#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLC18A3	6572	broad.mit.edu	37	10	50820321	50820321	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr10:50820321G>A	ENST00000374115.3	+	1	1975	c.1535G>A	c.(1534-1536)cGc>cAc	p.R512H	CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395562.2_5'Flank|CHAT_ENST00000455728.2_5'Flank|CHAT_ENST00000337653.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	512					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)	p.R512H(1)		endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						GGCGAGCCTCGCAGCCCGCCT	0.642																																					p.R512H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1535A	10						.						52.0	61.0	58.0					10																	50820321		2200	4296	6496	50490327	SO:0001583	missense	6572	exon1			BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.1535G>A	10.37:g.50820321G>A	ENSP00000363229:p.Arg512His		50490327	NM_003055	B2R7S1	Missense_Mutation	SNP	ENST00000374115.3	37	CCDS7231.1	.	.	.	.	.	.	.	.	.	.	g	11.77	1.736512	0.30774	.	.	ENSG00000187714	ENST00000374115	T	0.04502	3.61	4.72	0.638	0.17742	.	1.429520	0.04827	N	0.437989	T	0.03520	0.0101	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44298	-0.9337	10	0.39692	T	0.17	0.2692	5.0143	0.14328	0.258:0.1526:0.5894:0.0	.	512	Q16572	VACHT_HUMAN	H	512	ENSP00000363229:R512H	ENSP00000363229:R512H	R	+	2	0	SLC18A3	50490327	0.000000	0.05858	0.030000	0.17652	0.277000	0.26821	0.726000	0.25984	0.075000	0.16796	-0.226000	0.12346	CGC		0.642	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047995.1	NM_003055	
CCSER2	54462	broad.mit.edu	37	10	86259650	86259650	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr10:86259650C>T	ENST00000224756.8	+	10	2530	c.2345C>T	c.(2344-2346)tCc>tTc	p.S782F	CCSER2_ENST00000543283.1_Missense_Mutation_p.S209F|CCSER2_ENST00000494144.1_Intron|CCSER2_ENST00000372088.2_Intron	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	782					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)		p.S782F(1)									TCTGCTCCCTCCTTCTCTCCT	0.507																																					p.S782F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2345T	10						.						133.0	118.0	123.0					10																	86259650		2203	4300	6503	86249630	SO:0001583	missense	54462	exon10				CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.2345C>T	10.37:g.86259650C>T	ENSP00000224756:p.Ser782Phe		86249630	NM_018999	B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Missense_Mutation	SNP	ENST00000224756.8	37	CCDS31235.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.268483	0.80469	.	.	ENSG00000107771	ENST00000224756;ENST00000543283	T;T	0.25579	2.11;1.79	5.96	5.96	0.96718	.	0.076096	0.56097	D	0.000023	T	0.49729	0.1574	L	0.57536	1.79	0.51012	D	0.9999	D	0.76494	0.999	D	0.85130	0.997	T	0.38542	-0.9656	10	0.62326	D	0.03	.	17.9083	0.88926	0.0:1.0:0.0:0.0	.	782	Q9H7U1	F190B_HUMAN	F	782;209	ENSP00000224756:S782F;ENSP00000439944:S209F	ENSP00000224756:S782F	S	+	2	0	FAM190B	86249630	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.227000	0.58612	2.833000	0.97629	0.555000	0.69702	TCC		0.507	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049132.2	NM_018999	
AASDHPPT	60496	broad.mit.edu	37	11	105961286	105961286	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr11:105961286C>T	ENST00000278618.4	+	3	634	c.412C>T	c.(412-414)Cgt>Tgt	p.R138C	RP11-677I18.3_ENST00000532422.1_RNA	NM_015423.2	NP_056238.2	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase	138				PGRGSI -> FQVVVQF (in Ref. 4; AAG49439). {ECO:0000305}.	macromolecule biosynthetic process (GO:0009059)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	holo-[acyl-carrier-protein] synthase activity (GO:0008897)|magnesium ion binding (GO:0000287)	p.R138C(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)	17		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		ATTGGCAGGTCGTGGTTCAAT	0.333																																					p.R138C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C412T	11						.						70.0	83.0	79.0					11																	105961286		2199	4296	6495	105466496	SO:0001583	missense	60496	exon3			AF302110	CCDS31664.1	11q22	2010-12-09			ENSG00000149313	ENSG00000149313	1.2.1.31		14235	protein-coding gene	gene with protein product		607756				12815048, 11286508	Standard	NM_015423		Approved	LYS5, CGI-80, AASD-PPT	uc001pjc.1	Q9NRN7	OTTHUMG00000166253	ENST00000278618.4:c.412C>T	11.37:g.105961286C>T	ENSP00000278618:p.Arg138Cys		105466496	NM_015423	B2R6D1|B4DDW7|Q9C068|Q9P0Q3|Q9UG80|Q9Y389	Missense_Mutation	SNP	ENST00000278618.4	37	CCDS31664.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191531	0.78902	.	.	ENSG00000149313	ENST00000533423;ENST00000524411;ENST00000278618	.	.	.	5.66	4.69	0.59074	4&apos (3);-phosphopantetheinyl transferase (3);	0.232653	0.48286	N	0.000183	T	0.74160	0.3680	M	0.76328	2.33	0.58432	D	0.999992	D	0.89917	1.0	P	0.60886	0.88	T	0.76449	-0.2955	9	0.62326	D	0.03	.	11.9273	0.52827	0.3387:0.6613:0.0:0.0	.	138	Q9NRN7	ADPPT_HUMAN	C	73;73;138	.	ENSP00000278618:R138C	R	+	1	0	AASDHPPT	105466496	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.956000	0.56722	2.672000	0.90937	0.460000	0.39030	CGT		0.333	AASDHPPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388734.1	NM_015423	
OR52J3	119679	broad.mit.edu	37	11	5068125	5068125	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr11:5068125C>A	ENST00000380370.1	+	1	370	c.370C>A	c.(370-372)Cgt>Agt	p.R124S		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R124S(1)		NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGCTTTTGACCGTTATGTGGC	0.488																																					p.R124S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C370A	11						.						163.0	111.0	128.0					11																	5068125		2201	4298	6499	5024701	SO:0001583	missense	119679	exon1			AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.370C>A	11.37:g.5068125C>A	ENSP00000369728:p.Arg124Ser		5024701	NM_001001916	Q6IFE4	Missense_Mutation	SNP	ENST00000380370.1	37	CCDS31370.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997697	0.35226	.	.	ENSG00000205495	ENST00000380370	T	0.77620	-1.11	4.19	4.19	0.49359	GPCR, rhodopsin-like superfamily (1);	0.142736	0.32314	N	0.006274	D	0.89770	0.6811	H	0.98507	4.25	0.31118	N	0.709225	P	0.47910	0.902	P	0.53954	0.738	D	0.90615	0.4555	10	0.72032	D	0.01	.	10.6395	0.45584	0.1918:0.8082:0.0:0.0	.	124	Q8NH60	O52J3_HUMAN	S	124	ENSP00000369728:R124S	ENSP00000369728:R124S	R	+	1	0	OR52J3	5024701	0.004000	0.15560	0.858000	0.33744	0.042000	0.13812	0.102000	0.15272	2.143000	0.66587	0.655000	0.94253	CGT		0.488	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142807.1	NM_001001916	
OR52E8	390079	broad.mit.edu	37	11	5878597	5878597	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr11:5878597G>T	ENST00000537935.1	-	1	367	c.336C>A	c.(334-336)ttC>ttA	p.F112L	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F112L(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TAGCAGTGAAGAAATGGATGA	0.458																																					p.F112L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C336A	11						.						185.0	201.0	196.0					11																	5878597		2153	4296	6449	5835173	SO:0001583	missense	390079	exon1			BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.336C>A	11.37:g.5878597G>T	ENSP00000444054:p.Phe112Leu		5835173	NM_001005168	B9EH38	Missense_Mutation	SNP	ENST00000537935.1	37	CCDS31400.1	.	.	.	.	.	.	.	.	.	.	G	1.064	-0.672027	0.03403	.	.	ENSG00000183269	ENST00000537935	T	0.00408	7.54	4.24	2.29	0.28610	GPCR, rhodopsin-like superfamily (1);	0.367956	0.23250	N	0.050249	T	0.00178	0.0005	N	0.05534	-0.03	0.22096	N	0.999366	B	0.02656	0.0	B	0.04013	0.001	T	0.21724	-1.0237	10	0.10636	T	0.68	.	8.3108	0.32071	0.0899:0.1573:0.7528:0.0	.	112	Q6IFG1	O52E8_HUMAN	L	112	ENSP00000444054:F112L	ENSP00000444054:F112L	F	-	3	2	OR52E8	5835173	0.000000	0.05858	0.987000	0.45799	0.392000	0.30506	-1.520000	0.02241	0.510000	0.28216	0.549000	0.68633	TTC		0.458	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401145.1	NM_001005168	
RNF169	254225	broad.mit.edu	37	11	74546886	74546886	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr11:74546886A>G	ENST00000299563.4	+	6	1251	c.1238A>G	c.(1237-1239)aAc>aGc	p.N413S		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	413					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)	p.N413S(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						ACTCCACGCAACCTAAACAGA	0.493																																					p.N413S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1238G	11						.						114.0	116.0	115.0					11																	74546886		1932	4141	6073	74224534	SO:0001583	missense	254225	exon6			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.1238A>G	11.37:g.74546886A>G	ENSP00000299563:p.Asn413Ser		74224534	NM_001098638	Q6N015	Missense_Mutation	SNP	ENST00000299563.4	37	CCDS41691.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.226296	0.79576	.	.	ENSG00000166439	ENST00000299563	T	0.58358	0.34	5.99	5.99	0.97316	.	0.039327	0.85682	D	0.000000	T	0.72827	0.3509	M	0.79475	2.455	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.76252	-0.3027	10	0.72032	D	0.01	-30.4345	14.4413	0.67321	1.0:0.0:0.0:0.0	.	413	Q8NCN4	RN169_HUMAN	S	413	ENSP00000299563:N413S	ENSP00000299563:N413S	N	+	2	0	RNF169	74224534	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.730000	0.91510	2.296000	0.77279	0.533000	0.62120	AAC		0.493	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384741.1	XM_495886	
TBCEL	219899	broad.mit.edu	37	11	120957517	120957517	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr11:120957517G>T	ENST00000529397.1	+	8	1087	c.987G>T	c.(985-987)aaG>aaT	p.K329N	TBCEL_ENST00000422003.2_Missense_Mutation_p.K329N	NM_001130047.1	NP_001123519.1	Q5QJ74	TBCEL_HUMAN	tubulin folding cofactor E-like	329						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.K329N(1)	TECTA/TBCEL(2)	endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		Breast(109;0.00526)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.89e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.121)		AATATGGGAAGTTGGAGCCTT	0.433																																					p.K329N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G987T	11						.						86.0	80.0	82.0					11																	120957517		2203	4299	6502	120462727	SO:0001583	missense	219899	exon8			BC020501	CCDS31692.1	11q23.3	2008-02-05	2006-11-21	2006-11-21		ENSG00000154114			28115	protein-coding gene	gene with protein product		610451	"""leucine rich repeat containing 35"", ""tubulin-specific chaperone e-like"""	LRRC35		15728251	Standard	NM_152715		Approved	MGC10233	uc001pxo.3	Q5QJ74		ENST00000529397.1:c.987G>T	11.37:g.120957517G>T	ENSP00000437184:p.Lys329Asn		120462727	NM_152715	Q0VAN6	Missense_Mutation	SNP	ENST00000529397.1	37	CCDS31692.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.114618	0.37339	.	.	ENSG00000154114	ENST00000529397;ENST00000422003;ENST00000533134;ENST00000533169	T;T	0.33438	1.41;1.41	5.76	4.84	0.62591	.	0.083917	0.85682	D	0.000000	T	0.22244	0.0536	L	0.41710	1.295	0.48632	D	0.999689	P	0.36535	0.557	B	0.33042	0.157	T	0.04103	-1.0977	10	0.22109	T	0.4	-31.6075	10.1634	0.42866	0.1531:0.0:0.8469:0.0	.	329	Q5QJ74	TBCEL_HUMAN	N	329;329;96;132	ENSP00000437184:K329N;ENSP00000403925:K329N	ENSP00000403925:K329N	K	+	3	2	TBCEL	120462727	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	1.897000	0.39799	1.408000	0.46895	0.655000	0.94253	AAG		0.433	TBCEL-005	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387688.1	NM_152715	
LINC00477	144360	broad.mit.edu	37	12	24736892	24736892	+	lincRNA	SNP	G	G	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr12:24736892G>T	ENST00000483544.1	-	0	210					NR_029451.2		Q96M19	CL067_HUMAN	long intergenic non-protein coding RNA 477							integral component of membrane (GO:0016021)		p.F54L(1)									CCCCCGCGAAGAAAAAGATGA	0.498																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	12						.						46.0	49.0	48.0					12																	24736892		2203	4300	6503	24628159			144360	.			AK057456		12p12.1	2012-10-12	2011-08-31	2011-08-31	ENSG00000197503	ENSG00000197503		"""Long non-coding RNAs"""	26557	non-coding RNA	RNA, long non-coding	"""family with sequence similarity 191, member B"""		"""chromosome 12 open reading frame 67"""	C12orf67		14702039	Standard	NR_029451		Approved	FLJ32894, FAM191B	uc001rgb.1	Q96M19	OTTHUMG00000159485		12.37:g.24736892G>T			24628159	.		Missense_Mutation	SNP	ENST00000483544.1	37																																																																																					0.498	LINC00477-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000355725.1	NM_144667	
KRAS	3845	broad.mit.edu	37	12	25398281	25398281	+	Missense_Mutation	SNP	C	C	T	rs112445441		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr12:25398281C>T	ENST00000256078.4	-	2	101	c.38G>A	c.(37-39)gGc>gAc	p.G13D	KRAS_ENST00000311936.3_Missense_Mutation_p.G13D|KRAS_ENST00000556131.1_Missense_Mutation_p.G13D|KRAS_ENST00000557334.1_Missense_Mutation_p.G13D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	13			G -> D (in a breast carcinoma cell line and GASC; somatic mutation). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:3627975}.|G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway). {ECO:0000269|PubMed:16247081}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G13D(3223)|p.G13V(33)|p.G13A(28)|p.G13E(3)|p.G13I(1)|p.G13N(1)|p.G13_V14>DI(1)|p.G13R(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGCCTACGCCACCAGCTCC	0.338	G13D(DLD1_LARGE_INTESTINE)|G13D(DV90_LUNG)|G13D(HCT116_LARGE_INTESTINE)|G13D(HCT15_LARGE_INTESTINE)|G13D(LOVO_LARGE_INTESTINE)|G13D(MDAMB231_BREAST)|G13D(NCIH647_LUNG)|G13D(NCIH747_LARGE_INTESTINE)|G13D(NOMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G13D(T84_LARGE_INTESTINE)|G13D(TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G13D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,lung,NS,Substitution - Missense,-1 	.	3291	Substitution - Missense(3290)|Complex - compound substitution(1)	large_intestine(2808)|haematopoietic_and_lymphoid_tissue(94)|lung(92)|endometrium(54)|soft_tissue(38)|ovary(38)|stomach(32)|pancreas(30)|thyroid(27)|biliary_tract(21)|prostate(20)|breast(10)|cervix(4)|gastrointestinal_tract_(site_indeterminate)(3)|upper_aerodigestive_tract(3)|urinary_tract(3)|liver(3)|salivary_gland(3)|small_intestine(3)|oesophagus(2)|skin(1)|genital_tract(1)|bone(1)	c.G38A	12						.						88.0	78.0	82.0					12																	25398281		2203	4300	6503	25289548	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.38G>A	12.37:g.25398281C>T	ENSP00000256078:p.Gly13Asp		25289548	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867862	0.91587	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	D;T;T;T	0.82803	-1.65;-0.7;-0.7;-0.7	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.93062	3.375	0.80722	D	1	B;P	0.43314	0.215;0.803	B;P	0.46172	0.175;0.506	D	0.92106	0.5692	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	13;13	P01116-2;P01116	.;RASK_HUMAN	D	13	ENSP00000308495:G13D;ENSP00000452512:G13D;ENSP00000256078:G13D;ENSP00000451856:G13D	ENSP00000256078:G13D	G	-	2	0	KRAS	25289548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGC		0.338	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
OVCH1	341350	broad.mit.edu	37	12	29639264	29639264	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr12:29639264G>T	ENST00000318184.5	-	8	909	c.910C>A	c.(910-912)Ccc>Acc	p.P304T	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	304	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.P304T(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TTTGAGAGGGGTTGGCCCCGA	0.383																																					p.P304T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C910A	12						.						77.0	73.0	74.0					12																	29639264		1812	4078	5890	29530531	SO:0001583	missense	341350	exon8			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.910C>A	12.37:g.29639264G>T	ENSP00000326708:p.Pro304Thr		29530531	NM_183378		Missense_Mutation	SNP	ENST00000318184.5	37		.	.	.	.	.	.	.	.	.	.	G	0.007	-1.995185	0.00435	.	.	ENSG00000187950	ENST00000318184	D	0.85702	-2.02	1.94	-1.3	0.09259	.	.	.	.	.	T	0.61489	0.2351	N	0.14661	0.345	0.09310	N	1	P	0.37233	0.588	B	0.30646	0.118	T	0.56129	-0.8030	9	0.08837	T	0.75	.	2.8079	0.05432	0.3305:0.2514:0.4181:0.0	.	304	Q7RTY7	OVCH1_HUMAN	T	304	ENSP00000326708:P304T	ENSP00000326708:P304T	P	-	1	0	OVCH1	29530531	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.414000	0.02471	-0.400000	0.07656	0.563000	0.77884	CCC		0.383	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
YARS2	51067	broad.mit.edu	37	12	32906893	32906893	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr12:32906893C>A	ENST00000324868.8	-	2	933	c.906G>T	c.(904-906)ttG>ttT	p.L302F		NM_001040436.2	NP_001035526.1	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	302					gene expression (GO:0010467)|mitochondrial tyrosyl-tRNA aminoacylation (GO:0070184)|translation (GO:0006412)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)|tyrosine binding (GO:0072545)|tyrosine-tRNA ligase activity (GO:0004831)	p.L302F(1)		endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	16	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	AGAATTGATACAATTCAAATG	0.408																																					p.L302F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G906T	12						.						146.0	133.0	137.0					12																	32906893		2203	4300	6503	32798160	SO:0001583	missense	51067	exon2			AF132939	CCDS31770.1	12p11.21	2014-03-19	2007-02-23		ENSG00000139131	ENSG00000139131	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	24249	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 2, mitochondrial"""	610957				15779907, 15840810	Standard	NM_001040436		Approved	FLJ13995, CGI-04, mt-TyrRS	uc001rli.3	Q9Y2Z4	OTTHUMG00000169454	ENST00000324868.8:c.906G>T	12.37:g.32906893C>A	ENSP00000320658:p.Leu302Phe		32798160	NM_001040436	D3DUW8|Q9H817	Missense_Mutation	SNP	ENST00000324868.8	37	CCDS31770.1	.	.	.	.	.	.	.	.	.	.	C	3.392	-0.124122	0.06795	.	.	ENSG00000139131	ENST00000324868	T	0.50813	0.73	5.33	-3.26	0.05064	.	0.330019	0.22319	N	0.061623	T	0.10551	0.0258	N	0.01454	-0.855	0.51767	D	0.999937	B	0.30634	0.288	B	0.28849	0.095	T	0.32851	-0.9891	10	0.02654	T	1	-23.1594	0.8694	0.01210	0.3309:0.3013:0.1034:0.2644	.	302	Q9Y2Z4	SYYM_HUMAN	F	302	ENSP00000320658:L302F	ENSP00000320658:L302F	L	-	3	2	YARS2	32798160	0.840000	0.29493	0.719000	0.30619	0.949000	0.60115	-0.093000	0.11111	-0.452000	0.07087	0.650000	0.86243	TTG		0.408	YARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404153.1	NM_015936	
LRRK2	120892	broad.mit.edu	37	12	40745407	40745407	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr12:40745407G>A	ENST00000298910.7	+	44	6506	c.6448G>A	c.(6448-6450)Gta>Ata	p.V2150I		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2150					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.V2157I(1)|p.V2150I(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ACCTAAAAACGTAATTGTTGA	0.403																																					p.V2150I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G6448A	12						.						79.0	77.0	78.0					12																	40745407		2203	4300	6503	39031674	SO:0001583	missense	120892	exon44			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6448G>A	12.37:g.40745407G>A	ENSP00000298910:p.Val2150Ile		39031674	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	g	1.696	-0.502677	0.04261	.	.	ENSG00000188906	ENST00000298910	T	0.71341	-0.56	6.06	-12.1	0.00011	.	1.103060	0.06529	N	0.741054	T	0.25680	0.0625	N	0.00926	-1.1	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.19614	-1.0300	10	0.15952	T	0.53	.	0.6734	0.00862	0.3506:0.1325:0.1807:0.3362	.	2150;2150	Q17RV3;Q5S007	.;LRRK2_HUMAN	I	2150	ENSP00000298910:V2150I	ENSP00000298910:V2150I	V	+	1	0	LRRK2	39031674	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.071000	0.03437	-2.673000	0.00413	-2.436000	0.00213	GTA		0.403	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
VSIG10	54621	broad.mit.edu	37	12	118533516	118533516	+	Silent	SNP	C	C	T	rs117781232		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr12:118533516C>T	ENST00000359236.5	-	2	459	c.183G>A	c.(181-183)tcG>tcA	p.S61S	VSIG10_ENST00000536905.1_5'UTR	NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	61	Ig-like C2-type 1.					integral component of membrane (GO:0016021)		p.S61S(1)		endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						AGACAGGCTCCGAGTTGTTCC	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		17370	0.001		0.0	False		,,,				2504	0.0				p.S61S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G183A	12						.	C		1,4259		0,1,2129	71.0	82.0	78.0		183	-1.9	0.8	12	dbSNP_132	78	0,8514		0,0,4257	no	coding-synonymous	VSIG10	NM_019086.5		0,1,6386	TT,TC,CC		0.0,0.0235,0.0078		61/541	118533516	1,12773	2130	4257	6387	117017899	SO:0001819	synonymous_variant	54621	exon2				CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.183G>A	12.37:g.118533516C>T			117017899	NM_019086	Q9NWQ7	Silent	SNP	ENST00000359236.5	37	CCDS44992.1																																																																																				0.562	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2	NM_019086	
MTMR6	9107	broad.mit.edu	37	13	25835906	25835906	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr13:25835906C>A	ENST00000381801.5	-	6	1387	c.626G>T	c.(625-627)gGa>gTa	p.G209V	MTMR6_ENST00000540661.1_Missense_Mutation_p.G209V|MTMR6_ENST00000482345.1_5'UTR	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	209	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.G209V(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		GGCACTGAATCCAGAGAGTGG	0.408																																					p.G209V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G626T	13						.						102.0	92.0	95.0					13																	25835906		2203	4300	6503	24733906	SO:0001583	missense	9107	exon6			AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.626G>T	13.37:g.25835906C>A	ENSP00000371221:p.Gly209Val		24733906	NM_004685	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	ENST00000381801.5	37	CCDS9313.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782364	0.90282	.	.	ENSG00000139505	ENST00000540661;ENST00000541021;ENST00000381801	D;D	0.91894	-2.93;-2.93	4.94	4.94	0.65067	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.97879	0.9303	H	0.98351	4.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99716	1.1008	10	0.87932	D	0	.	18.509	0.90909	0.0:1.0:0.0:0.0	.	209;209	Q9Y217;Q9Y217-2	MTMR6_HUMAN;.	V	209	ENSP00000443161:G209V;ENSP00000371221:G209V	ENSP00000371221:G209V	G	-	2	0	MTMR6	24733906	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.673000	0.83973	2.434000	0.82447	0.655000	0.94253	GGA		0.408	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044225.1	NM_004685	
GPR12	2835	broad.mit.edu	37	13	27332980	27332980	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr13:27332980G>A	ENST00000381436.2	-	1	1447	c.985C>T	c.(985-987)Cgc>Tgc	p.R329C	GPR12_ENST00000405846.3_Missense_Mutation_p.R329C			P47775	GPR12_HUMAN	G protein-coupled receptor 12	329					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)	p.R329C(1)		endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		CTGGGCGAGCGCGCTCTCTGG	0.537																																					p.R329C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C985T	13						.						65.0	67.0	66.0					13																	27332980		2203	4300	6503	26230980	SO:0001583	missense	2835	exon2			U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.985C>T	13.37:g.27332980G>A	ENSP00000370844:p.Arg329Cys		26230980	NM_005288	Q5T8P3	Missense_Mutation	SNP	ENST00000381436.2	37	CCDS9319.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372641	0.61624	.	.	ENSG00000132975	ENST00000405846;ENST00000381436	T;T	0.38077	1.16;1.16	5.55	4.63	0.57726	.	0.000000	0.32093	N	0.006590	T	0.58409	0.2120	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.61802	-0.6988	10	0.87932	D	0	.	15.5018	0.75705	0.0:0.0:0.814:0.186	.	329	P47775	GPR12_HUMAN	C	329	ENSP00000384932:R329C;ENSP00000370844:R329C	ENSP00000370844:R329C	R	-	1	0	GPR12	26230980	1.000000	0.71417	0.943000	0.38184	0.925000	0.55904	3.827000	0.55745	2.629000	0.89072	0.561000	0.74099	CGC		0.537	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044257.2		
UNC79	57578	broad.mit.edu	37	14	94084688	94084688	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr14:94084688G>A	ENST00000393151.2	+	29	4375	c.4375G>A	c.(4375-4377)Gaa>Aaa	p.E1459K	UNC79_ENST00000256339.4_Missense_Mutation_p.E1282K|UNC79_ENST00000555664.1_Missense_Mutation_p.E1459K|UNC79_ENST00000553484.1_Missense_Mutation_p.E1481K			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1459					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E1481K(1)|p.E1282K(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CAGATACAGCGAAAAAGAAAA	0.398																																					p.E1282K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3844A	14						.						76.0	69.0	72.0					14																	94084688		2203	4300	6503	93154441	SO:0001583	missense	57578	exon29			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4375G>A	14.37:g.94084688G>A	ENSP00000376858:p.Glu1459Lys		93154441	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	G	35	5.584553	0.96578	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.25749	1.8;1.78;1.82;1.8	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.42607	0.1210	L	0.29908	0.895	0.58432	D	0.99999	D	0.71674	0.998	D	0.73380	0.98	T	0.11324	-1.0592	10	0.51188	T	0.08	-22.4367	20.5407	0.99260	0.0:0.0:1.0:0.0	.	1481	C9JQL1	.	K	1282;1459;1481;1459;1481	ENSP00000256339:E1282K;ENSP00000450868:E1459K;ENSP00000451360:E1481K;ENSP00000376858:E1459K	ENSP00000256339:E1282K	E	+	1	0	KIAA1409	93154441	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.888000	0.92464	2.865000	0.98341	0.655000	0.94253	GAA		0.398	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
IGDCC3	9543	broad.mit.edu	37	15	65623774	65623774	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr15:65623774C>T	ENST00000327987.4	-	8	1623	c.1372G>A	c.(1372-1374)Gtc>Atc	p.V458I	IGDCC3_ENST00000559231.1_5'UTR	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	458	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.V458I(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						ATGTGCAGGACGTAGCCGATG	0.587																																					p.V458I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1372A	15						.						45.0	43.0	43.0					15																	65623774		2201	4299	6500	63410827	SO:0001583	missense	9543	exon8			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1372G>A	15.37:g.65623774C>T	ENSP00000332773:p.Val458Ile		63410827	NM_004884	O95215	Missense_Mutation	SNP	ENST00000327987.4	37	CCDS10205.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.441085	0.63067	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.57107	0.42	4.85	4.85	0.62838	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.71367	0.3331	M	0.67953	2.075	0.47511	D	0.99944	D	0.89917	1.0	D	0.91635	0.999	T	0.72991	-0.4123	10	0.48119	T	0.1	-42.0419	17.9922	0.89172	0.0:1.0:0.0:0.0	.	458	Q8IVU1	IGDC3_HUMAN	I	458;321	ENSP00000332773:V458I	ENSP00000332773:V458I	V	-	1	0	IGDCC3	63410827	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	7.788000	0.85771	2.205000	0.71048	0.655000	0.94253	GTC		0.587	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884	
PML	5371	broad.mit.edu	37	15	74317244	74317244	+	Silent	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr15:74317244C>T	ENST00000268058.3	+	4	1326	c.1230C>T	c.(1228-1230)ccC>ccT	p.P410P	PML_ENST00000565898.1_Silent_p.P410P|PML_ENST00000436891.3_Silent_p.P410P|PML_ENST00000567543.1_Silent_p.P410P|PML_ENST00000569965.1_Silent_p.P410P|PML_ENST00000395132.2_Silent_p.P410P|PML_ENST00000354026.6_Silent_p.P410P|PML_ENST00000563500.1_Silent_p.P410P|PML_ENST00000359928.4_Silent_p.P410P|PML_ENST00000564428.1_Silent_p.P410P|PML_ENST00000569477.1_Silent_p.P410P|PML_ENST00000435786.2_Silent_p.P410P|PML_ENST00000569161.1_3'UTR|PML_ENST00000395135.3_Silent_p.P410P|PML_ENST00000268059.6_Silent_p.P410P	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	410					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P410P(3)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						CCAGCACTCCCAGGGACCCTA	0.572			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.P410P			Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C1230T	15						.						105.0	93.0	97.0					15																	74317244		2198	4297	6495	72104297	SO:0001819	synonymous_variant	5371	exon4			AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1230C>T	15.37:g.74317244C>T			72104297	NM_033238	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Silent	SNP	ENST00000268058.3	37	CCDS10255.1																																																																																				0.572	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
CSPG4	1464	broad.mit.edu	37	15	75982200	75982200	+	Silent	SNP	G	G	A	rs201738924		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr15:75982200G>A	ENST00000308508.5	-	3	1298	c.1206C>T	c.(1204-1206)gcC>gcT	p.A402A		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	402	Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.A402A(1)		breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						AAGCCTCAGGGGCCAGGGTGG	0.597																																					p.A402A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1206T	15						.																																			73769255	SO:0001819	synonymous_variant	1464	exon3			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1206C>T	15.37:g.75982200G>A			73769255	NM_001897	D3DW77|Q92675	Silent	SNP	ENST00000308508.5	37	CCDS10284.1																																																																																				0.597	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
ZNF213	7760	broad.mit.edu	37	16	3188474	3188474	+	Missense_Mutation	SNP	C	C	T	rs371164415		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr16:3188474C>T	ENST00000396878.3	+	3	930	c.455C>T	c.(454-456)aCg>aTg	p.T152M	ZNF213_ENST00000574902.1_Missense_Mutation_p.T152M|ZNF213_ENST00000576416.1_Missense_Mutation_p.T152M|ZNF213_ENST00000416391.2_Missense_Mutation_p.R19W	NM_001134655.1|NM_004220.2	NP_001128127.1|NP_004211.1	O14771	ZN213_HUMAN	zinc finger protein 213	152					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T152M(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	16						TCCCAGGCCACGGGGCCTCCC	0.677																																					p.T152M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C455T	16						.	C	MET/THR,MET/THR	0,4394		0,0,2197	30.0	38.0	35.0		455,455	-1.4	0.1	16		35	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense	ZNF213	NM_001134655.1,NM_004220.2	81,81	0,1,6494	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	152/460,152/460	3188474	1,12989	2197	4298	6495	3128475	SO:0001583	missense	7760	exon3			AF017433	CCDS10495.1	16p13.3	2014-05-13	2007-02-20	2007-02-20	ENSG00000085644	ENSG00000085644		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13005	protein-coding gene	gene with protein product		608387				9653642, 10023065	Standard	NM_004220		Approved	CR53, ZKSCAN21, ZSCAN53	uc010uws.2	O14771	OTTHUMG00000177519	ENST00000396878.3:c.455C>T	16.37:g.3188474C>T	ENSP00000380087:p.Thr152Met		3128475	NM_001134655	A8K1B9|B4DMG6|Q96IS1	Missense_Mutation	SNP	ENST00000396878.3	37	CCDS10495.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.70|12.70	2.017878|2.017878	0.35606|0.35606	0.0|0.0	1.16E-4|1.16E-4	ENSG00000085644|ENSG00000085644	ENST00000416391|ENST00000396878	T|T	0.05258|0.05139	3.47|3.49	5.18|5.18	-1.36|-1.36	0.09085|0.09085	.|.	.|1.046100	.|0.07623	.|N	.|0.927242	T|T	0.02807|0.02807	0.0084|0.0084	N|N	0.14661|0.14661	0.345|0.345	0.19300|0.19300	N|N	0.999975|0.999975	.|P	.|0.42973	.|0.796	.|B	.|0.35971	.|0.215	T|T	0.31888|0.31888	-0.9927|-0.9927	7|10	0.87932|0.32370	D|T	0|0.25	.|.	1.2251|1.2251	0.01932|0.01932	0.3899:0.3044:0.1684:0.1373|0.3899:0.3044:0.1684:0.1373	.|.	.|152	.|O14771	.|ZN213_HUMAN	W|M	19|152	ENSP00000403892:R19W|ENSP00000380087:T152M	ENSP00000403892:R19W|ENSP00000380087:T152M	R|T	+|+	1|2	2|0	ZNF213|ZNF213	3128475|3128475	0.001000|0.001000	0.12720|0.12720	0.124000|0.124000	0.21820|0.21820	0.050000|0.050000	0.14768|0.14768	-0.060000|-0.060000	0.11712|0.11712	-0.615000|-0.615000	0.05679|0.05679	-1.951000|-1.951000	0.00486|0.00486	CGG|ACG		0.677	ZNF213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437334.1	NM_004220	
RPGRIP1L	23322	broad.mit.edu	37	16	53730088	53730088	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr16:53730088G>A	ENST00000379925.3	-	3	255	c.205C>T	c.(205-207)Cgc>Tgc	p.R69C	RPGRIP1L_ENST00000566096.1_Missense_Mutation_p.R69C|RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.R69C|RPGRIP1L_ENST00000568653.3_Missense_Mutation_p.R69C|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.R69C|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.R69C	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	69					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)	p.R69C(1)		endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				TCCTGCTTGCGGGCATGCTGT	0.368																																					p.R69C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C205T	16						.						126.0	129.0	128.0					16																	53730088		2198	4300	6498	52287589	SO:0001583	missense	23322	exon3				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.205C>T	16.37:g.53730088G>A	ENSP00000369257:p.Arg69Cys		52287589	NM_001127897	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	ENST00000379925.3	37	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.876889	0.33162	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	D;D	0.88201	-2.35;-2.35	5.73	0.185	0.15096	.	0.439409	0.24615	N	0.037005	T	0.74861	0.3772	N	0.12961	0.28	0.36041	D	0.840069	B;B;B;B	0.15719	0.006;0.004;0.014;0.005	B;B;B;B	0.09377	0.002;0.001;0.004;0.001	T	0.64909	-0.6296	10	0.35671	T	0.21	-0.0133	6.443	0.21861	0.2592:0.0:0.553:0.1878	.	69;69;69;69	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	C	69	ENSP00000369257:R69C;ENSP00000262135:R69C	ENSP00000262135:R69C	R	-	1	0	RPGRIP1L	52287589	0.994000	0.37717	0.999000	0.59377	0.978000	0.69477	0.921000	0.28718	0.363000	0.24346	-0.244000	0.11960	CGC		0.368	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	
IRX6	79190	broad.mit.edu	37	16	55363201	55363201	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr16:55363201C>A	ENST00000290552.7	+	5	2643	c.1311C>A	c.(1309-1311)tgC>tgA	p.C437*	RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	437					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.C437*(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						TAGTGCAGTGCCAGTACCCGT	0.632																																					p.C437X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1311A	16						.						35.0	41.0	39.0					16																	55363201		2197	4296	6493	53920702	SO:0001587	stop_gained	79190	exon5			AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.1311C>A	16.37:g.55363201C>A	ENSP00000290552:p.Cys437*		53920702	NM_024335	B2RN06|Q7Z2K0	Nonsense_Mutation	SNP	ENST00000290552.7	37	CCDS32449.1	.	.	.	.	.	.	.	.	.	.	C	48	14.479927	0.99797	.	.	ENSG00000159387	ENST00000290552	.	.	.	4.92	3.98	0.46160	.	0.191966	0.44285	D	0.000466	.	.	.	.	.	.	0.45087	D	0.998103	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.5508	10.478	0.44676	0.0:0.9084:0.0:0.0916	.	.	.	.	X	437	.	ENSP00000290552:C437X	C	+	3	2	IRX6	53920702	1.000000	0.71417	0.995000	0.50966	0.692000	0.40212	2.212000	0.42835	1.289000	0.44618	0.561000	0.74099	TGC		0.632	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335	
PRPF8	10594	broad.mit.edu	37	17	1564662	1564662	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr17:1564662C>T	ENST00000572621.1	-	26	4506	c.4241G>A	c.(4240-4242)cGt>cAt	p.R1414H	PRPF8_ENST00000304992.6_Missense_Mutation_p.R1414H			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1414	Linker.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)	p.R1414H(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		AGGAATGCCACGATCCCATGA	0.453																																					p.R1414H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4241A	17						.						156.0	144.0	148.0					17																	1564662		2203	4300	6503	1511412	SO:0001583	missense	10594	exon27			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.4241G>A	17.37:g.1564662C>T	ENSP00000460348:p.Arg1414His		1511412	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	c	20.8	4.054070	0.75960	.	.	ENSG00000174231	ENST00000304992	D	0.82344	-1.6	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.90321	0.6972	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.63488	0.915	D	0.89507	0.3768	10	0.62326	D	0.03	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1414	Q6P2Q9	PRP8_HUMAN	H	1414	ENSP00000304350:R1414H	ENSP00000304350:R1414H	R	-	2	0	PRPF8	1511412	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.792000	0.85828	2.941000	0.99782	0.655000	0.94253	CGT		0.453	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
MYO18A	399687	broad.mit.edu	37	17	27422007	27422007	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr17:27422007G>A	ENST00000527372.1	-	29	4636	c.4456C>T	c.(4456-4458)Cgg>Tgg	p.R1486W	MYO18A_ENST00000533112.1_Missense_Mutation_p.R1486W|MYO18A_ENST00000354329.4_Missense_Mutation_p.R1486W|MYO18A_ENST00000531253.1_Missense_Mutation_p.R1486W	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1486					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.R1486W(1)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TCCTTCTCCCGCTGCAGCTTC	0.627																																					p.R1486W	Esophageal Squamous(182;472 2015 7001 15270 22562)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4456T	17						.						22.0	25.0	24.0					17																	27422007		2083	4222	6305	24446133	SO:0001583	missense	399687	exon29			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.4456C>T	17.37:g.27422007G>A	ENSP00000437073:p.Arg1486Trp		24446133	NM_203318	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.453216	0.84209	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428	T;D;T;T	0.83506	-1.49;-1.73;-1.49;-1.49	5.8	3.76	0.43208	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.90393	0.6993	M	0.79258	2.445	0.46167	D	0.998903	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.83275	0.996;0.95;0.973;0.973;0.988	D	0.90920	0.4782	10	0.87932	D	0	.	13.905	0.63828	0.0:0.0:0.6009:0.3991	.	1155;1098;1486;1486;1486	Q92614-2;F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;.;MY18A_HUMAN	W	1486;1486;1486;1486;1486;382;382;1098	ENSP00000346291:R1486W;ENSP00000435932:R1486W;ENSP00000434228:R1486W;ENSP00000437073:R1486W	ENSP00000346291:R1486W	R	-	1	2	MYO18A	24446133	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.077000	0.50089	0.748000	0.32831	0.655000	0.94253	CGG		0.627	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
ALOX15	246	broad.mit.edu	37	17	4534949	4534949	+	Silent	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr17:4534949G>A	ENST00000570836.1	-	15	2031	c.1935C>T	c.(1933-1935)gaC>gaT	p.D645D	ALOX15_ENST00000574640.1_Silent_p.D606D|ALOX15_ENST00000545513.1_Silent_p.D667D|ALOX15_ENST00000293761.3_Silent_p.D645D			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	645	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.D645D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		CGTAGGGCATGTCCAGCTTTG	0.552																																					p.D645D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1935T	17						.						161.0	144.0	150.0					17																	4534949		2203	4300	6503	4481698	SO:0001819	synonymous_variant	246	exon14			M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.1935C>T	17.37:g.4534949G>A			4481698	NM_001140	A8K2P4|B7ZA11|Q8N6R7|Q99657	Silent	SNP	ENST00000570836.1	37	CCDS11049.1																																																																																				0.552	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207487.2		
KPNB1	3837	broad.mit.edu	37	17	45752052	45752052	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr17:45752052G>A	ENST00000290158.4	+	15	2223	c.1816G>A	c.(1816-1818)Gtg>Atg	p.V606M	KPNB1_ENST00000537679.1_Missense_Mutation_p.V390M|KPNB1_ENST00000535458.2_Missense_Mutation_p.V461M|KPNB1_ENST00000540627.1_Missense_Mutation_p.V461M	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	606					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.V606M(1)		breast(1)|ovary(1)|pancreas(1)|skin(1)	4						GATCTCTGATGTGGTTATGGC	0.473																																					p.V606M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1816A	17						.						187.0	170.0	176.0					17																	45752052		2203	4300	6503	43107051	SO:0001583	missense	3837	exon15			L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.1816G>A	17.37:g.45752052G>A	ENSP00000290158:p.Val606Met		43107051	NM_002265	B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	ENST00000290158.4	37	CCDS11513.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012002	0.54468	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.13	5.13	0.70059	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.54775	0.1879	N	0.22421	0.69	0.34280	D	0.682062	P;P	0.46859	0.885;0.609	B;B	0.39503	0.301;0.158	T	0.63963	-0.6518	9	0.40728	T	0.16	-0.3917	18.9602	0.92674	0.0:0.0:1.0:0.0	.	390;606	F5H4R7;Q14974	.;IMB1_HUMAN	M	461;606;461;390	ENSP00000438253:V461M;ENSP00000290158:V606M;ENSP00000438964:V461M;ENSP00000445006:V390M	ENSP00000290158:V606M	V	+	1	0	KPNB1	43107051	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.561000	0.86390	0.561000	0.74099	GTG		0.473	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089755.2	NM_002265	
PRPF8	10594	broad.mit.edu	37	17	1585473	1585473	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr17:1585473delG	ENST00000572621.1	-	3	649	c.384delC	c.(382-384)ttcfs	p.F128fs	PRPF8_ENST00000304992.6_Frame_Shift_Del_p.F128fs			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	128					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)	p.F128fs*23(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TCTCATTGACGAAGGAAATGG	0.547																																					p.F128fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.384delC	17						.						146.0	126.0	133.0					17																	1585473		2203	4300	6503	1532223	SO:0001589	frameshift_variant	10594	exon4			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.384delC	17.37:g.1585473delG	ENSP00000460348:p.Phe128fs		1532223	NM_006445	O14547|O75965	Frame_Shift_Del	DEL	ENST00000572621.1	37	CCDS11010.1																																																																																				0.547	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
MKS1	54903	broad.mit.edu	37	17	56291736	56291736	+	Silent	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr17:56291736G>A	ENST00000393119.2	-	6	602	c.528C>T	c.(526-528)atC>atT	p.I176I	MKS1_ENST00000546108.1_5'UTR|MKS1_ENST00000537529.2_Silent_p.I166I|MKS1_ENST00000313863.6_Silent_p.I176I|MKS1_ENST00000337050.7_Silent_p.I176I	NM_017777.3	NP_060247.2	Q9NXB0	MKS1_HUMAN	Meckel syndrome, type 1	176					branching morphogenesis of an epithelial tube (GO:0048754)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)		p.I176I(2)		endometrium(5)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						GTGACTTGAGGATGCCGCCCT	0.557																																					p.I176I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C528T	17						.						87.0	89.0	88.0					17																	56291736		1994	4149	6143	53646735	SO:0001819	synonymous_variant	54903	exon6			DQ185029	CCDS11603.2, CCDS54148.1	17q21-q24	2014-09-17			ENSG00000011143	ENSG00000011143			7121	protein-coding gene	gene with protein product	"""POC12 centriolar protein homolog (Chlamydomonas)"""	609883		MKS		7550354, 16415886, 18327255	Standard	NM_017777		Approved	FLJ20345, POC12, BBS13	uc002ivr.2	Q9NXB0	OTTHUMG00000133714	ENST00000393119.2:c.528C>T	17.37:g.56291736G>A			53646735	NM_017777	B7WNX4|F5H885|Q284T0|Q96G13	Silent	SNP	ENST00000393119.2	37	CCDS11603.2	.	.	.	.	.	.	.	.	.	.	G	11.52	1.662476	0.29515	.	.	ENSG00000011143	ENST00000313863	.	.	.	5.74	-0.477	0.12097	.	.	.	.	.	T	0.39462	0.1079	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30937	-0.9961	4	.	.	.	-8.2415	0.5125	0.00597	0.2254:0.2179:0.3097:0.247	.	.	.	.	F	177	.	.	S	-	2	0	MKS1	53646735	0.999000	0.42202	1.000000	0.80357	0.969000	0.65631	0.618000	0.24373	0.320000	0.23234	0.643000	0.83706	TCC		0.557	MKS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258015.2	NM_017777	
TUBB6	84617	broad.mit.edu	37	18	12325518	12325518	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr18:12325518G>T	ENST00000317702.5	+	4	964	c.730G>T	c.(730-732)Ggc>Tgc	p.G244C	TUBB6_ENST00000590967.1_Intron|TUBB6_ENST00000591909.1_Intron|TUBB6_ENST00000591208.1_3'UTR			Q9BUF5	TBB6_HUMAN	tubulin, beta 6 class V	244					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G244C(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)	14				READ - Rectum adenocarcinoma(1;0.0649)		GCGCTTCCCGGGCCAGCTCAA	0.662																																					p.G244C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G730T	18						.						64.0	60.0	61.0					18																	12325518		2203	4300	6503	12315518	SO:0001583	missense	84617	exon4			AK001295	CCDS11858.1	18p11.21	2011-10-10	2011-10-10		ENSG00000176014	ENSG00000176014		"""Tubulins"""	20776	protein-coding gene	gene with protein product	"""tubulin beta MGC4083"", ""class V beta-tubulin"""	615103	"""tubulin, beta 6"""			12477932	Standard	NM_032525		Approved	MGC4083, HsT1601	uc002kqw.3	Q9BUF5	OTTHUMG00000131692	ENST00000317702.5:c.730G>T	18.37:g.12325518G>T	ENSP00000318697:p.Gly244Cys		12315518	NM_032525	B3KM76|Q9HA42	Missense_Mutation	SNP	ENST00000317702.5	37	CCDS11858.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418637	0.62622	.	.	ENSG00000176014	ENST00000317702;ENST00000417736;ENST00000445717	D	0.93811	-3.29	5.18	5.18	0.71444	Tubulin/FtsZ, GTPase domain (2);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98409	0.9471	H	0.99238	4.48	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.997	D	0.99701	1.1004	10	0.87932	D	0	.	19.1304	0.93404	0.0:0.0:1.0:0.0	.	216;244	B4DP54;Q9BUF5	.;TBB6_HUMAN	C	244;172;216	ENSP00000318697:G244C	ENSP00000318697:G244C	G	+	1	0	TUBB6	12315518	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	7.831000	0.86748	2.604000	0.88044	0.456000	0.33151	GGC		0.662	TUBB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254600.2	NM_032525	
EPG5	57724	broad.mit.edu	37	18	43460115	43460115	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr18:43460115G>C	ENST00000282041.5	-	32	5626	c.5592C>G	c.(5590-5592)agC>agG	p.S1864R	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1864			S -> N (in dbSNP:rs34064739).		autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.S1864R(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CCTGCTGGCAGCTGGGGGCGC	0.642											OREG0024951	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S1864R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5592G	18						.						31.0	32.0	32.0					18																	43460115		1883	4101	5984	41714113	SO:0001583	missense	57724	exon32			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.5592C>G	18.37:g.43460115G>C	ENSP00000282041:p.Ser1864Arg	916	41714113	NM_020964	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	G	10.94	1.492194	0.26774	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.10860	2.83	5.65	1.54	0.23209	.	.	.	.	.	T	0.05044	0.0135	N	0.16478	0.41	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44159	-0.9346	9	0.15066	T	0.55	6.4878	2.5083	0.04650	0.2329:0.208:0.4537:0.1054	.	1864	Q9HCE0	EPG5_HUMAN	R	1864;739	ENSP00000282041:S1864R	ENSP00000282041:S1864R	S	-	3	2	EPG5	41714113	0.002000	0.14202	0.023000	0.16930	0.748000	0.42578	1.332000	0.33805	0.745000	0.32763	-0.463000	0.05309	AGC		0.642	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
KATNAL2	83473	broad.mit.edu	37	18	44626631	44626631	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr18:44626631G>T	ENST00000245121.5	+	14	1359	c.1165G>T	c.(1165-1167)Gag>Tag	p.E389*	KATNAL2_ENST00000356157.7_Nonsense_Mutation_p.E461*	NM_031303.2	NP_112593.2			katanin p60 subunit A-like 2									p.E389*(1)		central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						TCAGGAGACTGAGGGCTACTC	0.512											OREG0024959	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E389X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1165T	18						.						93.0	79.0	84.0					18																	44626631		2203	4300	6503	42880629	SO:0001587	stop_gained	83473	exon14			BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000245121.5:c.1165G>T	18.37:g.44626631G>T	ENSP00000245121:p.Glu389*	925	42880629	NM_031303		Nonsense_Mutation	SNP	ENST00000245121.5	37	CCDS32828.1	.	.	.	.	.	.	.	.	.	.	G	38	6.654810	0.97739	.	.	ENSG00000167216	ENST00000356157;ENST00000245121	.	.	.	5.7	5.7	0.88788	.	0.172368	0.49916	D	0.000123	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-5.4473	14.97	0.71226	0.0702:0.0:0.9298:0.0	.	.	.	.	X	461;389	.	ENSP00000245121:E389X	E	+	1	0	KATNAL2	42880629	1.000000	0.71417	0.984000	0.44739	0.983000	0.72400	7.308000	0.78929	2.686000	0.91538	0.491000	0.48974	GAG		0.512	KATNAL2-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446138.2	NM_031303	
MTCL1	23255	broad.mit.edu	37	18	8720394	8720394	+	Missense_Mutation	SNP	G	G	A	rs371187347		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr18:8720394G>A	ENST00000306329.11	+	3	1337	c.1337G>A	c.(1336-1338)cGc>cAc	p.R446H	SOGA2_ENST00000400050.3_Missense_Mutation_p.R86H|SOGA2_ENST00000517570.1_Missense_Mutation_p.R86H|Y_RNA_ENST00000516510.1_RNA|SOGA2_ENST00000359865.3_Missense_Mutation_p.R86H|SOGA2_ENST00000306285.7_5'UTR														p.R86H(1)									GAGGAAAAGCGCGCTAAAGCT	0.468																																					p.R86H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G257A	18						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	113.0	98.0	103.0		257	5.2	1.0	18		103	0,8600		0,0,4300	no	missense	CCDC165	NM_015210.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	86/1587	8720394	1,13005	2203	4300	6503	8710394	SO:0001583	missense	23255	exon4																														ENST00000306329.11:c.1337G>A	18.37:g.8720394G>A	ENSP00000305027:p.Arg446His		8710394	NM_015210		Missense_Mutation	SNP	ENST00000306329.11	37		.	.	.	.	.	.	.	.	.	.	G	35	5.560167	0.96527	2.27E-4	0.0	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T	0.78003	-1.14;-1.14;-1.14	5.17	5.17	0.71159	.	0.000000	0.42682	D	0.000669	D	0.89026	0.6598	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88424	0.3030	10	0.40728	T	0.16	-16.9004	19.039	0.92991	0.0:0.0:1.0:0.0	.	86	Q9Y4B5-3	.	H	107;86;86;86	ENSP00000429556:R86H;ENSP00000352927:R86H;ENSP00000382924:R86H	ENSP00000305027:R107H	R	+	2	0	CCDC165	8710394	1.000000	0.71417	0.955000	0.39395	0.958000	0.62258	9.813000	0.99286	2.578000	0.87016	0.650000	0.86243	CGC		0.468	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
SERPINB11	89778	broad.mit.edu	37	18	61388161	61388161	+	RNA	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr18:61388161G>A	ENST00000382749.5	+	0	960				SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000544088.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V239I(1)		breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				GCTGCCCTACGTTAACAACAA	0.363																																					p.V239I	Ovarian(27;496 784 5942 8975 23930)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G715A	18						.						68.0	68.0	68.0					18																	61388161		1879	4121	6000	59539141			89778	exon7					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61388161G>A			59539141	NM_080475	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	ENST00000382749.5	37		.	.	.	.	.	.	.	.	.	.	G	10.61	1.399128	0.25291	.	.	ENSG00000206072	ENST00000544088;ENST00000536691	D;D	0.82711	-1.64;-1.64	5.76	3.95	0.45737	Serpin domain (3);	.	.	.	.	T	0.79862	0.4519	L	0.54323	1.7	0.09310	N	1	P;D;P;D	0.59767	0.948;0.986;0.948;0.958	B;B;B;P	0.46940	0.325;0.436;0.325;0.532	T	0.68857	-0.5298	9	0.41790	T	0.15	.	5.9806	0.19405	0.0724:0.1355:0.6517:0.1404	.	64;152;239;239	F5GWT8;Q96P15-2;F5GYW9;Q96P15	.;.;.;SPB11_HUMAN	I	239;64	ENSP00000441497:V239I;ENSP00000441708:V64I	ENSP00000421854:V239I	V	+	1	0	SERPINB11	59539141	0.008000	0.16893	0.001000	0.08648	0.510000	0.34073	1.619000	0.36965	0.755000	0.32990	0.650000	0.86243	GTT		0.363	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000207392.3	NM_080475	
TNPO2	30000	broad.mit.edu	37	19	12822221	12822221	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr19:12822221G>A	ENST00000592287.1	-	11	1114	c.1006C>T	c.(1006-1008)Cgc>Tgc	p.R336C	TNPO2_ENST00000588216.1_Missense_Mutation_p.R336C|TNPO2_ENST00000450764.2_Missense_Mutation_p.R336C|TNPO2_ENST00000589956.1_5'UTR|TNPO2_ENST00000441499.1_Missense_Mutation_p.R336C|TNPO2_ENST00000356861.5_Missense_Mutation_p.R336C|TNPO2_ENST00000425528.1_Missense_Mutation_p.R336C	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	336					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)	p.R336C(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						TTGTGGAAGCGTGGCTTGATG	0.617																																					p.R336C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1006T	19						.						158.0	168.0	165.0					19																	12822221		2200	4291	6491	12683221	SO:0001583	missense	30000	exon11			AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.1006C>T	19.37:g.12822221G>A	ENSP00000468434:p.Arg336Cys		12683221	NM_001136196	O14655|Q6IN77	Missense_Mutation	SNP	ENST00000592287.1	37	CCDS45991.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719223	0.89205	.	.	ENSG00000105576	ENST00000536114;ENST00000425528;ENST00000441499;ENST00000450764;ENST00000356861;ENST00000420511;ENST00000546320	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.44	4.37	0.52481	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85248	0.5653	M	0.93150	3.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.951	D	0.88924	0.3368	10	0.87932	D	0	-3.8122	14.4799	0.67573	0.0:0.0:0.8524:0.1476	.	500;336	Q4LE60;O14787	.;TNPO2_HUMAN	C	500;336;336;336;336;336;336	ENSP00000407182:R336C;ENSP00000389648:R336C;ENSP00000397379:R336C;ENSP00000349321:R336C	ENSP00000349321:R336C	R	-	1	0	TNPO2	12683221	1.000000	0.71417	0.991000	0.47740	0.920000	0.55202	7.621000	0.83083	2.556000	0.86216	0.561000	0.74099	CGC		0.617	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1	NM_013433	
TMEM147	10430	broad.mit.edu	37	19	36038037	36038037	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr19:36038037C>T	ENST00000222284.5	+	6	591	c.446C>T	c.(445-447)gCg>gTg	p.A149V	AD000090.2_ENST00000444728.1_RNA|TMEM147_ENST00000392205.1_Missense_Mutation_p.A149V|AD000090.2_ENST00000590717.1_RNA|AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000588286.1_RNA|TMEM147_ENST00000392204.2_Missense_Mutation_p.A100V	NM_032635.3	NP_116024.1	Q9BVK8	TM147_HUMAN	transmembrane protein 147	149						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.A149V(1)		endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TACATCGTCGCGTCTGCTCAG	0.557																																					p.A149V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C446T	19						.						153.0	132.0	139.0					19																	36038037		2203	4300	6503	40729877	SO:0001583	missense	10430	exon6			BC001118	CCDS12466.1, CCDS56091.1	19q13.12	2010-08-13			ENSG00000105677	ENSG00000105677			30414	protein-coding gene	gene with protein product		613585				20538592	Standard	NM_032635		Approved	NIFIE14, MGC1936	uc002oaj.2	Q9BVK8	OTTHUMG00000048105	ENST00000222284.5:c.446C>T	19.37:g.36038037C>T	ENSP00000222284:p.Ala149Val		40729877	NM_032635	A8MWW0|O75790	Missense_Mutation	SNP	ENST00000222284.5	37	CCDS12466.1	.	.	.	.	.	.	.	.	.	.	C	3.904	-0.021368	0.07634	.	.	ENSG00000105677	ENST00000392204;ENST00000222284;ENST00000392205	T;T;T	0.39997	1.05;1.05;1.05	5.63	4.55	0.56014	.	0.104811	0.64402	D	0.000005	T	0.12646	0.0307	N	0.03324	-0.35	0.36561	D	0.872403	B;B	0.34147	0.438;0.007	B;B	0.26310	0.068;0.008	T	0.34750	-0.9816	10	0.02654	T	1	.	5.2239	0.15383	0.0:0.7631:0.0:0.2369	.	100;149	A8MWW0;Q9BVK8	.;TM147_HUMAN	V	100;149;149	ENSP00000376040:A100V;ENSP00000222284:A149V;ENSP00000376041:A149V	ENSP00000222284:A149V	A	+	2	0	TMEM147	40729877	0.983000	0.35010	0.148000	0.22405	0.817000	0.46193	2.587000	0.46128	2.659000	0.90383	0.655000	0.94253	GCG		0.557	TMEM147-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109469.2	NM_032635	
NFKBID	84807	broad.mit.edu	37	19	36380912	36380912	+	Silent	SNP	A	A	G			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr19:36380912A>G	ENST00000396901.1	-	11	1341	c.768T>C	c.(766-768)ccT>ccC	p.P256P	NFKBID_ENST00000606253.1_Silent_p.P256P|NFKBID_ENST00000352614.2_Silent_p.P408P|NFKBID_ENST00000340950.2_Silent_p.P93P	NM_139239.1	NP_640332.1	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta	256					inflammatory response (GO:0006954)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|positive regulation of thymocyte apoptotic process (GO:0070245)	nucleus (GO:0005634)		p.P256P(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	14						GGGCCGGCCCAGGGGGCAGGG	0.697																																					p.P256P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T768C	19						.						13.0	16.0	15.0					19																	36380912		1881	4078	5959	41072752	SO:0001819	synonymous_variant	84807	exon11			AF385434	CCDS42552.1	19q13.12	2013-01-10				ENSG00000167604		"""Ankyrin repeat domain containing"""	15671	protein-coding gene	gene with protein product						12477932	Standard	NM_139239		Approved	TA-NFKBH, IkappaBNS	uc002oci.1	Q8NI38		ENST00000396901.1:c.768T>C	19.37:g.36380912A>G			41072752	NM_139239	Q8NI39|Q9BRG9	Silent	SNP	ENST00000396901.1	37	CCDS42552.1																																																																																				0.697	NFKBID-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452927.3	NM_032721	
ZNF569	148266	broad.mit.edu	37	19	37903658	37903658	+	Silent	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr19:37903658G>A	ENST00000316950.6	-	6	2459	c.1902C>T	c.(1900-1902)ttC>ttT	p.F634F	ZNF569_ENST00000392149.2_Silent_p.F634F|ZNF569_ENST00000392150.2_Silent_p.F475F	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	634					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F634F(1)		breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TACTACAGTCGAAGGGTTTCT	0.403																																					p.F634F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1902T	19						.						128.0	125.0	126.0					19																	37903658		2203	4300	6503	42595498	SO:0001819	synonymous_variant	148266	exon6			AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.1902C>T	19.37:g.37903658G>A			42595498	NM_152484	A8K1S2|Q15925|Q17RR6|Q96MQ2	Silent	SNP	ENST00000316950.6	37	CCDS12503.1																																																																																				0.403	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484	
PSG7	5676	broad.mit.edu	37	19	43430716	43430716	+	RNA	SNP	G	G	A	rs200153986		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr19:43430716G>A	ENST00000406070.2	-	0	958				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				TCAATGCGTCGCTTTACCCTG	0.488													.|||	1	0.000199681	0.0008	0.0	5008	,	,		21338	0.0		0.0	False		,,,				2504	0.0				p.R288X												.	.	0			c.C862T	19						.						234.0	219.0	224.0					19																	43430716		2202	4284	6486	48122556			5676	exon4					19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43430716G>A			48122556	NM_002783	Q15232	Nonsense_Mutation	SNP	ENST00000406070.2	37																																																																																					0.488	PSG7-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000321431.2	NM_001206650	
ZNF284	342909	broad.mit.edu	37	19	44591228	44591228	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr19:44591228C>T	ENST00000421176.3	+	5	1813	c.1597C>T	c.(1597-1599)Cac>Tac	p.H533Y	RNU6-902P_ENST00000517212.1_RNA|ZNF223_ENST00000591793.1_3'UTR	NM_001037813.2	NP_001032902.1	Q2VY69	ZN284_HUMAN	zinc finger protein 284	533					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H533Y(1)		NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0435)				TCAAAGACTCCACAGCAGAGA	0.443																																					p.H533Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1597T	19						.						42.0	44.0	43.0					19																	44591228		2152	4283	6435	49283068	SO:0001583	missense	342909	exon5			AY166789	CCDS46099.1	19q13.32	2013-01-08				ENSG00000186026		"""Zinc fingers, C2H2-type"", ""-"""	13078	protein-coding gene	gene with protein product						12743021	Standard	NM_001037813		Approved	DKFZp781F1775	uc002oyg.1	Q2VY69		ENST00000421176.3:c.1597C>T	19.37:g.44591228C>T	ENSP00000411032:p.His533Tyr		49283068	NM_001037813	Q86WM1	Missense_Mutation	SNP	ENST00000421176.3	37	CCDS46099.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004184	0.35320	.	.	ENSG00000186026	ENST00000421176	T	0.26518	1.73	2.36	2.36	0.29203	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48352	0.1495	M	0.85373	2.75	0.24878	N	0.992243	D	0.61080	0.989	P	0.60286	0.872	T	0.31475	-0.9942	9	0.72032	D	0.01	.	9.891	0.41290	0.0:1.0:0.0:0.0	.	533	Q2VY69	ZN284_HUMAN	Y	533	ENSP00000411032:H533Y	ENSP00000411032:H533Y	H	+	1	0	ZNF284	49283068	0.997000	0.39634	0.021000	0.16686	0.278000	0.26855	3.885000	0.56182	1.306000	0.44926	0.455000	0.32223	CAC		0.443	ZNF284-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460473.1	NM_001037813	
LRRC4B	94030	broad.mit.edu	37	19	51021872	51021872	+	Silent	SNP	G	G	A	rs550149281		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr19:51021872G>A	ENST00000599957.1	-	3	1295	c.1098C>T	c.(1096-1098)atC>atT	p.I366I	LRRC4B_ENST00000389201.3_Silent_p.I366I			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	366	Ig-like C2-type.				positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.I366M(1)|p.I366I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GCGGCTCCACGATGACGGGCG	0.667													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15868	0.0		0.0	False		,,,				2504	0.0				p.I366I												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C1098T	19						.						49.0	55.0	53.0					19																	51021872		2110	4233	6343	55713684	SO:0001819	synonymous_variant	94030	exon3			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1098C>T	19.37:g.51021872G>A			55713684	NM_001080457	Q3ZCQ4|Q58F20	Silent	SNP	ENST00000599957.1	37	CCDS42595.1																																																																																				0.667	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
ZNF256	10172	broad.mit.edu	37	19	58453320	58453320	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr19:58453320G>A	ENST00000282308.3	-	3	1052	c.856C>T	c.(856-858)Cga>Tga	p.R286*	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	286					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R286*(2)		endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		TGAATTCTTCGGTGCGTAATA	0.393																																					p.R286X	NSCLC(55;1313 1552 8040 11996)											.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C856T	19						.						97.0	92.0	94.0					19																	58453320		2203	4300	6503	63145132	SO:0001587	stop_gained	10172	exon3			AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.856C>T	19.37:g.58453320G>A	ENSP00000282308:p.Arg286*		63145132	NM_005773	B2RA92|Q53Y85|Q9BV71	Nonsense_Mutation	SNP	ENST00000282308.3	37	CCDS12966.1	.	.	.	.	.	.	.	.	.	.	.	38	6.729013	0.97796	.	.	ENSG00000152454	ENST00000282308	.	.	.	3.13	0.702	0.18110	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	6.7605	0.23538	0.0:0.1699:0.483:0.3471	.	.	.	.	X	286	.	ENSP00000282308:R286X	R	-	1	2	ZNF256	63145132	0.000000	0.05858	0.000000	0.03702	0.952000	0.60782	0.020000	0.13466	0.119000	0.18210	0.460000	0.39030	CGA		0.393	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1		
ADAM15	8751	broad.mit.edu	37	1	155034744	155034745	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:155034744_155034745insC	ENST00000356955.2	+	22	2549_2550	c.2448_2449insC	c.(2449-2451)cccfs	p.P817fs	EFNA4_ENST00000368409.3_5'Flank|ADAM15_ENST00000531455.1_Frame_Shift_Ins_p.P778fs|ADAM15_ENST00000355956.2_Frame_Shift_Ins_p.P793fs|ADAM15_ENST00000368412.3_Frame_Shift_Ins_p.HP768fs|ADAM15_ENST00000271836.6_Frame_Shift_Ins_p.P768fs|EFNA3_ENST00000556931.1_5'Flank|ADAM15_ENST00000368410.2_Frame_Shift_Ins_p.P474fs|ADAM15_ENST00000359280.4_Frame_Shift_Ins_p.P792fs|ADAM15_ENST00000368413.1_Frame_Shift_Ins_p.P474fs|EFNA3_ENST00000505139.1_5'Flank|ADAM15_ENST00000472434.1_3'UTR|EFNA4_ENST00000427683.2_5'Flank|EFNA4_ENST00000359751.4_5'Flank|ADAM15_ENST00000449910.2_Frame_Shift_Ins_p.P816fs|ADAM15_ENST00000360674.4_Frame_Shift_Ins_p.HP744fs	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	817					angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CCAAGCCCCCACCCCCAAGGAA	0.708											OREG0013848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P816fs												.	.	0			c.2448_2449insC	1						.																																			153301369	SO:0001589	frameshift_variant	8751	exon22			U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.2453dupC	1.37:g.155034749_155034749dupC	ENSP00000349436:p.Pro817fs	1767	153301368	NM_207197	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Frame_Shift_Ins	INS	ENST00000356955.2	37	CCDS1087.1																																																																																				0.708	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387168.1	NM_003815	
DENND2C	163259	broad.mit.edu	37	1	115143520	115143520	+	Missense_Mutation	SNP	C	C	T	rs143038734	byFrequency	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:115143520C>T	ENST00000393274.1	-	14	2502	c.1877G>A	c.(1876-1878)cGa>cAa	p.R626Q	DENND2C_ENST00000393277.1_Missense_Mutation_p.R626Q|DENND2C_ENST00000481894.1_5'UTR|DENND2C_ENST00000393276.3_Missense_Mutation_p.R569Q	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	626	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R569Q(1)		NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CATGACACTTCGCATGAATGG	0.428													C|||	5	0.000998403	0.0	0.0	5008	,	,		17715	0.005		0.0	False		,,,				2504	0.0				p.R569Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1706A	1						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	125.0	122.0	123.0		1706	4.5	1.0	1	dbSNP_134	123	0,8600		0,0,4300	yes	missense	DENND2C	NM_198459.3	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	569/872	115143520	1,13005	2203	4300	6503	114945043	SO:0001583	missense	163259	exon11				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.1877G>A	1.37:g.115143520C>T	ENSP00000376955:p.Arg626Gln		114945043	NM_198459	B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	ENST00000393274.1	37	CCDS58018.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519859	0.85495	2.27E-4	0.0	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.10763	2.84;2.84;2.84	5.45	4.5	0.54988	DENN (3);	0.059499	0.64402	N	0.000002	T	0.09202	0.0227	N	0.12920	0.275	0.48762	D	0.999709	D;P	0.89917	1.0;0.865	D;P	0.77557	0.99;0.459	T	0.30794	-0.9966	10	0.39692	T	0.17	.	13.2889	0.60260	0.0:0.9193:0.0:0.0807	.	626;569	Q68D51;Q68D51-3	DEN2C_HUMAN;.	Q	569;626;626;626	ENSP00000376957:R569Q;ENSP00000376955:R626Q;ENSP00000376958:R626Q	ENSP00000358553:R626Q	R	-	2	0	DENND2C	114945043	0.997000	0.39634	1.000000	0.80357	0.986000	0.74619	2.730000	0.47335	1.221000	0.43506	-0.355000	0.07637	CGA		0.428	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459	
ADAR	103	broad.mit.edu	37	1	154562856	154562856	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:154562856C>A	ENST00000368474.4	-	7	2499	c.2300G>T	c.(2299-2301)cGc>cTc	p.R767L	ADAR_ENST00000292205.5_Missense_Mutation_p.R810L|ADAR_ENST00000368471.3_Missense_Mutation_p.R472L	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	767	DRBM 3. {ECO:0000255|PROSITE- ProRule:PRU00266}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R767L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		TGGGAACCAGCGACCCCCAAC	0.517																																					p.R748L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2243T	1						.						82.0	80.0	81.0					1																	154562856		2203	4300	6503	152829480	SO:0001583	missense	103	exon7			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2300G>T	1.37:g.154562856C>A	ENSP00000357459:p.Arg767Leu		152829480	NM_015841	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	C	36	5.695242	0.96793	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	6.04	6.04	0.98038	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.83552	0.5279	L	0.46157	1.445	0.80722	D	1	D;D;D	0.89917	0.994;1.0;1.0	D;D;D	0.81914	0.97;0.99;0.995	T	0.82430	-0.0461	10	0.54805	T	0.06	-21.287	20.5948	0.99439	0.0:1.0:0.0:0.0	.	748;767;767	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	L	810;767;472;762	ENSP00000292205:R810L;ENSP00000357459:R767L;ENSP00000357456:R472L;ENSP00000431794:R762L	ENSP00000292205:R810L	R	-	2	0	ADAR	152829480	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.221000	0.78016	2.873000	0.98535	0.563000	0.77884	CGC		0.517	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
ZBTB7B	51043	broad.mit.edu	37	1	154987308	154987308	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:154987308T>C	ENST00000368426.3	+	3	309	c.172T>C	c.(172-174)Tac>Cac	p.Y58H	ZBTB7B_ENST00000417934.2_Missense_Mutation_p.Y92H|ZBTB7B_ENST00000487542.1_3'UTR|ZBTB7B_ENST00000292176.2_Missense_Mutation_p.Y58H|ZBTB7B_ENST00000535420.1_Missense_Mutation_p.Y58H	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	58	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y58H(1)		endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTGTAGCCACTACTTCAAGAA	0.647																																					p.Y58H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T172C	1						.						57.0	62.0	60.0					1																	154987308		2203	4300	6503	153253932	SO:0001583	missense	51043	exon3			AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.172T>C	1.37:g.154987308T>C	ENSP00000357411:p.Tyr58His		153253932	NM_015872	B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Missense_Mutation	SNP	ENST00000368426.3	37	CCDS1081.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.989045	0.74589	.	.	ENSG00000160685	ENST00000535420;ENST00000368426;ENST00000417934;ENST00000292176	T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83	3.59	3.59	0.41128	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.64402	D	0.000004	D	0.84561	0.5499	M	0.90922	3.16	0.40422	D	0.979858	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.87182	0.2228	10	0.87932	D	0	.	10.1444	0.42755	0.0:0.0:0.0:1.0	.	58;58;92	A8K6F4;O15156;B4E3K5	.;ZBT7B_HUMAN;.	H	58;58;92;58	ENSP00000438647:Y58H;ENSP00000357411:Y58H;ENSP00000406286:Y92H;ENSP00000292176:Y58H	ENSP00000292176:Y58H	Y	+	1	0	ZBTB7B	153253932	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.365000	0.79537	1.488000	0.48433	0.379000	0.24179	TAC		0.647	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1	NM_015872	
CACNA1S	779	broad.mit.edu	37	1	201039485	201039485	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:201039485G>A	ENST00000362061.3	-	17	2501	c.2275C>T	c.(2275-2277)Cgt>Tgt	p.R759C	CACNA1S_ENST00000367338.3_Missense_Mutation_p.R759C	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	759					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R759C(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCAGGGGACGTGGTCGGGGG	0.592																																					p.R759C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2275T	1						.						70.0	76.0	74.0					1																	201039485		2203	4300	6503	199306108	SO:0001583	missense	779	exon17			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.2275C>T	1.37:g.201039485G>A	ENSP00000355192:p.Arg759Cys		199306108	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643676	0.47258	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.96587	-4.06;-3.99	4.18	3.25	0.37280	.	0.000000	0.85682	D	0.000000	D	0.98182	0.9399	M	0.91717	3.235	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.98362	1.0549	10	0.87932	D	0	.	11.4361	0.50068	0.0:0.0:0.6718:0.3281	.	759	Q13698	CAC1S_HUMAN	C	759	ENSP00000355192:R759C;ENSP00000356307:R759C	ENSP00000355192:R759C	R	-	1	0	CACNA1S	199306108	1.000000	0.71417	0.262000	0.24481	0.426000	0.31534	4.519000	0.60517	0.836000	0.34901	0.643000	0.83706	CGT		0.592	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
CR2	1380	broad.mit.edu	37	1	207643266	207643266	+	Silent	SNP	G	G	A	rs144982406		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:207643266G>A	ENST00000367058.3	+	6	1233	c.1044G>A	c.(1042-1044)gcG>gcA	p.A348A	CR2_ENST00000367057.3_Silent_p.A348A|CR2_ENST00000367059.3_Silent_p.A348A|CR2_ENST00000458541.2_Silent_p.A348A|CR2_ENST00000485707.1_3'UTR	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	348					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)	p.A348A(1)		NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CTACTTCTGCGGTTCAGTGTC	0.488																																					p.A348A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1044A	1						.	G	,	1,4405	2.1+/-5.4	0,1,2202	138.0	122.0	127.0		1044,1044	-9.4	0.0	1	dbSNP_134	127	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CR2	NM_001006658.2,NM_001877.4	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	348/1093,348/1034	207643266	1,13005	2203	4300	6503	205709889	SO:0001819	synonymous_variant	1380	exon6			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1044G>A	1.37:g.207643266G>A			205709889	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Silent	SNP	ENST00000367058.3	37	CCDS1478.1																																																																																				0.488	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
SNAP47	116841	broad.mit.edu	37	1	227946859	227946859	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:227946859A>G	ENST00000366759.4	+	3	1210	c.796A>G	c.(796-798)Aca>Gca	p.T266A	SNAP47_ENST00000315781.5_Missense_Mutation_p.T266A|SNAP47_ENST00000366760.1_Missense_Mutation_p.T24A	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	266					long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)		p.T266A(1)		endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						TTCCCACAGAACAGAGTCTCA	0.463																																					p.T266A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A796G	1						.						118.0	123.0	121.0					1																	227946859		2203	4300	6503	226013482	SO:0001583	missense	116841	exon3			AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.796A>G	1.37:g.227946859A>G	ENSP00000355721:p.Thr266Ala		226013482	NM_053052	B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Missense_Mutation	SNP	ENST00000366759.4	37	CCDS1562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.599|6.599	0.478961|0.478961	0.12581|0.12581	.|.	.|.	ENSG00000143740|ENSG00000143740	ENST00000418653;ENST00000426344|ENST00000366760;ENST00000366759;ENST00000315781	.|T;T;T	.|0.44482	.|0.92;2.26;2.25	4.88|4.88	2.48|2.48	0.30137|0.30137	.|.	.|0.554171	.|0.21039	.|N	.|0.081204	T|T	0.27278|0.27278	0.0669|0.0669	L|L	0.47716|0.47716	1.5|1.5	0.24182|0.24182	N|N	0.99558|0.99558	.|B;B;B;B;B	.|0.28350	.|0.01;0.041;0.208;0.208;0.041	.|B;B;B;B;B	.|0.25759	.|0.011;0.016;0.063;0.063;0.016	T|T	0.18524|0.18524	-1.0334|-1.0334	5|10	.|0.11794	.|T	.|0.64	-9.7707|-9.7707	4.211|4.211	0.10512|0.10512	0.6407:0.1738:0.1854:0.0|0.6407:0.1738:0.1854:0.0	.|.	.|24;266;78;266;24	.|Q5SQN1-3;Q5SQN1;Q5TBZ4;Q5SQN1-2;Q5SQN1-4	.|.;SNP47_HUMAN;.;.;.	S|A	78;257|24;266;266	.|ENSP00000355722:T24A;ENSP00000355721:T266A;ENSP00000314157:T266A	.|ENSP00000314157:T266A	N|T	+|+	2|1	0|0	SNAP47|SNAP47	226013482|226013482	1.000000|1.000000	0.71417|0.71417	0.806000|0.806000	0.32338|0.32338	0.936000|0.936000	0.57629|0.57629	3.267000|3.267000	0.51577|0.51577	0.334000|0.334000	0.23590|0.23590	0.418000|0.418000	0.28097|0.28097	AAC|ACA		0.463	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091961.1	NM_053052	
WNT3A	89780	broad.mit.edu	37	1	228210379	228210379	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:228210379T>C	ENST00000284523.1	+	2	161	c.83T>C	c.(82-84)gTt>gCt	p.V28A	WNT3A_ENST00000366753.2_Missense_Mutation_p.V28A	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	28					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)	p.V28A(1)		kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				TCGCTGGCTGTTGGGCCACAG	0.637																																					p.V28A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T83C	1						.						51.0	52.0	52.0					1																	228210379		2203	4300	6503	226277002	SO:0001583	missense	89780	exon2			AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.83T>C	1.37:g.228210379T>C	ENSP00000284523:p.Val28Ala		226277002	NM_033131	Q3SY79|Q3SY80|Q969P2	Missense_Mutation	SNP	ENST00000284523.1	37	CCDS1564.1	.	.	.	.	.	.	.	.	.	.	T	10.83	1.459965	0.26248	.	.	ENSG00000154342	ENST00000284523;ENST00000366753	T;T	0.75589	-0.94;-0.95	4.47	4.47	0.54385	.	9.714430	0.01661	U	0.025106	T	0.58850	0.2151	N	0.08118	0	0.29807	N	0.831931	B;B	0.30068	0.267;0.136	B;B	0.26969	0.075;0.071	T	0.48581	-0.9023	10	0.10902	T	0.67	.	13.5625	0.61797	0.0:0.0:0.0:1.0	.	28;28	P56704;Q3SY79	WNT3A_HUMAN;.	A	28	ENSP00000284523:V28A;ENSP00000355715:V28A	ENSP00000284523:V28A	V	+	2	0	WNT3A	226277002	0.983000	0.35010	0.110000	0.21437	0.031000	0.12232	7.747000	0.85070	1.873000	0.54277	0.478000	0.44815	GTT		0.637	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091648.1	NM_033131	
PGBD5	79605	broad.mit.edu	37	1	230486756	230486756	+	Missense_Mutation	SNP	C	C	T	rs375905173		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:230486756C>T	ENST00000525115.1	-	3	658	c.635G>A	c.(634-636)cGg>cAg	p.R212Q	PGBD5_ENST00000391860.1_Missense_Mutation_p.R166Q|PGBD5_ENST00000321327.2_Missense_Mutation_p.R311Q			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	212						integral component of membrane (GO:0016021)		p.R311Q(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GCTGAATTTCCGCTTTTTCCT	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		19412	0.001		0.0	False		,,,				2504	0.0				p.R212Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G635A	1						.	C	GLN/ARG	0,4406		0,0,2203	127.0	116.0	120.0		635	5.7	1.0	1		120	1,8599	1.2+/-3.3	0,1,4299	no	missense	PGBD5	NM_024554.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	212/456	230486756	1,13005	2203	4300	6503	228553379	SO:0001583	missense	79605	exon3			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.635G>A	1.37:g.230486756C>T	ENSP00000431404:p.Arg212Gln		228553379	NM_024554	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	37		.	.	.	.	.	.	.	.	.	.	C	36	5.736589	0.96865	0.0	1.16E-4	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.17691	2.26;2.26;2.26	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.28632	0.0709	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04229	-1.0967	10	0.13470	T	0.59	-43.5715	19.8411	0.96685	0.0:1.0:0.0:0.0	.	212	Q8N414	PGBD5_HUMAN	Q	166;311;212	ENSP00000375733:R166Q;ENSP00000322530:R311Q;ENSP00000431404:R212Q	ENSP00000322530:R311Q	R	-	2	0	PGBD5	228553379	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.609000	0.82925	2.683000	0.91414	0.655000	0.94253	CGG		0.567	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
PER3	8863	broad.mit.edu	37	1	7887408	7887408	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:7887408G>A	ENST00000361923.2	+	17	2570	c.2395G>A	c.(2395-2397)Gtc>Atc	p.V799I	PER3_ENST00000377532.3_Missense_Mutation_p.V807I|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	799	Pro-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.V799F(1)|p.V799I(1)		breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CCCTTACCTCGTCCCAGCTTT	0.697																																					p.V799I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2395A	1						.						47.0	49.0	49.0					1																	7887408		2203	4300	6503	7809995	SO:0001583	missense	8863	exon17			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2395G>A	1.37:g.7887408G>A	ENSP00000355031:p.Val799Ile		7809995	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	CCDS89.1	.	.	.	.	.	.	.	.	.	.	G	9.697	1.153322	0.21371	.	.	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	T;T	0.10382	2.88;2.88	4.03	-6.07	0.02158	.	2.975620	0.01188	N	0.007247	T	0.06234	0.0161	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.30511	0.07;0.186;0.282;0.07	B;B;B;B	0.19946	0.009;0.012;0.027;0.009	T	0.20940	-1.0260	10	0.32370	T	0.25	.	10.9929	0.47559	0.2522:0.1266:0.6212:0.0	.	799;807;807;799	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	I	807;799;10	ENSP00000366755:V807I;ENSP00000355031:V799I	ENSP00000355031:V799I	V	+	1	0	PER3	7809995	0.000000	0.05858	0.000000	0.03702	0.243000	0.25628	-1.834000	0.01693	-1.223000	0.02584	-0.367000	0.07326	GTC		0.697	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
WDR78	79819	broad.mit.edu	37	1	67337149	67337149	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:67337149C>T	ENST00000371026.3	-	6	899	c.844G>A	c.(844-846)Ggc>Agc	p.G282S	WDR78_ENST00000431318.1_Missense_Mutation_p.G28S|WDR78_ENST00000371023.3_Missense_Mutation_p.G282S|WDR78_ENST00000371022.3_Missense_Mutation_p.G282S	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	282					hematopoietic progenitor cell differentiation (GO:0002244)			p.G282S(1)		NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						AGGTCATTGCCTAATCTGTTT	0.313																																					p.G282S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G844A	1						.						159.0	158.0	158.0					1																	67337149		2202	4297	6499	67109737	SO:0001583	missense	79819	exon6			BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.844G>A	1.37:g.67337149C>T	ENSP00000360065:p.Gly282Ser		67109737	NM_207014	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	ENST00000371026.3	37	CCDS635.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.37|15.37	2.813785|2.813785	0.50527|0.50527	.|.	.|.	ENSG00000152763|ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352;ENST00000371023;ENST00000371022|ENST00000469450	T;T;T;T;T|.	0.73575|.	0.24;-0.76;-0.39;1.97;0.72|.	5.86|5.86	3.96|3.96	0.45880|0.45880	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68485|0.68485	0.3006|0.3006	M|M	0.80422|0.80422	2.495|2.495	0.52501|0.52501	D|D	0.999952|0.999952	D;D;D;D|.	0.89917|.	0.999;1.0;0.989;0.989|.	D;D;P;P|.	0.97110|.	0.982;1.0;0.904;0.904|.	T|T	0.71623|0.71623	-0.4537|-0.4537	10|5	0.87932|.	D|.	0|.	-18.7818|-18.7818	15.6236|15.6236	0.76829|0.76829	0.0:0.7389:0.2611:0.0|0.0:0.7389:0.2611:0.0	.|.	28;282;282;282|.	Q5VTH9-3;Q5TAD8;A0AVI9;Q5VTH9|.	.;.;.;WDR78_HUMAN|.	S|K	282;28;48;282;282|15	ENSP00000360065:G282S;ENSP00000393182:G28S;ENSP00000433682:G48S;ENSP00000360062:G282S;ENSP00000360061:G282S|.	ENSP00000360061:G282S|.	G|R	-|-	1|2	0|0	WDR78|WDR78	67109737|67109737	1.000000|1.000000	0.71417|0.71417	0.916000|0.916000	0.36221|0.36221	0.007000|0.007000	0.05969|0.05969	5.986000|5.986000	0.70563|0.70563	0.791000|0.791000	0.33826|0.33826	-0.181000|-0.181000	0.13052|0.13052	GGC|AGG		0.313	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025404.1	NM_024763	
OR2G6	391211	broad.mit.edu	37	1	248685344	248685344	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr1:248685344A>G	ENST00000343414.4	+	1	429	c.397A>G	c.(397-399)Ata>Gta	p.I133V		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	133						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I133V(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACTGCGCTACATAGCCATTAT	0.587																																					p.I133V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A397G	1						.						66.0	55.0	59.0					1																	248685344		2203	4300	6503	246751967	SO:0001583	missense	391211	exon1				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.397A>G	1.37:g.248685344A>G	ENSP00000341291:p.Ile133Val		246751967	NM_001013355	B2RP33	Missense_Mutation	SNP	ENST00000343414.4	37	CCDS31119.1	.	.	.	.	.	.	.	.	.	.	N	0.688	-0.795535	0.02862	.	.	ENSG00000188558	ENST00000343414	T	0.07800	3.16	3.46	-2.17	0.07059	GPCR, rhodopsin-like superfamily (1);	0.930757	0.08804	U	0.891280	T	0.02193	0.0068	N	0.01277	-0.915	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42916	-0.9423	10	0.41790	T	0.15	.	0.444	0.00490	0.2358:0.1595:0.2928:0.3119	.	133	Q5TZ20	OR2G6_HUMAN	V	133	ENSP00000341291:I133V	ENSP00000341291:I133V	I	+	1	0	OR2G6	246751967	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-3.565000	0.00429	0.001000	0.14605	0.329000	0.21502	ATA		0.587	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842	
TM9SF4	9777	broad.mit.edu	37	20	30738628	30738628	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr20:30738628C>T	ENST00000398022.2	+	12	1430	c.1195C>T	c.(1195-1197)Cgt>Tgt	p.R399C	TM9SF4_ENST00000217315.5_Missense_Mutation_p.R382C	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	399						integral component of membrane (GO:0016021)		p.R382C(1)		central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TTCTGCTGGCCGTCTGTACCG	0.557																																					p.R399C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1195T	20						.						120.0	109.0	113.0					20																	30738628		2203	4300	6503	30202289	SO:0001583	missense	9777	exon12			BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.1195C>T	20.37:g.30738628C>T	ENSP00000381104:p.Arg399Cys		30202289	NM_014742	B0QYT7|Q9NUA3	Missense_Mutation	SNP	ENST00000398022.2	37	CCDS13196.2	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753709	0.69648	.	.	ENSG00000101337	ENST00000398022;ENST00000217315	T;T	0.50277	0.75;0.75	5.38	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.77322	0.4113	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84843	0.0809	10	0.87932	D	0	-6.2559	14.5058	0.67752	0.0:0.9291:0.0:0.0709	.	306;399	B4DH88;Q92544	.;TM9S4_HUMAN	C	399;382	ENSP00000381104:R399C;ENSP00000217315:R382C	ENSP00000217315:R382C	R	+	1	0	TM9SF4	30202289	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	3.369000	0.52365	1.415000	0.47037	0.655000	0.94253	CGT		0.557	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323568.1	NM_014742	
ASXL1	171023	broad.mit.edu	37	20	31023408	31023408	+	Nonsense_Mutation	SNP	C	C	T	rs397515401		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr20:31023408C>T	ENST00000375687.4	+	13	3317	c.2893C>T	c.(2893-2895)Cga>Tga	p.R965*	ASXL1_ENST00000306058.5_Nonsense_Mutation_p.R960*	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	965					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R965*(3)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						TGTGCCATCTCGAGGAGGCAG	0.527			"""F, N, Mis"""		"""MDS, CMML"""																																p.R965X			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	.	3	Substitution - Nonsense(3)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)	c.C2893T	20						.						75.0	62.0	66.0					20																	31023408		2203	4300	6503	30487069	SO:0001587	stop_gained	171023	exon12			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.2893C>T	20.37:g.31023408C>T	ENSP00000364839:p.Arg965*		30487069	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Nonsense_Mutation	SNP	ENST00000375687.4	37	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	C	39	7.813591	0.98504	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	.	.	.	4.32	2.25	0.28309	.	2.773430	0.00875	N	0.002066	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	12.9472	10.3788	0.44099	0.3558:0.6442:0.0:0.0	.	.	.	.	X	965;965;965;886;960	.	ENSP00000305119:R960X	R	+	1	2	ASXL1	30487069	0.000000	0.05858	0.001000	0.08648	0.036000	0.12997	0.007000	0.13174	0.502000	0.28037	-0.516000	0.04426	CGA		0.527	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
CTNNBL1	56259	broad.mit.edu	37	20	36361306	36361306	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr20:36361306G>A	ENST00000361383.6	+	2	173	c.56G>A	c.(55-57)cGg>cAg	p.R19Q	CTNNBL1_ENST00000405275.2_5'UTR	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	19					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)	p.R19Q(1)		autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				AAACGTCCCCGGGATGATGAA	0.502																																					p.R19Q	Ovarian(184;582 2038 3273 4106 42608)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G56A	20						.						69.0	66.0	67.0					20																	36361306		2203	4300	6503	35794720	SO:0001583	missense	56259	exon2			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.56G>A	20.37:g.36361306G>A	ENSP00000355050:p.Arg19Gln		35794720	NM_030877	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Missense_Mutation	SNP	ENST00000361383.6	37	CCDS13298.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946201	0.92593	.	.	ENSG00000132792	ENST00000361383	T	0.44083	0.93	5.04	5.04	0.67666	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.47284	0.1437	M	0.63843	1.955	0.80722	D	1	D	0.63046	0.992	P	0.46389	0.515	T	0.41680	-0.9495	10	0.28530	T	0.3	-17.3586	17.5428	0.87853	0.0:0.0:1.0:0.0	.	19	Q8WYA6	CTBL1_HUMAN	Q	19	ENSP00000355050:R19Q	ENSP00000355050:R19Q	R	+	2	0	CTNNBL1	35794720	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.793000	0.85851	2.606000	0.88127	0.561000	0.74099	CGG		0.502	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079125.1	NM_030877	
TSHZ2	128553	broad.mit.edu	37	20	51870331	51870331	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr20:51870331G>A	ENST00000371497.5	+	2	1221	c.334G>A	c.(334-336)Gtc>Atc	p.V112I	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Missense_Mutation_p.V109I|TSHZ2_ENST00000329613.6_Missense_Mutation_p.V109I	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	112					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V112I(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			ACACACTCACGTCAGGCTTCC	0.537																																					p.V112I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G334A	20						.						83.0	71.0	75.0					20																	51870331		2203	4300	6503	51303738	SO:0001583	missense	128553	exon2			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.334G>A	20.37:g.51870331G>A	ENSP00000360552:p.Val112Ile		51303738	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	G	6.426	0.446745	0.12223	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.13778	2.56;2.57	5.7	3.73	0.42828	.	0.279169	0.41823	D	0.000820	T	0.08179	0.0204	N	0.08118	0	0.21105	N	0.999786	B	0.10296	0.003	B	0.01281	0.0	T	0.24404	-1.0161	10	0.27082	T	0.32	-13.0118	16.1615	0.81721	0.0:0.738:0.262:0.0	.	112	Q9NRE2	TSH2_HUMAN	I	112;109	ENSP00000360552:V112I;ENSP00000333114:V109I	ENSP00000333114:V109I	V	+	1	0	TSHZ2	51303738	0.119000	0.22226	0.632000	0.29296	0.005000	0.04900	0.735000	0.26115	0.725000	0.32318	-0.178000	0.13098	GTC		0.537	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
KRTAP27-1	643812	broad.mit.edu	37	21	31709640	31709640	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr21:31709640C>A	ENST00000382835.2	-	1	372	c.347G>T	c.(346-348)tGc>tTc	p.C116F		NM_001077711.1	NP_001071179.1	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	116						intermediate filament (GO:0005882)		p.C116F(1)		endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(1)	18						TTCTGATTGGCAAGGCTGAGA	0.507																																					p.C116F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G347T	21						.						122.0	125.0	124.0					21																	31709640		2203	4300	6503	30631511	SO:0001583	missense	643812	exon1			AB096937	CCDS33532.1	21q22.11	2007-11-23			ENSG00000206107	ENSG00000206107		"""Keratin associated proteins"""	33864	protein-coding gene	gene with protein product							Standard	NM_001077711		Approved		uc002ynx.1	Q3LI81	OTTHUMG00000059577	ENST00000382835.2:c.347G>T	21.37:g.31709640C>A	ENSP00000372286:p.Cys116Phe		30631511	NM_001077711		Missense_Mutation	SNP	ENST00000382835.2	37	CCDS33532.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.367191	0.41902	.	.	ENSG00000206107	ENST00000382835	T	0.06687	3.27	4.44	2.59	0.31030	.	0.802775	0.11266	N	0.582001	T	0.20170	0.0485	M	0.81497	2.545	0.09310	N	0.999999	P	0.51351	0.944	P	0.54664	0.758	T	0.08493	-1.0719	10	0.39692	T	0.17	-4.3206	6.035	0.19702	0.0:0.7054:0.192:0.1025	.	116	Q3LI81	KR271_HUMAN	F	116	ENSP00000372286:C116F	ENSP00000372286:C116F	C	-	2	0	KRTAP27-1	30631511	0.009000	0.17119	0.104000	0.21259	0.146000	0.21551	-0.017000	0.12590	0.787000	0.33731	-0.229000	0.12294	TGC		0.507	KRTAP27-1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132470.3	NM_001077711	
RIMBP3C	150221	broad.mit.edu	37	22	21900499	21900500	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr22:21900499_21900500insC	ENST00000433039.1	-	1	5250_5251	c.4766_4767insG	c.(4765-4767)ggcfs	p.G1589fs	SCARNA18_ENST00000516796.1_RNA|SCARNA17_ENST00000516334.1_RNA|RN7SKP221_ENST00000410420.1_RNA|RIMBP3C_ENST00000331505.5_Frame_Shift_Ins_p.G1495fs	NM_001128633.1	NP_001122105.1	A6NJZ7	RIM3C_HUMAN	RIMS binding protein 3C	1589	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.							p.Q1590fs*22(1)		large_intestine(1)	1						CCTTCCCCTGGCCCCCCATTTG	0.584																																					p.G1589fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.4767_4768insG	22						.																																			20230500	SO:0001589	frameshift_variant	150221	exon1				CCDS46669.1	22q11.21	2008-10-21			ENSG00000183246	ENSG00000183246			33892	protein-coding gene	gene with protein product		612701				17855024	Standard	NM_001128633		Approved		uc002zuq.4	A6NJZ7	OTTHUMG00000150825	ENST00000433039.1:c.4767dupG	22.37:g.21900505_21900505dupC	ENSP00000390630:p.Gly1589fs		20230499	NM_001128633		Frame_Shift_Ins	INS	ENST00000433039.1	37	CCDS46669.1																																																																																				0.584	RIMBP3C-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		XM_036942	
RANBP2	5903	broad.mit.edu	37	2	109368070	109368070	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr2:109368070C>A	ENST00000283195.6	+	11	1668	c.1542C>A	c.(1540-1542)tgC>tgA	p.C514*		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	514					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.C514*(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AGCCGTTATGCCTGCCCCTTC	0.398																																					p.C514X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1542A	2						.						27.0	33.0	31.0					2																	109368070		1110	2193	3303	108734502	SO:0001587	stop_gained	5903	exon11			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.1542C>A	2.37:g.109368070C>A	ENSP00000283195:p.Cys514*		108734502	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Nonsense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952361	0.92660	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	.	.	.	5.25	1.32	0.21799	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	-9.1061	8.9949	0.36045	0.0:0.6176:0.0:0.3824	.	.	.	.	X	514	.	ENSP00000283195:C514X	C	+	3	2	RANBP2	108734502	0.944000	0.32072	0.951000	0.38953	0.185000	0.23345	0.056000	0.14256	0.286000	0.22352	0.650000	0.86243	TGC		0.398	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
CCDC74A	90557	broad.mit.edu	37	2	132288267	132288267	+	Silent	SNP	G	G	A	rs146155112		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr2:132288267G>A	ENST00000295171.6	+	3	549	c.411G>A	c.(409-411)gaG>gaA	p.E137E	CCDC74A_ENST00000467992.2_Silent_p.E239E|CCDC74A_ENST00000409856.3_Intron	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	137								p.E137E(1)		endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						GGCTGAAGGAGGGCTCCTCAC	0.662													g|||	1	0.000199681	0.0	0.0	5008	,	,		20824	0.0		0.001	False		,,,				2504	0.0				p.E137E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G411A	2						.	G		0,4402		0,0,2201	57.0	58.0	58.0		411	-1.5	0.0	2	dbSNP_134	58	3,8593		0,3,4295	no	coding-synonymous	CCDC74A	NM_138770.1		0,3,6496	AA,AG,GG		0.0349,0.0,0.0231		137/379	132288267	3,12995	2201	4298	6499	132004737	SO:0001819	synonymous_variant	90557	exon3				CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.411G>A	2.37:g.132288267G>A			132004737	NM_138770	Q6P4I5	Silent	SNP	ENST00000295171.6	37	CCDS2167.1																																																																																				0.662	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254570.2	NM_138770	
OSBPL6	114880	broad.mit.edu	37	2	179247784	179247784	+	Missense_Mutation	SNP	G	G	A	rs377158599		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr2:179247784G>A	ENST00000190611.4	+	17	2031	c.1655G>A	c.(1654-1656)cGa>cAa	p.R552Q	OSBPL6_ENST00000409045.3_Missense_Mutation_p.R521Q|OSBPL6_ENST00000409631.1_Missense_Mutation_p.R516Q|OSBPL6_ENST00000359685.3_Missense_Mutation_p.R516Q|OSBPL6_ENST00000315022.2_Missense_Mutation_p.R556Q|OSBPL6_ENST00000392505.2_Missense_Mutation_p.R577Q	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	552					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.R552Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			GGGGCCTTCCGAAATGGGCGT	0.473																																					p.R552Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1655A	2						.	G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	72.0	72.0	72.0		1730,1562,1547,1655,1667	6.0	1.0	2		72	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	OSBPL6	NM_001201480.1,NM_001201481.1,NM_001201482.1,NM_032523.3,NM_145739.2	43,43,43,43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	577/960,521/904,516/899,552/935,556/939	179247784	1,13005	2203	4300	6503	178956030	SO:0001583	missense	114880	exon17			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.1655G>A	2.37:g.179247784G>A	ENSP00000190611:p.Arg552Gln		178956030	NM_032523	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525906	0.85600	0.0	1.16E-4	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T	0.11604	2.76;2.78;2.77;2.76;2.78;2.76	6.04	6.04	0.98038	.	0.059731	0.64402	D	0.000009	T	0.24736	0.0600	L	0.34521	1.04	0.58432	D	0.999999	B;D;D;D;P	0.89917	0.275;0.96;0.996;1.0;0.703	B;B;P;D;B	0.83275	0.074;0.44;0.859;0.996;0.103	T	0.01162	-1.1432	10	0.21014	T	0.42	-10.3311	20.5948	0.99439	0.0:0.0:1.0:0.0	.	521;556;516;577;552	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3	.;.;.;.;OSBL6_HUMAN	Q	577;516;521;552;516;556	ENSP00000376293:R577Q;ENSP00000352713:R516Q;ENSP00000387248:R521Q;ENSP00000190611:R552Q;ENSP00000386885:R516Q;ENSP00000318723:R556Q	ENSP00000190611:R552Q	R	+	2	0	OSBPL6	178956030	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	7.559000	0.82265	2.873000	0.98535	0.563000	0.77884	CGA		0.473	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
DNPEP	23549	broad.mit.edu	37	2	220250721	220250721	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr2:220250721C>T	ENST00000273075.4	-	6	779	c.559G>A	c.(559-561)Gag>Aag	p.E187K	DNPEP_ENST00000373972.1_Missense_Mutation_p.E112K|DNPEP_ENST00000523282.1_Missense_Mutation_p.E195K|AC053503.4_ENST00000420563.1_RNA	NM_012100.2	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	177					peptide metabolic process (GO:0006518)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E187K(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCAAAGTTCTCGTTGATATTT	0.577																																					p.E187K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G559A	2						.						82.0	92.0	89.0					2																	220250721		2067	4217	6284	219958965	SO:0001583	missense	23549	exon6				CCDS42823.1	2q36.1	2008-05-22			ENSG00000123992	ENSG00000123992			2981	protein-coding gene	gene with protein product		611367				9632644	Standard	NM_012100		Approved	DAP, ASPEP	uc002vle.2	Q9ULA0	OTTHUMG00000058919	ENST00000273075.4:c.559G>A	2.37:g.220250721C>T	ENSP00000273075:p.Glu187Lys		219958965	NM_012100	Q9BW44|Q9NUV5	Missense_Mutation	SNP	ENST00000273075.4	37	CCDS42823.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415651	0.83449	.	.	ENSG00000123992	ENST00000273075;ENST00000337010;ENST00000373972;ENST00000523282;ENST00000535056;ENST00000457935;ENST00000429013;ENST00000521459;ENST00000322176;ENST00000434339;ENST00000430206	.	.	.	4.87	4.87	0.63330	Peptidase M18, domain 2 (1);	0.105245	0.64402	D	0.000005	T	0.57607	0.2065	L	0.45352	1.415	0.80722	D	1	P;P;P;P;P	0.48350	0.679;0.858;0.858;0.909;0.679	B;B;B;P;B	0.45753	0.144;0.432;0.204;0.492;0.144	T	0.63976	-0.6515	9	0.66056	D	0.02	-4.3798	18.0171	0.89245	0.0:1.0:0.0:0.0	.	195;187;195;177;187	E7ETB3;B7Z822;B7Z7F0;Q9ULA0;Q53SB6	.;.;.;DNPEP_HUMAN;.	K	187;187;112;195;80;195;173;187;187;112;112	.	ENSP00000273075:E187K	E	-	1	0	DNPEP	219958965	1.000000	0.71417	0.997000	0.53966	0.916000	0.54674	7.221000	0.78016	2.242000	0.73789	0.561000	0.74099	GAG		0.577	DNPEP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000130212.1	NM_012100	
DNAJC27	51277	broad.mit.edu	37	2	25174378	25174378	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr2:25174378G>A	ENST00000264711.2	-	6	763	c.574C>T	c.(574-576)Cgc>Tgc	p.R192C	DNAJC27_ENST00000534855.1_Missense_Mutation_p.R121C	NM_001198559.1|NM_016544.2	NP_001185488.1|NP_057628.1	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	192					small GTPase mediated signal transduction (GO:0007264)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)	p.R192C(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						GTGGTAGGGCGTTTCCCGCCA	0.393																																					p.R192C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C574T	2						.						90.0	89.0	89.0					2																	25174378		2203	4300	6503	25027882	SO:0001583	missense	51277	exon6				CCDS1716.1, CCDS74493.1	2p23.3	2011-09-02	2008-08-20	2008-08-20	ENSG00000115137	ENSG00000115137		"""Heat shock proteins / DNAJ (HSP40)"""	30290	protein-coding gene	gene with protein product		613527	"""rab and DnaJ domain containing"""	RBJ		14980719	Standard	NM_016544		Approved	RabJS	uc002rft.2	Q9NZQ0	OTTHUMG00000125524	ENST00000264711.2:c.574C>T	2.37:g.25174378G>A	ENSP00000264711:p.Arg192Cys		25027882	NM_016544	Q5JV88|Q86Y24	Missense_Mutation	SNP	ENST00000264711.2	37	CCDS1716.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.413413	0.83449	.	.	ENSG00000115137	ENST00000264711;ENST00000534855	T;T	0.23147	1.92;1.92	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.30792	0.0776	L	0.50333	1.59	0.80722	D	1	D	0.69078	0.997	P	0.47299	0.543	T	0.02691	-1.1123	10	0.62326	D	0.03	-16.601	13.392	0.60829	0.0:0.0:0.8427:0.1573	.	192	Q9NZQ0	DJC27_HUMAN	C	192;121	ENSP00000264711:R192C;ENSP00000440086:R121C	ENSP00000264711:R192C	R	-	1	0	DNAJC27	25027882	1.000000	0.71417	0.994000	0.49952	0.963000	0.63663	6.107000	0.71517	2.688000	0.91661	0.655000	0.94253	CGC		0.393	DNAJC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246855.3	NM_016544	
NRBP1	29959	broad.mit.edu	37	2	27656229	27656229	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr2:27656229T>C	ENST00000233557.3	+	3	921	c.89T>C	c.(88-90)gTg>gCg	p.V30A	NRBP1_ENST00000379852.3_Missense_Mutation_p.V30A|NRBP1_ENST00000379863.3_Missense_Mutation_p.V30A			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	30					ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)	p.V30A(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					CTGACATCAGTGTCACCTCCT	0.542																																					p.V30A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T89C	2						.						117.0	95.0	102.0					2																	27656229		2203	4300	6503	27509733	SO:0001583	missense	29959	exon2			AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.89T>C	2.37:g.27656229T>C	ENSP00000233557:p.Val30Ala		27509733	NM_013392	B3KV40|D6W558|Q53FZ5|Q96SU3	Missense_Mutation	SNP	ENST00000233557.3	37	CCDS1753.1	.	.	.	.	.	.	.	.	.	.	T	13.77	2.336788	0.41398	.	.	ENSG00000115216	ENST00000233557;ENST00000421823;ENST00000379852;ENST00000379863;ENST00000419281;ENST00000356442	T;T;T	0.13901	2.85;2.85;2.55	5.27	5.27	0.74061	.	0.066188	0.64402	D	0.000012	T	0.11281	0.0275	L	0.43152	1.355	0.46874	D	0.999233	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.06162	-1.0842	10	0.06891	T	0.86	-5.2013	12.5439	0.56188	0.0:0.0:0.0:1.0	.	30;30	F8W6G1;Q9UHY1	.;NRBP_HUMAN	A	30;10;30;30;30;30	ENSP00000233557:V30A;ENSP00000369181:V30A;ENSP00000369192:V30A	ENSP00000233557:V30A	V	+	2	0	NRBP1	27509733	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.358000	0.44134	1.997000	0.58415	0.460000	0.39030	GTG		0.542	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215033.1	NM_013392	
DYSF	8291	broad.mit.edu	37	2	71780216	71780216	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr2:71780216G>A	ENST00000258104.3	+	20	2105	c.1828G>A	c.(1828-1830)Gcc>Acc	p.A610T	DYSF_ENST00000413539.2_Missense_Mutation_p.A641T|DYSF_ENST00000409744.1_Missense_Mutation_p.A597T|DYSF_ENST00000409582.3_Missense_Mutation_p.A627T|DYSF_ENST00000409366.1_Missense_Mutation_p.A611T|DYSF_ENST00000409762.1_Missense_Mutation_p.A627T|DYSF_ENST00000410020.3_Missense_Mutation_p.A628T|DYSF_ENST00000394120.2_Missense_Mutation_p.A611T|DYSF_ENST00000429174.2_Missense_Mutation_p.A610T|DYSF_ENST00000409651.1_Missense_Mutation_p.A642T|DYSF_ENST00000410041.1_Missense_Mutation_p.A628T	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	610					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.A610T(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						TGTGGATGATGCCATCCAGTT	0.557																																					p.A642T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1924A	2						.						122.0	97.0	106.0					2																	71780216		2203	4300	6503	71633724	SO:0001583	missense	8291	exon21			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.1828G>A	2.37:g.71780216G>A	ENSP00000258104:p.Ala610Thr		71633724	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698427	0.88830	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.68;-1.68;-1.68;-1.68;-1.69;-1.68;-1.69;-1.69	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.89663	0.6780	L	0.61218	1.895	0.52099	D	0.999944	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.76494	0.997;0.997;0.997;0.997;0.998;0.999;0.998;0.995;0.997;0.992;0.999;0.998;0.997;0.995	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.76071	0.971;0.971;0.98;0.971;0.982;0.979;0.982;0.962;0.971;0.939;0.977;0.987;0.971;0.936	D	0.90235	0.4282	10	0.62326	D	0.03	-26.9479	16.4751	0.84130	0.0:0.0:1.0:0.0	.	642;628;611;597;628;597;627;596;641;627;610;596;611;610	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	T	641;627;627;610;610;642;611;597;611;628;628	ENSP00000407046:A641T;ENSP00000387137:A627T;ENSP00000386547:A627T;ENSP00000398305:A610T;ENSP00000258104:A610T;ENSP00000386683:A642T;ENSP00000377678:A611T;ENSP00000386285:A597T;ENSP00000386512:A611T;ENSP00000386881:A628T;ENSP00000386617:A628T	ENSP00000258104:A610T	A	+	1	0	DYSF	71633724	1.000000	0.71417	0.955000	0.39395	0.926000	0.56050	3.294000	0.51787	2.488000	0.83962	0.655000	0.94253	GCC		0.557	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
KANSL3	55683	broad.mit.edu	37	2	97276568	97276568	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr2:97276568C>A	ENST00000431828.1	-	11	1290	c.1214G>T	c.(1213-1215)gGt>gTt	p.G405V	KANSL3_ENST00000441706.2_Missense_Mutation_p.G318V|KANSL3_ENST00000599854.1_Missense_Mutation_p.G318V|KANSL3_ENST00000440133.1_Missense_Mutation_p.G199V|KANSL3_ENST00000487070.1_5'UTR			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	405					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G405V(1)									GGAATTCTGACCAATGACAAA	0.463																																					p.G405V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1214T	2						.						158.0	151.0	153.0					2																	97276568		1897	4123	6020	96640295	SO:0001583	missense	55683	exon11			BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.1214G>T	2.37:g.97276568C>A	ENSP00000396749:p.Gly405Val		96640295	NM_001115016	A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Missense_Mutation	SNP	ENST00000431828.1	37	CCDS46361.1	.	.	.	.	.	.	.	.	.	.	C	32	5.143416	0.94560	.	.	ENSG00000114982	ENST00000354204;ENST00000447759;ENST00000431828;ENST00000441706;ENST00000440133;ENST00000444759;ENST00000452268	T;T;T	0.65549	-0.16;-0.16;-0.16	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.77384	0.4122	L	0.58510	1.815	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.77940	-0.2399	10	0.87932	D	0	.	17.8531	0.88754	0.0:1.0:0.0:0.0	.	199;405;318;293	B4E1W4;Q9P2N6-3;Q9P2N6-5;Q9P2N6-6	.;.;.;.	V	318;293;405;318;199;199;318	ENSP00000396749:G405V;ENSP00000400678:G318V;ENSP00000406207:G199V	ENSP00000346144:G318V	G	-	2	0	KIAA1310	96640295	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.652000	0.83633	2.822000	0.97130	0.557000	0.71058	GGT		0.463	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339040.2	NM_017991	
RTP5	285093	broad.mit.edu	37	2	242814286	242814286	+	Silent	SNP	C	C	T	rs368462668		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr2:242814286C>T	ENST00000343216.3	+	2	607	c.579C>T	c.(577-579)gaC>gaT	p.D193D		NM_173821.2	NP_776182.2												p.D193D(1)									CCCCTGGCGACGACCTTGGCA	0.682																																					p.D193D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C579T	2						.			0,4100		0,0,2050	21.0	24.0	23.0		579	-4.5	0.0	2		23	1,8371		0,1,4185	no	coding-synonymous	C2orf85	NM_173821.2		0,1,6235	TT,TC,CC		0.0119,0.0,0.0080		193/573	242814286	1,12471	2050	4186	6236	242462959	SO:0001819	synonymous_variant	285093	exon2																														ENST00000343216.3:c.579C>T	2.37:g.242814286C>T			242462959	NM_173821		Silent	SNP	ENST00000343216.3	37	CCDS42843.1																																																																																				0.682	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322310.1		
EPHB1	2047	broad.mit.edu	37	3	134968204	134968204	+	Missense_Mutation	SNP	C	C	G	rs549592723		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr3:134968204C>G	ENST00000398015.3	+	15	3087	c.2717C>G	c.(2716-2718)tCc>tGc	p.S906C	EPHB1_ENST00000493838.1_Missense_Mutation_p.S467C	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	906					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.S906C(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CTCGACCGCTCCATCCCAGAC	0.597																																					p.S906C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2717G	3						.						74.0	78.0	76.0					3																	134968204		2113	4233	6346	136450894	SO:0001583	missense	2047	exon15			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.2717C>G	3.37:g.134968204C>G	ENSP00000381097:p.Ser906Cys		136450894	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.260601	0.80246	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.63417	-0.04;-0.04	5.43	5.43	0.79202	Sterile alpha motif/pointed domain (1);	0.115804	0.64402	D	0.000015	T	0.58836	0.2150	L	0.40543	1.245	0.80722	D	1	D	0.60575	0.988	B	0.43274	0.414	T	0.64618	-0.6365	10	0.66056	D	0.02	.	19.4372	0.94801	0.0:1.0:0.0:0.0	.	906	P54762	EPHB1_HUMAN	C	906;467	ENSP00000381097:S906C;ENSP00000419574:S467C	ENSP00000381097:S906C	S	+	2	0	EPHB1	136450894	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.647000	0.61418	2.827000	0.97445	0.650000	0.86243	TCC		0.597	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
GRM7	2917	broad.mit.edu	37	3	7620139	7620139	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr3:7620139C>T	ENST00000357716.4	+	8	1820	c.1546C>T	c.(1546-1548)Cga>Tga	p.R516*	GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000389336.4_Nonsense_Mutation_p.R516*|GRM7_ENST00000403881.1_Nonsense_Mutation_p.R516*|GRM7_ENST00000486284.1_Nonsense_Mutation_p.R516*|GRM7_ENST00000402647.2_Nonsense_Mutation_p.R516*	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	516					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.R516*(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						TAAAGGAGTCCGAGAGATACC	0.463																																					p.R516X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1546T	3						.						69.0	69.0	69.0					3																	7620139		2203	4300	6503	7595139	SO:0001587	stop_gained	2917	exon8			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1546C>T	3.37:g.7620139C>T	ENSP00000350348:p.Arg516*		7595139	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Nonsense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025083	0.35701	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492;ENST00000445087	.	.	.	5.71	4.83	0.62350	.	0.133103	0.51477	D	0.000089	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	12.6567	0.56791	0.3004:0.6996:0.0:0.0	.	.	.	.	X	516;516;516;516;516;516;516;173	.	ENSP00000350348:R516X	R	+	1	2	GRM7	7595139	0.988000	0.35896	0.964000	0.40570	0.006000	0.05464	2.568000	0.45965	1.408000	0.46895	-0.182000	0.12963	CGA		0.463	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
DCLK3	85443	broad.mit.edu	37	3	36759634	36759634	+	Silent	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr3:36759634G>A	ENST00000416516.2	-	4	2110	c.1620C>T	c.(1618-1620)ggC>ggT	p.G540G	DCLK3_ENST00000498047.1_5'UTR	NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	540	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G540G(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						AGAGGATCACGCCAGCAGCCC	0.547																																					p.G540G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1620T	3						.						143.0	157.0	152.0					3																	36759634		2141	4281	6422	36734638	SO:0001819	synonymous_variant	85443	exon4			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1620C>T	3.37:g.36759634G>A			36734638	NM_033403		Silent	SNP	ENST00000416516.2	37	CCDS43064.1																																																																																				0.547	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355	
SLC6A20	54716	broad.mit.edu	37	3	45801400	45801400	+	Silent	SNP	G	G	A	rs143985135	byFrequency	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr3:45801400G>A	ENST00000358525.4	-	10	1693	c.1578C>T	c.(1576-1578)agC>agT	p.S526S	SLC6A20_ENST00000456124.2_Silent_p.S526S|SLC6A20_ENST00000353278.4_Silent_p.S489S|SLC6A20_ENST00000493980.1_5'Flank	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	526					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)	p.S526S(1)|p.S489S(1)		breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		GGATGTAGTCGCTCAGGTAGA	0.592													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17976	0.0		0.0	False		,,,				2504	0.0				p.S489S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1467T	3						.	G	,	1,4405	2.1+/-5.4	0,1,2202	121.0	119.0	119.0		1578,1467	-12.0	0.7	3	dbSNP_134	119	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SLC6A20	NM_020208.3,NM_022405.3	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	526/593,489/556	45801400	2,13004	2203	4300	6503	45776404	SO:0001819	synonymous_variant	54716	exon9			AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.1578C>T	3.37:g.45801400G>A			45776404	NM_022405	A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Silent	SNP	ENST00000358525.4	37	CCDS43077.1																																																																																				0.592	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257318.3	NM_020208	
SETD2	29072	broad.mit.edu	37	3	47098411	47098411	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr3:47098411G>A	ENST00000409792.3	-	15	6905	c.6863C>T	c.(6862-6864)cCt>cTt	p.P2288L		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2288	Gln-rich.|Low charge region.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.P1785L(1)|p.P2288L(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AGACTGTGCAGGAGAGTACTG	0.483			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.P2288L			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C6863T	3						.						118.0	112.0	114.0					3																	47098411		2203	4300	6503	47073415	SO:0001583	missense	29072	exon15			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6863C>T	3.37:g.47098411G>A	ENSP00000386759:p.Pro2288Leu		47073415	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	25.0	4.595252	0.86953	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	T	0.45668	0.89	5.1	5.1	0.69264	.	0.000000	0.56097	D	0.000023	T	0.49338	0.1551	L	0.47716	1.5	0.80722	D	1	D;D	0.57257	0.979;0.979	P;P	0.50082	0.63;0.63	T	0.51849	-0.8653	10	0.72032	D	0.01	.	19.0757	0.93161	0.0:0.0:1.0:0.0	.	2288;2288	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	2288	ENSP00000386759:P2288L	ENSP00000386759:P2288L	P	-	2	0	SETD2	47073415	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.996000	0.70639	2.814000	0.96858	0.655000	0.94253	CCT		0.483	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SEMA3F	6405	broad.mit.edu	37	3	50225203	50225203	+	Silent	SNP	C	C	T	rs373344301		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr3:50225203C>T	ENST00000002829.3	+	19	2497	c.2013C>T	c.(2011-2013)agC>agT	p.S671S	SEMA3F_ENST00000413852.1_Silent_p.S572S|SEMA3F_ENST00000434342.1_Silent_p.S640S	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	671	Ig-like C2-type.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)	p.S671S(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		TGCAGCTCAGCGATCGTGGCC	0.612																																					p.S671S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2013T	3						.	C		0,4406		0,0,2203	63.0	50.0	54.0		2013	-10.8	0.0	3		54	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SEMA3F	NM_004186.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		671/786	50225203	1,13005	2203	4300	6503	50200207	SO:0001819	synonymous_variant	6405	exon19			U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.2013C>T	3.37:g.50225203C>T			50200207	NM_004186	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Silent	SNP	ENST00000002829.3	37	CCDS2811.1																																																																																				0.612	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
ATP13A4	84239	broad.mit.edu	37	3	193130136	193130136	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr3:193130136G>T	ENST00000342695.4	-	27	3361	c.3039C>A	c.(3037-3039)agC>agA	p.S1013R	ATP13A4_ENST00000482964.1_5'UTR|ATP13A4_ENST00000392443.3_Missense_Mutation_p.S994R|ATP13A4_ENST00000400270.2_Missense_Mutation_p.S29R	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	1013						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.S1013R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		ACTCTGAGATGCTTTCATTTT	0.393																																					p.S1013R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3039A	3						.						197.0	198.0	198.0					3																	193130136		2203	4300	6503	194612830	SO:0001583	missense	84239	exon27			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.3039C>A	3.37:g.193130136G>T	ENSP00000339182:p.Ser1013Arg		194612830	NM_032279	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	ENST00000342695.4	37	CCDS3304.2	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585600	0.28268	.	.	ENSG00000127249	ENST00000400270;ENST00000392443;ENST00000342695	T;D;D	0.88509	0.38;-2.39;-2.39	5.92	1.09	0.20402	.	0.691609	0.14482	N	0.316917	T	0.81819	0.4903	L	0.53249	1.67	0.09310	N	1	P	0.35383	0.498	B	0.26770	0.073	T	0.65911	-0.6053	10	0.26408	T	0.33	-4.3678	8.5753	0.33595	0.3831:0.0:0.6169:0.0	.	1013	Q4VNC1	AT134_HUMAN	R	29;994;1013	ENSP00000383129:S29R;ENSP00000376238:S994R;ENSP00000339182:S1013R	ENSP00000339182:S1013R	S	-	3	2	ATP13A4	194612830	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.279000	0.18771	-0.074000	0.12820	0.650000	0.86243	AGC		0.393	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279	
PALLD	23022	broad.mit.edu	37	4	169433109	169433109	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr4:169433109G>A	ENST00000505667.1	+	2	627	c.454G>A	c.(454-456)Gta>Ata	p.V152I	PALLD_ENST00000261509.6_Missense_Mutation_p.V152I|PALLD_ENST00000335742.7_5'UTR|PALLD_ENST00000333488.4_Missense_Mutation_p.V29I			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	152					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)	p.V152I(1)		breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CAGCACAAACGTAAAGCCCAA	0.512									Pancreatic Cancer, Familial Clustering of																												p.V152I	Esophageal Squamous(109;1482 1532 18347 40239 51172)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G454A	4						.						47.0	55.0	52.0					4																	169433109		2203	4300	6503	169669684	SO:0001583	missense	23022	exon2	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.454G>A	4.37:g.169433109G>A	ENSP00000425556:p.Val152Ile		169669684	NM_016081	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	37	CCDS54818.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.337709	0.24253	.	.	ENSG00000129116	ENST00000261509;ENST00000505667;ENST00000508898;ENST00000333488	T;T;T;T	0.64260	0.03;0.3;-0.09;0.05	5.22	3.48	0.39840	.	1.654590	0.04776	U	0.428821	T	0.47673	0.1458	L	0.29908	0.895	0.09310	N	0.999997	B;B	0.11235	0.004;0.004	B;B	0.06405	0.002;0.002	T	0.33343	-0.9872	10	0.36615	T	0.2	.	0.9865	0.01447	0.2154:0.1324:0.3796:0.2727	.	152;152	B7ZMM5;B2RTX2	.;.	I	152;152;131;29	ENSP00000261509:V152I;ENSP00000425556:V152I;ENSP00000423063:V131I;ENSP00000328945:V29I	ENSP00000261509:V152I	V	+	1	0	PALLD	169669684	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.022000	0.12480	0.578000	0.29487	0.585000	0.79938	GTA		0.512	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081	
WHSC1	7468	broad.mit.edu	37	4	1940243	1940243	+	Silent	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr4:1940243G>A	ENST00000382895.3	+	10	2171	c.1740G>A	c.(1738-1740)tcG>tcA	p.S580S	WHSC1_ENST00000514045.1_Silent_p.S580S|WHSC1_ENST00000382891.5_Silent_p.S580S|WHSC1_ENST00000503128.1_Silent_p.S580S|WHSC1_ENST00000398261.1_Silent_p.S580S|WHSC1_ENST00000508803.1_Silent_p.S580S|WHSC1_ENST00000382892.2_Silent_p.S580S|WHSC1_ENST00000420906.2_Silent_p.S580S	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	580					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.S580S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		CAGCCTCCTCGCTCAAGAGCC	0.488			T	IGH@	MM																																p.S580S			Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1740A	4						.						63.0	58.0	60.0					4																	1940243		2203	4300	6503	1910041	SO:0001819	synonymous_variant	7468	exon9			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.1740G>A	4.37:g.1940243G>A			1910041	NM_133331	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Silent	SNP	ENST00000382895.3	37	CCDS33940.1																																																																																				0.488	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
SMR3B	10879	broad.mit.edu	37	4	71255517	71255517	+	Silent	SNP	C	C	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr4:71255517C>A	ENST00000304915.3	+	3	341	c.192C>A	c.(190-192)ccC>ccA	p.P64P	SMR3B_ENST00000504825.1_Silent_p.P64P	NM_006685.3	NP_006676.1	P02814	SMR3B_HUMAN	submaxillary gland androgen regulated protein 3B	64	Poly-Pro.|Pro-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.P64P(1)		large_intestine(2)|lung(3)|skin(2)	7		all_hematologic(202;0.196)				CTCCTCCTCCCGCACCCTATG	0.602																																					p.P64P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C192A	4						.						118.0	110.0	112.0					4																	71255517		2203	4300	6503	71290106	SO:0001819	synonymous_variant	10879	exon3			D29833	CCDS3540.1	4q13.3	2008-02-27	2008-02-27	2005-02-07	ENSG00000171201	ENSG00000171201			17326	protein-coding gene	gene with protein product		611593	"""proline rich 3"", ""submaxillary gland androgen regulated protein 3 homolog B (mouse)"""	PROL3		7982889, 479131	Standard	NM_006685		Approved	P-B, PRL3		P02814	OTTHUMG00000129396	ENST00000304915.3:c.192C>A	4.37:g.71255517C>A			71290106	NM_006685	B7ZMG7|Q9UBN0|Q9UCT0	Silent	SNP	ENST00000304915.3	37	CCDS3540.1																																																																																				0.602	SMR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251552.2	NM_006685	
CCDC110	256309	broad.mit.edu	37	4	186379493	186379493	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr4:186379493C>T	ENST00000307588.3	-	6	2323	c.2248G>A	c.(2248-2250)Gta>Ata	p.V750I	CCDC110_ENST00000393540.3_Missense_Mutation_p.V713I|CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000510617.1_Missense_Mutation_p.V750I	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	750						nucleus (GO:0005634)		p.V750I(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		ATGCTTCTTACGTAATTTTCT	0.284																																					p.V750I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2248A	4						.						59.0	58.0	58.0					4																	186379493		2203	4297	6500	186616487	SO:0001583	missense	256309	exon6			AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.2248G>A	4.37:g.186379493C>T	ENSP00000306776:p.Val750Ile		186616487	NM_152775	Q86YI9|Q8N7W0	Missense_Mutation	SNP	ENST00000307588.3	37	CCDS3843.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.763163	0.31228	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.28895	1.59;1.59;1.59	5.54	3.55	0.40652	.	0.441395	0.19156	N	0.121335	T	0.30386	0.0763	M	0.63428	1.95	0.09310	N	1	D;D;D	0.60575	0.988;0.988;0.988	P;P;P	0.50934	0.654;0.654;0.654	T	0.18871	-1.0323	10	0.14252	T	0.57	-6.4794	1.659	0.02787	0.2086:0.4783:0.1387:0.1745	.	750;713;750	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	I	713;750;750	ENSP00000377172:V713I;ENSP00000306776:V750I;ENSP00000427246:V750I	ENSP00000306776:V750I	V	-	1	0	CCDC110	186616487	0.025000	0.19082	0.931000	0.37212	0.983000	0.72400	0.893000	0.28336	1.471000	0.48121	0.650000	0.86243	GTA		0.284	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360519.2	NM_152775	
CCDC69	26112	broad.mit.edu	37	5	150564302	150564303	+	Intron	INS	-	-	C			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr5:150564302_150564303insC	ENST00000355417.2	-	8	790				CCDC69_ENST00000521308.1_Intron	NM_015621.2	NP_056436.2	A6NI79	CCD69_HUMAN	coiled-coil domain containing 69											haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|stomach(1)	9		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			atatgatctatataaataaaat	0.317																																					.												.	.	0			.	5						.																																			150544496	SO:0001627	intron_variant	26112	.				CCDS4312.1	5q33.1	2008-02-05			ENSG00000198624	ENSG00000198624			24487	protein-coding gene	gene with protein product						12477932	Standard	NM_015621		Approved	FLJ13705, DKFZP434C171	uc011dcq.3	A6NI79	OTTHUMG00000130127	ENST00000355417.2:c.616-300->G	5.37:g.150564302_150564303insC			150544495	.	A8K9X6	De_novo_Start_InFrame	INS	ENST00000355417.2	37	CCDS4312.1																																																																																				0.317	CCDC69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252435.1	NM_015621	
DNAH5	1767	broad.mit.edu	37	5	13692194	13692194	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr5:13692194G>A	ENST00000265104.4	-	79	13878	c.13774C>T	c.(13774-13776)Cga>Tga	p.R4592*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4592					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R4592*(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AAGTCCGTTCGAACTGGCTTC	0.468									Kartagener syndrome																												p.R4592X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C13774T	5						.						108.0	99.0	102.0					5																	13692194		2203	4300	6503	13745194	SO:0001587	stop_gained	1767	exon79	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13774C>T	5.37:g.13692194G>A	ENSP00000265104:p.Arg4592*		13745194	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	55	23.841320	0.99957	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9617	0.97254	0.0:0.0:1.0:0.0	.	.	.	.	X	4592	.	ENSP00000265104:R4592X	R	-	1	2	DNAH5	13745194	0.948000	0.32251	0.997000	0.53966	0.683000	0.39861	1.417000	0.34770	2.722000	0.93159	0.650000	0.86243	CGA		0.468	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
CD14	929	broad.mit.edu	37	5	140011505	140011505	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr5:140011505G>A	ENST00000302014.6	-	2	1693	c.1064C>T	c.(1063-1065)tCg>tTg	p.S355L	CD14_ENST00000401743.2_Missense_Mutation_p.S355L	NM_000591.3	NP_000582.1	P08571	CD14_HUMAN	CD14 molecule	355					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|phagocytosis (GO:0006909)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endocytosis (GO:0045807)|positive regulation of tumor necrosis factor production (GO:0032760)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to magnesium ion (GO:0032026)|response to tumor necrosis factor (GO:0034612)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|opsonin receptor activity (GO:0001847)|peptidoglycan receptor activity (GO:0016019)	p.S355L(1)		endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGACAGGGTCGAACGTGCACA	0.607																																					p.S355L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1064T	5						.						50.0	54.0	52.0					5																	140011505		2203	4300	6503	139991689	SO:0001583	missense	929	exon3				CCDS4232.1	5q31.3	2012-09-20	2006-03-28		ENSG00000170458	ENSG00000170458		"""CD molecules"""	1628	protein-coding gene	gene with protein product		158120	"""CD14 antigen"""			2472171, 2462937	Standard	NM_000591		Approved		uc003lgi.2	P08571	OTTHUMG00000129507	ENST00000302014.6:c.1064C>T	5.37:g.140011505G>A	ENSP00000304236:p.Ser355Leu		139991689	NM_001040021	Q53XT5|Q96FR6|Q96L99|Q9UNS3	Missense_Mutation	SNP	ENST00000302014.6	37	CCDS4232.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953957	0.34471	.	.	ENSG00000170458	ENST00000302014;ENST00000401743	T;T	0.25912	1.77;1.77	5.35	2.59	0.31030	.	0.689818	0.12030	N	0.506077	T	0.23054	0.0557	L	0.58101	1.795	0.09310	N	1	B	0.25169	0.119	B	0.17979	0.02	T	0.26815	-1.0092	10	0.72032	D	0.01	-10.3882	5.0486	0.14496	0.1719:0.0:0.6619:0.1662	.	355	P08571	CD14_HUMAN	L	355	ENSP00000304236:S355L;ENSP00000385519:S355L	ENSP00000304236:S355L	S	-	2	0	CD14	139991689	0.004000	0.15560	0.004000	0.12327	0.016000	0.09150	0.119000	0.15626	0.480000	0.27534	0.655000	0.94253	TCG		0.607	CD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251681.2	NM_000591	
PCDHB6	56130	broad.mit.edu	37	5	140531249	140531249	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr5:140531249G>A	ENST00000231136.1	+	1	1411	c.1411G>A	c.(1411-1413)Gtc>Atc	p.V471I	PCDHB6_ENST00000543635.1_Missense_Mutation_p.V335I	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	471	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V471I(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CATCGGCAGCGTCAGCGCCAC	0.642																																					p.V471I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1411A	5						.						95.0	103.0	100.0					5																	140531249		2203	4300	6503	140511433	SO:0001583	missense	56130	exon1			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1411G>A	5.37:g.140531249G>A	ENSP00000231136:p.Val471Ile		140511433	NM_018939	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	G	8.705	0.910707	0.17833	.	.	ENSG00000113211	ENST00000543635;ENST00000231136;ENST00000542861	T;T	0.02787	4.16;4.16	4.18	1.86	0.25419	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.04634	0.0126	M	0.67700	2.07	0.09310	N	0.999998	B	0.19073	0.033	B	0.21917	0.037	T	0.32534	-0.9903	9	0.41790	T	0.15	.	7.8025	0.29183	0.4186:0.0:0.5814:0.0	.	471	Q9Y5E3	PCDB6_HUMAN	I	335;471;256	ENSP00000438466:V335I;ENSP00000231136:V471I	ENSP00000231136:V471I	V	+	1	0	PCDHB6	140511433	0.000000	0.05858	0.879000	0.34478	0.891000	0.51852	-0.360000	0.07622	0.142000	0.18901	-0.350000	0.07774	GTC		0.642	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
MROH2B	133558	broad.mit.edu	37	5	41065470	41065470	+	Silent	SNP	G	G	A	rs371986783		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr5:41065470G>A	ENST00000399564.4	-	4	774	c.324C>T	c.(322-324)ttC>ttT	p.F108F		NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	108								p.F108F(1)									CAAGCACAACGAATTCATCTG	0.418																																					p.F108F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C324T	5						.	G		1,3813		0,1,1906	73.0	68.0	70.0		324	-12.3	0.0	5		70	0,8252		0,0,4126	no	coding-synonymous	HEATR7B2	NM_173489.4		0,1,6032	AA,AG,GG		0.0,0.0262,0.0083		108/1586	41065470	1,12065	1907	4126	6033	41101227	SO:0001819	synonymous_variant	133558	exon4				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.324C>T	5.37:g.41065470G>A			41101227	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	ENST00000399564.4	37	CCDS47202.1																																																																																				0.418	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
MCTP1	79772	broad.mit.edu	37	5	94248559	94248559	+	Silent	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr5:94248559G>A	ENST00000515393.1	-	9	1472	c.1473C>T	c.(1471-1473)agC>agT	p.S491S	MCTP1_ENST00000505208.1_Silent_p.S270S|MCTP1_ENST00000312216.8_Silent_p.S270S|MCTP1_ENST00000429576.2_Silent_p.S224S|MCTP1_ENST00000505078.1_Silent_p.S7S	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	491	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.S491S(1)		breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		CGTAGGGATCGCTCAACCCGT	0.468																																					p.S270S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C810T	5						.						165.0	147.0	153.0					5																	94248559		2203	4300	6503	94274315	SO:0001819	synonymous_variant	79772	exon9				CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.1473C>T	5.37:g.94248559G>A			94274315	NM_001002796	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Silent	SNP	ENST00000515393.1	37	CCDS34203.1	.	.	.	.	.	.	.	.	.	.	G	9.378	1.072270	0.20147	.	.	ENSG00000175471	ENST00000503301	.	.	.	5.72	1.42	0.22433	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.9646	9.8923	0.41298	0.7288:0.0:0.2712:0.0	.	.	.	.	X	254	.	.	R	-	1	2	MCTP1	94274315	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	1.178000	0.31981	0.057000	0.16193	-0.808000	0.03180	CGA		0.468	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	NM_024717	
APC	324	broad.mit.edu	37	5	112174779	112174779	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr5:112174779delG	ENST00000457016.1	+	16	3868	c.3488delG	c.(3487-3489)agcfs	p.S1163fs	APC_ENST00000508376.2_Frame_Shift_Del_p.S1163fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.S1163fs			P25054	APC_HUMAN	adenomatous polyposis coli	1163	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1163fs*2(1)|p.S1163fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACAAATTATAGCATAAAATAT	0.333		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1145fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	3	Unknown(1)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	large_intestine(2)|skin(1)	c.3434delG	5						.						58.0	61.0	60.0					5																	112174779		2202	4299	6501	112202678	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3488delG	5.37:g.112174779delG	ENSP00000413133:p.Ser1163fs		112202678	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.333	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112176009	112176009	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr5:112176009delA	ENST00000457016.1	+	16	5098	c.4718delA	c.(4717-4719)gaafs	p.E1573fs	APC_ENST00000508376.2_Frame_Shift_Del_p.E1573fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.E1573fs			P25054	APC_HUMAN	adenomatous polyposis coli	1573	Asp/Glu-rich (acidic).|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.I1574fs*2(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GATGATATTGAAATACTAGAA	0.373		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1555fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	3	Deletion - Frameshift(2)|Unknown(1)	large_intestine(1)|soft_tissue(1)|skin(1)	c.4664delA	5						.						94.0	101.0	98.0					5																	112176009		2201	4300	6501	112203908	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4718delA	5.37:g.112176009delA	ENSP00000413133:p.Glu1573fs		112203908	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.373	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHB14	56122	broad.mit.edu	37	5	140604977	140604977	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr5:140604977G>A	ENST00000239449.4	+	1	1900	c.1900G>A	c.(1900-1902)Gac>Aac	p.D634N	PCDHB14_ENST00000515856.2_Missense_Mutation_p.D481N	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	634	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D634N(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGCGAGCGCGACGCGGCCAA	0.697																																					p.D634N	Ovarian(141;50 1831 27899 33809 37648)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1900A	5						.						9.0	11.0	10.0					5																	140604977		1635	3441	5076	140585161	SO:0001583	missense	56122	exon1			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1900G>A	5.37:g.140604977G>A	ENSP00000239449:p.Asp634Asn		140585161	NM_018934	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	16.77	3.214510	0.58452	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.51071	0.72;0.72	3.9	3.9	0.45041	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.69958	0.3169	M	0.79805	2.47	0.46927	D	0.999252	D	0.89917	1.0	D	0.87578	0.998	T	0.76817	-0.2819	9	0.87932	D	0	.	15.93	0.79651	0.0:0.0:1.0:0.0	.	634	Q9Y5E9	PCDBE_HUMAN	N	481;634	ENSP00000444518:D481N;ENSP00000239449:D634N	ENSP00000239449:D634N	D	+	1	0	PCDHB14	140585161	1.000000	0.71417	0.979000	0.43373	0.003000	0.03518	5.153000	0.64888	1.877000	0.54381	0.650000	0.86243	GAC		0.697	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
LAMA2	3908	broad.mit.edu	37	6	129777609	129777610	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr6:129777609_129777610insT	ENST00000421865.2	+	48	6886_6887	c.6837_6838insT	c.(6838-6840)tttfs	p.F2280fs		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2280	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.F2280L(1)|p.V2281fs*12(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ATGCAATGCTGTTTGTTGGTGG	0.465																																					p.L2279fs												.	.	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(1)|lung(1)	c.6837_6838insT	6						.																																			129819303	SO:0001589	frameshift_variant	3908	exon48			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.6840dupT	6.37:g.129777612_129777612dupT	ENSP00000400365:p.Phe2280fs		129819302	NM_000426	Q14736|Q5VUM2|Q93022	Frame_Shift_Ins	INS	ENST00000421865.2	37	CCDS5138.1																																																																																				0.465	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
LAMA4	3910	broad.mit.edu	37	6	112508673	112508673	+	Silent	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr6:112508673G>A	ENST00000230538.7	-	8	1342	c.945C>T	c.(943-945)aaC>aaT	p.N315N	LAMA4_ENST00000522006.1_Silent_p.N308N|LAMA4_ENST00000424408.2_Silent_p.N308N|LAMA4_ENST00000389463.4_Silent_p.N308N	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	315	Domain II and I.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.N308N(1)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AGATGGTGGCGTTGATTTCAT	0.542																																					p.N308N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C924T	6						.						143.0	122.0	129.0					6																	112508673		2203	4300	6503	112615366	SO:0001819	synonymous_variant	3910	exon8				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.945C>T	6.37:g.112508673G>A			112615366	NM_001105207	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Silent	SNP	ENST00000230538.7	37	CCDS43491.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.590|7.590	0.670501|0.670501	0.14776|0.14776	.|.	.|.	ENSG00000112769|ENSG00000112769	ENST00000521732|ENST00000368640	.|.	.|.	.|.	5.76|5.76	4.71|4.71	0.59529|0.59529	.|.	.|.	.|.	.|.	.|.	T|T	0.50069|0.50069	0.1594|0.1594	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.48139|0.48139	-0.9061|-0.9061	4|4	.|.	.|.	.|.	.|.	9.524|9.524	0.39154|0.39154	0.2259:0.0:0.7741:0.0|0.2259:0.0:0.7741:0.0	.|.	.|.	.|.	.|.	C|M	128|119	.|.	.|.	R|T	-|-	1|2	0|0	LAMA4|LAMA4	112615366|112615366	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.609000|0.609000	0.37215|0.37215	1.119000|1.119000	0.31258|0.31258	2.744000|2.744000	0.94065|0.94065	0.650000|0.650000	0.86243|0.86243	CGC|ACG		0.542	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
GFOD1	54438	broad.mit.edu	37	6	13365331	13365331	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr6:13365331G>C	ENST00000379287.3	-	2	1481	c.817C>G	c.(817-819)Ccg>Gcg	p.P273A	GFOD1_ENST00000379284.1_Missense_Mutation_p.P170A	NM_018988.3	NP_061861.1	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain containing 1	273						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)	p.P273A(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)	18	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			TCCTGCTCCGGGGCGCTGTTG	0.697																																					p.P273A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C817G	6						.						26.0	29.0	28.0					6																	13365331		2203	4296	6499	13473310	SO:0001583	missense	54438	exon2			AK000337	CCDS4524.1, CCDS56397.1, CCDS64351.1	6p24.1-p23	2013-09-19			ENSG00000145990	ENSG00000145990			21096	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 114"""	C6orf114			Standard	NM_018988		Approved	FLJ20330, ADG-90	uc003nat.2	Q9NXC2	OTTHUMG00000014276	ENST00000379287.3:c.817C>G	6.37:g.13365331G>C	ENSP00000368589:p.Pro273Ala		13473310	NM_018988	A8E4L6|Q5T058|Q96JD4|Q9H5K2	Missense_Mutation	SNP	ENST00000379287.3	37	CCDS4524.1	.	.	.	.	.	.	.	.	.	.	G	0.021	-1.430695	0.01117	.	.	ENSG00000145990	ENST00000379287;ENST00000379284	T;T	0.42513	1.53;0.97	5.73	-0.889	0.10580	.	0.456119	0.25801	N	0.028205	T	0.04998	0.0134	N	0.02539	-0.55	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.41088	-0.9528	10	0.07990	T	0.79	-31.5439	15.421	0.75011	0.063:0.6584:0.2787:0.0	.	273	Q9NXC2	GFOD1_HUMAN	A	273;170	ENSP00000368589:P273A;ENSP00000368586:P170A	ENSP00000368586:P170A	P	-	1	0	GFOD1	13473310	0.803000	0.28956	0.001000	0.08648	0.436000	0.31835	0.251000	0.18257	-0.530000	0.06349	-0.181000	0.13052	CCG		0.697	GFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039902.1	NM_018988	
HS3ST5	222537	broad.mit.edu	37	6	114379121	114379121	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr6:114379121G>A	ENST00000312719.5	-	5	1529	c.341C>T	c.(340-342)cCg>cTg	p.P114L	RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000523087.1_RNA|RP3-399L15.3_ENST00000519104.1_RNA|HS3ST5_ENST00000411826.1_Missense_Mutation_p.P114L			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	114					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)	p.P114L(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		GACTACTGCCGGATGTAGGTT	0.473																																					p.P114L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C341T	6						.						89.0	90.0	90.0					6																	114379121		2203	4300	6503	114485814	SO:0001583	missense	222537	exon2			AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.341C>T	6.37:g.114379121G>A	ENSP00000427888:p.Pro114Leu		114485814	NM_153612	A8K1J2|Q52LI2|Q8N285	Missense_Mutation	SNP	ENST00000312719.5	37	CCDS34517.1	.	.	.	.	.	.	.	.	.	.	G	18.28	3.589918	0.66105	.	.	ENSG00000249853	ENST00000312719;ENST00000411826	T;T	0.73047	-0.71;-0.71	5.62	5.62	0.85841	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.87811	0.6271	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.89894	0.4039	10	0.87932	D	0	.	20.0247	0.97519	0.0:0.0:1.0:0.0	.	114	Q8IZT8	HS3S5_HUMAN	L	114	ENSP00000427888:P114L;ENSP00000440332:P114L	ENSP00000427888:P114L	P	-	2	0	HS3ST5	114485814	1.000000	0.71417	0.854000	0.33618	0.872000	0.50106	9.813000	0.99286	2.804000	0.96469	0.655000	0.94253	CCG		0.473	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041911.2	NM_153612	
KIF13A	63971	broad.mit.edu	37	6	17837812	17837812	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr6:17837812G>A	ENST00000259711.6	-	10	938	c.833C>T	c.(832-834)tCg>tTg	p.S278L	KIF13A_ENST00000378816.5_Missense_Mutation_p.S278L|KIF13A_ENST00000378814.5_Missense_Mutation_p.S278L|KIF13A_ENST00000378843.2_Missense_Mutation_p.S278L|KIF13A_ENST00000378826.2_Missense_Mutation_p.S278L	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	278	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S278L(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GGTTGTAAGCGATCTGTCAAG	0.378																																					p.S278L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C833T	6						.						53.0	45.0	48.0					6																	17837812		1841	4080	5921	17945791	SO:0001583	missense	63971	exon10			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.833C>T	6.37:g.17837812G>A	ENSP00000259711:p.Ser278Leu		17945791	NM_022113	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	G	36	5.863574	0.97043	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	D;D;D;D;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29	5.64	5.64	0.86602	Kinesin, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.96552	0.8875	H	0.98559	4.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.97551	1.0092	10	0.87932	D	0	.	20.0585	0.97663	0.0:0.0:1.0:0.0	.	278;278;278;278	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	L	278	ENSP00000368091:S278L;ENSP00000259711:S278L;ENSP00000368103:S278L;ENSP00000368120:S278L;ENSP00000368093:S278L	ENSP00000259711:S278L	S	-	2	0	KIF13A	17945791	1.000000	0.71417	0.862000	0.33874	0.499000	0.33736	9.813000	0.99286	2.812000	0.96745	0.557000	0.71058	TCG		0.378	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
PTCHD4	442213	broad.mit.edu	37	6	47847119	47847119	+	Silent	SNP	G	G	A	rs528743841		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr6:47847119G>A	ENST00000339488.4	-	3	1494	c.1461C>T	c.(1459-1461)gaC>gaT	p.D487D		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	487						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)	p.D487D(1)									TGTTGGCTCCGTCACTGATCT	0.413													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21576	0.0		0.0	False		,,,				2504	0.0				p.D487D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1461T	6						.						76.0	70.0	72.0					6																	47847119		2203	4300	6503	47955078	SO:0001819	synonymous_variant	442213	exon3				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1461C>T	6.37:g.47847119G>A			47955078	NM_001013732	B0QZ29|B4DRK3|Q5T884	Silent	SNP	ENST00000339488.4	37	CCDS34473.2																																																																																				0.413	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732	
PKHD1	5314	broad.mit.edu	37	6	51875171	51875171	+	Missense_Mutation	SNP	G	G	A	rs140996978		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr6:51875171G>A	ENST00000371117.3	-	35	5962	c.5687C>T	c.(5686-5688)aCg>aTg	p.T1896M	PKHD1_ENST00000340994.4_Missense_Mutation_p.T1896M	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1896					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.T1896M(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CTGATTGGGCGTCTCACACTC	0.428																																					p.T1896M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5687T	6						.	G	MET/THR,MET/THR	0,4406		0,0,2203	154.0	138.0	143.0		5687,5687	3.7	1.0	6	dbSNP_134	143	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	PKHD1	NM_138694.3,NM_170724.2	81,81	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	benign,benign	1896/4075,1896/3397	51875171	3,13003	2203	4300	6503	51983130	SO:0001583	missense	5314	exon35			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.5687C>T	6.37:g.51875171G>A	ENSP00000360158:p.Thr1896Met		51983130	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	G	8.895	0.954857	0.18431	0.0	3.49E-4	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.91124	-2.48;-2.79	5.63	3.71	0.42584	.	0.330336	0.28077	N	0.016683	T	0.72187	0.3429	N	0.12182	0.205	0.22424	N	0.999119	D;P	0.61697	0.99;0.487	B;B	0.43575	0.424;0.023	T	0.68716	-0.5335	10	0.51188	T	0.08	.	10.7891	0.46422	0.0791:0.2022:0.7187:0.0	.	1896;1896	P08F94-2;P08F94	.;PKHD1_HUMAN	M	1896	ENSP00000360158:T1896M;ENSP00000341097:T1896M	ENSP00000341097:T1896M	T	-	2	0	PKHD1	51983130	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.584000	0.36589	1.345000	0.45676	0.557000	0.71058	ACG		0.428	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
COL19A1	1310	broad.mit.edu	37	6	70646742	70646742	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr6:70646742G>A	ENST00000322773.4	+	8	915	c.813G>A	c.(811-813)atG>atA	p.M271I		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	271					cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.M271I(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CCAGTAAAATGTCTTCATATC	0.438																																					p.M271I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G813A	6						.						167.0	157.0	160.0					6																	70646742		2203	4300	6503	70703463	SO:0001583	missense	1310	exon8				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.813G>A	6.37:g.70646742G>A	ENSP00000316030:p.Met271Ile		70703463	NM_001858	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	37	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	G	4.074	0.011537	0.07912	.	.	ENSG00000082293	ENST00000322773	D	0.91011	-2.77	5.37	0.581	0.17407	.	0.696176	0.13666	N	0.371248	T	0.64571	0.2610	L	0.28740	0.885	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.51803	-0.8659	10	0.27785	T	0.31	.	0.7811	0.01041	0.2014:0.1401:0.2702:0.3884	.	271	Q14993	COJA1_HUMAN	I	271	ENSP00000316030:M271I	ENSP00000316030:M271I	M	+	3	0	COL19A1	70703463	0.944000	0.32072	0.081000	0.20488	0.283000	0.27025	0.274000	0.18680	0.278000	0.22164	0.655000	0.94253	ATG		0.438	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
GABRR1	2569	broad.mit.edu	37	6	89907750	89907750	+	Silent	SNP	G	G	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr6:89907750G>T	ENST00000454853.2	-	5	671	c.561C>A	c.(559-561)ctC>ctA	p.L187L	GABRR1_ENST00000369451.3_Silent_p.L100L|GABRR1_ENST00000435811.1_Silent_p.L170L	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	187					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.L181L(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	TGAGACTATAGAGCACTTTCC	0.463																																					p.L187L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C561A	6						.						155.0	135.0	142.0					6																	89907750		2203	4300	6503	89964469	SO:0001819	synonymous_variant	2569	exon5				CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.561C>A	6.37:g.89907750G>T			89964469	NM_002042	A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Silent	SNP	ENST00000454853.2	37	CCDS5019.2																																																																																				0.463	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041479.2		
THBS2	7058	broad.mit.edu	37	6	169648753	169648753	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr6:169648753G>A	ENST00000366787.3	-	4	617	c.368C>T	c.(367-369)aCg>aTg	p.T123M		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	123	Heparin-binding. {ECO:0000255}.|Laminin G-like.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.T123M(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GAGATCCAGCGTGTCCGCGGG	0.652																																					p.T123M	Esophageal Squamous(91;219 1934 18562 44706)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C368T	6						.						88.0	79.0	82.0					6																	169648753		2203	4300	6503	169390678	SO:0001583	missense	7058	exon4				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.368C>T	6.37:g.169648753G>A	ENSP00000355751:p.Thr123Met		169390678	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424672	0.62733	.	.	ENSG00000186340	ENST00000366787	T	0.02446	4.29	4.37	4.37	0.52481	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.42172	U	0.000745	T	0.10423	0.0255	M	0.80422	2.495	0.48571	D	0.999672	D	0.89917	1.0	D	0.68943	0.961	T	0.02683	-1.1124	10	0.87932	D	0	-31.543	17.3016	0.87183	0.0:0.0:1.0:0.0	.	123	P35442	TSP2_HUMAN	M	123	ENSP00000355751:T123M	ENSP00000355751:T123M	T	-	2	0	THBS2	169390678	1.000000	0.71417	0.907000	0.35723	0.122000	0.20287	9.208000	0.95075	2.146000	0.66826	0.563000	0.77884	ACG		0.652	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
RELN	5649	broad.mit.edu	37	7	103236916	103236916	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr7:103236916A>G	ENST00000428762.1	-	25	3685	c.3526T>C	c.(3526-3528)Ttc>Ctc	p.F1176L	RELN_ENST00000343529.5_Missense_Mutation_p.F1176L|RELN_ENST00000424685.2_Missense_Mutation_p.F1176L	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1176					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.F1176L(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGTTTGCTGAAGTCTGAAAAG	0.473																																					p.F1176L	NSCLC(146;835 1944 15585 22231 52158)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3526C	7						.						178.0	162.0	168.0					7																	103236916		2203	4300	6503	103024152	SO:0001583	missense	5649	exon25				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.3526T>C	7.37:g.103236916A>G	ENSP00000392423:p.Phe1176Leu		103024152	NM_005045	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	A	32	5.182387	0.94885	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.40756	1.81;1.02;1.81	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.62159	0.2405	M	0.68593	2.085	0.58432	D	0.999999	D;D	0.54964	0.961;0.969	P;D	0.63381	0.735;0.914	T	0.64158	-0.6473	10	0.66056	D	0.02	.	16.5932	0.84781	1.0:0.0:0.0:0.0	.	1176;1176	P78509-2;P78509	.;RELN_HUMAN	L	1176	ENSP00000392423:F1176L;ENSP00000345694:F1176L;ENSP00000388446:F1176L	ENSP00000345694:F1176L	F	-	1	0	RELN	103024152	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.701000	0.91331	2.320000	0.78422	0.528000	0.53228	TTC		0.473	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
PURB	5814	broad.mit.edu	37	7	44924342	44924342	+	Silent	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr7:44924342G>A	ENST00000395699.2	-	1	618	c.606C>T	c.(604-606)ggC>ggT	p.G202G	MIR4657_ENST00000578157.1_RNA|RP4-673M15.1_ENST00000608450.1_RNA	NM_033224.3	NP_150093.1	Q96QR8	PURB_HUMAN	purine-rich element binding protein B	202	Gly-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of myeloid cell differentiation (GO:0045637)|transcription, DNA-templated (GO:0006351)	DNA replication factor A complex (GO:0005662)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)	p.G202G(1)		large_intestine(2)|lung(3)|prostate(1)|skin(1)	7						ctcccgggccgccTGCCAGCT	0.701																																					p.G202G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C606T	7						.						14.0	19.0	17.0					7																	44924342		2194	4289	6483	44890867	SO:0001819	synonymous_variant	5814	exon1				CCDS5499.1	7p13	2008-07-18			ENSG00000146676	ENSG00000146676			9702	protein-coding gene	gene with protein product		608887				1448097	Standard	NM_033224		Approved	PURBETA	uc003tme.3	Q96QR8	OTTHUMG00000023578	ENST00000395699.2:c.606C>T	7.37:g.44924342G>A			44890867	NM_033224	A4D2L7	Silent	SNP	ENST00000395699.2	37	CCDS5499.1																																																																																				0.701	PURB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251332.2	NM_033224	
GTF2IRD1	9569	broad.mit.edu	37	7	73944184	73944184	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr7:73944184A>T	ENST00000265755.3	+	9	1604	c.1211A>T	c.(1210-1212)tAt>tTt	p.Y404F	GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.Y436F|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.Y404F|GTF2IRD1_ENST00000489094.1_3'UTR|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.Y404F	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	404					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y404F(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCCTGCACTTATGGAGTCCCC	0.607																																					p.Y404F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1211T	7						.						55.0	54.0	54.0					7																	73944184		2203	4300	6503	73582120	SO:0001583	missense	9569	exon9			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1211A>T	7.37:g.73944184A>T	ENSP00000265755:p.Tyr404Phe		73582120	NM_005685	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	a	24.4	4.525600	0.85600	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.63581	0.2523	L	0.42487	1.325	0.58432	D	0.999998	D;P;P;P	0.76494	0.999;0.822;0.909;0.702	D;B;P;P	0.83275	0.996;0.298;0.771;0.461	T	0.63093	-0.6714	10	0.41790	T	0.15	-11.4089	13.3342	0.60507	1.0:0.0:0.0:0.0	.	436;404;404;404	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	F	404;436;404;404	ENSP00000265755:Y404F;ENSP00000397566:Y436F;ENSP00000408477:Y404F;ENSP00000418383:Y404F	ENSP00000265755:Y404F	Y	+	2	0	GTF2IRD1	73582120	1.000000	0.71417	0.806000	0.32338	0.866000	0.49608	6.775000	0.75018	1.824000	0.53156	0.375000	0.23000	TAT		0.607	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
ABCB4	5244	broad.mit.edu	37	7	87079364	87079364	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr7:87079364delT	ENST00000265723.4	-	8	864	c.753delA	c.(751-753)aaafs	p.K251fs	ABCB4_ENST00000453593.1_Frame_Shift_Del_p.K251fs|ABCB4_ENST00000358400.3_Frame_Shift_Del_p.K251fs|ABCB4_ENST00000359206.3_Frame_Shift_Del_p.K251fs|ABCB4_ENST00000545634.1_Frame_Shift_Del_p.K251fs	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	251	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)	p.A252fs*15(1)		breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	CGGCGCCTGCTTTTGCATAAG	0.483																																					p.K251fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.753delA	7						.						88.0	86.0	86.0					7																	87079364		2203	4300	6503	86917300	SO:0001589	frameshift_variant	5244	exon8			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.753delA	7.37:g.87079364delT	ENSP00000265723:p.Lys251fs		86917300	NM_018849	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Frame_Shift_Del	DEL	ENST00000265723.4	37	CCDS5606.1																																																																																				0.483	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
PLXNA4	91584	broad.mit.edu	37	7	131831420	131831420	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr7:131831420C>T	ENST00000359827.3	-	28	5866	c.4904G>A	c.(4903-4905)cGc>cAc	p.R1635H	PLXNA4_ENST00000321063.4_Missense_Mutation_p.R1635H			Q9HCM2	PLXA4_HUMAN	plexin A4	1635					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.R1635H(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TGTCCGTGAGCGGAGGCTGTC	0.587																																					p.R1635H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4904A	7						.						144.0	158.0	153.0					7																	131831420		2178	4292	6470	131481960	SO:0001583	missense	91584	exon28			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4904G>A	7.37:g.131831420C>T	ENSP00000352882:p.Arg1635His		131481960	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593623	0.86953	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.12465	2.68;2.68	5.8	5.8	0.92144	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.151438	0.64402	D	0.000008	T	0.22627	0.0546	L	0.54965	1.715	0.80722	D	1	P	0.45827	0.867	P	0.45406	0.479	T	0.00167	-1.1964	10	0.48119	T	0.1	.	20.0537	0.97638	0.0:1.0:0.0:0.0	.	1635	Q9HCM2	PLXA4_HUMAN	H	1635	ENSP00000323194:R1635H;ENSP00000352882:R1635H	ENSP00000323194:R1635H	R	-	2	0	PLXNA4	131481960	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.670000	0.83925	2.758000	0.94735	0.561000	0.74099	CGC		0.587	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
RIMS2	9699	broad.mit.edu	37	8	104948921	104948921	+	Nonsense_Mutation	SNP	C	C	T	rs561377229		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr8:104948921C>T	ENST00000436393.2	+	11	2093	c.1852C>T	c.(1852-1854)Cga>Tga	p.R618*	RIMS2_ENST00000406091.3_Nonsense_Mutation_p.R840*|RIMS2_ENST00000507740.1_Nonsense_Mutation_p.R632*|RIMS2_ENST00000262231.10_Nonsense_Mutation_p.R679*			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	902					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.R618*(2)|p.R632*(2)|p.R907*(2)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGCTCGTGTTCGAGAGGAAGA	0.383										HNSCC(12;0.0054)																											p.R840X												.	.	6	Substitution - Nonsense(6)	large_intestine(6)	c.C2518T	8						.						146.0	132.0	136.0					8																	104948921		1843	4091	5934	105018097	SO:0001587	stop_gained	9699	exon13			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1852C>T	8.37:g.104948921C>T	ENSP00000390665:p.Arg618*		105018097	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Nonsense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	C	39	7.483370	0.98312	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	.	.	.	4.89	4.0	0.46444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7516	0.69530	0.1459:0.8541:0.0:0.0	.	.	.	.	X	840;855;840;902;632;679;632;632;618	.	ENSP00000262231:R679X	R	+	1	2	RIMS2	105018097	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.082000	0.50128	1.156000	0.42514	0.467000	0.42956	CGA		0.383	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
ABRA	137735	broad.mit.edu	37	8	107782406	107782406	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr8:107782406C>T	ENST00000311955.3	-	1	67	c.13G>A	c.(13-15)Gaa>Aaa	p.E5K		NM_139166.4	NP_631905.1			actin-binding Rho activating protein									p.E5K(1)		breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			CTTTCCTTTTCGCCCGGAGCC	0.592																																					p.E5K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13A	8						.						34.0	38.0	37.0					8																	107782406		2202	4299	6501	107851582	SO:0001583	missense	137735	exon1			AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.13G>A	8.37:g.107782406C>T	ENSP00000311436:p.Glu5Lys		107851582	NM_139166		Missense_Mutation	SNP	ENST00000311955.3	37	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389704	0.42410	.	.	ENSG00000174429	ENST00000311955	.	.	.	5.66	5.66	0.87406	.	0.256457	0.38111	N	0.001803	T	0.55816	0.1944	M	0.65975	2.015	0.42153	D	0.99156	P	0.51449	0.945	B	0.34590	0.186	T	0.67260	-0.5715	9	0.87932	D	0	-3.5289	19.7503	0.96265	0.0:1.0:0.0:0.0	.	5	Q8N0Z2	ABRA_HUMAN	K	5	.	ENSP00000311436:E5K	E	-	1	0	ABRA	107851582	1.000000	0.71417	0.929000	0.37066	0.325000	0.28411	1.079000	0.30766	2.648000	0.89879	0.655000	0.94253	GAA		0.592	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166	
KCNB2	9312	broad.mit.edu	37	8	73480454	73480454	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr8:73480454G>A	ENST00000523207.1	+	2	1073	c.485G>A	c.(484-486)cGa>cAa	p.R162Q		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	162				ER -> DG (in Ref. 1; AAP46292). {ECO:0000305}.	potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.R162Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	ATGCGAGAGCGAGAAGGAGAA	0.458																																					p.R162Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G485A	8						.						130.0	138.0	135.0					8																	73480454		2203	4300	6503	73643008	SO:0001583	missense	9312	exon2			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.485G>A	8.37:g.73480454G>A	ENSP00000430846:p.Arg162Gln		73643008	NM_004770	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.483701	0.44147	.	.	ENSG00000182674	ENST00000523207	D	0.97138	-4.26	6.07	5.2	0.72013	.	0.000000	0.29307	U	0.012537	D	0.95223	0.8451	L	0.47716	1.5	0.34949	D	0.75106	P	0.35542	0.508	B	0.37508	0.252	D	0.97229	0.9883	10	0.40728	T	0.16	.	15.1772	0.72924	0.068:0.0:0.932:0.0	.	162	Q92953	KCNB2_HUMAN	Q	162	ENSP00000430846:R162Q	ENSP00000430846:R162Q	R	+	2	0	KCNB2	73643008	1.000000	0.71417	0.764000	0.31436	0.421000	0.31385	6.744000	0.74854	1.581000	0.49865	0.655000	0.94253	CGA		0.458	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
TSTA3	7264	broad.mit.edu	37	8	144696973	144696973	+	Missense_Mutation	SNP	G	G	A	rs370546429		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr8:144696973G>A	ENST00000425753.2	-	4	477	c.374C>T	c.(373-375)cCg>cTg	p.P125L	TSTA3_ENST00000529064.1_Missense_Mutation_p.P125L	NM_003313.3	NP_003304.1	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	125					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|cytolysis (GO:0019835)|GDP-mannose metabolic process (GO:0019673)|leukocyte cell-cell adhesion (GO:0007159)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	coenzyme binding (GO:0050662)|electron carrier activity (GO:0009055)|GDP-4-dehydro-D-rhamnose reductase activity (GO:0042356)|GDP-L-fucose synthase activity (GO:0050577)|isomerase activity (GO:0016853)	p.P125L(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CTCATCTATCGGGTAGGTCGT	0.657																																					p.P125L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C374T	8						.						91.0	83.0	86.0					8																	144696973		2203	4300	6503	144768116	SO:0001583	missense	7264	exon4			U58766	CCDS6408.1	8q24.3	2012-02-22			ENSG00000104522	ENSG00000104522	1.1.1.271	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	12390	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 4E, member 1"", ""GDP-L-fucose synthase"""	137020				7803801, 1348494, 19027726	Standard	NM_003313		Approved	FX, P35B, SDR4E1	uc003yzb.2	Q13630	OTTHUMG00000165159	ENST00000425753.2:c.374C>T	8.37:g.144696973G>A	ENSP00000398803:p.Pro125Leu		144768116	NM_003313	B2R8Y7|D3DWK5|Q567Q9|Q9UDG7	Missense_Mutation	SNP	ENST00000425753.2	37	CCDS6408.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959993	0.74016	.	.	ENSG00000104522	ENST00000529064;ENST00000425753;ENST00000529048;ENST00000533817	D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5	4.85	4.85	0.62838	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98642	0.9545	H	0.99487	4.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99705	1.1005	10	0.87932	D	0	-11.8563	16.5412	0.84385	0.0:0.0:1.0:0.0	.	125;125	B4DZW9;Q13630	.;FCL_HUMAN	L	125	ENSP00000435386:P125L;ENSP00000398803:P125L;ENSP00000431587:P125L;ENSP00000437012:P125L	ENSP00000398803:P125L	P	-	2	0	TSTA3	144768116	1.000000	0.71417	0.888000	0.34837	0.414000	0.31173	9.202000	0.95026	2.235000	0.73313	0.467000	0.42956	CCG		0.657	TSTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382263.1	NM_003313	
RNF20	56254	broad.mit.edu	37	9	104312898	104312898	+	Missense_Mutation	SNP	G	G	A	rs368721473		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr9:104312898G>A	ENST00000389120.3	+	10	1193	c.1103G>A	c.(1102-1104)cGg>cAg	p.R368Q	AL591377.1_ENST00000584534.1_RNA	NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	368					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R368Q(1)		breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		GTGGAATTGCGGAGTGCAGTG	0.473													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18976	0.0		0.0	False		,,,				2504	0.0				p.R368Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1103A	9						.	G	GLN/ARG	1,4405		0,1,2202	162.0	156.0	158.0		1103	5.9	1.0	9		158	0,8600		0,0,4300	no	missense	RNF20	NM_019592.5	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	368/976	104312898	1,13005	2203	4300	6503	103352719	SO:0001583	missense	56254	exon10			AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.1103G>A	9.37:g.104312898G>A	ENSP00000373772:p.Arg368Gln		103352719	NM_019592	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	37	CCDS35084.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086750	0.76642	2.27E-4	0.0	ENSG00000155827	ENST00000389120	T	0.32753	1.44	5.92	5.92	0.95590	.	0.250465	0.41001	D	0.000966	T	0.20047	0.0482	L	0.39245	1.2	0.37893	D	0.930798	P	0.42692	0.787	B	0.26693	0.072	T	0.14504	-1.0470	10	0.15499	T	0.54	-17.2616	15.4097	0.74908	0.0:0.1387:0.8613:0.0	.	368	Q5VTR2	BRE1A_HUMAN	Q	368	ENSP00000373772:R368Q	ENSP00000373772:R368Q	R	+	2	0	RNF20	103352719	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.673000	0.61604	2.810000	0.96702	0.650000	0.86243	CGG		0.473	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592	
OR1L1	26737	broad.mit.edu	37	9	125424053	125424053	+	Missense_Mutation	SNP	G	G	A	rs146350628	byFrequency	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr9:125424053G>A	ENST00000373686.1	+	1	209	c.209G>A	c.(208-210)cGa>cAa	p.R70Q	OR1L1_ENST00000309623.1_Missense_Mutation_p.R20Q			Q8NH94	OR1L1_HUMAN	olfactory receptor, family 1, subfamily L, member 1	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R70Q(1)		breast(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)	17						CTCTCCTCTCGACCTGAGGAT	0.463																																					p.R20Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G59A	9						.	G	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	114.0	105.0	108.0		59	1.0	0.0	9	dbSNP_134	108	0,8600		0,0,4300	no	missense	OR1L1	NM_001005236.3	43	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	20/311	125424053	2,13004	2203	4300	6503	124463874	SO:0001583	missense	26737	exon1				CCDS35127.1, CCDS35127.2	9q33.2	2013-09-20			ENSG00000173679	ENSG00000173679		"""GPCR / Class A : Olfactory receptors"""	8213	protein-coding gene	gene with protein product				OR1L2			Standard	NM_001005236		Approved	OR9-C	uc022bmz.1	Q8NH94	OTTHUMG00000020618	ENST00000373686.1:c.209G>A	9.37:g.125424053G>A	ENSP00000362790:p.Arg70Gln		124463874	NM_001005236	Q5T7Z3|Q6IFN2	Missense_Mutation	SNP	ENST00000373686.1	37		.	.	.	.	.	.	.	.	.	.	G	0.017	-1.492186	0.01009	4.54E-4	0.0	ENSG00000173679	ENST00000373686;ENST00000309623	T;T	0.01076	5.37;5.37	2.94	1.02	0.19986	.	.	.	.	.	T	0.00552	0.0018	N	0.05487	-0.04	0.09310	N	1	B	0.27559	0.181	B	0.14578	0.011	T	0.43475	-0.9389	9	0.02654	T	1	.	4.318	0.11002	0.2388:0.3144:0.4468:0.0	.	70	Q8NH94	OR1L1_HUMAN	Q	70;20	ENSP00000362790:R70Q;ENSP00000310773:R20Q	ENSP00000310773:R20Q	R	+	2	0	OR1L1	124463874	0.001000	0.12720	0.003000	0.11579	0.009000	0.06853	0.923000	0.28757	0.108000	0.17862	-0.657000	0.03884	CGA		0.463	OR1L1-201	KNOWN	basic	protein_coding	protein_coding			
SARDH	1757	broad.mit.edu	37	9	136596541	136596541	+	Silent	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr9:136596541C>T	ENST00000371872.4	-	4	833	c.576G>A	c.(574-576)ccG>ccA	p.P192P	SARDH_ENST00000422262.2_Silent_p.P24P|SARDH_ENST00000298628.5_Silent_p.P192P|SARDH_ENST00000439388.1_Silent_p.P192P|SARDH_ENST00000371867.1_Silent_p.P103P	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	192					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)	p.P192P(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CATTCATCAGCGGGTACAGAG	0.622																																					p.P192P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G576A	9						.						132.0	121.0	125.0					9																	136596541		2203	4300	6503	135586362	SO:0001819	synonymous_variant	1757	exon4				CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.576G>A	9.37:g.136596541C>T			135586362	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	ENST00000371872.4	37	CCDS6978.1																																																																																				0.622	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
GLIS3	169792	broad.mit.edu	37	9	4118504	4118504	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr9:4118504G>A	ENST00000324333.10	-	3	702	c.509C>T	c.(508-510)aCg>aTg	p.T170M	GLIS3_ENST00000381971.3_Missense_Mutation_p.T325M	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	170					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.T170M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		CACCAAGGACGTGGGCGACGT	0.647																																					p.T170M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C509T	9						.						69.0	59.0	62.0					9																	4118504		2203	4300	6503	4108504	SO:0001583	missense	169792	exon3			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.509C>T	9.37:g.4118504G>A	ENSP00000325494:p.Thr170Met		4108504	NM_152629	B1AL19|Q1PHK5	Missense_Mutation	SNP	ENST00000324333.10	37	CCDS6451.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540706	0.85917	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	T;T	0.16597	2.38;2.33	5.83	5.83	0.93111	.	0.000000	0.53938	D	0.000060	T	0.45915	0.1366	M	0.76002	2.32	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.23619	-1.0183	10	0.51188	T	0.08	.	20.1124	0.97915	0.0:0.0:1.0:0.0	.	325;170	Q8NEA6-2;Q8NEA6	.;GLIS3_HUMAN	M	170;325	ENSP00000325494:T170M;ENSP00000371398:T325M	ENSP00000325494:T170M	T	-	2	0	GLIS3	4108504	1.000000	0.71417	0.965000	0.40720	0.986000	0.74619	5.601000	0.67606	2.749000	0.94314	0.655000	0.94253	ACG		0.647	GLIS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051559.1	NM_152629	
DPH7	92715	broad.mit.edu	37	9	140458998	140458998	+	Silent	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chr9:140458998C>T	ENST00000277540.2	-	8	994	c.837G>A	c.(835-837)acG>acA	p.T279T	DPH7_ENST00000479650.1_5'UTR	NM_138778.2	NP_620133.1	Q9BTV6	DPH7_HUMAN	diphthamide biosynthesis 7	279					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)			p.T279T(1)									CCTGCACAGGCGTATCTGCCA	0.547																																					p.T279T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G837A	9						.						190.0	143.0	159.0					9																	140458998		2203	4300	6503	139578819	SO:0001819	synonymous_variant	92715	exon8			AK075115	CCDS7047.1	9q34.3	2013-06-20	2013-06-20	2013-06-20	ENSG00000148399	ENSG00000148399		"""WD repeat domain containing"""	25199	protein-coding gene	gene with protein product		613210	"""chromosome 9 open reading frame 112"", ""WD repeat domain 85"""	C9orf112, WDR85		23486472	Standard	NM_138778		Approved	FLJ90634, RRT2	uc004cnk.1	Q9BTV6	OTTHUMG00000020991	ENST00000277540.2:c.837G>A	9.37:g.140458998C>T			139578819	NM_138778	Q96AB7	Silent	SNP	ENST00000277540.2	37	CCDS7047.1																																																																																				0.547	DPH7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055350.1	NM_138778	
RAB40AL	282808	broad.mit.edu	37	X	102193053	102193053	+	Silent	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chrX:102193053C>T	ENST00000218249.5	+	1	854	c.807C>T	c.(805-807)aaC>aaT	p.N269N	LL0XNC01-237H1.3_ENST00000413528.1_RNA	NM_001031834.1	NP_001027004.1	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like	269					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.N269N(2)		endometrium(4)|large_intestine(2)|lung(3)|ovary(3)	12						CACCCAAAAACTGCACCAGAA	0.517																																					p.N269N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C807T	X						.						77.0	73.0	74.0					X																	102193053		2203	4300	6503	102079709	SO:0001819	synonymous_variant	282808	exon1			BC101169	CCDS35353.1	Xq22.2	2008-02-05			ENSG00000102128	ENSG00000102128			25410	protein-coding gene	gene with protein product	"""Ras like GTPase"""	300405					Standard	NM_001031834		Approved	RAR2, RLGP	uc004ejs.3	P0C0E4	OTTHUMG00000022084	ENST00000218249.5:c.807C>T	X.37:g.102193053C>T			102079709	NM_001031834	Q495H3	Silent	SNP	ENST00000218249.5	37	CCDS35353.1																																																																																				0.517	RAB40AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057679.1	NM_001031834	
CXorf57	55086	broad.mit.edu	37	X	105855880	105855880	+	Silent	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chrX:105855880G>A	ENST00000372548.4	+	1	679	c.570G>A	c.(568-570)gcG>gcA	p.A190A	CXorf57_ENST00000372544.2_Silent_p.A190A	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	190							poly(A) RNA binding (GO:0044822)	p.A190A(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						ATTACCTGGCGCTGTGGAATA	0.463																																					p.A190A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G570A	X						.						85.0	90.0	88.0					X																	105855880		2203	4300	6503	105742536	SO:0001819	synonymous_variant	55086	exon1			AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.570G>A	X.37:g.105855880G>A			105742536	NM_018015	H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Silent	SNP	ENST00000372548.4	37	CCDS14519.1																																																																																				0.463	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057800.2	NM_018015	
PSMD10	5716	broad.mit.edu	37	X	107332065	107332065	+	Silent	SNP	A	A	G			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chrX:107332065A>G	ENST00000217958.3	-	2	227	c.130T>C	c.(130-132)Ttg>Ctg	p.L44L	ATG4A_ENST00000545696.1_5'Flank|PSMD10_ENST00000340200.5_Intron|PSMD10_ENST00000372296.1_Silent_p.L44L|PSMD10_ENST00000361815.5_Silent_p.L44L|ATG4A_ENST00000345734.3_5'Flank|PSMD10_ENST00000372295.1_Silent_p.L44L|ATG4A_ENST00000372232.3_5'Flank|ATG4A_ENST00000372254.3_5'Flank	NM_002814.3|NM_170750.2	NP_002805.1|NP_736606.1	O75832	PSD10_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 10	44	Interaction with RB1.|Interaction with RELA.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell growth (GO:0030307)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	transcription factor binding (GO:0008134)	p.L44L(1)		endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9						GCCCAGTGCAATGCAGTTCTG	0.378																																					p.L44L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T130C	X						.						112.0	103.0	106.0					X																	107332065		2203	4300	6503	107218721	SO:0001819	synonymous_variant	5716	exon2			AB009619	CCDS14536.1, CCDS14537.1	Xq22.3	2013-01-10			ENSG00000101843	ENSG00000101843		"""Proteasome (prosome, macropain) subunits"", ""Ankyrin repeat domain containing"""	9555	protein-coding gene	gene with protein product	"""gankyrin"""	300880				9714768	Standard	NM_002814		Approved	p28	uc004enp.2	O75832	OTTHUMG00000022177	ENST00000217958.3:c.130T>C	X.37:g.107332065A>G			107218721	NM_002814	Q5U0B2|Q8IZK9	Silent	SNP	ENST00000217958.3	37	CCDS14536.1																																																																																				0.378	PSMD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057868.1	NM_170750	
RGAG1	57529	broad.mit.edu	37	X	109697207	109697207	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chrX:109697207C>T	ENST00000465301.2	+	3	3608	c.3362C>T	c.(3361-3363)tCg>tTg	p.S1121L	RGAG1_ENST00000540313.1_Missense_Mutation_p.S1121L	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1121								p.S1121L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						AAGCCCACATCGCACATGACT	0.517																																					p.S1121L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3362T	X						.						163.0	147.0	153.0					X																	109697207		2203	4300	6503	109583863	SO:0001583	missense	57529	exon3			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3362C>T	X.37:g.109697207C>T	ENSP00000419786:p.Ser1121Leu		109583863	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144449	0.37825	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.47528	0.84;0.84	4.26	4.26	0.50523	.	0.611619	0.13674	N	0.370681	T	0.27663	0.0680	N	0.08118	0	0.09310	N	1	B	0.21147	0.052	B	0.15870	0.014	T	0.06391	-1.0829	9	.	.	.	-6.4529	13.5204	0.61563	0.0:1.0:0.0:0.0	.	1121	Q8NET4	RGAG1_HUMAN	L	1121;1121;682	ENSP00000419786:S1121L;ENSP00000441452:S1121L	.	S	+	2	0	RGAG1	109583863	0.004000	0.15560	0.009000	0.14445	0.032000	0.12392	1.908000	0.39907	2.356000	0.79943	0.600000	0.82982	TCG		0.517	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
THOC2	57187	broad.mit.edu	37	X	122755179	122755179	+	Missense_Mutation	SNP	C	C	T	rs143837850		TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chrX:122755179C>T	ENST00000245838.8	-	31	4076	c.4045G>A	c.(4045-4047)Gca>Aca	p.A1349T	THOC2_ENST00000355725.4_Missense_Mutation_p.A1349T|THOC2_ENST00000497887.1_5'Flank|THOC2_ENST00000491737.1_Missense_Mutation_p.A1234T	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1349	Lys-rich.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)	p.A1270T(1)|p.A1349T(1)		breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TTTGATTCTGCGTTGGGGACA	0.383													C|||	1	0.000264901	0.0	0.0	3775	,	,		13304	0.001		0.0	False		,,,				2504	0.0				p.A1349T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4045A	X						.						229.0	203.0	211.0					X																	122755179		1865	4088	5953	122582860	SO:0001583	missense	57187	exon31			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.4045G>A	X.37:g.122755179C>T	ENSP00000245838:p.Ala1349Thr		122582860	NM_001081550	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	ENST00000245838.8	37	CCDS43988.1	1	6.027727546714888E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	0.013	-1.633583	0.00806	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737	T;T;T	0.42131	0.98;0.98;0.98	5.32	1.33	0.21861	.	1.027920	0.07744	N	0.947486	T	0.19725	0.0474	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25572	-1.0128	9	.	.	.	0.5491	3.726	0.08474	0.0:0.2995:0.1953:0.5053	.	1349	Q8NI27	THOC2_HUMAN	T	1349;1349;1234	ENSP00000245838:A1349T;ENSP00000347959:A1349T;ENSP00000419795:A1234T	.	A	-	1	0	THOC2	122582860	0.000000	0.05858	0.020000	0.16555	0.401000	0.30781	0.132000	0.15891	0.548000	0.28955	0.600000	0.82982	GCA		0.383	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058153.3		
SSX6	280657	broad.mit.edu	37	X	47969873	47969873	+	IGR	SNP	G	G	C			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chrX:47969873G>C								snoU13 (28634 upstream) : SSX6 (6592 downstream)														p.D26H(1)									CTAGGCCTTCGATGATATTGC	0.448																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	X						.						100.0	86.0	91.0					X																	47969873		2193	4290	6483	47854817	SO:0001628	intergenic_variant	280657	.																															X.37:g.47969873G>C			47854817	.		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	.	10.39	1.336849	0.24253	.	.	ENSG00000171483	ENST00000376932	T	0.00882	5.58	2.68	-4.08	0.03963	Krueppel-associated box (2);Krueppel-associated box-related (1);	1.965090	0.02087	N	0.052837	T	0.02455	0.0075	.	.	.	0.09310	N	0.999998	D;P	0.53151	0.958;0.584	P;B	0.52823	0.71;0.345	T	0.38067	-0.9678	9	0.72032	D	0.01	.	10.5066	0.44836	0.251:0.0:0.749:0.0	.	26;26	B7Z813;Q7RTT6	.;SSX6_HUMAN	H	26	ENSP00000366131:D26H	ENSP00000366131:D26H	D	+	1	0	SSX6	47854817	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.129000	0.03244	-1.241000	0.02526	-0.512000	0.04463	GAT	0	0.448								
BMP15	9210	broad.mit.edu	37	X	50659425	50659425	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chrX:50659425A>G	ENST00000252677.3	+	2	997	c.997A>G	c.(997-999)Aat>Gat	p.N333D		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	333					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.N333D(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					CGATGGTCTCAATTCCCCCAA	0.507																																					p.N333D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A997G	X						.						141.0	121.0	128.0					X																	50659425		2203	4299	6502	50676165	SO:0001583	missense	9210	exon2			AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.997A>G	X.37:g.50659425A>G	ENSP00000252677:p.Asn333Asp		50676165	NM_005448	Q17RM6|Q5JST1|Q9UMS1	Missense_Mutation	SNP	ENST00000252677.3	37	CCDS14334.1	.	.	.	.	.	.	.	.	.	.	a	11.68	1.711635	0.30322	.	.	ENSG00000130385	ENST00000252677	D	0.89196	-2.48	5.58	3.06	0.35304	Transforming growth factor-beta, C-terminal (3);	0.269621	0.38959	N	0.001516	D	0.91338	0.7268	M	0.87038	2.855	0.33089	D	0.537653	P	0.48589	0.912	P	0.52267	0.694	D	0.92240	0.5800	10	0.48119	T	0.1	.	7.1337	0.25517	0.7126:0.1446:0.0:0.1428	.	333	O95972	BMP15_HUMAN	D	333	ENSP00000252677:N333D	ENSP00000252677:N333D	N	+	1	0	BMP15	50676165	0.988000	0.35896	0.996000	0.52242	0.009000	0.06853	0.572000	0.23684	1.876000	0.54355	0.481000	0.45027	AAT		0.507	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448	
AMER1	139285	broad.mit.edu	37	X	63411678	63411678	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chrX:63411678G>A	ENST00000330258.3	-	2	1761	c.1489C>T	c.(1489-1491)Cga>Tga	p.R497*	AMER1_ENST00000374869.3_Nonsense_Mutation_p.R497*|AMER1_ENST00000403336.1_Nonsense_Mutation_p.R497*	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	497					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.R497*(5)|p.R497R(2)									TAGCTGTCTCGGGGTAGACAA	0.522																																					p.R497X												.	.	74	Whole gene deletion(67)|Substitution - Nonsense(5)|Substitution - coding silent(2)	kidney(65)|large_intestine(6)|lung(2)|ovary(1)	c.C1489T	X						.						56.0	47.0	50.0					X																	63411678		2203	4300	6503	63328403	SO:0001587	stop_gained	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1489C>T	X.37:g.63411678G>A	ENSP00000329117:p.Arg497*		63328403	NM_152424	A2IB86|Q8N885	Nonsense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	39	7.315935	0.98207	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	.	.	.	5.21	0.738	0.18319	.	0.076466	0.49916	D	0.000127	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.2202	14.7031	0.69168	0.0:0.0:0.2919:0.7081	.	.	.	.	X	497	.	ENSP00000329117:R497X	R	-	1	2	FAM123B	63328403	1.000000	0.71417	0.993000	0.49108	0.964000	0.63967	0.633000	0.24598	-0.084000	0.12595	-0.237000	0.12165	CGA		0.522	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
OTUD6A	139562	broad.mit.edu	37	X	69282840	69282840	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chrX:69282840G>A	ENST00000338352.2	+	1	500	c.466G>A	c.(466-468)Gcc>Acc	p.A156T		NM_207320.1	NP_997203.1	Q7L8S5	OTU6A_HUMAN	OTU deubiquitinase 6A	156	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)		ubiquitin-specific protease activity (GO:0004843)	p.A156T(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(3)|urinary_tract(1)	23						CATGTACCGCGCCATCCAAGA	0.632																																					p.A156T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G466A	X						.						49.0	31.0	37.0					X																	69282840		2203	4300	6503	69199565	SO:0001583	missense	139562	exon1			AK098697	CCDS14395.1	Xq13.1	2014-02-24	2014-02-24			ENSG00000189401		"""OTU domain containing"""	32312	protein-coding gene	gene with protein product		300714	"""OTU domain containing 6A"""			23827681	Standard	NM_207320		Approved	FLJ25831, HSHIN6, DUBA2	uc004dxu.1	Q7L8S5		ENST00000338352.2:c.466G>A	X.37:g.69282840G>A	ENSP00000339389:p.Ala156Thr		69199565	NM_207320	B2RPB7	Missense_Mutation	SNP	ENST00000338352.2	37	CCDS14395.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.439985	0.63067	.	.	ENSG00000189401	ENST00000338352	T	0.62364	0.03	4.2	4.2	0.49525	Ovarian tumour, otubain (2);	0.000000	0.85682	D	0.000000	D	0.82609	0.5074	M	0.92219	3.285	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.86786	0.1982	10	0.87932	D	0	.	13.4864	0.61369	0.0:0.0:1.0:0.0	.	156	Q7L8S5	OTU6A_HUMAN	T	156	ENSP00000339389:A156T	ENSP00000339389:A156T	A	+	1	0	OTUD6A	69199565	1.000000	0.71417	0.397000	0.26308	0.024000	0.10985	5.869000	0.69613	2.348000	0.79779	0.556000	0.70494	GCC		0.632	OTUD6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358763.1	NM_207320	
SLC25A14	9016	broad.mit.edu	37	X	129483311	129483311	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3680-01A-01W-0900-09	TCGA-AA-3680-10A-01W-0900-09	g.chrX:129483311G>A	ENST00000218197.5	+	4	631	c.404G>A	c.(403-405)cGt>cAt	p.R135H	SLC25A14_ENST00000467496.1_3'UTR|SLC25A14_ENST00000545805.1_Missense_Mutation_p.R135H|SLC25A14_ENST00000361980.5_Missense_Mutation_p.R132H|SLC25A14_ENST00000339231.3_Missense_Mutation_p.R132H|SLC25A14_ENST00000543953.1_Missense_Mutation_p.R100H	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14	135					aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)		p.R135H(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						TTCGTAGAACGTTTAGAAGGT	0.383																																					p.R135H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G404A	X						.						112.0	86.0	95.0					X																	129483311		2203	4299	6502	129310992	SO:0001583	missense	9016	exon4			AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.404G>A	X.37:g.129483311G>A	ENSP00000218197:p.Arg135His		129310992	NM_003951	D3DTG2|Q0VDH7|Q9HC60|Q9HC61	Missense_Mutation	SNP	ENST00000218197.5	37	CCDS14623.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565361	0.45694	.	.	ENSG00000102078	ENST00000424447;ENST00000545805;ENST00000543953;ENST00000218197;ENST00000361980;ENST00000339231	T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	4.96	4.96	0.65561	Mitochondrial carrier domain (2);	0.206631	0.42964	D	0.000627	T	0.68550	0.3013	L	0.29908	0.895	0.46874	D	0.99923	B;B;B;B	0.26318	0.146;0.023;0.023;0.029	B;B;B;B	0.26517	0.07;0.013;0.008;0.022	T	0.65837	-0.6071	10	0.35671	T	0.21	-8.8274	15.9839	0.80133	0.0:0.0:1.0:0.0	.	100;132;132;135	B7Z996;O95258-3;O95258-2;O95258	.;.;.;UCP5_HUMAN	H	135;135;100;135;132;132	ENSP00000402578:R135H;ENSP00000444642:R135H;ENSP00000445225:R100H;ENSP00000218197:R135H;ENSP00000354455:R132H;ENSP00000342797:R132H	ENSP00000218197:R135H	R	+	2	0	SLC25A14	129310992	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.763000	0.55257	2.288000	0.76882	0.600000	0.82982	CGT		0.383	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058253.1	NM_022810, NM_003951	
