A			77723506	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	37	CCDS5594.1																																																																																				0.507	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
COL1A2	1278	hgsc.bcm.edu	37	7	94054953	94054953	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:94054953G>A	ENST00000297268.6	+	43	3284	c.2813G>A	c.(2812-2814)cGc>cAc	p.R938H		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	938					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.R938H(2)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CCCCCAGGTCGCGATGGTCAA	0.488										HNSCC(75;0.22)																											p.R938H												.	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.G2813A	7						.						107.0	97.0	101.0					7																	94054953		2203	4300	6503	93892889	SO:0001583	missense	1278	exon43			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2813G>A	7.37:g.94054953G>A	ENSP00000297268:p.Arg938His		93892889	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677284	0.88445	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.94280	-3.39	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.95943	0.8679	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95785	0.8820	10	0.72032	D	0.01	.	19.5787	0.95455	0.0:0.0:1.0:0.0	.	938	P08123	CO1A2_HUMAN	H	938;939	ENSP00000297268:R938H	ENSP00000297268:R938H	R	+	2	0	COL1A2	93892889	1.000000	0.71417	0.995000	0.50966	0.930000	0.56654	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	CGC		0.488	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
DYNC1I1	1780	hgsc.bcm.edu	37	7	95442514	95442514	+	Missense_Mutation	SNP	C	C	T	rs199740432		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:95442514C>T	ENST00000324972.6	+	4	423	c.230C>T	c.(229-231)cCg>cTg	p.P77L	DYNC1I1_ENST00000437599.1_Missense_Mutation_p.P77L|DYNC1I1_ENST00000537881.1_Intron|DYNC1I1_ENST00000447467.2_Intron|DYNC1I1_ENST00000413338.1_Intron|DYNC1I1_ENST00000359388.4_Intron|DYNC1I1_ENST00000457059.1_Intron	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	77	Interaction with DCTN1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.P77L(2)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CCAGTGCAGCCGCTGCATTTT	0.433																																					p.P77L												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C230T	7						.	C	,,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	115.0	118.0	117.0		,,230	4.8	1.0	7		117	0,8600		0,0,4300	no	intron,intron,missense	DYNC1I1	NM_001135556.1,NM_001135557.1,NM_004411.4	,,98	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,benign	,,77/646	95442514	1,13005	2203	4300	6503	95280450	SO:0001583	missense	1780	exon4			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.230C>T	7.37:g.95442514C>T	ENSP00000320130:p.Pro77Leu		95280450	NM_004411	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201908	0.58234	2.27E-4	0.0	ENSG00000158560	ENST00000324972;ENST00000437599	T;T	0.70986	-0.48;-0.53	4.79	4.79	0.61399	.	0.539313	0.15764	N	0.245797	T	0.65512	0.2698	L	0.36672	1.1	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.61671	-0.7015	10	0.66056	D	0.02	-21.0814	19.1533	0.93499	0.0:1.0:0.0:0.0	.	77;77	G5E9K1;O14576	.;DC1I1_HUMAN	L	77	ENSP00000320130:P77L;ENSP00000398118:P77L	ENSP00000320130:P77L	P	+	2	0	DYNC1I1	95280450	1.000000	0.71417	0.978000	0.43139	0.974000	0.67602	4.540000	0.60664	2.941000	0.99782	0.655000	0.94253	CCG		0.433	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
OR2AE1	81392	hgsc.bcm.edu	37	7	99473808	99473808	+	Silent	SNP	T	T	G	rs150118912	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:99473808T>G	ENST00000316368.2	-	1	872	c.849A>C	c.(847-849)acA>acC	p.T283T		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GAGAATTCAATGTGGGCGTAA	0.463																																					p.T283T												.	.	0			c.A849C	7						.						113.0	117.0	116.0					7																	99473808		2203	4300	6503	99311744	SO:0001819	synonymous_variant	81392	exon1			AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.849A>C	7.37:g.99473808T>G			99311744	NM_001005276	B2RPD2	Silent	SNP	ENST00000316368.2	37	CCDS34696.1																																																																																				0.463	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345053.1		
HTR5A	3361	hgsc.bcm.edu	37	7	154875902	154875902	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr7:154875902C>T	ENST00000287907.2	+	2	1355	c.779C>T	c.(778-780)aCg>aTg	p.T260M	HTR5A_ENST00000486819.1_3'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	260					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)	p.T260M(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	ATGGTGTTCACGGTCCGCCAC	0.612																																					p.T260M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C779T	7						.						61.0	52.0	55.0					7																	154875902		2203	4300	6503	154506835	SO:0001583	missense	3361	exon2				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.779C>T	7.37:g.154875902C>T	ENSP00000287907:p.Thr260Met		154506835	NM_024012	Q2M2D2	Missense_Mutation	SNP	ENST00000287907.2	37	CCDS5936.1	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512338	0.64522	.	.	ENSG00000157219	ENST00000287907	T	0.71817	-0.6	4.86	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.741780	0.12290	N	0.482061	T	0.81489	0.4833	M	0.79123	2.44	0.80722	D	1	D	0.62365	0.991	P	0.53912	0.737	T	0.81562	-0.0876	10	0.46703	T	0.11	.	18.0042	0.89205	0.0:1.0:0.0:0.0	.	260	P47898	5HT5A_HUMAN	M	260	ENSP00000287907:T260M	ENSP00000287907:T260M	T	+	2	0	HTR5A	154506835	1.000000	0.71417	0.433000	0.26760	0.032000	0.12392	7.473000	0.81007	2.239000	0.73571	0.609000	0.83330	ACG		0.612	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012	
MACROD2	140733	hgsc.bcm.edu	37	20	15866410	15866410	+	Splice_Site	SNP	C	C	T	rs374819973	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr20:15866410C>T	ENST00000310348.4	+	10	729	c.729C>T	c.(727-729)gaC>gaT	p.D243D	MACROD2_ENST00000217246.4_Splice_Site_p.D243D|MACROD2_ENST00000378058.3_Splice_Site_p.D8D|MACROD2_ENST00000402914.1_Splice_Site_p.D8D			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	243					brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.D243D(2)|p.D8D(2)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				TTTTAACAGACGATAATAATG	0.289													C|||	2	0.000399361	0.0015	0.0	5008	,	,		15253	0.0		0.0	False		,,,				2504	0.0				p.D8D												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.C24T	20						.	C	,	2,4392	4.2+/-10.8	0,2,2195	71.0	85.0	80.0		24,729	4.2	1.0	20		80	0,8578		0,0,4289	no	coding-synonymous-near-splice,coding-synonymous-near-splice	MACROD2	NM_001033087.1,NM_080676.5	,	0,2,6484	TT,TC,CC		0.0,0.0455,0.0154	,	8/214,243/426	15866410	2,12970	2197	4289	6486	15814410	SO:0001630	splice_region_variant	140733	exon6			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.728-1C>T	20.37:g.15866410C>T			15814410	NM_001033087	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Silent	SNP	ENST00000310348.4	37	CCDS13120.2																																																																																				0.289	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	Silent
ITPA	3704	hgsc.bcm.edu	37	20	3204033	3204033	+	Silent	SNP	G	G	A	rs374703513		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr20:3204033G>A	ENST00000380113.3	+	8	702	c.510G>A	c.(508-510)gcG>gcA	p.A170A	ITPA_ENST00000399838.3_Silent_p.A129A|ITPA_ENST00000455664.2_Silent_p.A153A|ITPA_ENST00000483354.1_3'UTR	NM_033453.3|NM_181493.2	NP_258412.1|NP_852470.1			inosine triphosphatase (nucleoside triphosphate pyrophosphatase)									p.A170A(1)		autonomic_ganglia(1)|large_intestine(3)|ovary(1)|stomach(1)	6						TGCCTAAGGCGGAGAAGAACG	0.597																																					p.A170A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G510A	20						.	G	,	0,4406		0,0,2203	65.0	49.0	55.0		510,459	-11.6	0.1	20		55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	ITPA	NM_033453.2,NM_181493.1	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	170/195,153/178	3204033	1,13005	2203	4300	6503	3152033	SO:0001819	synonymous_variant	3704	exon8			AF026816	CCDS13051.1, CCDS46576.1, CCDS58762.1	20p	2002-02-01			ENSG00000125877	ENSG00000125877	3.6.1.19		6176	protein-coding gene	gene with protein product		147520		C20orf37		11278832	Standard	NM_033453		Approved	HLC14-06-P, dJ794I6.3	uc002wid.4	Q9BY32	OTTHUMG00000031738	ENST00000380113.3:c.510G>A	20.37:g.3204033G>A			3152033	NM_033453		Silent	SNP	ENST00000380113.3	37	CCDS13051.1																																																																																				0.597	ITPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077719.2		
ZNF337	26152	hgsc.bcm.edu	37	20	25656188	25656188	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr20:25656188C>T	ENST00000376436.1	-	4	2275	c.1736G>A	c.(1735-1737)cGa>cAa	p.R579Q	ZNF337_ENST00000481610.1_5'Flank|RP4-694B14.5_ENST00000421829.1_RNA|RP4-694B14.5_ENST00000439498.1_RNA|RP4-694B14.5_ENST00000455791.1_RNA|ZNF337_ENST00000538750.1_Missense_Mutation_p.R547Q|ZNF337_ENST00000252979.5_Missense_Mutation_p.R579Q|RP4-694B14.5_ENST00000428254.1_RNA|RP4-694B14.5_ENST00000414393.1_RNA			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	579					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R579Q(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GATGAAGCCTCGCCCGCAATC	0.458																																					p.R579Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1736A	20						.						97.0	93.0	94.0					20																	25656188		2203	4300	6503	25604188	SO:0001583	missense	26152	exon5				CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.1736G>A	20.37:g.25656188C>T	ENSP00000365619:p.Arg579Gln		25604188	NM_015655	B4DSM2|Q9Y3Y5	Missense_Mutation	SNP	ENST00000376436.1	37	CCDS13174.1	.	.	.	.	.	.	.	.	.	.	.	19.78	3.890257	0.72524	.	.	ENSG00000130684	ENST00000376436;ENST00000252979;ENST00000538750	T;T;T	0.18960	2.18;2.18;2.18	1.29	-2.57	0.06248	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11836	0.0288	L	0.31294	0.92	0.09310	N	0.999995	B;B	0.22414	0.069;0.069	B;B	0.06405	0.002;0.002	T	0.22452	-1.0216	9	0.87932	D	0	.	2.8338	0.05508	0.2015:0.3231:0.0:0.4754	.	547;579	B4DSM2;Q9Y3M9	.;ZN337_HUMAN	Q	579;579;547	ENSP00000365619:R579Q;ENSP00000252979:R579Q;ENSP00000442181:R547Q	ENSP00000252979:R579Q	R	-	2	0	ZNF337	25604188	0.943000	0.32029	0.000000	0.03702	0.880000	0.50808	2.148000	0.42235	-1.288000	0.02378	0.298000	0.19748	CGA		0.458	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078454.1		
SMOX	54498	hgsc.bcm.edu	37	20	4164184	4164184	+	Silent	SNP	C	C	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr20:4164184C>A	ENST00000305958.4	+	6	1638	c.1413C>A	c.(1411-1413)gcC>gcA	p.A471A	SMOX_ENST00000339123.6_Silent_p.A418A|SMOX_ENST00000346595.2_Intron|SMOX_ENST00000278795.3_Silent_p.A418A|SMOX_ENST00000379460.2_Silent_p.A471A	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	471					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)	p.A418A(1)|p.A471A(1)		breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	TGCGCTCGGCCTGGGGCAGCA	0.582																																					p.A418A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1254A	20						.						83.0	89.0	87.0					20																	4164184		2203	4300	6503	4112184	SO:0001819	synonymous_variant	54498	exon7			AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.1413C>A	20.37:g.4164184C>A			4112184	NM_175840	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Silent	SNP	ENST00000305958.4	37	CCDS13075.1																																																																																				0.582	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
CPNE1	8904	hgsc.bcm.edu	37	20	34214270	34214270	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr20:34214270C>T	ENST00000317619.3	-	18	1901	c.1507G>A	c.(1507-1509)Gca>Aca	p.A503T	CPNE1_ENST00000352393.4_Missense_Mutation_p.A503T|CPNE1_ENST00000317677.5_Missense_Mutation_p.A508T|CPNE1_ENST00000397442.1_Missense_Mutation_p.A447T|CPNE1_ENST00000397445.1_Missense_Mutation_p.A503T|CPNE1_ENST00000397443.1_Missense_Mutation_p.A503T|CPNE1_ENST00000397446.1_Missense_Mutation_p.A503T			Q99829	CPNE1_HUMAN	copine I	503	VWFA.				lipid metabolic process (GO:0006629)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.A503T(1)		breast(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GGCACTTCTGCGAGCACGGTC	0.597																																					p.A503T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1507A	20						.						90.0	102.0	98.0					20																	34214270		2203	4300	6503	33677684	SO:0001583	missense	8904	exon17			U83246	CCDS13260.1, CCDS46595.1	20q11.22	2009-06-01			ENSG00000214078	ENSG00000214078			2314	protein-coding gene	gene with protein product		604205				9430674	Standard	NM_152925		Approved	CPN1	uc002xdm.3	Q99829	OTTHUMG00000032356	ENST00000317619.3:c.1507G>A	20.37:g.34214270C>T	ENSP00000326126:p.Ala503Thr		33677684	NM_152927	E1P5Q4|Q6IBL3|Q9H243|Q9NTZ7	Missense_Mutation	SNP	ENST00000317619.3	37	CCDS13260.1	.	.	.	.	.	.	.	.	.	.	C	32	5.146759	0.94603	.	.	ENSG00000214078	ENST00000352393;ENST00000415920;ENST00000317677;ENST00000317619;ENST00000397446;ENST00000397445;ENST00000397443;ENST00000397442;ENST00000437340	T;T;T;T;T;T;T;T	0.09911	3.32;3.31;3.32;3.32;3.32;3.32;2.93;3.2	5.14	5.14	0.70334	.	0.135690	0.48767	U	0.000177	T	0.49932	0.1586	H	0.97315	3.98	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0	D;D;P;P;P	0.77557	0.95;0.99;0.869;0.871;0.881	T	0.68655	-0.5351	10	0.87932	D	0	-5.5971	17.5271	0.87803	0.0:1.0:0.0:0.0	.	508;447;503;483;502	B0QZ18;A6PVH9;Q99829;Q59EI4;F2Z2V0	.;.;CPNE1_HUMAN;.;.	T	503;143;508;503;503;503;503;447;502	ENSP00000336945:A503T;ENSP00000317257:A508T;ENSP00000326126:A503T;ENSP00000380588:A503T;ENSP00000380587:A503T;ENSP00000380585:A503T;ENSP00000380584:A447T;ENSP00000415597:A502T	ENSP00000326126:A503T	A	-	1	0	CPNE1	33677684	1.000000	0.71417	0.994000	0.49952	0.639000	0.38242	7.574000	0.82434	2.668000	0.90789	0.462000	0.41574	GCA		0.597	CPNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078909.3	NM_152930	
GDAP1L1	78997	hgsc.bcm.edu	37	20	42907758	42907758	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr20:42907758C>T	ENST00000342560.5	+	6	1010	c.922C>T	c.(922-924)Cgc>Tgc	p.R308C	GDAP1L1_ENST00000537864.1_Missense_Mutation_p.R116C	NM_001256737.1|NM_024034.4	NP_001243666.1|NP_076939.3	Q96MZ0	GD1L1_HUMAN	ganglioside induced differentiation associated protein 1-like 1	308	GST C-terminal.							p.R308C(1)		endometrium(1)|large_intestine(5)|lung(10)|pancreas(1)|prostate(1)	18		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GGTCCAGAGACGCTTTGCCTT	0.587																																					p.R308C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C922T	20						.						109.0	98.0	102.0					20																	42907758		2203	4300	6503	42341172	SO:0001583	missense	78997	exon6				CCDS13328.1, CCDS74725.1, CCDS74726.1, CCDS74727.1	20q12	2012-02-09	2012-02-09		ENSG00000124194	ENSG00000124194			4213	protein-coding gene	gene with protein product							Standard	NM_024034		Approved		uc010zwl.3	Q96MZ0	OTTHUMG00000032530	ENST00000342560.5:c.922C>T	20.37:g.42907758C>T	ENSP00000341782:p.Arg308Cys		42341172	NM_024034	B7Z621|Q5TE60|Q68CW7|Q9BQJ7|Q9BQV4|Q9BWJ4|Q9H3Y2|Q9H4G5	Missense_Mutation	SNP	ENST00000342560.5	37	CCDS13328.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501068	0.85176	.	.	ENSG00000124194	ENST00000342560;ENST00000372947;ENST00000372946;ENST00000545149;ENST00000262604;ENST00000438466;ENST00000537864;ENST00000447658	D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81	4.99	4.99	0.66335	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97629	0.9223	M	0.78916	2.43	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.99;0.976;0.952	D	0.98385	1.0560	10	0.87932	D	0	.	18.6372	0.91383	0.0:1.0:0.0:0.0	.	250;327;308	B7Z1I3;B7Z621;Q96MZ0	.;.;GD1L1_HUMAN	C	308;303;250;274;94;250;116;90	ENSP00000341782:R308C;ENSP00000392881:R250C;ENSP00000440498:R116C;ENSP00000391714:R90C	ENSP00000262604:R94C	R	+	1	0	GDAP1L1	42341172	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.358000	0.79466	2.482000	0.83794	0.591000	0.81541	CGC		0.587	GDAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079356.1	NM_024034	
ZSWIM3	140831	hgsc.bcm.edu	37	20	44506882	44506882	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr20:44506882G>A	ENST00000255152.2	+	2	1894	c.1685G>A	c.(1684-1686)cGa>cAa	p.R562Q	ZSWIM1_ENST00000372523.1_5'Flank|ZSWIM3_ENST00000454862.2_Missense_Mutation_p.R556Q|ZSWIM1_ENST00000372520.1_5'Flank	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	562							zinc ion binding (GO:0008270)	p.R562Q(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				CTGCCATGCCGACACATTTTG	0.557																																					p.R562Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1685A	20						.						70.0	64.0	66.0					20																	44506882		2203	4300	6503	43940289	SO:0001583	missense	140831	exon2			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1685G>A	20.37:g.44506882G>A	ENSP00000255152:p.Arg562Gln		43940289	NM_080752	Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	37	CCDS13381.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451110	0.84209	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.51071	0.73;0.72	5.36	5.36	0.76844	Zinc finger, PMZ-type (1);Zinc finger, SWIM-type (2);	0.000000	0.64402	D	0.000001	T	0.61324	0.2338	L	0.36672	1.1	0.40727	D	0.982713	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.60900	-0.7171	10	0.49607	T	0.09	-26.9861	18.8841	0.92368	0.0:0.0:1.0:0.0	.	556;562	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	Q	562;556	ENSP00000255152:R562Q;ENSP00000406313:R556Q	ENSP00000255152:R562Q	R	+	2	0	ZSWIM3	43940289	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.048000	0.71046	2.793000	0.96121	0.561000	0.74099	CGA		0.557	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752	
PLTP	5360	hgsc.bcm.edu	37	20	44533618	44533618	+	Missense_Mutation	SNP	C	C	T	rs56126980	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr20:44533618C>T	ENST00000477313.1	-	8	1439	c.845G>A	c.(844-846)cGg>cAg	p.R282Q	PLTP_ENST00000420868.2_Missense_Mutation_p.R187Q|PLTP_ENST00000372420.1_Missense_Mutation_p.R194Q|PLTP_ENST00000542937.1_Missense_Mutation_p.R302Q|PLTP_ENST00000354050.4_Missense_Mutation_p.R230Q|PLTP_ENST00000372431.3_Missense_Mutation_p.R282Q			P55058	PLTP_HUMAN	phospholipid transfer protein	282			R -> Q. {ECO:0000269|PubMed:12966036}.		lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)	p.R282Q(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				GGCCCCCGCCCGGAAGTAGCT	0.602													C|||	3	0.000599042	0.0	0.0	5008	,	,		22052	0.0		0.003	False		,,,				2504	0.0				p.R282Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G845A	20						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	7,4399	12.9+/-30.5	0,7,2196	67.0	68.0	68.0		560,581,845,689	0.7	1.0	20	dbSNP_129	68	19,8581	14.0+/-48.4	0,19,4281	yes	missense,missense,missense,missense	PLTP	NM_001242920.1,NM_001242921.1,NM_006227.3,NM_182676.2	43,43,43,43	0,26,6477	TT,TC,CC		0.2209,0.1589,0.1999	benign,benign,benign,benign	187/399,194/406,282/494,230/442	44533618	26,12980	2203	4300	6503	43967025	SO:0001583	missense	5360	exon9			L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.845G>A	20.37:g.44533618C>T	ENSP00000417138:p.Arg282Gln		43967025	NM_006227	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Missense_Mutation	SNP	ENST00000477313.1	37	CCDS13386.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	11.97	1.796268	0.31777	0.001589	0.002209	ENSG00000100979	ENST00000372420;ENST00000372431;ENST00000354050;ENST00000477313;ENST00000542937;ENST00000420868	T;T;T;T;T;T	0.08634	3.07;3.07;3.07;3.07;3.07;3.07	5.25	0.74	0.18330	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.544953	0.20727	N	0.086793	T	0.02418	0.0074	N	0.02142	-0.665	0.24296	N	0.995146	B;B;B;B;B;B;B	0.17852	0.024;0.024;0.021;0.007;0.006;0.007;0.013	B;B;B;B;B;B;B	0.11329	0.003;0.003;0.006;0.003;0.002;0.003;0.003	T	0.47086	-0.9144	10	0.06365	T	0.9	-4.8757	9.2863	0.37760	0.0:0.4026:0.0:0.5974	rs56126980	187;187;194;282;230;282;302	E7EV16;B4DRB4;B4DDD5;Q53H91;P55058-2;P55058;B3KUE5	.;.;.;.;.;PLTP_HUMAN;.	Q	194;282;230;282;302;187	ENSP00000361497:R194Q;ENSP00000361508:R282Q;ENSP00000335290:R230Q;ENSP00000417138:R282Q;ENSP00000440296:R302Q;ENSP00000411671:R187Q	ENSP00000335290:R230Q	R	-	2	0	PLTP	43967025	0.937000	0.31787	0.986000	0.45419	0.946000	0.59487	0.760000	0.26475	-0.098000	0.12285	0.563000	0.77884	CGG		0.602	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	NM_006227	
SLC23A2	9962	hgsc.bcm.edu	37	20	4842649	4842649	+	Silent	SNP	C	C	T	rs148408148		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr20:4842649C>T	ENST00000379333.1	-	15	1961	c.1569G>A	c.(1567-1569)tcG>tcA	p.S523S	SLC23A2_ENST00000338244.1_Silent_p.S523S|SLC23A2_ENST00000424750.2_Silent_p.S409S	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	523					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.S523S(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CAAAGAAGATCGAAAATCCAA	0.468																																					p.S523S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1569A	20						.						101.0	101.0	101.0					20																	4842649		2203	4300	6503	4790649	SO:0001819	synonymous_variant	9962	exon15			AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1569G>A	20.37:g.4842649C>T			4790649	NM_203327	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Silent	SNP	ENST00000379333.1	37	CCDS13085.1	.	.	.	.	.	.	.	.	.	.	C	9.769	1.172091	0.21704	.	.	ENSG00000089057	ENST00000423430	.	.	.	5.35	-4.77	0.03219	.	.	.	.	.	T	0.50274	0.1606	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51687	-0.8674	4	.	.	.	-15.0572	7.9507	0.30012	0.0841:0.0733:0.5937:0.2489	.	.	.	.	N	280	.	.	D	-	1	0	SLC23A2	4790649	0.150000	0.22732	0.979000	0.43373	0.984000	0.73092	-0.577000	0.05847	-0.536000	0.06298	-0.379000	0.06801	GAT		0.468	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
ZNFX1	57169	hgsc.bcm.edu	37	20	47868134	47868134	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr20:47868134C>T	ENST00000396105.1	-	13	3488	c.3242G>A	c.(3241-3243)cGc>cAc	p.R1081H	ZNFX1_ENST00000371752.1_Missense_Mutation_p.R1081H|ZNFX1_ENST00000371754.4_Missense_Mutation_p.R1081H	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1081							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R1081H(2)		cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GGTCAAAAGGCGGGCAATTTC	0.433																																					p.R1081H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3242A	20						.						77.0	71.0	73.0					20																	47868134		2203	4300	6503	47301541	SO:0001583	missense	57169	exon13			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.3242G>A	20.37:g.47868134C>T	ENSP00000379412:p.Arg1081His		47301541	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.121017	0.56613	.	.	ENSG00000124201	ENST00000371754;ENST00000371752;ENST00000396105	T;D;D	0.82433	1.91;-1.61;-1.61	6.01	3.07	0.35406	.	0.338680	0.35903	N	0.002901	T	0.79375	0.4435	M	0.68952	2.095	0.38598	D	0.950607	B	0.21309	0.054	B	0.20184	0.028	T	0.77164	-0.2688	10	0.59425	D	0.04	-21.214	8.9114	0.35555	0.0:0.713:0.0:0.287	.	1081	Q9P2E3	ZNFX1_HUMAN	H	1081	ENSP00000360819:R1081H;ENSP00000360817:R1081H;ENSP00000379412:R1081H	ENSP00000360817:R1081H	R	-	2	0	ZNFX1	47301541	0.911000	0.30947	1.000000	0.80357	0.997000	0.91878	1.551000	0.36233	0.890000	0.36211	0.643000	0.83706	CGC		0.433	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
PSMB5	5693	hgsc.bcm.edu	37	14	23495357	23495357	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:23495357G>A	ENST00000361611.6	-	3	996	c.733C>T	c.(733-735)Cga>Tga	p.R245*	PSMB5_ENST00000460922.2_3'UTR|PSMB5_ENST00000493471.2_3'UTR|PSMB5_ENST00000425762.2_Nonsense_Mutation_p.R142*	NM_002797.3	NP_002788.1	P28074	PSB5_HUMAN	proteasome (prosome, macropain) subunit, beta type, 5	245					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to oxidative stress (GO:0006979)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)	p.R245*(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)|Carfilzomib(DB08889)	CTGGAGACTCGGATCCAGCCA	0.547																																					p.R245X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C733T	14						.						156.0	137.0	143.0					14																	23495357		2203	4300	6503	22565197	SO:0001587	stop_gained	5693	exon3			D29011	CCDS9584.1, CCDS45083.1, CCDS45084.1	14q11.2	2008-08-29			ENSG00000100804	ENSG00000100804		"""Proteasome (prosome, macropain) subunits"""	9542	protein-coding gene	gene with protein product		600306				8066462, 8811196	Standard	NM_001130725		Approved	X, MB1	uc001wii.3	P28074	OTTHUMG00000028713	ENST00000361611.6:c.733C>T	14.37:g.23495357G>A	ENSP00000355325:p.Arg245*		22565197	NM_002797	B2R4N9|B4DUM9|D3DS43|E9PAV2|Q16242|Q6PEW2|Q7Z3B5|Q86T01|Q9TNN9	Nonsense_Mutation	SNP	ENST00000361611.6	37	CCDS9584.1	.	.	.	.	.	.	.	.	.	.	G	32	5.149995	0.94645	.	.	ENSG00000100804	ENST00000361611;ENST00000425762	.	.	.	5.49	3.67	0.42095	.	0.061061	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-0.2265	9.9559	0.41666	0.0734:0.0:0.7881:0.1385	.	.	.	.	X	245;142	.	ENSP00000355325:R245X	R	-	1	2	PSMB5	22565197	1.000000	0.71417	0.988000	0.46212	0.703000	0.40648	2.812000	0.47994	0.707000	0.31934	-1.103000	0.02113	CGA		0.547	PSMB5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071695.4	NM_002797	
CMTM5	116173	hgsc.bcm.edu	37	14	23847590	23847590	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:23847590G>A	ENST00000339180.4	+	2	375	c.159G>A	c.(157-159)acG>acA	p.T53T	CMTM5_ENST00000555731.1_Intron|CMTM5_ENST00000382809.2_Silent_p.T53T|CMTM5_ENST00000342473.4_Intron|CMTM5_ENST00000397227.3_Intron|CMTM5_ENST00000359320.3_Silent_p.T53T			Q96DZ9	CKLF5_HUMAN	CKLF-like MARVEL transmembrane domain containing 5	53	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.T53T(1)		endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	8	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.0064)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0382)		TCTGCTTCACGGCCTCCATCT	0.592																																					p.T53T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G159A	14						.						193.0	144.0	161.0					14																	23847590		2203	4300	6503	22917430	SO:0001819	synonymous_variant	116173	exon2			BC013109	CCDS9598.1, CCDS32050.1, CCDS73617.1, CCDS73618.1, CCDS73619.1	14q11.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000166091	ENSG00000166091			19176	protein-coding gene	gene with protein product		607888	"""chemokine-like factor super family 5"", ""chemokine-like factor superfamily 5"""	CKLFSF5			Standard	NM_138460		Approved	FLJ37521	uc001wjs.3	Q96DZ9	OTTHUMG00000028751	ENST00000339180.4:c.159G>A	14.37:g.23847590G>A			22917430	NM_138460	E9PH91|Q5PY48	Silent	SNP	ENST00000339180.4	37																																																																																					0.592	CMTM5-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000133708.2		
MYH7	4625	hgsc.bcm.edu	37	14	23893217	23893217	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:23893217G>A	ENST00000355349.3	-	23	2983	c.2821C>T	c.(2821-2823)Cgc>Tgc	p.R941C		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	941					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.R941C(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCCAGCTTGCGCTTCTTGGCA	0.507																																					p.R941C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2821T	14						.						247.0	207.0	221.0					14																	23893217		2203	4300	6503	22963057	SO:0001583	missense	4625	exon23			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2821C>T	14.37:g.23893217G>A	ENSP00000347507:p.Arg941Cys		22963057	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868407	0.72065	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.86497	-2.13	5.33	5.33	0.75918	.	.	.	.	.	D	0.94798	0.8320	M	0.92880	3.355	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95315	0.8415	9	0.66056	D	0.02	.	15.0102	0.71545	0.0:0.0:0.849:0.151	.	941	P12883	MYH7_HUMAN	C	941	ENSP00000347507:R941C	ENSP00000347507:R941C	R	-	1	0	MYH7	22963057	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.164000	0.50770	2.778000	0.95560	0.655000	0.94253	CGC		0.507	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
AP1G2	8906	hgsc.bcm.edu	37	14	24032794	24032794	+	Splice_Site	SNP	G	G	A	rs370083184		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:24032794G>A	ENST00000308724.5	-	12	2041	c.1286C>T	c.(1285-1287)aCg>aTg	p.T429M	AP1G2_ENST00000397120.3_Splice_Site_p.T429M|RP11-66N24.3_ENST00000555968.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|AP1G2_ENST00000556277.1_5'Flank	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	429				T -> S (in Ref. 2; AAC67390). {ECO:0000305}.	intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)	p.T429M(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		CTGCCTCACCGTTGTCAGCAC	0.577											OREG0022605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T429M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1286T	14						.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	119.0	92.0	101.0		1286	2.7	1.0	14		101	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice	AP1G2	NM_003917.2	81	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	possibly-damaging	429/786	24032794	2,13004	2203	4300	6503	23102634	SO:0001630	splice_region_variant	8906	exon13			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1287+1C>T	14.37:g.24032794G>A		768	23102634	NM_003917	D3DS51|O75504	Missense_Mutation	SNP	ENST00000308724.5	37	CCDS9602.1	.	.	.	.	.	.	.	.	.	.	G	9.738	1.163995	0.21538	2.27E-4	1.16E-4	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000545295;ENST00000535852	T;T	0.13657	2.57;2.57	4.5	2.68	0.31781	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.111856	0.64402	N	0.000012	T	0.15262	0.0368	M	0.70903	2.155	0.46678	D	0.999152	B;P	0.45569	0.32;0.861	B;B	0.40741	0.238;0.339	T	0.03249	-1.1056	10	0.35671	T	0.21	-2.8905	8.077	0.30722	0.1974:0.0:0.8026:0.0	.	429;284	O75843;Q86V28	AP1G2_HUMAN;.	M	429;429;198;284	ENSP00000312442:T429M;ENSP00000380309:T429M	ENSP00000312442:T429M	T	-	2	0	AP1G2	23102634	1.000000	0.71417	0.969000	0.41365	0.198000	0.23893	0.895000	0.28363	0.519000	0.28406	0.557000	0.71058	ACG		0.577	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917	Missense_Mutation
TGM1	7051	hgsc.bcm.edu	37	14	24731044	24731044	+	Missense_Mutation	SNP	G	G	A	rs141486741	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:24731044G>A	ENST00000206765.6	-	3	488	c.365C>T	c.(364-366)tCg>tTg	p.S122L	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	122					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.S122L(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GTTCTGGTCCGAGCGCGAGCT	0.607													G|||	31	0.0061901	0.0234	0.0	5008	,	,		17835	0.0		0.0	False		,,,				2504	0.0				p.S122L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C365T	14						.	G	LEU/SER	54,4352	53.6+/-89.4	1,52,2150	99.0	92.0	94.0		365	5.3	0.1	14	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	yes	missense	TGM1	NM_000359.2	145	1,53,6449	AA,AG,GG		0.0116,1.2256,0.4229	probably-damaging	122/818	24731044	55,12951	2203	4300	6503	23800884	SO:0001583	missense	7051	exon3			D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.365C>T	14.37:g.24731044G>A	ENSP00000206765:p.Ser122Leu		23800884	NM_000359	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	9	0.004120879120879121	9	0.018292682926829267	0	0.0	0	0.0	0	0.0	G	14.71	2.617594	0.46736	0.012256	1.16E-4	ENSG00000092295	ENST00000206765	D	0.85773	-2.03	5.29	5.29	0.74685	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.291547	0.32769	N	0.005665	T	0.75874	0.3909	L	0.38531	1.155	0.20926	N	0.999822	D	0.67145	0.996	P	0.57679	0.825	T	0.72308	-0.4332	10	0.22109	T	0.4	-8.5213	13.454	0.61189	0.0:0.1575:0.8425:0.0	.	122	P22735	TGM1_HUMAN	L	122	ENSP00000206765:S122L	ENSP00000206765:S122L	S	-	2	0	TGM1	23800884	0.471000	0.25862	0.071000	0.20095	0.061000	0.15899	2.397000	0.44477	2.480000	0.83734	0.561000	0.74099	TCG		0.607	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
DHRS1	115817	hgsc.bcm.edu	37	14	24760346	24760346	+	Splice_Site	SNP	G	G	A	rs200636329	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:24760346G>A	ENST00000288111.7	-	8	1080	c.804C>T	c.(802-804)gaC>gaT	p.D268D	DHRS1_ENST00000396813.1_Splice_Site_p.D268D|DHRS1_ENST00000559088.1_5'UTR	NM_001136050.2	NP_001129522.1	Q96LJ7	DHRS1_HUMAN	dehydrogenase/reductase (SDR family) member 1	268						endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)	oxidoreductase activity (GO:0016491)	p.D268D(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6				GBM - Glioblastoma multiforme(265;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(311;0.0442)		GGTCCTCACCGTCCACATCCC	0.602													G|||	2	0.000399361	0.0	0.0014	5008	,	,		21398	0.0		0.001	False		,,,				2504	0.0				p.D268D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C804T	14						.	G	,	0,4406		0,0,2203	102.0	83.0	90.0		804,804	0.0	1.0	14		90	2,8598	2.2+/-6.3	0,2,4298	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	DHRS1	NM_001136050.2,NM_138452.2	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	268/314,268/314	24760346	2,13004	2203	4300	6503	23830186	SO:0001630	splice_region_variant	115817	exon8			AK058159	CCDS9623.1	14q11.2	2011-09-14			ENSG00000157379	ENSG00000157379	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16445	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 19C, member 1"""	610410				12153138, 19027726	Standard	NM_138452		Approved	FLJ25430, MGC20204, SDR19C1	uc001wok.3	Q96LJ7	OTTHUMG00000029333	ENST00000288111.7:c.805+1C>T	14.37:g.24760346G>A			23830186	NM_138452	D3DS71|Q8NDG3|Q96B59|Q96CQ5	Silent	SNP	ENST00000288111.7	37	CCDS9623.1																																																																																				0.602	DHRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073168.4	NM_138452	Silent
PRKD1	5587	hgsc.bcm.edu	37	14	30066719	30066719	+	Silent	SNP	G	G	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:30066719G>T	ENST00000331968.5	-	16	2641	c.2412C>A	c.(2410-2412)ccC>ccA	p.P804P	PRKD1_ENST00000415220.2_Silent_p.P812P	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	804	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.P804P(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TTTCCTTCCAGGGATTTGGTG	0.303																																					p.P804P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2412A	14						.						121.0	118.0	119.0					14																	30066719		2203	4300	6503	29136470	SO:0001819	synonymous_variant	5587	exon16				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2412C>A	14.37:g.30066719G>T			29136470	NM_002742	A6NL64|B2RAF6	Silent	SNP	ENST00000331968.5	37	CCDS9637.1																																																																																				0.303	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
NID2	22795	hgsc.bcm.edu	37	14	52495455	52495455	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:52495455G>A	ENST00000216286.5	-	11	2514	c.2515C>T	c.(2515-2517)Cgg>Tgg	p.R839W	NID2_ENST00000541773.1_Missense_Mutation_p.R786W	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	839	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.R839W(2)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					CAAGTATGCCGGTCATCTGCA	0.458																																					p.R839W												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C2515T	14						.						95.0	88.0	90.0					14																	52495455		2203	4300	6503	51565205	SO:0001583	missense	22795	exon11			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.2515C>T	14.37:g.52495455G>A	ENSP00000216286:p.Arg839Trp		51565205	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.53|16.53	3.149046|3.149046	0.57151|0.57151	.|.	.|.	ENSG00000087303|ENSG00000087303	ENST00000556572|ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	.|D;D	.|0.92446	.|-2.27;-3.04	5.94|5.94	0.526|0.526	0.17078|0.17078	.|EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.|1.160920	.|0.06054	.|N	.|0.657132	D|D	0.91690|0.91690	0.7373|0.7373	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	0.999993|0.999993	.|D;D;D;D	.|0.76494	.|0.994;0.997;0.999;0.995	.|P;P;D;P	.|0.63033	.|0.892;0.648;0.91;0.586	T|T	0.81291|0.81291	-0.0999|-0.0999	5|10	.|0.72032	.|D	.|0.01	.|.	4.5713|4.5713	0.12210|0.12210	0.0733:0.2894:0.4078:0.2295|0.0733:0.2894:0.4078:0.2295	.|.	.|433;786;841;839	.|E7EPP3;Q14112-2;Q5CZI2;Q14112	.|.;.;.;NID2_HUMAN	L|W	155|839;433;786;841	.|ENSP00000216286:R839W;ENSP00000443730:R786W	.|ENSP00000216286:R839W	P|R	-|-	2|1	0|2	NID2|NID2	51565205|51565205	0.004000|0.004000	0.15560|0.15560	0.328000|0.328000	0.25416|0.25416	0.795000|0.795000	0.44927|0.44927	-0.030000|-0.030000	0.12308|0.12308	0.382000|0.382000	0.24878|0.24878	0.563000|0.563000	0.77884|0.77884	CCG|CGG		0.458	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
GPHN	10243	hgsc.bcm.edu	37	14	67346678	67346678	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:67346678C>T	ENST00000315266.5	+	5	1437	c.316C>T	c.(316-318)Cgg>Tgg	p.R106W	GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000305960.9_Missense_Mutation_p.R75W|GPHN_ENST00000459628.1_Missense_Mutation_p.R88W|GPHN_ENST00000543237.1_Missense_Mutation_p.R119W|GPHN_ENST00000478722.1_Missense_Mutation_p.R106W	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	106	MPT Mo-transferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)	p.R106W(1)		large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		AGTAATAGAACGGGAAGCACC	0.408			T	MLL	AL																																p.R106W			Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C316T	14						.						88.0	82.0	84.0					14																	67346678		2203	4300	6503	66416431	SO:0001583	missense	10243	exon5			AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.316C>T	14.37:g.67346678C>T	ENSP00000312771:p.Arg106Trp		66416431	NM_001024218	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	C	32	5.169766	0.94768	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960;ENST00000555456	T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	4.93	4.93	0.64822	Molybdenum cofactor synthesis (1);Molybdopterin binding (4);	0.000000	0.85682	D	0.000000	D	0.91050	0.7184	M	0.92367	3.3	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.992;1.0;0.999;0.95;0.99	D	0.93249	0.6633	10	0.87932	D	0	-4.4638	18.4954	0.90863	0.0:1.0:0.0:0.0	.	75;119;106;106;88	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	W	106;106;88;119;75;39	ENSP00000312771:R106W;ENSP00000417901:R106W;ENSP00000452220:R88W;ENSP00000438404:R119W;ENSP00000303019:R75W;ENSP00000450706:R39W	ENSP00000303019:R75W	R	+	1	2	GPHN	66416431	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.839000	0.55835	2.440000	0.82611	0.655000	0.94253	CGG		0.408	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
SIPA1L1	26037	hgsc.bcm.edu	37	14	72128131	72128131	+	Silent	SNP	C	C	T	rs142619560	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:72128131C>T	ENST00000555818.1	+	7	2550	c.2202C>T	c.(2200-2202)caC>caT	p.H734H	SIPA1L1_ENST00000358550.2_Silent_p.H734H|SIPA1L1_ENST00000381232.3_Silent_p.H734H|SIPA1L1_ENST00000537413.1_Silent_p.H209H	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	734	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)	p.H734H(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ACTTCCAGCACGTTTTCGTCA	0.498													C|||	2	0.000399361	0.0	0.0	5008	,	,		20200	0.0		0.001	False		,,,				2504	0.001				p.H734H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2202T	14						.	C		1,4405	2.1+/-5.4	0,1,2202	175.0	145.0	155.0		2202	-2.5	1.0	14	dbSNP_134	155	18,8582	13.3+/-46.6	0,18,4282	no	coding-synonymous	SIPA1L1	NM_015556.1		0,19,6484	TT,TC,CC		0.2093,0.0227,0.1461		734/1805	72128131	19,12987	2203	4300	6503	71197884	SO:0001819	synonymous_variant	26037	exon7			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.2202C>T	14.37:g.72128131C>T			71197884	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	37	CCDS9807.1																																																																																				0.498	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
ACOT1	641371	hgsc.bcm.edu	37	14	74008370	74008370	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:74008370G>A	ENST00000311148.4	+	2	939	c.631G>A	c.(631-633)Gct>Act	p.A211T	HEATR4_ENST00000553558.1_Intron|HEATR4_ENST00000334988.2_Intron|HEATR4_ENST00000560393.1_Intron|ACOT1_ENST00000557556.1_Missense_Mutation_p.A211T	NM_001037161.1	NP_001032238.1	Q86TX2	ACOT1_HUMAN	acyl-CoA thioesterase 1	211					acyl-CoA metabolic process (GO:0006637)|long-chain fatty acid metabolic process (GO:0001676)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)	p.A211T(1)		endometrium(1)|large_intestine(1)|lung(2)	4				OV - Ovarian serous cystadenocarcinoma(108;1.37e-45)|BRCA - Breast invasive adenocarcinoma(234;0.0033)		CTTTGAAGAAGCTGTGAACTA	0.468																																					p.A211T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G631A	14						.						189.0	149.0	163.0					14																	74008370		1946	3540	5486	73078123	SO:0001583	missense	641371	exon2			DQ082754	CCDS32117.1	14q24.3	2013-09-20			ENSG00000184227	ENSG00000184227		"""Acyl CoA thioesterases"""	33128	protein-coding gene	gene with protein product		614313				16103133, 16940157	Standard	NM_001037161		Approved	ACH2, CTE-1, LACH2		Q86TX2	OTTHUMG00000171607	ENST00000311148.4:c.631G>A	14.37:g.74008370G>A	ENSP00000311224:p.Ala211Thr		73078123	NM_001037161	A1L173|Q3I5F9	Missense_Mutation	SNP	ENST00000311148.4	37	CCDS32117.1	.	.	.	.	.	.	.	.	.	.	-	17.47	3.398220	0.62177	.	.	ENSG00000184227	ENST00000311148;ENST00000557556	T;T	0.52754	0.65;0.65	3.61	3.61	0.41365	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.049353	0.85682	D	0.000000	T	0.72590	0.3479	M	0.93594	3.435	0.50813	D	0.999895	P;P	0.50156	0.932;0.932	P;P	0.58172	0.834;0.834	T	0.82633	-0.0361	10	0.87932	D	0	-18.9862	15.853	0.78947	0.0:0.0:1.0:0.0	.	211;211	E9KL42;Q86TX2	.;ACOT1_HUMAN	T	211	ENSP00000311224:A211T;ENSP00000451764:A211T	ENSP00000311224:A211T	A	+	1	0	ACOT1	73078123	1.000000	0.71417	0.989000	0.46669	0.235000	0.25334	9.105000	0.94246	2.022000	0.59522	0.423000	0.28283	GCT		0.468	ACOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414432.1	NM_001037161	
SERPINA12	145264	hgsc.bcm.edu	37	14	94964254	94964254	+	Missense_Mutation	SNP	C	C	T	rs557748313	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:94964254C>T	ENST00000341228.2	-	3	1276	c.481G>A	c.(481-483)Gaa>Aaa	p.E161K	SERPINA12_ENST00000556881.1_Missense_Mutation_p.E161K	NM_173850.2	NP_776249.1	Q8IW75	SPA12_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12	161					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.E161K(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33				COAD - Colon adenocarcinoma(157;0.235)		AGGATGGTTTCGGCACTGTAA	0.438													C|||	3	0.000599042	0.0	0.0	5008	,	,		19744	0.0		0.0	False		,,,				2504	0.0031				p.E161K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G481A	14						.						113.0	109.0	110.0					14																	94964254		2203	4300	6503	94034007	SO:0001583	missense	145264	exon3			AY177692	CCDS9926.1	14q32.13	2014-02-21	2005-08-18		ENSG00000165953	ENSG00000165953		"""Serine (or cysteine) peptidase inhibitors"""	18359	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12"""			24172014	Standard	NM_173850		Approved	OL-64, Vaspin	uc001ydj.3	Q8IW75	OTTHUMG00000171349	ENST00000341228.2:c.481G>A	14.37:g.94964254C>T	ENSP00000342109:p.Glu161Lys		94034007	NM_173850		Missense_Mutation	SNP	ENST00000341228.2	37	CCDS9926.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393450	0.62066	.	.	ENSG00000165953	ENST00000556881;ENST00000341228	D;D	0.85629	-2.01;-2.01	5.49	5.49	0.81192	Serpin domain (3);	0.529435	0.18396	N	0.142515	D	0.84101	0.5398	L	0.50919	1.6	0.42438	D	0.992702	P	0.52061	0.95	B	0.42319	0.383	D	0.86591	0.1860	10	0.72032	D	0.01	.	19.3786	0.94521	0.0:1.0:0.0:0.0	.	161	Q8IW75	SPA12_HUMAN	K	161	ENSP00000451738:E161K;ENSP00000342109:E161K	ENSP00000342109:E161K	E	-	1	0	SERPINA12	94034007	0.989000	0.36119	0.059000	0.19551	0.002000	0.02628	2.895000	0.48648	2.578000	0.87016	0.655000	0.94253	GAA		0.438	SERPINA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413097.1	NM_173850	
SERPINA4	5267	hgsc.bcm.edu	37	14	95033382	95033382	+	Missense_Mutation	SNP	G	G	A	rs140397956		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr14:95033382G>A	ENST00000557004.1	+	3	1146	c.725G>A	c.(724-726)cGg>cAg	p.R242Q	SERPINA4_ENST00000555095.1_Missense_Mutation_p.R242Q|SERPINA5_ENST00000553780.1_Intron|SERPINA4_ENST00000298841.5_Missense_Mutation_p.R242Q			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	242					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R242Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		ACAACAGTCCGGGTGCCCATG	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		20410	0.0		0.0	False		,,,				2504	0.001				p.R242Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G725A	14						.						111.0	98.0	102.0					14																	95033382		2203	4300	6503	94103135	SO:0001583	missense	5267	exon3			L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.725G>A	14.37:g.95033382G>A	ENSP00000450838:p.Arg242Gln		94103135	NM_006215	Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	ENST00000557004.1	37	CCDS9927.1	.	.	.	.	.	.	.	.	.	.	G	8.393	0.840294	0.16891	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	D;D;D	0.83837	-1.77;-1.77;-1.77	4.44	-4.14	0.03892	Serpin domain (3);	1.277500	0.06121	N	0.668959	T	0.60856	0.2301	N	0.05554	-0.025	0.09310	N	1	B;B	0.25486	0.083;0.127	B;B	0.21708	0.019;0.036	T	0.48958	-0.8988	10	0.15499	T	0.54	.	6.0544	0.19802	0.4624:0.2346:0.303:0.0	.	242;242	B2R815;P29622	.;KAIN_HUMAN	Q	242	ENSP00000450838:R242Q;ENSP00000451172:R242Q;ENSP00000298841:R242Q	ENSP00000298841:R242Q	R	+	2	0	SERPINA4	94103135	0.000000	0.05858	0.016000	0.15963	0.006000	0.05464	0.056000	0.14256	-0.764000	0.04651	-2.434000	0.00213	CGG		0.498	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410718.1	NM_006215	
GGT5	2687	hgsc.bcm.edu	37	22	24622662	24622662	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr22:24622662C>T	ENST00000327365.4	-	7	1391	c.975G>A	c.(973-975)acG>acA	p.T325T	GGT5_ENST00000418439.2_Silent_p.T248T|GGT5_ENST00000398292.3_Silent_p.T325T|GGT5_ENST00000263112.7_Silent_p.T293T	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	325					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.T325T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						CAAACTTGAGCGTCTCTACAA	0.612																																					p.T325T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G975A	22						.						122.0	110.0	114.0					22																	24622662		2203	4300	6503	22952662	SO:0001819	synonymous_variant	2687	exon7			M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.975G>A	22.37:g.24622662C>T			22952662	NM_004121	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Silent	SNP	ENST00000327365.4	37	CCDS13825.1																																																																																				0.612	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320119.1	NM_004121	
ASCC2	84164	hgsc.bcm.edu	37	22	30200658	30200658	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr22:30200658G>T	ENST00000397771.2	-	14	1499	c.1322C>A	c.(1321-1323)tCa>tAa	p.S441*	ASCC2_ENST00000478812.1_5'Flank|ASCC2_ENST00000542393.1_Nonsense_Mutation_p.S365*|ASCC2_ENST00000307790.3_Nonsense_Mutation_p.S441*			Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit 2	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.S441*(1)		endometrium(3)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			CGGATGTGATGATGCTTGACT	0.562																																					p.S441X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1322A	22						.						349.0	296.0	314.0					22																	30200658		2203	4300	6503	28530658	SO:0001587	stop_gained	84164	exon13			AY013289	CCDS13869.1, CCDS56226.1	22q12.1	2004-07-27			ENSG00000100325	ENSG00000100325			24103	protein-coding gene	gene with protein product	"""ASC 1 complex subunit P100"""	614216				12077347, 9847074	Standard	NM_032204		Approved	ASC1p100, FLJ21588, DKFZp586O0223	uc003agr.3	Q9H1I8	OTTHUMG00000067658	ENST00000397771.2:c.1322C>A	22.37:g.30200658G>T	ENSP00000380877:p.Ser441*		28530658	NM_032204	B7Z8E0|F5H6J9|Q4TT54|Q8TAZ0|Q9H711|Q9H9D6	Nonsense_Mutation	SNP	ENST00000397771.2	37	CCDS13869.1	.	.	.	.	.	.	.	.	.	.	G	34	5.382509	0.95967	.	.	ENSG00000100325	ENST00000307790;ENST00000397771;ENST00000542393	.	.	.	5.25	0.718	0.18202	.	1.560100	0.03153	N	0.168296	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	1.5676	1.4843	0.02444	0.2478:0.1557:0.4546:0.1419	.	.	.	.	X	441;441;365	.	ENSP00000305502:S441X	S	-	2	0	ASCC2	28530658	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.085000	0.11250	0.139000	0.18822	0.655000	0.94253	TCA		0.562	ASCC2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322127.1	NM_032204	
EP300	2033	hgsc.bcm.edu	37	22	41513293	41513293	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr22:41513293C>T	ENST00000263253.7	+	2	1416	c.197C>T	c.(196-198)aCa>aTa	p.T66I		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	66	Interaction with ALX1.|Interaction with RORA.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.T66I(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CAGCTTCAGACAAGTCTTGGC	0.428			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.T66I			Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C197T	22						.						109.0	102.0	105.0					22																	41513293		2203	4300	6503	39843239	SO:0001583	missense	2033	exon2	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.197C>T	22.37:g.41513293C>T	ENSP00000263253:p.Thr66Ile		39843239	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	37	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243263	0.79912	.	.	ENSG00000100393	ENST00000263253	D	0.83992	-1.79	6.16	6.16	0.99307	.	0.000000	0.49916	D	0.000129	D	0.89164	0.6637	M	0.64404	1.975	0.48975	D	0.99973	D	0.71674	0.998	D	0.65684	0.937	D	0.89053	0.3457	10	0.66056	D	0.02	-7.5528	15.5636	0.76269	0.1378:0.8622:0.0:0.0	.	66	Q09472	EP300_HUMAN	I	66	ENSP00000263253:T66I	ENSP00000263253:T66I	T	+	2	0	EP300	39843239	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.727000	0.47311	2.937000	0.99478	0.650000	0.86243	ACA		0.428	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
ARHGAP8	23779	hgsc.bcm.edu	37	22	45258162	45258162	+	Missense_Mutation	SNP	G	G	A	rs77740333	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr22:45258162G>A	ENST00000389774.2	+	13	1223	c.1082G>A	c.(1081-1083)cGg>cAg	p.R361Q	PRR5-ARHGAP8_ENST00000361473.5_Missense_Mutation_p.R461Q|PRR5-ARHGAP8_ENST00000352766.7_Missense_Mutation_p.R540Q|ARHGAP8_ENST00000336963.4_Silent_p.P295P|ARHGAP8_ENST00000389773.5_Missense_Mutation_p.R452Q|ARHGAP8_ENST00000517296.3_Missense_Mutation_p.R540Q|ARHGAP8_ENST00000356099.6_Missense_Mutation_p.R330Q	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	361	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.R361Q(1)|p.R366Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		CAGGTGTCCCGGGAGAGCATC	0.567													G|||	17	0.00339457	0.0113	0.0014	5008	,	,		19308	0.0		0.001	False		,,,				2504	0.0				p.R452Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1355A	22						.	G	GLN/ARG,,GLN/ARG,GLN/ARG	43,4363	46.7+/-81.2	0,43,2160	84.0	75.0	78.0		1082,885,1355,989	-7.1	0.7	22	dbSNP_131	78	3,8597	3.0+/-9.4	0,3,4297	yes	missense,coding-synonymous,missense,missense	ARHGAP8,PRR5-ARHGAP8	NM_001017526.1,NM_001198726.1,NM_181334.4,NM_181335.2	43,,43,43	0,46,6457	AA,AG,GG		0.0349,0.9759,0.3537	benign,,benign,benign	361/465,295/306,452/556,330/434	45258162	46,12960	2203	4300	6503	43636826	SO:0001583	missense	23779	exon15			AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.1082G>A	22.37:g.45258162G>A	ENSP00000374424:p.Arg361Gln		43636826	NM_181334	A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Missense_Mutation	SNP	ENST00000389774.2	37	CCDS33664.1	7|7	0.003205128205128205|0.003205128205128205	6|6	0.012195121951219513|0.012195121951219513	1|1	0.0027624309392265192|0.0027624309392265192	0|0	0.0|0.0	0|0	0.0|0.0	G|G	1.304|1.304	-0.604143|-0.604143	0.03717|0.03717	0.009759|0.009759	3.49E-4|3.49E-4	ENSG00000248405|ENSG00000248405;ENSG00000248405;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484	ENST00000515632|ENST00000361473;ENST00000352766;ENST00000517296;ENST00000389773;ENST00000389774;ENST00000356099	.|T;T;T;T;T;T	.|0.17854	.|2.25;2.25;2.25;2.25;2.25;2.25	3.54|3.54	-7.08|-7.08	0.01558|0.01558	.|Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	.|1.264820	.|0.06143	.|N	.|0.672720	T|T	0.02767|0.02767	0.0083|0.0083	N|N	0.01168|0.01168	-0.975|-0.975	0.22171|0.22171	N|N	0.999315|0.999315	.|B;B;B;B;B	.|0.13594	.|0.001;0.002;0.001;0.0;0.008	.|B;B;B;B;B	.|0.14023	.|0.001;0.001;0.001;0.001;0.01	T|T	0.35895|0.35895	-0.9770|-0.9770	5|10	.|0.13853	.|T	.|0.58	.|.	5.5626|5.5626	0.17152|0.17152	0.2925:0.0:0.4439:0.2636|0.2925:0.0:0.4439:0.2636	.|.	.|383;366;361;540;461	.|B7ZMA4;A2RU51;P85298;B1AHC4;B1AHC3	.|.;.;RHG08_HUMAN;.;.	R|Q	401|461;540;540;452;361;330	.|ENSP00000354732:R461Q;ENSP00000262731:R540Q;ENSP00000429240:R540Q;ENSP00000374423:R452Q;ENSP00000374424:R361Q;ENSP00000348407:R330Q	.|ENSP00000348407:R330Q	G|R	+|+	1|2	0|0	PRR5-ARHGAP8|PRR5-ARHGAP8;ARHGAP8	43636826|43636826	0.249000|0.249000	0.23941|0.23941	0.667000|0.667000	0.29798|0.29798	0.115000|0.115000	0.19883|0.19883	-0.336000|-0.336000	0.07863|0.07863	-2.575000|-2.575000	0.00465|0.00465	-1.166000|-1.166000	0.01754|0.01754	GGG|CGG		0.567	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701	
DNMT1	1786	hgsc.bcm.edu	37	19	10259679	10259679	+	Silent	SNP	G	G	A	rs200414033		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:10259679G>A	ENST00000340748.4	-	26	2788	c.2553C>T	c.(2551-2553)ccC>ccT	p.P851P	DNMT1_ENST00000540357.1_Silent_p.P851P|DNMT1_ENST00000359526.4_Silent_p.P867P			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	851	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.P851P(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	GCAGGGACTCGGGATCCATGC	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		19464	0.0		0.001	False		,,,				2504	0.0				p.P867P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2601T	19						.	G	,	0,4406		0,0,2203	96.0	74.0	81.0		2601,2553	-8.7	0.7	19		81	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	DNMT1	NM_001130823.1,NM_001379.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	867/1633,851/1617	10259679	1,13005	2203	4300	6503	10120679	SO:0001819	synonymous_variant	1786	exon27			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2553C>T	19.37:g.10259679G>A			10120679	NM_001130823	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	ENST00000340748.4	37	CCDS12228.1																																																																																				0.587	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
OR10H2	26538	hgsc.bcm.edu	37	19	15839520	15839520	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:15839520G>A	ENST00000305899.3	+	1	687	c.667G>A	c.(667-669)Gtg>Atg	p.V223M		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	223						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V223M(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					TGCCTTCATCGTGGCCGACAT	0.527																																					p.V223M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G667A	19						.						241.0	178.0	199.0					19																	15839520		2203	4300	6503	15700520	SO:0001583	missense	26538	exon1			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.667G>A	19.37:g.15839520G>A	ENSP00000306095:p.Val223Met		15700520	NM_013939	Q6IFQ1|Q96R58	Missense_Mutation	SNP	ENST00000305899.3	37	CCDS12333.1	.	.	.	.	.	.	.	.	.	.	.	10.44	1.351102	0.24512	.	.	ENSG00000171942	ENST00000305899	T	0.00164	8.64	3.39	1.19	0.21007	GPCR, rhodopsin-like superfamily (1);	0.175426	0.27640	N	0.018479	T	0.00178	0.0005	L	0.39692	1.235	0.09310	N	0.999992	D	0.61697	0.99	P	0.50659	0.647	T	0.50048	-0.8873	10	0.72032	D	0.01	.	5.5764	0.17225	0.3843:0.0:0.6157:0.0	.	223	O60403	O10H2_HUMAN	M	223	ENSP00000306095:V223M	ENSP00000306095:V223M	V	+	1	0	OR10H2	15700520	0.000000	0.05858	0.246000	0.24233	0.284000	0.27059	-1.112000	0.03299	0.017000	0.15025	0.531000	0.56144	GTG		0.527	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460917.1		
UPF1	5976	hgsc.bcm.edu	37	19	18963027	18963027	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:18963027C>T	ENST00000599848.1	+	6	1103	c.894C>T	c.(892-894)gaC>gaT	p.D298D	UPF1_ENST00000600310.1_3'UTR|UPF1_ENST00000262803.5_Silent_p.D298D			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	298	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.D298D(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						GGTACGAGGACGCCTACCAGT	0.597																																					p.D298D												.	.	2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	c.C894T	19						.						96.0	84.0	88.0					19																	18963027		2203	4300	6503	18824027	SO:0001819	synonymous_variant	5976	exon6			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.894C>T	19.37:g.18963027C>T			18824027	NM_002911	O00239|O43343|Q86Z25|Q92842	Silent	SNP	ENST00000599848.1	37																																																																																					0.597	UPF1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000464684.1	NM_002911	
SLC7A9	11136	hgsc.bcm.edu	37	19	33359416	33359416	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:33359416G>A	ENST00000023064.4	-	2	216	c.25C>T	c.(25-27)Cgg>Tgg	p.R9W	SLC7A9_ENST00000590341.1_Missense_Mutation_p.R9W|SLC7A9_ENST00000587772.1_Missense_Mutation_p.R9W	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	9					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)	p.R9W(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	TCCTCTCTCCGCTTTCTCAGG	0.562																																					p.R9W	GBM(181;1335 2108 9644 44178 46689)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C25T	19						.						181.0	122.0	142.0					19																	33359416		2203	4300	6503	38051256	SO:0001583	missense	11136	exon2			AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.25C>T	19.37:g.33359416G>A	ENSP00000023064:p.Arg9Trp		38051256	NM_001126335	B2R9A6	Missense_Mutation	SNP	ENST00000023064.4	37	CCDS12425.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.224613	0.39300	.	.	ENSG00000021488	ENST00000023064	D	0.90133	-2.62	5.29	1.77	0.24775	.	0.910972	0.09590	N	0.781612	D	0.86331	0.5907	L	0.29908	0.895	0.34786	D	0.735196	D	0.67145	0.996	P	0.46885	0.53	D	0.84097	0.0393	10	0.66056	D	0.02	.	8.5486	0.33438	0.105:0.0:0.5953:0.2997	.	9	P82251	BAT1_HUMAN	W	9	ENSP00000023064:R9W	ENSP00000023064:R9W	R	-	1	2	SLC7A9	38051256	0.987000	0.35691	0.039000	0.18376	0.335000	0.28730	0.755000	0.26405	0.556000	0.29098	0.462000	0.41574	CGG		0.562	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1		
SBSN	374897	hgsc.bcm.edu	37	19	36015644	36015644	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:36015644G>A	ENST00000452271.2	-	3	1746	c.1718C>T	c.(1717-1719)aCg>aTg	p.T573M	SBSN_ENST00000518157.1_Missense_Mutation_p.T230M	NM_001166034.1	NP_001159506.1	Q6UWP8	SBSN_HUMAN	suprabasin	573						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.T230M(1)		large_intestine(5)|lung(6)|ovary(1)|prostate(2)	14	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GATGAAAGGCGTGTTGACCGA	0.602																																					p.T573M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1718T	19						.						129.0	104.0	113.0					19																	36015644		2203	4300	6503	40707484	SO:0001583	missense	374897	exon3			AY358701	CCDS12464.1, CCDS54253.1	19q13.13	2008-02-05							24950	protein-coding gene	gene with protein product		609969				12228223	Standard	NM_198538		Approved	UNQ698, HLAR698	uc002oad.2	Q6UWP8		ENST00000452271.2:c.1718C>T	19.37:g.36015644G>A	ENSP00000430242:p.Thr573Met		40707484	NM_001166034	A8K5J0|E9PBV3	Missense_Mutation	SNP	ENST00000452271.2	37	CCDS54253.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.820575	0.32145	.	.	ENSG00000189001	ENST00000452271;ENST00000518157	T;T	0.40756	1.09;1.02	3.05	-0.822	0.10819	.	.	.	.	.	T	0.16257	0.0391	N	0.02539	-0.55	0.20307	N	0.999913	B;D	0.59767	0.001;0.986	B;P	0.45310	0.0;0.476	T	0.07947	-1.0746	9	0.51188	T	0.08	.	0.4565	0.00509	0.2104:0.1378:0.2271:0.4248	.	230;573	Q6UWP8;E9PBV3	SBSN_HUMAN;.	M	573;230	ENSP00000430242:T573M;ENSP00000428771:T230M	ENSP00000430242:T573M	T	-	2	0	SBSN	40707484	1.000000	0.71417	0.980000	0.43619	0.774000	0.43823	0.743000	0.26231	-0.008000	0.14320	-0.721000	0.03606	ACG		0.602	SBSN-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109463.3	NM_198538	
ATP4A	495	hgsc.bcm.edu	37	19	36041781	36041781	+	Missense_Mutation	SNP	C	C	T	rs148503854		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:36041781C>T	ENST00000262623.3	-	21	3062	c.3034G>A	c.(3034-3036)Gtc>Atc	p.V1012I		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	1012					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.V1012I(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	TCATCATAGACGAAGATGAGG	0.612																																					p.V1012I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3034A	19						.	C	ILE/VAL	0,4406		0,0,2203	56.0	54.0	54.0		3034	4.0	1.0	19	dbSNP_134	54	1,8599	1.2+/-3.3	0,1,4299	no	missense	ATP4A	NM_000704.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1012/1036	36041781	1,13005	2203	4300	6503	40733621	SO:0001583	missense	495	exon21				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.3034G>A	19.37:g.36041781C>T	ENSP00000262623:p.Val1012Ile		40733621	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043389	0.55003	0.0	1.16E-4	ENSG00000105675	ENST00000262623	D	0.95622	-3.76	5.02	3.96	0.45880	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.207554	0.29119	N	0.013082	D	0.92031	0.7475	L	0.43152	1.355	0.44852	D	0.997863	P	0.34837	0.472	B	0.38225	0.268	D	0.88489	0.3074	10	0.17369	T	0.5	.	11.539	0.50655	0.0:0.9106:0.0:0.0894	.	1012	P20648	ATP4A_HUMAN	I	1012	ENSP00000262623:V1012I	ENSP00000262623:V1012I	V	-	1	0	ATP4A	40733621	0.993000	0.37304	0.997000	0.53966	0.995000	0.86356	2.564000	0.45931	2.595000	0.87683	0.491000	0.48974	GTC		0.612	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
ZNF565	147929	hgsc.bcm.edu	37	19	36673679	36673679	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:36673679C>T	ENST00000355114.5	-	5	2035	c.1309G>A	c.(1309-1311)Ggg>Agg	p.G437R	ZNF565_ENST00000392173.2_Missense_Mutation_p.G397R|ZNF565_ENST00000304116.5_Missense_Mutation_p.G397R			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	437					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G397R(1)		large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			AATGCCTTCCCGCAGTCCTTA	0.473																																					p.G397R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1189A	19						.						124.0	102.0	110.0					19																	36673679		2203	4300	6503	41365519	SO:0001583	missense	147929	exon5			AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.1309G>A	19.37:g.36673679C>T	ENSP00000347234:p.Gly437Arg		41365519	NM_152477	B3KQ35|Q6NUS2	Missense_Mutation	SNP	ENST00000355114.5	37		.	.	.	.	.	.	.	.	.	.	c	10.10	1.256887	0.22965	.	.	ENSG00000196357	ENST00000392173;ENST00000304116;ENST00000355114	T;T;T	0.03524	3.9;3.9;3.9	4.7	3.64	0.41730	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40640	N	0.001055	T	0.05547	0.0146	M	0.70787	2.145	0.37114	D	0.900492	P	0.38745	0.645	B	0.30855	0.121	T	0.31503	-0.9941	10	0.54805	T	0.06	.	12.4708	0.55785	0.1681:0.8319:0.0:0.0	.	397	Q8N9K5	ZN565_HUMAN	R	397;397;437	ENSP00000376013:G397R;ENSP00000306869:G397R;ENSP00000347234:G437R	ENSP00000306869:G397R	G	-	1	0	ZNF565	41365519	0.983000	0.35010	0.987000	0.45799	0.042000	0.13812	3.676000	0.54612	1.310000	0.45006	0.650000	0.86243	GGG		0.473	ZNF565-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000451697.1	NM_152477	
CIC	23152	hgsc.bcm.edu	37	19	42791864	42791864	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:42791864C>T	ENST00000575354.2	+	5	790	c.750C>T	c.(748-750)caC>caT	p.H250H	CIC_ENST00000572681.2_Silent_p.H1159H|CIC_ENST00000160740.3_Silent_p.H250H	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	250					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.H250H(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				AGAAGTACCACGACCTGGCCT	0.622			"""Mis, F, S"""		oligodendroglioma																																p.H250H			Rec	yes		19	19q13.2	23152	capicua homolog		O	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C750T	19						.						78.0	69.0	72.0					19																	42791864		2203	4300	6503	47483704	SO:0001819	synonymous_variant	23152	exon5			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.750C>T	19.37:g.42791864C>T			47483704	NM_015125	Q7LGI1|Q9UEG5|Q9Y6T1	Silent	SNP	ENST00000575354.2	37	CCDS12601.1																																																																																				0.622	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2		
ZNF112	7771	hgsc.bcm.edu	37	19	44832470	44832470	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:44832470G>A	ENST00000337401.4	-	5	1946	c.1858C>T	c.(1858-1860)Cgg>Tgg	p.R620W	ZNF112_ENST00000536500.1_Missense_Mutation_p.R637W|ZNF112_ENST00000354340.4_Missense_Mutation_p.R614W	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	620					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R614W(1)									TGTGAACTCCGACTGAAGCCC	0.473																																					p.R614W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1840T	19						.						141.0	137.0	138.0					19																	44832470		2203	4300	6503	49524310	SO:0001583	missense	7771	exon4			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.1858C>T	19.37:g.44832470G>A	ENSP00000337081:p.Arg620Trp		49524310	NM_013380	A4FU53|Q9HCA7	Missense_Mutation	SNP	ENST00000337401.4	37	CCDS54276.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.335464	0.60853	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.08008	3.14;5.4;3.14	5.0	3.95	0.45737	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.31370	N	0.007774	T	0.23886	0.0578	M	0.68593	2.085	0.30726	N	0.747708	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.988;0.993	T	0.05053	-1.0909	10	0.36615	T	0.2	-19.8544	11.9024	0.52690	0.0:0.0:0.6836:0.3164	.	619;637;620	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	W	620;620;614;637;619	ENSP00000337081:R620W;ENSP00000346305:R614W;ENSP00000441990:R637W	ENSP00000253426:R619W	R	-	1	2	ZNF285	49524310	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	-0.202000	0.09451	1.217000	0.43442	-0.182000	0.12963	CGG		0.473	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380	
RPL36	25873	hgsc.bcm.edu	37	19	5693616	5693616	+	IGR	SNP	C	C	T	rs35804229	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:5693616C>T	ENST00000577222.1	+	0	874				LONP1_ENST00000593119.1_Missense_Mutation_p.A765T|LONP1_ENST00000360614.3_Missense_Mutation_p.A829T|LONP1_ENST00000540670.2_Missense_Mutation_p.A633T|LONP1_ENST00000585374.1_Missense_Mutation_p.A715T|LONP1_ENST00000590729.1_Missense_Mutation_p.A699T			Q9Y3U8	RL36_HUMAN	ribosomal protein L36						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.A829T(1)		breast(1)|upper_aerodigestive_tract(1)	2						TTGGCGGGGGCGTGCTGCATG	0.657													C|||	31	0.0061901	0.0008	0.0058	5008	,	,		17440	0.0		0.0189	False		,,,				2504	0.0072				p.A829T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2485A	19						.	C	THR/ALA	9,4397	16.8+/-37.8	0,9,2194	145.0	108.0	120.0		2485	4.3	0.8	19	dbSNP_126	120	148,8452	72.3+/-134.9	2,144,4154	yes	missense	LONP1	NM_004793.2	58	2,153,6348	TT,TC,CC		1.7209,0.2043,1.2071	benign	829/960	5693616	157,12849	2203	4300	6503	5644616	SO:0001628	intergenic_variant	9361	exon16				CCDS12147.1	19p13.2	2011-04-06				ENSG00000130255		"""L ribosomal proteins"""	13631	protein-coding gene	gene with protein product							Standard	NM_033643		Approved	DKFZp566B023, L36	uc002mcv.3	Q9Y3U8			19.37:g.5693616C>T			5644616	NM_004793	B2R4Y1|D6W634|Q6FIG1|Q9UQF6	Missense_Mutation	SNP	ENST00000577222.1	37	CCDS12147.1	18	0.008241758241758242	0	0.0	2	0.0055248618784530384	0	0.0	16	0.021108179419525065	C	8.530	0.870892	0.17322	0.002043	0.017209	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	T;T	0.30448	1.53;1.53	4.33	4.33	0.51752	Ribosomal protein S5 domain 2-type fold (1);Peptidase S16, Lon C-terminal (1);	0.499176	0.22251	N	0.062555	T	0.10208	0.0250	L	0.27975	0.815	0.22378	N	0.999159	B;B;B	0.25105	0.118;0.118;0.118	B;B;B	0.25291	0.059;0.059;0.059	T	0.11665	-1.0578	10	0.19590	T	0.45	-37.6726	10.4234	0.44363	0.0:0.8007:0.1993:0.0	rs35804229;rs35804229	829;765;829	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	T	829;793;633	ENSP00000353826:A829T;ENSP00000441523:A633T	ENSP00000351177:A793T	A	-	1	0	LONP1	5644616	0.832000	0.29368	0.832000	0.32986	0.596000	0.36781	1.696000	0.37773	1.922000	0.55676	0.549000	0.68633	GCC		0.657	RPL36-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442561.1	NM_015414	
SLC1A5	6510	hgsc.bcm.edu	37	19	47278930	47278930	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:47278930C>T	ENST00000542575.2	-	8	2091	c.1463G>A	c.(1462-1464)cGt>cAt	p.R488H	SLC1A5_ENST00000412532.2_Missense_Mutation_p.R260H|SLC1A5_ENST00000594991.1_Missense_Mutation_p.R312H|FKRP_ENST00000600646.1_Intron|SLC1A5_ENST00000434726.2_Missense_Mutation_p.R286H	NM_005628.2	NP_005619.1	Q15758	AAAT_HUMAN	solute carrier family 1 (neutral amino acid transporter), member 5	488					amino acid transport (GO:0006865)|extracellular amino acid transport (GO:0006860)|glutamine transport (GO:0006868)|ion transport (GO:0006811)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-glutamine transmembrane transporter activity (GO:0015186)|L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)|receptor activity (GO:0004872)|sodium:dicarboxylate symporter activity (GO:0017153)|virus receptor activity (GO:0001618)	p.R488H(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(2)|stomach(1)	13		all_epithelial(76;0.00314)|Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000882)|Epithelial(262;0.0211)|GBM - Glioblastoma multiforme(486;0.0341)	L-Asparagine(DB00174)|L-Glutamine(DB00130)	CGACTCCGTACGGTCCACGTA	0.562																																					p.R286H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G857A	19						.						120.0	106.0	111.0					19																	47278930		2203	4300	6503	51970770	SO:0001583	missense	6510	exon7			U53347	CCDS12692.1, CCDS46125.1, CCDS46126.1	19q13.32	2013-07-15			ENSG00000105281	ENSG00000105281		"""Solute carriers"""	10943	protein-coding gene	gene with protein product		109190		RDRC, M7V1		8702519, 10051606	Standard	NM_005628		Approved	AAAT, ASCT2	uc002pfs.3	Q15758	OTTHUMG00000183434	ENST00000542575.2:c.1463G>A	19.37:g.47278930C>T	ENSP00000444408:p.Arg488His		51970770	NM_001145145	A8K9H5|B4DR77|B4DWS4|B7ZB81|D0EYG6|E9PC01|O95720|Q96RL9|Q9BWQ3|Q9UNP2	Missense_Mutation	SNP	ENST00000542575.2	37	CCDS12692.1	.	.	.	.	.	.	.	.	.	.	-	20.3	3.963890	0.74131	.	.	ENSG00000105281	ENST00000542575;ENST00000434726;ENST00000412532;ENST00000306894	T;T;T	0.65732	0.62;-0.17;-0.16	4.88	3.8	0.43715	.	0.981212	0.08361	N	0.957625	T	0.60830	0.2299	N	0.22421	0.69	0.26968	N	0.965652	D;D;P	0.59357	0.985;0.973;0.941	P;P;P	0.52514	0.628;0.701;0.635	T	0.55438	-0.8141	10	0.87932	D	0	-12.7729	12.2865	0.54795	0.0:0.9027:0.0:0.0973	.	286;488;488	E9PC01;Q15758;Q71UA6	.;AAAT_HUMAN;.	H	488;286;260;495	ENSP00000444408:R488H;ENSP00000406532:R286H;ENSP00000397924:R260H	ENSP00000303623:R495H	R	-	2	0	SLC1A5	51970770	0.003000	0.15002	0.060000	0.19600	0.060000	0.15804	0.698000	0.25571	2.547000	0.85894	0.550000	0.68814	CGT		0.562	SLC1A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466630.1		
HAS1	3036	hgsc.bcm.edu	37	19	52217284	52217284	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:52217284C>T	ENST00000222115.1	-	5	1167	c.1133G>A	c.(1132-1134)cGc>cAc	p.R378H	HAS1_ENST00000601714.1_Missense_Mutation_p.R385H|HAS1_ENST00000540069.2_Missense_Mutation_p.R377H|HAS1_ENST00000594621.1_Silent_p.T207T	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	378					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.R378H(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CTTGGACCAGCGTGTCTGCTG	0.642																																					p.R378H	NSCLC(132;636 2450 45807 47979)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1133A	19						.						49.0	32.0	37.0					19																	52217284		2203	4300	6503	56909096	SO:0001583	missense	3036	exon5			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1133G>A	19.37:g.52217284C>T	ENSP00000222115:p.Arg378His		56909096	NM_001523	Q14470|Q9NS49	Missense_Mutation	SNP	ENST00000222115.1	37	CCDS12838.1	.	.	.	.	.	.	.	.	.	.	c	16.57	3.160354	0.57368	.	.	ENSG00000105509	ENST00000540069;ENST00000222115	T;T	0.74842	-0.88;-0.88	3.22	3.22	0.36961	.	0.000000	0.85682	U	0.000000	D	0.89385	0.6700	H	0.96208	3.785	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	D	0.91983	0.5596	10	0.87932	D	0	-20.5593	12.2907	0.54817	0.0:1.0:0.0:0.0	.	377;378;377	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	H	377;378	ENSP00000445021:R377H;ENSP00000222115:R378H	ENSP00000222115:R378H	R	-	2	0	HAS1	56909096	1.000000	0.71417	1.000000	0.80357	0.083000	0.17756	7.559000	0.82265	1.816000	0.52996	0.174000	0.16983	CGC		0.642	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466953.1	NM_001523	
ZNF600	162966	hgsc.bcm.edu	37	19	53269487	53269487	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:53269487G>A	ENST00000338230.3	-	3	1789	c.1522C>T	c.(1522-1524)Cgt>Tgt	p.R508C		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	508				R -> H (in Ref. 1; BAD18414). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R508C(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		GACCTCAGACGGAAGGTCTTG	0.443																																					p.R508C	Esophageal Squamous(196;1235 2112 2375 33339 34207)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1522T	19						.						192.0	175.0	181.0					19																	53269487		2203	4300	6503	57961299	SO:0001583	missense	162966	exon3			U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.1522C>T	19.37:g.53269487G>A	ENSP00000344791:p.Arg508Cys		57961299	NM_198457	Q6MZR0	Missense_Mutation	SNP	ENST00000338230.3	37	CCDS12856.1	.	.	.	.	.	.	.	.	.	.	.	10.67	1.415808	0.25552	.	.	ENSG00000189190	ENST00000338230	T	0.15952	2.38	1.51	-3.02	0.05446	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24392	0.0591	M	0.67517	2.055	0.09310	N	1	D	0.69078	0.997	P	0.54965	0.765	T	0.10109	-1.0644	9	0.62326	D	0.03	.	3.6636	0.08247	0.2133:0.0:0.2256:0.561	.	508	Q6ZNG1	ZN600_HUMAN	C	508	ENSP00000344791:R508C	ENSP00000344791:R508C	R	-	1	0	ZNF600	57961299	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.062000	0.03468	-0.819000	0.04323	-1.210000	0.01631	CGT		0.443	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463093.1	NM_198457	
ARHGEF18	23370	hgsc.bcm.edu	37	19	7516071	7516071	+	Missense_Mutation	SNP	G	G	A	rs368588291		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:7516071G>A	ENST00000359920.6	+	6	1463	c.1210G>A	c.(1210-1212)Gtg>Atg	p.V404M	CTD-2207O23.3_ENST00000593531.1_Silent_p.A361A|ARHGEF18_ENST00000319670.9_Missense_Mutation_p.V246M	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	404	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V246M(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				GCGGCTTGGCGTGCAGGAGTG	0.498													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18404	0.0		0.0	False		,,,				2504	0.0				p.V246M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G736A	19						.						115.0	96.0	102.0					19																	7516071		2203	4300	6503	7422071	SO:0001583	missense	23370	exon7			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.1210G>A	19.37:g.7516071G>A	ENSP00000352995:p.Val404Met		7422071	NM_015318	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	ENST00000359920.6	37	CCDS45946.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.566637	0.45694	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.68181	-0.31;-0.31	5.21	4.17	0.49024	Dbl homology (DH) domain (5);	0.123199	0.36167	N	0.002744	T	0.79311	0.4424	M	0.76574	2.34	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70227	0.921;0.968	T	0.81258	-0.1014	10	0.87932	D	0	-24.3011	11.6091	0.51049	0.087:0.0:0.913:0.0	.	246;404	Q6ZSZ5-2;Q6ZSZ5	.;ARHGI_HUMAN	M	246;404	ENSP00000319200:V246M;ENSP00000352995:V404M	ENSP00000319200:V246M	V	+	1	0	ARHGEF18	7422071	0.922000	0.31269	0.954000	0.39281	0.187000	0.23431	1.382000	0.34374	1.208000	0.43306	-0.150000	0.13652	GTG		0.498	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318	
LAIR1	3903	hgsc.bcm.edu	37	19	54868559	54868559	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr19:54868559C>T	ENST00000391742.2	-	5	584	c.432G>A	c.(430-432)ccG>ccA	p.P144P	LAIR1_ENST00000313038.6_Silent_p.P137P|LAIR1_ENST00000348231.4_Silent_p.P127P|LAIR1_ENST00000474878.1_Silent_p.P126P|LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000434277.2_Silent_p.P143P|LAIR1_ENST00000391743.3_Silent_p.P126P			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	144					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P144P(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		TGTTGTCCGACGGCCTCTGCG	0.587																																					p.P127P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G381A	19						.						75.0	62.0	66.0					19																	54868559		2203	4300	6503	59560371	SO:0001819	synonymous_variant	3903	exon4			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.432G>A	19.37:g.54868559C>T			59560371	NM_021706		Silent	SNP	ENST00000391742.2	37	CCDS12891.1																																																																																				0.587	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140506.1		
LRP12	29967	hgsc.bcm.edu	37	8	105503259	105503259	+	Missense_Mutation	SNP	C	C	T	rs148476233		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr8:105503259C>T	ENST00000276654.5	-	7	2330	c.2222G>A	c.(2221-2223)cGt>cAt	p.R741H	LRP12_ENST00000518375.1_5'UTR|LRP12_ENST00000424843.2_Missense_Mutation_p.R722H	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	741					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.R741H(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TAATGTAAAACGTACCCAGCG	0.478																																					p.R741H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2222A	8						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	109.0	96.0	100.0		2165,2222	5.5	0.7	8	dbSNP_134	100	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LRP12	NM_001135703.2,NM_013437.4	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	722/841,741/860	105503259	1,13005	2203	4300	6503	105572435	SO:0001583	missense	29967	exon7			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.2222G>A	8.37:g.105503259C>T	ENSP00000276654:p.Arg741His		105572435	NM_013437	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728670	0.69074	0.0	1.16E-4	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000520873	D;D	0.85171	-1.95;-1.88	5.51	5.51	0.81932	.	0.102433	0.64402	D	0.000002	D	0.84014	0.5379	N	0.24115	0.695	0.58432	D	0.999999	D;D	0.67145	0.993;0.996	P;P	0.51833	0.681;0.62	D	0.85254	0.1046	10	0.52906	T	0.07	-26.9802	19.7828	0.96424	0.0:1.0:0.0:0.0	.	722;741	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	H	722;741;106	ENSP00000399148:R722H;ENSP00000276654:R741H	ENSP00000276654:R741H	R	-	2	0	LRP12	105572435	1.000000	0.71417	0.679000	0.29978	0.986000	0.74619	4.243000	0.58721	2.747000	0.94245	0.650000	0.86243	CGT		0.478	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
DLC1	10395	hgsc.bcm.edu	37	8	12950268	12950268	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr8:12950268C>T	ENST00000276297.4	-	13	4002	c.3593G>A	c.(3592-3594)cGg>cAg	p.R1198Q	DLC1_ENST00000512044.2_Missense_Mutation_p.R795Q|DLC1_ENST00000358919.2_Missense_Mutation_p.R761Q|DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000520226.1_Missense_Mutation_p.R687Q	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1198	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.R1198Q(1)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CAGAACCTCCCGGTTCTCGTC	0.572																																					p.R1198Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3593A	8						.						73.0	63.0	66.0					8																	12950268		2203	4300	6503	12994639	SO:0001583	missense	10395	exon13			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3593G>A	8.37:g.12950268C>T	ENSP00000276297:p.Arg1198Gln		12994639	NM_182643	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	C	36	5.772294	0.96922	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	4.98	4.98	0.66077	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.74092	0.3671	M	0.87971	2.92	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	P;D;D	0.91635	0.832;0.999;0.982	T	0.78838	-0.2046	10	0.87932	D	0	.	18.8331	0.92150	0.0:1.0:0.0:0.0	.	1198;795;761	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	Q	1198;761;137;795;687	ENSP00000276297:R1198Q;ENSP00000351797:R761Q;ENSP00000422595:R795Q;ENSP00000428028:R687Q	ENSP00000276297:R1198Q	R	-	2	0	DLC1	12994639	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	7.630000	0.83225	2.770000	0.95276	0.655000	0.94253	CGG		0.572	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207632.2	NM_182643, NM_006094	
CSMD3	114788	hgsc.bcm.edu	37	8	113323314	113323314	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr8:113323314C>T	ENST00000297405.5	-	50	8022	c.7778G>A	c.(7777-7779)cGt>cAt	p.R2593H	CSMD3_ENST00000352409.3_Missense_Mutation_p.R2523H|CSMD3_ENST00000343508.3_Missense_Mutation_p.R2553H|CSMD3_ENST00000455883.2_Missense_Mutation_p.R2489H	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2593	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R2593H(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACAGGCCCAACGGACCACACT	0.473										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.R2593H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7778A	8						.						158.0	128.0	138.0					8																	113323314		2203	4300	6503	113392490	SO:0001583	missense	114788	exon50			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7778G>A	8.37:g.113323314C>T	ENSP00000297405:p.Arg2593His		113392490	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808634	0.70797	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	5.62	5.62	0.85841	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.67287	0.2877	N	0.21448	0.665	0.80722	D	1	D;D;B	0.89917	1.0;1.0;0.311	D;D;B	0.91635	0.999;0.999;0.096	T	0.59757	-0.7394	10	0.10902	T	0.67	.	19.6449	0.95773	0.0:1.0:0.0:0.0	.	2489;2593;2553	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	H	2553;2593;1863;2489;2523	ENSP00000345799:R2553H;ENSP00000297405:R2593H;ENSP00000341558:R1863H;ENSP00000412263:R2489H;ENSP00000343124:R2523H	ENSP00000297405:R2593H	R	-	2	0	CSMD3	113392490	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.088000	0.71371	2.628000	0.89032	0.655000	0.94253	CGT		0.473	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
SLC7A2	6542	hgsc.bcm.edu	37	8	17412484	17412484	+	Intron	SNP	G	G	A	rs368445046		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr8:17412484G>A	ENST00000494857.1	+	8	1413				SLC7A2_ENST00000004531.10_Intron|SLC7A2_ENST00000398090.3_Missense_Mutation_p.R402Q|SLC7A2_ENST00000522656.1_Intron|SLC7A2_ENST00000470360.1_Missense_Mutation_p.R402Q	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2						amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)	p.R402Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	CCTTTACCCCGAATTCTGTTT	0.443																																					p.R402Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1205A	8						.	G	,,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	160.0	143.0	149.0		,,1205	5.2	1.0	8		149	0,8600		0,0,4300	no	intron,intron,missense	SLC7A2	NM_001008539.3,NM_001164771.1,NM_003046.5	,,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,probably-damaging	,,402/698	17412484	1,13005	2203	4300	6503	17456776	SO:0001627	intron_variant	6542	exon7			D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.1195+276G>A	8.37:g.17412484G>A			17456776	NM_003046	B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Missense_Mutation	SNP	ENST00000494857.1	37	CCDS34852.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983072	0.93044	2.27E-4	0.0	ENSG00000003989	ENST00000470360;ENST00000398090	D;D	0.93659	-3.26;-3.26	5.15	5.15	0.70609	.	0.053410	0.85682	D	0.000000	D	0.96790	0.8952	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96595	0.9440	9	0.51188	T	0.08	.	19.0069	0.92854	0.0:0.0:1.0:0.0	.	402	P52569-2	.	Q	402	ENSP00000419873:R402Q;ENSP00000381164:R402Q	ENSP00000381164:R402Q	R	+	2	0	SLC7A2	17456776	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.813000	0.99286	2.579000	0.87056	0.460000	0.39030	CGA		0.443	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253367.3	NM_003046	
CCAR2	57805	hgsc.bcm.edu	37	8	22470552	22470552	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr8:22470552C>T	ENST00000308511.4	+	8	856	c.607C>T	c.(607-609)Cgc>Tgc	p.R203C	CCAR2_ENST00000389279.3_Missense_Mutation_p.R203C|RP11-582J16.5_ENST00000521025.1_RNA|CCAR2_ENST00000520861.1_5'UTR			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	203					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)	p.R203C(1)									CTCCAAGAAACGCAAACAGCG	0.488																																					p.R203C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C607T	8						.						112.0	93.0	100.0					8																	22470552		2203	4300	6503	22526497	SO:0001583	missense	57805	exon8			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.607C>T	8.37:g.22470552C>T	ENSP00000310670:p.Arg203Cys		22526497	NM_021174	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	ENST00000308511.4	37	CCDS34863.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781627	0.90282	.	.	ENSG00000158941	ENST00000308511;ENST00000389279;ENST00000522599	T;T;T	0.56444	1.27;1.27;0.46	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000001	T	0.64316	0.2587	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.65100	-0.6250	10	0.87932	D	0	-18.089	17.4969	0.87720	0.0:1.0:0.0:0.0	.	203	Q8N163	K1967_HUMAN	C	203;203;21	ENSP00000310670:R203C;ENSP00000373930:R203C;ENSP00000429739:R21C	ENSP00000310670:R203C	R	+	1	0	KIAA1967	22526497	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.102000	0.57776	2.941000	0.99782	0.655000	0.94253	CGC		0.488	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375865.1	NM_021174	
ZNF395	55893	hgsc.bcm.edu	37	8	28206719	28206719	+	Silent	SNP	G	G	A	rs375928784		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr8:28206719G>A	ENST00000344423.5	-	9	1484	c.1353C>T	c.(1351-1353)agC>agT	p.S451S	ZNF395_ENST00000523202.1_Silent_p.S451S|ZNF395_ENST00000523095.1_Silent_p.S451S	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	451					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S451S(1)		cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GCTGGGGCTCGCTGAAGCTTA	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17873	0.0		0.0	False		,,,				2504	0.0				p.S451S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1353T	8						.	G		1,4405	2.1+/-5.4	0,1,2202	77.0	81.0	80.0		1353	-2.5	1.0	8		80	0,8600		0,0,4300	no	coding-synonymous	ZNF395	NM_018660.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		451/514	28206719	1,13005	2203	4300	6503	28262638	SO:0001819	synonymous_variant	55893	exon9			AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1353C>T	8.37:g.28206719G>A			28262638	NM_018660	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Silent	SNP	ENST00000344423.5	37	CCDS6067.1																																																																																				0.617	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		
ATP6V1H	51606	hgsc.bcm.edu	37	8	54684641	54684641	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr8:54684641C>T	ENST00000359530.2	-	10	1220	c.957G>A	c.(955-957)gaG>gaA	p.E319E	ATP6V1H_ENST00000396774.2_Silent_p.E319E|ATP6V1H_ENST00000523899.1_5'Flank|ATP6V1H_ENST00000355221.3_Silent_p.E301E|ATP6V1H_ENST00000520188.1_Silent_p.E279E	NM_015941.3	NP_057025.2	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H	319					ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|endocytosis (GO:0006897)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|regulation of catalytic activity (GO:0050790)|regulation of defense response to virus by virus (GO:0050690)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V1 domain (GO:0000221)	enzyme regulator activity (GO:0030234)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.E301E(1)		endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	18		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			GTTCCAAGTTCTCCAACTGTT	0.388																																					p.E319E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G957A	8						.						122.0	110.0	114.0					8																	54684641		2203	4300	6503	54847194	SO:0001819	synonymous_variant	51606	exon10			AF132945	CCDS6153.1, CCDS6154.1	8q11.2	2011-05-24	2002-08-29		ENSG00000047249	ENSG00000047249		"""ATPases / V-type"""	18303	protein-coding gene	gene with protein product	"""vacuolar ATP synthase subunit H"""	608861	"""ATPase, H+ transporting, lysosomal 50/57kD, V1 subunit H"""			9620685, 10810093	Standard	NM_015941		Approved	CGI-11, SFD, VMA13, SFDalpha, SFDbeta	uc003xrm.4	Q9UI12	OTTHUMG00000164231	ENST00000359530.2:c.957G>A	8.37:g.54684641C>T			54847194	NM_015941	B3KMR0|Q6PK44|Q9H3E3|Q9Y300	Silent	SNP	ENST00000359530.2	37	CCDS6153.1																																																																																				0.388	ATP6V1H-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377865.1	NM_015941	
POP1	10940	hgsc.bcm.edu	37	8	99168279	99168279	+	Splice_Site	SNP	C	C	T	rs142902409		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr8:99168279C>T	ENST00000401707.2	+	15	2140	c.2059C>T	c.(2059-2061)Cgc>Tgc	p.R687C	POP1_ENST00000349693.3_Splice_Site_p.R687C	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	687					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)	p.R687C(1)		autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			TTTCTTTAGACGCCCTCCTGC	0.408																																					p.R687C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2059T	8						.	C	CYS/ARG,CYS/ARG,CYS/ARG	2,4404	2.1+/-5.4	0,2,2201	102.0	96.0	98.0		2059,2059,2059	5.4	1.0	8	dbSNP_134	98	5,8595	4.3+/-15.6	0,5,4295	yes	missense-near-splice,missense-near-splice,missense-near-splice	POP1	NM_001145860.1,NM_001145861.1,NM_015029.2	180,180,180	0,7,6496	TT,TC,CC		0.0581,0.0454,0.0538	probably-damaging,probably-damaging,probably-damaging	687/1025,687/1025,687/1025	99168279	7,12999	2203	4300	6503	99237455	SO:0001630	splice_region_variant	10940	exon15			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.2058-1C>T	8.37:g.99168279C>T			99237455	NM_001145860	A8K5W9|Q15037	Missense_Mutation	SNP	ENST00000401707.2	37	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.769897	0.49680	4.54E-4	5.81E-4	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.44083	0.93;0.93	5.43	5.43	0.79202	POPLD (1);	0.319686	0.33792	N	0.004553	T	0.61887	0.2383	M	0.67397	2.05	0.54753	D	0.999989	D	0.76494	0.999	D	0.63192	0.912	T	0.65084	-0.6254	10	0.87932	D	0	0.2749	17.4135	0.87493	0.0:1.0:0.0:0.0	.	687	Q99575	POP1_HUMAN	C	687	ENSP00000385787:R687C;ENSP00000339529:R687C	ENSP00000339529:R687C	R	+	1	0	POP1	99237455	1.000000	0.71417	1.000000	0.80357	0.315000	0.28087	3.481000	0.53179	2.538000	0.85594	0.491000	0.48974	CGC		0.408	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	Missense_Mutation
KCNQ3	3786	hgsc.bcm.edu	37	8	133152339	133152339	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr8:133152339C>T	ENST00000388996.4	-	11	1972	c.1552G>A	c.(1552-1554)Gcc>Acc	p.A518T	KCNQ3_ENST00000519445.1_Missense_Mutation_p.A518T|KCNQ3_ENST00000521134.1_Missense_Mutation_p.A398T	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	518					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.A518T(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GCTCGGATGGCGGCCTTCAGG	0.607																																					p.A518T												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G1552A	8						.						58.0	62.0	61.0					8																	133152339		2203	4300	6503	133221521	SO:0001583	missense	3786	exon11			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1552G>A	8.37:g.133152339C>T	ENSP00000373648:p.Ala518Thr		133221521	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.169872	0.57584	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.99594	-6.25;-6.25;-6.25	6.03	6.03	0.97812	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.053669	0.85682	D	0.000000	D	0.98065	0.9362	L	0.33093	0.98	0.40979	D	0.98476	B;B	0.23990	0.095;0.095	B;B	0.16289	0.015;0.015	D	0.97204	0.9866	10	0.28530	T	0.3	-25.9683	14.389	0.66965	0.1475:0.8525:0.0:0.0	.	518;518	E7ET42;O43525	.;KCNQ3_HUMAN	T	518;398;518;507;397	ENSP00000373648:A518T;ENSP00000429799:A398T;ENSP00000428790:A518T	ENSP00000373648:A518T	A	-	1	0	KCNQ3	133221521	1.000000	0.71417	0.986000	0.45419	0.927000	0.56198	4.755000	0.62198	2.861000	0.98227	0.655000	0.94253	GCC		0.607	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
KIF1B	23095	hgsc.bcm.edu	37	1	10408754	10408754	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:10408754C>T	ENST00000377086.1	+	37	4114	c.3912C>T	c.(3910-3912)agC>agT	p.S1304S	KIF1B_ENST00000263934.6_Silent_p.S1258S|KIF1B_ENST00000465635.1_3'UTR|KIF1B_ENST00000377081.1_Silent_p.S1304S			O60333	KIF1B_HUMAN	kinesin family member 1B	1304					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.S1258S(1)		breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AGAAGGGGAGCGAGCTCCATT	0.438																																					p.S1258S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3774T	1						.						140.0	108.0	119.0					1																	10408754		2203	4300	6503	10331341	SO:0001819	synonymous_variant	23095	exon35			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.3912C>T	1.37:g.10408754C>T			10331341	NM_015074	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Silent	SNP	ENST00000377086.1	37																																																																																					0.438	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
WDR47	22911	hgsc.bcm.edu	37	1	109553927	109553927	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:109553927C>T	ENST00000369962.3	-	5	963	c.741G>A	c.(739-741)tgG>tgA	p.W247*	WDR47_ENST00000369965.4_Nonsense_Mutation_p.W247*|WDR47_ENST00000357672.3_Nonsense_Mutation_p.W219*|WDR47_ENST00000361054.3_Nonsense_Mutation_p.W219*|WDR47_ENST00000400794.3_Nonsense_Mutation_p.W254*			O94967	WDR47_HUMAN	WD repeat domain 47	247					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.W247*(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		GATTCTGAAGCCATGACAGTA	0.383																																					p.W247X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G741A	1						.						186.0	190.0	189.0					1																	109553927		2203	4296	6499	109355450	SO:0001587	stop_gained	22911	exon5			AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.741G>A	1.37:g.109553927C>T	ENSP00000358979:p.Trp247*		109355450	NM_014969	A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Nonsense_Mutation	SNP	ENST00000369962.3	37	CCDS44187.1	.	.	.	.	.	.	.	.	.	.	C	37	6.266300	0.97426	.	.	ENSG00000085433	ENST00000400794;ENST00000369962;ENST00000361054;ENST00000369965;ENST00000357672	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5384	19.2988	0.94134	0.0:1.0:0.0:0.0	.	.	.	.	X	254;247;219;247;219	.	ENSP00000350301:W219X	W	-	3	0	WDR47	109355450	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.487000	0.81328	2.543000	0.85770	0.563000	0.77884	TGG		0.383	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032414.2	NM_014969	
HIPK1	204851	hgsc.bcm.edu	37	1	114512684	114512684	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:114512684G>A	ENST00000369558.1	+	14	3110	c.2878G>A	c.(2878-2880)Gct>Act	p.A960T	HIPK1_ENST00000369561.4_Missense_Mutation_p.A926T|HIPK1_ENST00000426820.2_Missense_Mutation_p.A960T|HIPK1_ENST00000369555.2_Missense_Mutation_p.A915T|HIPK1_ENST00000369559.4_Missense_Mutation_p.A960T|HIPK1_ENST00000406344.1_Missense_Mutation_p.A566T|HIPK1_ENST00000369553.1_Missense_Mutation_p.A566T|HIPK1_ENST00000340480.4_Missense_Mutation_p.A586T|HIPK1_ENST00000369554.2_Missense_Mutation_p.A915T			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	960	Interaction with TP53.|Required for localization to nuclear speckles. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.A960T(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACCCTGAGTGCTCTCCGAGG	0.502																																					p.A586T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1756A	1						.						166.0	167.0	166.0					1																	114512684		2203	4300	6503	114314207	SO:0001583	missense	204851	exon13			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.2878G>A	1.37:g.114512684G>A	ENSP00000358571:p.Ala960Thr		114314207	NM_198269	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.36|10.36	1.328087|1.328087	0.24080|0.24080	.|.	.|.	ENSG00000163349|ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480;ENST00000369553;ENST00000406344|ENST00000361587	T;T;T;T;T;T;T;T;T;T|.	0.49720|.	0.8;0.77;0.84;0.81;0.81;0.84;0.81;3.84;2.93;2.93|.	6.04|6.04	4.18|4.18	0.49190|0.49190	.|.	0.262203|.	0.32563|.	N|.	0.005921|.	T|T	0.14743|0.14743	0.0356|0.0356	L|L	0.29908|0.29908	0.895|0.895	0.32133|0.32133	N|N	0.586528|0.586528	B;B;B;B|.	0.11235|.	0.004;0.002;0.0;0.003|.	B;B;B;B|.	0.12837|.	0.008;0.007;0.0;0.004|.	T|T	0.14227|0.14227	-1.0480|-1.0480	10|5	0.15952|.	T|.	0.53|.	.|.	4.797|4.797	0.13277|0.13277	0.216:0.0:0.5425:0.2415|0.216:0.0:0.5425:0.2415	.|.	252;566;960;960|.	E9PCF6;Q86Z02-4;Q86Z02;Q86Z02-2|.	.;.;HIPK1_HUMAN;.|.	T|Y	1031;960;960;915;915;960;926;586;566;566|240	ENSP00000407442:A1031T;ENSP00000358572:A960T;ENSP00000409673:A960T;ENSP00000358567:A915T;ENSP00000358568:A915T;ENSP00000358571:A960T;ENSP00000358574:A926T;ENSP00000340956:A586T;ENSP00000358566:A566T;ENSP00000384960:A566T|.	ENSP00000340956:A586T|.	A|C	+|+	1|2	0|0	HIPK1|HIPK1	114314207|114314207	0.768000|0.768000	0.28519|0.28519	0.993000|0.993000	0.49108|0.49108	0.857000|0.857000	0.48899|0.48899	0.871000|0.871000	0.28023|0.28023	0.897000|0.897000	0.36392|0.36392	0.561000|0.561000	0.74099|0.74099	GCT|TGC		0.502	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
PRDM2	7799	hgsc.bcm.edu	37	1	14105136	14105136	+	Missense_Mutation	SNP	A	A	T	rs376676285|rs369010172		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:14105136A>T	ENST00000235372.7	+	8	1702	c.846A>T	c.(844-846)gaA>gaT	p.E282D	PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.E282D|PRDM2_ENST00000413440.1_Missense_Mutation_p.E81D|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.E81D	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	282	Asp/Glu-rich (acidic).			EDEEEEEDDDDDELEDEG -> VGGGGGVVVVVSWKARGE (in Ref. 6; AAA87023). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E282D(1)		endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		aagaagaagaagatgatgatg	0.483																																					p.E81D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A243T	1						.	A	,ASP/GLU,ASP/GLU,ASP/GLU	1,4405	2.1+/-5.4	0,1,2202	62.0	63.0	62.0		,846,846,243	-4.0	0.6	1		62	0,8600		0,0,4300	no	intron,missense,missense,missense	PRDM2	NM_001135610.1,NM_015866.4,NM_012231.4,NM_001007257.2	,45,45,45	0,1,6502	TT,TA,AA		0.0,0.0227,0.0077	,benign,benign,benign	,282/1683,282/1719,81/1482	14105136	1,13005	2203	4300	6503	13977723	SO:0001583	missense	7799	exon3			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.846A>T	1.37:g.14105136A>T	ENSP00000235372:p.Glu282Asp		13977723	NM_001007257	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	A	4.812	0.150968	0.09185	2.27E-4	0.0	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01821	4.74;4.62;4.63;4.63	2.2	-4.02	0.04034	.	0.126342	0.30011	N	0.010637	T	0.01353	0.0044	L	0.52759	1.655	0.80722	D	1	B;B;B;B	0.15719	0.008;0.0;0.008;0.014	B;B;B;B	0.10450	0.002;0.0;0.002;0.005	T	0.52200	-0.8607	10	0.15066	T	0.55	.	2.6243	0.04925	0.2447:0.0:0.3894:0.3659	.	282;140;282;282	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	D	282;282;282;81;81	ENSP00000235372:E282D;ENSP00000312352:E282D;ENSP00000411103:E81D;ENSP00000341621:E81D	ENSP00000235372:E282D	E	+	3	2	PRDM2	13977723	0.969000	0.33509	0.604000	0.28916	0.208000	0.24298	-0.363000	0.07593	-0.752000	0.04728	0.374000	0.22700	GAA		0.483	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
PTGFRN	5738	hgsc.bcm.edu	37	1	117509633	117509633	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:117509633G>A	ENST00000393203.2	+	6	1887	c.1740G>A	c.(1738-1740)tcG>tcA	p.S580S		NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	580	Ig-like C2-type 5.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.S580S(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		ATATTAAGTCGCCACGCTACT	0.488																																					p.S580S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1740A	1						.						60.0	63.0	62.0					1																	117509633		2203	4300	6503	117311156	SO:0001819	synonymous_variant	5738	exon6			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.1740G>A	1.37:g.117509633G>A			117311156	NM_020440	Q5VVU9|Q8N2K6	Silent	SNP	ENST00000393203.2	37	CCDS890.1																																																																																				0.488	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033271.1	NM_020440	
SV2A	9900	hgsc.bcm.edu	37	1	149882490	149882490	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:149882490G>A	ENST00000369146.3	-	4	1333	c.843C>T	c.(841-843)tcC>tcT	p.S281S	SV2A_ENST00000369145.1_Silent_p.S281S	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	281					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)	p.S281S(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CCAGAAACTCGGAGAAATAGG	0.522																																					p.S281S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C843T	1						.						60.0	60.0	60.0					1																	149882490		2203	4300	6503	148149114	SO:0001819	synonymous_variant	9900	exon4			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.843C>T	1.37:g.149882490G>A			148149114	NM_014849	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	ENST00000369146.3	37	CCDS940.1																																																																																				0.522	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1		
TARS2	80222	hgsc.bcm.edu	37	1	150469374	150469374	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:150469374C>T	ENST00000369064.3	+	9	1044	c.1010C>T	c.(1009-1011)gCg>gTg	p.A337V	TARS2_ENST00000463555.1_Intron|TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Intron|TARS2_ENST00000369054.2_Intron	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	337					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)	p.A337V(1)		cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	GCACTAGTGGCGTTTATCAGG	0.527																																					p.A337V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1010T	1						.						64.0	55.0	58.0					1																	150469374		2203	4300	6503	148735998	SO:0001583	missense	80222	exon9			BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.1010C>T	1.37:g.150469374C>T	ENSP00000358060:p.Ala337Val		148735998	NM_025150	Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	ENST00000369064.3	37	CCDS952.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529505	0.64860	.	.	ENSG00000143374	ENST00000369064	T	0.68903	-0.36	5.39	4.46	0.54185	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.359629	0.29293	N	0.012566	T	0.44456	0.1294	L	0.46819	1.47	0.80722	D	1	B	0.24963	0.115	B	0.18263	0.021	T	0.53215	-0.8470	10	0.62326	D	0.03	-5.8383	11.9664	0.53038	0.4674:0.5326:0.0:0.0	.	337	Q9BW92	SYTM_HUMAN	V	337	ENSP00000358060:A337V	ENSP00000358060:A337V	A	+	2	0	TARS2	148735998	1.000000	0.71417	0.979000	0.43373	0.989000	0.77384	5.003000	0.63959	1.463000	0.47967	0.655000	0.94253	GCG		0.527	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150	
SETDB1	9869	hgsc.bcm.edu	37	1	150933350	150933350	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:150933350G>A	ENST00000271640.5	+	16	3002	c.2812G>A	c.(2812-2814)Gga>Aga	p.G938R	SETDB1_ENST00000368969.4_Missense_Mutation_p.G938R|SETDB1_ENST00000459773.1_3'UTR	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	938	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.G938R(2)		NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			GAAAGAGAACGGACTCTCTGA	0.552																																					p.G938R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2812A	1						.						101.0	109.0	106.0					1																	150933350		2203	4300	6503	149199974	SO:0001583	missense	9869	exon16			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2812G>A	1.37:g.150933350G>A	ENSP00000271640:p.Gly938Arg		149199974	NM_001145415	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	ENST00000271640.5	37	CCDS44217.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.280940	0.59758	.	.	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	D;D;T	0.87966	-2.32;-2.32;1.17	5.54	5.54	0.83059	SET domain (3);	0.214979	0.47455	D	0.000235	T	0.79673	0.4486	N	0.22421	0.69	0.80722	D	1	P;P;P	0.50272	0.933;0.848;0.875	P;B;B	0.45829	0.494;0.252;0.368	T	0.82655	-0.0350	10	0.54805	T	0.06	.	19.5534	0.95331	0.0:0.0:1.0:0.0	.	938;938;938	E9PRF4;Q15047-3;Q15047	.;.;SETB1_HUMAN	R	938	ENSP00000271640:G938R;ENSP00000357965:G938R;ENSP00000432348:G938R	ENSP00000271640:G938R	G	+	1	0	SETDB1	149199974	1.000000	0.71417	0.869000	0.34112	0.729000	0.41735	6.638000	0.74309	2.625000	0.88918	0.456000	0.33151	GGA		0.552	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
PEAR1	375033	hgsc.bcm.edu	37	1	156882711	156882711	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:156882711C>T	ENST00000338302.3	+	19	2584	c.2359C>T	c.(2359-2361)Cac>Tac	p.H787Y	PEAR1_ENST00000292357.7_Missense_Mutation_p.H787Y			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	787					recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.H787Y(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGGCAAGGAGCACCACCACCT	0.622																																					p.H787Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2359T	1						.						103.0	101.0	102.0					1																	156882711		2203	4300	6503	155149335	SO:0001583	missense	375033	exon18			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.2359C>T	1.37:g.156882711C>T	ENSP00000344465:p.His787Tyr		155149335	NM_001080471	Q8TEK2	Missense_Mutation	SNP	ENST00000338302.3	37	CCDS30892.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043876	0.55110	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	D;D	0.89270	-2.49;-2.49	5.23	5.23	0.72850	.	0.000000	0.50627	D	0.000117	T	0.77191	0.4094	L	0.56769	1.78	0.28628	N	0.907834	P	0.38335	0.627	B	0.29176	0.099	T	0.72643	-0.4231	10	0.20046	T	0.44	.	16.338	0.83073	0.0:1.0:0.0:0.0	.	787	Q5VY43	PEAR1_HUMAN	Y	787	ENSP00000344465:H787Y;ENSP00000292357:H787Y	ENSP00000292357:H787Y	H	+	1	0	PEAR1	155149335	0.996000	0.38824	1.000000	0.80357	0.957000	0.61999	2.117000	0.41939	2.717000	0.92951	0.563000	0.77884	CAC		0.622	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	
OR6K2	81448	hgsc.bcm.edu	37	1	158669500	158669500	+	Missense_Mutation	SNP	C	C	T	rs141972386		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:158669500C>T	ENST00000359610.2	-	1	986	c.943G>A	c.(943-945)Gta>Ata	p.V315I		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	315						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V315I(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					CCTGGTCTTACGGAAAAAAAT	0.368																																					p.V315I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G943A	1						.	T	ILE/VAL	1,4405	825.9+/-416.6	0,1,2202	72.0	70.0	71.0		943	-9.4	0.0	1	dbSNP_134	71	0,8600		0,0,4300	no	missense	OR6K2	NM_001005279.1	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	315/325	158669500	1,13005	2203	4300	6503	156936124	SO:0001583	missense	81448	exon1			BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.943G>A	1.37:g.158669500C>T	ENSP00000352626:p.Val315Ile		156936124	NM_001005279	B9EH33|Q6IFR6	Missense_Mutation	SNP	ENST00000359610.2	37	CCDS30902.1	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.500215	0.01001	2.27E-4	0.0	ENSG00000196171	ENST00000359610	T	0.01005	5.45	4.69	-9.38	0.00623	.	.	.	.	.	T	0.00109	0.0003	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48293	-0.9048	9	0.07813	T	0.8	.	2.6891	0.05116	0.2475:0.2546:0.3735:0.1244	.	315	Q8NGY2	OR6K2_HUMAN	I	315	ENSP00000352626:V315I	ENSP00000352626:V315I	V	-	1	0	OR6K2	156936124	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.204000	0.03017	-3.694000	0.00120	-1.327000	0.01280	GTA		0.368	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279	
OR6K2	81448	hgsc.bcm.edu	37	1	158669925	158669925	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:158669925A>G	ENST00000359610.2	-	1	561	c.518T>C	c.(517-519)cTt>cCt	p.L173P		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L173P(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					GATATGTTCAAGGTGATTCGA	0.483																																					p.L173P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T518C	1						.						128.0	110.0	116.0					1																	158669925		2203	4300	6503	156936549	SO:0001583	missense	81448	exon1			BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.518T>C	1.37:g.158669925A>G	ENSP00000352626:p.Leu173Pro		156936549	NM_001005279	B9EH33|Q6IFR6	Missense_Mutation	SNP	ENST00000359610.2	37	CCDS30902.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.628095	0.46944	.	.	ENSG00000196171	ENST00000359610	T	0.00076	8.76	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36778	N	0.002419	T	0.00271	0.0008	M	0.84156	2.68	0.23473	N	0.997607	D	0.76494	0.999	D	0.73708	0.981	T	0.24657	-1.0154	10	0.87932	D	0	-10.8433	13.9851	0.64328	1.0:0.0:0.0:0.0	.	173	Q8NGY2	OR6K2_HUMAN	P	173	ENSP00000352626:L173P	ENSP00000352626:L173P	L	-	2	0	OR6K2	156936549	0.823000	0.29233	0.069000	0.20011	0.645000	0.38454	6.796000	0.75145	2.110000	0.64415	0.528000	0.53228	CTT		0.483	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279	
IGSF9	57549	hgsc.bcm.edu	37	1	159898557	159898557	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:159898557C>T	ENST00000368094.1	-	19	2818	c.2621G>A	c.(2620-2622)cGg>cAg	p.R874Q	IGSF9_ENST00000493195.1_5'UTR|IGSF9_ENST00000361509.3_Missense_Mutation_p.R858Q	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	874	Pro-rich.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.R858Q(1)		central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GGCTGGAGTCCGAGGTTCTGC	0.677																																					p.R874Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2621A	1						.						9.0	6.0	7.0					1																	159898557		2091	4114	6205	158165181	SO:0001583	missense	57549	exon19			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.2621G>A	1.37:g.159898557C>T	ENSP00000357073:p.Arg874Gln		158165181	NM_001135050		Missense_Mutation	SNP	ENST00000368094.1	37	CCDS44254.1	.	.	.	.	.	.	.	.	.	.	C	8.861	0.946842	0.18356	.	.	ENSG00000085552	ENST00000361509;ENST00000368094	T;T	0.64438	-0.1;-0.01	4.63	-0.841	0.10752	.	0.472558	0.15815	N	0.243269	T	0.12944	0.0314	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.29274	-1.0017	9	.	.	.	-2.2067	4.2392	0.10640	0.1695:0.3191:0.0:0.5114	.	874	Q9P2J2	TUTLA_HUMAN	Q	858;874	ENSP00000355049:R858Q;ENSP00000357073:R874Q	.	R	-	2	0	IGSF9	158165181	0.000000	0.05858	0.148000	0.22405	0.752000	0.42762	-0.977000	0.03782	-0.034000	0.13713	0.655000	0.94253	CGG		0.677	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	NM_020789	
ATP1A4	480	hgsc.bcm.edu	37	1	160136483	160136483	+	Missense_Mutation	SNP	G	G	A	rs187960925		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:160136483G>A	ENST00000368081.4	+	8	1684	c.1213G>A	c.(1213-1215)Gtg>Atg	p.V405M		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	405					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)	p.V405M(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGATATGACCGTGTATGAGGC	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		20638	0.001		0.0	False		,,,				2504	0.0				p.V405M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1213A	1						.						116.0	91.0	100.0					1																	160136483		2203	4300	6503	158403107	SO:0001583	missense	480	exon8			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1213G>A	1.37:g.160136483G>A	ENSP00000357060:p.Val405Met		158403107	NM_144699	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	CCDS1197.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	16.16	3.044844	0.55110	.	.	ENSG00000132681	ENST00000368081	T	0.79940	-1.32	4.35	1.16	0.20824	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.610871	0.15783	N	0.244825	T	0.66096	0.2755	N	0.17631	0.505	0.80722	D	1	D	0.56035	0.974	P	0.58130	0.833	T	0.66324	-0.5952	10	0.87932	D	0	.	6.0102	0.19571	0.5411:0.0:0.4589:0.0	.	405	Q13733	AT1A4_HUMAN	M	405	ENSP00000357060:V405M	ENSP00000357060:V405M	V	+	1	0	ATP1A4	158403107	1.000000	0.71417	0.000000	0.03702	0.002000	0.02628	3.678000	0.54627	0.139000	0.18822	-0.143000	0.13931	GTG		0.562	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
POGK	57645	hgsc.bcm.edu	37	1	166818405	166818405	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:166818405C>T	ENST00000367875.1	+	5	949	c.589C>T	c.(589-591)Cgc>Tgc	p.R197C	POGK_ENST00000537173.1_Missense_Mutation_p.R79C|POGK_ENST00000367876.4_Missense_Mutation_p.R197C|POGK_ENST00000536514.1_Missense_Mutation_p.R112C			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	197					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R197C(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						CCGGGGCATGCGCCGCAGTTA	0.537																																					p.R197C	GBM(76;192 1530 30153 48742)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C589T	1						.						75.0	67.0	70.0					1																	166818405		2203	4300	6503	165085029	SO:0001583	missense	57645	exon5			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.589C>T	1.37:g.166818405C>T	ENSP00000356849:p.Arg197Cys		165085029	NM_017542	Q5TIJ1|Q8TE07	Missense_Mutation	SNP	ENST00000367875.1	37	CCDS1254.1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131976	0.56828	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000449930;ENST00000367876;ENST00000367875	T;T;T;T;T	0.56275	0.47;0.48;4.22;3.81;3.81	5.39	2.36	0.29203	Brinker DNA-binding domain (1);	0.141789	0.30510	N	0.009480	T	0.58293	0.2112	M	0.72894	2.215	0.35057	D	0.761171	D;D;D	0.89917	1.0;1.0;0.998	D;D;P	0.79784	0.984;0.993;0.82	T	0.64914	-0.6295	9	0.87932	D	0	-21.187	11.1627	0.48524	0.4862:0.5138:0.0:0.0	.	79;112;197	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	C	79;112;197;197;197	ENSP00000442763:R79C;ENSP00000441187:R112C;ENSP00000404402:R197C;ENSP00000356850:R197C;ENSP00000356849:R197C	ENSP00000356849:R197C	R	+	1	0	POGK	165085029	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	0.757000	0.26433	0.336000	0.23639	0.655000	0.94253	CGC		0.537	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082888.1	NM_017542	
GPR161	23432	hgsc.bcm.edu	37	1	168066329	168066329	+	Silent	SNP	G	G	A	rs200671514		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:168066329G>A	ENST00000367838.1	-	5	829	c.516C>T	c.(514-516)gaC>gaT	p.D172D	GPR161_ENST00000539777.1_Silent_p.D94D|GPR161_ENST00000361697.2_Silent_p.D172D|GPR161_ENST00000367836.1_Silent_p.D40D|GPR161_ENST00000271357.5_Silent_p.D172D|GPR161_ENST00000537209.1_Silent_p.D192D|GPR161_ENST00000367835.1_Silent_p.D172D|GPR161_ENST00000546300.1_Silent_p.D58D	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	172					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)	p.D172D(1)		breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					ATTTGAACTCGTCAAACTCCA	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19685	0.0		0.0	False		,,,				2504	0.0				p.D172D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C516T	1						.						76.0	60.0	65.0					1																	168066329		2203	4300	6503	166332953	SO:0001819	synonymous_variant	23432	exon5			AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.516C>T	1.37:g.168066329G>A			166332953	NM_153832	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Silent	SNP	ENST00000367838.1	37	CCDS1268.1																																																																																				0.582	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369	
HMCN1	83872	hgsc.bcm.edu	37	1	185892612	185892612	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:185892612C>A	ENST00000271588.4	+	8	1341	c.1112C>A	c.(1111-1113)tCt>tAt	p.S371Y	HMCN1_ENST00000367492.2_Missense_Mutation_p.S371Y	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	371					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.S371Y(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCAGGAAGTTCTCTTAAGACT	0.358																																					p.S371Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1112A	1						.						100.0	99.0	99.0					1																	185892612		2203	4299	6502	184159235	SO:0001583	missense	83872	exon8			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1112C>A	1.37:g.185892612C>A	ENSP00000271588:p.Ser371Tyr		184159235	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.210742	0.58343	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67171	-0.24;-0.25	5.4	5.4	0.78164	.	0.411778	0.27991	N	0.017037	T	0.48390	0.1497	L	0.46157	1.445	0.26723	N	0.970748	P	0.45283	0.855	B	0.35413	0.202	T	0.52449	-0.8574	10	0.02654	T	1	.	9.1935	0.37213	0.0:0.7984:0.0:0.2016	.	371	Q96RW7	HMCN1_HUMAN	Y	371	ENSP00000271588:S371Y;ENSP00000356462:S371Y	ENSP00000271588:S371Y	S	+	2	0	HMCN1	184159235	0.999000	0.42202	0.735000	0.30896	0.993000	0.82548	4.616000	0.61197	2.521000	0.84997	0.655000	0.94253	TCT		0.358	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
CELA3A	10136	hgsc.bcm.edu	37	1	22336291	22336291	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:22336291T>A	ENST00000290122.3	+	7	755	c.736T>A	c.(736-738)Ttc>Atc	p.F246I	RNU6-776P_ENST00000364403.1_RNA|RN7SL186P_ENST00000466485.2_RNA	NM_005747.4	NP_005738.4	P09093	CEL3A_HUMAN	chymotrypsin-like elastase family, member 3A	246	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|digestion (GO:0007586)|proteolysis (GO:0006508)		serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TGGCTGCAACTTCATCTGGAA	0.612																																					p.F246I												.	.	0			c.T736A	1						.						81.0	71.0	74.0					1																	22336291		2197	4300	6497	22208878	SO:0001583	missense	10136	exon7			D00306	CCDS220.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000142789	ENSG00000142789			15944	protein-coding gene	gene with protein product	"""protease E"""		"""elastase 3A, pancreatic (protease E)"", ""elastase 3A, pancreatic"""	ELA3A		2826474, 2460440	Standard	NM_005747		Approved	ELA3		P09093	OTTHUMG00000002755	ENST00000290122.3:c.736T>A	1.37:g.22336291T>A	ENSP00000290122:p.Phe246Ile		22208878	NM_005747	B1AQ53|Q9BRW4	Missense_Mutation	SNP	ENST00000290122.3	37	CCDS220.1	.	.	.	.	.	.	.	.	.	.	T	1.608	-0.524666	0.04141	.	.	ENSG00000142789	ENST00000290122;ENST00000400271	D;D	0.88124	-2.34;-2.34	3.65	1.23	0.21249	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.69762	0.3147	N	0.08118	0	0.21105	N	0.99979	B	0.06786	0.001	B	0.15052	0.012	T	0.55823	-0.8080	9	0.25106	T	0.35	-22.0992	4.207	0.10493	0.7119:0.0:0.1073:0.1808	.	246	P09093	CEL3A_HUMAN	I	246;54	ENSP00000290122:F246I;ENSP00000383130:F54I	ENSP00000290122:F246I	F	+	1	0	CELA3A	22208878	0.000000	0.05858	0.771000	0.31576	0.007000	0.05969	0.162000	0.16501	0.470000	0.27294	-0.585000	0.04130	TTC		0.612	CELA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007791.1	NM_005747	
TRAF5	7188	hgsc.bcm.edu	37	1	211534100	211534100	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:211534100G>A	ENST00000261464.5	+	6	654	c.600G>A	c.(598-600)gcG>gcA	p.A200A	TRAF5_ENST00000427925.2_Intron|TRAF5_ENST00000462410.1_3'UTR|TRAF5_ENST00000367004.3_Silent_p.A200A|TRAF5_ENST00000336184.2_Silent_p.A200A	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	200					apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A200A(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		ACAATTGTGCGAAGATTATTC	0.343																																					p.A200A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G600A	1						.						90.0	84.0	87.0					1																	211534100		2203	4300	6503	209600723	SO:0001819	synonymous_variant	7188	exon6			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.600G>A	1.37:g.211534100G>A			209600723	NM_004619	B4DIS9|B4E0A2|Q6FHY1	Silent	SNP	ENST00000261464.5	37	CCDS1497.1																																																																																				0.343	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619	
STPG1	90529	hgsc.bcm.edu	37	1	24700267	24700267	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:24700267C>T	ENST00000374409.1	-	6	750	c.496G>A	c.(496-498)Gtc>Atc	p.V166I	STPG1_ENST00000440416.1_Missense_Mutation_p.V119I|STPG1_ENST00000468303.1_5'UTR|STPG1_ENST00000337248.4_Missense_Mutation_p.V166I|STPG1_ENST00000003583.8_Missense_Mutation_p.V119I	NM_001199012.1	NP_001185941.1	Q5TH74	STPG1_HUMAN	sperm-tail PG-rich repeat containing 1	166					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.V119I(1)									CGAGTACAGACGTTGTTTCTC	0.488																																					p.V166I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G496A	1						.						181.0	190.0	187.0					1																	24700267		2203	4300	6503	24572854	SO:0001583	missense	90529	exon6			BC047705	CCDS253.1, CCDS55581.1	1p36.11	2012-10-31	2012-07-30	2012-07-30	ENSG00000001460	ENSG00000001460			28070	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 2"""	615826	"""chromosome 1 open reading frame 201"""	C1orf201		23028632	Standard	NM_001199012		Approved	FLJ33340, MAPO2	uc001bjc.3	Q5TH74	OTTHUMG00000003297	ENST00000374409.1:c.496G>A	1.37:g.24700267C>T	ENSP00000363530:p.Val166Ile		24572854	NM_001199013	Q49AP0|Q6P3R4|Q86VU9|Q8WVQ3	Missense_Mutation	SNP	ENST00000374409.1	37	CCDS55581.1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609486	0.46527	.	.	ENSG00000001460	ENST00000374409;ENST00000440416;ENST00000003583;ENST00000337248;ENST00000438866;ENST00000374404	.	.	.	5.81	4.82	0.62117	.	0.179896	0.36200	N	0.002737	T	0.47451	0.1446	L	0.61036	1.89	0.31108	N	0.71035	D;P	0.57899	0.981;0.941	P;B	0.45232	0.474;0.407	T	0.55717	-0.8097	9	0.32370	T	0.25	.	12.862	0.57918	0.1733:0.8267:0.0:0.0	.	166;119	Q5TH74;Q5TH74-3	CA201_HUMAN;.	I	166;119;119;166;69;70	.	ENSP00000003583:V119I	V	-	1	0	C1orf201	24572854	0.999000	0.42202	1.000000	0.80357	0.907000	0.53573	2.396000	0.44468	2.746000	0.94184	0.655000	0.94253	GTC		0.488	STPG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009172.1	NM_178122	
LYST	1130	hgsc.bcm.edu	37	1	235922694	235922694	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:235922694G>A	ENST00000389794.3	-	23	6633	c.6459C>T	c.(6457-6459)tcC>tcT	p.S2153S	LYST_ENST00000536965.1_3'UTR|LYST_ENST00000389793.2_Silent_p.S2153S			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2153					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.S2153S(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TCAGTGTGTCGGAACTCCCCA	0.428																																					p.S2153S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6459T	1						.						155.0	148.0	150.0					1																	235922694		2203	4300	6503	233989317	SO:0001819	synonymous_variant	1130	exon23			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6459C>T	1.37:g.235922694G>A			233989317	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	37	CCDS31062.1																																																																																				0.428	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
CHD5	26038	hgsc.bcm.edu	37	1	6212530	6212530	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:6212530G>A	ENST00000262450.3	-	6	911	c.812C>T	c.(811-813)aCg>aTg	p.T271M	CHD5_ENST00000378021.1_De_novo_Start_InFrame	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.T271M(1)		breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GAGCCCGGCCGTCTTTTTCCC	0.537																																					p.T271M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C812T	1						.						153.0	130.0	138.0					1																	6212530		2203	4300	6503	6135117	SO:0001583	missense	26038	exon6			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.812C>T	1.37:g.6212530G>A	ENSP00000262450:p.Thr271Met		6135117	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	G	2.590	-0.295515	0.05532	.	.	ENSG00000116254	ENST00000262450	D	0.90385	-2.66	4.42	0.747	0.18371	.	0.647631	0.14397	N	0.322170	T	0.69233	0.3088	N	0.00707	-1.245	0.53688	D	0.999978	B	0.02656	0.0	B	0.01281	0.0	T	0.53528	-0.8426	10	0.25106	T	0.35	-11.7681	8.5789	0.33617	0.675:0.0:0.325:0.0	.	271	Q8TDI0	CHD5_HUMAN	M	271	ENSP00000262450:T271M	ENSP00000262450:T271M	T	-	2	0	CHD5	6135117	0.701000	0.27806	0.015000	0.15790	0.677000	0.39632	0.970000	0.29383	-0.067000	0.12976	-0.415000	0.06103	ACG		0.537	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
SLC2A7	155184	hgsc.bcm.edu	37	1	9067390	9067390	+	Missense_Mutation	SNP	C	C	T	rs371136367		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:9067390C>T	ENST00000400906.1	-	10	1170	c.1171G>A	c.(1171-1173)Gcg>Acg	p.A391T		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	391					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.A391T(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GAATGTCCCGCGATGTAGGCA	0.632													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20428	0.0		0.0	False		,,,				2504	0.0				p.A391T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1171A	1						.	C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	155.0	118.0	130.0		1171	0.7	0.8	1		130	0,8600		0,0,4300	no	missense	SLC2A7	NM_207420.2	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	391/513	9067390	1,13005	2203	4300	6503	8989977	SO:0001583	missense	155184	exon10			AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.1171G>A	1.37:g.9067390C>T	ENSP00000383698:p.Ala391Thr		8989977	NM_207420	A2A333	Missense_Mutation	SNP	ENST00000400906.1	37	CCDS98.2	.	.	.	.	.	.	.	.	.	.	C	11.76	1.734823	0.30774	2.27E-4	0.0	ENSG00000197241	ENST00000400906	T	0.59224	0.28	3.8	0.676	0.17958	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.554792	0.15604	U	0.253742	T	0.47078	0.1426	L	0.58810	1.83	0.09310	N	1	P	0.43607	0.812	B	0.43386	0.418	T	0.34403	-0.9830	10	0.31617	T	0.26	.	0.7282	0.00952	0.3506:0.2827:0.197:0.1697	.	391	Q6PXP3	GTR7_HUMAN	T	391	ENSP00000383698:A391T	ENSP00000383698:A391T	A	-	1	0	SLC2A7	8989977	0.404000	0.25328	0.752000	0.31206	0.782000	0.44232	0.106000	0.15354	-0.047000	0.13423	-0.521000	0.04368	GCG		0.632	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127768.3	NM_207420	
ARID1A	8289	hgsc.bcm.edu	37	1	27099906	27099906	+	Missense_Mutation	SNP	G	G	A	rs140125151		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:27099906G>A	ENST00000324856.7	+	15	4156	c.3785G>A	c.(3784-3786)cGt>cAt	p.R1262H	ARID1A_ENST00000540690.1_5'UTR|ARID1A_ENST00000374152.2_Missense_Mutation_p.R879H|ARID1A_ENST00000457599.2_Missense_Mutation_p.R1262H	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1262					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.R1262H(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCCTACAGTCGTGCTGCCGGC	0.597			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.R1262H			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3785A	1						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	66.0	62.0	63.0		3785,3785	5.0	1.0	1	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ARID1A	NM_006015.4,NM_139135.2	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	1262/2286,1262/2069	27099906	1,13005	2203	4300	6503	26972493	SO:0001583	missense	8289	exon15			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3785G>A	1.37:g.27099906G>A	ENSP00000320485:p.Arg1262His		26972493	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.172120	0.57584	0.0	1.16E-4	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.03386	4.1;3.98;3.95	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.11922	0.0290	L	0.50333	1.59	0.80722	D	1	B;D;D;D	0.76494	0.054;0.998;0.999;0.998	B;P;P;P	0.58660	0.011;0.7;0.843;0.7	T	0.01688	-1.1295	10	0.42905	T	0.14	-0.9968	18.5413	0.91029	0.0:0.0:1.0:0.0	.	879;1262;1262;915	O14497-3;O14497;O14497-2;Q4LE49	.;ARI1A_HUMAN;.;.	H	1262;1262;879	ENSP00000320485:R1262H;ENSP00000387636:R1262H;ENSP00000363267:R879H	ENSP00000320485:R1262H	R	+	2	0	ARID1A	26972493	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.306000	0.78905	2.627000	0.88993	0.655000	0.94253	CGT		0.597	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ZC3H12A	80149	hgsc.bcm.edu	37	1	37947357	37947357	+	Missense_Mutation	SNP	C	C	T	rs201792321		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:37947357C>T	ENST00000373087.6	+	4	855	c.739C>T	c.(739-741)Cgt>Tgt	p.R247C		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A									p.R247C(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGACACATACCGTGACCTCCA	0.577																																					p.R247C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C739T	1						.						197.0	168.0	178.0					1																	37947357		2203	4300	6503	37719944	SO:0001583	missense	80149	exon4				CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.739C>T	1.37:g.37947357C>T	ENSP00000362179:p.Arg247Cys		37719944	NM_025079		Missense_Mutation	SNP	ENST00000373087.6	37	CCDS417.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227953	0.79576	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.56941	0.43	5.8	4.81	0.61882	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.80470	0.4629	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86026	0.1510	10	0.87932	D	0	-34.8138	15.6868	0.77418	0.225:0.775:0.0:0.0	.	247	Q5D1E8	ZC12A_HUMAN	C	247	ENSP00000362179:R247C	ENSP00000362174:R247C	R	+	1	0	ZC3H12A	37719944	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	2.481000	0.45215	2.735000	0.93741	0.655000	0.94253	CGT		0.577	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
MACF1	23499	hgsc.bcm.edu	37	1	39782199	39782199	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:39782199C>T	ENST00000372915.3	+	27	3688	c.3601C>T	c.(3601-3603)Cgg>Tgg	p.R1201W	MACF1_ENST00000361689.2_Missense_Mutation_p.R1201W|MACF1_ENST00000567887.1_Missense_Mutation_p.R1233W|MACF1_ENST00000564288.1_Missense_Mutation_p.R1196W|MACF1_ENST00000539005.1_Missense_Mutation_p.R1201W|MACF1_ENST00000317713.7_Missense_Mutation_p.R1201W|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000545844.1_Missense_Mutation_p.R1201W			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1201					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.R1201W(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTCGACATTACGGGTGAGTTG	0.433																																					p.R1201W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3601T	1						.						139.0	140.0	140.0					1																	39782199		2203	4300	6503	39554786	SO:0001583	missense	23499	exon29			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.3601C>T	1.37:g.39782199C>T	ENSP00000362006:p.Arg1201Trp		39554786	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.37|19.37	3.815056|3.815056	0.70912|0.70912	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262|ENST00000372925	T;T;T;T;T;T;T|.	0.78246|.	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16|.	5.91|5.91	2.8|2.8	0.32819|0.32819	.|.	.|.	.|.	.|.	.|.	T|T	0.32436|0.32436	0.0829|0.0829	N|N	0.08118|0.08118	0|0	0.43050|0.43050	D|D	0.994657|0.994657	P;D;D|.	0.65815|.	0.717;0.993;0.995|.	B;P;P|.	0.54924|.	0.043;0.514;0.764|.	T|T	0.06391|0.06391	-1.0829|-1.0829	9|5	0.72032|.	D|.	0.01|.	.|.	9.3972|9.3972	0.38410|0.38410	0.1069:0.7127:0.1157:0.0647|0.1069:0.7127:0.1157:0.0647	.|.	1201;1201;1166|.	F8W8Q1;Q9UPN3-2;Q9UPN3-3|.	.;.;.|.	W|M	1201;1201;1201;1201;1201;1159;1350|334	ENSP00000439537:R1201W;ENSP00000362006:R1201W;ENSP00000354573:R1201W;ENSP00000313438:R1201W;ENSP00000444364:R1201W;ENSP00000435070:R1159W;ENSP00000437059:R1350W|.	ENSP00000313438:R1201W|.	R|T	+|+	1|2	2|0	MACF1|MACF1	39554786|39554786	0.930000|0.930000	0.31532|0.31532	0.974000|0.974000	0.42286|0.42286	0.881000|0.881000	0.50899|0.50899	0.395000|0.395000	0.20850|0.20850	0.836000|0.836000	0.34901|0.34901	0.655000|0.655000	0.94253|0.94253	CGG|ACG		0.433	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
HEYL	26508	hgsc.bcm.edu	37	1	40092672	40092672	+	Missense_Mutation	SNP	G	G	A	rs368302386		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:40092672G>A	ENST00000372852.3	-	5	813	c.494C>T	c.(493-495)aCg>aTg	p.T165M	HEYL_ENST00000535435.1_Missense_Mutation_p.T137M	NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	165	Pro-rich.				atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.T165M(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCCAGTGGGCGTGGGCGAAGG	0.652																																					p.T165M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C494T	1						.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	67.0	61.0	63.0		494	-0.9	0.2	1		63	0,8600		0,0,4300	no	missense	HEYL	NM_014571.3	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	165/329	40092672	1,13005	2203	4300	6503	39865259	SO:0001583	missense	26508	exon5			BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.494C>T	1.37:g.40092672G>A	ENSP00000361943:p.Thr165Met		39865259	NM_014571	Q5TG99	Missense_Mutation	SNP	ENST00000372852.3	37	CCDS439.1	.	.	.	.	.	.	.	.	.	.	G	3.620	-0.077654	0.07184	2.27E-4	0.0	ENSG00000163909	ENST00000372852;ENST00000535435	T;T	0.58652	0.33;0.32	5.02	-0.853	0.10709	.	0.647918	0.16363	N	0.217685	T	0.46737	0.1408	L	0.56769	1.78	0.09310	N	1	B	0.21753	0.06	B	0.17433	0.018	T	0.38286	-0.9668	10	0.39692	T	0.17	-19.4355	7.1519	0.25616	0.4072:0.1255:0.4673:0.0	.	165	Q9NQ87	HEYL_HUMAN	M	165;137	ENSP00000361943:T165M;ENSP00000439071:T137M	ENSP00000361943:T165M	T	-	2	0	HEYL	39865259	0.000000	0.05858	0.151000	0.22473	0.045000	0.14185	0.846000	0.27682	0.118000	0.18165	0.462000	0.41574	ACG		0.652	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001179.2	NM_014571	
SCMH1	22955	hgsc.bcm.edu	37	1	41514528	41514528	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:41514528G>A	ENST00000326197.7	-	10	1409	c.1110C>T	c.(1108-1110)ggC>ggT	p.G370G	SCMH1_ENST00000456518.2_Silent_p.G212G|SCMH1_ENST00000361191.5_Silent_p.G309G|SCMH1_ENST00000397171.2_Silent_p.G309G|SCMH1_ENST00000337495.5_Silent_p.G380G|SCMH1_ENST00000372595.1_Silent_p.G309G|SCMH1_ENST00000361705.3_Silent_p.G323G|SCMH1_ENST00000397174.2_Silent_p.G350G|SCMH1_ENST00000402904.2_Silent_p.G370G|SCMH1_ENST00000372597.1_Silent_p.G323G|SCMH1_ENST00000372596.1_Silent_p.G309G					sex comb on midleg homolog 1 (Drosophila)									p.G323G(1)|p.G380G(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				CTAAGTGGGGGCCTGTGCTGC	0.493																																					p.G309G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C927T	1						.						107.0	110.0	109.0					1																	41514528		2203	4300	6503	41287115	SO:0001819	synonymous_variant	22955	exon12			AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.1110C>T	1.37:g.41514528G>A			41287115	NM_001172218		Silent	SNP	ENST00000326197.7	37	CCDS30688.1																																																																																				0.493	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015656.1		
RNF220	55182	hgsc.bcm.edu	37	1	44877962	44877962	+	Missense_Mutation	SNP	G	G	A	rs147759221		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:44877962G>A	ENST00000355387.2	+	2	643	c.193G>A	c.(193-195)Ggt>Agt	p.G65S	RNF220_ENST00000372247.2_Missense_Mutation_p.G65S|RNF220_ENST00000361799.2_Missense_Mutation_p.G65S			Q5VTB9	RN220_HUMAN	ring finger protein 220	65					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G65S(2)|p.G65C(2)		endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						TTTCACCAACGGTTCCTATAC	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		21616	0.0		0.001	False		,,,				2504	0.0				p.G65S												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.G193A	1						.	G	SER/GLY	0,4406		0,0,2203	306.0	293.0	297.0		193	6.1	1.0	1	dbSNP_134	297	1,8599	1.2+/-3.3	0,1,4299	yes	missense	RNF220	NM_018150.2	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	65/567	44877962	1,13005	2203	4300	6503	44650549	SO:0001583	missense	55182	exon2			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.193G>A	1.37:g.44877962G>A	ENSP00000347548:p.Gly65Ser		44650549	NM_018150	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Missense_Mutation	SNP	ENST00000355387.2	37	CCDS510.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	23.8	4.459842	0.84317	0.0	1.16E-4	ENSG00000187147	ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247	.	.	.	6.05	6.05	0.98169	.	0.059753	0.64402	N	0.000003	T	0.68137	0.2968	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.69555	-0.5114	9	0.72032	D	0.01	.	20.6086	0.99469	0.0:0.0:1.0:0.0	.	65	Q5VTB9	RN220_HUMAN	S	65	.	ENSP00000347548:G65S	G	+	1	0	RNF220	44650549	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	9.476000	0.97823	2.880000	0.98712	0.655000	0.94253	GGT		0.542	RNF220-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020683.4	NM_018150	
FAF1	11124	hgsc.bcm.edu	37	1	51050425	51050425	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:51050425G>A	ENST00000396153.2	-	10	1350	c.899C>T	c.(898-900)aCa>aTa	p.T300I	RNU6-1026P_ENST00000384465.1_RNA|FAF1_ENST00000371778.4_Missense_Mutation_p.T300I|FAF1_ENST00000545823.1_Missense_Mutation_p.T58I|FAF1_ENST00000472808.1_5'UTR	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	300					apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.0?(1)|p.T300I(1)		breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		CCCAAATTCTGTAGCATCTTC	0.398																																					p.T300I												.	.	2	Substitution - Missense(1)|Whole gene deletion(1)	thyroid(1)|large_intestine(1)	c.C899T	1						.						193.0	180.0	185.0					1																	51050425		2203	4300	6503	50823013	SO:0001583	missense	11124	exon10			AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.899C>T	1.37:g.51050425G>A	ENSP00000379457:p.Thr300Ile		50823013	NM_007051	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Missense_Mutation	SNP	ENST00000396153.2	37	CCDS554.1	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908742	0.72868	.	.	ENSG00000185104	ENST00000396153;ENST00000371778;ENST00000545823	T;T	0.29917	1.55;1.55	5.5	5.5	0.81552	.	0.318671	0.38436	N	0.001691	T	0.32406	0.0828	L	0.47190	1.495	0.46798	D	0.999205	B;B	0.31153	0.31;0.026	B;B	0.28638	0.092;0.039	T	0.11966	-1.0566	10	0.72032	D	0.01	-20.4043	19.7504	0.96265	0.0:0.0:1.0:0.0	.	58;300	B4DEJ6;Q9UNN5	.;FAF1_HUMAN	I	300;300;58	ENSP00000379457:T300I;ENSP00000360843:T300I	ENSP00000360843:T300I	T	-	2	0	FAF1	50823013	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	9.311000	0.96282	2.731000	0.93534	0.655000	0.94253	ACA		0.398	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021807.1	NM_007051	
PGM1	5236	hgsc.bcm.edu	37	1	64114308	64114308	+	Missense_Mutation	SNP	G	G	A	rs527959572		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:64114308G>A	ENST00000371084.3	+	8	1478	c.1265G>A	c.(1264-1266)cGg>cAg	p.R422Q	PGM1_ENST00000540265.1_Missense_Mutation_p.R225Q|PGM1_ENST00000371083.4_Missense_Mutation_p.R440Q	NM_002633.2	NP_002624.2	P36871	PGM1_HUMAN	phosphoglucomutase 1	422					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)	p.R422Q(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20						AAGTATGGCCGGAATTTCTTC	0.542																																					p.R440Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1319A	1						.						78.0	75.0	76.0					1																	64114308		2203	4300	6503	63886896	SO:0001583	missense	5236	exon8			BC019920	CCDS625.1, CCDS53323.1, CCDS53324.1	1p22.1	2012-10-02			ENSG00000079739	ENSG00000079739	5.4.2.2		8905	protein-coding gene	gene with protein product		171900				4517931, 1530890	Standard	NM_002633		Approved		uc010ooz.2	P36871	OTTHUMG00000008968	ENST00000371084.3:c.1265G>A	1.37:g.64114308G>A	ENSP00000360125:p.Arg422Gln		63886896	NM_001172818	B2R5N9|B4DPV0|Q16105|Q16106|Q5BKZ9|Q6NW22|Q86U74|Q96J40|Q9NTY4	Missense_Mutation	SNP	ENST00000371084.3	37	CCDS625.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533509	0.85812	.	.	ENSG00000079739	ENST00000538673;ENST00000371084;ENST00000540265;ENST00000371083	T;T;T	0.58210	0.35;0.35;0.35	5.9	4.03	0.46877	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (1);	0.000000	0.85682	D	0.000000	T	0.74741	0.3756	H	0.96861	3.895	0.37634	D	0.9218	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	T	0.82546	-0.0403	10	0.87932	D	0	-39.1454	11.1505	0.48455	0.0659:0.0:0.8051:0.1289	.	440;422	P36871-2;P36871	.;PGM1_HUMAN	Q	398;422;225;440	ENSP00000360125:R422Q;ENSP00000443449:R225Q;ENSP00000360124:R440Q	ENSP00000360124:R440Q	R	+	2	0	PGM1	63886896	1.000000	0.71417	0.998000	0.56505	0.770000	0.43624	9.869000	0.99810	0.833000	0.34828	-0.136000	0.14681	CGG		0.542	PGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024868.1	NM_002633	
ZNF692	55657	hgsc.bcm.edu	37	1	249150713	249150713	+	Splice_Site	SNP	C	C	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr1:249150713C>A	ENST00000306601.4	-	5	690	c.524G>T	c.(523-525)aGg>aTg	p.R175M	AL672294.1_ENST00000417047.1_RNA|ZNF692_ENST00000468455.1_5'UTR|ZNF692_ENST00000451251.1_Splice_Site_p.R180M|ZNF692_ENST00000366469.5_Splice_Site_p.R175M|ZNF692_ENST00000366471.3_Splice_Site_p.S175I|ZNF692_ENST00000427146.1_Splice_Site_p.S175I	NM_017865.3	NP_060335.2	Q9BU19	ZN692_HUMAN	zinc finger protein 692	175					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R175M(1)		endometrium(3)|large_intestine(6)|lung(7)|stomach(1)	17	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			ACATCCTCACCTGGGCAACCT	0.542																																					p.S175I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G524T	1						.						161.0	149.0	153.0					1																	249150713		2203	4300	6503	247117336	SO:0001630	splice_region_variant	55657	exon5			BC002948	CCDS31127.1, CCDS44348.1, CCDS53487.1	1q44	2013-01-08			ENSG00000171163	ENSG00000171163		"""Zinc fingers, C2H2-type"""	26049	protein-coding gene	gene with protein product						12477932	Standard	NM_001136036		Approved	FLJ20531, Zfp692	uc001ifc.2	Q9BU19	OTTHUMG00000040423	ENST00000306601.4:c.524+1G>T	1.37:g.249150713C>A			247117336	NM_001193328	B4DXZ0|Q5SRA5|Q5SRA6|Q9HBC9|Q9NW93|Q9NWY6|Q9UF97	Missense_Mutation	SNP	ENST00000306601.4	37	CCDS31127.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.23|14.23	2.473845|2.473845	0.43942|0.43942	.|.	.|.	ENSG00000171163|ENSG00000171163	ENST00000306601;ENST00000366469;ENST00000451251|ENST00000427146;ENST00000366471	T;T;T|T;T	0.08720|0.07327	3.09;3.08;3.06|3.2;3.2	4.18|4.18	4.18|4.18	0.49190|0.49190	.|.	0.671775|.	0.14274|.	N|.	0.329949|.	T|T	0.15955|0.15955	0.0384|0.0384	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	P;P|D	0.50943|0.61697	0.94;0.94|0.99	B;B|P	0.43783|0.58266	0.431;0.431|0.836	T|T	0.00510|0.00510	-1.1697|-1.1697	9|8	.|.	.|.	.|.	-0.7891|-0.7891	12.3173|12.3173	0.54964|0.54964	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	180;175|175	B4DXZ0;Q9BU19|Q9BU19-2	.;ZN692_HUMAN|.	M|I	175;175;180|175	ENSP00000305483:R175M;ENSP00000355425:R175M;ENSP00000391200:R180M|ENSP00000390044:S175I;ENSP00000355427:S175I	.|.	R|S	-|-	2|2	0|0	ZNF692|ZNF692	247117336|247117336	0.976000|0.976000	0.34144|0.34144	0.990000|0.990000	0.47175|0.47175	0.942000|0.942000	0.58702|0.58702	1.937000|1.937000	0.40193|0.40193	2.626000|2.626000	0.88956|0.88956	0.462000|0.462000	0.41574|0.41574	AGG|AGT		0.542	ZNF692-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097298.1	NM_017865	Missense_Mutation
KIAA1377	57562	hgsc.bcm.edu	37	11	101833642	101833642	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:101833642A>G	ENST00000263468.8	+	6	2146	c.1876A>G	c.(1876-1878)Acc>Gcc	p.T626A	KIAA1377_ENST00000537689.1_Missense_Mutation_p.T427A	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	626								p.T626A(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AATTCCAAAGACCATTAAAAA	0.318																																					p.T626A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1876G	11						.						32.0	36.0	34.0					11																	101833642		2200	4294	6494	101338852	SO:0001583	missense	57562	exon6			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.1876A>G	11.37:g.101833642A>G	ENSP00000263468:p.Thr626Ala		101338852	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	A	10.41	1.343639	0.24339	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.08634	3.07;3.07	5.31	3.0	0.34707	.	0.451750	0.22843	N	0.054954	T	0.09642	0.0237	M	0.68317	2.08	0.09310	N	1	B	0.28933	0.228	B	0.30855	0.121	T	0.20940	-1.0260	10	0.48119	T	0.1	-0.6267	4.4261	0.11503	0.6455:0.0:0.2184:0.1361	.	626	Q9P2H0	K1377_HUMAN	A	626;427	ENSP00000263468:T626A;ENSP00000443184:T427A	ENSP00000263468:T626A	T	+	1	0	KIAA1377	101338852	0.985000	0.35326	0.057000	0.19452	0.306000	0.27790	2.668000	0.46816	0.961000	0.38030	0.459000	0.35465	ACC		0.318	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
GRIA4	2893	hgsc.bcm.edu	37	11	105842684	105842684	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:105842684G>A	ENST00000530497.1	+	14	2338	c.2338G>A	c.(2338-2340)Gtc>Atc	p.V780I	GRIA4_ENST00000533094.1_Intron|GRIA4_ENST00000393127.2_Intron|GRIA4_ENST00000525187.1_Intron|GRIA4_ENST00000282499.5_Missense_Mutation_p.V780I|RNU6-277P_ENST00000516272.1_RNA			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	780					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.V780I(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		TGAGGCAGGCGTCTTAGACAA	0.418																																					p.V780I												.	.	2	Substitution - Missense(2)	urinary_tract(1)|large_intestine(1)	c.G2338A	11						.						100.0	98.0	99.0					11																	105842684		2201	4299	6500	105347894	SO:0001583	missense	2893	exon15			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2338G>A	11.37:g.105842684G>A	ENSP00000435775:p.Val780Ile		105347894	NM_000829	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.420382	0.25552	.	.	ENSG00000152578	ENST00000282499;ENST00000530497	T;T	0.37752	1.18;1.18	5.55	5.55	0.83447	Ionotropic glutamate receptor (2);	0.553633	0.16351	N	0.218201	T	0.26955	0.0660	N	0.21194	0.64	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.11665	-1.0578	10	0.06625	T	0.88	.	19.5116	0.95144	0.0:0.0:1.0:0.0	.	780	P48058	GRIA4_HUMAN	I	780	ENSP00000282499:V780I;ENSP00000435775:V780I	ENSP00000282499:V780I	V	+	1	0	GRIA4	105347894	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.588000	0.67517	2.619000	0.88677	0.655000	0.94253	GTC		0.418	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
KMT2A	4297	hgsc.bcm.edu	37	11	118390716	118390716	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:118390716G>A	ENST00000389506.5	+	33	11357	c.11357G>A	c.(11356-11358)cGt>cAt	p.R3786H	KMT2A_ENST00000534358.1_Missense_Mutation_p.R3789H|RP11-770J1.3_ENST00000554407.1_RNA|RP11-770J1.3_ENST00000556583.1_RNA|KMT2A_ENST00000354520.4_Missense_Mutation_p.R3748H|RP11-770J1.3_ENST00000525992.2_RNA|RP11-770J1.3_ENST00000532597.1_RNA|RP11-770J1.3_ENST00000528578.1_RNA			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3786					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.R3786H(1)									TCTAAACATCGTCAGCCTCCT	0.423																																					p.R3786H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G11357A	11						.						96.0	92.0	93.0					11																	118390716		2200	4295	6495	117895926	SO:0001583	missense	4297	exon33			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.11357G>A	11.37:g.118390716G>A	ENSP00000374157:p.Arg3786His		117895926	NM_005933	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752873	0.89753	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.84516	-1.86;-1.86;-1.82	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.93841	0.8030	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.93995	0.7270	10	0.87932	D	0	.	20.282	0.98514	0.0:0.0:1.0:0.0	.	3789;3786	E9PQG7;Q03164	.;MLL1_HUMAN	H	3789;3786;3748;2696	ENSP00000436786:R3789H;ENSP00000374157:R3786H;ENSP00000346516:R3748H	ENSP00000346516:R3748H	R	+	2	0	MLL	117895926	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	6.420000	0.73349	2.786000	0.95864	0.563000	0.77884	CGT		0.423	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
PHLDB1	23187	hgsc.bcm.edu	37	11	118486842	118486842	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:118486842C>T	ENST00000361417.2	+	5	682	c.271C>T	c.(271-273)Cgg>Tgg	p.R91W	PHLDB1_ENST00000356063.5_Missense_Mutation_p.R91W	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	91	FHA.							p.R91W(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CGAGAACCTGCGGGGCACCCT	0.622																																					p.R91W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C271T	11						.						115.0	110.0	111.0					11																	118486842		2200	4295	6495	117992052	SO:0001583	missense	23187	exon4				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.271C>T	11.37:g.118486842C>T	ENSP00000354498:p.Arg91Trp		117992052	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328376	0.60743	.	.	ENSG00000019144	ENST00000361417;ENST00000543207;ENST00000545313;ENST00000356063	T;T	0.58060	0.36;0.36	5.76	4.84	0.62591	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.516501	0.20476	N	0.091585	T	0.60996	0.2312	L	0.34521	1.04	0.80722	D	1	D;D;P	0.76494	0.996;0.999;0.83	D;P;B	0.69307	0.963;0.866;0.165	T	0.63829	-0.6548	10	0.72032	D	0.01	-24.877	13.1847	0.59673	0.2885:0.7115:0.0:0.0	.	91;91;91	B4DIX4;Q86UU1-2;Q86UU1	.;.;PHLB1_HUMAN	W	91	ENSP00000354498:R91W;ENSP00000348359:R91W	ENSP00000348359:R91W	R	+	1	2	PHLDB1	117992052	0.000000	0.05858	0.989000	0.46669	0.999000	0.98932	0.267000	0.18552	1.550000	0.49438	0.655000	0.94253	CGG		0.622	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
OR5P2	120065	hgsc.bcm.edu	37	11	7817856	7817856	+	Missense_Mutation	SNP	C	C	T	rs78460198	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:7817856C>T	ENST00000329434.2	-	1	664	c.634G>A	c.(634-636)Gtc>Atc	p.V212I	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V212I(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ATGTAGCAGACGGCTATGACA	0.493													C|||	1185	0.236621	0.3472	0.2911	5008	,	,		18815	0.128		0.2763	False		,,,				2504	0.1196				p.V212I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G634A	11						.	C	ILE/VAL	1371,2839		401,569,1135	99.0	104.0	102.0		634	-11.0	0.0	11	dbSNP_131	102	2425,6159		393,1639,2260	no	missense	OR5P2	NM_153444.1	29	794,2208,3395	TT,TC,CC		28.2502,32.5653,29.6702	benign	212/323	7817856	3796,8998	2105	4292	6397	7774432	SO:0001583	missense	120065	exon1			AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.634G>A	11.37:g.7817856C>T	ENSP00000331823:p.Val212Ile		7774432	NM_153444	Q3MIS8	Missense_Mutation	SNP	ENST00000329434.2	37	CCDS7782.1	586	0.2683150183150183	180	0.36585365853658536	100	0.27624309392265195	84	0.14685314685314685	222	0.2928759894459103	C	0.005	-2.119520	0.00346	0.325653	0.282502	ENSG00000183303	ENST00000329434	T	0.37235	1.21	5.5	-11.0	0.00169	GPCR, rhodopsin-like superfamily (1);	0.814212	0.11083	N	0.601638	T	0.00012	0.0000	N	0.11000	0.08	0.80722	P	0.0	B	0.13594	0.008	B	0.18263	0.021	T	0.36578	-0.9742	9	0.02654	T	1	-5.754	20.7759	0.99721	0.0:0.328:0.0:0.672	.	212	Q8WZ92	OR5P2_HUMAN	I	212	ENSP00000331823:V212I	ENSP00000331823:V212I	V	-	1	0	OR5P2	7774432	0.000000	0.05858	0.000000	0.03702	0.379000	0.30106	-6.285000	0.00072	-3.387000	0.00174	-1.300000	0.01332	GTC		0.493	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385696.1	NM_153444	
SBF2	81846	hgsc.bcm.edu	37	11	9802030	9802030	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:9802030C>T	ENST00000256190.8	-	40	5622	c.5485G>A	c.(5485-5487)Gcc>Acc	p.A1829T	SBF2-AS1_ENST00000534671.1_RNA|SBF2-AS1_ENST00000498905.2_RNA|SBF2-AS1_ENST00000527406.1_RNA|SBF2-AS1_ENST00000499953.2_RNA|SBF2-AS1_ENST00000525636.1_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1829	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.A1829T(1)		breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		CCATCCTGGGCGCAGAAGTTA	0.488																																					p.A1829T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5485A	11						.						141.0	119.0	127.0					11																	9802030		2201	4294	6495	9758606	SO:0001583	missense	81846	exon40			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.5485G>A	11.37:g.9802030C>T	ENSP00000256190:p.Ala1829Thr		9758606	NM_030962	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	C	36	5.743529	0.96873	.	.	ENSG00000133812	ENST00000256190	T	0.27557	1.66	5.93	5.93	0.95920	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.64605	0.2613	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68599	-0.5366	10	0.87932	D	0	.	20.3409	0.98764	0.0:1.0:0.0:0.0	.	1829	Q86WG5	MTMRD_HUMAN	T	1829	ENSP00000256190:A1829T	ENSP00000256190:A1829T	A	-	1	0	SBF2	9758606	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	5.918000	0.69996	2.814000	0.96858	0.655000	0.94253	GCC		0.488	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	
SBF2	81846	hgsc.bcm.edu	37	11	9853807	9853807	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:9853807C>T	ENST00000256190.8	-	27	3753	c.3616G>A	c.(3616-3618)Gtt>Att	p.V1206I		NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1206	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.V1206I(1)|p.V1206F(1)		breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		AAAAGACCAACGACTCCCTTC	0.473																																					p.V1206I												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G3616A	11						.						89.0	86.0	87.0					11																	9853807		2201	4294	6495	9810383	SO:0001583	missense	81846	exon27			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.3616G>A	11.37:g.9853807C>T	ENSP00000256190:p.Val1206Ile		9810383	NM_030962	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	37	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609192	0.87258	.	.	ENSG00000133812	ENST00000256190	D	0.93189	-3.18	5.76	5.76	0.90799	Myotubularin phosphatase domain (1);	0.000000	0.85682	D	0.000000	D	0.96399	0.8825	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	D	0.94407	0.7628	10	0.28530	T	0.3	.	20.3242	0.98691	0.0:1.0:0.0:0.0	.	1206	Q86WG5	MTMRD_HUMAN	I	1206	ENSP00000256190:V1206I	ENSP00000256190:V1206I	V	-	1	0	SBF2	9810383	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.764000	0.85297	2.882000	0.98803	0.655000	0.94253	GTT		0.473	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	
PLEKHA7	144100	hgsc.bcm.edu	37	11	16877393	16877393	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:16877393G>A	ENST00000355661.3	-	5	384	c.374C>T	c.(373-375)aCg>aTg	p.T125M	PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000448080.2_Missense_Mutation_p.T125M|PLEKHA7_ENST00000531066.1_Missense_Mutation_p.T125M			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	125					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)	p.T125M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						GGTCCCAGCCGTGGATGTTTC	0.542																																					p.T125M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C374T	11						.						193.0	184.0	187.0					11																	16877393		2200	4294	6494	16833969	SO:0001583	missense	144100	exon5			BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.374C>T	11.37:g.16877393G>A	ENSP00000347883:p.Thr125Met		16833969	NM_175058	B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	ENST00000355661.3	37	CCDS31434.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737731	0.69304	.	.	ENSG00000166689	ENST00000531066;ENST00000355661;ENST00000448080;ENST00000528376	T;T;T;T	0.23950	2.72;2.72;2.72;1.88	5.65	4.73	0.59995	.	0.262525	0.43416	D	0.000565	T	0.37999	0.1024	L	0.29908	0.895	0.33323	D	0.567536	D;D	0.89917	0.999;1.0	P;D	0.74348	0.821;0.983	T	0.53913	-0.8371	10	0.87932	D	0	-8.5391	13.5093	0.61502	0.0756:0.0:0.9244:0.0	.	125;125	E9PKC0;Q6IQ23	.;PKHA7_HUMAN	M	125;125;125;19	ENSP00000435389:T125M;ENSP00000347883:T125M;ENSP00000416895:T125M;ENSP00000435806:T19M	ENSP00000347883:T125M	T	-	2	0	PLEKHA7	16833969	1.000000	0.71417	0.947000	0.38551	0.996000	0.88848	2.983000	0.49345	1.616000	0.50265	0.655000	0.94253	ACG		0.542	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058	
NELL1	4745	hgsc.bcm.edu	37	11	21392432	21392432	+	Missense_Mutation	SNP	C	C	T	rs373209512		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:21392432C>T	ENST00000357134.5	+	15	1735	c.1583C>T	c.(1582-1584)aCg>aTg	p.T528M	NELL1_ENST00000532434.1_Missense_Mutation_p.T528M|NELL1_ENST00000325319.5_Missense_Mutation_p.T471M|NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000298925.5_Missense_Mutation_p.T556M	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	528	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.T528M(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						TACGGTGGAACGTGTGTGGCT	0.428																																					p.T528M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1583T	11						.	C	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	111.0	101.0	104.0		1583,1583	4.7	0.2	11		104	0,8600		0,0,4300	no	missense,missense	NELL1	NM_006157.3,NM_201551.1	81,81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	528/811,528/764	21392432	1,13005	2203	4300	6503	21349008	SO:0001583	missense	4745	exon15			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1583C>T	11.37:g.21392432C>T	ENSP00000349654:p.Thr528Met		21349008	NM_006157	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.394793	0.62066	2.27E-4	0.0	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	D;D;D;D	0.92595	-2.46;-2.46;-2.46;-3.07	5.59	4.67	0.58626	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.96150	0.8745	M	0.90082	3.085	0.49299	D	0.999779	D;D;D;D	0.71674	0.986;0.997;0.998;0.998	P;P;P;P	0.61592	0.73;0.745;0.891;0.855	D	0.96373	0.9275	10	0.52906	T	0.07	-11.677	15.4833	0.75545	0.0:0.8606:0.1393:0.0	.	471;556;528;528	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	M	556;528;471;528	ENSP00000298925:T556M;ENSP00000349654:T528M;ENSP00000317837:T471M;ENSP00000437170:T528M	ENSP00000298925:T556M	T	+	2	0	NELL1	21349008	0.995000	0.38212	0.214000	0.23707	0.838000	0.47535	3.773000	0.55333	1.351000	0.45789	0.650000	0.86243	ACG		0.428	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	
DCDC1	341019	hgsc.bcm.edu	37	11	31327282	31327282	+	Missense_Mutation	SNP	C	C	T	rs374157559		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:31327282C>T	ENST00000452803.1	-	6	835	c.634G>A	c.(634-636)Gca>Aca	p.A212T	RP1-296L11.1_ENST00000528872.1_RNA|DCDC1_ENST00000597505.1_Missense_Mutation_p.A212T	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	212	Doublecortin. {ECO:0000255|PROSITE- ProRule:PRU00072}.				intracellular signal transduction (GO:0035556)			p.A212T(3)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					ACTCGTCTTGCGGCCATGTTC	0.438																																					p.A212T												.	.	3	Substitution - Missense(3)	large_intestine(1)|lung(1)|endometrium(1)	c.G634A	11						.	C	THR/ALA	0,4404		0,0,2202	105.0	105.0	105.0		634	5.1	0.1	11		105	1,8597	1.2+/-3.3	0,1,4298	no	missense	DCDC1	NM_181807.3	58	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	212/355	31327282	1,13001	2202	4299	6501	31283858	SO:0001583	missense	341019	exon6			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.634G>A	11.37:g.31327282C>T	ENSP00000389792:p.Ala212Thr		31283858	NM_181807	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000452803.1	37	CCDS7872.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414141	0.62511	0.0	1.16E-4	ENSG00000188682	ENST00000452803	D	0.94330	-3.4	5.95	5.05	0.67936	Doublecortin domain (3);	0.000000	0.56097	D	0.000040	D	0.93432	0.7905	M	0.84082	2.675	0.29704	N	0.839908	D	0.59357	0.985	B	0.43225	0.412	D	0.91478	0.5202	10	0.87932	D	0	.	13.4508	0.61169	0.0:0.9279:0.0:0.0721	.	212	P59894	DCDC1_HUMAN	T	212	ENSP00000389792:A212T	ENSP00000343496:A212T	A	-	1	0	DCDC1	31283858	1.000000	0.71417	0.101000	0.21167	0.961000	0.63080	5.356000	0.66052	1.522000	0.49001	-0.142000	0.14014	GCA		0.438	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1	NM_181807	
MYBPC3	4607	hgsc.bcm.edu	37	11	47350618	47350618	+	IGR	SNP	G	G	A	rs140803760		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:47350618G>A	ENST00000545968.1	-	0	4217				MADD_ENST00000395336.3_3'UTR|MADD_ENST00000395344.3_Missense_Mutation_p.V1515I|MADD_ENST00000407859.3_Missense_Mutation_p.V1539I|MADD_ENST00000402192.2_Missense_Mutation_p.V1561I|MADD_ENST00000311027.5_Missense_Mutation_p.V1621I|MADD_ENST00000349238.3_Missense_Mutation_p.V1582I|MADD_ENST00000342922.4_Missense_Mutation_p.V1562I|MADD_ENST00000406482.1_3'UTR|MADD_ENST00000402799.1_Missense_Mutation_p.V1519I	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac						cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.V1621I(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		CTGCTACTCCGTATTATGTCT	0.537																																					p.V1621I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4861A	11						.	G	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,,,ILE/VAL	0,4402		0,0,2201	195.0	166.0	176.0		4552,4543,4861,4684,4615,4555,4744,,,4681	5.8	1.0	11	dbSNP_134	176	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense,missense,missense,missense,missense,missense,utr-3,utr-3,missense	MADD	NM_001135943.1,NM_001135944.1,NM_003682.3,NM_130470.2,NM_130471.2,NM_130472.2,NM_130473.2,NM_130474.2,NM_130475.2,NM_130476.2	29,29,29,29,29,29,29,,,29	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,,,probably-damaging	1518/1545,1515/1542,1621/1648,1562/1589,1539/1566,1519/1546,1582/1609,,,1561/1588	47350618	1,12997	2201	4298	6499	47307194	SO:0001628	intergenic_variant	8567	exon36			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896			11.37:g.47350618G>A			47307194	NM_003682	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	37	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	G	35	5.462090	0.96240	0.0	1.16E-4	ENSG00000110514	ENST00000342922;ENST00000402799;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000402192	T;T;T;T;T;T;T	0.08807	3.18;3.05;3.16;3.2;3.05;3.05;3.18	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.26557	0.0649	L	0.49350	1.555	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;0.999;0.999;1.0	D;D;D;D;D;D;D	0.80764	0.972;0.979;0.987;0.994;0.991;0.987;0.994	T	0.00065	-1.2149	10	0.59425	D	0.04	-17.7185	20.0016	0.97412	0.0:0.0:1.0:0.0	.	1515;1515;1519;1582;1539;1621;1562	B5MEE5;A8K8S7;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;MADD_HUMAN;.	I	1562;1519;1582;1621;1539;1515;1561	ENSP00000343902:V1562I;ENSP00000385585:V1519I;ENSP00000304505:V1582I;ENSP00000310933:V1621I;ENSP00000384204:V1539I;ENSP00000378753:V1515I;ENSP00000384287:V1561I	ENSP00000310933:V1621I	V	+	1	0	MADD	47307194	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	8.864000	0.92294	2.731000	0.93534	0.555000	0.69702	GTA		0.537	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3		
TMEM109	79073	hgsc.bcm.edu	37	11	60687179	60687179	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:60687179G>T	ENST00000227525.3	+	2	417	c.14G>T	c.(13-15)aGc>aTc	p.S5I	RP11-881M11.4_ENST00000543907.1_RNA|TMEM109_ENST00000536171.1_Missense_Mutation_p.S5I	NM_024092.2	NP_076997.1	Q9BVC6	TM109_HUMAN	transmembrane protein 109	5					cellular response to gamma radiation (GO:0071480)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell death (GO:0060548)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)		p.S5I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8						GCAGCCTCCAGCATCAGTTCA	0.547																																					p.S5I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G14T	11						.						100.0	83.0	89.0					11																	60687179		2203	4299	6502	60443755	SO:0001583	missense	79073	exon2				CCDS7996.1	11q12.2	2005-12-22				ENSG00000110108			28771	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_024092		Approved	MGC5508	uc001nqg.3	Q9BVC6		ENST00000227525.3:c.14G>T	11.37:g.60687179G>T	ENSP00000227525:p.Ser5Ile		60443755	NM_024092		Missense_Mutation	SNP	ENST00000227525.3	37	CCDS7996.1	.	.	.	.	.	.	.	.	.	.	G	6.704	0.498525	0.12762	.	.	ENSG00000110108	ENST00000227525;ENST00000446886;ENST00000540407;ENST00000536171	.	.	.	5.1	3.17	0.36434	.	0.903465	0.09507	N	0.792851	T	0.27900	0.0687	N	0.14661	0.345	0.09310	N	1	B	0.17268	0.021	B	0.24155	0.051	T	0.24905	-1.0147	9	0.59425	D	0.04	-0.475	7.6851	0.28536	0.208:0.0:0.792:0.0	.	5	Q9BVC6	TM109_HUMAN	I	5	.	ENSP00000227525:S5I	S	+	2	0	TMEM109	60443755	0.531000	0.26338	0.023000	0.16930	0.021000	0.10359	1.658000	0.37376	1.106000	0.41623	0.563000	0.77884	AGC		0.547	TMEM109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396343.1	NM_024092	
SLC3A2	6520	hgsc.bcm.edu	37	11	62655936	62655936	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:62655936G>A	ENST00000377890.2	+	12	1832	c.1664G>A	c.(1663-1665)cGc>cAc	p.R555H	SLC3A2_ENST00000536981.1_Missense_Mutation_p.R100H|SLC3A2_ENST00000338663.7_Missense_Mutation_p.R454H|SLC3A2_ENST00000377891.2_Missense_Mutation_p.R556H|SLC3A2_ENST00000377892.1_Missense_Mutation_p.R586H|SLC3A2_ENST00000377889.2_Missense_Mutation_p.R493H|SLC3A2_ENST00000535296.1_Missense_Mutation_p.R524H	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	555					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)	p.R586H(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						TCCTATATCCGCCACTGGGAC	0.617																																					p.R555H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1664A	11						.						100.0	99.0	99.0					11																	62655936		2201	4298	6499	62412512	SO:0001583	missense	6520	exon12				CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.1664G>A	11.37:g.62655936G>A	ENSP00000367122:p.Arg555His		62412512	NM_002394	Q13543	Missense_Mutation	SNP	ENST00000377890.2	37	CCDS8039.2	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843657	0.91197	.	.	ENSG00000168003	ENST00000377892;ENST00000377891;ENST00000377890;ENST00000542007;ENST00000377889;ENST00000535296;ENST00000338663;ENST00000422606;ENST00000536981	D;D;D;D;D;D;D	0.99663	-6.16;-6.28;-6.32;-6.24;-6.24;-6.33;-4.91	4.79	4.79	0.61399	Glycosyl hydrolase, family 13, all-beta (1);	0.056581	0.64402	N	0.000001	D	0.99704	0.9887	M	0.93763	3.455	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.97321	0.9944	10	0.87932	D	0	-14.234	15.4107	0.74917	0.0:0.0:1.0:0.0	.	493;524;555;454;586	P08195-3;F5GZS6;P08195;P08195-2;P08195-4	.;.;4F2_HUMAN;.;.	H	586;556;555;556;493;524;454;436;100	ENSP00000367124:R586H;ENSP00000367123:R556H;ENSP00000367122:R555H;ENSP00000367121:R493H;ENSP00000444236:R524H;ENSP00000340815:R454H;ENSP00000444439:R100H	ENSP00000340815:R454H	R	+	2	0	SLC3A2	62412512	1.000000	0.71417	0.987000	0.45799	0.828000	0.46876	8.086000	0.89520	2.234000	0.73211	0.449000	0.29647	CGC		0.617	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157306.1	NM_001012661	
LGALS12	85329	hgsc.bcm.edu	37	11	63277283	63277283	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:63277283C>T	ENST00000394618.3	+	4	763	c.472C>T	c.(472-474)Cgc>Tgc	p.R158C	LGALS12_ENST00000255684.5_Missense_Mutation_p.R158C|LGALS12_ENST00000415491.2_Missense_Mutation_p.R97C|LGALS12_ENST00000425950.2_Missense_Mutation_p.R97C|LGALS12_ENST00000340246.5_Missense_Mutation_p.R159C	NM_001142535.1|NM_033101.3	NP_001136007.1|NP_149092.2	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12	158	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)	p.R158C(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	16						TCTCCACTTCCGCTACCGGCT	0.488																																					p.R158C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C472T	11						.						165.0	141.0	149.0					11																	63277283		2201	4298	6499	63033859	SO:0001583	missense	85329	exon4			AF222695	CCDS8045.1, CCDS44633.1, CCDS44634.1, CCDS44635.1, CCDS53648.1	11q13	2011-08-04	2008-07-25		ENSG00000133317	ENSG00000133317		"""Lectins, galactoside-binding"""	15788	protein-coding gene	gene with protein product	"""galectin 12"""	606096				11283015, 11435439	Standard	NM_033101		Approved	GRIP1	uc001nxc.2	Q96DT0	OTTHUMG00000167807	ENST00000394618.3:c.472C>T	11.37:g.63277283C>T	ENSP00000378116:p.Arg158Cys		63033859	NM_001142536	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000394618.3	37	CCDS8045.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675841	0.67928	.	.	ENSG00000133317	ENST00000255684;ENST00000394618;ENST00000340246;ENST00000415491;ENST00000425950	T;T;T;T;T	0.05855	3.38;3.38;3.38;3.38;3.38	5.7	2.58	0.30949	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.854892	0.10368	N	0.683140	T	0.21347	0.0514	M	0.84683	2.71	0.44447	D	0.997373	D;D;D;D	0.76494	0.999;0.991;0.998;0.993	P;P;P;P	0.57679	0.825;0.653;0.802;0.683	T	0.01977	-1.1236	10	0.62326	D	0.03	-5.9385	8.3864	0.32503	0.4308:0.4263:0.1429:0.0	.	118;159;158;158	Q9NZ03;G5E970;Q96DT0-3;Q96DT0	.;.;.;LEG12_HUMAN	C	158;158;159;97;97	ENSP00000255684:R158C;ENSP00000378116:R158C;ENSP00000339374:R159C;ENSP00000394659:R97C;ENSP00000399093:R97C	ENSP00000255684:R158C	R	+	1	0	LGALS12	63033859	0.010000	0.17322	0.973000	0.42090	0.832000	0.47134	0.041000	0.13927	0.720000	0.32209	0.511000	0.50034	CGC		0.488	LGALS12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396378.1	NM_033101	
POLA2	23649	hgsc.bcm.edu	37	11	65046311	65046311	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:65046311T>C	ENST00000265465.3	+	6	1103	c.572T>C	c.(571-573)aTc>aCc	p.I191T	POLA2_ENST00000541089.1_5'UTR	NM_002689.2	NP_002680.2	Q14181	DPOA2_HUMAN	polymerase (DNA directed), alpha 2, accessory subunit	191					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein import into nucleus, translocation (GO:0000060)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|protein heterodimerization activity (GO:0046982)	p.I191T(1)		endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	11					Dacarbazine(DB00851)	GCTGGAAACATCAGCCTGAAG	0.493																																					p.I191T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T572C	11						.						162.0	158.0	160.0					11																	65046311		2201	4297	6498	64802887	SO:0001583	missense	23649	exon6			BC002990	CCDS8098.1	11q13	2012-05-18	2012-05-18		ENSG00000014138	ENSG00000014138		"""DNA polymerases"""	30073	protein-coding gene	gene with protein product	"""DNA polymerase alpha subunit B"", ""DNA polymerase alpha 70 kDa subunit"""		"""polymerase (DNA directed), alpha 2 (70kD subunit)"""			8223465, 11433027	Standard	NM_002689		Approved	FLJ21662	uc001odj.3	Q14181	OTTHUMG00000165951	ENST00000265465.3:c.572T>C	11.37:g.65046311T>C	ENSP00000265465:p.Ile191Thr		64802887	NM_002689	B4DNB4|Q9BPV3	Missense_Mutation	SNP	ENST00000265465.3	37	CCDS8098.1	.	.	.	.	.	.	.	.	.	.	T	14.39	2.521596	0.44866	.	.	ENSG00000014138	ENST00000265465	T	0.21543	2.0	5.59	4.46	0.54185	DNA polymerase alpha, subunit B N-terminal (1);	0.500089	0.23148	N	0.051393	T	0.12603	0.0306	N	0.25647	0.755	0.80722	D	1	B	0.16603	0.018	B	0.19946	0.027	T	0.09640	-1.0665	10	0.11485	T	0.65	-6.1501	7.2893	0.26356	0.0:0.1707:0.0:0.8293	.	191	Q14181	DPOA2_HUMAN	T	191	ENSP00000265465:I191T	ENSP00000265465:I191T	I	+	2	0	POLA2	64802887	0.994000	0.37717	0.789000	0.31954	0.981000	0.71138	2.634000	0.46528	1.059000	0.40554	0.455000	0.32223	ATC		0.493	POLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387223.1	NM_002689	
CPT1A	1374	hgsc.bcm.edu	37	11	68529131	68529131	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:68529131T>C	ENST00000265641.5	-	16	2054	c.1900A>G	c.(1900-1902)Aag>Gag	p.K634E	CPT1A_ENST00000540367.1_Missense_Mutation_p.K634E|CPT1A_ENST00000376618.2_Missense_Mutation_p.K634E|CPT1A_ENST00000537756.2_5'Flank|CPT1A_ENST00000539743.1_Missense_Mutation_p.K634E	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	634					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)	p.K634E(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	GACGCCAACTTGAACAACTTC	0.493																																					p.K634E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1900G	11						.						231.0	204.0	213.0					11																	68529131		2200	4294	6494	68285707	SO:0001583	missense	1374	exon16			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1900A>G	11.37:g.68529131T>C	ENSP00000265641:p.Lys634Glu		68285707	NM_001031847	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	T	12.03	1.815122	0.32053	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	5.95	4.81	0.61882	.	0.227351	0.44097	D	0.000498	D	0.90487	0.7020	M	0.87180	2.865	0.42222	D	0.991854	B;B	0.29136	0.066;0.234	B;B	0.32149	0.141;0.087	D	0.89095	0.3485	10	0.87932	D	0	.	12.9598	0.58451	0.0:0.0:0.27:0.73	.	634;634	P50416;P50416-2	CPT1A_HUMAN;.	E	634	ENSP00000439084:K634E;ENSP00000365803:K634E;ENSP00000265641:K634E;ENSP00000446108:K634E	ENSP00000265641:K634E	K	-	1	0	CPT1A	68285707	0.997000	0.39634	0.740000	0.30986	0.015000	0.08874	2.136000	0.42121	1.055000	0.40461	0.533000	0.62120	AAG		0.493	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	
ORAOV1	220064	hgsc.bcm.edu	37	11	69486581	69486581	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:69486581A>G	ENST00000535657.1	-	3	244	c.163T>C	c.(163-165)Tgc>Cgc	p.C55R	ORAOV1_ENST00000536870.1_Intron|ORAOV1_ENST00000542341.1_Missense_Mutation_p.C55R|ORAOV1_ENST00000279147.4_Missense_Mutation_p.C55R|ORAOV1_ENST00000539414.1_Missense_Mutation_p.C55R			Q8WV07	ORAV1_HUMAN	oral cancer overexpressed 1	55								p.C55R(1)		NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_cancers(3;5.53e-114)|all_epithelial(3;1.34e-121)|Breast(3;9.28e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;6.15e-15)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;5.64e-57)|all cancers(3;5.98e-51)|BRCA - Breast invasive adenocarcinoma(2;5.49e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)			CCTTGGTAGCACCCGATCTGT	0.413																																					p.C55R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T163C	11						.						130.0	116.0	121.0					11																	69486581		2200	4294	6494	69195762	SO:0001583	missense	220064	exon3				CCDS8192.1	11q13.2	2010-11-23			ENSG00000149716	ENSG00000149716			17589	protein-coding gene	gene with protein product	"""oral cancer overexpressed protein 1-A"""	607224				12172009	Standard	NM_153451		Approved	TAOS1	uc001opc.3	Q8WV07		ENST00000535657.1:c.163T>C	11.37:g.69486581A>G	ENSP00000446129:p.Cys55Arg		69195762	NM_153451	B2R4R2|Q8NFK0	Missense_Mutation	SNP	ENST00000535657.1	37	CCDS8192.1	.	.	.	.	.	.	.	.	.	.	A	11.01	1.511944	0.27036	.	.	ENSG00000149716	ENST00000538554;ENST00000376587;ENST00000279147;ENST00000535657;ENST00000539414;ENST00000542341	T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14	5.41	4.21	0.49690	Essential protein Yae1, N-terminal (1);	0.306262	0.29737	N	0.011324	T	0.41143	0.1146	L	0.39898	1.24	0.47737	D	0.999506	D;P;P	0.60575	0.988;0.764;0.572	P;B;B	0.59424	0.857;0.307;0.357	T	0.09885	-1.0654	10	0.23891	T	0.37	-12.6999	9.1245	0.36807	0.7547:0.0:0.0:0.2453	.	55;55;55	B4DFA5;F5H6T8;Q8WV07	.;.;ORAV1_HUMAN	R	55	ENSP00000446428:C55R;ENSP00000279147:C55R;ENSP00000446129:C55R;ENSP00000444112:C55R;ENSP00000437367:C55R	ENSP00000279147:C55R	C	-	1	0	ORAOV1	69195762	0.990000	0.36364	0.977000	0.42913	0.210000	0.24377	3.091000	0.50199	2.042000	0.60477	0.368000	0.22195	TGC		0.413	ORAOV1-009	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000396821.1	NM_153451	
FOLR1	2348	hgsc.bcm.edu	37	11	71906954	71906954	+	Silent	SNP	C	C	T	rs398124307		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:71906954C>T	ENST00000393679.1	+	5	943	c.507C>T	c.(505-507)tgC>tgT	p.C169C	FOLR1_ENST00000312293.4_Silent_p.C169C|FOLR1_ENST00000393676.3_Silent_p.C169C|RP11-807H22.7_ENST00000378140.3_RNA|FOLR1_ENST00000393681.2_Silent_p.C169C			P15328	FOLR1_HUMAN	folate receptor 1 (adult)	169					cell death (GO:0008219)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|receptor-mediated endocytosis (GO:0006898)	anchored component of external side of plasma membrane (GO:0031362)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|receptor activity (GO:0004872)	p.C169C(1)		cervix(2)|endometrium(1)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	14					Methotrexate(DB00563)	TTAACAAGTGCGCAGTGGGAG	0.512													c|||	1	0.000199681	0.0	0.0014	5008	,	,		19624	0.0		0.0	False		,,,				2504	0.0				p.C169C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C507T	11						.						94.0	92.0	93.0					11																	71906954		2200	4293	6493	71584602	SO:0001819	synonymous_variant	2348	exon6			J05013	CCDS8211.1	11q13.3-q14.1	2010-04-09			ENSG00000110195	ENSG00000110195			3791	protein-coding gene	gene with protein product		136430		FOLR		1717147	Standard	NM_000802		Approved		uc001osa.2	P15328		ENST00000393679.1:c.507C>T	11.37:g.71906954C>T			71584602	NM_016724	Q53EW2|Q6FGT8|Q6LC90|Q9UCT2	Silent	SNP	ENST00000393679.1	37	CCDS8211.1																																																																																				0.512	FOLR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396773.1	NM_016725	
C11orf30	56946	hgsc.bcm.edu	37	11	76227206	76227206	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:76227206C>T	ENST00000529032.1	+	10	1534	c.1534C>T	c.(1534-1536)Cgg>Tgg	p.R512W	C11orf30_ENST00000524767.1_Missense_Mutation_p.R527W|C11orf30_ENST00000524490.1_Missense_Mutation_p.R428W|C11orf30_ENST00000343878.3_Missense_Mutation_p.R512W|C11orf30_ENST00000334736.3_Missense_Mutation_p.R512W|C11orf30_ENST00000525919.1_Missense_Mutation_p.R513W|C11orf30_ENST00000533248.1_Missense_Mutation_p.R526W|C11orf30_ENST00000525038.1_Missense_Mutation_p.R527W			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	512	Thr-rich.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.R512W(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						AACCTATACCCGGCCAACAGT	0.433																																					p.R512W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1534T	11						.						109.0	106.0	107.0					11																	76227206		2200	4292	6492	75904854	SO:0001583	missense	56946	exon11			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1534C>T	11.37:g.76227206C>T	ENSP00000432327:p.Arg512Trp		75904854	NM_020193	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	CCDS8244.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.492162	0.44352	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000533972;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032;ENST00000531998	.	.	.	5.38	3.46	0.39613	.	0.054164	0.64402	D	0.000001	T	0.64670	0.2619	L	0.29908	0.895	0.53688	D	0.999979	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.79784	0.985;0.985;0.985;0.993;0.99;0.993	T	0.66586	-0.5886	9	0.66056	D	0.02	-9.8663	14.2902	0.66273	0.286:0.714:0.0:0.0	.	526;527;527;513;428;512	B7ZKT8;B7ZKU2;B7ZKU0;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;EMSY_HUMAN	W	428;512;512;81;527;526;513;527;512;54	.	ENSP00000334130:R512W	R	+	1	2	C11orf30	75904854	0.992000	0.36948	0.950000	0.38849	0.941000	0.58515	2.902000	0.48703	0.593000	0.29745	-0.319000	0.08680	CGG		0.433	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193	
CAPN5	726	hgsc.bcm.edu	37	11	76823688	76823688	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:76823688C>T	ENST00000278559.3	+	4	540	c.351C>T	c.(349-351)taC>taT	p.Y117Y	CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000529629.1_Silent_p.Y117Y|CAPN5_ENST00000456580.2_Silent_p.Y157Y	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	117	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.Y117Y(2)		NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						CCAACGCCTACGCGGGCATCT	0.607																																					p.Y117Y												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C351T	11						.						112.0	95.0	101.0					11																	76823688		2200	4292	6492	76501336	SO:0001819	synonymous_variant	726	exon4				CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.351C>T	11.37:g.76823688C>T			76501336	NM_004055	O00263	Silent	SNP	ENST00000278559.3	37	CCDS8248.1																																																																																				0.607	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382564.2	NM_004055	
NAALAD2	10003	hgsc.bcm.edu	37	11	89896504	89896504	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:89896504C>T	ENST00000534061.1	+	10	1332	c.1102C>T	c.(1102-1104)Cgg>Tgg	p.R368W	NAALAD2_ENST00000375944.3_Intron|NAALAD2_ENST00000525171.1_Missense_Mutation_p.R275W|NAALAD2_ENST00000321955.4_Missense_Mutation_p.R335W	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	368	NAALADase.				neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)	p.R368W(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GGGAGGTCACCGGGACTCCTG	0.368																																					p.R368W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1102T	11						.						116.0	125.0	122.0					11																	89896504		2201	4298	6499	89536152	SO:0001583	missense	10003	exon10			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.1102C>T	11.37:g.89896504C>T	ENSP00000432481:p.Arg368Trp		89536152	NM_005467	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	ENST00000534061.1	37	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367517	0.61513	.	.	ENSG00000077616	ENST00000534061;ENST00000321955;ENST00000525171	T;T;T	0.45668	0.89;0.89;0.89	5.51	5.51	0.81932	Peptidase M28 (1);	0.000000	0.64402	D	0.000003	T	0.59905	0.2228	L	0.60067	1.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.991	T	0.56384	-0.7988	9	.	.	.	-8.5304	14.2853	0.66243	0.1853:0.8146:0.0:0.0	.	368;275	Q9Y3Q0;E9PKX5	NALD2_HUMAN;.	W	368;335;275	ENSP00000432481:R368W;ENSP00000320083:R335W;ENSP00000435249:R275W	.	R	+	1	2	NAALAD2	89536152	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.372000	0.66156	2.746000	0.94184	0.591000	0.81541	CGG		0.368	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467	
HYOU1	10525	hgsc.bcm.edu	37	11	118925720	118925720	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr11:118925720G>A	ENST00000404233.3	-	6	596	c.472C>T	c.(472-474)Cgt>Tgt	p.R158C	HYOU1_ENST00000529972.1_Missense_Mutation_p.R158C|HYOU1_ENST00000525859.1_Missense_Mutation_p.R158C|HYOU1_ENST00000543287.1_Missense_Mutation_p.R71C	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	158					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.R158C(2)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		GCTAGAGAACGAGAATAATTG	0.537																																					p.R158C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C472T	11						.						117.0	98.0	105.0					11																	118925720		2200	4295	6495	118430930	SO:0001583	missense	10525	exon6			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.472C>T	11.37:g.118925720G>A	ENSP00000384144:p.Arg158Cys		118430930	NM_006389	A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	ENST00000404233.3	37	CCDS8408.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418794	0.83559	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	T;T;T;T;T	0.01106	5.33;5.33;5.33;5.33;5.33	4.96	4.96	0.65561	.	0.049673	0.85682	D	0.000000	T	0.04724	0.0128	M	0.87038	2.855	0.80722	D	1	D;P;P;P	0.53151	0.958;0.839;0.928;0.928	P;B;P;P	0.48063	0.565;0.33;0.565;0.565	T	0.08330	-1.0727	10	0.87932	D	0	-8.7309	16.5649	0.84576	0.0:0.0:1.0:0.0	.	149;202;158;158	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	C	158;149;158;158;7;158;201;71;158	ENSP00000384144:R158C;ENSP00000437313:R158C;ENSP00000433397:R158C;ENSP00000442727:R71C;ENSP00000431874:R158C	ENSP00000278752:R149C	R	-	1	0	HYOU1	118430930	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	3.777000	0.55364	2.564000	0.86499	0.561000	0.74099	CGT		0.537	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389	
UST	10090	hgsc.bcm.edu	37	6	149395060	149395060	+	Silent	SNP	C	C	T	rs369320331		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:149395060C>T	ENST00000367463.4	+	8	1132	c.1029C>T	c.(1027-1029)taC>taT	p.Y343Y	UST_ENST00000466695.1_3'UTR	NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	343					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)	p.Y343Y(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		GGATGAGATACGAGTACGAGT	0.532																																					p.Y343Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1029T	6						.	C		0,4406		0,0,2203	130.0	113.0	119.0		1029	-2.2	0.9	6		119	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	UST	NM_005715.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		343/407	149395060	1,13005	2203	4300	6503	149436753	SO:0001819	synonymous_variant	10090	exon8			AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.1029C>T	6.37:g.149395060C>T			149436753	NM_005715	B2RCX6	Silent	SNP	ENST00000367463.4	37	CCDS5213.1																																																																																				0.532	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715	
TIAM2	26230	hgsc.bcm.edu	37	6	155485666	155485666	+	Missense_Mutation	SNP	G	G	A	rs377169813		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:155485666G>A	ENST00000461783.3	+	10	3419	c.2146G>A	c.(2146-2148)Gcc>Acc	p.A716T	TIAM2_ENST00000360366.4_Missense_Mutation_p.A716T|TIAM2_ENST00000456144.1_Missense_Mutation_p.A716T|TIAM2_ENST00000456877.2_Missense_Mutation_p.A28T|TIAM2_ENST00000529824.2_Missense_Mutation_p.A716T|TIAM2_ENST00000528391.2_Missense_Mutation_p.A28T|TIAM2_ENST00000318981.5_Missense_Mutation_p.A716T|TIAM2_ENST00000367174.2_Missense_Mutation_p.A68T			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	716					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A716T(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CCTTGCAGCCGCCAGCCGCCC	0.552																																					p.A716T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2146A	6						.	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	85.0	97.0	93.0		2146	-1.2	0.1	6		93	0,8600		0,0,4300	no	missense	TIAM2	NM_012454.3	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	716/1702	155485666	1,13005	2203	4300	6503	155527358	SO:0001583	missense	26230	exon7				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.2146G>A	6.37:g.155485666G>A	ENSP00000437188:p.Ala716Thr		155527358	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.466954	0.43839	2.27E-4	0.0	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824;ENST00000456877;ENST00000528391	T;T;T;T;T;T;T;T;T	0.08720	3.36;3.26;3.32;3.36;3.21;3.33;3.32;3.19;3.06	5.29	-1.22	0.09494	.	0.259140	0.39687	N	0.001293	T	0.01387	0.0045	N	0.20685	0.6	0.24920	N	0.991981	B;B;B;B	0.32302	0.052;0.363;0.183;0.248	B;B;B;B	0.20955	0.032;0.024;0.024;0.011	T	0.45991	-0.9223	10	0.37606	T	0.19	.	11.0022	0.47614	0.472:0.0:0.528:0.0	.	28;716;716;716	E9PKT1;Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;.;TIAM2_HUMAN	T	716;962;716;716;716;68;716;716;28;28	ENSP00000437188:A716T;ENSP00000434901:A716T;ENSP00000407746:A716T;ENSP00000327315:A716T;ENSP00000356142:A68T;ENSP00000353528:A716T;ENSP00000433348:A716T;ENSP00000407183:A28T;ENSP00000435335:A28T	ENSP00000327315:A716T	A	+	1	0	TIAM2	155527358	0.985000	0.35326	0.106000	0.21319	0.897000	0.52465	1.920000	0.40025	-0.130000	0.11599	0.650000	0.86243	GCC		0.552	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
IGF2R	3482	hgsc.bcm.edu	37	6	160500662	160500662	+	Silent	SNP	C	C	T	rs200730925		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:160500662C>T	ENST00000356956.1	+	38	5677	c.5529C>T	c.(5527-5529)gtC>gtT	p.V1843V		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1843					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.V1843V(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	CCTTTGCAGTCGGGCCAGAAC	0.582																																					p.V1843V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5529T	6						.						106.0	87.0	93.0					6																	160500662		2203	4300	6503	160420652	SO:0001819	synonymous_variant	3482	exon38			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.5529C>T	6.37:g.160500662C>T			160420652	NM_000876	Q7Z7G9|Q96PT5	Silent	SNP	ENST00000356956.1	37	CCDS5273.1																																																																																				0.582	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
GABBR1	2550	hgsc.bcm.edu	37	6	29576387	29576387	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:29576387G>A	ENST00000377034.4	-	16	2318	c.1983C>T	c.(1981-1983)ttC>ttT	p.F661F	GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000377012.4_Silent_p.F544F|GABBR1_ENST00000355973.3_Silent_p.F544F|GABBR1_ENST00000377016.4_Silent_p.F599F	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	661					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.F661F(2)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CCTGGCAGACGAAAGGAAACT	0.547																																					p.F599F												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C1797T	6						.						95.0	81.0	86.0					6																	29576387		1511	2708	4219	29684366	SO:0001819	synonymous_variant	2550	exon15			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1983C>T	6.37:g.29576387G>A			29684366	NM_021904	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	ENST00000377034.4	37	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	G	9.555	1.116862	0.20795	.	.	ENSG00000204681	ENST00000485026	.	.	.	4.49	-1.51	0.08664	.	.	.	.	.	T	0.40694	0.1127	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41662	-0.9496	4	.	.	.	-17.5261	9.9804	0.41811	0.783:0.0:0.217:0.0	.	.	.	.	C	42	.	.	R	-	1	0	GABBR1	29684366	0.994000	0.37717	0.913000	0.36048	0.922000	0.55478	0.201000	0.17276	-0.450000	0.07107	0.557000	0.71058	CGT		0.547	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
IP6K3	117283	hgsc.bcm.edu	37	6	33693314	33693314	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:33693314G>A	ENST00000293756.4	-	5	995	c.669C>T	c.(667-669)caC>caT	p.H223H	IP6K3_ENST00000451316.1_Silent_p.H223H	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	223					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.H223H(1)		skin(1)	1						CATCATCGCCGTGCTGCCGGG	0.567																																					p.H223H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C669T	6						.						85.0	74.0	78.0					6																	33693314		2203	4300	6503	33801292	SO:0001819	synonymous_variant	117283	exon5			AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.669C>T	6.37:g.33693314G>A			33801292	NM_054111	Q96MQ9	Silent	SNP	ENST00000293756.4	37	CCDS34435.1																																																																																				0.567	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111	
ZFAND3	60685	hgsc.bcm.edu	37	6	38084447	38084447	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:38084447G>A	ENST00000287218.4	+	5	908	c.461G>A	c.(460-462)cGa>cAa	p.R154Q	ZFAND3_ENST00000373391.2_Missense_Mutation_p.R132Q	NM_021943.2	NP_068762.1	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3	154							DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R154Q(1)		endometrium(2)|large_intestine(4)|lung(2)|ovary(1)	9						CAGAAGAGTCGACGTCGGTGC	0.537																																					p.R154Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G461A	6						.						125.0	107.0	113.0					6																	38084447		2203	4300	6503	38192425	SO:0001583	missense	60685	exon5			AK023284	CCDS4836.1	6p21.2	2013-09-19	2005-12-15	2005-12-15	ENSG00000156639	ENSG00000156639		"""Zinc fingers, AN1-type domain containing"""	18019	protein-coding gene	gene with protein product		607455	"""testis expressed sequence 27"""	TEX27			Standard	NM_021943		Approved	FLJ13222	uc003onx.3	Q9H8U3	OTTHUMG00000014629	ENST00000287218.4:c.461G>A	6.37:g.38084447G>A	ENSP00000287218:p.Arg154Gln		38192425	NM_021943	Q5SZZ0|Q5SZZ1	Missense_Mutation	SNP	ENST00000287218.4	37	CCDS4836.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.543845	0.86022	.	.	ENSG00000156639	ENST00000287218;ENST00000373391;ENST00000474522	T	0.68025	-0.3	5.28	4.41	0.53225	Zinc finger, AN1-type (2);	0.000000	0.85682	D	0.000000	T	0.64170	0.2574	L	0.34521	1.04	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.65302	-0.6201	10	0.34782	T	0.22	-4.4268	14.1538	0.65405	0.0726:0.0:0.9274:0.0	.	154	Q9H8U3	ZFAN3_HUMAN	Q	154;132;185	ENSP00000420240:R185Q	ENSP00000287218:R154Q	R	+	2	0	ZFAND3	38192425	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.289000	0.96061	1.356000	0.45884	0.650000	0.86243	CGA		0.537	ZFAND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040424.3	NM_021943	
DNAH8	1769	hgsc.bcm.edu	37	6	38952065	38952065	+	Silent	SNP	A	A	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:38952065A>G	ENST00000359357.3	+	85	12638	c.12384A>G	c.(12382-12384)ctA>ctG	p.L4128L	DNAH8_ENST00000441566.1_Silent_p.L4092L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4128					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L4128L(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ACAAACGTCTACTTAATTGCT	0.343																																					p.L4128L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A12384G	6						.						110.0	107.0	108.0					6																	38952065		2203	4300	6503	39060043	SO:0001819	synonymous_variant	1769	exon85			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12384A>G	6.37:g.38952065A>G			39060043	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																					0.343	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
BAI3	577	hgsc.bcm.edu	37	6	69666692	69666692	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:69666692C>T	ENST00000370598.1	+	8	2337	c.1516C>T	c.(1516-1518)Cga>Tga	p.R506*		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	506	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R506*(2)|p.R506R(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CAATGAGCAGCGATGCCCTGG	0.428																																					p.R506X												.	.	3	Substitution - Nonsense(2)|Substitution - coding silent(1)	large_intestine(2)|lung(1)	c.C1516T	6						.						118.0	118.0	118.0					6																	69666692		2203	4300	6503	69723413	SO:0001587	stop_gained	577	exon8			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1516C>T	6.37:g.69666692C>T	ENSP00000359630:p.Arg506*		69723413	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Nonsense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	C	46	12.842583	0.99700	.	.	ENSG00000135298	ENST00000370598	.	.	.	5.19	4.2	0.49525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9396	0.58335	0.2751:0.7249:0.0:0.0	.	.	.	.	X	506	.	ENSP00000359630:R506X	R	+	1	2	BAI3	69723413	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	3.080000	0.50112	2.595000	0.87683	0.650000	0.86243	CGA		0.428	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
PHIP	55023	hgsc.bcm.edu	37	6	79650559	79650559	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:79650559G>A	ENST00000275034.4	-	40	5484	c.5317C>T	c.(5317-5319)Cga>Tga	p.R1773*	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1773					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.R1773*(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		GCTGTCCTTCGACCTTGATTT	0.418																																					p.R1773X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C5317T	6						.						582.0	573.0	576.0					6																	79650559		2203	4300	6503	79707278	SO:0001587	stop_gained	55023	exon40			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.5317C>T	6.37:g.79650559G>A	ENSP00000275034:p.Arg1773*		79707278	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Nonsense_Mutation	SNP	ENST00000275034.4	37	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	G	43	10.313297	0.99381	.	.	ENSG00000146247	ENST00000275034	.	.	.	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.1745	12.8348	0.57767	0.0:0.0:0.7448:0.2551	.	.	.	.	X	1773	.	.	R	-	1	2	PHIP	79707278	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.676000	0.61627	2.810000	0.96702	0.650000	0.86243	CGA		0.418	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
UBE3D	90025	hgsc.bcm.edu	37	6	83754183	83754183	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:83754183C>T	ENST00000369747.3	-	4	683	c.561G>A	c.(559-561)gaG>gaA	p.E187E		NM_198920.1	NP_944602.1	Q7Z6J8	UBE3D_HUMAN	ubiquitin protein ligase E3D	187					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)	p.E187E(1)									CACAGCACATCTCCACTGGGG	0.368																																					p.E187E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G561A	6						.						115.0	125.0	121.0					6																	83754183		2203	4300	6503	83810902	SO:0001819	synonymous_variant	90025	exon4			AL137544	CCDS34491.1	6q15	2012-02-24	2012-02-24	2012-02-24	ENSG00000118420	ENSG00000118420			21381	protein-coding gene	gene with protein product	"""UBCH10 binding protein with a hect-like domain"""	612495	"""chromosome 6 open reading frame 157"", ""ubiquitin-conjugating enzyme E2C binding protein"""	C6orf157, UBE2CBP		15749827	Standard	NM_198920		Approved	DKFZp434A1520, H10BH, YJR141W	uc003pjp.2	Q7Z6J8	OTTHUMG00000015108	ENST00000369747.3:c.561G>A	6.37:g.83754183C>T			83810902	NM_198920	B4DP63|Q5T4W2|Q6IPR4|Q75UG0|Q9NT42	Silent	SNP	ENST00000369747.3	37	CCDS34491.1																																																																																				0.368	UBE3D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041347.7	NM_198920	
PRSS35	167681	hgsc.bcm.edu	37	6	84233343	84233343	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:84233343G>A	ENST00000369700.3	+	2	360	c.183G>A	c.(181-183)gtG>gtA	p.V61V	PRSS35_ENST00000536636.1_Silent_p.V61V	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	61						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)	p.V61V(1)		breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		TAAATACAGTGTGTGGCATCG	0.478																																					p.V61V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G183A	6						.						125.0	121.0	122.0					6																	84233343		2203	4300	6503	84290062	SO:0001819	synonymous_variant	167681	exon3			BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.183G>A	6.37:g.84233343G>A			84290062	NM_001170423	A8K7B3|Q9BQP6	Silent	SNP	ENST00000369700.3	37	CCDS4999.1																																																																																				0.478	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041352.1	NM_153362	
THBS2	7058	hgsc.bcm.edu	37	6	169639742	169639742	+	Missense_Mutation	SNP	C	C	T	rs534794489		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr6:169639742C>T	ENST00000366787.3	-	8	1330	c.1081G>A	c.(1081-1083)Gcc>Acc	p.A361T	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	361	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.A361T(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GATGGACTGGCGCAGGTTGCA	0.512																																					p.A361T	Esophageal Squamous(91;219 1934 18562 44706)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1081A	6						.						82.0	60.0	68.0					6																	169639742		2201	4299	6500	169381667	SO:0001583	missense	7058	exon8				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1081G>A	6.37:g.169639742C>T	ENSP00000355751:p.Ala361Thr		169381667	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.189465	0.38707	.	.	ENSG00000186340	ENST00000366787	T	0.72167	-0.63	5.34	5.34	0.76211	von Willebrand factor, type C (4);	0.000000	0.40728	U	0.001025	T	0.53334	0.1790	L	0.58925	1.835	0.41921	D	0.990514	B	0.28636	0.218	B	0.26693	0.072	T	0.57464	-0.7807	10	0.38643	T	0.18	-55.5773	12.4104	0.55464	0.0:0.9236:0.0:0.0764	.	361	P35442	TSP2_HUMAN	T	361	ENSP00000355751:A361T	ENSP00000355751:A361T	A	-	1	0	THBS2	169381667	1.000000	0.71417	0.046000	0.18839	0.008000	0.06430	4.554000	0.60760	2.492000	0.84095	0.655000	0.94253	GCC		0.512	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
SMYD4	114826	hgsc.bcm.edu	37	17	1703857	1703857	+	Silent	SNP	C	C	T	rs138794221	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:1703857C>T	ENST00000305513.7	-	5	998	c.831G>A	c.(829-831)ccG>ccA	p.P277P		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	277	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.P277P(1)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						GGCCGTGATGCGGTGGTGGCA	0.537																																					p.P277P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G831A	17						.	C		2,4404	4.2+/-10.8	0,2,2201	154.0	139.0	144.0		831	-4.4	0.0	17	dbSNP_134	144	0,8600		0,0,4300	no	coding-synonymous	SMYD4	NM_052928.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		277/805	1703857	2,13004	2203	4300	6503	1650607	SO:0001819	synonymous_variant	114826	exon5			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.831G>A	17.37:g.1703857C>T			1650607	NM_052928	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Silent	SNP	ENST00000305513.7	37	CCDS11013.1																																																																																				0.537	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207108.4	XM_056082	
ALDH3A2	224	hgsc.bcm.edu	37	17	19566800	19566800	+	Silent	SNP	G	G	A	rs372077578		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:19566800G>A	ENST00000176643.6	+	7	1541	c.1095G>A	c.(1093-1095)tcG>tcA	p.S365S	ALDH3A2_ENST00000581518.1_Silent_p.S365S|ALDH3A2_ENST00000571163.1_Silent_p.S38S|ALDH3A2_ENST00000395575.2_Silent_p.S365S|ALDH3A2_ENST00000579855.1_Silent_p.S365S|ALDH3A2_ENST00000339618.4_Silent_p.S365S|SNORA31_ENST00000516540.1_RNA			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	365			S -> L (in SLS; severe loss of activity). {ECO:0000269|PubMed:10577908, ECO:0000269|PubMed:9829906}.		cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)	p.S365S(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					ATGTATTTTCGCATAACCATA	0.358																																					p.S365S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1095A	17						.	G	,	1,4405	2.1+/-5.4	0,1,2202	80.0	79.0	80.0		1095,1095	0.5	0.8	17		80	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ALDH3A2	NM_000382.2,NM_001031806.1	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	365/486,365/509	19566800	1,13005	2203	4300	6503	19507392	SO:0001819	synonymous_variant	224	exon7			L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.1095G>A	17.37:g.19566800G>A			19507392	NM_000382	Q6I9T3|Q93011|Q96J37	Silent	SNP	ENST00000176643.6	37	CCDS11210.1																																																																																				0.358	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132268.1		
LEPREL4	10609	hgsc.bcm.edu	37	17	39963095	39963095	+	Missense_Mutation	SNP	G	G	A	rs186874945		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:39963095G>A	ENST00000355468.3	-	7	1565	c.1099C>T	c.(1099-1101)Cgg>Tgg	p.R367W	LEPREL4_ENST00000393928.1_Missense_Mutation_p.R367W			Q92791	SC65_HUMAN	leprecan-like 4	367	Asp/Glu-rich (acidic).				synaptonemal complex assembly (GO:0007130)	condensed nuclear chromosome (GO:0000794)|nucleolus (GO:0005730)|synaptonemal complex (GO:0000795)		p.R367W(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	8						AGCAGCTCCCGCAGCTCGGCG	0.602													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19242	0.0		0.0	False		,,,				2504	0.0				p.R367W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1099T	17						.						60.0	50.0	53.0					17																	39963095		2203	4300	6503	37216621	SO:0001583	missense	10609	exon6			BC001047	CCDS11408.1	17q12	2013-05-03	2002-08-29		ENSG00000141696	ENSG00000141696			16946	protein-coding gene	gene with protein product			"""nucleolar autoantigen (55kD)"", ""rat synaptonemal complex protein"""			8862517	Standard	NM_006455		Approved	SC65, NO55	uc002hxt.3	Q92791	OTTHUMG00000133501	ENST00000355468.3:c.1099C>T	17.37:g.39963095G>A	ENSP00000347649:p.Arg367Trp		37216621	NM_006455	Q53GI6|Q9H4F6	Missense_Mutation	SNP	ENST00000355468.3	37	CCDS11408.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	21.8	4.206486	0.79127	.	.	ENSG00000141696	ENST00000355468;ENST00000393928;ENST00000545545	T;T	0.41065	1.01;1.01	5.36	4.38	0.52667	.	0.228710	0.41712	D	0.000832	T	0.45875	0.1364	L	0.43152	1.355	0.38576	D	0.950069	D;D	0.76494	0.999;0.994	P;P	0.56916	0.809;0.502	T	0.50197	-0.8856	10	0.72032	D	0.01	-13.9008	7.2741	0.26273	0.0838:0.0:0.663:0.2531	.	356;367	B4DVZ5;Q92791	.;SC65_HUMAN	W	367;367;356	ENSP00000347649:R367W;ENSP00000377505:R367W	ENSP00000347649:R367W	R	-	1	2	LEPREL4	37216621	1.000000	0.71417	0.993000	0.49108	0.879000	0.50718	3.256000	0.51492	2.509000	0.84616	0.609000	0.83330	CGG		0.602	LEPREL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257439.2		
ZMYND15	84225	hgsc.bcm.edu	37	17	4644277	4644277	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:4644277G>A	ENST00000433935.1	+	2	491	c.434G>A	c.(433-435)cGg>cAg	p.R145Q	ZMYND15_ENST00000573751.2_Missense_Mutation_p.R145Q|ZMYND15_ENST00000269289.6_Missense_Mutation_p.R145Q|ZMYND15_ENST00000592813.1_Missense_Mutation_p.R145Q|CXCL16_ENST00000574412.1_5'Flank|CXCL16_ENST00000293778.6_5'Flank	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	145	Glu-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.R145Q(1)		endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						GAGGAGGACCGGGAGCTAGCC	0.627																																					p.R145Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G434A	17						.						40.0	42.0	41.0					17																	4644277		2187	4285	6472	4591026	SO:0001583	missense	84225	exon2			AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.434G>A	17.37:g.4644277G>A	ENSP00000391742:p.Arg145Gln		4591026	NM_032265	B4DXY5|I3L296	Missense_Mutation	SNP	ENST00000433935.1	37	CCDS45584.1	.	.	.	.	.	.	.	.	.	.	G	1.053	-0.675360	0.03378	.	.	ENSG00000141497	ENST00000433935;ENST00000269289	T;T	0.42900	0.97;0.96	4.91	2.94	0.34122	.	0.701366	0.13009	N	0.421011	T	0.19485	0.0468	N	0.03608	-0.345	0.09310	N	1	B;B	0.17852	0.024;0.019	B;B	0.08055	0.003;0.003	T	0.18967	-1.0320	10	0.28530	T	0.3	-10.1614	9.1441	0.36921	0.1265:0.0:0.8735:0.0	.	145;145	B4DXY5;Q9H091	.;ZMY15_HUMAN	Q	145	ENSP00000391742:R145Q;ENSP00000269289:R145Q	ENSP00000269289:R145Q	R	+	2	0	ZMYND15	4591026	0.295000	0.24389	0.068000	0.19968	0.003000	0.03518	1.085000	0.30840	0.678000	0.31325	-0.782000	0.03352	CGG		0.627	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1	NM_032265	
KCNH4	23415	hgsc.bcm.edu	37	17	40328171	40328171	+	Missense_Mutation	SNP	C	C	T	rs576758601		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:40328171C>T	ENST00000264661.3	-	5	1062	c.730G>A	c.(730-732)Gtc>Atc	p.V244I	KCNH4_ENST00000607371.1_Missense_Mutation_p.V244I	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	244					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.V244I(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TTGTAGGGGACGGTGACCGCA	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17723	0.0		0.0	False		,,,				2504	0.0				p.V244I	NSCLC(117;707 1703 2300 21308 31858)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G730A	17						.						145.0	116.0	126.0					17																	40328171		2203	4300	6503	37581697	SO:0001583	missense	23415	exon5			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.730G>A	17.37:g.40328171C>T	ENSP00000264661:p.Val244Ile		37581697	NM_012285		Missense_Mutation	SNP	ENST00000264661.3	37	CCDS11420.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.685621	0.88639	.	.	ENSG00000089558	ENST00000264661	D	0.97066	-4.23	5.45	5.45	0.79879	.	0.000000	0.36854	N	0.002365	D	0.96806	0.8957	M	0.69248	2.105	0.53005	D	0.999966	P	0.45396	0.857	P	0.44946	0.465	D	0.97066	0.9774	10	0.62326	D	0.03	.	19.4712	0.94963	0.0:1.0:0.0:0.0	.	244	Q9UQ05	KCNH4_HUMAN	I	244	ENSP00000264661:V244I	ENSP00000264661:V244I	V	-	1	0	KCNH4	37581697	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.898000	0.69838	2.840000	0.97914	0.655000	0.94253	GTC		0.597	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	NM_012285	
MRC2	9902	hgsc.bcm.edu	37	17	60759646	60759646	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:60759646C>T	ENST00000303375.5	+	20	3256	c.2854C>T	c.(2854-2856)Cgc>Tgc	p.R952C	MRC2_ENST00000446119.2_5'UTR|RNU6-446P_ENST00000362827.1_RNA	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	952					collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.R952C(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CATCTGCAAGCGCAGCAACGT	0.642																																					p.R952C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2854T	17						.						36.0	30.0	32.0					17																	60759646		2202	4299	6501	58113378	SO:0001583	missense	9902	exon20			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2854C>T	17.37:g.60759646C>T	ENSP00000307513:p.Arg952Cys		58113378	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255151	0.39896	.	.	ENSG00000011028	ENST00000303375	T	0.18657	2.2	5.84	5.84	0.93424	C-type lectin fold (1);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.50309	0.1608	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51865	-0.8651	10	0.62326	D	0.03	-35.6161	14.9203	0.70832	0.1431:0.8569:0.0:0.0	.	952	Q9UBG0	MRC2_HUMAN	C	952	ENSP00000307513:R952C	ENSP00000307513:R952C	R	+	1	0	MRC2	58113378	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	2.857000	0.48349	2.767000	0.95098	0.561000	0.74099	CGC		0.642	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
NLGN2	57555	hgsc.bcm.edu	37	17	7319006	7319006	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:7319006C>T	ENST00000302926.2	+	6	1287	c.1214C>T	c.(1213-1215)gCc>gTc	p.A405V	NLGN2_ENST00000575301.1_Missense_Mutation_p.A405V	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	405					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.A405V(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				TCTGCCAGCGCCTTTGACTTC	0.542																																					p.A405V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1214T	17						.						194.0	164.0	174.0					17																	7319006		2203	4300	6503	7259730	SO:0001583	missense	57555	exon6			AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.1214C>T	17.37:g.7319006C>T	ENSP00000305288:p.Ala405Val		7259730	NM_020795	Q9P2I1	Missense_Mutation	SNP	ENST00000302926.2	37	CCDS11103.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.486779	0.44249	.	.	ENSG00000169992	ENST00000302926	T	0.67865	-0.29	5.41	5.41	0.78517	Carboxylesterase, type B (1);	0.132588	0.51477	D	0.000096	T	0.53012	0.1770	N	0.26042	0.785	0.44762	D	0.997763	B	0.20988	0.05	B	0.18263	0.021	T	0.51164	-0.8740	10	0.52906	T	0.07	.	11.6016	0.51006	0.1774:0.8226:0.0:0.0	.	405	Q8NFZ4	NLGN2_HUMAN	V	405	ENSP00000305288:A405V	ENSP00000305288:A405V	A	+	2	0	NLGN2	7259730	0.988000	0.35896	1.000000	0.80357	0.867000	0.49689	3.186000	0.50942	2.826000	0.97356	0.561000	0.74099	GCC		0.542	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2	NM_020795	
DNAH2	146754	hgsc.bcm.edu	37	17	7701884	7701884	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:7701884C>T	ENST00000572933.1	+	55	9867	c.8407C>T	c.(8407-8409)Cgt>Tgt	p.R2803C	DNAH2_ENST00000389173.2_Missense_Mutation_p.R2803C			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2803	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R2803C(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AGATATCAAGCGTCTGTATCG	0.532																																					p.R2803C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8407T	17						.						74.0	71.0	72.0					17																	7701884		2203	4300	6503	7642609	SO:0001583	missense	146754	exon54			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.8407C>T	17.37:g.7701884C>T	ENSP00000458355:p.Arg2803Cys		7642609	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361569	0.41801	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.49720	0.77	5.91	2.74	0.32292	Dynein heavy chain, P-loop containing D4 domain (1);	0.200777	0.40554	N	0.001065	T	0.42607	0.1210	M	0.74389	2.26	0.80722	D	1	B	0.19445	0.036	B	0.18561	0.022	T	0.34775	-0.9815	10	0.39692	T	0.17	.	5.2611	0.15573	0.2781:0.5618:0.0:0.1601	.	2803	Q9P225	DYH2_HUMAN	C	2803	ENSP00000373825:R2803C	ENSP00000353818:R2803C	R	+	1	0	DNAH2	7642609	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	1.255000	0.32909	0.859000	0.35456	-0.263000	0.10527	CGT		0.532	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
DNAH2	146754	hgsc.bcm.edu	37	17	7727196	7727196	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:7727196G>A	ENST00000572933.1	+	75	12834	c.11374G>A	c.(11374-11376)Gtt>Att	p.V3792I	DNAH2_ENST00000389173.2_Missense_Mutation_p.V3792I			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3792					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V3792I(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GATGCTGATCGTTCGCTCCCT	0.572																																					p.V3792I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G11374A	17						.						112.0	90.0	98.0					17																	7727196		2203	4300	6503	7667921	SO:0001583	missense	146754	exon74			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11374G>A	17.37:g.7727196G>A	ENSP00000458355:p.Val3792Ile		7667921	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790533	0.50102	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.08282	3.11	4.96	3.96	0.45880	Dynein heavy chain (1);	0.000000	0.64402	D	0.000001	T	0.05135	0.0137	N	0.16708	0.43	0.80722	D	1	B;B	0.31752	0.338;0.057	B;B	0.32342	0.055;0.144	T	0.22765	-1.0207	10	0.06757	T	0.87	.	13.3318	0.60492	0.0:0.0:0.8402:0.1598	.	3753;3792	Q9P225-2;Q9P225	.;DYH2_HUMAN	I	3753;3792	ENSP00000373825:V3792I	ENSP00000353818:V3753I	V	+	1	0	DNAH2	7667921	1.000000	0.71417	0.234000	0.24042	0.964000	0.63967	4.587000	0.60991	1.051000	0.40369	0.609000	0.83330	GTT		0.572	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
CCDC42	146849	hgsc.bcm.edu	37	17	8638559	8638559	+	Missense_Mutation	SNP	G	G	A	rs376369221		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:8638559G>A	ENST00000293845.3	-	6	954	c.728C>T	c.(727-729)gCg>gTg	p.A243V	CCDC42_ENST00000539522.2_Missense_Mutation_p.A169V	NM_144681.2	NP_653282.2	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42	243								p.A243V(1)		kidney(1)|large_intestine(4)|lung(3)|ovary(1)	9						CTGGATGTGCGCCCAGCGAGA	0.557																																					p.A169V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C506T	17						.	G	VAL/ALA,VAL/ALA	0,4406		0,0,2203	122.0	99.0	107.0		506,728	5.1	1.0	17		107	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CCDC42	NM_001158261.1,NM_144681.2	64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	169/243,243/317	8638559	1,13005	2203	4300	6503	8579284	SO:0001583	missense	146849	exon5			AK057296	CCDS11145.1, CCDS54088.1	17p13.1	2012-05-28			ENSG00000161973	ENSG00000161973			26528	protein-coding gene	gene with protein product							Standard	NM_144681		Approved	FLJ32734, CCDC42A	uc002gln.3	Q96M95		ENST00000293845.3:c.728C>T	17.37:g.8638559G>A	ENSP00000293845:p.Ala243Val		8579284	NM_001158261	Q8N6Q0	Missense_Mutation	SNP	ENST00000293845.3	37	CCDS11145.1	.	.	.	.	.	.	.	.	.	.	G	13.12	2.143624	0.37825	0.0	1.16E-4	ENSG00000161973	ENST00000293845;ENST00000539522	T;T	0.25749	1.78;1.83	5.05	5.05	0.67936	.	0.000000	0.56097	D	0.000025	T	0.38558	0.1045	L	0.38531	1.155	0.31727	N	0.637507	D	0.76494	0.999	D	0.63192	0.912	T	0.22661	-1.0210	10	0.31617	T	0.26	-9.9405	17.3291	0.87258	0.0:0.0:1.0:0.0	.	243	Q96M95	CCD42_HUMAN	V	243;169	ENSP00000293845:A243V;ENSP00000444359:A169V	ENSP00000293845:A243V	A	-	2	0	CCDC42	8579284	1.000000	0.71417	0.964000	0.40570	0.953000	0.61014	3.372000	0.52387	2.633000	0.89246	0.563000	0.77884	GCG		0.557	CCDC42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442491.1	NM_144681	
DDX42	11325	hgsc.bcm.edu	37	17	61898437	61898437	+	IGR	SNP	G	G	A	rs145182298		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:61898437G>A	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_Missense_Mutation_p.P642L	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.P642L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						ATCTGACTTAGGCCCACGGCT	0.527																																					p.P642L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1925T	17						.						98.0	86.0	90.0					17																	61898437		2203	4300	6503	59252169	SO:0001628	intergenic_variant	117246	exon17			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61898437G>A			59252169	NM_017647	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	ENST00000578681.1	37	CCDS32704.1	.	.	.	.	.	.	.	.	.	.	G	8.760	0.923290	0.18056	.	.	ENSG00000108592	ENST00000427159	T	0.29917	1.55	5.03	0.582	0.17412	Ribosomal RNA methyltransferase, Spb1, C-terminal (1);	1.855670	0.02556	N	0.096163	T	0.19604	0.0471	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.14671	-1.0464	10	0.30078	T	0.28	-1.4849	3.8498	0.08949	0.3065:0.1812:0.5123:0.0	.	642	Q8IY81	RRMJ3_HUMAN	L	642	ENSP00000396673:P642L	ENSP00000396673:P642L	P	-	2	0	FTSJ3	59252169	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.328000	0.19681	0.305000	0.22832	-0.257000	0.10917	CCT		0.527	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372	
TIMP2	7077	hgsc.bcm.edu	37	17	76851777	76851777	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr17:76851777T>C	ENST00000262768.7	-	5	933	c.635A>G	c.(634-636)cAg>cGg	p.Q212R	TIMP2_ENST00000585421.1_Missense_Mutation_p.Q135R|RP11-323N12.5_ENST00000587434.1_RNA|TIMP2_ENST00000536189.2_Missense_Mutation_p.Q135R|TIMP2_ENST00000586057.1_Missense_Mutation_p.Q135R	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2	212					aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)	p.Q212R(1)		central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			GAGAAACTCCTGCTTGGGGGG	0.592																																					p.Q212R												TIMP2,central_nervous_system,brain,Substitution - Nonsense,-1	.	1	Substitution - Missense(1)	large_intestine(1)	c.A635G	17						.						46.0	43.0	44.0					17																	76851777		2203	4300	6503	74363372	SO:0001583	missense	7077	exon5				CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.635A>G	17.37:g.76851777T>C	ENSP00000262768:p.Gln212Arg		74363372	NM_003255	Q16121|Q93006|Q9UDF7	Missense_Mutation	SNP	ENST00000262768.7	37	CCDS11758.1	.	.	.	.	.	.	.	.	.	.	t	20.4	3.983740	0.74474	.	.	ENSG00000035862	ENST00000262768;ENST00000536189	D;D	0.94613	-3.47;-3.31	5.93	5.93	0.95920	.	0.119083	0.56097	D	0.000027	D	0.90445	0.7008	N	0.25647	0.755	0.49483	D	0.999796	B	0.18461	0.028	B	0.15052	0.012	D	0.86878	0.2040	10	0.59425	D	0.04	.	15.3574	0.74437	0.0:0.0:0.0:1.0	.	212	P16035	TIMP2_HUMAN	R	212;135	ENSP00000262768:Q212R;ENSP00000441724:Q135R	ENSP00000262768:Q212R	Q	-	2	0	TIMP2	74363372	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.140000	0.71738	2.268000	0.75426	0.478000	0.44815	CAG		0.592	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255	
ADAMTS1	9510	hgsc.bcm.edu	37	21	28212325	28212325	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr21:28212325G>A	ENST00000284984.3	-	6	2175	c.1721C>T	c.(1720-1722)aCg>aTg	p.T574M		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	574	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T574M(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		TCCACCGCACGTTCTCGAACA	0.493																																					p.T574M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1721T	21						.						110.0	92.0	98.0					21																	28212325		2203	4300	6503	27134196	SO:0001583	missense	9510	exon6			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1721C>T	21.37:g.28212325G>A	ENSP00000284984:p.Thr574Met		27134196	NM_006988	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	ENST00000284984.3	37	CCDS33524.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.267391	0.59540	.	.	ENSG00000154734	ENST00000284984	T	0.70986	-0.53	5.11	5.11	0.69529	.	.	.	.	.	D	0.89629	0.6770	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92623	0.6109	9	0.87932	D	0	.	15.7374	0.77856	0.0:0.1459:0.8541:0.0	.	574	Q9UHI8	ATS1_HUMAN	M	574	ENSP00000284984:T574M	ENSP00000284984:T574M	T	-	2	0	ADAMTS1	27134196	1.000000	0.71417	0.927000	0.36925	0.336000	0.28762	6.159000	0.71856	2.826000	0.97356	0.655000	0.94253	ACG		0.493	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2		
ITGB2	3689	hgsc.bcm.edu	37	21	46306325	46306325	+	Silent	SNP	G	G	A	rs375931424		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr21:46306325G>A	ENST00000397850.2	-	17	2720	c.2268C>T	c.(2266-2268)agC>agT	p.S756S	ITGB2_ENST00000397852.1_Silent_p.S756S|ITGB2_ENST00000397857.1_Silent_p.S756S|ITGB2_ENST00000397854.3_Silent_p.S699S|ITGB2_ENST00000355153.4_Silent_p.S756S|ITGB2_ENST00000302347.5_Silent_p.S756S			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	756					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.S756S(1)		breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	TCGTGGTGGCGCTCTTGAAAA	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19200	0.0		0.0	False		,,,				2504	0.0				p.S756S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2268T	21						.	G	,	1,4405	2.1+/-5.4	0,1,2202	157.0	136.0	143.0		2268,2268	-9.6	0.2	21		143	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ITGB2	NM_000211.3,NM_001127491.1	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	756/770,756/770	46306325	1,13005	2203	4300	6503	45130753	SO:0001819	synonymous_variant	3689	exon16			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.2268C>T	21.37:g.46306325G>A			45130753	NM_001127491	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	ENST00000397850.2	37	CCDS13716.1																																																																																				0.562	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	
ITGB2	3689	hgsc.bcm.edu	37	21	46320235	46320235	+	Splice_Site	SNP	G	G	A	rs150327269		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr21:46320235G>A	ENST00000397850.2	-	8	1349	c.897C>T	c.(895-897)ttC>ttT	p.F299F	ITGB2_ENST00000397852.1_Splice_Site_p.F299F|ITGB2_ENST00000397857.1_Splice_Site_p.F299F|ITGB2_ENST00000397854.3_Splice_Site_p.F242F|ITGB2_ENST00000355153.4_Splice_Site_p.F299F|ITGB2_ENST00000302347.5_Splice_Site_p.F299F			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	299	VWFA.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GGGGACTTACGAATTCGTTGC	0.637																																					p.F299F												.	.	0			c.C897T	21						.	G	,	1,4405	2.1+/-5.4	0,1,2202	120.0	94.0	103.0		897,897	-7.0	0.4	21	dbSNP_134	103	1,8599	1.2+/-3.3	0,1,4299	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	ITGB2	NM_000211.3,NM_001127491.1	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	299/770,299/770	46320235	2,13004	2203	4300	6503	45144663	SO:0001630	splice_region_variant	3689	exon7			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.897+1C>T	21.37:g.46320235G>A			45144663	NM_001127491	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	ENST00000397850.2	37	CCDS13716.1																																																																																				0.637	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	Silent
NTAN1	123803	hgsc.bcm.edu	37	16	15134971	15134971	+	Silent	SNP	A	A	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:15134971A>G	ENST00000287706.3	-	7	587	c.495T>C	c.(493-495)aaT>aaC	p.N165N	PDXDC1_ENST00000535621.2_Intron	NM_001270766.1|NM_173474.3	NP_001257695.1|NP_775745.1	Q96AB6	NTAN1_HUMAN	N-terminal asparagine amidase	165					adult locomotory behavior (GO:0008344)|memory (GO:0007613)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-N-terminal asparagine amidohydrolase activity (GO:0008418)	p.N165N(1)		endometrium(1)|large_intestine(4)|lung(3)	8						CTTCCCGGTCATTTAATTCTA	0.343																																					p.N165N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T495C	16						.						128.0	116.0	120.0					16																	15134971		2197	4300	6497	15042472	SO:0001819	synonymous_variant	123803	exon7			AF092440	CCDS10558.1, CCDS73832.1	16p13	2008-02-05			ENSG00000157045	ENSG00000157045			29909	protein-coding gene	gene with protein product		615367				8910481	Standard	NM_173474		Approved		uc002ddd.4	Q96AB6	OTTHUMG00000129849	ENST00000287706.3:c.495T>C	16.37:g.15134971A>G			15042472	NM_173474	Q7Z4Z0	Silent	SNP	ENST00000287706.3	37	CCDS10558.1																																																																																				0.343	NTAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252089.1	NM_173474	
MYH11	4629	hgsc.bcm.edu	37	16	15931809	15931809	+	Missense_Mutation	SNP	C	C	T	rs375159635		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:15931809C>T	ENST00000300036.5	-	2	410	c.301G>A	c.(301-303)Gtg>Atg	p.V101M	MYH11_ENST00000396324.3_Missense_Mutation_p.V101M|MYH11_ENST00000576790.2_Missense_Mutation_p.V101M|MYH11_ENST00000452625.2_Missense_Mutation_p.V101M	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	101	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.V101M(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TTGTGTAGCACGGAGGCTTCG	0.532			T	CBFB	AML																																p.V101M			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G301A	16						.	C	MET/VAL,MET/VAL,MET/VAL,MET/VAL	0,4394		0,0,2197	190.0	158.0	169.0		301,301,301,301	5.7	1.0	16		169	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	MYH11	NM_001040113.1,NM_001040114.1,NM_002474.2,NM_022844.2	21,21,21,21	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	101/1946,101/1980,101/1973,101/1939	15931809	1,12993	2197	4300	6497	15839310	SO:0001583	missense	4629	exon2			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.301G>A	16.37:g.15931809C>T	ENSP00000300036:p.Val101Met		15839310	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.165295	0.78339	0.0	1.16E-4	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18	5.65	5.65	0.86999	Myosin head, motor domain (2);	0.000000	0.64402	D	0.000001	D	0.91784	0.7401	H	0.94734	3.575	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.93594	0.6924	10	0.87932	D	0	.	18.7211	0.91694	0.0:1.0:0.0:0.0	.	101;101;101;101;101	Q4G140;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	M	101	ENSP00000300036:V101M;ENSP00000345136:V101M;ENSP00000379616:V101M;ENSP00000407821:V101M	ENSP00000300036:V101M	V	-	1	0	MYH11	15839310	1.000000	0.71417	0.957000	0.39632	0.464000	0.32679	7.776000	0.85560	2.663000	0.90544	0.655000	0.94253	GTG		0.532	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
TMC5	79838	hgsc.bcm.edu	37	16	19498613	19498613	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:19498613C>T	ENST00000396229.2	+	17	3287	c.2538C>T	c.(2536-2538)acC>acT	p.T846T	TMC5_ENST00000541464.1_Silent_p.T794T|TMC5_ENST00000561503.1_Silent_p.T487T|TMC5_ENST00000564959.1_Silent_p.T529T|TMC5_ENST00000381414.4_Silent_p.T846T|CTA-363E6.6_ENST00000561762.1_RNA|TMC5_ENST00000542583.2_Silent_p.T846T|TMC5_ENST00000219821.5_Silent_p.T600T	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	846					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.T846T(2)|p.T600T(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CATCCTTCACCGGGGTCTTGT	0.522																																					p.T600T												.	.	4	Substitution - coding silent(4)	large_intestine(2)|central_nervous_system(2)	c.C1800T	16						.						68.0	60.0	63.0					16																	19498613		2197	4300	6497	19406114	SO:0001819	synonymous_variant	79838	exon13			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2538C>T	16.37:g.19498613C>T			19406114	NM_024780	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Silent	SNP	ENST00000396229.2	37	CCDS45431.1																																																																																				0.522	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
DCUN1D3	123879	hgsc.bcm.edu	37	16	20873524	20873524	+	Missense_Mutation	SNP	G	G	A	rs200217368		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:20873524G>A	ENST00000324344.4	-	2	622	c.337C>T	c.(337-339)Cgc>Tgc	p.R113C	ERI2_ENST00000564349.1_Intron|DCUN1D3_ENST00000563934.1_Missense_Mutation_p.R113C	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	113	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.				negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)		p.R113C(1)		NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		TTGCAAAAGCGCTCCATGCCT	0.498																																					p.R113C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C337T	16						.						154.0	125.0	134.0					16																	20873524		2201	4300	6501	20781025	SO:0001583	missense	123879	exon2			BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.337C>T	16.37:g.20873524G>A	ENSP00000319482:p.Arg113Cys		20781025	NM_173475	B3KVY4	Missense_Mutation	SNP	ENST00000324344.4	37	CCDS10592.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845512	0.71603	.	.	ENSG00000188215	ENST00000324344	D	0.94758	-3.51	6.03	5.07	0.68467	Domain of unknown function DUF298 (1);	0.093763	0.64402	N	0.000001	D	0.96895	0.8986	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	P	0.60236	0.871	D	0.97398	0.9994	10	0.87932	D	0	-12.6302	15.0435	0.71811	0.0676:0.0:0.9324:0.0	.	113	Q8IWE4	DCNL3_HUMAN	C	113	ENSP00000319482:R113C	ENSP00000319482:R113C	R	-	1	0	DCUN1D3	20781025	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.441000	0.59981	1.551000	0.49450	0.655000	0.94253	CGC		0.498	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254415.2	NM_173475	
SETD1A	9739	hgsc.bcm.edu	37	16	30980937	30980937	+	Silent	SNP	C	C	T	rs200721841		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:30980937C>T	ENST00000262519.8	+	12	3629	c.2943C>T	c.(2941-2943)gaC>gaT	p.D981D		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	981	Glu-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.D981D(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						AGGAGGATGACGAGGAAGATG	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		20937	0.0		0.001	False		,,,				2504	0.0				p.D981D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2943T	16						.	C		0,4394		0,0,2197	113.0	85.0	95.0		2943	-11.0	0.2	16		95	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SETD1A	NM_014712.1		0,1,6496	TT,TC,CC		0.0116,0.0,0.0077		981/1708	30980937	1,12993	2197	4300	6497	30888438	SO:0001819	synonymous_variant	9739	exon12			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.2943C>T	16.37:g.30980937C>T			30888438	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	ENST00000262519.8	37	CCDS32435.1																																																																																				0.493	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
ABCC12	94160	hgsc.bcm.edu	37	16	48138247	48138247	+	Silent	SNP	C	C	T	rs565086106	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:48138247C>T	ENST00000311303.3	-	20	3051	c.2706G>A	c.(2704-2706)acG>acA	p.T902T	ABCC12_ENST00000448542.1_Intron|ABCC12_ENST00000416054.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	902	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.T902T(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				CAGTGGGAGTCGTGTCAAAGA	0.483																																					p.T902T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2706A	16						.						109.0	103.0	105.0					16																	48138247		2201	4300	6501	46695748	SO:0001819	synonymous_variant	94160	exon20			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.2706G>A	16.37:g.48138247C>T			46695748	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Silent	SNP	ENST00000311303.3	37	CCDS10730.1																																																																																				0.483	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
RBL2	5934	hgsc.bcm.edu	37	16	53498191	53498191	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:53498191G>T	ENST00000262133.6	+	12	1751	c.1614G>T	c.(1612-1614)gaG>gaT	p.E538D	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Missense_Mutation_p.E322D	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	538	Domain A.|Pocket; binds E1A.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)	p.E538D(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GCTGCCTTGAGGTCGTCACTT	0.318																																					p.E538D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1614T	16						.						97.0	100.0	99.0					16																	53498191		2198	4300	6498	52055692	SO:0001583	missense	5934	exon12			X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.1614G>T	16.37:g.53498191G>T	ENSP00000262133:p.Glu538Asp		52055692	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	37	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.490765	0.64074	.	.	ENSG00000103479	ENST00000262133;ENST00000544405;ENST00000379935;ENST00000544545	D;D;D	0.92299	-3.01;-3.01;-3.01	5.86	1.42	0.22433	Retinoblastoma-associated protein, A-box (1);Cyclin-like (2);	0.000000	0.85682	D	0.000000	D	0.95494	0.8536	M	0.87827	2.91	0.45704	D	0.998617	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.97110	0.994;1.0;1.0;0.994	D	0.93879	0.7169	10	0.87932	D	0	-20.5127	9.111	0.36727	0.361:0.0:0.639:0.0	.	322;538;248;538	B7Z913;Q8NE70;E9PG04;Q08999	.;.;.;RBL2_HUMAN	D	538;464;248;322	ENSP00000262133:E538D;ENSP00000443744:E464D;ENSP00000444685:E322D	ENSP00000262133:E538D	E	+	3	2	RBL2	52055692	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.095000	0.41729	0.045000	0.15804	0.650000	0.86243	GAG		0.318	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
NLRC5	84166	hgsc.bcm.edu	37	16	57089381	57089381	+	Silent	SNP	A	A	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:57089381A>G	ENST00000262510.6	+	27	3921	c.3696A>G	c.(3694-3696)gtA>gtG	p.V1232V	NLRC5_ENST00000539144.1_Intron|NLRC5_ENST00000436936.1_Silent_p.V1232V|NLRC5_ENST00000308149.7_Intron|RP11-322D14.2_ENST00000562970.1_RNA	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1232					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.V1232V(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				AGGAGCACGTAGAGTCACTCT	0.607																																					p.V1232V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3696G	16						.						87.0	68.0	75.0					16																	57089381		2198	4300	6498	55646882	SO:0001819	synonymous_variant	84166	exon27			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3696A>G	16.37:g.57089381A>G			55646882	NM_032206	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Silent	SNP	ENST00000262510.6	37	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	A	0.033	-1.323661	0.01309	.	.	ENSG00000140853	ENST00000538805	.	.	.	4.7	2.74	0.32292	.	.	.	.	.	T	0.33265	0.0857	.	.	.	0.21290	N	0.999739	.	.	.	.	.	.	T	0.20107	-1.0285	4	.	.	.	.	7.3657	0.26772	0.2002:0.0:0.7998:0.0	.	.	.	.	G	984	.	.	R	+	1	2	NLRC5	55646882	0.941000	0.31946	0.045000	0.18777	0.007000	0.05969	2.685000	0.46959	0.584000	0.29591	-0.220000	0.12472	AGA		0.607	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
EXOSC6	118460	hgsc.bcm.edu	37	16	70287897	70287897	+	5'Flank	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:70287897C>T	ENST00000435634.1	-	0	0				AARS_ENST00000564359.1_5'Flank|AARS_ENST00000261772.8_Silent_p.L815L	NM_058219.2	NP_478126.1	Q5RKV6	EXOS6_HUMAN	exosome component 6						DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|isotype switching (GO:0045190)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L815L(1)									GAGTCTCCCGCAATTCATCCT	0.562											OREG0023912	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L815L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2445A	16						.						113.0	110.0	111.0					16																	70287897		2198	4300	6498	68845398	SO:0001631	upstream_gene_variant	16	exon18			BC052252	CCDS10887.1	16q22.1	2008-02-05			ENSG00000223496	ENSG00000223496			19055	protein-coding gene	gene with protein product	"""Mtr3 (mRNA transport regulator 3)-homolog (yeast)"""	606490				11719186, 12419256	Standard	NM_058219		Approved	MTR3, hMtr3p, Mtr3p, EAP4, p11	uc002eym.1	Q5RKV6	OTTHUMG00000137578		16.37:g.70287897C>T	Exception_encountered	1121	68845398	NM_001605		Silent	SNP	ENST00000435634.1	37	CCDS10887.1																																																																																				0.562	EXOSC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268966.1	NM_058219	
AARS	16	hgsc.bcm.edu	37	16	70303525	70303525	+	Missense_Mutation	SNP	G	G	A	rs138490305		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:70303525G>A	ENST00000261772.8	-	7	1101	c.958C>T	c.(958-960)Cgt>Tgt	p.R320C		NM_001605.2	NP_001596.2			alanyl-tRNA synthetase									p.R320C(1)		breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		ACTTACCCACGCCCTGTGTTG	0.557																																					p.R320C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C958T	16						.	G	CYS/ARG	0,4396		0,0,2198	130.0	99.0	109.0		958	4.7	1.0	16	dbSNP_134	109	3,8597	3.0+/-9.4	0,3,4297	yes	missense	AARS	NM_001605.2	180	0,3,6495	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	320/969	70303525	3,12993	2198	4300	6498	68861026	SO:0001583	missense	16	exon7			D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.958C>T	16.37:g.70303525G>A	ENSP00000261772:p.Arg320Cys		68861026	NM_001605		Missense_Mutation	SNP	ENST00000261772.8	37	CCDS32474.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.367799	0.61513	0.0	3.49E-4	ENSG00000090861	ENST00000261772	T	0.76448	-1.02	5.67	4.69	0.59074	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.048741	0.85682	D	0.000000	D	0.92397	0.7587	H	0.98351	4.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94557	0.7759	10	0.87932	D	0	.	13.2379	0.59979	0.0:0.0:0.8266:0.1734	.	328;320	E7ETK8;P49588	.;SYAC_HUMAN	C	320	ENSP00000261772:R320C	ENSP00000261772:R320C	R	-	1	0	AARS	68861026	0.980000	0.34600	0.957000	0.39632	0.386000	0.30323	2.156000	0.42310	1.347000	0.45714	0.655000	0.94253	CGT		0.557	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435021.2	NM_001605	
PMM2	5373	hgsc.bcm.edu	37	16	8905023	8905023	+	Silent	SNP	C	C	T	rs550231531		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:8905023C>T	ENST00000268261.4	+	5	501	c.435C>T	c.(433-435)taC>taT	p.Y145Y	PMM2_ENST00000569958.1_Intron|PMM2_ENST00000566983.1_Silent_p.Y118Y|PMM2_ENST00000537352.1_Silent_p.Y20Y|PMM2_ENST00000539622.1_Silent_p.Y62Y	NM_000303.2	NP_000294.1	O15305	PMM2_HUMAN	phosphomannomutase 2	145					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)	phosphomannomutase activity (GO:0004615)	p.Y145Y(1)		breast(3)|cervix(1)|endometrium(2)|large_intestine(1)|ovary(1)|skin(1)	9						TTGAGTTCTACGAACTCGATA	0.433													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22520	0.0		0.0	False		,,,				2504	0.0				p.Y145Y	Esophageal Squamous(154;1308 1842 2827 29799 42829)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C435T	16						.						79.0	63.0	69.0					16																	8905023		2197	4287	6484	8812524	SO:0001819	synonymous_variant	5373	exon5			BC008310	CCDS10536.1	16p13	2012-09-06			ENSG00000140650	ENSG00000140650	5.3.1.8		9115	protein-coding gene	gene with protein product	"""phosphomannose isomerase 1"""	601785		CDG1		9140401	Standard	NM_000303		Approved	CDGS, CDG1a, PMI, PMI1	uc002czf.4	O15305	OTTHUMG00000129697	ENST00000268261.4:c.435C>T	16.37:g.8905023C>T			8812524	NM_000303	A8K672|B7Z6R0|D3DUF3	Silent	SNP	ENST00000268261.4	37	CCDS10536.1																																																																																				0.433	PMM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251904.1	NM_000303	
ADAT1	23536	hgsc.bcm.edu	37	16	75646371	75646371	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr16:75646371G>A	ENST00000307921.3	-	7	958	c.813C>T	c.(811-813)tcC>tcT	p.S271S		NM_012091.3	NP_036223.2	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	271	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|RNA binding (GO:0003723)|tRNA-specific adenosine deaminase activity (GO:0008251)	p.S271S(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)	19						CCGGCTTTCCGGAGTCTCCAG	0.567																																					p.S271S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C813T	16						.						61.0	62.0	62.0					16																	75646371		2198	4300	6498	74203872	SO:0001819	synonymous_variant	23536	exon7			AF125188	CCDS10922.1	16q23	2008-02-05			ENSG00000065457	ENSG00000065457			228	protein-coding gene	gene with protein product		604230				10430867	Standard	NM_012091		Approved		uc002feo.2	Q9BUB4	OTTHUMG00000137611	ENST00000307921.3:c.813C>T	16.37:g.75646371G>A			74203872	NM_012091	Q9NVB7|Q9UNG3	Silent	SNP	ENST00000307921.3	37	CCDS10922.1																																																																																				0.567	ADAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269027.1	NM_012091	
LDLRAD4	753	hgsc.bcm.edu	37	18	13645163	13645163	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr18:13645163C>T	ENST00000359446.5	+	6	896	c.428C>T	c.(427-429)gCg>gTg	p.A143V	LDLRAD4_ENST00000586765.1_Missense_Mutation_p.A88V|LDLRAD4_ENST00000585931.1_Missense_Mutation_p.A66V|LDLRAD4_ENST00000361205.4_Missense_Mutation_p.A143V|RP11-701H16.4_ENST00000588397.1_RNA|LDLRAD4_ENST00000592991.1_Missense_Mutation_p.A45V|LDLRAD4_ENST00000399848.3_Missense_Mutation_p.A125V|LDLRAD4_ENST00000587757.1_Missense_Mutation_p.A106V	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4	143					negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)	p.A143V(1)									AGGTTCACAGCGCCGTCCTTC	0.557																																					p.A88V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C263T	18						.						95.0	91.0	93.0					18																	13645163		2203	4300	6503	13635163	SO:0001583	missense	753	exon3			AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.428C>T	18.37:g.13645163C>T	ENSP00000352420:p.Ala143Val		13635163	NM_001003675	B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	Missense_Mutation	SNP	ENST00000359446.5	37	CCDS32793.1	.	.	.	.	.	.	.	.	.	.	C	1.027	-0.682944	0.03353	.	.	ENSG00000168675	ENST00000361205;ENST00000399848;ENST00000359446;ENST00000399847;ENST00000361303;ENST00000435606	T;T	0.26067	1.77;1.76	4.95	3.15	0.36227	.	0.157883	0.56097	D	0.000029	T	0.15739	0.0379	L	0.31294	0.92	0.26906	N	0.967017	P;P;P;P;P;P	0.51147	0.519;0.942;0.531;0.942;0.579;0.494	B;B;B;B;B;B	0.40901	0.084;0.343;0.084;0.294;0.113;0.079	T	0.12941	-1.0528	10	0.13108	T	0.6	-18.7456	10.2369	0.43288	0.0:0.789:0.1365:0.0746	.	67;85;88;106;125;143	O15165-4;O15165-3;E9PAY9;B3KNT9;O15165-2;O15165	.;.;.;.;.;CR001_HUMAN	V	143;125;106;88;85;67	ENSP00000354753:A143V;ENSP00000382741:A125V	ENSP00000352420:A106V	A	+	2	0	C18orf1	13635163	0.973000	0.33851	0.014000	0.15608	0.225000	0.24961	3.447000	0.52936	0.502000	0.28037	0.655000	0.94253	GCG		0.557	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458326.1	NM_181481	
NPC1	4864	hgsc.bcm.edu	37	18	21125051	21125051	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr18:21125051C>T	ENST00000269228.5	-	12	2374	c.1820G>A	c.(1819-1821)cGa>cAa	p.R607Q	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_Missense_Mutation_p.R289Q	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	607					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)	p.R607Q(1)		breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TTCAATACTTCGTTCAGCAGT	0.338																																					p.R607Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1820A	18						.						107.0	97.0	101.0					18																	21125051		2203	4300	6503	19379049	SO:0001583	missense	4864	exon12			AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.1820G>A	18.37:g.21125051C>T	ENSP00000269228:p.Arg607Gln		19379049	NM_000271	B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	37	CCDS11878.1	.	.	.	.	.	.	.	.	.	.	C	35	5.415489	0.96092	.	.	ENSG00000141458	ENST00000269228;ENST00000412552;ENST00000540608	D;D	0.91351	-2.83;-2.83	5.96	5.08	0.68730	.	0.054594	0.64402	N	0.000001	D	0.96093	0.8727	M	0.91300	3.195	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.76071	0.982;0.987	D	0.96490	0.9363	10	0.54805	T	0.06	-7.0229	15.0359	0.71748	0.0:0.9319:0.0:0.0681	.	618;607	Q59GR1;O15118	.;NPC1_HUMAN	Q	607;289;452	ENSP00000269228:R607Q;ENSP00000408606:R289Q	ENSP00000269228:R607Q	R	-	2	0	NPC1	19379049	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.793000	0.62474	1.506000	0.48736	0.655000	0.94253	CGA		0.338	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2	NM_000271	
PIK3C3	5289	hgsc.bcm.edu	37	18	39584468	39584468	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr18:39584468G>A	ENST00000262039.4	+	10	1219	c.1133G>A	c.(1132-1134)cGt>cAt	p.R378H	PIK3C3_ENST00000398870.3_Missense_Mutation_p.R315H	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	378	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.R378H(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						ACTGTGAGGCGTTATGCTGTT	0.448										TSP Lung(28;0.18)																											p.R378H	NSCLC(37;552 1060 2683 16430 37914)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1133A	18						.						126.0	109.0	115.0					18																	39584468		2203	4300	6503	37838466	SO:0001583	missense	5289	exon10			Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.1133G>A	18.37:g.39584468G>A	ENSP00000262039:p.Arg378His		37838466	NM_002647	Q15134	Missense_Mutation	SNP	ENST00000262039.4	37	CCDS11920.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.151240	0.78001	.	.	ENSG00000078142	ENST00000262039;ENST00000398870	T;T	0.63913	-0.07;-0.07	5.45	5.45	0.79879	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63082	0.2481	M	0.74467	2.265	0.80722	D	1	P;P	0.43607	0.812;0.812	B;B	0.36186	0.219;0.219	T	0.67465	-0.5664	9	.	.	.	.	19.2798	0.94048	0.0:0.0:1.0:0.0	.	315;378	A8MYT4;Q8NEB9	.;PK3C3_HUMAN	H	378;315	ENSP00000262039:R378H;ENSP00000381845:R315H	.	R	+	2	0	PIK3C3	37838466	1.000000	0.71417	0.989000	0.46669	0.941000	0.58515	9.843000	0.99491	2.579000	0.87056	0.655000	0.94253	CGT		0.448	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255804.1	NM_002647	
ATP8B1	5205	hgsc.bcm.edu	37	18	55362457	55362457	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr18:55362457G>A	ENST00000283684.4	-	9	885	c.886C>T	c.(886-888)Cgt>Tgt	p.R296C	ATP8B1_ENST00000589147.1_5'Flank|RP11-35G9.5_ENST00000588925.1_RNA|RP11-35G9.3_ENST00000599199.1_RNA|ATP8B1_ENST00000536015.1_Missense_Mutation_p.R296C			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	296					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R296C(1)		breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				ACACAGCCACGTAACAAAATT	0.358																																					p.R296C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C886T	18						.						96.0	94.0	95.0					18																	55362457		2203	4300	6503	53513455	SO:0001583	missense	5205	exon10			AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.886C>T	18.37:g.55362457G>A	ENSP00000283684:p.Arg296Cys		53513455	NM_005603	Q9BTP8	Missense_Mutation	SNP	ENST00000283684.4	37	CCDS11965.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525483	0.85600	.	.	ENSG00000081923	ENST00000283684;ENST00000536015	D;D	0.91237	-2.81;-2.81	5.46	4.55	0.56014	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.064498	0.64402	D	0.000010	D	0.96722	0.8930	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.97679	1.0171	10	0.87932	D	0	.	15.2403	0.73465	0.0:0.0:0.859:0.141	.	296	O43520	AT8B1_HUMAN	C	296	ENSP00000283684:R296C;ENSP00000445359:R296C	ENSP00000283684:R296C	R	-	1	0	ATP8B1	53513455	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.522000	0.67092	2.567000	0.86603	0.655000	0.94253	CGT		0.358	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256097.1	NM_005603	
ARHGAP28	79822	hgsc.bcm.edu	37	18	6908981	6908981	+	Missense_Mutation	SNP	A	A	G	rs370814527		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr18:6908981A>G	ENST00000383472.4	+	17	2157	c.2053A>G	c.(2053-2055)Aag>Gag	p.K685E	ARHGAP28_ENST00000314319.3_Missense_Mutation_p.K526E|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.K521E|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.K526E			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	685					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)	p.K526E(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				AGAATGTATTAAGATTCAGAA	0.279																																					p.K526E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1576G	18						.	A	GLU/LYS	0,4378		0,0,2189	39.0	46.0	43.0		1576	5.9	1.0	18		43	1,8573	1.2+/-3.3	0,1,4286	no	missense	ARHGAP28	NM_001010000.2	56	0,1,6475	GG,GA,AA		0.0117,0.0,0.0077	benign	526/571	6908981	1,12951	2189	4287	6476	6898981	SO:0001583	missense	79822	exon16			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.2053A>G	18.37:g.6908981A>G	ENSP00000372964:p.Lys685Glu		6898981	NM_001010000	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	ENST00000383472.4	37		.	.	.	.	.	.	.	.	.	.	A	14.16	2.452340	0.43531	0.0	1.17E-4	ENSG00000088756	ENST00000419673;ENST00000531294;ENST00000314319	T;T;T	0.08008	3.15;3.14;3.15	5.95	5.95	0.96441	.	.	.	.	.	T	0.07324	0.0185	L	0.31578	0.945	0.80722	D	1	B	0.30406	0.278	B	0.25140	0.058	T	0.41124	-0.9526	9	0.20046	T	0.44	.	15.3941	0.74778	1.0:0.0:0.0:0.0	.	685	Q9P2N2	RHG28_HUMAN	E	526;521;526	ENSP00000392660:K526E;ENSP00000437262:K521E;ENSP00000313506:K526E	ENSP00000313506:K526E	K	+	1	0	ARHGAP28	6898981	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.054000	0.57434	2.276000	0.75962	0.528000	0.53228	AAG		0.279	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	XM_371108	
LAMA1	284217	hgsc.bcm.edu	37	18	6964739	6964739	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr18:6964739G>A	ENST00000389658.3	-	51	7352	c.7259C>T	c.(7258-7260)cCg>cTg	p.P2420L		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2420	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.P2420L(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AGATGCTCCCGGAGTCTCGCC	0.443																																					p.P2420L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7259T	18						.						140.0	120.0	127.0					18																	6964739		2203	4300	6503	6954739	SO:0001583	missense	284217	exon51			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7259C>T	18.37:g.6964739G>A	ENSP00000374309:p.Pro2420Leu		6954739	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064217	0.76187	.	.	ENSG00000101680	ENST00000389658	T	0.80566	-1.39	5.85	5.85	0.93711	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.90758	0.7099	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.90917	0.4780	10	0.72032	D	0.01	.	20.1577	0.98120	0.0:0.0:1.0:0.0	.	2420	P25391	LAMA1_HUMAN	L	2420	ENSP00000374309:P2420L	ENSP00000374309:P2420L	P	-	2	0	LAMA1	6954739	1.000000	0.71417	0.979000	0.43373	0.255000	0.26057	8.169000	0.89672	2.767000	0.95098	0.655000	0.94253	CCG		0.443	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
LAMA1	284217	hgsc.bcm.edu	37	18	7012042	7012042	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr18:7012042G>A	ENST00000389658.3	-	24	3552	c.3459C>T	c.(3457-3459)tcC>tcT	p.S1153S		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1153	Laminin EGF-like 14; first part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.S1153S(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GGGACAGCCCGGAGCAGAAGC	0.592																																					p.S1153S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3459T	18						.						35.0	31.0	32.0					18																	7012042		2203	4300	6503	7002042	SO:0001819	synonymous_variant	284217	exon24			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3459C>T	18.37:g.7012042G>A			7002042	NM_005559		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																				0.592	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ALPK2	115701	hgsc.bcm.edu	37	18	56184260	56184260	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr18:56184260G>A	ENST00000361673.3	-	9	6033	c.5820C>T	c.(5818-5820)caC>caT	p.H1940H		NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1940	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.H1301H(2)|p.H1940H(1)|p.H1940Q(1)|p.H1301Q(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GCATGAGGCCGTGCATCACTG	0.557																																					p.H1940H												ALPK2,ovary,NS,Substitution - coding silent,0	.	5	Substitution - coding silent(3)|Substitution - Missense(2)	lung(2)|large_intestine(2)|ovary(1)	c.C5820T	18						.						159.0	138.0	145.0					18																	56184260		2203	4300	6503	54335240	SO:0001819	synonymous_variant	115701	exon9			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.5820C>T	18.37:g.56184260G>A			54335240	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	CCDS11966.2																																																																																				0.557	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
TOMM70A	9868	hgsc.bcm.edu	37	3	100093993	100093993	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:100093993G>A	ENST00000284320.5	-	7	1544	c.1096C>T	c.(1096-1098)Cga>Tga	p.R366*		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	366					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)	p.R366*(1)		endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						GCATTTGCTCGAAGCTATATA	0.398																																					p.R366X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1096T	3						.						117.0	117.0	117.0					3																	100093993		2203	4300	6503	101576683	SO:0001587	stop_gained	9868	exon7			AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.1096C>T	3.37:g.100093993G>A	ENSP00000284320:p.Arg366*		101576683	NM_014820	D3DN48	Nonsense_Mutation	SNP	ENST00000284320.5	37	CCDS33807.1	.	.	.	.	.	.	.	.	.	.	G	40	8.476733	0.98827	.	.	ENSG00000154174	ENST00000284320;ENST00000544924	.	.	.	5.76	3.96	0.45880	.	0.234702	0.44097	D	0.000492	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.8615	10.7686	0.46308	0.0675:0.0:0.8003:0.1322	.	.	.	.	X	366;259	.	ENSP00000284320:R366X	R	-	1	2	TOMM70A	101576683	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	5.821000	0.69257	0.775000	0.33450	0.561000	0.74099	CGA		0.398	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353141.2		
TATDN2	9797	hgsc.bcm.edu	37	3	10312572	10312572	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:10312572G>A	ENST00000287652.4	+	4	2757	c.1706G>A	c.(1705-1707)cGt>cAt	p.R569H	TATDN2_ENST00000448281.2_Missense_Mutation_p.R569H|RP11-438J1.1_ENST00000450534.1_3'UTR	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	569					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)	p.R569H(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						CATTTTGCACGTTACTACAGT	0.498																																					p.R569H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1706A	3						.						111.0	114.0	113.0					3																	10312572		2203	4300	6503	10287572	SO:0001583	missense	9797	exon4			D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.1706G>A	3.37:g.10312572G>A	ENSP00000287652:p.Arg569His		10287572	NM_014760	Q3MIL9|Q5BKU0	Missense_Mutation	SNP	ENST00000287652.4	37	CCDS33698.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.182438	0.57800	.	.	ENSG00000157014	ENST00000287652;ENST00000448281	T;T	0.24908	1.83;1.83	5.0	5.0	0.66597	.	0.188514	0.33980	N	0.004368	T	0.19327	0.0464	L	0.33485	1.01	0.33495	D	0.589247	P	0.43519	0.809	B	0.39027	0.288	T	0.30387	-0.9980	10	0.72032	D	0.01	-7.1011	9.8093	0.40812	0.0938:0.0:0.9062:0.0	.	569	Q93075	TATD2_HUMAN	H	569	ENSP00000287652:R569H;ENSP00000408736:R569H	ENSP00000287652:R569H	R	+	2	0	TATDN2	10287572	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.278000	0.58946	2.494000	0.84150	0.644000	0.83932	CGT		0.498	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	XM_376203	
SENP7	57337	hgsc.bcm.edu	37	3	101047326	101047326	+	Nonsense_Mutation	SNP	G	G	A	rs374261191		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:101047326G>A	ENST00000394095.2	-	22	2913	c.2860C>T	c.(2860-2862)Cga>Tga	p.R954*	SENP7_ENST00000394094.2_Nonsense_Mutation_p.R889*|SENP7_ENST00000394091.1_Nonsense_Mutation_p.R790*|SENP7_ENST00000358203.3_Nonsense_Mutation_p.R790*|SENP7_ENST00000314261.7_Nonsense_Mutation_p.R888*|SENP7_ENST00000394085.3_Nonsense_Mutation_p.R142*|SENP7_ENST00000348610.3_Nonsense_Mutation_p.R921*	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	954	Protease.					intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)	p.R888*(2)		breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						ACTTACTCTCGTAAATTCTGA	0.318																																					p.R954X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|breast(1)	c.C2860T	3						.	G	stop/ARG,stop/ARG	0,4406		0,0,2203	84.0	96.0	92.0		2665,2860	4.5	1.0	3		92	1,8595	1.2+/-3.3	0,1,4297	no	stop-gained,stop-gained	SENP7	NM_001077203.1,NM_020654.3	,	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	,	889/986,954/1051	101047326	1,13001	2203	4298	6501	102530016	SO:0001587	stop_gained	57337	exon22				CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2860C>T	3.37:g.101047326G>A	ENSP00000377655:p.Arg954*		102530016	NM_020654	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Nonsense_Mutation	SNP	ENST00000394095.2	37	CCDS2941.2	.	.	.	.	.	.	.	.	.	.	G	39	7.580735	0.98371	0.0	1.16E-4	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000394085;ENST00000348610	.	.	.	5.42	4.47	0.54385	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8682	0.57951	0.0:0.0:0.752:0.248	.	.	.	.	X	954;889;888;790;790;142;921	.	ENSP00000313624:R888X	R	-	1	2	SENP7	102530016	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.086000	0.30853	2.543000	0.85770	0.591000	0.81541	CGA		0.318	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654	
CD200R1L	344807	hgsc.bcm.edu	37	3	112546320	112546320	+	Silent	SNP	C	C	T	rs142213153	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:112546320C>T	ENST00000398214.1	-	3	549	c.324G>A	c.(322-324)tcG>tcA	p.S108S	CD200R1L_ENST00000448932.1_Silent_p.S87S|CD200R1L_ENST00000488794.1_Silent_p.S87S	NM_001008784.2	NP_001008784.2	Q6Q8B3	MO2R2_HUMAN	CD200 receptor 1-like	108	Ig-like V-type.					integral component of membrane (GO:0016021)		p.S108S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(2)	19						TCTGAAGGTCCGAATTCTGAT	0.463													C|||	52	0.0103834	0.0	0.0	5008	,	,		19537	0.0506		0.0	False		,,,				2504	0.001				p.S108S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G324A	3						.	C	,	3,4403	6.2+/-15.9	0,3,2200	157.0	152.0	153.0		324,261	-1.2	0.0	3	dbSNP_134	153	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CD200R1L	NM_001008784.2,NM_001199215.1	,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,	108/272,87/251	112546320	3,13003	2203	4300	6503	114029010	SO:0001819	synonymous_variant	344807	exon3			AY284976	CCDS43131.1, CCDS56267.1	3q13.2	2014-05-15	2008-10-08		ENSG00000206531	ENSG00000206531		"""Immunoglobulin superfamily / C2-set domain containing"""	24665	protein-coding gene	gene with protein product	"""CD200 receptor 2"""						Standard	NM_001008784		Approved	CD200RLa, CD200R2	uc003dzi.1	Q6Q8B3	OTTHUMG00000159283	ENST00000398214.1:c.324G>A	3.37:g.112546320C>T			114029010	NM_001008784	Q6WHB7	Silent	SNP	ENST00000398214.1	37	CCDS43131.1																																																																																				0.463	CD200R1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354365.1	NM_001008784	
PARP9	83666	hgsc.bcm.edu	37	3	122259595	122259595	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:122259595C>T	ENST00000360356.2	-	8	1821	c.1594G>A	c.(1594-1596)Gca>Aca	p.A532T	PARP9_ENST00000492382.1_Missense_Mutation_p.A77T|PARP9_ENST00000462315.1_Missense_Mutation_p.A497T|PARP9_ENST00000477522.2_Missense_Mutation_p.A497T|PARP9_ENST00000471785.1_Missense_Mutation_p.A497T	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	532					cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.A532T(1)		endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		TGGATCCATGCGTGGGCCTCA	0.448																																					p.A497T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1489A	3						.						145.0	144.0	145.0					3																	122259595		2203	4300	6503	123742285	SO:0001583	missense	83666	exon8			AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.1594G>A	3.37:g.122259595C>T	ENSP00000353512:p.Ala532Thr		123742285	NM_001146103	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Missense_Mutation	SNP	ENST00000360356.2	37	CCDS3014.1	.	.	.	.	.	.	.	.	.	.	C	6.757	0.508467	0.12883	.	.	ENSG00000138496	ENST00000360356;ENST00000492382;ENST00000477522;ENST00000471785;ENST00000452457;ENST00000462315	T;T;T;T;T	0.17370	3.28;2.95;3.14;3.14;2.28	4.83	2.84	0.33178	.	1.026890	0.07743	N	0.947175	T	0.14356	0.0347	L	0.51422	1.61	0.09310	N	1	B;B;B;B	0.25235	0.012;0.021;0.121;0.01	B;B;B;B	0.16722	0.004;0.004;0.016;0.004	T	0.35051	-0.9804	10	0.17369	T	0.5	.	5.0882	0.14694	0.0:0.6659:0.2174:0.1167	.	497;532;77;497	E9PFM7;Q8IXQ6;G5E9U8;Q8IXQ6-2	.;PARP9_HUMAN;.;.	T	532;77;497;497;455;497	ENSP00000353512:A532T;ENSP00000417664:A77T;ENSP00000419506:A497T;ENSP00000419001:A497T;ENSP00000418894:A497T	ENSP00000353512:A532T	A	-	1	0	PARP9	123742285	0.000000	0.05858	0.001000	0.08648	0.040000	0.13550	0.109000	0.15417	1.231000	0.43661	0.650000	0.86243	GCA		0.448	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458	
OSBPL11	114885	hgsc.bcm.edu	37	3	125282656	125282656	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:125282656T>C	ENST00000296220.5	-	7	1189	c.900A>G	c.(898-900)atA>atG	p.I300M		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	300					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)	p.I300M(1)		NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						TTGATAAAGATATCTTTGGTT	0.438																																					p.I300M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A900G	3						.						92.0	92.0	92.0					3																	125282656		2203	4300	6503	126765346	SO:0001583	missense	114885	exon7			AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.900A>G	3.37:g.125282656T>C	ENSP00000296220:p.Ile300Met		126765346	NM_022776	A8K9I7	Missense_Mutation	SNP	ENST00000296220.5	37	CCDS3033.1	.	.	.	.	.	.	.	.	.	.	T	10.21	1.288203	0.23478	.	.	ENSG00000144909	ENST00000296220	T	0.17854	2.25	5.09	1.12	0.20585	.	0.311329	0.34362	N	0.004032	T	0.08714	0.0216	L	0.36672	1.1	0.37612	D	0.920964	P	0.34780	0.468	B	0.27500	0.08	T	0.27191	-1.0081	10	0.32370	T	0.25	-15.3508	2.1058	0.03690	0.2343:0.0722:0.241:0.4524	.	300	Q9BXB4	OSB11_HUMAN	M	300	ENSP00000296220:I300M	ENSP00000296220:I300M	I	-	3	3	OSBPL11	126765346	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.311000	0.19380	0.355000	0.24131	0.383000	0.25322	ATA		0.438	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
CLSTN2	64084	hgsc.bcm.edu	37	3	139894853	139894853	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:139894853A>G	ENST00000458420.3	+	2	360	c.170A>G	c.(169-171)gAc>gGc	p.D57G		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	57	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.D57G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GAGAACAATGACACAGTCATT	0.443										HNSCC(16;0.037)																											p.D57G	GBM(45;858 913 3709 36904 37282)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A170G	3						.						104.0	103.0	103.0					3																	139894853		2203	4300	6503	141377543	SO:0001583	missense	64084	exon2			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.170A>G	3.37:g.139894853A>G	ENSP00000402460:p.Asp57Gly		141377543	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	A	18.07	3.542464	0.65198	.	.	ENSG00000158258	ENST00000458420	T	0.49720	0.77	5.6	5.6	0.85130	Cadherin (3);Cadherin-like (1);	0.169449	0.35124	N	0.003431	T	0.58581	0.2132	L	0.41236	1.265	0.58432	D	0.999993	D	0.89917	1.0	D	0.80764	0.994	T	0.55016	-0.8206	10	0.33141	T	0.24	-28.8935	14.0326	0.64624	1.0:0.0:0.0:0.0	.	57	Q9H4D0	CSTN2_HUMAN	G	57	ENSP00000402460:D57G	ENSP00000402460:D57G	D	+	2	0	CLSTN2	141377543	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.223000	0.89779	2.251000	0.74343	0.528000	0.53228	GAC		0.443	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
HLTF	6596	hgsc.bcm.edu	37	3	148765848	148765848	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:148765848C>T	ENST00000310053.5	-	17	2052	c.1859G>A	c.(1858-1860)cGt>cAt	p.R620H	HLTF_ENST00000392912.2_Missense_Mutation_p.R620H|HLTF_ENST00000494055.1_Missense_Mutation_p.R620H|HLTF_ENST00000465259.1_Missense_Mutation_p.R619H	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	620					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R620H(1)		breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TGTGACAGGACGCTGTATTGT	0.363																																					p.R620H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1859A	3						.						121.0	114.0	117.0					3																	148765848		2203	4300	6503	150248538	SO:0001583	missense	6596	exon17			L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.1859G>A	3.37:g.148765848C>T	ENSP00000308944:p.Arg620His		150248538	NM_139048	D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Missense_Mutation	SNP	ENST00000310053.5	37	CCDS33875.1	.	.	.	.	.	.	.	.	.	.	C	30	5.052523	0.93793	.	.	ENSG00000071794	ENST00000465259;ENST00000310053;ENST00000392912;ENST00000494055;ENST00000467858	D;D;D;D;D	0.94330	-3.4;-3.4;-3.4;-3.4;-3.4	5.65	5.65	0.86999	SNF2-related (1);	.	.	.	.	D	0.95746	0.8616	L	0.55834	1.745	0.80722	D	1	D;D;D	0.89917	0.993;1.0;1.0	P;D;D	0.91635	0.877;0.999;0.997	D	0.94818	0.7984	9	0.39692	T	0.17	-16.4962	18.4906	0.90846	0.0:1.0:0.0:0.0	.	620;620;620	Q59GQ7;A8K5B6;Q14527	.;.;HLTF_HUMAN	H	619;620;620;620;84	ENSP00000420745:R619H;ENSP00000308944:R620H;ENSP00000376644:R620H;ENSP00000420429:R620H;ENSP00000420106:R84H	ENSP00000308944:R620H	R	-	2	0	HLTF	150248538	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.013000	0.76373	2.656000	0.90262	0.655000	0.94253	CGT		0.363	HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356064.1		
VEPH1	79674	hgsc.bcm.edu	37	3	157131701	157131701	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:157131701C>A	ENST00000362010.2	-	6	1182	c.875G>T	c.(874-876)aGg>aTg	p.R292M	VEPH1_ENST00000392832.2_Missense_Mutation_p.R292M|VEPH1_ENST00000469007.1_5'UTR|VEPH1_ENST00000392833.2_Missense_Mutation_p.R292M|VEPH1_ENST00000543418.1_Missense_Mutation_p.R292M	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	292						plasma membrane (GO:0005886)		p.R292M(1)		autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			TCCATAAATCCTTGCCATCTG	0.433																																					p.R292M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G875T	3						.						155.0	162.0	160.0					3																	157131701		2203	4300	6503	158614395	SO:0001583	missense	79674	exon6			AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.875G>T	3.37:g.157131701C>A	ENSP00000354919:p.Arg292Met		158614395	NM_001167911	D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	ENST00000362010.2	37	CCDS3179.1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475434	0.63737	.	.	ENSG00000197415	ENST00000392833;ENST00000362010;ENST00000543418;ENST00000392832	T;T;T;T	0.08984	3.03;3.04;3.03;3.04	5.81	3.05	0.35203	.	0.101640	0.64402	D	0.000004	T	0.11537	0.0281	L	0.43152	1.355	0.51767	D	0.999937	P;P	0.52692	0.955;0.924	P;B	0.53360	0.724;0.41	T	0.05084	-1.0907	10	0.87932	D	0	2.2675	3.9365	0.09309	0.0:0.548:0.188:0.264	.	292;292	Q14D04-2;Q14D04	.;MELT_HUMAN	M	292	ENSP00000376578:R292M;ENSP00000354919:R292M;ENSP00000446258:R292M;ENSP00000376577:R292M	ENSP00000354919:R292M	R	-	2	0	VEPH1	158614395	1.000000	0.71417	0.530000	0.27963	0.969000	0.65631	2.615000	0.46368	0.796000	0.33947	0.591000	0.81541	AGG		0.433	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351845.3	NM_024621	
LMCD1	29995	hgsc.bcm.edu	37	3	8607282	8607282	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:8607282C>T	ENST00000157600.3	+	5	1120	c.888C>T	c.(886-888)tgC>tgT	p.C296C	LMCD1-AS1_ENST00000439407.1_RNA|LMCD1_ENST00000397386.3_Silent_p.C184C|LMCD1_ENST00000454244.1_Silent_p.C223C	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	296	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.C296C(1)		breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		CACCCTGGTGCGGCCGCCATT	0.627																																					p.C296C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C888T	3						.						21.0	21.0	21.0					3																	8607282		2203	4298	6501	8582282	SO:0001819	synonymous_variant	29995	exon5			AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.888C>T	3.37:g.8607282C>T			8582282	NM_014583	B4DG80	Silent	SNP	ENST00000157600.3	37	CCDS33688.1																																																																																				0.627	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337854.1	NM_014583	
STT3B	201595	hgsc.bcm.edu	37	3	31666534	31666534	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:31666534C>T	ENST00000295770.2	+	12	2065	c.1856C>T	c.(1855-1857)aCg>aTg	p.T619M		NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	619					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)	p.T619M(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						AATAGAACTACGTTGGTGGAT	0.383																																					p.T619M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1856T	3						.						174.0	176.0	175.0					3																	31666534		2203	4300	6503	31641538	SO:0001583	missense	201595	exon12			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.1856C>T	3.37:g.31666534C>T	ENSP00000295770:p.Thr619Met		31641538	NM_178862	Q96JZ4|Q96KY7	Missense_Mutation	SNP	ENST00000295770.2	37	CCDS2650.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.694655	0.88830	.	.	ENSG00000163527	ENST00000295770	D	0.89810	-2.57	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.96228	0.8770	H	0.94658	3.565	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97379	0.9981	10	0.87932	D	0	-14.1677	18.566	0.91116	0.0:1.0:0.0:0.0	.	619	Q8TCJ2	STT3B_HUMAN	M	619	ENSP00000295770:T619M	ENSP00000295770:T619M	T	+	2	0	STT3B	31641538	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	6.008000	0.70739	2.464000	0.83262	0.313000	0.20887	ACG		0.383	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253166.2	NM_178862	
LRRFIP2	9209	hgsc.bcm.edu	37	3	37170568	37170568	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:37170568G>A	ENST00000336686.4	-	3	243	c.163C>T	c.(163-165)Cga>Tga	p.R55*	LRRFIP2_ENST00000354379.4_Nonsense_Mutation_p.R55*|LRRFIP2_ENST00000421276.2_Nonsense_Mutation_p.R55*|LRRFIP2_ENST00000440230.1_Nonsense_Mutation_p.R55*|LRRFIP2_ENST00000396428.2_Nonsense_Mutation_p.R55*|LRRFIP2_ENST00000421307.1_Nonsense_Mutation_p.R55*			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	55	DVL3-binding.				Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.R55*(1)|p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						TTTTGTTGTCGTTCCAGTTCT	0.423																																					p.R55X												.	.	2	Substitution - Nonsense(1)|Whole gene deletion(1)	ovary(1)|large_intestine(1)	c.C163T	3						.						175.0	175.0	175.0					3																	37170568		2203	4300	6503	37145572	SO:0001587	stop_gained	9209	exon4			AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.163C>T	3.37:g.37170568G>A	ENSP00000338727:p.Arg55*		37145572	NM_017724	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Nonsense_Mutation	SNP	ENST00000336686.4	37	CCDS2664.1	.	.	.	.	.	.	.	.	.	.	G	37	6.283895	0.97440	.	.	ENSG00000093167	ENST00000421307;ENST00000354379;ENST00000336686;ENST00000421276;ENST00000396428;ENST00000440230;ENST00000416425;ENST00000438374;ENST00000434749;ENST00000436858;ENST00000452742	.	.	.	5.47	5.47	0.80525	.	0.060923	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.3735	19.2964	0.94124	0.0:0.0:1.0:0.0	.	.	.	.	X	55	.	ENSP00000338727:R55X	R	-	1	2	LRRFIP2	37145572	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.341000	0.59335	2.729000	0.93468	0.655000	0.94253	CGA		0.423	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253335.3	NM_006309	
ZNF620	253639	hgsc.bcm.edu	37	3	40553908	40553908	+	Missense_Mutation	SNP	C	C	T	rs199758819		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:40553908C>T	ENST00000314529.6	+	4	316	c.167C>T	c.(166-168)aCg>aTg	p.T56M	ZNF620_ENST00000418905.1_Intron	NM_175888.3	NP_787084.1	Q6ZNG0	ZN620_HUMAN	zinc finger protein 620	56	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T56M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(1)|urinary_tract(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CCATTCACCACGCCTGTTCTG	0.557													c|||	1	0.000199681	0.0	0.0014	5008	,	,		18059	0.0		0.0	False		,,,				2504	0.0				p.T56M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C167T	3						.	C	MET/THR	0,4406		0,0,2203	80.0	78.0	79.0		167	1.3	0.3	3		79	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF620	NM_175888.2	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	56/423	40553908	1,13005	2203	4300	6503	40528912	SO:0001583	missense	253639	exon4			AK093599	CCDS33740.1, CCDS58825.1	3p21.33	2013-01-08			ENSG00000177842	ENSG00000177842		"""Zinc fingers, C2H2-type"", ""-"""	28742	protein-coding gene	gene with protein product						12477932	Standard	NM_175888		Approved	MGC50836	uc003ckk.4	Q6ZNG0	OTTHUMG00000156044	ENST00000314529.6:c.167C>T	3.37:g.40553908C>T	ENSP00000322265:p.Thr56Met		40528912	NM_175888	Q8N223	Missense_Mutation	SNP	ENST00000314529.6	37	CCDS33740.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	9.781	1.175389	0.21704	0.0	1.16E-4	ENSG00000177842	ENST00000420891;ENST00000314529	T;T	0.00816	5.66;5.66	2.19	1.3	0.21679	Krueppel-associated box (3);	.	.	.	.	T	0.00552	0.0018	N	0.13272	0.32	0.50813	D	0.999896	P	0.43287	0.802	B	0.32211	0.142	T	0.74231	-0.3732	9	0.87932	D	0	.	3.4816	0.07605	0.1657:0.3014:0.5329:0.0	.	56	Q6ZNG0	ZN620_HUMAN	M	56	ENSP00000406156:T56M;ENSP00000322265:T56M	ENSP00000322265:T56M	T	+	2	0	ZNF620	40528912	0.000000	0.05858	0.326000	0.25389	0.184000	0.23303	-0.244000	0.08903	0.464000	0.27142	-0.357000	0.07601	ACG		0.557	ZNF620-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342824.1	XM_171060	
LZTFL1	54585	hgsc.bcm.edu	37	3	45877152	45877152	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:45877152G>A	ENST00000296135.6	-	3	427	c.253C>T	c.(253-255)Cga>Tga	p.R85*	LZTFL1_ENST00000539217.1_Nonsense_Mutation_p.R81*|LZTFL1_ENST00000490463.1_5'UTR|LZTFL1_ENST00000536047.1_Nonsense_Mutation_p.R68*	NM_001276378.1|NM_020347.2	NP_001263307.1|NP_065080.1	Q9NQ48	LZTL1_HUMAN	leucine zipper transcription factor-like 1	85					establishment of protein localization to organelle (GO:0072594)	BBSome (GO:0034464)|cytoplasm (GO:0005737)	identical protein binding (GO:0042802)	p.R85*(1)		endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	8				BRCA - Breast invasive adenocarcinoma(193;0.00867)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		AACAGCTGTCGCAGAAGTAAC	0.418																																					p.R85X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C253T	3						.						134.0	118.0	124.0					3																	45877152		2203	4300	6503	45852156	SO:0001587	stop_gained	54585	exon3			AJ297351	CCDS2731.1, CCDS63608.1, CCDS63609.1	3p21.3	2014-01-28			ENSG00000163818	ENSG00000163818			6741	protein-coding gene	gene with protein product		606568				11352561, 22510444	Standard	NM_020347		Approved	BBS17	uc003cox.2	Q9NQ48	OTTHUMG00000133452	ENST00000296135.6:c.253C>T	3.37:g.45877152G>A	ENSP00000296135:p.Arg85*		45852156	NM_020347	B3KSI9|B4E0K7|Q8TC61|Q9NQ56	Nonsense_Mutation	SNP	ENST00000296135.6	37	CCDS2731.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.172332|10.172332	0.99352|0.99352	.|.	.|.	ENSG00000163818|ENSG00000163818	ENST00000440576|ENST00000296135;ENST00000536047;ENST00000539217;ENST00000445698	.|.	.|.	.|.	5.87|5.87	3.08|3.08	0.35506|0.35506	.|.	.|0.105066	.|0.64402	.|D	.|0.000003	T|.	0.21841|.	0.0526|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35375|.	-0.9791|.	3|.	.|0.02654	.|T	.|1	-0.8072|-0.8072	8.3256|8.3256	0.32156|0.32156	0.1329:0.0:0.7392:0.128|0.1329:0.0:0.7392:0.128	.|.	.|.	.|.	.|.	V|X	42|85;68;81;68	.|.	.|ENSP00000296135:R85X	A|R	-|-	2|1	0|2	LZTFL1|LZTFL1	45852156|45852156	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.991000|0.991000	0.79684|0.79684	3.084000|3.084000	0.50143|0.50143	0.369000|0.369000	0.24510|0.24510	-0.136000|-0.136000	0.14681|0.14681	GCG|CGA		0.418	LZTFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257326.3	NM_020347	
MAP4	4134	hgsc.bcm.edu	37	3	47912398	47912398	+	Missense_Mutation	SNP	G	G	A	rs554984915		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:47912398G>A	ENST00000360240.6	-	13	3282	c.2764C>T	c.(2764-2766)Cgc>Tgc	p.R922C	MAP4_ENST00000420772.2_Missense_Mutation_p.R653C|MAP4_ENST00000264724.11_Missense_Mutation_p.R657C|MAP4_ENST00000383737.4_Missense_Mutation_p.R650C|MAP4_ENST00000462206.1_5'Flank|MAP4_ENST00000395734.3_Missense_Mutation_p.R922C|MAP4_ENST00000441748.2_Missense_Mutation_p.R74C|MAP4_ENST00000426837.2_Missense_Mutation_p.R2067C	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	922					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)	p.R922C(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	GTGGCCAGGCGGCTGAGCCGG	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16771	0.0		0.0	False		,,,				2504	0.0				p.R922C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2764T	3						.						58.0	67.0	64.0					3																	47912398		2203	4300	6503	47887402	SO:0001583	missense	4134	exon13				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.2764C>T	3.37:g.47912398G>A	ENSP00000353375:p.Arg922Cys		47887402	NM_001134364	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	ENST00000360240.6	37	CCDS33750.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.07|19.07	3.756724|3.756724	0.69648|0.69648	.|.	.|.	ENSG00000047849|ENSG00000047849	ENST00000429422|ENST00000383737;ENST00000264724;ENST00000395734;ENST00000426837;ENST00000360240;ENST00000420772;ENST00000335271;ENST00000441748;ENST00000383736	.|T;T;T;T;T;T;T;T	.|0.36340	.|2.78;1.26;2.93;3.04;2.92;1.98;1.99;1.3	5.13|5.13	5.13|5.13	0.70059|0.70059	.|.	.|.	.|.	.|.	.|.	T|T	0.52240|0.52240	0.1722|0.1722	L|L	0.47190|0.47190	1.495|1.495	0.35287|0.35287	D|D	0.781836|0.781836	.|D;D;D;D;D;P;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;0.926;0.999	.|D;D;D;D;D;B;D	.|0.97110	.|0.998;0.998;1.0;0.996;0.996;0.218;0.986	T|T	0.62487|0.62487	-0.6844|-0.6844	5|9	.|0.87932	.|D	.|0	-6.7134|-6.7134	12.7914|12.7914	0.57537|0.57537	0.0:0.0:0.8366:0.1634|0.0:0.0:0.8366:0.1634	.|.	.|653;657;922;922;657;650;2067	.|F8W9U4;P27816-4;P27816-6;P27816;E9PGM5;B9ZVR1;E7EVA0	.|.;.;.;MAP4_HUMAN;.;.;.	L|C	332|650;657;922;2067;922;653;288;74;657	.|ENSP00000373243:R650C;ENSP00000264724:R657C;ENSP00000379083:R922C;ENSP00000407602:R2067C;ENSP00000353375:R922C;ENSP00000409731:R653C;ENSP00000334770:R288C;ENSP00000415130:R74C	.|ENSP00000264724:R657C	P|R	-|-	2|1	0|0	MAP4|MAP4	47887402|47887402	.|.	.|.	0.998000|0.998000	0.56505|0.56505	0.889000|0.889000	0.51656|0.51656	.|.	.|.	2.663000|2.663000	0.90544|0.90544	0.655000|0.655000	0.94253|0.94253	CCG|CGC		0.612	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375	
POC1A	25886	hgsc.bcm.edu	37	3	52183891	52183891	+	Silent	SNP	C	C	T	rs543539287		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:52183891C>T	ENST00000296484.2	-	3	255	c.216G>A	c.(214-216)tcG>tcA	p.S72S	POC1A_ENST00000394970.2_Silent_p.S72S|POC1A_ENST00000474012.1_Silent_p.S34S	NM_015426.4	NP_056241.3	Q8NBT0	POC1A_HUMAN	POC1 centriolar protein A	72					cell projection organization (GO:0030030)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)		p.S72S(1)		endometrium(1)|large_intestine(4)|liver(1)|lung(4)|prostate(3)|skin(1)	14						GCAGGTGTCCCGAAGGAGAGA	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		20927	0.0		0.0	False		,,,				2504	0.001				p.S34S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G102A	3						.						109.0	96.0	101.0					3																	52183891		2203	4300	6503	52158931	SO:0001819	synonymous_variant	25886	exon3			AL117629	CCDS2846.1, CCDS54591.1, CCDS54592.1	3p21.2	2014-05-02	2013-08-21	2010-03-26	ENSG00000164087	ENSG00000164087		"""WD repeat domain containing"""	24488	protein-coding gene	gene with protein product		614783	"""WD repeat domain 51A"", ""POC1 centriolar protein homolog A (Chlamydomonas)"""	WDR51A		19109428, 22840364	Standard	NM_015426		Approved	DKFZP434C245	uc003dcu.3	Q8NBT0	OTTHUMG00000157817	ENST00000296484.2:c.216G>A	3.37:g.52183891C>T			52158931	NM_001161581	A4FUW4|E9PFC6|Q0VDF8|Q2TAK6|Q96IK6|Q9UFJ8	Silent	SNP	ENST00000296484.2	37	CCDS2846.1																																																																																				0.582	POC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349685.1	NM_015426	
PBRM1	55193	hgsc.bcm.edu	37	3	52588777	52588777	+	Silent	SNP	C	C	T	rs537850469		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:52588777C>T	ENST00000296302.7	-	27	4573	c.4572G>A	c.(4570-4572)ccG>ccA	p.P1524P	RNU6-856P_ENST00000516959.1_RNA|PBRM1_ENST00000356770.4_Silent_p.P1437P|PBRM1_ENST00000337303.4_Intron|PBRM1_ENST00000409114.3_Intron|PBRM1_ENST00000409057.1_Silent_p.P1469P|PBRM1_ENST00000394830.3_Silent_p.P1417P|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000409767.1_Intron|PBRM1_ENST00000410007.1_Silent_p.P1444P			Q86U86	PB1_HUMAN	polybromo 1	1524	Pro-rich.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.P1437P(1)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GCACACCTGGCGGAAGATGGT	0.567			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""								C|||	1	0.000199681	0.0	0.0	5008	,	,		21143	0.0		0.0	False		,,,				2504	0.001				p.P1417P			Rec	yes		3	3p21	55193	polybromo 1		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4251A	3						.						44.0	44.0	44.0					3																	52588777		2203	4300	6503	52563817	SO:0001819	synonymous_variant	55193	exon27			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4572G>A	3.37:g.52588777C>T			52563817	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Silent	SNP	ENST00000296302.7	37																																																																																					0.567	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
ITIH1	3697	hgsc.bcm.edu	37	3	52818391	52818391	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:52818391C>T	ENST00000273283.2	+	11	1329	c.1305C>T	c.(1303-1305)ttC>ttT	p.F435F	ITIH1_ENST00000537050.1_Silent_p.F147F|ITIH1_ENST00000542827.1_Silent_p.F435F|ITIH1_ENST00000540715.1_Silent_p.F293F	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	435	Hyaluronan-binding.|VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.F435F(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		ACCTGGGTTTCGGCCACAATG	0.582																																					p.F293F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C879T	3						.						92.0	83.0	86.0					3																	52818391		2203	4300	6503	52793431	SO:0001819	synonymous_variant	3697	exon9				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1305C>T	3.37:g.52818391C>T			52793431	NM_001166434	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Silent	SNP	ENST00000273283.2	37	CCDS2864.1																																																																																				0.582	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
GHSR	2693	hgsc.bcm.edu	37	3	172165538	172165540	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	GAA	GAA	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:172165538_172165540delGAA	ENST00000241256.2	-	1	706_708	c.664_666delTTC	c.(664-666)ttcdel	p.F222del	GHSR_ENST00000427970.1_In_Frame_Del_p.F222del	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	222					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)	p.F222delF(2)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			AGACAGGAAGGAAGAAGAAGATG	0.635																																					p.222_222del	Esophageal Squamous(93;641 1401 20883 29581 34638)											.	.	2	Deletion - In frame(2)	large_intestine(2)	c.664_666del	3						.																																			173648234	SO:0001651	inframe_deletion	2693	exon1			AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.664_666delTTC	3.37:g.172165544_172165546delGAA	ENSP00000241256:p.Phe222del		173648232	NM_198407	Q14D12|Q6ISR8|Q92848|Q96RJ7	In_Frame_Del	DEL	ENST00000241256.2	37	CCDS3218.1																																																																																				0.635	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346728.1	NM_004122	
PAK2	5062	hgsc.bcm.edu	37	3	196541368	196541368	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr3:196541368G>A	ENST00000327134.3	+	11	1304	c.982G>A	c.(982-984)Ggg>Agg	p.G328R		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	328	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		ATACCTTGCTGGGGGGTCACT	0.408																																					p.G328R												.	.	0			c.G982A	3						.						164.0	159.0	161.0					3																	196541368		2203	4300	6503	198025765	SO:0001583	missense	5062	exon11			U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.982G>A	3.37:g.196541368G>A	ENSP00000314067:p.Gly328Arg		198025765	NM_002577	Q13154|Q6ISC3	Missense_Mutation	SNP	ENST00000327134.3	37	CCDS3321.1	.	.	.	.	.	.	.	.	.	.	G	33	5.209725	0.95069	.	.	ENSG00000180370	ENST00000327134	T	0.18810	2.19	6.06	6.06	0.98353	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.53126	0.1777	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53049	-0.8493	10	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	328	Q13177	PAK2_HUMAN	R	328	ENSP00000314067:G328R	ENSP00000314067:G328R	G	+	1	0	PAK2	198025765	1.000000	0.71417	0.977000	0.42913	0.834000	0.47266	9.444000	0.97578	2.882000	0.98803	0.655000	0.94253	GGG		0.408	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
IGF1	3479	hgsc.bcm.edu	37	12	102813316	102813316	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:102813316G>A	ENST00000307046.8	-	3	554	c.373C>T	c.(373-375)Cgc>Tgc	p.R125C	IGF1_ENST00000456098.1_Missense_Mutation_p.R125C|IGF1_ENST00000337514.6_Missense_Mutation_p.R125C|IGF1_ENST00000392904.1_Missense_Mutation_p.R125C|IGF1_ENST00000424202.2_Missense_Mutation_p.R109C	NM_001111285.1	NP_001104755.1	P05019	IGF1_HUMAN	insulin-like growth factor 1 (somatomedin C)	125					blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|bone mineralization involved in bone maturation (GO:0035630)|branching morphogenesis of an epithelial tube (GO:0048754)|cell activation (GO:0001775)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|DNA replication (GO:0006260)|exocrine pancreas development (GO:0031017)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|glial cell differentiation (GO:0010001)|glycolate metabolic process (GO:0009441)|inner ear development (GO:0048839)|insulin-like growth factor receptor signaling pathway (GO:0048009)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mammary gland development (GO:0030879)|multicellular organism growth (GO:0035264)|muscle hypertrophy (GO:0014896)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|myoblast proliferation (GO:0051450)|myotube cell development (GO:0014904)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate gland growth (GO:0060736)|prostate gland stromal morphogenesis (GO:0060741)|proteoglycan biosynthetic process (GO:0030166)|Ras protein signal transduction (GO:0007265)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of multicellular organism growth (GO:0040014)|signal transduction (GO:0007165)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|skeletal system development (GO:0001501)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)|water homeostasis (GO:0030104)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|insulin-like growth factor binding protein complex (GO:0016942)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	hormone activity (GO:0005179)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|integrin binding (GO:0005178)	p.R125C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)	11						TCGGTGTGGCGCTGGGCACGG	0.602																																					p.R125C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C373T	12						.						88.0	86.0	87.0					12																	102813316		2203	4300	6503	101337446	SO:0001583	missense	3479	exon3			X00173	CCDS9091.1, CCDS44960.1, CCDS44961.1, CCDS44962.1	12q23.2	2014-09-16			ENSG00000017427	ENSG00000017427		"""Endogenous ligands"""	5464	protein-coding gene	gene with protein product		147440				2982726, 6358902	Standard	NM_001111283		Approved	IGF1A, IGFI, IGF-I	uc001tjp.4	P05019	OTTHUMG00000149910	ENST00000307046.8:c.373C>T	12.37:g.102813316G>A	ENSP00000302665:p.Arg125Cys		101337446	NM_001111285	B2RWM7|E9PD02|P01343|Q14620	Missense_Mutation	SNP	ENST00000307046.8	37	CCDS44962.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020883	0.93462	.	.	ENSG00000017427	ENST00000456098;ENST00000337514;ENST00000392904;ENST00000424202;ENST00000392905;ENST00000307046	D;D;D;D;D;D	0.97256	-4.3;-4.31;-4.3;-4.3;-4.28;-3.28	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.97841	0.9291	L	0.47716	1.5	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.993;0.993;0.997	D	0.98134	1.0432	10	0.54805	T	0.06	-3.7641	20.1731	0.98165	0.0:0.0:1.0:0.0	.	125;156;109;125	P05019;Q59GC5;Q14620;E9PD02	IGF1_HUMAN;.;.;.	C	125;125;125;109;106;125	ENSP00000394999:R125C;ENSP00000337612:R125C;ENSP00000376637:R125C;ENSP00000416811:R109C;ENSP00000376638:R106C;ENSP00000302665:R125C	ENSP00000302665:R125C	R	-	1	0	IGF1	101337446	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	9.383000	0.97214	2.768000	0.95171	0.655000	0.94253	CGC		0.602	IGF1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313855.1	NM_000618	
STAB2	55576	hgsc.bcm.edu	37	12	104109638	104109638	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:104109638C>T	ENST00000388887.2	+	43	4787	c.4583C>T	c.(4582-4584)gCg>gTg	p.A1528V		NM_017564.9	NP_060034.9			stabilin 2									p.A1528V(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GACAAGAATGCGGAGTGCACA	0.502																																					p.A1528V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4583T	12						.						108.0	108.0	108.0					12																	104109638		2203	4300	6503	102633768	SO:0001583	missense	55576	exon43			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4583C>T	12.37:g.104109638C>T	ENSP00000373539:p.Ala1528Val		102633768	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.987193	0.93106	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	D	0.97710	-4.5	5.95	5.95	0.96441	EGF domain, merozoite surface protein 1-like (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.98305	0.9438	L	0.54965	1.715	0.44985	D	0.998009	D	0.89917	1.0	D	0.91635	0.999	D	0.99406	1.0929	10	0.87932	D	0	.	18.5737	0.91147	0.0:1.0:0.0:0.0	.	1528	Q8WWQ8	STAB2_HUMAN	V	1528;215	ENSP00000373539:A1528V	ENSP00000258495:A215V	A	+	2	0	STAB2	102633768	1.000000	0.71417	0.974000	0.42286	0.891000	0.51852	5.894000	0.69806	2.824000	0.97209	0.655000	0.94253	GCG		0.502	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
RNF10	9921	hgsc.bcm.edu	37	12	121001289	121001289	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:121001289A>C	ENST00000325954.4	+	9	1855	c.1394A>C	c.(1393-1395)gAg>gCg	p.E465A	RNF10_ENST00000413266.2_Missense_Mutation_p.E470A	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	465					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E465A(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGTTGCCAGAGGCCTGTGAT	0.522																																					p.E465A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1394C	12						.						76.0	74.0	75.0					12																	121001289		2203	4300	6503	119485672	SO:0001583	missense	9921	exon9			AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.1394A>C	12.37:g.121001289A>C	ENSP00000322242:p.Glu465Ala		119485672	NM_014868	Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	37	CCDS9201.1	.	.	.	.	.	.	.	.	.	.	A	18.80	3.701179	0.68501	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266;ENST00000540046	T;T	0.47177	0.85;0.85	5.88	1.99	0.26369	.	0.485319	0.21102	N	0.080148	T	0.23451	0.0567	N	0.15975	0.35	0.46185	D	0.998916	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.05273	-1.0895	10	0.11182	T	0.66	.	6.1471	0.20291	0.7237:0.1352:0.1412:0.0	.	470;465	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	A	465;465;470;11	ENSP00000322242:E465A;ENSP00000415682:E470A	ENSP00000322242:E465A	E	+	2	0	RNF10	119485672	1.000000	0.71417	0.992000	0.48379	0.972000	0.66771	1.937000	0.40193	0.453000	0.26858	-0.280000	0.10049	GAG		0.522	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4		
CHD4	1108	hgsc.bcm.edu	37	12	6700689	6700689	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:6700689G>A	ENST00000357008.2	-	22	3446	c.3283C>T	c.(3283-3285)Cgc>Tgc	p.R1095C	CHD4_ENST00000544040.1_Missense_Mutation_p.R1088C|CHD4_ENST00000544484.1_Missense_Mutation_p.R1092C|CHD4_ENST00000309577.6_Missense_Mutation_p.R1095C	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1095	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.R1095C(1)		central_nervous_system(2)	2						CCATCGATGCGTTCGTATTTA	0.443																																					p.R1095C	Colon(32;586 792 4568 16848 45314)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3283T	12						.						215.0	184.0	195.0					12																	6700689		2203	4300	6503	6570950	SO:0001583	missense	1108	exon22			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3283C>T	12.37:g.6700689G>A	ENSP00000349508:p.Arg1095Cys		6570950	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481226	0.63849	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42	5.15	5.15	0.70609	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.98510	0.9503	H	0.99238	4.48	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.992	D	0.99289	1.0898	10	0.87932	D	0	.	14.369	0.66826	0.0:0.0:0.8515:0.1485	.	1095;1095;1088	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	C	1092;1088;1095;1095;1069	ENSP00000440392:R1092C;ENSP00000440542:R1088C;ENSP00000312419:R1095C;ENSP00000349508:R1095C	ENSP00000312419:R1095C	R	-	1	0	CHD4	6570950	1.000000	0.71417	1.000000	0.80357	0.612000	0.37316	5.624000	0.67764	2.409000	0.81822	0.655000	0.94253	CGC		0.443	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
LRRC23	10233	hgsc.bcm.edu	37	12	7021957	7021957	+	Silent	SNP	G	G	A	rs3759353		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:7021957G>A	ENST00000007969.8	+	7	1042	c.822G>A	c.(820-822)gcG>gcA	p.A274A	ENO2_ENST00000545045.2_5'Flank|LRRC23_ENST00000436789.1_Intron|ENO2_ENST00000544774.1_5'Flank|ENO2_ENST00000541477.1_5'Flank|LRRC23_ENST00000323702.5_Intron|ENO2_ENST00000535366.1_5'Flank|ENO2_ENST00000229277.1_5'Flank|ENO2_ENST00000538763.1_5'Flank|LRRC23_ENST00000429740.1_Intron|LRRC23_ENST00000443597.2_Silent_p.A274A	NM_001135217.1|NM_201650.2	NP_001128689.1|NP_964013.1	Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23	274								p.A274A(2)		NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						AGCTGCGAGCGTTGGTGCTGC	0.587													G|||	234	0.0467252	0.0	0.0	5008	,	,		-128	0.2163		0.0	False		,,,				2504	0.0164				p.A274A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)	c.G822A	12						.	G	,,	4,4402	8.1+/-20.4	0,4,2199	106.0	102.0	103.0		822,,822	-2.4	0.1	12	dbSNP_107	103	0,8600		0,0,4300	no	coding-synonymous,intron,coding-synonymous	LRRC23	NM_001135217.1,NM_006992.3,NM_201650.2	,,	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	,,	274/344,,274/344	7021957	4,13002	2203	4300	6503	6892218	SO:0001819	synonymous_variant	10233	exon7			BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000007969.8:c.822G>A	12.37:g.7021957G>A			6892218	NM_001135217	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	Silent	SNP	ENST00000007969.8	37	CCDS8569.1																																																																																				0.587	LRRC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345214.1	NM_006992	
CLSTN3	9746	hgsc.bcm.edu	37	12	7310123	7310123	+	Missense_Mutation	SNP	G	G	A	rs138735435	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:7310123G>A	ENST00000266546.6	+	17	3016	c.2566G>A	c.(2566-2568)Gtg>Atg	p.V856M	CLSTN3_ENST00000537408.1_Missense_Mutation_p.V868M|CLSTN3_ENST00000331148.5_3'UTR	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	856					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)	p.V856M(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						TGTGGTGTGCGTGGGCTTCCT	0.667													G|||	2	0.000399361	0.0	0.0	5008	,	,		-128	0.0		0.002	False		,,,				2504	0.0				p.V856M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2566A	12						.	G	MET/VAL	0,4406		0,0,2203	68.0	56.0	60.0		2566	4.7	1.0	12	dbSNP_134	60	5,8595	4.3+/-15.6	0,5,4295	yes	missense	CLSTN3	NM_014718.3	21	0,5,6498	AA,AG,GG		0.0581,0.0,0.0384	probably-damaging	856/957	7310123	5,13001	2203	4300	6503	7201390	SO:0001583	missense	9746	exon17			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2566G>A	12.37:g.7310123G>A	ENSP00000266546:p.Val856Met		7201390	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	37	CCDS8575.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	18.02	3.529693	0.64860	0.0	5.81E-4	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.36520	1.25;1.25	4.72	4.72	0.59763	.	0.076637	0.52532	D	0.000072	T	0.56673	0.2001	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;0.994;1.0	D;P;D	0.80764	0.994;0.739;0.981	T	0.58719	-0.7587	10	0.66056	D	0.02	-29.9301	11.693	0.51527	0.0816:0.0:0.9184:0.0	.	198;868;856	Q8IUW6;Q5UE57;Q9BQT9	.;.;CSTN3_HUMAN	M	856;868	ENSP00000266546:V856M;ENSP00000440679:V868M	ENSP00000266546:V856M	V	+	1	0	CLSTN3	7201390	1.000000	0.71417	0.992000	0.48379	0.337000	0.28794	7.805000	0.86005	2.619000	0.88677	0.462000	0.41574	GTG		0.667	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
RAPGEF3	10411	hgsc.bcm.edu	37	12	48143716	48143716	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:48143716C>T	ENST00000449771.2	-	8	902	c.814G>A	c.(814-816)Gtg>Atg	p.V272M	RAPGEF3_ENST00000171000.4_Missense_Mutation_p.V230M|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.V230M|RAPGEF3_ENST00000548919.1_Missense_Mutation_p.V230M|RAPGEF3_ENST00000549347.1_5'Flank|RAPGEF3_ENST00000395358.3_Missense_Mutation_p.V272M|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.V272M|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.V230M			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	272					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)	p.V230M(2)		endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		GACTTACACACGGTCCCTGCC	0.567																																					p.V230M												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.G688A	12						.						253.0	249.0	250.0					12																	48143716		2203	4300	6503	46429983	SO:0001583	missense	10411	exon7			AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.814G>A	12.37:g.48143716C>T	ENSP00000395708:p.Val272Met		46429983	NM_001098532	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	37	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971730	0.74246	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919;ENST00000395358	D;D;D;D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37;-3.37;-3.37;-3.37	3.86	3.86	0.44501	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.64402	D	0.000001	D	0.96049	0.8713	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.914;0.995;0.999	D	0.96234	0.9170	10	0.87932	D	0	.	14.1261	0.65222	0.0:1.0:0.0:0.0	.	284;272;272	B7Z5J6;O95398-2;O95398	.;.;RPGF3_HUMAN	M	230;272;230;230;230;272;284;230;272	ENSP00000384521:V230M;ENSP00000395708:V272M;ENSP00000448619:V230M;ENSP00000171000:V230M;ENSP00000373864:V272M;ENSP00000448480:V230M;ENSP00000378764:V272M	ENSP00000171000:V230M	V	-	1	0	RAPGEF3	46429983	0.999000	0.42202	0.975000	0.42487	0.845000	0.48019	4.241000	0.58707	2.445000	0.82738	0.643000	0.83706	GTG		0.567	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	NM_006105	
SMARCD1	6602	hgsc.bcm.edu	37	12	50492581	50492581	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:50492581C>T	ENST00000394963.4	+	12	1875	c.1477C>T	c.(1477-1479)Cga>Tga	p.R493*	SMARCD1_ENST00000381513.4_Nonsense_Mutation_p.R452*|SMARCD1_ENST00000548573.1_Nonsense_Mutation_p.R291*	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1									p.R454*(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						GGCTGTGTGCCGATACTTCTA	0.547																																					p.R452X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1354T	12						.						80.0	74.0	76.0					12																	50492581		2203	4300	6503	48778848	SO:0001587	stop_gained	6602	exon11			U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.1477C>T	12.37:g.50492581C>T	ENSP00000378414:p.Arg493*		48778848	NM_139071		Nonsense_Mutation	SNP	ENST00000394963.4	37	CCDS8797.2	.	.	.	.	.	.	.	.	.	.	C	39	7.484102	0.98312	.	.	ENSG00000066117	ENST00000394963;ENST00000381513;ENST00000542914;ENST00000548573	.	.	.	5.12	2.06	0.26882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.1051	10.0006	0.41927	0.311:0.615:0.0:0.074	.	.	.	.	X	493;452;269;291	.	ENSP00000370924:R452X	R	+	1	2	SMARCD1	48778848	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	1.708000	0.37899	0.829000	0.34733	0.591000	0.81541	CGA		0.547	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316759.2	NM_003076	
SLC4A8	9498	hgsc.bcm.edu	37	12	51883494	51883494	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:51883494G>A	ENST00000453097.2	+	19	2676	c.2459G>A	c.(2458-2460)gGc>gAc	p.G820D	SLC4A8_ENST00000358657.3_Missense_Mutation_p.G847D	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8									p.G820D(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		AAAGGCTGTGGCTACCACCTG	0.537																																					p.G820D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2459A	12						.						138.0	112.0	121.0					12																	51883494		2203	4300	6503	50169761	SO:0001583	missense	9498	exon19			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.2459G>A	12.37:g.51883494G>A	ENSP00000405812:p.Gly820Asp		50169761	NM_001039960		Missense_Mutation	SNP	ENST00000453097.2	37	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.666055	0.88251	.	.	ENSG00000050438	ENST00000358657;ENST00000453097;ENST00000319957;ENST00000551071	D;D	0.89746	-2.56;-2.56	4.77	4.77	0.60923	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96380	0.8819	H	0.96430	3.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.97623	1.0137	10	0.87932	D	0	.	17.4385	0.87559	0.0:0.0:1.0:0.0	.	847;820;820	Q2Y0W8-2;Q2Y0W8;Q2Y0W8-3	.;S4A8_HUMAN;.	D	847;820;820;767	ENSP00000351483:G847D;ENSP00000405812:G820D	ENSP00000315789:G820D	G	+	2	0	SLC4A8	50169761	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.574000	0.86865	0.491000	0.48974	GGC		0.537	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858	
ESPL1	9700	hgsc.bcm.edu	37	12	53664562	53664562	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:53664562C>T	ENST00000257934.4	+	5	1440	c.1349C>T	c.(1348-1350)aCg>aTg	p.T450M	ESPL1_ENST00000552462.1_Missense_Mutation_p.T450M	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	450					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.T450M(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						CAAGAGCTGACGGACCACATG	0.552																																					p.T450M	Colon(53;1069 1201 2587 5382)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1349T	12						.						121.0	102.0	109.0					12																	53664562		2203	4300	6503	51950829	SO:0001583	missense	9700	exon5			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.1349C>T	12.37:g.53664562C>T	ENSP00000257934:p.Thr450Met		51950829	NM_012291		Missense_Mutation	SNP	ENST00000257934.4	37	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.731439	0.48939	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.12672	2.66;2.66	4.95	4.06	0.47325	.	0.374898	0.25798	N	0.028234	T	0.20780	0.0500	L	0.60455	1.87	0.19775	N	0.999958	D	0.71674	0.998	P	0.50791	0.65	T	0.06534	-1.0821	10	0.87932	D	0	.	9.3877	0.38354	0.0:0.9034:0.0:0.0966	.	450	Q14674	ESPL1_HUMAN	M	450;125;450	ENSP00000257934:T450M;ENSP00000449831:T450M	ENSP00000257934:T450M	T	+	2	0	ESPL1	51950829	0.240000	0.23847	0.405000	0.26409	0.542000	0.35054	0.917000	0.28665	1.325000	0.45301	-0.221000	0.12465	ACG		0.552	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
SHMT2	6472	hgsc.bcm.edu	37	12	57627815	57627815	+	Missense_Mutation	SNP	C	C	T	rs371444119		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:57627815C>T	ENST00000328923.3	+	11	1761	c.1309C>T	c.(1309-1311)Cgt>Tgt	p.R437C	SHMT2_ENST00000414700.3_Missense_Mutation_p.R416C|SHMT2_ENST00000393827.4_Missense_Mutation_p.R341C|SHMT2_ENST00000449049.3_Missense_Mutation_p.R416C|SHMT2_ENST00000553474.1_Missense_Mutation_p.R416C|SHMT2_ENST00000557487.1_Missense_Mutation_p.R427C	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	437					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)	p.R437C(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	TCGACAGTTCCGTGAGGATGA	0.557																																					p.R416C	Esophageal Squamous(150;1369 2416 49071 49364)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1246T	12						.	C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	93.0	90.0	91.0		1279,1246,1246,1246,1309	5.0	1.0	12		91	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	SHMT2	NM_001166356.1,NM_001166357.1,NM_001166358.1,NM_001166359.1,NM_005412.5	180,180,180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	427/495,416/484,416/484,416/484,437/505	57627815	1,13005	2203	4300	6503	55914082	SO:0001583	missense	6472	exon11			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.1309C>T	12.37:g.57627815C>T	ENSP00000333667:p.Arg437Cys		55914082	NM_001166359	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	37	CCDS8934.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.6|21.6	4.173435|4.173435	0.78452|0.78452	0.0|0.0	1.16E-4|1.16E-4	ENSG00000182199|ENSG00000182199	ENST00000557529|ENST00000328923;ENST00000557487;ENST00000414700;ENST00000553474;ENST00000449049;ENST00000393827	.|T;T;T;T;T;T	.|0.44881	.|1.52;0.91;1.52;1.52;1.52;0.91	4.98|4.98	4.98|4.98	0.66077|0.66077	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.133377	.|0.49305	.|D	.|0.000159	T|T	0.56615|0.56615	0.1997|0.1997	L|L	0.59436|0.59436	1.845|1.845	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D;D;P	.|0.67145	.|0.996;0.981;0.993;0.99;0.918	.|D;P;P;P;P	.|0.63488	.|0.915;0.806;0.779;0.86;0.606	T|T	0.57659|0.57659	-0.7773|-0.7773	5|10	.|0.56958	.|D	.|0.05	-11.5438|-11.5438	12.5178|12.5178	0.56042|0.56042	0.1671:0.8329:0.0:0.0|0.1671:0.8329:0.0:0.0	.|.	.|446;427;341;368;437	.|B4DWA7;Q8N1A5;B4DLV4;B4DP88;P34897	.|.;.;.;.;GLYM_HUMAN	L|C	236|437;427;416;416;416;341	.|ENSP00000333667:R437C;ENSP00000452315:R427C;ENSP00000406881:R416C;ENSP00000452419:R416C;ENSP00000413770:R416C;ENSP00000377413:R341C	.|ENSP00000333667:R437C	P|R	+|+	2|1	0|0	SHMT2|SHMT2	55914082|55914082	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.693000|2.693000	0.47027|0.47027	2.485000|2.485000	0.83878|0.83878	0.655000|0.655000	0.94253|0.94253	CCG|CGT		0.557	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
HELB	92797	hgsc.bcm.edu	37	12	66712428	66712428	+	Missense_Mutation	SNP	C	C	T	rs143522796	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:66712428C>T	ENST00000247815.4	+	7	2070	c.2011C>T	c.(2011-2013)Cgc>Tgc	p.R671C		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	671					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)	p.R671C(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		AATCTCAAGACGCCAATTTCC	0.313													C|||	6	0.00119808	0.003	0.0	5008	,	,		16420	0.002		0.0	False		,,,				2504	0.0				p.R671C												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.C2011T	12						.	C	CYS/ARG	16,4390	22.3+/-47.3	0,16,2187	99.0	103.0	102.0		2011	4.4	1.0	12	dbSNP_134	102	2,8598	2.2+/-6.3	0,2,4298	yes	missense	HELB	NM_033647.2	180	0,18,6485	TT,TC,CC		0.0233,0.3631,0.1384	probably-damaging	671/1088	66712428	18,12988	2203	4300	6503	64998695	SO:0001583	missense	92797	exon7			AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.2011C>T	12.37:g.66712428C>T	ENSP00000247815:p.Arg671Cys		64998695	NM_033647	A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	ENST00000247815.4	37	CCDS8976.1	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	C	10.68	1.417678	0.25552	0.003631	2.33E-4	ENSG00000127311	ENST00000247815	T	0.45276	0.9	5.26	4.36	0.52297	.	0.170193	0.39475	N	0.001342	T	0.37598	0.1009	L	0.59436	1.845	0.45899	D	0.99874	B	0.34255	0.445	B	0.28465	0.09	T	0.19976	-1.0289	9	.	.	.	-8.2078	14.5379	0.67973	0.0:0.9286:0.0:0.0714	.	671	Q8NG08	HELB_HUMAN	C	671	ENSP00000247815:R671C	.	R	+	1	0	HELB	64998695	0.780000	0.28664	0.967000	0.41034	0.195000	0.23768	3.328000	0.52052	1.355000	0.45865	0.655000	0.94253	CGC		0.313	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401919.1		
CPSF6	11052	hgsc.bcm.edu	37	12	69656329	69656329	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:69656329G>A	ENST00000435070.2	+	9	1756	c.1646G>A	c.(1645-1647)cGt>cAt	p.R549H	CPSF6_ENST00000551516.1_Missense_Mutation_p.V52I|CPSF6_ENST00000456847.3_Missense_Mutation_p.R476H|CPSF6_ENST00000266679.8_Missense_Mutation_p.R586H	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	549	Arg-rich.|Sufficient for nuclear targeting.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R549H(2)		endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			cgCGAATATCGTCATCGTTAG	0.463																																					p.R549H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1646A	12						.						197.0	133.0	155.0					12																	69656329		2203	4300	6503	67942596	SO:0001583	missense	11052	exon9			X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1646G>A	12.37:g.69656329G>A	ENSP00000391774:p.Arg549His		67942596	NM_007007	A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	ENST00000435070.2	37	CCDS8988.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.8|22.8	4.338002|4.338002	0.81911|0.81911	.|.	.|.	ENSG00000111605|ENSG00000111605	ENST00000435070;ENST00000456847;ENST00000266679|ENST00000551516	T;T;T|.	0.72282|.	-0.64;-0.64;-0.64|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67239|0.67239	0.2872|0.2872	L|L	0.52573|0.52573	1.65|1.65	0.34948|0.34948	D|D	0.750948|0.750948	P;D;D|.	0.64830|.	0.925;0.994;0.989|.	B;P;B|.	0.48488|.	0.381;0.579;0.375|.	T|T	0.69049|0.69049	-0.5248|-0.5248	9|5	.|.	.|.	.|.	-9.6562|-9.6562	19.9374|19.9374	0.97146|0.97146	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	298;586;549|.	B4DSU9;Q16630-2;Q16630|.	.;.;CPSF6_HUMAN|.	H|I	549;476;586|52	ENSP00000391774:R549H;ENSP00000391437:R476H;ENSP00000266679:R586H|.	.|.	R|V	+|+	2|1	0|0	CPSF6|CPSF6	67942596|67942596	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.869000|9.869000	0.99810|0.99810	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	CGT|GTC		0.463	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403609.1	NM_007007	
ACSS3	79611	hgsc.bcm.edu	37	12	81593216	81593216	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:81593216G>A	ENST00000548058.1	+	9	2257	c.1347G>A	c.(1345-1347)tgG>tgA	p.W449*	ACSS3_ENST00000261206.3_Nonsense_Mutation_p.W448*|ACSS3_ENST00000548324.1_Nonsense_Mutation_p.W131*			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	449						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)	p.W449*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						ACCATTGGTGGCAAACTGGTA	0.408																																					p.W449X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1347A	12						.						79.0	74.0	75.0					12																	81593216		2203	4300	6503	80117347	SO:0001587	stop_gained	79611	exon9				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1347G>A	12.37:g.81593216G>A	ENSP00000449535:p.Trp449*		80117347	NM_024560	Q8NC66	Nonsense_Mutation	SNP	ENST00000548058.1	37	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	G	37	6.200606	0.97371	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.7464	19.075	0.93158	0.0:0.0:1.0:0.0	.	.	.	.	X	449;448;131	.	ENSP00000261206:W448X	W	+	3	0	ACSS3	80117347	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	8.528000	0.90598	2.878000	0.98634	0.650000	0.86243	TGG		0.408	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
KERA	11081	hgsc.bcm.edu	37	12	91449493	91449493	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:91449493T>C	ENST00000266719.3	-	2	813	c.566A>G	c.(565-567)aAa>aGa	p.K189R		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	189					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.K189R(1)		breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						CTTGAGTCCTTTAAAAGTGTC	0.418																																					p.K189R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A566G	12						.						122.0	118.0	119.0					12																	91449493		2203	4299	6502	89973624	SO:0001583	missense	11081	exon2			AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.566A>G	12.37:g.91449493T>C	ENSP00000266719:p.Lys189Arg		89973624	NM_007035		Missense_Mutation	SNP	ENST00000266719.3	37	CCDS9037.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.376869	0.82682	.	.	ENSG00000139330	ENST00000266719	T	0.59083	0.29	6.08	6.08	0.98989	.	0.081587	0.85682	D	0.000000	T	0.48537	0.1505	N	0.21508	0.67	0.50632	D	0.999881	B	0.27068	0.167	B	0.33690	0.168	T	0.41288	-0.9517	10	0.25106	T	0.35	-30.0017	16.6438	0.85155	0.0:0.0:0.0:1.0	.	189	O60938	KERA_HUMAN	R	189	ENSP00000266719:K189R	ENSP00000266719:K189R	K	-	2	0	KERA	89973624	1.000000	0.71417	0.986000	0.45419	0.979000	0.70002	7.698000	0.84413	2.333000	0.79357	0.533000	0.62120	AAA		0.418	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407149.2	NM_007035	
TMCC3	57458	hgsc.bcm.edu	37	12	94976064	94976064	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:94976064C>T	ENST00000261226.4	-	2	460	c.329G>A	c.(328-330)cGt>cAt	p.R110H	TMCC3_ENST00000551457.1_Missense_Mutation_p.R79H	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	110						integral component of membrane (GO:0016021)		p.R110H(2)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						TTGCTTGATACGTCCCGCCTG	0.463																																					p.R110H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G329A	12						.						136.0	122.0	127.0					12																	94976064		2203	4300	6503	93500195	SO:0001583	missense	57458	exon2			AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.329G>A	12.37:g.94976064C>T	ENSP00000261226:p.Arg110His		93500195	NM_020698	Q8IWB2	Missense_Mutation	SNP	ENST00000261226.4	37	CCDS31877.1	.	.	.	.	.	.	.	.	.	.	C	32	5.114813	0.94339	.	.	ENSG00000057704	ENST00000261226;ENST00000551457;ENST00000548918	T;T;T	0.54866	0.55;0.55;0.55	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.72260	0.3438	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.69446	-0.5143	10	0.45353	T	0.12	-26.4066	20.2825	0.98528	0.0:1.0:0.0:0.0	.	110	Q9ULS5	TMCC3_HUMAN	H	110;79;79	ENSP00000261226:R110H;ENSP00000449888:R79H;ENSP00000450078:R79H	ENSP00000261226:R110H	R	-	2	0	TMCC3	93500195	1.000000	0.71417	0.285000	0.24819	0.945000	0.59286	7.634000	0.83273	2.873000	0.98535	0.561000	0.74099	CGT		0.463	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698	
BCL7A	605	hgsc.bcm.edu	37	12	122468668	122468668	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:122468668C>T	ENST00000261822.4	+	2	361	c.155C>T	c.(154-156)aCg>aTg	p.T52M	BCL7A_ENST00000538010.1_Missense_Mutation_p.T52M	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	52					negative regulation of transcription, DNA-templated (GO:0045892)			p.T52M(2)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		GTCCCTGTGACGGAGCCCAAG	0.582			T	MYC	BNHL																																p.T52M	GBM(17;197 467 16477 23242 44349)		Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C155T	12						.						160.0	127.0	138.0					12																	122468668		2203	4300	6503	120953051	SO:0001583	missense	605	exon2			X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.155C>T	12.37:g.122468668C>T	ENSP00000261822:p.Thr52Met		120953051	NM_020993	B4DJN6|B7ZB21|Q13843|Q14CT7	Missense_Mutation	SNP	ENST00000261822.4	37	CCDS53841.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.330386	0.60743	.	.	ENSG00000110987	ENST00000538010;ENST00000261822	T;T	0.49139	0.79;0.8	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.64283	0.2584	L	0.42245	1.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.989	T	0.63681	-0.6582	10	0.72032	D	0.01	.	19.1994	0.93704	0.0:1.0:0.0:0.0	.	52;52	Q4VC05;Q4VC05-2	BCL7A_HUMAN;.	M	52	ENSP00000445868:T52M;ENSP00000261822:T52M	ENSP00000261822:T52M	T	+	2	0	BCL7A	120953051	1.000000	0.71417	0.995000	0.50966	0.027000	0.11550	5.296000	0.65698	2.837000	0.97791	0.655000	0.94253	ACG		0.582	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000401712.1		
SPRED1	161742	hgsc.bcm.edu	37	15	38643651	38643651	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:38643651G>T	ENST00000299084.4	+	7	1981	c.1121G>T	c.(1120-1122)aGc>aTc	p.S374I		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	374	SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)	p.S374I(1)		kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TGTGCAGAGAGCATGTTGTAT	0.428									Legius syndrome																												p.S374I	Melanoma(196;2146 2959 7698 16532)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1121T	15						.						216.0	196.0	203.0					15																	38643651		2200	4297	6497	36430943	SO:0001583	missense	161742	exon7	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.1121G>T	15.37:g.38643651G>T	ENSP00000299084:p.Ser374Ile		36430943	NM_152594	B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	ENST00000299084.4	37	CCDS32193.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492563	0.64074	.	.	ENSG00000166068	ENST00000299084	T	0.66638	-0.22	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.84051	0.5387	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84478	0.0603	10	0.72032	D	0.01	-11.8667	20.5705	0.99360	0.0:0.0:1.0:0.0	.	374	Q7Z699	SPRE1_HUMAN	I	374	ENSP00000299084:S374I	ENSP00000299084:S374I	S	+	2	0	SPRED1	36430943	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.863000	0.87023	2.872000	0.98467	0.560000	0.71715	AGC		0.428	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418217.1		
CAPN3	825	hgsc.bcm.edu	37	15	42695961	42695961	+	Missense_Mutation	SNP	G	G	A	rs370809015		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:42695961G>A	ENST00000397163.3	+	14	1987	c.1768G>A	c.(1768-1770)Gtg>Atg	p.V590M	CAPN3_ENST00000561817.1_5'Flank|CAPN3_ENST00000337571.4_5'Flank|CAPN3_ENST00000397200.4_Missense_Mutation_p.V78M|CAPN3_ENST00000356316.3_Missense_Mutation_p.V503M|CAPN3_ENST00000349748.3_Missense_Mutation_p.V542M|CAPN3_ENST00000318023.7_Missense_Mutation_p.V590M|CAPN3_ENST00000569136.1_5'Flank|CAPN3_ENST00000397204.4_5'Flank|CAPN3_ENST00000357568.3_Missense_Mutation_p.V590M|RP11-164J13.1_ENST00000495723.1_RNA	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	590	Linker.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.V590M(2)|p.V503M(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		TACCATCTCCGTGGATCGGCC	0.557																																					p.V503M												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G1507A	15						.	G	MET/VAL,MET/VAL,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	152.0	148.0	149.0		1768,1768,1624,232	4.8	0.7	15		149	0,8598		0,0,4299	no	missense,missense,missense,missense	CAPN3	NM_000070.2,NM_024344.1,NM_173087.1,NM_173088.1	21,21,21,21	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign	590/822,590/816,542/730,78/310	42695961	1,13003	2203	4299	6502	40483253	SO:0001583	missense	825	exon18			X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.1768G>A	15.37:g.42695961G>A	ENSP00000380349:p.Val590Met		40483253	NM_212465	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	37	CCDS45245.1	.	.	.	.	.	.	.	.	.	.	g	16.11	3.030878	0.54790	2.27E-4	0.0	ENSG00000092529	ENST00000356316;ENST00000337522;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023;ENST00000397200	D;D;D;D;D;D	0.88509	-2.32;-2.39;-2.39;-2.23;-2.39;-1.59	5.68	4.76	0.60689	.	0.153416	0.42821	U	0.000660	T	0.77942	0.4206	N	0.08118	0	0.31225	N	0.696951	B;B;B;P;B;B	0.36125	0.266;0.403;0.385;0.538;0.403;0.425	B;B;B;B;B;B	0.31495	0.043;0.042;0.092;0.131;0.062;0.066	T	0.80306	-0.1438	10	0.66056	D	0.02	.	15.066	0.71996	0.0:0.1414:0.8586:0.0	.	455;503;542;590;590;503	C6EVS4;C6EVS3;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;CAN3_HUMAN;.	M	503;78;590;590;542;590;78	ENSP00000348667:V503M;ENSP00000380349:V590M;ENSP00000350181:V590M;ENSP00000183936:V542M;ENSP00000326281:V590M;ENSP00000380384:V78M	ENSP00000326281:V590M	V	+	1	0	CAPN3	40483253	1.000000	0.71417	0.732000	0.30844	0.904000	0.53231	5.764000	0.68826	1.401000	0.46761	0.651000	0.88453	GTG		0.557	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421075.1		
TP53BP1	7158	hgsc.bcm.edu	37	15	43720287	43720287	+	Missense_Mutation	SNP	C	C	T	rs151132652		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:43720287C>T	ENST00000263801.3	-	18	3992	c.3740G>A	c.(3739-3741)cGc>cAc	p.R1247H	TP53BP1_ENST00000382039.3_Missense_Mutation_p.R1252H|TP53BP1_ENST00000382044.4_Missense_Mutation_p.R1252H|TP53BP1_ENST00000450115.2_Missense_Mutation_p.R1252H	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1247					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)	p.R1247H(1)		breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		GACAAGTGTGCGTACTTCCCG	0.433								Other conserved DNA damage response genes																													p.R1247H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3740A	15						.	C	HIS/ARG,HIS/ARG,HIS/ARG	0,4402		0,0,2201	247.0	218.0	228.0		3755,3755,3740	5.5	1.0	15	dbSNP_134	228	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense,missense	TP53BP1	NM_001141979.1,NM_001141980.1,NM_005657.2	29,29,29	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	1252/1976,1252/1978,1247/1973	43720287	1,12997	2201	4298	6499	41507579	SO:0001583	missense	7158	exon18			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.3740G>A	15.37:g.43720287C>T	ENSP00000263801:p.Arg1247His		41507579	NM_005657	F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	ENST00000263801.3	37	CCDS10096.1	.	.	.	.	.	.	.	.	.	.	C	32	5.136228	0.94517	0.0	1.16E-4	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	T;T;T;T	0.22743	2.23;2.23;1.94;2.21	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.39253	0.1071	L	0.32530	0.975	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.991;0.997;0.999;0.999	T	0.13522	-1.0506	10	0.72032	D	0.01	-7.65	19.7689	0.96353	0.0:1.0:0.0:0.0	.	1252;1247;1252;1252	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	H	1247;1252;1252;1252	ENSP00000263801:R1247H;ENSP00000371475:R1252H;ENSP00000371470:R1252H;ENSP00000393497:R1252H	ENSP00000263801:R1247H	R	-	2	0	TP53BP1	41507579	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.690000	0.68241	2.747000	0.94245	0.650000	0.86243	CGC		0.433	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132897.3		
CASC4	113201	hgsc.bcm.edu	37	15	44705546	44705546	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:44705546G>A	ENST00000345795.2	+	9	1355	c.1085G>A	c.(1084-1086)cGa>cAa	p.R362Q	CASC4_ENST00000360824.3_3'UTR|RP11-516C1.1_ENST00000558047.1_RNA|CASC4_ENST00000299957.6_Missense_Mutation_p.R418Q	NM_177974.2	NP_816929.1	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4	364						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.R418Q(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(2)	17		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		GATGAAGAACGAGAGCTTCAA	0.318																																					p.R362Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1085A	15						.						62.0	61.0	62.0					15																	44705546		2198	4297	6495	42492838	SO:0001583	missense	113201	exon9			AF103804	CCDS10108.1, CCDS10109.1	15q15.1	2010-11-24			ENSG00000166734	ENSG00000166734			24892	protein-coding gene	gene with protein product						10497265	Standard	NM_138423		Approved	H63, DKFZp459F1927	uc001ztp.3	Q6P4E1	OTTHUMG00000131133	ENST00000345795.2:c.1085G>A	15.37:g.44705546G>A	ENSP00000335063:p.Arg362Gln		42492838	NM_177974	B4DPZ6|G5E934|Q6UY45|Q96EM1	Missense_Mutation	SNP	ENST00000345795.2	37	CCDS10109.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778699	0.70107	.	.	ENSG00000166734	ENST00000299957;ENST00000345795;ENST00000416522	.	.	.	4.81	3.89	0.44902	.	0.323267	0.28659	N	0.014574	T	0.27313	0.0670	N	0.14661	0.345	0.80722	D	1	B;P	0.46578	0.309;0.88	B;B	0.36989	0.034;0.238	T	0.04708	-1.0932	9	0.35671	T	0.21	.	11.6308	0.51173	0.0848:0.0:0.9152:0.0	.	362;418	Q6P4E1-2;G5E934	.;.	Q	418;362;397	.	ENSP00000299957:R418Q	R	+	2	0	CASC4	42492838	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.733000	0.47360	1.173000	0.42796	0.644000	0.83932	CGA		0.318	CASC4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253816.1	NM_138423	
MYEF2	50804	hgsc.bcm.edu	37	15	48450222	48450222	+	Missense_Mutation	SNP	C	C	T	rs190142072		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:48450222C>T	ENST00000324324.7	-	9	1232	c.953G>A	c.(952-954)cGt>cAt	p.R318H	MYEF2_ENST00000557868.1_5'UTR|MYEF2_ENST00000267836.6_Missense_Mutation_p.R318H	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	318					myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R318H(1)		endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		ATCATGTGAACGGTACTCTTC	0.338													C|||	1	0.000199681	0.0	0.0	5008	,	,		19849	0.001		0.0	False		,,,				2504	0.0				p.R318H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G953A	15						.						155.0	144.0	148.0					15																	48450222		2198	4297	6495	46237514	SO:0001583	missense	50804	exon9			AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.953G>A	15.37:g.48450222C>T	ENSP00000316950:p.Arg318His		46237514	NM_016132	A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Missense_Mutation	SNP	ENST00000324324.7	37	CCDS32230.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	13.50	2.254302	0.39896	.	.	ENSG00000104177	ENST00000324324;ENST00000267836	T;T	0.24538	2.42;1.85	5.69	5.69	0.88448	.	0.050030	0.85682	D	0.000000	T	0.18964	0.0455	L	0.38838	1.175	0.58432	D	0.999999	P;P	0.41313	0.698;0.745	B;B	0.32022	0.139;0.067	T	0.05099	-1.0906	10	0.14656	T	0.56	-7.6738	18.0	0.89196	0.0:1.0:0.0:0.0	.	318;318	Q9P2K5-2;Q9P2K5	.;MYEF2_HUMAN	H	318	ENSP00000316950:R318H;ENSP00000267836:R318H	ENSP00000267836:R318H	R	-	2	0	MYEF2	46237514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.389000	0.59639	2.686000	0.91538	0.586000	0.80456	CGT		0.338	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416909.2	NM_016132	
DMXL2	23312	hgsc.bcm.edu	37	15	51772872	51772872	+	Missense_Mutation	SNP	C	C	T	rs377032691		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:51772872C>T	ENST00000251076.5	-	24	6718	c.6431G>A	c.(6430-6432)cGa>cAa	p.R2144Q	DMXL2_ENST00000543779.2_Missense_Mutation_p.R2144Q|DMXL2_ENST00000449909.3_Missense_Mutation_p.R1508Q|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2144						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.R2144Q(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CCACGACTTTCGTCTTTCTGC	0.458																																					p.R2144Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6431A	15						.						140.0	134.0	136.0					15																	51772872		2196	4293	6489	49560164	SO:0001583	missense	23312	exon24			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.6431G>A	15.37:g.51772872C>T	ENSP00000251076:p.Arg2144Gln		49560164	NM_015263	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.044898	0.93685	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.77877	-1.13;-1.13;-1.13	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.88672	0.6500	M	0.76170	2.325	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;1.0	D;D;D;D	0.87578	0.998;0.96;0.984;0.98	D	0.88996	0.3418	10	0.87932	D	0	.	19.9981	0.97395	0.0:1.0:0.0:0.0	.	2144;1508;2144;2144	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	Q	2144;2144;1508	ENSP00000251076:R2144Q;ENSP00000441858:R2144Q;ENSP00000400855:R1508Q	ENSP00000251076:R2144Q	R	-	2	0	DMXL2	49560164	1.000000	0.71417	0.952000	0.39060	0.820000	0.46376	7.776000	0.85560	2.729000	0.93468	0.655000	0.94253	CGA		0.458	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
CA12	771	hgsc.bcm.edu	37	15	63631115	63631115	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:63631115G>A	ENST00000178638.3	-	8	1217	c.777C>T	c.(775-777)tgC>tgT	p.C259C	CA12_ENST00000344366.3_Silent_p.C259C|CA12_ENST00000422263.2_Silent_p.C199C	NM_001218.3	NP_001209.1	O43570	CAH12_HUMAN	carbonic anhydrase XII	259					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.C259C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	16					Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	CCATGTGTGTGCAGTACAGGG	0.562																																					p.C259C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C777T	15						.						99.0	86.0	91.0					15																	63631115		2203	4300	6503	61418168	SO:0001819	synonymous_variant	771	exon8			AF051882	CCDS10185.1, CCDS10186.1	15q22	2004-01-19			ENSG00000074410	ENSG00000074410		"""Carbonic anhydrases"""	1371	protein-coding gene	gene with protein product		603263				9636197	Standard	NM_001218		Approved	HsT18816	uc002amc.3	O43570	OTTHUMG00000132881	ENST00000178638.3:c.777C>T	15.37:g.63631115G>A			61418168	NM_001218	B2RE24|Q53YE5|Q9BWG2	Silent	SNP	ENST00000178638.3	37	CCDS10185.1																																																																																				0.562	CA12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256370.1	NM_001218	
IGDCC4	57722	hgsc.bcm.edu	37	15	65702517	65702517	+	Splice_Site	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:65702517G>A	ENST00000352385.2	-	3	771	c.562C>T	c.(562-564)Cgg>Tgg	p.R188W		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	188	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R188W(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GGCACTCACCGAGGCTCCTCA	0.582																																					p.R188W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C562T	15						.						72.0	62.0	65.0					15																	65702517		2201	4299	6500	63489570	SO:0001630	splice_region_variant	57722	exon3				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.563+1C>T	15.37:g.65702517G>A			63489570	NM_020962	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076373	0.76415	.	.	ENSG00000103742	ENST00000352385	T	0.81163	-1.46	5.48	4.48	0.54585	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.053869	0.64402	D	0.000001	D	0.92515	0.7623	H	0.96777	3.88	0.54753	D	0.999986	D	0.89917	1.0	D	0.97110	1.0	D	0.94076	0.7340	10	0.87932	D	0	-26.9358	12.6584	0.56799	0.0:0.0:0.7757:0.2243	.	188	Q8TDY8	IGDC4_HUMAN	W	188	ENSP00000319623:R188W	ENSP00000319623:R188W	R	-	1	2	IGDCC4	63489570	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	3.483000	0.53194	2.576000	0.86940	0.655000	0.94253	CGG		0.582	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	Missense_Mutation
DIS3L	115752	hgsc.bcm.edu	37	15	66625607	66625607	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:66625607G>A	ENST00000319212.4	+	17	3172	c.3122G>A	c.(3121-3123)cGg>cAg	p.R1041Q	DIS3L_ENST00000319194.5_Missense_Mutation_p.R958Q|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	1041					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)	p.R958Q(1)|p.R1041Q(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GAGGAGATACGGGACCTAGCT	0.403																																					p.R1041Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3122A	15						.						111.0	111.0	111.0					15																	66625607		2201	4299	6500	64412661	SO:0001583	missense	115752	exon17				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.3122G>A	15.37:g.66625607G>A	ENSP00000321711:p.Arg1041Gln		64412661	NM_001143688	Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	ENST00000319212.4	37	CCDS45286.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.752560	0.49362	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.23348	1.91;1.91	5.79	0.61	0.17580	.	0.235104	0.48286	D	0.000192	T	0.15955	0.0384	L	0.32530	0.975	0.21878	N	0.999491	B	0.32604	0.377	B	0.27170	0.077	T	0.11470	-1.0586	10	0.38643	T	0.18	-12.9156	10.1201	0.42616	0.3317:0.0:0.6683:0.0	.	1041	Q8TF46	DI3L1_HUMAN	Q	958;1041	ENSP00000321583:R958Q;ENSP00000321711:R1041Q	ENSP00000321583:R958Q	R	+	2	0	DIS3L	64412661	0.944000	0.32072	0.005000	0.12908	0.974000	0.67602	1.167000	0.31847	-0.137000	0.11455	-0.137000	0.14449	CGG		0.403	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375	
LCTL	197021	hgsc.bcm.edu	37	15	66857032	66857032	+	Silent	SNP	G	G	A	rs544840401	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:66857032G>A	ENST00000341509.5	-	2	395	c.264C>T	c.(262-264)gaC>gaT	p.D88D	LCTL_ENST00000563438.1_5'UTR|LCTL_ENST00000537670.1_Intron	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	88					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)	p.D88D(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TGTAGTAGCCGTCACAGGCTA	0.597													G|||	3	0.000599042	0.0	0.0	5008	,	,		22426	0.0		0.0	False		,,,				2504	0.0031				p.D88D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C264T	15						.						192.0	125.0	148.0					15																	66857032		2201	4299	6500	64644086	SO:0001819	synonymous_variant	197021	exon2			AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.264C>T	15.37:g.66857032G>A			64644086	NM_207338	B3KQY0	Silent	SNP	ENST00000341509.5	37	CCDS10220.1																																																																																				0.597	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256921.2	NM_207338	
ACSBG1	23205	hgsc.bcm.edu	37	15	78463851	78463851	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:78463851G>A	ENST00000258873.4	-	14	2315	c.2110C>T	c.(2110-2112)Cgg>Tgg	p.R704W	ACSBG1_ENST00000541759.1_Missense_Mutation_p.R462W|ACSBG1_ENST00000560817.1_Missense_Mutation_p.R462W|IDH3A_ENST00000299518.2_3'UTR	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	704					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.R704W(1)		endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						ACTGTGAGCCGTTTCAGTTTC	0.428																																					p.R700W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2098T	15						.						89.0	86.0	87.0					15																	78463851		2196	4293	6489	76250906	SO:0001583	missense	23205	exon14			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.2110C>T	15.37:g.78463851G>A	ENSP00000258873:p.Arg704Trp		76250906	NM_001199377	B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	ENST00000258873.4	37	CCDS10298.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084032	0.76642	.	.	ENSG00000103740	ENST00000258873;ENST00000541759	T;T	0.20738	2.05;2.05	5.69	4.75	0.60458	.	0.000000	0.64402	D	0.000003	T	0.60983	0.2311	H	0.97051	3.93	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75806	-0.3188	10	0.87932	D	0	-35.8842	14.5757	0.68246	0.0:0.0:0.8417:0.1583	.	700;704	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	W	704;462	ENSP00000258873:R704W;ENSP00000439955:R462W	ENSP00000258873:R704W	R	-	1	2	ACSBG1	76250906	0.998000	0.40836	0.930000	0.37139	0.980000	0.70556	2.286000	0.43496	1.339000	0.45563	0.561000	0.74099	CGG		0.428	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162	
POLG	5428	hgsc.bcm.edu	37	15	89867381	89867381	+	Missense_Mutation	SNP	G	G	A	rs376306906		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:89867381G>A	ENST00000268124.5	-	11	2360	c.2027C>T	c.(2026-2028)gCg>gTg	p.A676V	POLG_ENST00000442287.2_Missense_Mutation_p.A676V	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	676					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)	p.A676V(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			GAACTCCTCCGCCAGGCCGGC	0.592								DNA polymerases (catalytic subunits)																													p.A676V	Colon(73;648 1203 11348 18386 27782)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2027T	15						.	G	VAL/ALA,VAL/ALA	1,4399	2.1+/-5.4	0,1,2199	74.0	67.0	70.0		2027,2027	4.2	0.9	15		70	0,8598		0,0,4299	no	missense,missense	POLG	NM_001126131.1,NM_002693.2	64,64	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	676/1240,676/1240	89867381	1,12997	2200	4299	6499	87668385	SO:0001583	missense	5428	exon11			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.2027C>T	15.37:g.89867381G>A	ENSP00000268124:p.Ala676Val		87668385	NM_001126131	Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	37	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	G	8.607	0.888163	0.17540	2.27E-4	0.0	ENSG00000140521	ENST00000268124;ENST00000442287;ENST00000526314	D;D;D	0.96396	-4.0;-4.0;-3.17	5.13	4.15	0.48705	.	0.601907	0.17821	N	0.160877	D	0.86431	0.5931	N	0.08118	0	0.09310	N	1	P	0.41710	0.76	B	0.24541	0.054	T	0.81066	-0.1101	10	0.46703	T	0.11	-5.3732	7.8744	0.29584	0.0:0.1286:0.5555:0.3159	.	676	P54098	DPOG1_HUMAN	V	676;676;132	ENSP00000268124:A676V;ENSP00000399851:A676V;ENSP00000432389:A132V	ENSP00000268124:A676V	A	-	2	0	POLG	87668385	0.051000	0.20477	0.863000	0.33907	0.120000	0.20174	1.937000	0.40193	2.384000	0.81235	0.491000	0.48974	GCG		0.592	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
MCTP2	55784	hgsc.bcm.edu	37	15	94841631	94841631	+	Missense_Mutation	SNP	G	G	A	rs61735139	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:94841631G>A	ENST00000357742.4	+	1	137	c.137G>A	c.(136-138)cGc>cAc	p.R46H	MCTP2_ENST00000451018.3_Missense_Mutation_p.R46H|MCTP2_ENST00000543482.1_Missense_Mutation_p.R46H|MCTP2_ENST00000331706.4_5'UTR	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	46					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.R46H(2)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CACTTGGACCGCCGTCTCAGC	0.587													G|||	6	0.00119808	0.0038	0.0014	5008	,	,		15580	0.0		0.0	False		,,,				2504	0.0				p.R46H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G137A	15						.						62.0	65.0	64.0					15																	94841631		2197	4298	6495	92642635	SO:0001583	missense	55784	exon1			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.137G>A	15.37:g.94841631G>A	ENSP00000350377:p.Arg46His		92642635	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	37	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.971150	0.53614	.	.	ENSG00000140563	ENST00000543482;ENST00000556363;ENST00000451018;ENST00000357742	T;T;T	0.74632	-0.86;-0.59;-0.43	5.17	5.17	0.71159	.	0.000000	0.50627	D	0.000104	T	0.56572	0.1994	N	0.19112	0.55	0.80722	D	1	P;B;B;P;P	0.49559	0.765;0.257;0.167;0.877;0.925	B;B;B;B;B	0.38327	0.125;0.039;0.018;0.139;0.271	T	0.59332	-0.7474	10	0.33940	T	0.23	.	11.7616	0.51908	0.0816:0.0:0.9184:0.0	rs61735139	46;46;46;46;46	F5H415;Q6DN12-2;Q6DN12;B7Z6H2;G3V2J2	.;.;MCTP2_HUMAN;.;.	H	46	ENSP00000438521:R46H;ENSP00000395109:R46H;ENSP00000350377:R46H	ENSP00000350377:R46H	R	+	2	0	MCTP2	92642635	1.000000	0.71417	0.984000	0.44739	0.398000	0.30690	4.789000	0.62446	2.421000	0.82119	0.655000	0.94253	CGC		0.587	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
CHSY1	22856	hgsc.bcm.edu	37	15	101775530	101775530	+	Silent	SNP	G	G	A	rs147152103	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr15:101775530G>A	ENST00000254190.3	-	2	1048	c.573C>T	c.(571-573)agC>agT	p.S191S		NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	191					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.S191S(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGAGGGGCTCGCTGCTGTTCA	0.542													G|||	5	0.000998403	0.0038	0.0	5008	,	,		17977	0.0		0.0	False		,,,				2504	0.0				p.S191S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C573T	15						.	G		5,4401	9.9+/-24.2	0,5,2198	59.0	59.0	59.0		573	-2.5	1.0	15	dbSNP_134	59	0,8600		0,0,4300	no	coding-synonymous	CHSY1	NM_014918.4		0,5,6498	AA,AG,GG		0.0,0.1135,0.0384		191/803	101775530	5,13001	2203	4300	6503	99593053	SO:0001819	synonymous_variant	22856	exon2			AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.573C>T	15.37:g.101775530G>A			99593053	NM_014918	Q6UX38|Q7LFU5|Q9Y2J5	Silent	SNP	ENST00000254190.3	37	CCDS10390.1																																																																																				0.542	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313624.1	NM_014918	
ADH1A	124	hgsc.bcm.edu	37	4	100205628	100205628	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:100205628C>T	ENST00000209668.2	-	5	608	c.495G>A	c.(493-495)tcG>tcA	p.S165S	RP11-696N14.1_ENST00000500358.2_RNA|ADH1A_ENST00000511656.1_5'Flank	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	165					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)	p.S165S(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	TCTCTAGAGGCGAGGCTGCAT	0.478																																					p.S165S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G495A	4						.						97.0	93.0	95.0					4																	100205628		2203	4300	6503	100424651	SO:0001819	synonymous_variant	124	exon5			M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.495G>A	4.37:g.100205628C>T			100424651	NM_000667	A8K3E3|Q17R68	Silent	SNP	ENST00000209668.2	37	CCDS3648.1																																																																																				0.478	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667	
MANBA	4126	hgsc.bcm.edu	37	4	103560932	103560932	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:103560932G>A	ENST00000226578.4	-	14	2051	c.1952C>T	c.(1951-1953)aCg>aTg	p.T651M	MANBA_ENST00000505239.1_Missense_Mutation_p.T594M	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	651					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)	p.T651M(1)		cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		TGCCCCCATCGTGTGCCCTTG	0.493																																					p.T651M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1952T	4						.						144.0	118.0	127.0					4																	103560932		2203	4300	6503	103779980	SO:0001583	missense	4126	exon14				CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1952C>T	4.37:g.103560932G>A	ENSP00000226578:p.Thr651Met		103779980	NM_005908	Q96BC3|Q9NYX9	Missense_Mutation	SNP	ENST00000226578.4	37	CCDS3658.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458820	0.84317	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	T;T	0.79749	-1.3;-1.3	5.7	4.86	0.63082	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.097443	0.64402	D	0.000001	D	0.91425	0.7294	M	0.91972	3.26	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.93048	0.6463	10	0.66056	D	0.02	-6.3094	14.6915	0.69091	0.0696:0.0:0.9304:0.0	.	594;651	E9PFW2;O00462	.;MANBA_HUMAN	M	651;594	ENSP00000226578:T651M;ENSP00000427322:T594M	ENSP00000226578:T651M	T	-	2	0	MANBA	103779980	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	9.353000	0.97080	1.432000	0.47375	0.650000	0.86243	ACG		0.493	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2		
DKK2	27123	hgsc.bcm.edu	37	4	107845302	107845302	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:107845302G>A	ENST00000285311.3	-	4	1294	c.589C>T	c.(589-591)Cgt>Tgt	p.R197C	DKK2_ENST00000510463.1_Missense_Mutation_p.R151C|DKK2_ENST00000513208.1_Missense_Mutation_p.R97C	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	197	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.R197C(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		CAGAAATGACGAGCACAGCAA	0.493																																					p.R197C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C589T	4						.						127.0	117.0	120.0					4																	107845302		2203	4300	6503	108064751	SO:0001583	missense	27123	exon4			AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.589C>T	4.37:g.107845302G>A	ENSP00000285311:p.Arg197Cys		108064751	NM_014421	A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	ENST00000285311.3	37	CCDS3675.1	.	.	.	.	.	.	.	.	.	.	G	32	5.109722	0.94292	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.59906	0.49;0.23;0.59	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.78660	0.4318	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.80812	-0.1215	10	0.87932	D	0	-11.5138	19.6876	0.95986	0.0:0.0:1.0:0.0	.	197	Q9UBU2	DKK2_HUMAN	C	197;97;151	ENSP00000285311:R197C;ENSP00000421255:R97C;ENSP00000423797:R151C	ENSP00000285311:R197C	R	-	1	0	DKK2	108064751	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.476000	0.97823	2.657000	0.90304	0.585000	0.79938	CGT		0.493	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4		
ANK2	287	hgsc.bcm.edu	37	4	114277599	114277599	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:114277599A>G	ENST00000357077.4	+	38	7878	c.7825A>G	c.(7825-7827)Agg>Ggg	p.R2609G	ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.R2576G|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2609					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R2609G(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AAAGCAGAAAAGGGACTACAA	0.388																																					p.R2609G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A7825G	4						.						114.0	122.0	119.0					4																	114277599		2203	4300	6503	114497048	SO:0001583	missense	287	exon38			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.7825A>G	4.37:g.114277599A>G	ENSP00000349588:p.Arg2609Gly		114497048	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	A	16.59	3.165739	0.57476	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.69806	-0.42;-0.43	6.01	6.01	0.97437	.	0.000000	0.64402	D	0.000014	T	0.78188	0.4244	L	0.58810	1.83	0.80722	D	1	D;D	0.89917	0.979;1.0	P;D	0.83275	0.702;0.996	T	0.77632	-0.2515	9	.	.	.	.	13.5277	0.61605	0.8705:0.1295:0.0:0.0	.	2576;2609	Q01484;Q01484-4	ANK2_HUMAN;.	G	2609;2576	ENSP00000349588:R2609G;ENSP00000264366:R2576G	.	R	+	1	2	ANK2	114497048	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.933000	0.63484	2.299000	0.77371	0.533000	0.62120	AGG		0.388	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
SMARCA5	8467	hgsc.bcm.edu	37	4	144459998	144459998	+	Silent	SNP	G	G	A	rs61761959	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:144459998G>A	ENST00000283131.3	+	13	2139	c.1677G>A	c.(1675-1677)acG>acA	p.T559T		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	559	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.T559T(1)	EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					TGTTAAGCACGCGTGCTGGTG	0.383													G|||	5	0.000998403	0.0038	0.0	5008	,	,		19057	0.0		0.0	False		,,,				2504	0.0				p.T559T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1677A	4						.	G		7,4399	12.9+/-30.5	0,7,2196	180.0	169.0	173.0		1677	-6.6	0.9	4	dbSNP_129	173	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SMARCA5	NM_003601.3		0,8,6495	AA,AG,GG		0.0116,0.1589,0.0615		559/1053	144459998	8,12998	2203	4300	6503	144679448	SO:0001819	synonymous_variant	8467	exon13			AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.1677G>A	4.37:g.144459998G>A			144679448	NM_003601		Silent	SNP	ENST00000283131.3	37	CCDS3761.1																																																																																				0.383	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
OTUD4	54726	hgsc.bcm.edu	37	4	146059566	146059566	+	Silent	SNP	C	C	T	rs140860184		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:146059566C>T	ENST00000447906.2	-	21	2548	c.2361G>A	c.(2359-2361)ccG>ccA	p.P787P	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000454497.2_Silent_p.P722P			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	787					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)	p.P721P(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					AAAATGTCGGCGGTCCAATCT	0.488																																					p.P722P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2166A	4						.	C		0,4406		0,0,2203	86.0	80.0	82.0		2166	-5.4	0.1	4	dbSNP_134	82	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OTUD4	NM_001102653.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		722/1050	146059566	1,13005	2203	4300	6503	146279016	SO:0001819	synonymous_variant	54726	exon21				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2361G>A	4.37:g.146059566C>T			146279016	NM_001102653	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Silent	SNP	ENST00000447906.2	37																																																																																					0.488	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493	
LDB2	9079	hgsc.bcm.edu	37	4	16504335	16504335	+	Silent	SNP	C	C	T	rs147641994		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:16504335C>T	ENST00000304523.5	-	8	1376	c.1053G>A	c.(1051-1053)ccG>ccA	p.P351P	LDB2_ENST00000515064.1_Silent_p.P349P|RP11-446J8.1_ENST00000512370.1_RNA|LDB2_ENST00000502640.1_3'UTR|LDB2_ENST00000441778.2_3'UTR	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	351					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)	p.P351P(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						TACTGTTCCACGGGCTGTTGT	0.522																																					p.P351P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1053A	4						.	C	,	4,4402	8.1+/-20.4	0,4,2199	167.0	172.0	171.0		,1053	-10.3	0.2	4	dbSNP_134	171	0,8600		0,0,4300	no	utr-3,coding-synonymous	LDB2	NM_001130834.1,NM_001290.3	,	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	,	,351/374	16504335	4,13002	2203	4300	6503	16113433	SO:0001819	synonymous_variant	9079	exon8			AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.1053G>A	4.37:g.16504335C>T			16113433	NM_001290	O60619|O75480	Silent	SNP	ENST00000304523.5	37	CCDS3420.1	.	.	.	.	.	.	.	.	.	.	C	5.404	0.259768	0.10239	9.08E-4	0.0	ENSG00000169744	ENST00000507464	.	.	.	5.48	-10.3	0.00346	.	.	.	.	.	T	0.34803	0.0910	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43228	-0.9404	4	.	.	.	-11.0231	3.7757	0.08659	0.1482:0.173:0.1475:0.5313	.	.	.	.	H	272	.	.	R	-	2	0	LDB2	16113433	0.001000	0.12720	0.250000	0.24296	0.996000	0.88848	-2.028000	0.01431	-2.418000	0.00566	-0.119000	0.15052	CGT		0.522	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250321.2		
GATB	5188	hgsc.bcm.edu	37	4	152637171	152637171	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:152637171C>T	ENST00000263985.6	-	5	793	c.753G>A	c.(751-753)gcG>gcA	p.A251A	PET112_ENST00000515812.1_Intron|PET112_ENST00000512306.1_Silent_p.A251A	NM_004564.2	NP_004555.1												p.A251A(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	23						CTGCCATGTTCGCCTGGCTGG	0.527																																					p.A251A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G753A	4						.						53.0	50.0	51.0					4																	152637171		2203	4300	6503	152856621	SO:0001819	synonymous_variant	5188	exon5																														ENST00000263985.6:c.753G>A	4.37:g.152637171C>T			152856621	NM_004564		Silent	SNP	ENST00000263985.6	37	CCDS3776.1																																																																																				0.527	PET112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365671.1		
PIGG	54872	hgsc.bcm.edu	37	4	515636	515636	+	Missense_Mutation	SNP	C	C	T	rs144879126	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:515636C>T	ENST00000453061.2	+	8	1626	c.1520C>T	c.(1519-1521)gCg>gTg	p.A507V	PIGG_ENST00000504346.1_Missense_Mutation_p.A418V|PIGG_ENST00000310340.5_Missense_Mutation_p.A499V|PIGG_ENST00000296306.7_3'UTR|PIGG_ENST00000383028.4_Missense_Mutation_p.A374V|PIGG_ENST00000536264.1_3'UTR|PIGG_ENST00000509768.1_Missense_Mutation_p.A418V|PIGG_ENST00000503111.1_3'UTR	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	507					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)	p.A499V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						TCGTGGCTGGCGGCAGGTGGG	0.562													C|||	20	0.00399361	0.0151	0.0	5008	,	,		20457	0.0		0.0	False		,,,				2504	0.0				p.A499V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1496T	4						.	C	VAL/ALA,VAL/ALA	74,4332	66.4+/-103.9	1,72,2130	116.0	102.0	107.0		1520,1496	-1.9	0.0	4	dbSNP_134	107	0,8600		0,0,4300	yes	missense,missense	PIGG	NM_001127178.1,NM_017733.3	64,64	1,72,6430	TT,TC,CC		0.0,1.6795,0.569	benign,benign	507/984,499/976	515636	74,12932	2203	4300	6503	505636	SO:0001583	missense	54872	exon8				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1520C>T	4.37:g.515636C>T	ENSP00000415203:p.Ala507Val		505636	NM_017733	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Missense_Mutation	SNP	ENST00000453061.2	37	CCDS46992.1	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	C	6.284	0.420591	0.11928	0.016795	0.0	ENSG00000174227	ENST00000310340;ENST00000453061;ENST00000504346;ENST00000383028;ENST00000509768	T;T;T;T;T	0.30448	3.3;3.27;2.94;2.93;1.53	5.84	-1.87	0.07737	.	0.875934	0.10551	N	0.661459	T	0.09468	0.0233	L	0.36672	1.1	0.09310	N	1	P;B;P;P	0.40534	0.72;0.398;0.455;0.583	B;B;B;B	0.34138	0.131;0.038;0.062;0.176	T	0.15665	-1.0429	10	0.18276	T	0.48	.	11.1249	0.48312	0.0:0.2776:0.0:0.7224	.	374;418;507;499	Q5H8A4-3;D6RFE8;Q5H8A4;Q5H8A4-2	.;.;PIGG_HUMAN;.	V	499;507;418;374;418	ENSP00000311750:A499V;ENSP00000415203:A507V;ENSP00000424800:A418V;ENSP00000372494:A374V;ENSP00000421550:A418V	ENSP00000311750:A499V	A	+	2	0	PIGG	505636	0.011000	0.17503	0.001000	0.08648	0.056000	0.15407	-0.093000	0.11111	-0.300000	0.08895	-0.258000	0.10820	GCG		0.562	PIGG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357494.1	NM_017733	
ADD1	118	hgsc.bcm.edu	37	4	2910326	2910326	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:2910326G>A	ENST00000398129.1	+	11	1620	c.1600G>A	c.(1600-1602)Gtc>Atc	p.V534I	ADD1_ENST00000264758.7_Missense_Mutation_p.V565I|ADD1_ENST00000398123.2_Missense_Mutation_p.V565I|ADD1_ENST00000513328.2_Missense_Mutation_p.V534I|ADD1_ENST00000398125.1_Missense_Mutation_p.V565I|ADD1_ENST00000355842.3_Missense_Mutation_p.V534I|ADD1_ENST00000446856.1_Missense_Mutation_p.V534I|ADD1_ENST00000503455.2_Missense_Mutation_p.V565I			P35611	ADDA_HUMAN	adducin 1 (alpha)	534					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)	p.V565I(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CAGGAGCCTCGTCCAGGTGAG	0.522																																					p.V534I	Esophageal Squamous(71;505 1201 20414 34538 37449)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1600A	4						.						144.0	112.0	123.0					4																	2910326		2203	4300	6503	2880124	SO:0001583	missense	118	exon12			L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1600G>A	4.37:g.2910326G>A	ENSP00000381197:p.Val534Ile		2880124	NM_001119	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Missense_Mutation	SNP	ENST00000398129.1	37	CCDS43205.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865066	0.71949	.	.	ENSG00000087274	ENST00000264758;ENST00000446856;ENST00000398125;ENST00000513328;ENST00000503455;ENST00000355842;ENST00000398123;ENST00000398129;ENST00000536424	T;T;T;T;T;T;T;T;T	0.51325	3.53;3.54;3.44;3.43;3.44;3.31;3.44;3.54;0.71	5.91	5.91	0.95273	.	0.149727	0.43919	D	0.000517	T	0.48187	0.1486	L	0.50333	1.59	0.52099	D	0.999946	P;P;B;P;B	0.42620	0.694;0.785;0.123;0.671;0.045	B;B;B;B;B	0.40602	0.334;0.166;0.04;0.139;0.022	T	0.38929	-0.9638	10	0.36615	T	0.2	-9.2605	20.3052	0.98627	0.0:0.0:1.0:0.0	.	534;534;565;534;565	Q86XM2;P35611;P35611-3;P35611-2;A2A3N8	.;ADDA_HUMAN;.;.;.	I	565;534;565;534;565;534;565;534;34	ENSP00000264758:V565I;ENSP00000399828:V534I;ENSP00000381193:V565I;ENSP00000421907:V534I;ENSP00000423024:V565I;ENSP00000348100:V534I;ENSP00000381191:V565I;ENSP00000381197:V534I;ENSP00000438069:V34I	ENSP00000264758:V565I	V	+	1	0	ADD1	2880124	1.000000	0.71417	0.960000	0.40013	0.991000	0.79684	4.940000	0.63533	2.808000	0.96608	0.655000	0.94253	GTC		0.522	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189	
STK32B	55351	hgsc.bcm.edu	37	4	5469789	5469789	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:5469789C>T	ENST00000282908.5	+	11	1520	c.1098C>T	c.(1096-1098)aaC>aaT	p.N366N	STK32B_ENST00000508728.1_3'UTR|STK32B_ENST00000512636.1_Silent_p.N289N|STK32B_ENST00000510398.1_Silent_p.N319N	NM_018401.1	NP_060871.1			serine/threonine kinase 32B									p.N366N(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						TCATATTCAACAGAGAGAAGT	0.522																																					p.N366N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1098T	4						.						146.0	140.0	142.0					4																	5469789		2203	4300	6503	5520690	SO:0001819	synonymous_variant	55351	exon11			AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.1098C>T	4.37:g.5469789C>T			5520690	NM_018401		Silent	SNP	ENST00000282908.5	37	CCDS3380.1																																																																																				0.522	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
ATP10D	57205	hgsc.bcm.edu	37	4	47514762	47514762	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:47514762G>A	ENST00000273859.3	+	2	474	c.205G>A	c.(205-207)Gga>Aga	p.G69R	ATP10D_ENST00000504445.1_Missense_Mutation_p.G69R	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	69					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.G69R(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GAAGTTCTCCGGAGCCTATGT	0.433																																					p.G69R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G205A	4						.						84.0	84.0	84.0					4																	47514762		2203	4300	6503	47209519	SO:0001583	missense	57205	exon2			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.205G>A	4.37:g.47514762G>A	ENSP00000273859:p.Gly69Arg		47209519	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	G	3.927	-0.017031	0.07681	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	T;T	0.54071	0.59;0.59	5.1	5.1	0.69264	.	0.226096	0.39274	N	0.001407	T	0.28466	0.0704	N	0.17474	0.49	0.38825	D	0.95571	B;B	0.17667	0.023;0.0	B;B	0.08055	0.003;0.001	T	0.20273	-1.0280	10	0.02654	T	1	-18.5961	7.781	0.29064	0.1806:0.0:0.8194:0.0	.	69;69	Q9P241;Q6PEW3	AT10D_HUMAN;.	R	69	ENSP00000273859:G69R;ENSP00000420909:G69R	ENSP00000273859:G69R	G	+	1	0	ATP10D	47209519	1.000000	0.71417	0.999000	0.59377	0.332000	0.28634	5.702000	0.68332	2.519000	0.84933	0.557000	0.71058	GGA		0.433	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
CEP135	9662	hgsc.bcm.edu	37	4	56831850	56831850	+	Missense_Mutation	SNP	G	G	A	rs371196044		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:56831850G>A	ENST00000257287.4	+	8	993	c.869G>A	c.(868-870)cGt>cAt	p.R290H		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	290					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)	p.R290H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					CTGGAGAAGCGTATACGAGAG	0.333																																					p.R290H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G869A	4						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	58.0	57.0	57.0		869	-0.1	1.0	4		57	0,8600		0,0,4300	no	missense	CEP135	NM_025009.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	290/1141	56831850	1,13005	2203	4300	6503	56526607	SO:0001583	missense	9662	exon8			AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.869G>A	4.37:g.56831850G>A	ENSP00000257287:p.Arg290His		56526607	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	37	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	G	8.048	0.765388	0.15914	2.27E-4	0.0	ENSG00000174799	ENST00000257287	T	0.49139	0.79	5.56	-0.0468	0.13846	.	0.319686	0.35525	N	0.003145	T	0.23014	0.0556	N	0.10733	0.035	0.34020	D	0.652491	B	0.20164	0.042	B	0.14023	0.01	T	0.14924	-1.0455	10	0.28530	T	0.3	.	9.7838	0.40664	0.4476:0.0:0.5524:0.0	.	290	Q66GS9	CP135_HUMAN	H	290	ENSP00000257287:R290H	ENSP00000257287:R290H	R	+	2	0	CEP135	56526607	0.974000	0.33945	0.995000	0.50966	0.814000	0.46013	1.020000	0.30027	0.060000	0.16281	-0.691000	0.03719	CGT		0.333	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
ARHGAP24	83478	hgsc.bcm.edu	37	4	86844920	86844920	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:86844920G>T	ENST00000395184.1	+	4	854	c.388G>T	c.(388-390)Gga>Tga	p.G130*	ARHGAP24_ENST00000395183.2_Nonsense_Mutation_p.G35*|ARHGAP24_ENST00000503995.1_Nonsense_Mutation_p.G130*	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	130					activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)	p.G130*(1)		breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		ACCTTTCGGAGGAGGTGAGTG	0.458																																					p.G130X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G388T	4						.						91.0	84.0	86.0					4																	86844920		2203	4300	6503	87063944	SO:0001587	stop_gained	83478	exon4			AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.388G>T	4.37:g.86844920G>T	ENSP00000378611:p.Gly130*		87063944	NM_001025616	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Nonsense_Mutation	SNP	ENST00000395184.1	37	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	G	42	9.272829	0.99122	.	.	ENSG00000138639	ENST00000395184;ENST00000503995;ENST00000512201;ENST00000395183;ENST00000514229	.	.	.	6.17	6.17	0.99709	.	0.099691	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	130;130;35;35;45	.	ENSP00000378610:G35X	G	+	1	0	ARHGAP24	87063944	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	9.188000	0.94921	2.941000	0.99782	0.655000	0.94253	GGA		0.458	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
HERC3	8916	hgsc.bcm.edu	37	4	89579568	89579568	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:89579568C>T	ENST00000402738.1	+	10	1311	c.1072C>T	c.(1072-1074)Cgc>Tgc	p.R358C	HERC3_ENST00000543130.1_5'UTR|HERC3_ENST00000264345.3_Missense_Mutation_p.R358C	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	358					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R358C(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		TTTGACAGATCGCTTTAAATA	0.353																																					p.R358C												.	.	2	Substitution - Missense(2)	large_intestine(1)|NS(1)	c.C1072T	4						.						65.0	64.0	65.0					4																	89579568		2203	4300	6503	89798591	SO:0001583	missense	8916	exon10			D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.1072C>T	4.37:g.89579568C>T	ENSP00000385684:p.Arg358Cys		89798591	NM_014606	A8K1S5|Q8IXX3	Missense_Mutation	SNP	ENST00000402738.1	37	CCDS34028.1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.296970	0.40594	.	.	ENSG00000138641	ENST00000402738;ENST00000264345	T;T	0.41400	1.0;1.0	5.18	4.25	0.50352	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.596619	0.18007	N	0.154707	T	0.19446	0.0467	N	0.02960	-0.455	0.80722	D	1	B	0.13594	0.008	B	0.10450	0.005	T	0.06954	-1.0798	10	0.54805	T	0.06	.	8.7935	0.34866	0.0:0.7053:0.2021:0.0926	.	358	Q15034	HERC3_HUMAN	C	358	ENSP00000385684:R358C;ENSP00000264345:R358C	ENSP00000264345:R358C	R	+	1	0	HERC3	89798591	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.256000	0.32921	2.688000	0.91661	0.655000	0.94253	CGC		0.353	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2	NM_014606	
WDR17	116966	hgsc.bcm.edu	37	4	177032829	177032829	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr4:177032829C>T	ENST00000280190.4	+	3	326	c.170C>T	c.(169-171)gCg>gTg	p.A57V	WDR17_ENST00000508596.1_Missense_Mutation_p.A33V|WDR17_ENST00000507824.2_Missense_Mutation_p.A57V|WDR17_ENST00000393643.2_Missense_Mutation_p.A33V			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	57								p.A57V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GCATATTGTGCGACCCTGGCT	0.368																																					p.A33V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C98T	4						.						116.0	106.0	109.0					4																	177032829		2203	4300	6503	177269823	SO:0001583	missense	116966	exon2			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.170C>T	4.37:g.177032829C>T	ENSP00000280190:p.Ala57Val		177269823	NM_181265	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843483	0.71488	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000296524;ENST00000507824	T;T;T	0.64991	-0.09;-0.06;-0.13	5.39	5.39	0.77823	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70090	0.3184	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.974;0.994	T	0.70487	-0.4858	10	0.42905	T	0.14	-16.3469	19.1629	0.93541	0.0:1.0:0.0:0.0	.	33;57;57	E7EQX0;E7ESC9;Q8IZU2	.;.;WDR17_HUMAN	V	33;33;57;33;57	ENSP00000422763:A33V;ENSP00000377258:A33V;ENSP00000280190:A57V	ENSP00000280190:A57V	A	+	2	0	WDR17	177269823	1.000000	0.71417	0.852000	0.33557	0.087000	0.18053	7.212000	0.77941	2.513000	0.84729	0.467000	0.42956	GCG		0.368	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
TBC1D8B	54885	hgsc.bcm.edu	37	X	106083995	106083995	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:106083995C>T	ENST00000357242.5	+	10	1774	c.1600C>T	c.(1600-1602)Cgt>Tgt	p.R534C	TBC1D8B_ENST00000310452.2_Missense_Mutation_p.R534C|TBC1D8B_ENST00000276175.3_Missense_Mutation_p.R528C	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	534	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.	Arginine finger. {ECO:0000250}.					calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.R534C(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AGAAATTGAACGTGATTTACG	0.468																																					p.R534C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1600T	X						.						178.0	157.0	164.0					X																	106083995		2203	4299	6502	105970651	SO:0001583	missense	54885	exon10			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.1600C>T	X.37:g.106083995C>T	ENSP00000349781:p.Arg534Cys		105970651	NM_198881	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	ENST00000357242.5	37	CCDS14522.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.897758	0.72639	.	.	ENSG00000133138	ENST00000357242;ENST00000310452;ENST00000276175	T;T;T	0.04654	3.58;3.58;3.58	5.3	5.3	0.74995	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.31482	0.0798	H	0.96080	3.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.41124	-0.9526	10	0.87932	D	0	-11.1374	11.7323	0.51744	0.1762:0.8238:0.0:0.0	.	534;534	Q0IIM8;B9A6K6	TBC8B_HUMAN;.	C	534;534;528	ENSP00000349781:R534C;ENSP00000310675:R534C;ENSP00000276175:R528C	ENSP00000276175:R528C	R	+	1	0	TBC1D8B	105970651	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.958000	0.49145	2.208000	0.71279	0.506000	0.49869	CGT		0.468	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057807.2	NM_017752	
ARHGAP6	395	hgsc.bcm.edu	37	X	11162198	11162198	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:11162198G>A	ENST00000337414.4	-	11	2950	c.2078C>T	c.(2077-2079)tCg>tTg	p.S693L	ARHGAP6_ENST00000413512.3_3'UTR|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.S518L|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.S693L|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.S490L|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.S490L	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	693					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)	p.S693L(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						AAGCTTCTCCGAGCCCCCCGG	0.587											OREG0019666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S490L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1469T	X						.						72.0	72.0	72.0					X																	11162198		2203	4300	6503	11072119	SO:0001583	missense	395	exon11			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2078C>T	X.37:g.11162198G>A	ENSP00000338967:p.Ser693Leu	670	11072119	NM_013423	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	37	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	G	16.67	3.187227	0.57909	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718	T;T;T;T;T;T	0.28454	1.72;1.68;1.68;1.61;1.72;1.73	5.51	5.51	0.81932	.	0.159052	0.29745	N	0.011319	T	0.44498	0.1296	M	0.65975	2.015	0.80722	D	1	B;B;D;D	0.64830	0.054;0.14;0.994;0.994	B;B;P;P	0.50860	0.01;0.017;0.652;0.652	T	0.28138	-1.0053	10	0.27785	T	0.31	.	18.5701	0.91132	0.0:0.0:1.0:0.0	.	490;693;693;693	O43182-5;O43182-2;O43182;A8KAL3	.;.;RHG06_HUMAN;.	L	518;490;490;693;529;693	ENSP00000438135:S518L;ENSP00000370112:S490L;ENSP00000302312:S490L;ENSP00000338967:S693L;ENSP00000370093:S529L;ENSP00000370094:S693L	ENSP00000302312:S490L	S	-	2	0	ARHGAP6	11072119	1.000000	0.71417	0.975000	0.42487	0.491000	0.33493	4.445000	0.60007	2.329000	0.79093	0.506000	0.49869	TCG		0.587	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427	
VSIG1	340547	hgsc.bcm.edu	37	X	107320509	107320509	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:107320509G>A	ENST00000217957.5	+	7	1179	c.1062G>A	c.(1060-1062)acG>acA	p.T354T	VSIG1_ENST00000415430.3_Silent_p.T390T	NM_182607.4	NP_872413.1	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1	354						integral component of membrane (GO:0016021)		p.T354T(1)|p.T390T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17						AGCCAGAAACGCAGTCGGAAT	0.572																																					p.T354T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1062A	X						.						78.0	74.0	75.0					X																	107320509		2203	4300	6503	107207165	SO:0001819	synonymous_variant	340547	exon7			BX648658	CCDS14535.1, CCDS55474.1	Xq22.3	2013-01-29			ENSG00000101842	ENSG00000101842		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28675	protein-coding gene	gene with protein product		300620				12477932	Standard	NM_182607		Approved	MGC44287	uc011msk.2	Q86XK7	OTTHUMG00000022175	ENST00000217957.5:c.1062G>A	X.37:g.107320509G>A			107207165	NM_182607	C9J4P2|Q6MZS4	Silent	SNP	ENST00000217957.5	37	CCDS14535.1																																																																																				0.572	VSIG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057858.1	NM_182607	
HTR2C	3358	hgsc.bcm.edu	37	X	113965790	113965790	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:113965790C>T	ENST00000276198.1	+	4	851	c.123C>T	c.(121-123)tcC>tcT	p.S41S	HTR2C_ENST00000371951.1_Silent_p.S41S|HTR2C_ENST00000371950.3_Silent_p.S41S	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	41					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.S41S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TCAATACCTCCGATGGTGGAC	0.423																																					p.S41S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C123T	X						.						123.0	114.0	117.0					X																	113965790		2203	4300	6503	113872046	SO:0001819	synonymous_variant	3358	exon4				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.123C>T	X.37:g.113965790C>T			113872046	NM_000868	B1AMW4|Q5VUF8|Q9NP28	Silent	SNP	ENST00000276198.1	37	CCDS14564.1																																																																																				0.423	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868	
BCORL1	63035	hgsc.bcm.edu	37	X	129148899	129148899	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:129148899C>T	ENST00000218147.7	+	4	2348	c.2151C>T	c.(2149-2151)taC>taT	p.Y717Y	BCORL1_ENST00000540052.1_Silent_p.Y717Y|BCORL1_ENST00000359304.2_Silent_p.Y717Y|BCORL1_ENST00000303743.5_Silent_p.Y717Y			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	717					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.Y717Y(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CTGGCACCTACGTGGGAGTGG	0.607																																					p.Y717Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2151T	X						.						97.0	75.0	83.0					X																	129148899		2203	4300	6503	128976580	SO:0001819	synonymous_variant	63035	exon3			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2151C>T	X.37:g.129148899C>T			128976580	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Silent	SNP	ENST00000218147.7	37	CCDS14616.1	.	.	.	.	.	.	.	.	.	.	C	2.889	-0.230125	0.05983	.	.	ENSG00000085185	ENST00000441294	.	.	.	5.28	-3.96	0.04106	.	.	.	.	.	T	0.62233	0.2411	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58346	-0.7652	4	.	.	.	-9.1343	13.2266	0.59919	0.0:0.3696:0.0:0.6304	.	.	.	.	C	153	.	.	R	+	1	0	BCORL1	128976580	0.000000	0.05858	0.795000	0.32087	0.932000	0.56968	-2.857000	0.00728	-1.747000	0.01333	-0.422000	0.05995	CGT		0.607	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
PHKA2	5256	hgsc.bcm.edu	37	X	18911679	18911679	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:18911679G>A	ENST00000379942.4	-	33	4297	c.3632C>T	c.(3631-3633)aCg>aTg	p.T1211M	PHKA2-AS1_ENST00000452900.1_RNA|PHKA2-AS1_ENST00000439295.1_RNA|PHKA2_ENST00000481718.1_5'UTR	NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	1211					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.T1211M(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GTAGGTCATCGTCCCATAAGC	0.512																																					p.T1211M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3632T	X						.						208.0	195.0	200.0					X																	18911679		2203	4300	6503	18821600	SO:0001583	missense	5256	exon33				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.3632C>T	X.37:g.18911679G>A	ENSP00000369274:p.Thr1211Met		18821600	NM_000292	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.371646	0.61624	.	.	ENSG00000044446	ENST00000379942	D	0.81499	-1.5	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.91429	0.7295	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.92430	0.5953	10	0.87932	D	0	-13.2645	19.2244	0.93812	0.0:0.0:1.0:0.0	.	1211	P46019	KPB2_HUMAN	M	1211	ENSP00000369274:T1211M	ENSP00000369274:T1211M	T	-	2	0	PHKA2	18821600	1.000000	0.71417	0.933000	0.37362	0.205000	0.24178	7.516000	0.81772	2.492000	0.84095	0.600000	0.82982	ACG		0.512	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292	
MAP7D2	256714	hgsc.bcm.edu	37	X	20071061	20071061	+	Missense_Mutation	SNP	G	G	A	rs367603064		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:20071061G>A	ENST00000379651.3	-	5	548	c.530C>T	c.(529-531)aCg>aTg	p.T177M	MAP7D2_ENST00000443379.3_Intron|MAP7D2_ENST00000379643.5_Missense_Mutation_p.T177M|MAP7D2_ENST00000543767.1_Missense_Mutation_p.T70M|MAP7D2_ENST00000452324.3_Missense_Mutation_p.T133M	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	177					microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)		p.T177M(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						GGGAGGCTCCGTTGGCTTTGG	0.443																																					p.T177M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C530T	X						.	G	,MET/THR,MET/THR,MET/THR	1,3834		0,1,1631,571	236.0	183.0	201.0		,530,398,530	0.1	0.9	X		201	0,6728		0,0,2428,1872	no	intron,missense,missense,missense	MAP7D2	NM_001168466.1,NM_152780.3,NM_001168467.1,NM_001168465.1	,81,81,81	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	,benign,benign,benign	,177/733,133/681,177/774	20071061	1,10562	2203	4300	6503	19980982	SO:0001583	missense	256714	exon5			BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.530C>T	X.37:g.20071061G>A	ENSP00000368972:p.Thr177Met		19980982	NM_001168465	B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Missense_Mutation	SNP	ENST00000379651.3	37	CCDS14195.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.009536	0.35415	2.61E-4	0.0	ENSG00000184368	ENST00000379651;ENST00000379643;ENST00000543767;ENST00000452324;ENST00000330274	T;T;T;T	0.08193	3.65;3.65;3.12;3.65	5.64	0.102	0.14522	.	0.367289	0.27645	N	0.018448	T	0.05318	0.0141	L	0.34521	1.04	0.23366	N	0.99782	B;B;B;B;B	0.27192	0.066;0.117;0.171;0.071;0.117	B;B;B;B;B	0.17433	0.009;0.014;0.018;0.006;0.014	T	0.31024	-0.9958	10	0.46703	T	0.11	-1.6074	5.6573	0.17650	0.5325:0.1422:0.3253:0.0	.	133;177;210;177;70	C9JYW0;Q96T17-2;B5ME62;Q96T17;F5GYC2	.;.;.;MA7D2_HUMAN;.	M	177;177;70;133;210	ENSP00000368972:T177M;ENSP00000368964:T177M;ENSP00000440691:T70M;ENSP00000413301:T133M	ENSP00000332677:T210M	T	-	2	0	MAP7D2	19980982	0.605000	0.26941	0.939000	0.37840	0.994000	0.84299	-0.036000	0.12185	-0.051000	0.13334	0.600000	0.82982	ACG		0.443	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056001.1	NM_152780	
CNKSR2	22866	hgsc.bcm.edu	37	X	21627654	21627654	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:21627654G>A	ENST00000379510.3	+	20	2647	c.2611G>A	c.(2611-2613)Gtg>Atg	p.V871M	CNKSR2_ENST00000425654.2_Missense_Mutation_p.V841M|CNKSR2_ENST00000543067.1_Missense_Mutation_p.V822M|CNKSR2_ENST00000279451.4_Missense_Mutation_p.V871M	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	871					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.V871M(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						ACAGGATGACGTGCAACCCCC	0.527																																					p.V822M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2464A	X						.						48.0	42.0	44.0					X																	21627654		2203	4298	6501	21537575	SO:0001583	missense	22866	exon19			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2611G>A	X.37:g.21627654G>A	ENSP00000368824:p.Val871Met		21537575	NM_001168649	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	G	9.494	1.101506	0.20632	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.17854	2.51;2.25;2.25;2.51	5.55	4.67	0.58626	.	0.384512	0.25445	N	0.030633	T	0.11367	0.0277	N	0.22421	0.69	0.21627	N	0.999612	B;B;B;B	0.10296	0.003;0.002;0.001;0.003	B;B;B;B	0.09377	0.002;0.001;0.004;0.002	T	0.20075	-1.0286	10	0.37606	T	0.19	-31.0364	8.8373	0.35119	0.1784:0.0:0.8216:0.0	.	841;822;463;871	B7ZLJ1;B4DGR4;B3KPN2;Q8WXI2	.;.;.;CNKR2_HUMAN	M	841;822;871;871	ENSP00000397906:V841M;ENSP00000444633:V822M;ENSP00000279451:V871M;ENSP00000368824:V871M	ENSP00000279451:V871M	V	+	1	0	CNKSR2	21537575	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	3.304000	0.51866	1.187000	0.43000	0.513000	0.50165	GTG		0.527	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
IL1RAPL1	11141	hgsc.bcm.edu	37	X	29973260	29973260	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:29973260C>T	ENST00000378993.1	+	11	2087	c.1414C>T	c.(1414-1416)Cgg>Tgg	p.R472W	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.R472W	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	472	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)	p.R472W(1)		biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						TCAAAGCAAGCGGCTGATTAT	0.403																																					p.R472W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1414T	X						.						103.0	91.0	95.0					X																	29973260		2202	4300	6502	29883181	SO:0001583	missense	11141	exon11			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1414C>T	X.37:g.29973260C>T	ENSP00000368278:p.Arg472Trp		29883181	NM_014271	A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.716998	0.48622	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.10960	2.82;2.82	6.02	3.08	0.35506	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.85682	D	0.000000	T	0.40196	0.1107	M	0.91663	3.23	0.54753	D	0.999985	D	0.89917	1.0	D	0.97110	1.0	T	0.51663	-0.8677	9	.	.	.	.	13.959	0.64166	0.5445:0.4554:0.0:0.0	.	472	Q9NZN1	IRPL1_HUMAN	W	472	ENSP00000368278:R472W;ENSP00000305200:R472W	.	R	+	1	2	IL1RAPL1	29883181	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.423000	0.34837	0.620000	0.30215	0.600000	0.82982	CGG		0.403	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271	
KCND1	3750	hgsc.bcm.edu	37	X	48826537	48826537	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:48826537C>T	ENST00000218176.3	-	1	1439	c.142G>A	c.(142-144)Gga>Aga	p.G48R	KCND1_ENST00000376477.1_5'Flank	NM_004979.4	NP_004970.3	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 1	48					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|metal ion binding (GO:0046872)	p.G48R(1)		endometrium(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	24					Dalfampridine(DB06637)	AAGCGCCGTCCGCTCACGTTC	0.622																																					p.G48R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G142A	X						.						47.0	30.0	36.0					X																	48826537		2203	4300	6503	48711481	SO:0001583	missense	3750	exon1			AF166003	CCDS14314.1	Xp11.23	2012-07-05			ENSG00000102057	ENSG00000102057		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6237	protein-coding gene	gene with protein product		300281				10729221, 16382104	Standard	NM_004979		Approved	Kv4.1	uc004dlx.1	Q9NSA2	OTTHUMG00000024127	ENST00000218176.3:c.142G>A	X.37:g.48826537C>T	ENSP00000218176:p.Gly48Arg		48711481	NM_004979	A6NEF1|B2RCG0|O75671	Missense_Mutation	SNP	ENST00000218176.3	37	CCDS14314.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410338	0.62399	.	.	ENSG00000102057	ENST00000218176	D	0.95724	-3.79	4.57	3.71	0.42584	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.98830	0.9605	H	0.99931	4.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97629	1.0141	10	0.87932	D	0	.	10.7854	0.46403	0.0:0.9032:0.0:0.0968	.	48	Q9NSA2	KCND1_HUMAN	R	48	ENSP00000218176:G48R	ENSP00000218176:G48R	G	-	1	0	KCND1	48711481	1.000000	0.71417	0.545000	0.28153	0.762000	0.43233	7.651000	0.83577	0.945000	0.37605	0.422000	0.28245	GGA		0.622	KCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060774.1	NM_004979	
GRIPAP1	56850	hgsc.bcm.edu	37	X	48830666	48830666	+	Missense_Mutation	SNP	C	C	T	rs371634362		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:48830666C>T	ENST00000376441.1	-	26	2499	c.2465G>A	c.(2464-2466)cGg>cAg	p.R822Q	GRIPAP1_ENST00000376444.3_Missense_Mutation_p.R777Q|GRIPAP1_ENST00000376425.3_Missense_Mutation_p.R791Q|GRIPAP1_ENST00000473581.1_5'Flank|KCND1_ENST00000218176.3_5'Flank	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	822						blood microparticle (GO:0072562)|endosome (GO:0005768)		p.R465Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						CTTGCTGAGCCGCACAATTTC	0.567																																					p.R822Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2465A	X						.		GLN/ARG	0,3835		0,0,1632,571	62.0	48.0	53.0		2465	3.9	1.0	X		53	1,6727		0,1,2427,1872	no	missense	GRIPAP1	NM_020137.3	43	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging	822/842	48830666	1,10562	2203	4300	6503	48715610	SO:0001583	missense	56850	exon26			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.2465G>A	X.37:g.48830666C>T	ENSP00000365624:p.Arg822Gln		48715610	NM_020137	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	ENST00000376441.1	37	CCDS35248.1	.	.	.	.	.	.	.	.	.	.	c	25.7	4.666511	0.88251	0.0	1.49E-4	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291	.	.	.	3.93	3.93	0.45458	.	0.000000	0.53938	U	0.000053	T	0.70351	0.3214	M	0.65498	2.005	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.70730	-0.4792	9	0.45353	T	0.12	-15.5009	10.3749	0.44077	0.0:1.0:0.0:0.0	.	822	Q4V328	GRAP1_HUMAN	Q	791;777;822;791	.	ENSP00000365608:R791Q	R	-	2	0	GRIPAP1	48715610	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.008000	0.57103	1.805000	0.52779	0.548000	0.68491	CGG		0.567	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
GRIPAP1	56850	hgsc.bcm.edu	37	X	48831648	48831648	+	Silent	SNP	G	G	A	rs144302135	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:48831648G>A	ENST00000376441.1	-	25	2386	c.2352C>T	c.(2350-2352)ggC>ggT	p.G784G	GRIPAP1_ENST00000376444.3_Silent_p.G739G|GRIPAP1_ENST00000376425.3_Silent_p.G753G|GRIPAP1_ENST00000473581.1_5'Flank	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	784						blood microparticle (GO:0072562)|endosome (GO:0005768)		p.G427G(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GGTTCTCGTCGCCTGGCTTCA	0.592													g|||	58	0.0153642	0.0431	0.0014	3775	,	,		14171	0.0		0.0	False		,,,				2504	0.0				p.G784G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2352T	X						.			156,3679		4,125,23,1503,548	62.0	48.0	53.0		2352	-0.6	1.0	X	dbSNP_134	53	1,6727		0,0,1,2428,1871	no	coding-synonymous	GRIPAP1	NM_020137.3		4,125,24,3931,2419	AA,AG,A,GG,G		0.0149,4.0678,1.4863		784/842	48831648	157,10406	2203	4300	6503	48716592	SO:0001819	synonymous_variant	56850	exon25			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.2352C>T	X.37:g.48831648G>A			48716592	NM_020137	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Silent	SNP	ENST00000376441.1	37	CCDS35248.1																																																																																				0.592	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
CCDC120	90060	hgsc.bcm.edu	37	X	48920010	48920010	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:48920010G>A	ENST00000376396.3	+	4	280	c.61G>A	c.(61-63)Gga>Aga	p.G21R	CCDC120_ENST00000496529.2_Missense_Mutation_p.G21R|CCDC120_ENST00000603986.1_Missense_Mutation_p.G56R|CCDC120_ENST00000597275.1_Missense_Mutation_p.G21R|CCDC120_ENST00000422185.2_Missense_Mutation_p.G21R|CCDC120_ENST00000536628.2_Missense_Mutation_p.G9R	NM_001271835.1|NM_001271836.1|NM_033626.2	NP_001258764.1|NP_001258765.1|NP_296375.1	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120	21								p.G21R(1)		breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14						TGCCCTGTTCGGAGAGGCTGC	0.642																																					p.G9R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G25A	X						.						37.0	35.0	35.0					X																	48920010		2203	4300	6503	48806954	SO:0001583	missense	90060	exon4			BC008769	CCDS14316.1, CCDS55413.1, CCDS55414.1, CCDS55414.2	Xp11.23	2008-02-05			ENSG00000147144	ENSG00000147144			28910	protein-coding gene	gene with protein product						12477932	Standard	NM_033626		Approved	JM11	uc011mmr.3	Q96HB5	OTTHUMG00000021509	ENST00000376396.3:c.61G>A	X.37:g.48920010G>A	ENSP00000365577:p.Gly21Arg		48806954	NM_001163323	B4DFC1|B4DTU2|F5GZU4	Missense_Mutation	SNP	ENST00000376396.3	37	CCDS14316.1	.	.	.	.	.	.	.	.	.	.	G	19.86	3.905246	0.72868	.	.	ENSG00000147144	ENST00000376396;ENST00000422185;ENST00000536628	.	.	.	5.64	4.74	0.60224	.	0.341385	0.24985	N	0.034035	T	0.18676	0.0448	N	0.08118	0	0.28990	N	0.888128	P;P;P;P	0.38300	0.626;0.626;0.626;0.626	B;B;B;B	0.34590	0.11;0.186;0.186;0.11	T	0.07347	-1.0777	9	0.22706	T	0.39	-5.236	13.7942	0.63160	0.0:0.2655:0.7345:0.0	.	9;56;9;21	B4DTU2;B4DFC1;B4DF24;Q96HB5	.;.;.;CC120_HUMAN	R	21;21;9	.	ENSP00000365577:G21R	G	+	1	0	CCDC120	48806954	0.998000	0.40836	0.963000	0.40424	0.976000	0.68499	2.317000	0.43770	2.374000	0.81015	0.529000	0.55759	GGA		0.642	CCDC120-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056528.1	NM_033626	
MAGED2	10916	hgsc.bcm.edu	37	X	54837741	54837741	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:54837741G>A	ENST00000375068.1	+	5	1138	c.905G>A	c.(904-906)cGc>cAc	p.R302H	MAGED2_ENST00000375058.1_Missense_Mutation_p.R302H|MAGED2_ENST00000375062.4_Missense_Mutation_p.R217H|MAGED2_ENST00000347546.4_Missense_Mutation_p.R284H|MAGED2_ENST00000396224.1_Missense_Mutation_p.R302H|MAGED2_ENST00000375060.1_Missense_Mutation_p.R217H|MAGED2_ENST00000218439.4_Missense_Mutation_p.R302H|MAGED2_ENST00000375053.2_Missense_Mutation_p.R302H			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	302	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					membrane (GO:0016020)		p.R302H(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						CCCATCAAGCGCTCGGGTAAA	0.483																																					p.R302H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G905A	X						.						102.0	93.0	96.0					X																	54837741		2203	4300	6503	54854466	SO:0001583	missense	10916	exon5			AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.905G>A	X.37:g.54837741G>A	ENSP00000364209:p.Arg302His		54854466	NM_201222	A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	Missense_Mutation	SNP	ENST00000375068.1	37	CCDS14362.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901758	0.52227	.	.	ENSG00000102316	ENST00000375068;ENST00000375053;ENST00000347546;ENST00000343474;ENST00000375062;ENST00000218439;ENST00000375058;ENST00000375060;ENST00000396224	T;T;T;T;T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21;3.21;3.21;3.21;3.21	3.88	3.88	0.44766	.	0.000000	0.41396	D	0.000881	T	0.27063	0.0663	M	0.77103	2.36	0.45118	D	0.998131	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.79784	0.965;0.993;0.98	T	0.01951	-1.1241	10	0.87932	D	0	.	11.0737	0.48019	0.0:0.0:1.0:0.0	.	284;217;302	Q9UNF1-2;Q5H907;Q9UNF1	.;.;MAGD2_HUMAN	H	302;302;246;284;217;302;302;217;302	ENSP00000364209:R302H;ENSP00000364193:R302H;ENSP00000336962:R246H;ENSP00000340290:R284H;ENSP00000364202:R217H;ENSP00000218439:R302H;ENSP00000364198:R302H;ENSP00000364200:R217H;ENSP00000379526:R302H	ENSP00000218439:R302H	R	+	2	0	MAGED2	54854466	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	5.227000	0.65305	1.884000	0.54569	0.513000	0.50165	CGC		0.483	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056821.2	NM_014599	
ARHGEF9	23229	hgsc.bcm.edu	37	X	62893977	62893977	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:62893977G>A	ENST00000253401.6	-	6	1665	c.865C>T	c.(865-867)Cga>Tga	p.R289*	ARHGEF9_ENST00000374878.1_Nonsense_Mutation_p.R287*|ARHGEF9-IT1_ENST00000420917.1_RNA|ARHGEF9_ENST00000374870.4_Nonsense_Mutation_p.R187*|ARHGEF9_ENST00000495564.1_5'UTR|ARHGEF9_ENST00000374872.1_Nonsense_Mutation_p.R268*|ARHGEF9_ENST00000437457.2_Nonsense_Mutation_p.R236*|ARHGEF9_ENST00000433323.2_Nonsense_Mutation_p.R60*	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	289					apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R287*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						TCTAAACGTCGCTTGCGTTCG	0.458																																					p.R187X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C559T	X						.						115.0	87.0	96.0					X																	62893977		2203	4300	6503	62810702	SO:0001587	stop_gained	23229	exon5			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.865C>T	X.37:g.62893977G>A	ENSP00000253401:p.Arg289*		62810702	NM_001173480	A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Nonsense_Mutation	SNP	ENST00000253401.6	37	CCDS35315.1	.	.	.	.	.	.	.	.	.	.	G	46	12.897766	0.99704	.	.	ENSG00000131089	ENST00000253401;ENST00000374878;ENST00000437457;ENST00000374870;ENST00000433323;ENST00000374872	.	.	.	5.61	3.73	0.42828	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8884	0.52615	0.0:0.0:0.5501:0.4498	.	.	.	.	X	289;287;236;187;60;268	.	ENSP00000253401:R289X	R	-	1	2	ARHGEF9	62810702	1.000000	0.71417	0.970000	0.41538	0.996000	0.88848	1.470000	0.35354	1.085000	0.41206	0.600000	0.82982	CGA		0.458	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056937.1		
AMER1	139285	hgsc.bcm.edu	37	X	63411063	63411063	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:63411063C>A	ENST00000330258.3	-	2	2376	c.2104G>T	c.(2104-2106)Gag>Tag	p.E702*	AMER1_ENST00000403336.1_Nonsense_Mutation_p.E702*|AMER1_ENST00000374869.3_Nonsense_Mutation_p.E702*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	702					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.E702*(2)									TAACGCTTCTCCAGAGGACGG	0.537																																					p.E702X												.	.	69	Whole gene deletion(67)|Substitution - Nonsense(2)	kidney(65)|large_intestine(3)|ovary(1)	c.G2104T	X						.						53.0	46.0	48.0					X																	63411063		2203	4300	6503	63327788	SO:0001587	stop_gained	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2104G>T	X.37:g.63411063C>A	ENSP00000329117:p.Glu702*		63327788	NM_152424	A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	40	7.979639	0.98594	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-18.7292	16.762	0.85514	0.0:1.0:0.0:0.0	.	.	.	.	X	702	.	ENSP00000329117:E702X	E	-	1	0	FAM123B	63327788	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	3.726000	0.54977	2.618000	0.88619	0.600000	0.82982	GAG		0.537	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
NLGN3	54413	hgsc.bcm.edu	37	X	70387438	70387438	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:70387438C>T	ENST00000358741.3	+	7	1794	c.1491C>T	c.(1489-1491)taC>taT	p.Y497Y	NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000374051.3_Silent_p.Y477Y|NLGN3_ENST00000536169.1_Silent_p.Y457Y	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	497					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)	p.Y477Y(1)		biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					ATGCCCGCTACGGCTCGCCTA	0.562																																					p.Y457Y	Esophageal Squamous(103;760 1488 16849 22250 40351)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1371T	X						.						76.0	63.0	67.0					X																	70387438		2203	4300	6503	70304163	SO:0001819	synonymous_variant	54413	exon5			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1491C>T	X.37:g.70387438C>T			70304163	NM_001166660	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	ENST00000358741.3	37	CCDS55441.1																																																																																				0.562	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977	
NHSL2	340527	hgsc.bcm.edu	37	X	71359951	71359951	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:71359951C>T	ENST00000373677.1	+	2	2717	c.1455C>T	c.(1453-1455)gcC>gcT	p.A485A	NHSL2_ENST00000540800.1_Silent_p.A851A|NHSL2_ENST00000535692.1_Silent_p.A485A|NHSL2_ENST00000510661.1_Silent_p.A620A			Q5HYW2	NHSL2_HUMAN	NHS-like 2	485								p.A482A(1)|p.A851A(1)		NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					CTGAGTATGCCGAGGAACCCA	0.552																																					p.A851A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2553T	X						.						55.0	50.0	52.0					X																	71359951		2203	4299	6502	71276676	SO:0001819	synonymous_variant	340527	exon6					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.1455C>T	X.37:g.71359951C>T			71276676	NM_001013627	B2RN94	Silent	SNP	ENST00000373677.1	37																																																																																					0.552	NHSL2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000057170.1	NM_001013627	
NAP1L3	4675	hgsc.bcm.edu	37	X	92928044	92928044	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:92928044G>A	ENST00000373079.3	-	1	523	c.260C>T	c.(259-261)gCg>gTg	p.A87V	FAM133A_ENST00000332647.4_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.A80V|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000538690.1_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	87					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)		p.A87V(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						GGCCCGCCGCGCCCTTCTGGA	0.572																																					p.A87V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C260T	X						.						19.0	21.0	20.0					X																	92928044		2195	4279	6474	92814700	SO:0001583	missense	4675	exon1				CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.260C>T	X.37:g.92928044G>A	ENSP00000362171:p.Ala87Val		92814700	NM_004538	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	G	7.217	0.596644	0.13875	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.29917	1.55	3.65	-0.142	0.13448	.	0.484707	0.20854	N	0.084467	T	0.14960	0.0361	N	0.24115	0.695	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.14392	-1.0474	10	0.28530	T	0.3	.	3.9376	0.09313	0.3165:0.0:0.5142:0.1693	.	87	Q99457	NP1L3_HUMAN	V	87;80	ENSP00000362171:A87V	ENSP00000362171:A87V	A	-	2	0	NAP1L3	92814700	0.006000	0.16342	0.001000	0.08648	0.008000	0.06430	-0.307000	0.08167	-0.168000	0.10853	0.529000	0.55759	GCG		0.572	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
SRPX2	27286	hgsc.bcm.edu	37	X	99917178	99917178	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:99917178C>T	ENST00000373004.3	+	4	597	c.169C>T	c.(169-171)Cga>Tga	p.R57*		NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2	57					angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)	p.R57*(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						TACAGTCCCCCGATGGTGTTA	0.438																																					p.R57X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C169T	X						.						62.0	56.0	58.0					X																	99917178		2203	4300	6503	99803834	SO:0001587	stop_gained	27286	exon4			AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.169C>T	X.37:g.99917178C>T	ENSP00000362095:p.Arg57*		99803834	NM_014467	B3KQT3|Q8WW85	Nonsense_Mutation	SNP	ENST00000373004.3	37	CCDS14471.1	.	.	.	.	.	.	.	.	.	.	C	39	7.703009	0.98441	.	.	ENSG00000102359	ENST00000373004	.	.	.	5.07	3.21	0.36854	.	0.369972	0.28533	N	0.015003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.3346	13.2711	0.60161	0.2884:0.7116:0.0:0.0	.	.	.	.	X	57	.	.	R	+	1	2	SRPX2	99803834	0.692000	0.27719	0.997000	0.53966	0.920000	0.55202	1.272000	0.33109	0.408000	0.25621	0.523000	0.50628	CGA		0.438	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057486.1	NM_014467	
AFF2	2334	hgsc.bcm.edu	37	X	148068927	148068927	+	Silent	SNP	C	C	T	rs370206293		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chrX:148068927C>T	ENST00000370460.2	+	20	4133	c.3654C>T	c.(3652-3654)aaC>aaT	p.N1218N	AFF2_ENST00000342251.3_Silent_p.N1185N|AFF2_ENST00000370457.5_Silent_p.N1183N|AFF2_ENST00000286437.5_Silent_p.N859N	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	1218					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.N1218N(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CTCTCAACAACGTCTCCCCCA	0.537																																					p.N1218N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3654T	X						.	C	,,,,,	2,3833		0,2,1630,571	216.0	154.0	175.0		3549,3624,3549,3537,2577,3654	-7.6	0.7	X		175	1,6727		0,1,2427,1872	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	AFF2	NM_001169122.1,NM_001169123.1,NM_001169124.1,NM_001169125.1,NM_001170628.1,NM_002025.3	,,,,,	0,3,4057,2443	TT,TC,CC,C		0.0149,0.0522,0.0284	,,,,,	1183/1277,1208/1302,1183/1277,1179/1273,859/953,1218/1312	148068927	3,10560	2203	4300	6503	147876633	SO:0001819	synonymous_variant	2334	exon20			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.3654C>T	X.37:g.148068927C>T			147876633	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	ENST00000370460.2	37	CCDS14684.1																																																																																				0.537	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
PSD4	23550	hgsc.bcm.edu	37	2	113950133	113950133	+	Missense_Mutation	SNP	G	G	A	rs377061829		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:113950133G>A	ENST00000245796.6	+	6	2000	c.1805G>A	c.(1804-1806)cGg>cAg	p.R602Q	PSD4_ENST00000441564.3_Missense_Mutation_p.R574Q	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	602	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.R602Q(1)|p.R602L(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GAGGGCTTCCGGAAGTCTGAA	0.602																																					p.R602Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1805A	2						.		GLN/ARG	0,4406		0,0,2203	77.0	80.0	79.0		1805	1.9	1.0	2		79	1,8599	1.2+/-3.3	0,1,4299	no	missense	PSD4	NM_012455.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	602/1057	113950133	1,13005	2203	4300	6503	113666604	SO:0001583	missense	23550	exon6			U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1805G>A	2.37:g.113950133G>A	ENSP00000245796:p.Arg602Gln		113666604	NM_012455	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	37	CCDS33276.1	.	.	.	.	.	.	.	.	.	.	g	13.86	2.363859	0.41902	0.0	1.16E-4	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.29397	1.57;1.57	5.68	1.92	0.25849	SEC7-like (4);	0.137812	0.50627	D	0.000114	T	0.12902	0.0313	N	0.10809	0.05	0.80722	D	1	B;B;B	0.15473	0.013;0.006;0.005	B;B;B	0.23150	0.015;0.004;0.044	T	0.10064	-1.0646	10	0.21540	T	0.41	.	3.5807	0.07952	0.3286:0.0:0.5045:0.1669	.	260;574;602	Q59HG0;Q8NDX1-2;Q8NDX1	.;.;PSD4_HUMAN	Q	602;574	ENSP00000245796:R602Q;ENSP00000413997:R574Q	ENSP00000245796:R602Q	R	+	2	0	PSD4	113666604	1.000000	0.71417	0.999000	0.59377	0.907000	0.53573	1.581000	0.36558	0.358000	0.24211	-0.837000	0.03062	CGG		0.602	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455	
STEAP3	55240	hgsc.bcm.edu	37	2	120003324	120003324	+	Silent	SNP	G	G	A	rs144377604	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:120003324G>A	ENST00000354888.5	+	3	756	c.252G>A	c.(250-252)ccG>ccA	p.P84P	STEAP3_ENST00000393110.2_Silent_p.P94P|STEAP3_ENST00000393108.2_Silent_p.P84P|STEAP3_ENST00000393106.2_Silent_p.P84P|STEAP3_ENST00000393107.2_Silent_p.P84P|STEAP3_ENST00000450943.2_Silent_p.P84P|STEAP3_ENST00000425223.2_Silent_p.P84P|STEAP3_ENST00000409811.1_Silent_p.P84P|STEAP3-AS1_ENST00000454260.1_RNA	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	84					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)	p.P84P(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						TGAGCTCCCCGGAGGTCATCT	0.592													G|||	14	0.00279553	0.0098	0.0014	5008	,	,		18902	0.0		0.0	False		,,,				2504	0.0				p.P94P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G282A	2						.	G	,,	72,4334	64.1+/-101.4	0,72,2131	57.0	53.0	54.0		252,252,282	-9.9	0.0	2	dbSNP_134	54	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	STEAP3	NM_001008410.1,NM_018234.2,NM_182915.2	,,	0,73,6430	AA,AG,GG		0.0116,1.6341,0.5613	,,	84/489,84/489,94/499	120003324	73,12933	2203	4300	6503	119719794	SO:0001819	synonymous_variant	55240	exon3			AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.252G>A	2.37:g.120003324G>A			119719794	NM_182915	A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Silent	SNP	ENST00000354888.5	37	CCDS2125.1																																																																																				0.592	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254193.1	NM_018234	
KCNH7	90134	hgsc.bcm.edu	37	2	163393500	163393500	+	Missense_Mutation	SNP	G	G	A	rs201399722		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:163393500G>A	ENST00000332142.5	-	3	497	c.398C>T	c.(397-399)aCg>aTg	p.T133M	KCNH7_ENST00000328032.4_Missense_Mutation_p.T133M	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	133	PAC.				circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.T133M(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TTCATTATCCGTCACATATTC	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		15517	0.0		0.001	False		,,,				2504	0.0				p.T133M	GBM(196;1492 2208 17507 24132 45496)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C398T	2						.	G	MET/THR,MET/THR	0,4406		0,0,2203	196.0	182.0	187.0		398,398	4.7	1.0	2		187	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KCNH7	NM_033272.3,NM_173162.2	81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	133/1197,133/733	163393500	1,13005	2203	4300	6503	163101746	SO:0001583	missense	90134	exon3			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.398C>T	2.37:g.163393500G>A	ENSP00000331727:p.Thr133Met		163101746	NM_173162	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	5.733	0.319633	0.10845	0.0	1.16E-4	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.99900	-7.63;-7.63	5.56	4.67	0.58626	PAS (1);	0.226376	0.46442	D	0.000283	D	0.99432	0.9799	M	0.65677	2.01	0.41059	D	0.985364	P;B	0.41910	0.764;0.251	B;B	0.29785	0.107;0.104	D	0.99701	1.1004	10	0.42905	T	0.14	.	16.4356	0.83874	0.0:0.1316:0.8684:0.0	.	133;133	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	M	133	ENSP00000331727:T133M;ENSP00000333781:T133M	ENSP00000333781:T133M	T	-	2	0	KCNH7	163101746	1.000000	0.71417	0.976000	0.42696	0.122000	0.20287	6.168000	0.71908	1.333000	0.45449	0.561000	0.74099	ACG		0.388	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
SCN1A	6323	hgsc.bcm.edu	37	2	166904257	166904257	+	Missense_Mutation	SNP	C	C	T	rs147095862		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:166904257C>T	ENST00000303395.4	-	8	1049	c.1050G>A	c.(1048-1050)atG>atA	p.M350I	AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.M350I|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.M350I|SCN1A_ENST00000423058.2_Missense_Mutation_p.M350I			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	350					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.M350I(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTTCACACACATATATCCCT	0.408																																					p.M350I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1050A	2						.	C	ILE/MET,ILE/MET,ILE/MET,ILE/MET	0,4406		0,0,2203	116.0	110.0	112.0		1050,1050,1050,1050	0.1	0.3	2	dbSNP_134	112	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	SCN1A	NM_001165963.1,NM_001165964.1,NM_001202435.1,NM_006920.4	10,10,10,10	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign	350/2010,350/1982,350/2010,350/1999	166904257	1,13005	2203	4300	6503	166612503	SO:0001583	missense	6323	exon8			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1050G>A	2.37:g.166904257C>T	ENSP00000303540:p.Met350Ile		166612503	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	C	0.202	-1.043672	0.01997	0.0	1.16E-4	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.95518	-3.73;-3.73;-3.69;-3.68	5.0	0.0962	0.14489	Ion transport (1);	0.516121	0.20745	N	0.086472	T	0.76485	0.3994	N	0.00879	-1.12	0.18873	N	0.999981	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.0	T	0.71889	-0.4456	10	0.02654	T	1	.	2.1032	0.03685	0.1184:0.4264:0.1155:0.3397	.	350;350;350	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	I	350	ENSP00000407030:M350I;ENSP00000303540:M350I;ENSP00000364554:M350I;ENSP00000386312:M350I	ENSP00000303540:M350I	M	-	3	0	SCN1A	166612503	0.000000	0.05858	0.300000	0.25030	0.284000	0.27059	-2.337000	0.01104	-0.205000	0.10219	-0.794000	0.03295	ATG		0.408	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
CHRNA1	1134	hgsc.bcm.edu	37	2	175618366	175618366	+	Missense_Mutation	SNP	C	C	T	rs148304857	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:175618366C>T	ENST00000261007.5	-	7	784	c.718G>A	c.(718-720)Gac>Aac	p.D240N	CHRNA1_ENST00000409542.1_Missense_Mutation_p.D133N|CHRNA1_ENST00000409323.1_Missense_Mutation_p.D215N|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409219.1_Missense_Mutation_p.D215N|CHRNA1_ENST00000348749.5_Missense_Mutation_p.D215N	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	240					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)	p.D240N(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	TAGGGGGTGTCGGGGCAGCAG	0.592													C|||	27	0.00539137	0.0204	0.0	5008	,	,		18949	0.0		0.0	False		,,,				2504	0.0				p.D215N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G643A	2						.	C	ASN/ASP,ASN/ASP	56,4350	55.5+/-91.7	0,56,2147	157.0	148.0	151.0		643,718	-6.4	0.8	2	dbSNP_134	151	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	CHRNA1	NM_000079.3,NM_001039523.2	23,23	0,57,6446	TT,TC,CC		0.0116,1.271,0.4383	benign,benign	215/458,240/483	175618366	57,12949	2203	4300	6503	175326612	SO:0001583	missense	1134	exon6			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.718G>A	2.37:g.175618366C>T	ENSP00000261007:p.Asp240Asn		175326612	NM_000079	B4DRV6|D3DPE8	Missense_Mutation	SNP	ENST00000261007.5	37	CCDS33331.1	10	0.004578754578754579	10	0.02032520325203252	0	0.0	0	0.0	0	0.0	C	13.82	2.349779	0.41599	0.01271	1.16E-4	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219;ENST00000409323	T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11	5.17	-6.43	0.01926	Neurotransmitter-gated ion-channel ligand-binding (3);	0.684736	0.15430	N	0.262756	T	0.42630	0.1211	L	0.31294	0.92	0.35465	D	0.796834	B;B;B	0.15473	0.001;0.013;0.0	B;B;B	0.14023	0.003;0.01;0.005	T	0.22382	-1.0218	10	0.72032	D	0.01	.	7.8998	0.29727	0.1452:0.5004:0.0:0.3544	.	215;215;240	G5E9G9;Q53SH4;P02708	.;.;ACHA_HUMAN	N	215;240;133;215;215	ENSP00000261008:D215N;ENSP00000261007:D240N;ENSP00000387026:D133N;ENSP00000386611:D215N;ENSP00000386684:D215N	ENSP00000261007:D240N	D	-	1	0	CHRNA1	175326612	0.126000	0.22350	0.838000	0.33150	0.181000	0.23173	0.180000	0.16860	-0.528000	0.06366	-1.148000	0.01847	GAC		0.592	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1		
SESTD1	91404	hgsc.bcm.edu	37	2	180047901	180047901	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:180047901G>A	ENST00000428443.3	-	3	386	c.70C>T	c.(70-72)Cgg>Tgg	p.R24W	SESTD1_ENST00000486468.1_5'UTR	NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	24	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.R24W(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			AGGCCACTCCGTCTGTCTTTT	0.343																																					p.R24W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C70T	2						.						93.0	91.0	92.0					2																	180047901		2203	4300	6503	179756146	SO:0001583	missense	91404	exon3			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.70C>T	2.37:g.180047901G>A	ENSP00000415332:p.Arg24Trp		179756146	NM_178123	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755288	0.69648	.	.	ENSG00000187231	ENST00000428443;ENST00000440010;ENST00000435047	T;T;T	0.16457	2.34;2.34;2.34	5.21	4.28	0.50868	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.35364	0.0929	L	0.59436	1.845	0.58432	D	0.999997	D	0.89917	1.0	D	0.79784	0.993	T	0.01621	-1.1310	9	.	.	.	-11.5568	12.8357	0.57771	0.0:0.0:0.7119:0.2881	.	24	Q86VW0	SESD1_HUMAN	W	24	ENSP00000415332:R24W;ENSP00000416164:R24W;ENSP00000410286:R24W	.	R	-	1	2	SESTD1	179756146	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.212000	0.51145	2.580000	0.87095	0.655000	0.94253	CGG		0.343	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
COL3A1	1281	hgsc.bcm.edu	37	2	189872269	189872269	+	Missense_Mutation	SNP	G	G	A	rs370069953		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:189872269G>A	ENST00000304636.3	+	45	3469	c.3299G>A	c.(3298-3300)cGt>cAt	p.R1100H	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1100	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.R1100H(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	ACAGGTGAACGTGGAGCTGCT	0.428																																					p.R1100H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3299A	2						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	66.0	57.0	60.0		3299	5.2	1.0	2		60	0,8600		0,0,4300	no	missense	COL3A1	NM_000090.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1100/1467	189872269	1,13005	2203	4300	6503	189580514	SO:0001583	missense	1281	exon45			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.3299G>A	2.37:g.189872269G>A	ENSP00000304408:p.Arg1100His		189580514	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.236966	0.58886	2.27E-4	0.0	ENSG00000168542	ENST00000304636	D	0.96265	-3.96	5.22	5.22	0.72569	.	0.000000	0.51477	D	0.000084	D	0.97492	0.9179	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97271	0.9911	10	0.45353	T	0.12	.	14.4002	0.67037	0.0:0.1475:0.8525:0.0	.	1100	P02461	CO3A1_HUMAN	H	1100	ENSP00000304408:R1100H	ENSP00000304408:R1100H	R	+	2	0	COL3A1	189580514	1.000000	0.71417	1.000000	0.80357	0.371000	0.29859	5.563000	0.67352	2.441000	0.82636	0.650000	0.86243	CGT		0.428	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
SF3B1	23451	hgsc.bcm.edu	37	2	198266128	198266128	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:198266128C>T	ENST00000335508.6	-	17	2583	c.2492G>A	c.(2491-2493)cGa>cAa	p.R831Q	SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	831					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.R831Q(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GCTTACCTGTCGGTAATTTCT	0.338			Mis		myelodysplastic syndrome																																p.R831Q			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2492A	2						.						81.0	89.0	86.0					2																	198266128		2203	4300	6503	197974373	SO:0001583	missense	23451	exon17			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2492G>A	2.37:g.198266128C>T	ENSP00000335321:p.Arg831Gln		197974373	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.690064	0.88735	.	.	ENSG00000115524	ENST00000335508	T	0.67523	-0.27	5.42	5.42	0.78866	Armadillo-type fold (1);	0.110120	0.64402	D	0.000009	T	0.73102	0.3544	M	0.90759	3.145	0.80722	D	1	P	0.38250	0.624	B	0.32090	0.14	T	0.79855	-0.1627	10	0.66056	D	0.02	.	19.2026	0.93717	0.0:1.0:0.0:0.0	.	831	O75533	SF3B1_HUMAN	Q	831	ENSP00000335321:R831Q	ENSP00000335321:R831Q	R	-	2	0	SF3B1	197974373	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.551000	0.82182	2.535000	0.85469	0.591000	0.81541	CGA		0.338	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
BMPR2	659	hgsc.bcm.edu	37	2	203420138	203420138	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:203420138C>T	ENST00000374580.4	+	12	2289	c.1750C>T	c.(1750-1752)Cga>Tga	p.R584*	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	584					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.R584*(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						GGAAAAAAACCGAAATTCAAT	0.433																																					p.R584X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1750T	2	GRCh37	CM010166	BMPR2	M		.						118.0	110.0	113.0					2																	203420138		2203	4300	6503	203128383	SO:0001587	stop_gained	659	exon12			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1750C>T	2.37:g.203420138C>T	ENSP00000363708:p.Arg584*		203128383	NM_001204	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Nonsense_Mutation	SNP	ENST00000374580.4	37	CCDS33361.1	.	.	.	.	.	.	.	.	.	.	C	40	8.346363	0.98769	.	.	ENSG00000204217	ENST00000374580	.	.	.	5.42	4.54	0.55810	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6713	0.62427	0.3374:0.6626:0.0:0.0	.	.	.	.	X	584	.	ENSP00000363708:R584X	R	+	1	2	BMPR2	203128383	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.991000	0.56973	1.276000	0.44395	-0.175000	0.13238	CGA		0.433	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257743.1	NM_001204	
PTH2R	5746	hgsc.bcm.edu	37	2	209308201	209308201	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:209308201T>C	ENST00000272847.2	+	6	851	c.638T>C	c.(637-639)cTa>cCa	p.L213P	PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	213					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.L213P(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	CTGGAGTCCCTAATAATGCAG	0.393																																					p.L213P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T638C	2						.						149.0	138.0	142.0					2																	209308201		2203	4300	6503	209016446	SO:0001583	missense	5746	exon6			BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.638T>C	2.37:g.209308201T>C	ENSP00000272847:p.Leu213Pro		209016446	NM_005048	Q8N429	Missense_Mutation	SNP	ENST00000272847.2	37	CCDS2383.1	.	.	.	.	.	.	.	.	.	.	T	16.22	3.062543	0.55432	.	.	ENSG00000144407	ENST00000272847	T	0.41758	0.99	5.08	5.08	0.68730	GPCR, family 2-like (1);	0.571998	0.13251	N	0.402103	T	0.51618	0.1685	L	0.46819	1.47	0.22096	N	0.999365	P;P	0.50272	0.933;0.86	P;P	0.56398	0.797;0.74	T	0.39981	-0.9587	10	0.34782	T	0.22	.	12.7812	0.57479	0.0:0.0:0.0:1.0	.	102;213	B4DFN8;P49190	.;PTH2R_HUMAN	P	213	ENSP00000272847:L213P	ENSP00000272847:L213P	L	+	2	0	PTH2R	209016446	0.081000	0.21417	0.122000	0.21767	0.039000	0.13416	3.284000	0.51708	1.914000	0.55421	0.477000	0.44152	CTA		0.393	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048	
TRIP12	9320	hgsc.bcm.edu	37	2	230723595	230723595	+	Missense_Mutation	SNP	C	C	T	rs188117573	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:230723595C>T	ENST00000283943.5	-	3	972	c.794G>A	c.(793-795)cGt>cAt	p.R265H	TRIP12_ENST00000389045.3_Intron|TRIP12_ENST00000389044.4_Missense_Mutation_p.R307H|TRIP12_ENST00000543084.1_Missense_Mutation_p.R307H|TRIP12_ENST00000409677.1_Missense_Mutation_p.R307H	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	265					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.R265H(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AGGGCTGAAACGAGCAGCCCA	0.478													C|||	2	0.000399361	0.0	0.0	5008	,	,		17936	0.0		0.001	False		,,,				2504	0.001				p.R265H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G794A	2						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	96.0	98.0	97.0		794	5.8	1.0	2		97	3,8597	3.0+/-9.4	0,3,4297	yes	missense	TRIP12	NM_004238.1	29	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	probably-damaging	265/1993	230723595	4,13002	2203	4300	6503	230431839	SO:0001583	missense	9320	exon3			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.794G>A	2.37:g.230723595C>T	ENSP00000283943:p.Arg265His		230431839	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	24.4	4.530869	0.85706	2.27E-4	3.49E-4	ENSG00000153827	ENST00000283943;ENST00000389044;ENST00000543084;ENST00000409677	T;T	0.48522	0.81;0.81	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.58264	0.2110	N	0.24115	0.695	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.72075	0.976;0.976;0.976	T	0.61227	-0.7105	10	0.66056	D	0.02	.	20.0182	0.97486	0.0:1.0:0.0:0.0	.	265;307;265	D4HL82;Q14CA3;Q14669	.;.;TRIPC_HUMAN	H	265;307;307;307	ENSP00000283943:R265H;ENSP00000373696:R307H	ENSP00000283943:R265H	R	-	2	0	TRIP12	230431839	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.456000	0.80751	2.738000	0.93877	0.655000	0.94253	CGT		0.478	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
DGKD	8527	hgsc.bcm.edu	37	2	234377151	234377151	+	Silent	SNP	C	C	T	rs199988457		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:234377151C>T	ENST00000264057.2	+	29	3519	c.3507C>T	c.(3505-3507)caC>caT	p.H1169H	DGKD_ENST00000409813.3_Silent_p.H1125H	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	1169	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.H1169H(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TCACACGGCACGACATCCGGG	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		17923	0.001		0.0	False		,,,				2504	0.0				p.H1169H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3507T	2						.	C	,	0,4406		0,0,2203	95.0	87.0	89.0		3375,3507	1.9	1.0	2		89	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	DGKD	NM_003648.2,NM_152879.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	1125/1171,1169/1215	234377151	1,13005	2203	4300	6503	234041890	SO:0001819	synonymous_variant	8527	exon29			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.3507C>T	2.37:g.234377151C>T			234041890	NM_152879	Q14158|Q6PK55|Q8NG53	Silent	SNP	ENST00000264057.2	37	CCDS2504.1																																																																																				0.592	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
ASAP2	8853	hgsc.bcm.edu	37	2	9496317	9496317	+	Silent	SNP	T	T	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:9496317T>G	ENST00000281419.3	+	14	1510	c.1170T>G	c.(1168-1170)tcT>tcG	p.S390S	ASAP2_ENST00000315273.4_Silent_p.S390S	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	390	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)	p.S390S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						GATGGATGTCTGTGCTGCAAA	0.408																																					p.S390S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1170G	2						.						140.0	140.0	140.0					2																	9496317		2203	4300	6503	9413768	SO:0001819	synonymous_variant	8853	exon14			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.1170T>G	2.37:g.9496317T>G			9413768	NM_001135191	D6W4Y8	Silent	SNP	ENST00000281419.3	37	CCDS1661.1																																																																																				0.408	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
PPM1G	5496	hgsc.bcm.edu	37	2	27606398	27606398	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:27606398C>T	ENST00000344034.4	-	7	1300	c.1036G>A	c.(1036-1038)Gca>Aca	p.A346T	ZNF513_ENST00000323703.6_5'Flank|PPM1G_ENST00000350803.4_Missense_Mutation_p.A346T	NM_177983.2	NP_817092.1	O15355	PPM1G_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1G	346					cell cycle arrest (GO:0007050)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.A346T(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					GAGTCTCCTGCGTTGGCTACA	0.507																																					p.A346T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1036A	2						.						118.0	103.0	108.0					2																	27606398		2203	4300	6503	27459902	SO:0001583	missense	5496	exon7			Y13936	CCDS1752.1	2p23.3	2012-04-17	2010-03-05		ENSG00000115241	ENSG00000115241	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9278	protein-coding gene	gene with protein product	"""PP2C, gamma"", ""protein phosphatase 2C, gamma isoform"""	605119	"""protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform"""			9276438	Standard	NM_177983		Approved	PP2CG, PP2Cgamma	uc002rkl.4	O15355	OTTHUMG00000097788	ENST00000344034.4:c.1036G>A	2.37:g.27606398C>T	ENSP00000342778:p.Ala346Thr		27459902	NM_177983		Missense_Mutation	SNP	ENST00000344034.4	37	CCDS1752.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.790607	0.90367	.	.	ENSG00000115241	ENST00000344034;ENST00000350803;ENST00000544412;ENST00000395543	T;T	0.10288	2.89;2.89	5.48	5.48	0.80851	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.34048	0.0884	M	0.70108	2.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.986;0.993	T	0.01914	-1.1248	10	0.56958	D	0.05	-7.7062	17.9136	0.88942	0.0:1.0:0.0:0.0	.	147;346	Q59GB2;O15355	.;PPM1G_HUMAN	T	346;346;329;147	ENSP00000342778:A346T;ENSP00000264714:A346T	ENSP00000342778:A346T	A	-	1	0	PPM1G	27459902	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.088000	0.76901	2.547000	0.85894	0.650000	0.86243	GCA		0.507	PPM1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215032.1	NM_002707	
ALK	238	hgsc.bcm.edu	37	2	29455174	29455174	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:29455174G>A	ENST00000389048.3	-	15	3534	c.2628C>T	c.(2626-2628)gcC>gcT	p.A876A	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	876	Gly-rich.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A876A(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CTTTACCTGCGGCTCCGGAAT	0.612			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.A876A		yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2628T	2						.						99.0	94.0	96.0					2																	29455174		2203	4300	6503	29308678	SO:0001819	synonymous_variant	238	exon15	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2628C>T	2.37:g.29455174G>A			29308678	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	ENST00000389048.3	37	CCDS33172.1																																																																																				0.612	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
ABCG5	64240	hgsc.bcm.edu	37	2	44051166	44051166	+	Missense_Mutation	SNP	C	C	T	rs200396635		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:44051166C>T	ENST00000260645.1	-	9	1349	c.1210G>A	c.(1210-1212)Gtt>Att	p.V404I	ABCG5_ENST00000405322.1_Missense_Mutation_p.V233I|ABCG5_ENST00000543989.1_Missense_Mutation_p.V9I	NM_022436.2	NP_071881.1	Q9H222	ABCG5_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 5	404	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)	p.V404I(1)		breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	ACCCGCAGAACGAAGAAAAGG	0.502																																					p.V404I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1210A	2						.		ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	91.0	84.0	86.0		1210	2.9	0.3	2		86	0,8600		0,0,4300	yes	missense	ABCG5	NM_022436.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	404/652	44051166	1,13005	2203	4300	6503	43904670	SO:0001583	missense	64240	exon9			T93792	CCDS1814.1	2p21	2012-03-14	2008-07-31		ENSG00000138075	ENSG00000138075		"""ATP binding cassette transporters / subfamily G"""	13886	protein-coding gene	gene with protein product	"""sterolin 1"""	605459				11099417, 11452359	Standard	NM_022436		Approved	STSL	uc002rtn.3	Q9H222	OTTHUMG00000128758	ENST00000260645.1:c.1210G>A	2.37:g.44051166C>T	ENSP00000260645:p.Val404Ile		43904670	NM_022436	Q2T9G2|Q96QZ2|Q96QZ3	Missense_Mutation	SNP	ENST00000260645.1	37	CCDS1814.1	.	.	.	.	.	.	.	.	.	.	c	0.701	-0.790925	0.02884	2.27E-4	0.0	ENSG00000138075	ENST00000260645;ENST00000405322;ENST00000543989	T;T;T	0.71341	-0.56;-0.56;1.1	5.9	2.86	0.33363	ABC-2 type transporter (1);	4.095920	0.00714	N	0.000853	T	0.60599	0.2281	N	0.14661	0.345	0.25575	N	0.986853	B;B	0.19706	0.038;0.004	B;B	0.17433	0.018;0.003	T	0.53092	-0.8487	10	0.59425	D	0.04	.	12.1444	0.54016	0.0:0.1173:0.6539:0.2288	.	233;404	E7EX35;Q9H222	.;ABCG5_HUMAN	I	404;233;9	ENSP00000260645:V404I;ENSP00000384513:V233I;ENSP00000445107:V9I	ENSP00000260645:V404I	V	-	1	0	ABCG5	43904670	1.000000	0.71417	0.317000	0.25265	0.003000	0.03518	3.069000	0.50026	0.842000	0.35045	-0.141000	0.14075	GTT		0.502	ABCG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250675.1	NM_022436	
PSME4	23198	hgsc.bcm.edu	37	2	54153153	54153153	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:54153153C>T	ENST00000404125.1	-	13	1656	c.1601G>A	c.(1600-1602)cGa>cAa	p.R534Q	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	534					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)	p.R420Q(1)		breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			ACAAAGTTCTCGTTCCACCTA	0.373																																					p.R534Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1601A	2						.						120.0	117.0	118.0					2																	54153153		2203	4300	6503	54006657	SO:0001583	missense	23198	exon13			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.1601G>A	2.37:g.54153153C>T	ENSP00000384211:p.Arg534Gln		54006657	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	C	15.63	2.890470	0.52014	.	.	ENSG00000068878	ENST00000404125	T	0.04809	3.55	5.57	3.41	0.39046	.	0.111665	0.64402	D	0.000014	T	0.02970	0.0088	N	0.17631	0.505	0.80722	D	1	B	0.33171	0.4	B	0.19391	0.025	T	0.56848	-0.7911	10	0.20046	T	0.44	.	12.2547	0.54617	0.0:0.8312:0.0:0.1688	.	534	Q14997	PSME4_HUMAN	Q	534	ENSP00000384211:R534Q	ENSP00000374643:R534Q	R	-	2	0	PSME4	54006657	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.523000	0.45580	1.313000	0.45069	0.557000	0.71058	CGA		0.373	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
PNPT1	87178	hgsc.bcm.edu	37	2	55867766	55867766	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:55867766C>T	ENST00000447944.2	-	26	2230	c.2144G>A	c.(2143-2145)cGa>cAa	p.R715Q		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	715	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)	p.R715Q(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TTTTACCTTTCGTTGATCAAG	0.313																																					p.R715Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2144A	2						.						119.0	116.0	117.0					2																	55867766		2202	4300	6502	55721270	SO:0001583	missense	87178	exon26			BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.2144G>A	2.37:g.55867766C>T	ENSP00000400646:p.Arg715Gln		55721270	NM_033109	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	37	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	C	31	5.088882	0.94100	.	.	ENSG00000138035	ENST00000447944	T	0.46451	0.87	5.72	5.72	0.89469	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.182150	0.46145	D	0.000310	T	0.55065	0.1897	L	0.51914	1.62	0.47737	D	0.999503	D	0.56968	0.978	P	0.55749	0.783	T	0.50693	-0.8798	10	0.46703	T	0.11	-0.9305	19.5695	0.95406	0.0:1.0:0.0:0.0	.	715	Q8TCS8	PNPT1_HUMAN	Q	715	ENSP00000400646:R715Q	ENSP00000393953:R715Q	R	-	2	0	PNPT1	55721270	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.467000	0.60155	2.715000	0.92844	0.549000	0.68633	CGA		0.313	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	
EFEMP1	2202	hgsc.bcm.edu	37	2	56149516	56149516	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:56149516G>A	ENST00000394555.2	-	2	495	c.60C>T	c.(58-60)acC>acT	p.T20T	EFEMP1_ENST00000355426.3_Silent_p.T20T|EFEMP1_ENST00000497698.1_5'Flank|EFEMP1_ENST00000394554.1_Silent_p.T20T|EFEMP1_ENST00000424836.2_5'UTR	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	20					epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)	p.T20T(2)		NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TGGTTTCTTCGGTGTCCTGTG	0.433																																					p.T20T	GBM(92;934 1319 7714 28760 40110)											.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C60T	2						.						163.0	147.0	152.0					2																	56149516		2203	4300	6503	56003020	SO:0001819	synonymous_variant	2202	exon3			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.60C>T	2.37:g.56149516G>A			56003020	NM_001039348	A8K3I4|B4DW75|D6W5D2|Q541U7	Silent	SNP	ENST00000394555.2	37	CCDS1857.1																																																																																				0.433	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		
SMYD5	10322	hgsc.bcm.edu	37	2	73447813	73447813	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:73447813C>T	ENST00000389501.4	+	4	415	c.370C>T	c.(370-372)Cgg>Tgg	p.R124W	SMYD5_ENST00000474652.1_3'UTR	NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	124	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.R8W(1)|p.R124W(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						TGCAGAATGTCGGTTGGCAGC	0.542																																					p.R124W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C370T	2						.						110.0	92.0	98.0					2																	73447813		2203	4300	6503	73301321	SO:0001583	missense	10322	exon4			U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.370C>T	2.37:g.73447813C>T	ENSP00000374152:p.Arg124Trp		73301321	NM_006062	D6W5H3|Q13558	Missense_Mutation	SNP	ENST00000389501.4	37	CCDS33221.2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633752	0.87660	.	.	ENSG00000135632	ENST00000389501;ENST00000443900	T	0.53423	0.62	4.81	4.81	0.61882	SET domain (2);	0.205916	0.41500	D	0.000863	T	0.67552	0.2905	M	0.85373	2.75	0.49213	D	0.999765	D	0.76494	0.999	D	0.63033	0.91	T	0.69892	-0.5022	10	0.45353	T	0.12	-5.0115	12.8589	0.57901	0.1635:0.8365:0.0:0.0	.	124	Q6GMV2	SMYD5_HUMAN	W	124;97	ENSP00000374152:R124W	ENSP00000374152:R124W	R	+	1	2	SMYD5	73301321	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.500000	0.45381	2.665000	0.90641	0.563000	0.77884	CGG		0.542	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318301.1	NM_006062	
KDM3A	55818	hgsc.bcm.edu	37	2	86683566	86683566	+	Splice_Site	SNP	T	T	C	rs201676265		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:86683566T>C	ENST00000409556.1	+	7	923	c.558T>C	c.(556-558)ggT>ggC	p.G186G	KDM3A_ENST00000312912.5_Splice_Site_p.G186G|KDM3A_ENST00000409064.1_Splice_Site_p.G186G|KDM3A_ENST00000542128.1_Splice_Site_p.G134G			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	186					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						ttttttAAGGTGACAAAAACT	0.308																																					p.G186G	NSCLC(96;1150 1523 6936 46253 49736)											.	.	0			c.T558C	2						.						21.0	22.0	22.0					2																	86683566		2199	4295	6494	86537077	SO:0001630	splice_region_variant	55818	exon6			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.557-1T>C	2.37:g.86683566T>C			86537077	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	ENST00000409556.1	37	CCDS1990.1																																																																																				0.308	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	Silent
SNRNP200	23020	hgsc.bcm.edu	37	2	96949678	96949678	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:96949678C>T	ENST00000323853.5	-	32	4534	c.4457G>A	c.(4456-4458)cGc>cAc	p.R1486H	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1486	Helicase ATP-binding 2. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.R1486H(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TGCCACAATGCGAATGGGCCG	0.587																																					p.R1486H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4457A	2						.						48.0	37.0	41.0					2																	96949678		2203	4300	6503	96313405	SO:0001583	missense	23020	exon32			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.4457G>A	2.37:g.96949678C>T	ENSP00000317123:p.Arg1486His		96313405	NM_014014	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	C	34	5.292224	0.95546	.	.	ENSG00000144028	ENST00000323853;ENST00000543553	T	0.37752	1.18	5.12	5.12	0.69794	DEAD-like helicase (2);ATPase, AAA+ type, core (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.73636	0.3612	H	0.97077	3.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.83846	0.0260	10	0.87932	D	0	-13.2889	17.3354	0.87278	0.0:1.0:0.0:0.0	.	1237;1486	A4FU77;O75643	.;U520_HUMAN	H	1486;69	ENSP00000317123:R1486H	ENSP00000317123:R1486H	R	-	2	0	SNRNP200	96313405	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.466000	0.80914	2.393000	0.81446	0.561000	0.74099	CGC		0.587	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
COL6A3	1293	hgsc.bcm.edu	37	2	238274436	238274436	+	Missense_Mutation	SNP	G	G	A	rs201938007		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr2:238274436G>A	ENST00000295550.4	-	12	6195	c.5743C>T	c.(5743-5745)Cgg>Tgg	p.R1915W	COL6A3_ENST00000409809.1_Missense_Mutation_p.R1709W|COL6A3_ENST00000353578.4_Missense_Mutation_p.R1709W|COL6A3_ENST00000346358.4_Missense_Mutation_p.R1715W|COL6A3_ENST00000472056.1_Missense_Mutation_p.R1308W|COL6A3_ENST00000347401.3_Missense_Mutation_p.R1714W	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1915	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R1915W(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CGCATGTTCCGGAACTTCTCG	0.617																																					p.R1308W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3922T	2						.						81.0	76.0	78.0					2																	238274436		2203	4300	6503	237939175	SO:0001583	missense	1293	exon9			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5743C>T	2.37:g.238274436G>A	ENSP00000295550:p.Arg1915Trp		237939175	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.908810	0.33721	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05	5.34	5.34	0.76211	von Willebrand factor, type A (2);	0.543501	0.16574	N	0.208461	T	0.49457	0.1558	N	0.22421	0.69	0.35546	D	0.803469	D;D;D	0.89917	1.0;1.0;0.996	D;D;P	0.70935	0.948;0.971;0.53	T	0.59134	-0.7511	10	0.72032	D	0.01	.	12.7377	0.57234	0.0754:0.0:0.9246:0.0	.	1308;1709;1915	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	W	1915;1714;1709;1308;1709;1715	ENSP00000295550:R1915W;ENSP00000315609:R1714W;ENSP00000315873:R1709W;ENSP00000418285:R1308W;ENSP00000386844:R1709W;ENSP00000295546:R1715W	ENSP00000295550:R1915W	R	-	1	2	COL6A3	237939175	1.000000	0.71417	0.925000	0.36789	0.681000	0.39784	4.686000	0.61700	2.665000	0.90641	0.655000	0.94253	CGG		0.617	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
MSANTD3	91283	hgsc.bcm.edu	37	9	103204553	103204553	+	Silent	SNP	C	C	T	rs191944797		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr9:103204553C>T	ENST00000395067.2	+	2	604	c.333C>T	c.(331-333)atC>atT	p.I111I	MSANTD3_ENST00000374885.1_Silent_p.I111I|TMEFF1_ENST00000334943.6_5'Flank|MSANTD3_ENST00000489377.1_3'UTR|MSANTD3-TMEFF1_ENST00000502978.1_Missense_Mutation_p.R1C	NM_001198805.1|NM_001198806.1|NM_080655.2	NP_001185734.1|NP_001185735.1|NP_542386.1	Q96H12	MSD3_HUMAN	Myb/SANT-like DNA-binding domain containing 3	111								p.I111I(1)		endometrium(2)|lung(2)	4						AGGAGAAGATCGCCAGCATGC	0.582													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15175	0.0		0.0	False		,,,				2504	0.0				p.I111I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C333T	9						.						42.0	40.0	41.0					9																	103204553		2203	4300	6503	102244374	SO:0001819	synonymous_variant	91283	exon2			BC008993	CCDS6749.1, CCDS56579.1	9q31.1	2012-03-13	2012-03-13	2012-03-13	ENSG00000066697	ENSG00000066697			23370	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 30"""	C9orf30			Standard	NM_080655		Approved	MGC17337		Q96H12	OTTHUMG00000020365	ENST00000395067.2:c.333C>T	9.37:g.103204553C>T			102244374	NM_080655	B2RC35|Q5T726|Q5T727|Q5T728	Silent	SNP	ENST00000395067.2	37	CCDS6749.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	19.48	3.835139	0.71373	.	.	ENSG00000251349	ENST00000502978	.	.	.	5.92	-7.28	0.01456	.	.	.	.	.	T	0.53400	0.1794	.	.	.	0.46336	D	0.998998	.	.	.	.	.	.	T	0.59526	-0.7438	4	.	.	.	-7.9668	12.0214	0.53346	0.0:0.2342:0.0891:0.6767	.	.	.	.	C	1	.	.	R	+	1	0	C9orf30-TMEFF1	102244374	0.225000	0.23685	0.031000	0.17742	0.984000	0.73092	-0.948000	0.03897	-1.466000	0.01897	-0.302000	0.09304	CGC		0.582	MSANTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053410.1	NM_080655	
PAPPA	5069	hgsc.bcm.edu	37	9	118949999	118949999	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr9:118949999G>A	ENST00000328252.3	+	2	1351	c.982G>A	c.(982-984)Gga>Aga	p.G328R	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	328	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G328R(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TCCTCTGTGCGGACAGACATT	0.572																																					p.G328R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G982A	9						.						73.0	68.0	70.0					9																	118949999		2203	4300	6503	117989820	SO:0001583	missense	5069	exon2				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.982G>A	9.37:g.118949999G>A	ENSP00000330658:p.Gly328Arg		117989820	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.987300	0.74589	.	.	ENSG00000182752	ENST00000328252	T	0.61040	0.14	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.80529	0.4640	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82305	-0.0523	10	0.87932	D	0	-20.1355	20.2422	0.98381	0.0:0.0:1.0:0.0	.	328	Q13219	PAPP1_HUMAN	R	328	ENSP00000330658:G328R	ENSP00000330658:G328R	G	+	1	0	PAPPA	117989820	1.000000	0.71417	0.973000	0.42090	0.525000	0.34531	9.818000	0.99354	2.782000	0.95742	0.655000	0.94253	GGA		0.572	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
ZER1	10444	hgsc.bcm.edu	37	9	131517732	131517732	+	Missense_Mutation	SNP	G	G	A	rs540575103		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr9:131517732G>A	ENST00000291900.2	-	2	519	c.113C>T	c.(112-114)cCg>cTg	p.P38L	ZER1_ENST00000494461.1_Intron	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	38					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)	p.P38L(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						GAAGATGTCCGGATGTAGCCG	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		22002	0.001		0.0	False		,,,				2504	0.0				p.P38L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C113T	9						.						138.0	122.0	128.0					9																	131517732		2203	4300	6503	130557553	SO:0001583	missense	10444	exon2			X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.113C>T	9.37:g.131517732G>A	ENSP00000291900:p.Pro38Leu		130557553	NM_006336	O00156|Q5T272|Q5T273	Missense_Mutation	SNP	ENST00000291900.2	37	CCDS6910.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.005370	0.93287	.	.	ENSG00000160445	ENST00000291900;ENST00000414921;ENST00000427848	T	0.44482	0.92	5.51	5.51	0.81932	.	0.053208	0.85682	D	0.000000	T	0.41003	0.1140	L	0.29908	0.895	0.80722	D	1	D	0.58268	0.982	P	0.47102	0.537	T	0.16305	-1.0407	10	0.41790	T	0.15	-15.6742	18.7539	0.91825	0.0:0.0:1.0:0.0	.	38	Q7Z7L7	ZER1_HUMAN	L	38	ENSP00000291900:P38L	ENSP00000291900:P38L	P	-	2	0	ZER1	130557553	1.000000	0.71417	0.972000	0.41901	0.970000	0.65996	9.148000	0.94652	2.745000	0.94114	0.655000	0.94253	CCG		0.587	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054491.1	NM_006336	
PTPDC1	138639	hgsc.bcm.edu	37	9	96860136	96860136	+	Missense_Mutation	SNP	C	C	T	rs142408898		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr9:96860136C>T	ENST00000375360.3	+	7	1466	c.1126C>T	c.(1126-1128)Cgg>Tgg	p.R376W	PTPDC1_ENST00000288976.3_Missense_Mutation_p.R428W	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	376					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R376W(2)|p.R428W(2)		endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						TTGGAAAAGGCGGAATGTTGA	0.512													.|||	1	0.000199681	0.0	0.0	5008	,	,		21270	0.0		0.001	False		,,,				2504	0.0				p.R428W												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C1282T	9						.	C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	62.0	65.0	64.0		1282,1126	1.8	1.0	9	dbSNP_134	64	3,8597		0,3,4297	yes	missense,missense	PTPDC1	NM_152422.3,NM_177995.1	101,101	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging,probably-damaging	428/807,376/755	96860136	3,13003	2203	4300	6503	95899957	SO:0001583	missense	138639	exon6			BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.1126C>T	9.37:g.96860136C>T	ENSP00000364509:p.Arg376Trp		95899957	NM_152422	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	37	CCDS6707.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	.	18.52	3.642154	0.67244	0.0	3.49E-4	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.16073	2.38;2.37	5.93	1.79	0.24919	.	0.250728	0.39615	N	0.001318	T	0.39809	0.1092	M	0.78916	2.43	0.42954	D	0.994387	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.991;0.996;0.991;0.991	T	0.20773	-1.0265	10	0.87932	D	0	-17.659	11.3461	0.49561	0.5178:0.3784:0.1038:0.0	.	430;428;430;376	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	W	376;428	ENSP00000364509:R376W;ENSP00000288976:R428W	ENSP00000288976:R428W	R	+	1	2	PTPDC1	95899957	0.997000	0.39634	0.998000	0.56505	0.987000	0.75469	1.021000	0.30040	0.055000	0.16094	0.655000	0.94253	CGG		0.512	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422	
PTCH1	5727	hgsc.bcm.edu	37	9	98229625	98229625	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr9:98229625G>A	ENST00000331920.6	-	15	2632	c.2333C>T	c.(2332-2334)aCg>aTg	p.T778M	PTCH1_ENST00000430669.2_Missense_Mutation_p.T712M|PTCH1_ENST00000375274.2_Missense_Mutation_p.T777M|PTCH1_ENST00000418258.1_Missense_Mutation_p.T627M|PTCH1_ENST00000437951.1_Missense_Mutation_p.T712M|PTCH1_ENST00000429896.2_Missense_Mutation_p.T627M|PTCH1_ENST00000421141.1_Missense_Mutation_p.T627M	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	778					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.T778M(2)|p.T777M(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TACAATGTCCGTAAGGTCCAG	0.473																																					p.T627M												PTCH1,skin,face,Substitution - coding silent,+1	.	3	Substitution - Missense(3)	large_intestine(3)	c.C1880T	9	GRCh37	CI972684	PTCH1	I		.						103.0	103.0	103.0					9																	98229625		2203	4300	6503	97269446	SO:0001583	missense	5727	exon15			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2333C>T	9.37:g.98229625G>A	ENSP00000332353:p.Thr778Met		97269446	NM_001083605	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	ENST00000331920.6	37	CCDS6714.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.742987	0.89573	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000375275;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.90732	-2.72;-2.71;-2.7;-2.7;-2.71;-2.7;-2.72	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.94535	0.8240	M	0.71036	2.16	0.80722	D	1	D;D;D	0.69078	0.997;0.994;0.996	P;P;P	0.61592	0.891;0.803;0.883	D	0.94031	0.7301	10	0.52906	T	0.07	-14.1169	19.894	0.96945	0.0:0.0:1.0:0.0	.	712;777;778	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	M	778;712;627;627;214;712;627;777	ENSP00000332353:T778M;ENSP00000389744:T712M;ENSP00000399981:T627M;ENSP00000396135:T627M;ENSP00000410287:T712M;ENSP00000414823:T627M;ENSP00000364423:T777M	ENSP00000332353:T778M	T	-	2	0	PTCH1	97269446	1.000000	0.71417	0.970000	0.41538	0.973000	0.67179	9.476000	0.97823	2.700000	0.92200	0.591000	0.81541	ACG		0.473	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
DENND1A	57706	hgsc.bcm.edu	37	9	126146132	126146133	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	AC	AC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr9:126146132_126146133delAC	ENST00000373624.2	-	21	1838_1839	c.1637_1638delGT	c.(1636-1638)agtfs	p.S546fs	DENND1A_ENST00000542603.1_Frame_Shift_Del_p.S331fs|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394219.3_Frame_Shift_Del_p.S557fs	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	546					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.S546fs*17(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						GCTGCTCTGGACTCTCTGCCTC	0.649																																					p.546_546del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1637_1638del	9						.																																			125185954	SO:0001589	frameshift_variant	57706	exon21			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.1637_1638delGT	9.37:g.126146132_126146133delAC	ENSP00000362727:p.Ser546fs		125185953	NM_020946	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Frame_Shift_Del	DEL	ENST00000373624.2	37	CCDS35133.1																																																																																				0.649	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820	
ADAMTS13	11093	hgsc.bcm.edu	37	9	136307538	136307538	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr9:136307538G>A	ENST00000371929.3	+	17	2431	c.1987G>A	c.(1987-1989)Gag>Aag	p.E663K	ADAMTS13_ENST00000355699.2_Missense_Mutation_p.E663K|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000485925.1_Intron|ADAMTS13_ENST00000536611.1_Intron|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.E632K	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	663	Spacer.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E663K(1)		central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCGGTATGGCGAGGAGTATGG	0.622																																					p.E663K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1987A	9						.						112.0	89.0	97.0					9																	136307538		2203	4300	6503	135297359	SO:0001583	missense	11093	exon17			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1987G>A	9.37:g.136307538G>A	ENSP00000360997:p.Glu663Lys		135297359	NM_139025	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	37	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	G	0.100	-1.153816	0.01700	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589	T;T;T	0.68025	-0.25;-0.3;-0.29	5.24	1.98	0.26296	.	.	.	.	.	T	0.46814	0.1412	L	0.43152	1.355	0.09310	N	0.999998	B;B;B	0.26602	0.095;0.154;0.154	B;B;B	0.15052	0.005;0.012;0.012	T	0.29088	-1.0023	9	0.07030	T	0.85	.	3.2618	0.06851	0.4154:0.2105:0.3741:0.0	.	663;632;663	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	K	663;663;632	ENSP00000360997:E663K;ENSP00000347927:E663K;ENSP00000348997:E632K	ENSP00000347927:E663K	E	+	1	0	ADAMTS13	135297359	0.421000	0.25465	0.023000	0.16930	0.030000	0.12068	2.259000	0.43259	0.611000	0.30052	-0.229000	0.12294	GAG		0.622	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
POLR1D	51082	hgsc.bcm.edu	37	13	28197152	28197152	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr13:28197152G>A	ENST00000302979.3	+	3	1189	c.167G>A	c.(166-168)cGt>cAt	p.R56H	POLR1D_ENST00000465887.1_Intron|POLR1D_ENST00000399697.3_Intron|POLR1D_ENST00000399696.1_Missense_Mutation_p.R56H|LNX2_ENST00000316334.3_5'Flank	NM_015972.3	NP_057056.1	Q9Y2S0	RPAC2_HUMAN	polymerase (RNA) I polypeptide D, 16kDa	56			R -> C (in TCS2). {ECO:0000269|PubMed:21131976}.		gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.R56H(1)		endometrium(1)|large_intestine(1)|lung(4)|stomach(2)	8		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0758)|OV - Ovarian serous cystadenocarcinoma(117;0.1)|Epithelial(112;0.213)		AATTCTCTACGTTACATGATC	0.453																																					p.R56H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G167A	13						.						106.0	105.0	105.0					13																	28197152		2203	4300	6503	27095152	SO:0001583	missense	51082	exon2			AF077044, BC018528	CCDS9324.1, CCDS9325.1, CCDS73555.1	13q12.2	2013-01-21			ENSG00000186184	ENSG00000186184		"""RNA polymerase subunits"""	20422	protein-coding gene	gene with protein product		613715				11042152, 12391170	Standard	NM_015972		Approved	RPAC2, RPA16, RPO1-3, RPA9, MGC9850	uc001urp.3	Q9Y2S0	OTTHUMG00000016635	ENST00000302979.3:c.167G>A	13.37:g.28197152G>A	ENSP00000302478:p.Arg56His		27095152	NM_015972	Q5TBX2|Q96BR3	Missense_Mutation	SNP	ENST00000302979.3	37	CCDS9325.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062904	0.76187	.	.	ENSG00000186184	ENST00000302979;ENST00000399696	D;D	0.94232	-3.38;-3.38	4.42	2.67	0.31697	DNA-directed RNA polymerase, dimerisation (1);DNA-directed RNA polymerase, RBP11-like (1);DNA-directed RNA polymerase Rpb11, 13-16kDa subunit, conserved site (1);	.	.	.	.	D	0.96204	0.8762	M	0.88310	2.945	0.39235	D	0.963748	D	0.89917	1.0	D	0.97110	1.0	D	0.95122	0.8247	9	0.72032	D	0.01	-7.0669	6.3488	0.21365	0.0987:0.1846:0.7167:0.0	.	56	Q9Y2S0	RPAC2_HUMAN	H	56	ENSP00000302478:R56H;ENSP00000382603:R56H	ENSP00000302478:R56H	R	+	2	0	POLR1D	27095152	1.000000	0.71417	0.984000	0.44739	0.997000	0.91878	7.223000	0.78033	0.801000	0.34066	0.650000	0.86243	CGT		0.453	POLR1D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044305.1	NM_015972, NM_152705	
VWA8	23078	hgsc.bcm.edu	37	13	42407654	42407654	+	Missense_Mutation	SNP	C	C	T	rs369778717		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr13:42407654C>T	ENST00000379310.3	-	13	1507	c.1439G>A	c.(1438-1440)cGt>cAt	p.R480H	VWA8_ENST00000281496.6_Missense_Mutation_p.R480H	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	480						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.R480H(1)									TAGCAGATCACGCGCTGTCAT	0.478																																					p.R480H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1439A	13						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	66.0	55.0	59.0		1439,1439	5.4	0.9	13		59	0,8600		0,0,4300	no	missense,missense	KIAA0564	NM_001009814.1,NM_015058.1	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	480/1040,480/1906	42407654	1,13005	2203	4300	6503	41305654	SO:0001583	missense	23078	exon13			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.1439G>A	13.37:g.42407654C>T	ENSP00000368612:p.Arg480His		41305654	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	37	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.779278	0.90195	2.27E-4	0.0	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496	T;T	0.55930	0.49;0.49	5.44	5.44	0.79542	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	T	0.77955	0.4208	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81364	-0.0966	10	0.87932	D	0	.	19.6313	0.95704	0.0:1.0:0.0:0.0	.	480	A3KMH1	K0564_HUMAN	H	384;480;480	ENSP00000368612:R480H;ENSP00000281496:R480H	ENSP00000251030:R384H	R	-	2	0	KIAA0564	41305654	1.000000	0.71417	0.944000	0.38274	0.577000	0.36160	7.670000	0.83925	2.715000	0.92844	0.655000	0.94253	CGT		0.478	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
DGKH	160851	hgsc.bcm.edu	37	13	42742607	42742607	+	Missense_Mutation	SNP	C	C	T	rs369204515		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr13:42742607C>T	ENST00000337343.4	+	10	1171	c.1150C>T	c.(1150-1152)Cgg>Tgg	p.R384W	DGKH_ENST00000379274.2_Missense_Mutation_p.R248W|DGKH_ENST00000536612.1_Missense_Mutation_p.R248W|DGKH_ENST00000540693.1_Missense_Mutation_p.R384W|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000538674.1_Missense_Mutation_p.R139W|DGKH_ENST00000261491.5_Missense_Mutation_p.R384W	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	384	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.R384W(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TGACAATTTCCGGATTCTTGT	0.318																																					p.R384W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1150T	13						.	C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	92.0	90.0	91.0		1150,742,742,1150,1150	4.7	1.0	13		91	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	DGKH	NM_001204504.1,NM_001204505.1,NM_001204506.1,NM_152910.4,NM_178009.3	101,101,101,101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	384/1165,248/1101,248/1085,384/1165,384/1221	42742607	1,13005	2203	4300	6503	41640607	SO:0001583	missense	160851	exon10			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.1150C>T	13.37:g.42742607C>T	ENSP00000337572:p.Arg384Trp		41640607	NM_178009	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	37	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.381986	0.61845	0.0	1.16E-4	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	5.56	4.72	0.59763	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.73418	0.3584	H	0.96111	3.77	0.54753	D	0.999986	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.998;1.0	T	0.80661	-0.1283	10	0.87932	D	0	.	11.1672	0.48550	0.0:0.8409:0.0:0.1591	.	139;248;384;384	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	W	384;384;384;248;248;139	ENSP00000440823:R384W;ENSP00000337572:R384W;ENSP00000261491:R384W;ENSP00000368576:R248W;ENSP00000445114:R248W;ENSP00000441308:R139W	ENSP00000261491:R384W	R	+	1	2	DGKH	41640607	1.000000	0.71417	1.000000	0.80357	0.612000	0.37316	2.610000	0.46325	1.357000	0.45904	-0.251000	0.11542	CGG		0.318	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
ZC3H13	23091	hgsc.bcm.edu	37	13	46562939	46562939	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr13:46562939C>T	ENST00000242848.4	-	9	1586	c.1238G>A	c.(1237-1239)cGc>cAc	p.R413H	ZC3H13_ENST00000282007.3_Missense_Mutation_p.R413H			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	413	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R413H(1)		cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		CCTTTCATGGCGTCGATCATG	0.423																																					p.R413H	Esophageal Squamous(187;747 2077 11056 31291 44172)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1238A	13						.						135.0	115.0	122.0					13																	46562939		2203	4300	6503	45460940	SO:0001583	missense	23091	exon9			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1238G>A	13.37:g.46562939C>T	ENSP00000242848:p.Arg413His		45460940	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	C	16.32	3.091259	0.55968	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	T;T	0.43294	2.1;0.95	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000005	T	0.57519	0.2059	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.58317	-0.7657	10	0.72032	D	0.01	.	20.0804	0.97772	0.0:1.0:0.0:0.0	.	413;413	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	H	413;413;229	ENSP00000242848:R413H;ENSP00000282007:R413H	ENSP00000242848:R413H	R	-	2	0	ZC3H13	45460940	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.255000	0.72466	2.738000	0.93877	0.655000	0.94253	CGC		0.423	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
PCDH17	27253	hgsc.bcm.edu	37	13	58206724	58206724	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr13:58206724C>T	ENST00000377918.3	+	1	70	c.44C>T	c.(43-45)gCc>gTc	p.A15V		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	15					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A15V(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TGGGCCCCTGCCCTCACTCTC	0.602																																					p.A15V	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C44T	13						.						52.0	47.0	49.0					13																	58206724		2203	4300	6503	57104725	SO:0001583	missense	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.44C>T	13.37:g.58206724C>T	ENSP00000367151:p.Ala15Val		57104725	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.302934	0.40795	.	.	ENSG00000118946	ENST00000377918	T	0.13089	2.62	5.55	3.82	0.43975	Cadherin (1);Cadherin-like (1);	0.141958	0.64402	N	0.000005	T	0.13927	0.0337	L	0.46741	1.465	0.52501	D	0.999959	B;B	0.17667	0.023;0.014	B;B	0.28709	0.093;0.015	T	0.05869	-1.0859	9	.	.	.	.	11.2545	0.49045	0.0:0.8039:0.1279:0.0681	.	15;15	O14917-2;O14917	.;PCD17_HUMAN	V	15	ENSP00000367151:A15V	.	A	+	2	0	PCDH17	57104725	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.897000	0.56273	0.898000	0.36418	0.655000	0.94253	GCC		0.602	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
FAM204A	63877	hgsc.bcm.edu	37	10	120095078	120095078	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:120095078G>A	ENST00000369183.4	-	4	569	c.310C>T	c.(310-312)Cgc>Tgc	p.R104C	FAM204A_ENST00000369172.4_Missense_Mutation_p.R104C|FAM204A_ENST00000469758.1_5'UTR	NM_022063.2	NP_071346.1	Q9H8W3	F204A_HUMAN	family with sequence similarity 204, member A	104								p.R104C(1)		kidney(1)|large_intestine(5)|lung(4)|ovary(1)	11						TTTCTGGAGCGTTTTCTTCTT	0.308																																					p.R104C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C310T	10						.						98.0	90.0	93.0					10																	120095078		2201	4300	6501	120085068	SO:0001583	missense	63877	exon3			AK023250	CCDS7605.1	10q26.12	2011-06-01	2011-06-01	2011-06-01	ENSG00000165669	ENSG00000165669			25794	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 84"""	C10orf84		12477932	Standard	NM_022063		Approved	FLJ13188, bA319I23.1	uc010qss.1	Q9H8W3	OTTHUMG00000019131	ENST00000369183.4:c.310C>T	10.37:g.120095078G>A	ENSP00000358183:p.Arg104Cys		120085068	NM_001134672	D3DRC6|Q5T373|Q9H5V5	Missense_Mutation	SNP	ENST00000369183.4	37	CCDS7605.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.478827	0.26511	.	.	ENSG00000165669	ENST00000369183;ENST00000369172;ENST00000369170	.	.	.	6.17	3.36	0.38483	.	0.117382	0.56097	N	0.000023	T	0.60077	0.2241	M	0.78049	2.395	0.58432	D	0.999997	B	0.29805	0.257	B	0.26202	0.067	T	0.59705	-0.7404	9	0.87932	D	0	0.3053	9.3835	0.38329	0.2225:0.0:0.7775:0.0	.	104	Q9H8W3	F204A_HUMAN	C	104	.	ENSP00000358168:R104C	R	-	1	0	FAM204A	120085068	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.373000	0.66162	0.495000	0.27882	-0.136000	0.14681	CGC		0.308	FAM204A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050596.2	NM_022063	
EIF3A	8661	hgsc.bcm.edu	37	10	120824934	120824934	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:120824934G>A	ENST00000369144.3	-	7	1226	c.1099C>T	c.(1099-1101)Cga>Tga	p.R367*	EIF3A_ENST00000541549.1_Nonsense_Mutation_p.R333*	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)	p.R367*(1)		endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		AGGCCAATTCGTGTCGGTGGG	0.393																																					p.R367X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1099T	10						.						116.0	109.0	111.0					10																	120824934		2203	4300	6503	120814924	SO:0001587	stop_gained	8661	exon7			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.1099C>T	10.37:g.120824934G>A	ENSP00000358140:p.Arg367*		120814924	NM_003750	B7ZBG9|Q6IBN8|Q96TD5	Nonsense_Mutation	SNP	ENST00000369144.3	37	CCDS7608.1	.	.	.	.	.	.	.	.	.	.	G	37	6.349487	0.97494	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	.	.	.	5.57	5.57	0.84162	.	0.241233	0.20888	N	0.083874	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.3151	19.9152	0.97057	0.0:0.0:1.0:0.0	.	.	.	.	X	367;333	.	ENSP00000358140:R367X	R	-	1	2	EIF3A	120814924	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.725000	0.98778	2.784000	0.95788	0.585000	0.79938	CGA		0.393	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750	
BTBD16	118663	hgsc.bcm.edu	37	10	124036355	124036355	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:124036355G>A	ENST00000260723.4	+	3	319	c.68G>A	c.(67-69)cGt>cAt	p.R23H	BTBD16_ENST00000368994.2_Missense_Mutation_p.R24H	NM_144587.2	NP_653188.2	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	23								p.R23H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(3)|skin(2)|stomach(1)|urinary_tract(1)	15		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				AACCGGTGGCGTTTGCCCAAA	0.502																																					p.R23H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G68A	10						.						107.0	102.0	104.0					10																	124036355		2203	4300	6503	124026345	SO:0001583	missense	118663	exon3			AK058088	CCDS31301.1	10q26.13	2013-01-24	2006-07-04	2006-07-04	ENSG00000138152	ENSG00000138152		"""BTB/POZ domain containing"""	26340	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 87"""	C10orf87			Standard	NM_144587		Approved	FLJ25359, Em:AC061711.1	uc001lgc.1	Q32M84	OTTHUMG00000019182	ENST00000260723.4:c.68G>A	10.37:g.124036355G>A	ENSP00000260723:p.Arg23His		124026345	NM_144587	A6NM63|Q4VXL1|Q96LN0	Missense_Mutation	SNP	ENST00000260723.4	37	CCDS31301.1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.563450	0.65651	.	.	ENSG00000138152	ENST00000260723;ENST00000368994	T;T	0.36520	1.26;1.25	4.9	2.05	0.26809	.	0.237922	0.30762	N	0.008931	T	0.52869	0.1761	M	0.73962	2.25	0.30078	N	0.809447	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.982	T	0.52049	-0.8627	10	0.62326	D	0.03	-2.8555	6.7051	0.23246	0.2904:0.0:0.7096:0.0	.	24;23	Q32M84-2;Q32M84	.;BTBDG_HUMAN	H	23;24	ENSP00000260723:R23H;ENSP00000357990:R24H	ENSP00000260723:R23H	R	+	2	0	BTBD16	124026345	0.998000	0.40836	0.903000	0.35520	0.845000	0.48019	1.769000	0.38522	0.363000	0.24346	-0.141000	0.14075	CGT		0.502	BTBD16-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050780.3	NM_144587	
FANK1	92565	hgsc.bcm.edu	37	10	127697035	127697035	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:127697035G>A	ENST00000368693.1	+	8	869	c.765G>A	c.(763-765)tcG>tcA	p.S255S	FANK1_ENST00000368695.1_Silent_p.S249S|FANK1_ENST00000477963.1_3'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	255						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S255S(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				CTGCGGTGTCGGGAAATCAGA	0.532																																					p.S255S												.	.	2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	c.G765A	10						.						113.0	110.0	111.0					10																	127697035		2203	4300	6503	127687025	SO:0001819	synonymous_variant	92565	exon8			BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.765G>A	10.37:g.127697035G>A			127687025	NM_145235	Q6UXY9|Q6X7T6	Silent	SNP	ENST00000368693.1	37	CCDS31309.1	.	.	.	.	.	.	.	.	.	.	G	0.527	-0.859534	0.02610	.	.	ENSG00000203780	ENST00000456942	.	.	.	5.62	-11.2	0.00127	.	.	.	.	.	T	0.32194	0.0821	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46219	-0.9207	4	.	.	.	-13.9202	1.9821	0.03429	0.4587:0.2082:0.1125:0.2206	.	.	.	.	Q	150	.	.	R	+	2	0	FANK1	127687025	0.000000	0.05858	0.006000	0.13384	0.104000	0.19210	-3.541000	0.00437	-3.551000	0.00142	-0.140000	0.14226	CGG		0.532	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
C10orf90	118611	hgsc.bcm.edu	37	10	128202503	128202503	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:128202503G>A	ENST00000284694.7	-	2	148	c.28C>T	c.(28-30)Cgg>Tgg	p.R10W	C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000544758.1_Missense_Mutation_p.R107W|C10orf90_ENST00000356858.3_De_novo_Start_OutOfFrame|C10orf90_ENST00000392694.1_De_novo_Start_OutOfFrame|C10orf90_ENST00000454341.1_Missense_Mutation_p.R10W	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	10					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.R10W(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TAGCTGTCCCGTAATCCTAGG	0.343																																					p.R10W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C28T	10						.						145.0	134.0	137.0					10																	128202503		2203	4300	6503	128192493	SO:0001583	missense	118611	exon2			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.28C>T	10.37:g.128202503G>A	ENSP00000284694:p.Arg10Trp		128192493	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	37	CCDS31310.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.615126	0.28712	.	.	ENSG00000154493	ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642	T;T;T;T	0.20069	2.11;2.1;2.11;2.11	5.2	2.04	0.26737	.	1.179070	0.06493	N	0.735003	T	0.20210	0.0486	L	0.54323	1.7	0.09310	N	0.999998	B;B;B	0.25007	0.01;0.116;0.01	B;B;B	0.15484	0.003;0.013;0.003	T	0.32052	-0.9921	10	0.87932	D	0	-0.6891	4.4792	0.11759	0.1985:0.0:0.6307:0.1708	.	107;107;10	F5GZL2;B4DMQ6;Q96M02	.;.;CJ090_HUMAN	W	10;10;107;10	ENSP00000284694:R10W;ENSP00000398786:R10W;ENSP00000444369:R107W;ENSP00000405995:R10W	ENSP00000284694:R10W	R	-	1	2	C10orf90	128192493	0.000000	0.05858	0.001000	0.08648	0.080000	0.17528	0.432000	0.21461	0.243000	0.21327	0.643000	0.83706	CGG		0.343	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
FBXO18	84893	hgsc.bcm.edu	37	10	5978482	5978482	+	Missense_Mutation	SNP	G	G	A	rs371208439		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:5978482G>A	ENST00000362091.4	+	20	3008	c.2893G>A	c.(2893-2895)Gtg>Atg	p.V965M	FBXO18_ENST00000379999.5_Missense_Mutation_p.V1016M|FBXO18_ENST00000397269.3_Missense_Mutation_p.V469M|RP11-536K7.3_ENST00000397264.4_RNA	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	965					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)	p.V1016M(1)		NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GCGCTGCTGCGTGGGACAGTG	0.507																																					p.V1016M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3046A	10						.	G	MET/VAL,MET/VAL	0,4406		0,0,2203	191.0	119.0	143.0		3046,2893	4.9	1.0	10		143	2,8598		0,2,4298	no	missense,missense	FBXO18	NM_032807.3,NM_178150.1	21,21	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	1016/1095,965/1044	5978482	2,13004	2203	4300	6503	6018488	SO:0001583	missense	84893	exon21			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2893G>A	10.37:g.5978482G>A	ENSP00000355415:p.Val965Met		6018488	NM_032807	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	ENST00000362091.4	37	CCDS7072.1	.	.	.	.	.	.	.	.	.	.	.	17.08	3.299036	0.60195	0.0	2.33E-4	ENSG00000134452	ENST00000397269;ENST00000362091;ENST00000379999	.	.	.	4.87	4.87	0.63330	.	0.361216	0.27117	N	0.020841	T	0.50888	0.1642	N	0.24115	0.695	0.32127	N	0.587248	D;D;D	0.76494	0.999;0.998;0.995	D;P;P	0.63192	0.912;0.681;0.681	T	0.59408	-0.7460	9	0.52906	T	0.07	-17.3933	13.0388	0.58887	0.0:0.1624:0.8376:0.0	.	1016;965;891	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	M	469;965;1016	.	ENSP00000355415:V965M	V	+	1	0	FBXO18	6018488	1.000000	0.71417	0.999000	0.59377	0.583000	0.36354	3.743000	0.55104	2.403000	0.81681	0.454000	0.30748	GTG		0.507	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
HSPA14	51182	hgsc.bcm.edu	37	10	14896241	14896241	+	Silent	SNP	A	A	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:14896241A>G	ENST00000378372.3	+	9	1091	c.852A>G	c.(850-852)tcA>tcG	p.S284S		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	284					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.S284S(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						TTCTTGACTCATTATATGAAG	0.353																																					p.S284S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A852G	10						.						127.0	124.0	125.0					10																	14896241		2203	4300	6503	14936247	SO:0001819	synonymous_variant	51182	exon9			AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.852A>G	10.37:g.14896241A>G			14936247	NM_016299	A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Silent	SNP	ENST00000378372.3	37	CCDS7103.1																																																																																				0.353	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046910.1	NM_016299	
CUBN	8029	hgsc.bcm.edu	37	10	16870805	16870805	+	Splice_Site	SNP	C	C	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:16870805C>A	ENST00000377833.4	-	66	10828	c.10763G>T	c.(10762-10764)gGc>gTc	p.G3588V		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3588	CUB 27. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.G3588A(1)|p.G3588V(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTTACTCACGCCTCCGCAGTA	0.408											OREG0020047	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G3588V												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G10763T	10						.						87.0	86.0	86.0					10																	16870805		2203	4300	6503	16910811	SO:0001630	splice_region_variant	8029	exon66			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10764+1G>T	10.37:g.16870805C>A		713	16910811	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	0.032	-1.325905	0.01309	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.28454	1.61	5.64	2.72	0.32119	CUB (5);	0.990094	0.08192	N	0.983646	T	0.20536	0.0494	L	0.33137	0.985	0.09310	N	0.999997	B	0.11235	0.004	B	0.11329	0.006	T	0.30736	-0.9968	10	0.25751	T	0.34	.	2.6923	0.05124	0.2203:0.1294:0.5265:0.1238	.	3588	O60494	CUBN_HUMAN	V	3588;429	ENSP00000367064:G3588V	ENSP00000367064:G3588V	G	-	2	0	CUBN	16910811	0.022000	0.18835	0.017000	0.16124	0.004000	0.04260	0.298000	0.19120	0.720000	0.32209	-0.311000	0.09066	GGC		0.408	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	Missense_Mutation
SPAG6	9576	hgsc.bcm.edu	37	10	22657522	22657522	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:22657522G>A	ENST00000376624.3	+	4	529	c.387G>A	c.(385-387)acG>acA	p.T129T	RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000376603.2_Silent_p.T205T|SPAG6_ENST00000313311.6_Silent_p.T129T|SPAG6_ENST00000376601.1_Intron|SPAG6_ENST00000538630.1_Silent_p.T104T	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	129					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.T129T(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						CACTGGATACGCTGGTCATAT	0.458																																					p.T129T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G387A	10						.						112.0	107.0	109.0					10																	22657522		2203	4300	6503	22697528	SO:0001819	synonymous_variant	9576	exon4			AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.387G>A	10.37:g.22657522G>A			22697528	NM_012443	A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Silent	SNP	ENST00000376624.3	37	CCDS7139.1																																																																																				0.458	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047187.1		
ERCC6	2074	hgsc.bcm.edu	37	10	50684305	50684305	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:50684305C>T	ENST00000355832.5	-	12	2416	c.2338G>A	c.(2338-2340)Gtt>Att	p.V780I	ERCC6_ENST00000542458.1_Missense_Mutation_p.V150I	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	780					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)	p.V780I(2)		breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TTGGAATCAACGAAATTTTGG	0.368								Direct reversal of damage;Nucleotide excision repair (NER)																													p.V780I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2338A	10						.						59.0	59.0	59.0					10																	50684305		2203	4300	6503	50354311	SO:0001583	missense	2074	exon12			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.2338G>A	10.37:g.50684305C>T	ENSP00000348089:p.Val780Ile		50354311	NM_000124	D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	37	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	C	6.857	0.527444	0.13066	.	.	ENSG00000225830	ENST00000355832;ENST00000539110;ENST00000542458	T;T	0.75154	-0.91;-0.91	5.31	2.78	0.32641	SNF2-related (1);	.	.	.	.	T	0.58509	0.2127	N	0.26042	0.785	0.26353	N	0.977179	B	0.09022	0.002	B	0.01281	0.0	T	0.39165	-0.9627	9	0.15952	T	0.53	-9.8268	9.822	0.40887	0.0:0.1311:0.0:0.8689	.	780	Q03468	ERCC6_HUMAN	I	780;29;150	ENSP00000348089:V780I;ENSP00000445134:V150I	ENSP00000348089:V780I	V	-	1	0	ERCC6	50354311	1.000000	0.71417	0.998000	0.56505	0.905000	0.53344	1.323000	0.33701	0.331000	0.23511	-1.028000	0.02416	GTT		0.368	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
PRKG1	5592	hgsc.bcm.edu	37	10	54041917	54041917	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:54041917A>G	ENST00000401604.2	+	14	1699	c.1505A>G	c.(1504-1506)gAt>gGt	p.D502G	PRKG1_ENST00000373980.4_Missense_Mutation_p.D517G|PRKG1_ENST00000373985.1_Missense_Mutation_p.D490G|PRKG1-AS1_ENST00000426785.2_RNA|PRKG1_ENST00000373975.2_Missense_Mutation_p.D220G|PRKG1-AS1_ENST00000452247.2_RNA			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	502	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)	p.D517G(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TGTAAGGTTGATTTTGGCTTT	0.333																																					p.D517G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1550G	10						.						75.0	77.0	77.0					10																	54041917		2203	4299	6502	53711923	SO:0001583	missense	5592	exon14				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.1505A>G	10.37:g.54041917A>G	ENSP00000384200:p.Asp502Gly		53711923	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	37	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.405313	0.83230	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000332193;ENST00000373975	D;D;D	0.93019	-3.15;-3.15;-3.15	5.49	5.49	0.81192	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97892	0.9307	H	0.96996	3.92	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.97110	0.981;1.0;1.0	D	0.99320	1.0906	10	0.87932	D	0	-21.0279	15.5343	0.75990	1.0:0.0:0.0:0.0	.	220;517;502	B3KSF3;Q13976-2;Q13976	.;.;KGP1_HUMAN	G	502;490;517;220;114	ENSP00000384200:D502G;ENSP00000363097:D490G;ENSP00000363092:D517G	ENSP00000327642:D220G	D	+	2	0	PRKG1	53711923	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.279000	0.95777	2.201000	0.70794	0.460000	0.39030	GAT		0.333	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ANK3	288	hgsc.bcm.edu	37	10	62149199	62149199	+	Missense_Mutation	SNP	C	C	T	rs34973575		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:62149199C>T	ENST00000280772.2	-	1	289	c.98G>A	c.(97-99)cGg>cAg	p.R33Q	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	33					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.R33Q(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CTTCCGATCCCGGGACCGTTT	0.408																																					p.R33Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G98A	10						.						162.0	153.0	156.0					10																	62149199		2203	4300	6503	61819205	SO:0001583	missense	288	exon1			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.98G>A	10.37:g.62149199C>T	ENSP00000280772:p.Arg33Gln		61819205	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717785	0.48622	.	.	ENSG00000151150	ENST00000280772	T	0.63417	-0.04	5.96	5.96	0.96718	.	0.000000	0.30850	U	0.008745	T	0.37461	0.1004	N	0.08118	0	0.80722	D	1	P	0.47545	0.897	B	0.33339	0.162	T	0.49634	-0.8919	10	0.72032	D	0.01	.	12.6808	0.56920	0.0:0.9256:0.0:0.0744	.	33	Q12955	ANK3_HUMAN	Q	33	ENSP00000280772:R33Q	ENSP00000280772:R33Q	R	-	2	0	ANK3	61819205	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.284000	0.51708	2.832000	0.97577	0.655000	0.94253	CGG		0.408	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
VCL	7414	hgsc.bcm.edu	37	10	75860761	75860761	+	Missense_Mutation	SNP	C	C	T	rs150643310		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:75860761C>T	ENST00000211998.4	+	14	2022	c.1928C>T	c.(1927-1929)aCg>aTg	p.T643M	VCL_ENST00000478896.2_Intron|VCL_ENST00000417648.2_Intron|VCL_ENST00000372755.3_Missense_Mutation_p.T643M	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	643	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.T643M(1)	VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					CTTGGTGCTACGGCCGAGAAG	0.458																																					p.T643M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1928T	10						.	C	MET/THR,MET/THR	0,4406		0,0,2203	55.0	54.0	54.0		1928,1928	5.0	1.0	10	dbSNP_134	54	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	VCL	NM_003373.3,NM_014000.2	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	643/1067,643/1135	75860761	1,13005	2203	4300	6503	75530767	SO:0001583	missense	7414	exon14			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.1928C>T	10.37:g.75860761C>T	ENSP00000211998:p.Thr643Met		75530767	NM_014000	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	ENST00000211998.4	37	CCDS7341.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.823133	0.90873	0.0	1.16E-4	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T	0.45668	0.89;0.89;0.89	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.66597	0.2805	M	0.74647	2.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.996	T	0.70510	-0.4852	10	0.72032	D	0.01	.	18.738	0.91763	0.0:1.0:0.0:0.0	.	570;643;643	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	M	643;643;550;570;315	ENSP00000361841:T643M;ENSP00000211998:T643M;ENSP00000415489:T315M	ENSP00000211998:T643M	T	+	2	0	VCL	75530767	1.000000	0.71417	0.982000	0.44146	0.977000	0.68977	7.238000	0.78173	2.492000	0.84095	0.650000	0.86243	ACG		0.458	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000	
KAT6B	23522	hgsc.bcm.edu	37	10	76789082	76789082	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:76789082C>T	ENST00000287239.4	+	18	4989	c.4500C>T	c.(4498-4500)ccC>ccT	p.P1500P	KAT6B_ENST00000372724.1_Silent_p.P1208P|KAT6B_ENST00000372725.1_Silent_p.P1208P|KAT6B_ENST00000372714.1_Silent_p.P1208P|KAT6B_ENST00000372711.1_Silent_p.P1317P	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1500					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P1500P(1)									AAGCTGTACCCGAATCTGACG	0.542																																					p.P1500P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4500T	10						.						65.0	66.0	66.0					10																	76789082		2203	4300	6503	76459088	SO:0001819	synonymous_variant	23522	exon18			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4500C>T	10.37:g.76789082C>T			76459088	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	37	CCDS7345.1																																																																																				0.542	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
KAT6B	23522	hgsc.bcm.edu	37	10	76789417	76789417	+	Missense_Mutation	SNP	G	G	A	rs72803461	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:76789417G>A	ENST00000287239.4	+	18	5324	c.4835G>A	c.(4834-4836)cGt>cAt	p.R1612H	KAT6B_ENST00000372724.1_Missense_Mutation_p.R1320H|KAT6B_ENST00000372725.1_Missense_Mutation_p.R1320H|KAT6B_ENST00000372714.1_Missense_Mutation_p.R1320H|KAT6B_ENST00000372711.1_Missense_Mutation_p.R1429H	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1612	Interaction with RUNX1 and RUNX2.|Ser-rich.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R1612H(1)									CAGTCCGTACGTTCTGTCAAC	0.547													G|||	3	0.000599042	0.0	0.0	5008	,	,		21548	0.0		0.003	False		,,,				2504	0.0				p.R1612H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4835A	10						.	G	HIS/ARG	3,4403	6.2+/-15.9	0,3,2200	165.0	139.0	148.0		4835	4.8	1.0	10	dbSNP_130	148	41,8559	27.4+/-76.7	1,39,4260	yes	missense	KAT6B	NM_012330.2	29	1,42,6460	AA,AG,GG		0.4767,0.0681,0.3383	probably-damaging	1612/2074	76789417	44,12962	2203	4300	6503	76459423	SO:0001583	missense	23522	exon18			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4835G>A	10.37:g.76789417G>A	ENSP00000287239:p.Arg1612His		76459423	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	37	CCDS7345.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	G	12.63	1.995705	0.35226	6.81E-4	0.004767	ENSG00000156650	ENST00000372725;ENST00000372724;ENST00000287239;ENST00000372714;ENST00000372711	D;D;D;D;D	0.85556	-1.93;-1.93;-2.0;-1.93;-1.95	4.77	4.77	0.60923	.	0.000000	0.51477	D	0.000100	D	0.88829	0.6543	L	0.32530	0.975	0.58432	D	0.999995	B;D;B	0.89917	0.054;1.0;0.004	B;D;B	0.85130	0.01;0.997;0.007	D	0.90577	0.4526	10	0.87932	D	0	-7.0229	17.7923	0.88558	0.0:0.0:1.0:0.0	.	1429;1320;1612	Q8WYB5-2;Q8WYB5-3;Q8WYB5	.;.;KAT6B_HUMAN	H	1320;1320;1612;1320;1429	ENSP00000361810:R1320H;ENSP00000361809:R1320H;ENSP00000287239:R1612H;ENSP00000361799:R1320H;ENSP00000361796:R1429H	ENSP00000287239:R1612H	R	+	2	0	KAT6B	76459423	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.408000	0.73285	2.191000	0.70037	0.563000	0.77884	CGT		0.547	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
DUSP13	51207	hgsc.bcm.edu	37	10	76861663	76861663	+	5'Flank	SNP	C	C	T	rs141678047		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:76861663C>T	ENST00000472493.2	-	0	0				DUSP13_ENST00000607131.1_Silent_p.P80P|DUSP13_ENST00000605915.1_5'Flank|DUSP13_ENST00000478873.2_5'Flank|DUSP13_ENST00000372700.3_Intron|DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000607009.1_Intron|DUSP13_ENST00000491677.2_Silent_p.P116P	NM_016364.3	NP_057448.3	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13						meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.P116P(1)		large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					ACTTCTCTGACGGGCAGTTCG	0.512																																					p.P80P	NSCLC(174;1655 2059 12324 40663 42963)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G240A	10						.	C	,,	1,4405	2.1+/-5.4	0,1,2202	112.0	107.0	109.0		,,240	-2.0	0.0	10	dbSNP_134	109	0,8600		0,0,4300	no	utr-3,intron,coding-synonymous	DUSP13	NM_001007271.1,NM_001007272.1,NM_001007273.1	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	,,80/292	76861663	1,13005	2203	4300	6503	76531669	SO:0001631	upstream_gene_variant	51207	exon3			AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516		10.37:g.76861663C>T	Exception_encountered		76531669	NM_001007273	A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Silent	SNP	ENST00000472493.2	37	CCDS7346.1																																																																																				0.512	DUSP13-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048786.3		
KCNMA1	3778	hgsc.bcm.edu	37	10	78729809	78729809	+	Silent	SNP	C	C	T	rs377596790		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:78729809C>T	ENST00000286628.8	-	20	2282	c.2283G>A	c.(2281-2283)ccG>ccA	p.P761P	KCNMA1_ENST00000286627.5_Silent_p.P703P|RP11-443A13.5_ENST00000598613.1_RNA|KCNMA1_ENST00000406533.3_Silent_p.P765P|RP11-443A13.5_ENST00000458661.2_RNA|RP11-443A13.5_ENST00000600782.1_RNA|KCNMA1_ENST00000404857.1_Silent_p.P703P|KCNMA1_ENST00000372440.1_Silent_p.P703P|KCNMA1_ENST00000404771.3_Silent_p.P761P|KCNMA1_ENST00000354353.5_Silent_p.P764P|KCNMA1_ENST00000372443.1_Silent_p.P703P	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	761					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.P703P(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	ATAGTGTTGACGGCTGCTCAT	0.483													c|||	1	0.000199681	0.0008	0.0	5008	,	,		18661	0.0		0.0	False		,,,				2504	0.0				p.P703P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2109A	10						.	T	,,,	1,4405	2.1+/-5.4	0,1,2202	212.0	186.0	195.0		2121,2283,2109,2109	0.2	1.0	10		195	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KCNMA1	NM_001014797.2,NM_001161352.1,NM_001161353.1,NM_002247.3	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	707/1183,761/1237,703/1220,703/1179	78729809	1,13005	2203	4300	6503	78399815	SO:0001819	synonymous_variant	3778	exon19			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2283G>A	10.37:g.78729809C>T			78399815	NM_001161353	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Silent	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	8.341|8.341	0.828673|0.828673	0.16749|0.16749	2.27E-4|2.27E-4	0.0|0.0	ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372421;ENST00000434208	.|.	.|.	.|.	5.66|5.66	0.183|0.183	0.15082|0.15082	.|.	.|.	.|.	.|.	.|.	T|T	0.51415|0.51415	0.1673|0.1673	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.35425|0.35425	-0.9789|-0.9789	4|4	.|.	.|.	.|.	-12.9149|-12.9149	5.8155|5.8155	0.18490|0.18490	0.0:0.4914:0.1345:0.3741|0.0:0.4914:0.1345:0.3741	.|.	.|.	.|.	.|.	H|I	654|692;411	.|.	.|.	R|V	-|-	2|1	0|0	KCNMA1|KCNMA1	78399815|78399815	0.161000|0.161000	0.22892|0.22892	0.975000|0.975000	0.42487|0.42487	0.947000|0.947000	0.59692|0.59692	-0.524000|-0.524000	0.06222|0.06222	-0.257000|-0.257000	0.09459|0.09459	-0.993000|-0.993000	0.02533|0.02533	CGT|GTC		0.483	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
GRID1	2894	hgsc.bcm.edu	37	10	87675993	87675993	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:87675993C>T	ENST00000327946.7	-	5	815	c.730G>A	c.(730-732)Gtg>Atg	p.V244M		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	244					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.V244M(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TTGGTCTCCACGGCCTGCAGA	0.502										Multiple Myeloma(13;0.14)																											p.V244M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G730A	10						.						74.0	71.0	72.0					10																	87675993		2203	4300	6503	87665973	SO:0001583	missense	2894	exon5			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.730G>A	10.37:g.87675993C>T	ENSP00000330148:p.Val244Met		87665973	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532431	0.64972	.	.	ENSG00000182771	ENST00000327946	D	0.83837	-1.77	5.37	5.37	0.77165	Extracellular ligand-binding receptor (1);	0.627229	0.15911	N	0.238620	D	0.89448	0.6718	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.87662	0.2535	10	0.40728	T	0.16	.	14.6027	0.68453	0.0:1.0:0.0:0.0	.	244	Q9ULK0	GRID1_HUMAN	M	244	ENSP00000330148:V244M	ENSP00000330148:V244M	V	-	1	0	GRID1	87665973	1.000000	0.71417	0.995000	0.50966	0.947000	0.59692	5.801000	0.69115	2.504000	0.84457	0.561000	0.74099	GTG		0.502	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
TLL2	7093	hgsc.bcm.edu	37	10	98173000	98173000	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:98173000G>A	ENST00000357947.3	-	8	1222	c.997C>T	c.(997-999)Cgg>Tgg	p.R333W	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	333	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R333W(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		TGACTGAGCCGCACGCGCTGG	0.532																																					p.R333W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C997T	10						.						66.0	60.0	62.0					10																	98173000		2203	4300	6503	98162990	SO:0001583	missense	7093	exon8			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.997C>T	10.37:g.98173000G>A	ENSP00000350630:p.Arg333Trp		98162990	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	ENST00000357947.3	37	CCDS7449.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265972	0.80358	.	.	ENSG00000095587	ENST00000357947	T	0.65178	-0.14	5.28	4.37	0.52481	Peptidase M12A, astacin (1);Metallopeptidase, catalytic domain (1);	0.000000	0.42172	D	0.000744	T	0.77260	0.4104	M	0.85945	2.785	0.58432	D	0.999996	D	0.76494	0.999	P	0.57679	0.825	T	0.81944	-0.0701	10	0.72032	D	0.01	.	14.5269	0.67894	0.0:0.0:0.8528:0.1472	.	333	Q9Y6L7	TLL2_HUMAN	W	333	ENSP00000350630:R333W	ENSP00000350630:R333W	R	-	1	2	TLL2	98162990	1.000000	0.71417	0.998000	0.56505	0.905000	0.53344	4.185000	0.58330	1.217000	0.43442	0.455000	0.32223	CGG		0.532	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
PI4K2A	55361	hgsc.bcm.edu	37	10	99426277	99426277	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:99426277G>A	ENST00000370631.3	+	7	1224	c.1167G>A	c.(1165-1167)tcG>tcA	p.S389S	PI4K2A_ENST00000370649.3_Silent_p.S359S|PI4K2A_ENST00000555577.1_Silent_p.S359S	NM_018425.2	NP_060895.1	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	389	PI3K/PI4K.				basophil degranulation (GO:0002561)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endosome (GO:0005768)|exocytic vesicle (GO:0070382)|Golgi apparatus (GO:0005794)|growing cell tip (GO:0035838)|host cell presynaptic membrane (GO:0044231)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|AP-3 adaptor complex binding (GO:0035651)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)	p.S359S(1)|p.S389S(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		CAAAGATATCGGACCCTAACT	0.453																																					p.S389S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1167A	10						.						69.0	67.0	68.0					10																	99426277		2203	4300	6503	99416267	SO:0001819	synonymous_variant	55361	exon7			AF070611	CCDS7469.1	10q24	2011-02-09			ENSG00000155252	ENSG00000155252			30031	protein-coding gene	gene with protein product		609763				11244087, 11279162	Standard	NM_018425		Approved	PI4KII, DKFZP761G1923, PIK42A	uc001kog.1	Q9BTU6	OTTHUMG00000018863	ENST00000370631.3:c.1167G>A	10.37:g.99426277G>A			99416267	NM_018425	D3DR59|Q9NSG8	Silent	SNP	ENST00000370631.3	37	CCDS7469.1																																																																																				0.453	PI4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049735.1	NM_018425	
MKI67	4288	hgsc.bcm.edu	37	10	129899558	129899558	+	Silent	SNP	C	C	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr10:129899558C>A	ENST00000368654.3	-	14	10044	c.9669G>T	c.(9667-9669)acG>acT	p.T3223T	MKI67_ENST00000368653.3_Silent_p.T2863T	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	3223					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.T3223T(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGACACTCCGCGTTACTCTCT	0.428																																					p.T2863T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G8589T	10						.						133.0	122.0	126.0					10																	129899558		2203	4300	6503	129789548	SO:0001819	synonymous_variant	4288	exon13			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.9669G>T	10.37:g.129899558C>A			129789548	NM_001145966	Q5VWH2	Silent	SNP	ENST00000368654.3	37	CCDS7659.1																																																																																				0.428	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
APC	324	hgsc.bcm.edu	37	5	112177427	112177427	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:112177427G>A	ENST00000457016.1	+	16	6516	c.6136G>A	c.(6136-6138)Gca>Aca	p.A2046T	APC_ENST00000508376.2_Missense_Mutation_p.A2046T|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.A2046T			P25054	APC_HUMAN	adenomatous polyposis coli	2046	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.A2046T(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TATAAGCTCCGCAATGCCAAA	0.393		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.A2028T	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Missense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.G6082A	5						.						87.0	87.0	87.0					5																	112177427		2202	4299	6501	112205326	SO:0001583	missense	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.6136G>A	5.37:g.112177427G>A	ENSP00000413133:p.Ala2046Thr		112205326	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120567	0.77323	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.99848	-7.14;-7.14;-7.14	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.99768	0.9905	M	0.68593	2.085	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98074	1.0400	9	.	.	.	-17.6663	19.8965	0.96963	0.0:0.0:1.0:0.0	.	2048;2046	Q4LE70;P25054	.;APC_HUMAN	T	2046	ENSP00000413133:A2046T;ENSP00000257430:A2046T;ENSP00000427089:A2046T	.	A	+	1	0	APC	112205326	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.390000	0.97246	2.786000	0.95864	0.650000	0.86243	GCA		0.393	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
REEP5	7905	hgsc.bcm.edu	37	5	112214531	112214531	+	Splice_Site	SNP	C	C	T	rs553914342	byFrequency	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:112214531C>T	ENST00000379638.4	-	5	870	c.522G>A	c.(520-522)gcG>gcA	p.A174A	CTC-487M23.8_ENST00000512790.1_Intron|CTC-487M23.8_ENST00000506997.1_Intron|REEP5_ENST00000545426.1_3'UTR|REEP5_ENST00000513339.1_Splice_Site_p.R118Q	NM_005669.4	NP_005660.4	Q00765	REEP5_HUMAN	receptor accessory protein 5	174						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A174A(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		TAGCTTTCTTCGCTGTTTGTT	0.413																																					p.A174A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G522A	5						.						195.0	172.0	180.0					5																	112214531		2202	4300	6502	112242430	SO:0001630	splice_region_variant	7905	exon5			BC000232	CCDS4109.2	5q22-q23	2008-02-05	2006-02-07	2006-02-07	ENSG00000129625	ENSG00000129625		"""Receptor accessory proteins"""	30077	protein-coding gene	gene with protein product	"""deleted in polyposis 1"", ""polyposis locus protein 1"", ""polyposis coli region hypothetical protein DP1"""	125265	"""chromosome 5 open reading frame 18"""	C5orf18		16271481, 15550249	Standard	NM_005669		Approved	DP1, TB2, D5S346	uc003kqe.1	Q00765	OTTHUMG00000128807	ENST00000379638.4:c.521-1G>A	5.37:g.112214531C>T			112242430	NM_005669	B7Z681|D3DT04|Q04198|Q5QGT0|Q9BWH9	Silent	SNP	ENST00000379638.4	37	CCDS4109.2	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279467	0.59758	.	.	ENSG00000129625	ENST00000513339	D	0.92348	-3.02	5.13	5.13	0.70059	.	.	.	.	.	D	0.87617	0.6222	.	.	.	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.82798	-0.0279	8	0.48119	T	0.1	.	9.0213	0.36202	0.0784:0.1492:0.7724:0.0	.	118	B7Z510	.	Q	118	ENSP00000425901:R118Q	ENSP00000425901:R118Q	R	-	2	0	REEP5	112242430	1.000000	0.71417	1.000000	0.80357	0.432000	0.31715	2.003000	0.40844	1.298000	0.44778	-0.187000	0.12897	CGA		0.413	REEP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250739.2	NM_005669	Silent
FBN2	2201	hgsc.bcm.edu	37	5	127673796	127673796	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:127673796C>T	ENST00000508053.1	-	33	4465	c.3491G>A	c.(3490-3492)cGt>cAt	p.R1164H	FBN2_ENST00000262464.4_Missense_Mutation_p.R1164H|FBN2_ENST00000507835.1_Missense_Mutation_p.R14H|FBN2_ENST00000508989.1_Missense_Mutation_p.R1131H			P35556	FBN2_HUMAN	fibrillin 2	1164	EGF-like 17; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R1164H(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GAGAGGGTTACGTTCACATTC	0.473																																					p.R1164H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3491A	5						.						77.0	69.0	71.0					5																	127673796		2203	4300	6503	127701695	SO:0001583	missense	2201	exon27			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3491G>A	5.37:g.127673796C>T	ENSP00000424571:p.Arg1164His		127701695	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.549588	0.65311	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97	4.89	4.01	0.46588	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.072279	0.56097	D	0.000034	D	0.93874	0.8040	L	0.46670	1.46	0.47476	D	0.999432	D;P	0.89917	1.0;0.593	D;B	0.79784	0.993;0.134	D	0.93785	0.7087	10	0.66056	D	0.02	.	14.1015	0.65059	0.0:0.9239:0.0:0.0761	.	1131;1164	D6RJI3;P35556	.;FBN2_HUMAN	H	1164;1164;14;1131	ENSP00000262464:R1164H;ENSP00000424571:R1164H;ENSP00000426839:R14H;ENSP00000425596:R1131H	ENSP00000262464:R1164H	R	-	2	0	FBN2	127701695	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.689000	0.61723	2.712000	0.92718	0.650000	0.86243	CGT		0.473	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FBN2	2201	hgsc.bcm.edu	37	5	127728859	127728859	+	Silent	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:127728859G>A	ENST00000508053.1	-	16	2408	c.1434C>T	c.(1432-1434)gcC>gcT	p.A478A	FBN2_ENST00000262464.4_Silent_p.A478A|FBN2_ENST00000508989.1_Silent_p.A445A			P35556	FBN2_HUMAN	fibrillin 2	478					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.A478A(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCTGTCCCCCGGCCCCCACAC	0.532																																					p.A478A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1434T	5						.						75.0	87.0	83.0					5																	127728859		2203	4300	6503	127756758	SO:0001819	synonymous_variant	2201	exon10			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1434C>T	5.37:g.127728859G>A			127756758	NM_001999	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	37	CCDS34222.1																																																																																				0.532	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
RAPGEF6	51735	hgsc.bcm.edu	37	5	130846087	130846087	+	Missense_Mutation	SNP	C	C	T	rs201006948		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:130846087C>T	ENST00000509018.1	-	8	930	c.725G>A	c.(724-726)cGa>cAa	p.R242Q	RAPGEF6_ENST00000307984.5_Missense_Mutation_p.R242Q|RAPGEF6_ENST00000512052.1_5'Flank|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.R242Q|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.R242Q|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.R292Q|RAPGEF6_ENST00000510071.1_Missense_Mutation_p.R242Q|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.R242Q	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	242					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)	p.R292Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TGGATCTGTTCGATCAATCTC	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		18469	0.0		0.001	False		,,,				2504	0.0				p.R242Q	Melanoma(168;435 1955 13113 13877 23213)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G725A	5						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	124.0	114.0	118.0		725,725,725,725,725,725	4.5	1.0	5		118	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	RAPGEF6	NM_001164386.1,NM_001164387.1,NM_001164388.1,NM_001164389.1,NM_001164390.1,NM_016340.5	43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	242/1610,242/1510,242/1505,242/1392,242/828,242/1602	130846087	1,13005	2203	4300	6503	130873986	SO:0001583	missense	51735	exon8			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.725G>A	5.37:g.130846087C>T	ENSP00000421684:p.Arg242Gln		130873986	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	32	5.173123	0.94807	0.0	1.16E-4	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000308008;ENST00000510071;ENST00000513227;ENST00000504575;ENST00000504039;ENST00000514667	T;T;T;T;T;T;T;T	0.44881	1.88;1.8;1.8;1.88;1.72;2.26;0.91;1.98	5.33	4.46	0.54185	.	0.070231	0.56097	D	0.000032	T	0.44371	0.1290	N	0.08118	0	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.85130	0.967;0.994;0.985;0.994;0.997;0.97	T	0.55566	-0.8121	10	0.66056	D	0.02	.	14.132	0.65260	0.0:0.927:0.0:0.073	.	242;242;242;292;242;242	A3KN82;B7ZML2;Q8TEU7-2;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;RPGF6_HUMAN	Q	242;242;242;242;242;242;242;70;95;95;292	ENSP00000421684:R242Q;ENSP00000309298:R242Q;ENSP00000426081:R242Q;ENSP00000296859:R242Q;ENSP00000311419:R242Q;ENSP00000425389:R242Q;ENSP00000424574:R70Q;ENSP00000426948:R292Q	ENSP00000426948:R292Q	R	-	2	0	RAPGEF6;FNIP1	130873986	1.000000	0.71417	0.993000	0.49108	0.899000	0.52679	6.050000	0.71063	1.383000	0.46405	0.563000	0.77884	CGA		0.428	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
RAD50	10111	hgsc.bcm.edu	37	5	131953890	131953890	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:131953890G>A	ENST00000265335.6	+	21	3680	c.3293G>A	c.(3292-3294)cGg>cAg	p.R1098Q	RAD50_ENST00000378823.3_Missense_Mutation_p.R959Q			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	1098					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.R1098Q(1)|p.R959Q(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCACAATTTCGGGATGCTGAG	0.328								Homologous recombination																													p.R1098Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3293A	5						.						103.0	117.0	112.0					5																	131953890		2203	4299	6502	131981789	SO:0001583	missense	10111	exon21			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.3293G>A	5.37:g.131953890G>A	ENSP00000265335:p.Arg1098Gln		131981789	NM_005732	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	37	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596931	0.46318	.	.	ENSG00000113522	ENST00000378823;ENST00000265335	T;T	0.04862	3.54;3.77	5.4	2.41	0.29592	.	0.604969	0.18076	N	0.152449	T	0.02688	0.0081	N	0.14661	0.345	0.09310	N	1	B	0.33494	0.414	B	0.20577	0.03	T	0.42275	-0.9461	10	0.62326	D	0.03	-1.4383	1.3617	0.02193	0.2562:0.1562:0.4286:0.1591	.	1098	Q92878	RAD50_HUMAN	Q	959;1098	ENSP00000368100:R959Q;ENSP00000265335:R1098Q	ENSP00000265335:R1098Q	R	+	2	0	RAD50	131981789	0.994000	0.37717	0.995000	0.50966	0.994000	0.84299	1.859000	0.39418	0.728000	0.32382	0.655000	0.94253	CGG		0.328	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
TCF7	6932	hgsc.bcm.edu	37	5	133474713	133474713	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:133474713C>A	ENST00000321584.4	+	5	815	c.619C>A	c.(619-621)Ccc>Acc	p.P207T	TCF7_ENST00000342854.5_Missense_Mutation_p.P207T|TCF7_ENST00000395029.1_Missense_Mutation_p.P207T|TCF7_ENST00000395023.1_Missense_Mutation_p.P92T|TCF7_ENST00000378564.1_Missense_Mutation_p.P207T|TCF7_ENST00000518915.1_Missense_Mutation_p.P92T|TCF7_ENST00000321603.6_Missense_Mutation_p.P207T|TCF7_ENST00000378560.4_Missense_Mutation_p.P92T|TCF7_ENST00000432532.2_Missense_Mutation_p.P92T|TCF7_ENST00000520958.1_Missense_Mutation_p.P92T|TCF7_ENST00000517478.1_3'UTR			P36402	TCF7_HUMAN	transcription factor 7 (T-cell specific, HMG-box)	207					alpha-beta T cell differentiation (GO:0046632)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cellular response to interleukin-4 (GO:0071353)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|generation of neurons (GO:0048699)|immune response (GO:0006955)|neural tube development (GO:0021915)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor V(D)J recombination (GO:0033153)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P207T(2)		kidney(2)|large_intestine(7)|lung(2)|skin(1)	12		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGGGCAGCTCCCCCACACTGT	0.607																																					p.P207T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C619A	5						.						70.0	55.0	60.0					5																	133474713		2203	4300	6503	133502612	SO:0001583	missense	6932	exon5			Z47362	CCDS4169.1, CCDS4170.1, CCDS43362.1, CCDS47263.1, CCDS47263.2	5q31	2008-02-05			ENSG00000081059	ENSG00000081059			11639	protein-coding gene	gene with protein product		189908					Standard	NM_003202		Approved	TCF-1	uc003kyt.3	P36402	OTTHUMG00000129124	ENST00000321584.4:c.619C>A	5.37:g.133474713C>A	ENSP00000326540:p.Pro207Thr		133502612	NM_003202	B3KSH3|Q86WR9|Q9UKI4	Missense_Mutation	SNP	ENST00000321584.4	37		.	.	.	.	.	.	.	.	.	.	C	11.83	1.755824	0.31046	.	.	ENSG00000081059	ENST00000342854;ENST00000361590;ENST00000321603;ENST00000321584;ENST00000378564;ENST00000395029;ENST00000518887;ENST00000517851;ENST00000521639;ENST00000522375;ENST00000378560;ENST00000432532;ENST00000520958;ENST00000518915;ENST00000395023;ENST00000519037	D;D;D;D;D;D;D;D;D;D;T	0.99129	-5.15;-5.13;-5.09;-5.12;-5.19;-5.36;-5.45;-5.46;-5.35;-5.46;1.02	5.62	4.64	0.57946	CTNNB1 binding, N-teminal (1);	0.373756	0.30347	N	0.009825	D	0.93491	0.7923	N	0.03608	-0.345	0.30311	N	0.788548	B;B;B;B;B	0.22909	0.002;0.077;0.0;0.022;0.006	B;B;B;B;B	0.25759	0.002;0.063;0.0;0.049;0.009	D	0.86915	0.2063	10	0.27082	T	0.32	.	2.9513	0.05862	0.2456:0.5512:0.0:0.2032	.	207;207;5;207;207	P36402-9;B7WNT5;B3KQ75;P36402;P36402-5	.;.;.;TCF7_HUMAN;.	T	207;207;207;207;207;207;92;92;92;92;92;92;92;92;92;67	ENSP00000340347:P207T;ENSP00000326654:P207T;ENSP00000326540:P207T;ENSP00000367827:P207T;ENSP00000378472:P207T;ENSP00000367822:P92T;ENSP00000397946:P92T;ENSP00000429547:P92T;ENSP00000430179:P92T;ENSP00000378469:P92T;ENSP00000429696:P67T	ENSP00000326540:P207T	P	+	1	0	TCF7	133502612	0.942000	0.31987	1.000000	0.80357	0.926000	0.56050	0.578000	0.23773	2.650000	0.89964	0.561000	0.74099	CCC		0.607	TCF7-201	KNOWN	basic	protein_coding	protein_coding		NM_201634	
CXCL14	9547	hgsc.bcm.edu	37	5	134910302	134910302	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:134910302G>A	ENST00000337225.5	-	3	744	c.280C>T	c.(280-282)Cgc>Tgc	p.R94C	CXCL14_ENST00000512158.1_Missense_Mutation_p.R82C|CTC-321K16.1_ENST00000509372.1_RNA	NM_004887.4	NP_004878.2	O95715	CXL14_HUMAN	chemokine (C-X-C motif) ligand 14	94					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inner ear development (GO:0048839)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	chemokine activity (GO:0008009)	p.R94C(1)		large_intestine(2)|lung(2)|prostate(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTGATGAAGCGCTTGGTGCTC	0.607																																					p.R94C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C280T	5						.						184.0	140.0	155.0					5																	134910302		2203	4300	6503	134938201	SO:0001583	missense	9547	exon3			AF073957	CCDS4188.1	5q31	2010-04-30	2002-08-22	2002-08-23	ENSG00000145824	ENSG00000145824			10640	protein-coding gene	gene with protein product	"""breast and kidney"""	604186	"""small inducible cytokine subfamily B (Cys-X-Cys), member 14 (BRAK)"""	SCYB14		10049774	Standard	NM_004887		Approved	BRAK, NJAC, bolekine, Kec, MIP-2g, BMAC, KS1	uc003lay.3	O95715	OTTHUMG00000129139	ENST00000337225.5:c.280C>T	5.37:g.134910302G>A	ENSP00000337065:p.Arg94Cys		134938201	NM_004887	B3KQU8|Q6UW97|Q86U69|Q9BTR1|Q9NS21	Missense_Mutation	SNP	ENST00000337225.5	37	CCDS4188.1	.	.	.	.	.	.	.	.	.	.	G	19.72	3.880723	0.72294	.	.	ENSG00000145824	ENST00000337225;ENST00000512158	T;T	0.05786	3.39;3.39	5.59	2.39	0.29439	Chemokine interleukin-8-like domain (2);	0.166906	0.52532	D	0.000064	T	0.15912	0.0383	L	0.54323	1.7	0.48632	D	0.999689	D	0.76494	0.999	P	0.60886	0.88	T	0.00664	-1.1620	10	0.87932	D	0	-0.381	12.3056	0.54900	0.0:0.0:0.3426:0.6574	.	94	O95715	CXL14_HUMAN	C	94;82	ENSP00000337065:R94C;ENSP00000423783:R82C	ENSP00000337065:R94C	R	-	1	0	CXCL14	134938201	1.000000	0.71417	0.998000	0.56505	0.925000	0.55904	3.103000	0.50298	0.648000	0.30732	0.462000	0.41574	CGC		0.607	CXCL14-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_004887	
JAKMIP2	9832	hgsc.bcm.edu	37	5	147040528	147040528	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:147040528G>A	ENST00000265272.5	-	3	1077	c.610C>T	c.(610-612)Cgg>Tgg	p.R204W	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.R204W|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.R162W	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	204						Golgi apparatus (GO:0005794)		p.R204W(2)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAATATCCCGCTCCGACTCC	0.507																																					p.R204W												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.C610T	5						.						135.0	127.0	130.0					5																	147040528		2203	4300	6503	147020721	SO:0001583	missense	9832	exon3			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.610C>T	5.37:g.147040528G>A	ENSP00000265272:p.Arg204Trp		147020721	NM_014790	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404067	0.62288	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.38240	1.15;1.15;1.15	5.13	3.17	0.36434	.	0.000000	0.85682	D	0.000000	T	0.57125	0.2032	M	0.73962	2.25	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.76575	0.988;0.988;0.988;0.988	T	0.62863	-0.6764	10	0.87932	D	0	.	11.8289	0.52283	0.0:0.0:0.4596:0.5404	.	162;204;204;204	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	W	204;204;162;204	ENSP00000421398:R204W;ENSP00000265272:R204W;ENSP00000328989:R162W	ENSP00000265272:R204W	R	-	1	2	JAKMIP2	147020721	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	2.454000	0.44979	1.465000	0.48006	0.655000	0.94253	CGG		0.507	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
FBXO38	81545	hgsc.bcm.edu	37	5	147796677	147796677	+	Missense_Mutation	SNP	G	G	A	rs187292361		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:147796677G>A	ENST00000340253.5	+	12	1696	c.1528G>A	c.(1528-1530)Gac>Aac	p.D510N	FBXO38_ENST00000296701.6_Missense_Mutation_p.D510N|FBXO38_ENST00000394370.3_Missense_Mutation_p.D510N|FBXO38_ENST00000513826.1_Missense_Mutation_p.D510N			Q6PIJ6	FBX38_HUMAN	F-box protein 38	510					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.D510N(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACATCCACGACAACAATCA	0.478													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17574	0.0		0.0	False		,,,				2504	0.0				p.D510N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1528A	5						.						166.0	138.0	148.0					5																	147796677		2203	4300	6503	147776870	SO:0001583	missense	81545	exon12			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.1528G>A	5.37:g.147796677G>A	ENSP00000342023:p.Asp510Asn		147776870	NM_205836	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37		1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	6.372	0.436792	0.12104	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.52	3.61	0.41365	.	0.263407	0.38897	N	0.001539	T	0.12689	0.0308	N	0.04508	-0.205	0.27903	N	0.938904	B;B;B	0.16396	0.017;0.0;0.001	B;B;B	0.09377	0.004;0.001;0.001	T	0.06303	-1.0834	10	0.40728	T	0.16	-19.753	7.0047	0.24830	0.0918:0.2936:0.6147:0.0	.	510;510;510	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	N	510	ENSP00000342023:D510N;ENSP00000296701:D510N;ENSP00000377895:D510N;ENSP00000426410:D510N	ENSP00000296701:D510N	D	+	1	0	FBXO38	147776870	0.270000	0.24152	1.000000	0.80357	0.967000	0.64934	1.652000	0.37313	2.753000	0.94483	0.467000	0.42956	GAC		0.478	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
GRPEL2	134266	hgsc.bcm.edu	37	5	148727935	148727935	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:148727935C>T	ENST00000329271.3	+	2	288	c.178C>T	c.(178-180)Cga>Tga	p.R60*	GRPEL2-AS1_ENST00000521295.1_RNA|GRPEL2_ENST00000416916.2_Nonsense_Mutation_p.R60*|GRPEL2_ENST00000507562.1_3'UTR|GRPEL2_ENST00000513661.1_Nonsense_Mutation_p.R60*	NM_152407.3	NP_689620.2	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial (E. coli)	60					cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	adenyl-nucleotide exchange factor activity (GO:0000774)	p.R60*(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTGCTGAACGAGCCTTAAG	0.473																																					p.R60X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C178T	5						.						83.0	83.0	83.0					5																	148727935		2203	4300	6503	148708128	SO:0001587	stop_gained	134266	exon2			AL832325	CCDS4295.1	5q33.1	2008-02-05			ENSG00000164284	ENSG00000164284			21060	protein-coding gene	gene with protein product							Standard	NM_152407		Approved	DKFZp451C205, Mt-GrpE#2, FLJ23713	uc003lqj.3	Q8TAA5	OTTHUMG00000130048	ENST00000329271.3:c.178C>T	5.37:g.148727935C>T	ENSP00000329558:p.Arg60*		148708128	NM_152407	B4DFA6|Q49AJ6	Nonsense_Mutation	SNP	ENST00000329271.3	37	CCDS4295.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067531	0.76301	.	.	ENSG00000164284	ENST00000513661;ENST00000329271;ENST00000416916	.	.	.	5.77	-0.0507	0.13829	.	0.575379	0.16045	N	0.232223	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-7.9058	6.5153	0.22244	0.474:0.3624:0.0973:0.0664	.	.	.	.	X	60	.	ENSP00000329558:R60X	R	+	1	2	GRPEL2	148708128	0.381000	0.25140	0.994000	0.49952	0.997000	0.91878	-0.105000	0.10907	0.011000	0.14865	0.561000	0.74099	CGA		0.473	GRPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252327.1	NM_152407	
RBM22	55696	hgsc.bcm.edu	37	5	150076185	150076185	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:150076185C>T	ENST00000199814.4	-	6	576	c.455G>A	c.(454-456)cGg>cAg	p.R152Q	RBM22_ENST00000447771.2_Missense_Mutation_p.R103Q|RBM22_ENST00000540000.1_Missense_Mutation_p.R103Q	NM_018047.2	NP_060517.1	Q9NW64	RBM22_HUMAN	RNA binding motif protein 22	152					cellular response to drug (GO:0035690)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of RNA splicing (GO:0033120)|protein import into nucleus, translocation (GO:0000060)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium-dependent protein binding (GO:0048306)|metal ion binding (GO:0046872)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|snRNA binding (GO:0017069)	p.R152Q(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(1)	17		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGTGTGGTCCGGGCCAGTTT	0.507																																					p.R152Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G455A	5						.						117.0	107.0	110.0					5																	150076185		2203	4300	6503	150056378	SO:0001583	missense	55696	exon6			AL136933	CCDS34278.1	5q33.1	2013-02-12			ENSG00000086589	ENSG00000086589		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	25503	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 47"""	612430				20013661, 19133299	Standard	NM_018047		Approved	FLJ10290, ZC3H16, fSAP47, Cwc2	uc031slu.1	Q9NW64	OTTHUMG00000163589	ENST00000199814.4:c.455G>A	5.37:g.150076185C>T	ENSP00000199814:p.Arg152Gln		150056378	NM_018047	A6NDM5|B4DLI9|O95607	Missense_Mutation	SNP	ENST00000199814.4	37	CCDS34278.1	.	.	.	.	.	.	.	.	.	.	C	36	5.625069	0.96671	.	.	ENSG00000086589	ENST00000199814;ENST00000540000;ENST00000447771;ENST00000518917	T;T;T;T	0.06687	3.27;3.27;3.27;3.27	5.42	5.42	0.78866	.	0.110983	0.64402	N	0.000012	T	0.34193	0.0889	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.06844	-1.0804	10	0.51188	T	0.08	-12.066	19.2304	0.93836	0.0:1.0:0.0:0.0	.	152	Q9NW64	RBM22_HUMAN	Q	152;103;103;145	ENSP00000199814:R152Q;ENSP00000441594:R103Q;ENSP00000412118:R103Q;ENSP00000428154:R145Q	ENSP00000199814:R152Q	R	-	2	0	RBM22	150056378	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.675000	0.84002	2.540000	0.85666	0.655000	0.94253	CGG		0.507	RBM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374431.2	NM_018047	
FAT2	2196	hgsc.bcm.edu	37	5	150945612	150945612	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:150945612G>A	ENST00000261800.5	-	1	2893	c.2881C>T	c.(2881-2883)Cga>Tga	p.R961*		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	961	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R961*(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGAACATATCGCACTTCACCT	0.592																																					p.R961X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2881T	5						.						52.0	55.0	54.0					5																	150945612		2203	4300	6503	150925805	SO:0001587	stop_gained	2196	exon1			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.2881C>T	5.37:g.150945612G>A	ENSP00000261800:p.Arg961*		150925805	NM_001447	O75091|Q9NSR7	Nonsense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	38	7.266002	0.98175	.	.	ENSG00000086570	ENST00000261800	.	.	.	5.39	0.779	0.18550	.	1.295100	0.05318	N	0.526098	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6604	0.68868	0.0:0.0:0.3708:0.6292	.	.	.	.	X	961	.	ENSP00000261800:R961X	R	-	1	2	FAT2	150925805	0.000000	0.05858	0.090000	0.20809	0.822000	0.46500	0.601000	0.24119	0.189000	0.20188	-0.268000	0.10319	CGA		0.592	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
DOCK2	1794	hgsc.bcm.edu	37	5	169461420	169461420	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:169461420C>T	ENST00000256935.8	+	35	3565	c.3485C>T	c.(3484-3486)gCa>gTa	p.A1162V	DOCK2_ENST00000520908.1_Missense_Mutation_p.A654V|DOCK2_ENST00000540750.1_Missense_Mutation_p.A223V|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1162	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.A1162V(1)|p.A1162E(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAATGTGCTGCAGAGCACCCA	0.592																																					p.A1162V												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C3485T	5						.						89.0	85.0	86.0					5																	169461420		2203	4300	6503	169393998	SO:0001583	missense	1794	exon35			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3485C>T	5.37:g.169461420C>T	ENSP00000256935:p.Ala1162Val		169393998	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	C	5.307	0.241963	0.10077	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.37752	1.18;1.18;1.18	5.63	2.59	0.31030	.	0.515606	0.20929	N	0.083134	T	0.14657	0.0354	N	0.11000	0.08	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.09377	0.001;0.004	T	0.07366	-1.0776	10	0.29301	T	0.29	.	1.3626	0.02194	0.2373:0.4452:0.1365:0.1809	.	654;1162	E7ERW7;Q92608	.;DOCK2_HUMAN	V	1162;654;223	ENSP00000256935:A1162V;ENSP00000429283:A654V;ENSP00000438827:A223V	ENSP00000256935:A1162V	A	+	2	0	DOCK2	169393998	0.000000	0.05858	0.159000	0.22649	0.107000	0.19398	0.147000	0.16202	1.363000	0.46019	-0.211000	0.12701	GCA		0.592	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
DOCK2	1794	hgsc.bcm.edu	37	5	169472857	169472857	+	Missense_Mutation	SNP	C	C	T	rs370316549		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:169472857C>T	ENST00000256935.8	+	39	3994	c.3914C>T	c.(3913-3915)gCg>gTg	p.A1305V	DOCK2_ENST00000520908.1_Missense_Mutation_p.A797V|DOCK2_ENST00000540750.1_Missense_Mutation_p.A366V|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1305	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.A1305V(1)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGGAGCTGGCGGAACAGTAC	0.567													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20836	0.0		0.0	False		,,,				2504	0.0				p.A1305V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3914T	5						.	C	VAL/ALA	0,4406		0,0,2203	185.0	164.0	171.0		3914	5.2	0.9	5		171	1,8599	1.2+/-3.3	0,1,4299	no	missense	DOCK2	NM_004946.2	64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	1305/1831	169472857	1,13005	2203	4300	6503	169405435	SO:0001583	missense	1794	exon39			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3914C>T	5.37:g.169472857C>T	ENSP00000256935:p.Ala1305Val		169405435	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669958	0.67814	0.0	1.16E-4	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.67698	-0.28;-0.28;4.59	5.15	5.15	0.70609	.	0.059605	0.64402	D	0.000003	T	0.54791	0.1880	L	0.55834	1.745	0.50171	D	0.999853	D;B	0.53885	0.963;0.35	B;B	0.25614	0.062;0.013	T	0.61860	-0.6976	10	0.29301	T	0.29	.	18.629	0.91352	0.0:1.0:0.0:0.0	.	797;1305	E7ERW7;Q92608	.;DOCK2_HUMAN	V	1305;797;366	ENSP00000256935:A1305V;ENSP00000429283:A797V;ENSP00000438827:A366V	ENSP00000256935:A1305V	A	+	2	0	DOCK2	169405435	1.000000	0.71417	0.948000	0.38648	0.885000	0.51271	4.878000	0.63093	2.379000	0.81126	0.561000	0.74099	GCG		0.567	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
KCNIP1	30820	hgsc.bcm.edu	37	5	170159897	170159897	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:170159897G>A	ENST00000411494.1	+	7	562	c.562G>A	c.(562-564)Gtc>Atc	p.V188I	KCNIP1_ENST00000434108.1_Missense_Mutation_p.V202I|KCNIP1_ENST00000520740.1_Missense_Mutation_p.V149I|KCNIP1_ENST00000390656.4_Missense_Mutation_p.V177I|KCNIP1_ENST00000328939.4_Missense_Mutation_p.V177I|KCNIP1_ENST00000377360.4_Missense_Mutation_p.V186I			Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1	188	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of calcium ion (GO:0005513)|positive regulation of action potential (GO:0045760)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|potassium channel complex (GO:0034705)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|voltage-gated ion channel activity (GO:0005244)	p.V188I(1)		autonomic_ganglia(1)|large_intestine(7)|lung(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	18	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCATGTGGACGTCTTCTTCCA	0.493																																					p.V186I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G556A	5						.						149.0	114.0	126.0					5																	170159897		2203	4300	6503	170092475	SO:0001583	missense	30820	exon6			AF199597	CCDS34285.1, CCDS34286.1, CCDS4374.1, CCDS64312.1, CCDS64313.1	5q35	2013-01-10			ENSG00000182132	ENSG00000182132		"""EF-hand domain containing"""	15521	protein-coding gene	gene with protein product		604660				10676964	Standard	NM_001278339		Approved	KCHIP1	uc003map.3	Q9NZI2	OTTHUMG00000130442	ENST00000411494.1:c.562G>A	5.37:g.170159897G>A	ENSP00000395323:p.Val188Ile		170092475	NM_001034838	B7Z7B4|Q3YAD0|Q3YAD1|Q3YAD2|Q3YAD3|Q5U822	Missense_Mutation	SNP	ENST00000411494.1	37	CCDS34286.1	.	.	.	.	.	.	.	.	.	.	G	12.50	1.955569	0.34471	.	.	ENSG00000182132	ENST00000377360;ENST00000328939;ENST00000390656;ENST00000520740;ENST00000434108;ENST00000411494	T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55	5.55	2.83	0.33086	EF-hand-like domain (1);	0.115056	0.64402	N	0.000016	T	0.52789	0.1756	L	0.28274	0.84	0.41085	D	0.985556	B;B;B;B	0.11235	0.004;0.001;0.0;0.003	B;B;B;B	0.10450	0.005;0.003;0.001;0.003	T	0.33343	-0.9872	9	.	.	.	.	8.7389	0.34545	0.2456:0.0:0.7544:0.0	.	202;177;188;186	Q3YAD0;Q3YAD2;Q9NZI2;Q3YAD3	.;.;KCIP1_HUMAN;.	I	186;177;177;149;202;188	ENSP00000366577:V186I;ENSP00000329686:V177I;ENSP00000375071:V177I;ENSP00000431102:V149I;ENSP00000414886:V202I;ENSP00000395323:V188I	.	V	+	1	0	KCNIP1	170092475	1.000000	0.71417	0.651000	0.29564	0.771000	0.43674	3.278000	0.51662	0.310000	0.22990	0.650000	0.86243	GTC		0.493	KCNIP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000371760.1		
SRD5A1	6715	hgsc.bcm.edu	37	5	6652109	6652109	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:6652109C>T	ENST00000274192.5	+	2	682	c.448C>T	c.(448-450)Cgt>Tgt	p.R150C	SRD5A1_ENST00000537411.1_3'UTR|SRD5A1_ENST00000504286.1_3'UTR|SRD5A1_ENST00000538824.1_Intron	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	150					androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)	p.R150C(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	AACAGATCCCCGTTTTCTAAT	0.438																																					p.R150C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C448T	5						.						173.0	154.0	161.0					5																	6652109		2203	4300	6503	6705109	SO:0001583	missense	6715	exon2			M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.448C>T	5.37:g.6652109C>T	ENSP00000274192:p.Arg150Cys		6705109	NM_001047	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Missense_Mutation	SNP	ENST00000274192.5	37	CCDS3870.1	.	.	.	.	.	.	.	.	.	.	C	9.072	0.997096	0.19043	.	.	ENSG00000145545	ENST00000274192	T	0.33216	1.42	5.7	3.55	0.40652	3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (1);	0.428936	0.28062	N	0.016756	T	0.32255	0.0823	M	0.80422	2.495	0.80722	D	1	P	0.38370	0.628	B	0.34779	0.189	T	0.06285	-1.0835	10	0.30854	T	0.27	-13.3306	9.4878	0.38940	0.0:0.7943:0.0:0.2057	.	150	P18405	S5A1_HUMAN	C	150	ENSP00000274192:R150C	ENSP00000274192:R150C	R	+	1	0	SRD5A1	6705109	0.640000	0.27243	0.722000	0.30670	0.054000	0.15201	0.208000	0.17415	0.515000	0.28320	0.650000	0.86243	CGT		0.438	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
CDH12	1010	hgsc.bcm.edu	37	5	21842333	21842333	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:21842333C>T	ENST00000382254.1	-	8	1837	c.751G>A	c.(751-753)Gga>Aga	p.G251R	CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Missense_Mutation_p.G211R|CDH12_ENST00000504376.2_Missense_Mutation_p.G251R	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	251	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G251R(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						ATTGTTGTTCCGGCTAATCCT	0.428										HNSCC(59;0.17)																											p.G251R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G751A	5						.						360.0	271.0	301.0					5																	21842333		2203	4300	6503	21878090	SO:0001583	missense	1010	exon8			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.751G>A	5.37:g.21842333C>T	ENSP00000371689:p.Gly251Arg		21878090	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	C	35	5.421379	0.96111	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.62232	0.57;0.57;0.04	5.55	5.55	0.83447	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.77731	0.4174	L	0.58925	1.835	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.77557	0.764;0.99	T	0.79080	-0.1950	10	0.87932	D	0	.	19.5042	0.95108	0.0:1.0:0.0:0.0	.	211;251	B7Z2U6;P55289	.;CAD12_HUMAN	R	251;251;211	ENSP00000423577:G251R;ENSP00000371689:G251R;ENSP00000428786:G211R	ENSP00000371689:G251R	G	-	1	0	CDH12	21878090	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.666000	0.83877	2.590000	0.87494	0.655000	0.94253	GGA		0.428	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
TTC33	23548	hgsc.bcm.edu	37	5	40746925	40746925	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:40746925C>A	ENST00000337702.4	-	2	348	c.196G>T	c.(196-198)Gga>Tga	p.G66*	TTC33_ENST00000503936.2_5'UTR	NM_012382.2	NP_036514.1	Q6PID6	TTC33_HUMAN	tetratricopeptide repeat domain 33	66								p.G66*(1)		NS(1)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|urinary_tract(1)	11						AAACTGGCTCCTTCATCCTTC	0.383																																					p.G66X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G196T	5						.						57.0	50.0	53.0					5																	40746925		2203	4299	6502	40782682	SO:0001587	stop_gained	23548	exon2			BC015701	CCDS3931.1	5p13.1	2013-01-11			ENSG00000113638	ENSG00000113638		"""Tetratricopeptide (TTC) repeat domain containing"""	29959	protein-coding gene	gene with protein product	"""osmosis responsive factor"""					12477932	Standard	NM_012382		Approved	OSRF	uc003jma.3	Q6PID6	OTTHUMG00000131142	ENST00000337702.4:c.196G>T	5.37:g.40746925C>A	ENSP00000338533:p.Gly66*		40782682	NM_012382	B2R6G0|O95105	Nonsense_Mutation	SNP	ENST00000337702.4	37	CCDS3931.1	.	.	.	.	.	.	.	.	.	.	C	37	6.087380	0.97271	.	.	ENSG00000113638	ENST00000337702	.	.	.	5.5	4.58	0.56647	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-22.817	15.0977	0.72247	0.1423:0.8577:0.0:0.0	.	.	.	.	X	66	.	ENSP00000338533:G66X	G	-	1	0	TTC33	40782682	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.531000	0.67148	2.571000	0.86741	0.650000	0.86243	GGA		0.383	TTC33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253831.1	NM_012382	
NIM1K	167359	hgsc.bcm.edu	37	5	43246092	43246092	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:43246092G>A	ENST00000512796.1	+	2	1714	c.215G>A	c.(214-216)gGc>gAc	p.G72D	NIM1_ENST00000326035.2_Missense_Mutation_p.G72D			Q8IY84	NIM1_HUMAN		72					protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.G72D(1)									AAACGGATAGGCTTCTACCGA	0.552																																					p.G72D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G215A	5						.						84.0	83.0	83.0					5																	43246092		2203	4300	6503	43281849	SO:0001583	missense	167359	exon2																														ENST00000512796.1:c.215G>A	5.37:g.43246092G>A	ENSP00000420849:p.Gly72Asp		43281849	NM_153361	B3KVM1	Missense_Mutation	SNP	ENST00000512796.1	37	CCDS3943.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.730892	0.89390	.	.	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.24151	1.87;1.87	5.59	5.59	0.84812	Protein kinase-like domain (1);	0.065063	0.64402	D	0.000009	T	0.51924	0.1703	M	0.76574	2.34	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	T	0.49331	-0.8951	9	.	.	.	.	16.5922	0.84769	0.0:0.1298:0.8702:0.0	.	72	Q8IY84	NIM1_HUMAN	D	72	ENSP00000313572:G72D;ENSP00000420849:G72D	.	G	+	2	0	AC114947.1	43281849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.346000	0.72999	2.640000	0.89533	0.650000	0.86243	GGC		0.552	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368017.1		
NNT	23530	hgsc.bcm.edu	37	5	43613129	43613129	+	Missense_Mutation	SNP	G	G	A	rs376701705		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:43613129G>A	ENST00000264663.5	+	3	492	c.271G>A	c.(271-273)Gtg>Atg	p.V91M	NNT_ENST00000512996.2_5'UTR|NNT_ENST00000344920.4_Missense_Mutation_p.V91M	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	91					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)	p.V91M(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					TAATGTTGTCGTGGAATCGGG	0.493																																					p.V91M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G271A	5						.						164.0	166.0	165.0					5																	43613129		2203	4300	6503	43648886	SO:0001583	missense	23530	exon3			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.271G>A	5.37:g.43613129G>A	ENSP00000264663:p.Val91Met		43648886	NM_182977	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	37	CCDS3949.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021309	0.75275	.	.	ENSG00000112992	ENST00000505678;ENST00000512422;ENST00000264663;ENST00000344920	D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02	5.7	5.7	0.88788	Alanine dehydrogenase/PNT, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93232	0.7844	M	0.82433	2.59	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.93553	0.6888	10	0.87932	D	0	-19.4905	19.8481	0.96728	0.0:0.0:1.0:0.0	.	91	Q13423	NNTM_HUMAN	M	91	ENSP00000427670:V91M;ENSP00000421886:V91M;ENSP00000264663:V91M;ENSP00000343873:V91M	ENSP00000264663:V91M	V	+	1	0	NNT	43648886	1.000000	0.71417	0.964000	0.40570	0.264000	0.26372	9.584000	0.98220	2.705000	0.92388	0.650000	0.86243	GTG		0.493	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977	
NLN	57486	hgsc.bcm.edu	37	5	65105485	65105485	+	Silent	SNP	C	C	T			TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:65105485C>T	ENST00000380985.5	+	10	1849	c.1671C>T	c.(1669-1671)gaC>gaT	p.D557D	NLN_ENST00000502464.1_Silent_p.D453D	NM_020726.4	NP_065777.1	Q9BYT8	NEUL_HUMAN	neurolysin (metallopeptidase M3 family)	557						mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)	p.D557D(1)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		CTATTGCAGACGATCTGCTTG	0.383																																					p.D557D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1671T	5						.						102.0	103.0	103.0					5																	65105485		2203	4300	6503	65141241	SO:0001819	synonymous_variant	57486	exon10			AJ300837	CCDS3989.1	5q12.3	2008-02-05	2005-03-31		ENSG00000123213	ENSG00000123213	3.4.24.16		16058	protein-coding gene	gene with protein product		611530	"""angiotensin binding protein"""	AGTBP		10574462	Standard	NM_020726		Approved	KIAA1226	uc003juf.3	Q9BYT8	OTTHUMG00000097803	ENST00000380985.5:c.1671C>T	5.37:g.65105485C>T			65141241	NM_020726	Q9ULJ4	Silent	SNP	ENST00000380985.5	37	CCDS3989.1	.	.	.	.	.	.	.	.	.	.	C	7.996	0.754366	0.15778	.	.	ENSG00000123213	ENST00000509935	.	.	.	5.66	-2.48	0.06423	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.9179	14.7889	0.69824	0.0:0.5946:0.0:0.4054	.	.	.	.	X	154	.	.	R	+	1	2	NLN	65141241	0.866000	0.29940	0.847000	0.33407	0.820000	0.46376	-0.060000	0.11712	-0.171000	0.10797	-0.238000	0.12139	CGA		0.383	NLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215060.1		
STK10	6793	hgsc.bcm.edu	37	5	171523445	171523445	+	Silent	SNP	G	G	A	rs199947150		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr5:171523445G>A	ENST00000176763.5	-	8	1333	c.990C>T	c.(988-990)gcC>gcT	p.A330A	STK10_ENST00000517775.1_5'Flank	NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	330					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)	p.A330A(1)		breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CGGCATCCACGGCGTCCTCCT	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		15609	0.001		0.0	False		,,,				2504	0.0				p.A330A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C990T	5						.						70.0	66.0	67.0					5																	171523445		2203	4300	6503	171456050	SO:0001819	synonymous_variant	6793	exon8			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.990C>T	5.37:g.171523445G>A			171456050	NM_005990	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	ENST00000176763.5	37	CCDS34290.1																																																																																				0.662	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990	
PLEKHA8P1	51054	hgsc.bcm.edu	37	12	45567093	45567093	+	RNA	SNP	G	G	A	rs149191571		TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-3554-01A-01W-0833-10	TCGA-AA-3554-10A-01W-0833-10	g.chr12:45567093G>A	ENST00000256692.5	-	0	1592					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)	p.A352A(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CGGTTAACGCGGCCACAAAAT	0.498																																					.												.	.	1	Substitution - coding silent(1)	large_intestine(1)	.	12						.	G		0,4406		0,0,2203	103.0	97.0	99.0			-0.9	0.1	12	dbSNP_134	99	1,8599	1.2+/-3.3	0,1,4299	no	intergenic				0,1,6502	AA,AG,GG		0.0116,0.0,0.0077			45567093	1,13005	2203	4300	6503	43853360			51054	.			AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567093G>A			43853360	.		Silent	SNP	ENST00000256692.5	37																																																																																					0.498	PLEKHA8P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000404814.1	NR_037144	
