#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLXDC2	84898	broad.mit.edu	37	10	20506444	20506444	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr10:20506444G>T	ENST00000377252.4	+	11	2053	c.1212G>T	c.(1210-1212)agG>agT	p.R404S	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Missense_Mutation_p.R355S	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	404	Thr-rich.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R404S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						CCCAGTTCAGGGTCCTAACTA	0.438																																					p.R404S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1212T	10						.						101.0	90.0	94.0					10																	20506444		2203	4300	6503	20546450	SO:0001583	missense	84898	exon11			AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.1212G>T	10.37:g.20506444G>T	ENSP00000366460:p.Arg404Ser		20546450	NM_032812	Q96E59|Q96PD9|Q96SU9	Missense_Mutation	SNP	ENST00000377252.4	37	CCDS7132.1	.	.	.	.	.	.	.	.	.	.	G	6.339	0.430594	0.12045	.	.	ENSG00000120594	ENST00000377252;ENST00000377242;ENST00000377238;ENST00000536022	T;T	0.37411	1.2;1.2	5.55	1.62	0.23740	.	0.347909	0.37857	N	0.001901	T	0.24890	0.0604	L	0.56769	1.78	0.44918	D	0.997937	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.08806	-1.0704	10	0.08599	T	0.76	.	4.0406	0.09750	0.3362:0.1693:0.4945:0.0	.	355;404	Q6UX71-2;Q6UX71	.;PXDC2_HUMAN	S	404;355;267;390	ENSP00000366460:R404S;ENSP00000366450:R355S	ENSP00000366446:R267S	R	+	3	2	PLXDC2	20546450	1.000000	0.71417	0.926000	0.36857	0.353000	0.29299	0.712000	0.25779	0.309000	0.22966	0.563000	0.77884	AGG		0.438	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047101.2	NM_032812	
BLID	414899	broad.mit.edu	37	11	121986589	121986590	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr11:121986589_121986590insA	ENST00000560104.1	-	1	333_334	c.41_42insT	c.(40-42)ttcfs	p.F14fs		NM_001001786.2	NP_001001786.2	Q8IZY5	BLID_HUMAN	BH3-like motif containing, cell death inducer	14					apoptotic process (GO:0006915)	mitochondrion (GO:0005739)		p.F15fs*2(1)		NS(1)|large_intestine(4)|lung(6)|pancreas(1)	12		Breast(109;0.0164)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;2.08e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.101)		GGATCTCAAAGAAATGTATTTC	0.431											OREG0021435	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F14fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.42_43insT	11						.																																			121491800	SO:0001589	frameshift_variant	414899	exon1			AF303179	CCDS31693.1	11q24.1	2007-06-22				ENSG00000259571			33495	protein-coding gene	gene with protein product	"""breast cancer cell 2"""	608853				15069058, 17220890	Standard	NM_001001786		Approved	BRCC2	uc001pyf.3	Q8IZY5		ENST00000560104.1:c.42dupT	11.37:g.121986592_121986592dupA	ENSP00000453153:p.Phe14fs	1515	121491799	NM_001001786	A1L416	Frame_Shift_Ins	INS	ENST00000560104.1	37	CCDS31693.1																																																																																				0.431	BLID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387656.1	NM_001001786	
KCNQ1	3784	broad.mit.edu	37	11	2609948	2609949	+	Frame_Shift_Ins	INS	-	-	A	rs397508084|rs397508083		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr11:2609948_2609949insA	ENST00000155840.5	+	10	1365_1366	c.1257_1258insA	c.(1258-1260)aaafs	p.K420fs	KCNQ1_ENST00000335475.5_Frame_Shift_Ins_p.K293fs	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	420					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	TTTAGGTAAAGAAAAAAAAGTT	0.559																																					p.K292fs												.	.	0			c.876_877insA	11						.																																			2566525	SO:0001589	frameshift_variant	3784	exon10			AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1265dupA	11.37:g.2609956_2609956dupA	ENSP00000155840:p.Lys420fs		2566524	NM_181798	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Frame_Shift_Ins	INS	ENST00000155840.5	37	CCDS7736.1																																																																																				0.559	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027382.2	NM_000218	
PLEKHA7	144100	broad.mit.edu	37	11	16872786	16872786	+	Silent	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr11:16872786G>A	ENST00000355661.3	-	8	658	c.648C>T	c.(646-648)atC>atT	p.I216I	PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000531066.1_Silent_p.I216I|PLEKHA7_ENST00000448080.2_Silent_p.I216I			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	216	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)	p.I216I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						CCACAGGAGAGATCACGTAGC	0.512																																					p.I216I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C648T	11						.						113.0	104.0	107.0					11																	16872786		2200	4294	6494	16829362	SO:0001819	synonymous_variant	144100	exon8			BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.648C>T	11.37:g.16872786G>A			16829362	NM_175058	B4DK33|B4DWC3|Q86VZ7	Silent	SNP	ENST00000355661.3	37	CCDS31434.1																																																																																				0.512	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000387242.2	NM_175058	
KBTBD3	143879	broad.mit.edu	37	11	105923981	105923981	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr11:105923981A>G	ENST00000526793.1	-	3	1594	c.1435T>C	c.(1435-1437)Tac>Cac	p.Y479H	KBTBD3_ENST00000534815.1_Missense_Mutation_p.Y400H|KBTBD3_ENST00000531837.1_Missense_Mutation_p.Y479H	NM_152433.3	NP_689646.2	Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	475								p.Y479H(1)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		GTAGCATTGTATTTAAAAAAG	0.358																																					p.Y479H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1435C	11						.						57.0	57.0	57.0					11																	105923981		2200	4297	6497	105429191	SO:0001583	missense	143879	exon3			AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000526793.1:c.1435T>C	11.37:g.105923981A>G	ENSP00000436262:p.Tyr479His		105429191	NM_152433	Q6N066|Q86X38|Q96NK5	Missense_Mutation	SNP	ENST00000526793.1	37	CCDS8334.1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.142230	0.57044	.	.	ENSG00000182359	ENST00000534815;ENST00000526793;ENST00000531837	T;T;T	0.74106	-0.81;-0.81;-0.81	5.97	5.97	0.96955	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.80391	0.4614	L	0.29908	0.895	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.82690	-0.0332	10	0.87932	D	0	.	16.4383	0.83889	1.0:0.0:0.0:0.0	.	479;475	A8K1K0;Q8NAB2	.;KBTB3_HUMAN	H	400;479;479	ENSP00000431910:Y400H;ENSP00000436262:Y479H;ENSP00000432163:Y479H	ENSP00000436262:Y479H	Y	-	1	0	KBTBD3	105429191	1.000000	0.71417	0.968000	0.41197	0.748000	0.42578	8.962000	0.93254	2.287000	0.76781	0.482000	0.46254	TAC		0.358	KBTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388705.2	NM_152433	
AICDA	57379	broad.mit.edu	37	12	8758025	8758025	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr12:8758025G>T	ENST00000229335.6	-	3	316	c.213C>A	c.(211-213)gaC>gaA	p.D71E	AICDA_ENST00000537228.1_Missense_Mutation_p.D71E	NM_020661.2	NP_065712.1	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	71					B cell differentiation (GO:0030183)|cellular response to lipopolysaccharide (GO:0071222)|DNA demethylation (GO:0080111)|isotype switching (GO:0045190)|mRNA processing (GO:0006397)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|somatic diversification of immunoglobulins (GO:0016445)|somatic hypermutation of immunoglobulin genes (GO:0016446)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D71E(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)	16	Lung SC(5;0.184)					AGCGGCCAGGGTCTAGGTCCC	0.582																																					p.D71E	GBM(62;896 1067 5527 26594 30137)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C213A	12						.						51.0	56.0	55.0					12																	8758025		2097	4234	6331	8649292	SO:0001583	missense	57379	exon3			AB040430	CCDS41747.1	12p13	2014-09-17			ENSG00000111732	ENSG00000111732		"""Apolipoprotein B mRNA editing enzymes"""	13203	protein-coding gene	gene with protein product		605257					Standard	NM_020661		Approved	HIGM2, CDA2, ARP2, AID	uc001qur.2	Q9GZX7	OTTHUMG00000168676	ENST00000229335.6:c.213C>A	12.37:g.8758025G>T	ENSP00000229335:p.Asp71Glu		8649292	NM_020661	Q6QJ81|Q8NFC1	Missense_Mutation	SNP	ENST00000229335.6	37	CCDS41747.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.5|21.5	4.155206|4.155206	0.78114|0.78114	.|.	.|.	ENSG00000111732|ENSG00000111732	ENST00000229335;ENST00000537228|ENST00000543081;ENST00000545512	T;T|.	0.65916|.	-0.18;-0.18|.	5.43|5.43	3.26|3.26	0.37387|0.37387	APOBEC-like, N-terminal (1);APOBEC/CMP deaminase, zinc-binding (1);Cytidine deaminase-like (1);|.	0.086880|.	0.85682|.	D|.	0.000000|.	T|T	0.70193|0.70193	0.3196|0.3196	M|M	0.71871|0.71871	2.18|2.18	0.49798|0.49798	D|D	0.999827|0.999827	D;D;D|.	0.57571|.	0.98;0.98;0.98|.	P;P;P|.	0.55713|.	0.782;0.721;0.782|.	T|T	0.70342|0.70342	-0.4898|-0.4898	10|5	0.87932|.	D|.	0|.	-33.1432|-33.1432	11.993|11.993	0.53186|0.53186	0.1703:0.0:0.8297:0.0|0.1703:0.0:0.8297:0.0	.|.	71;71;71|.	Q9GZX7;Q6QJ80;Q6QJ81|.	AICDA_HUMAN;.;.|.	E|N	71|70	ENSP00000229335:D71E;ENSP00000445691:D71E|.	ENSP00000229335:D71E|.	D|T	-|-	3|2	2|0	AICDA|AICDA	8649292|8649292	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.851000|0.851000	0.48451|0.48451	2.602000|2.602000	0.46257|0.46257	1.288000|1.288000	0.44600|0.44600	0.462000|0.462000	0.41574|0.41574	GAC|ACC		0.582	AICDA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400575.1	NM_020661	
ESPL1	9700	broad.mit.edu	37	12	53682998	53682998	+	Silent	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr12:53682998G>A	ENST00000257934.4	+	21	4924	c.4833G>A	c.(4831-4833)cgG>cgA	p.R1611R	ESPL1_ENST00000552462.1_Silent_p.R1611R	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1611					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.R1611R(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						TGGGCCACCGGGATCCTTATG	0.602																																					p.R1611R	Colon(53;1069 1201 2587 5382)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4833A	12						.						143.0	136.0	138.0					12																	53682998		2203	4300	6503	51969265	SO:0001819	synonymous_variant	9700	exon21			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.4833G>A	12.37:g.53682998G>A			51969265	NM_012291		Silent	SNP	ENST00000257934.4	37	CCDS8852.1																																																																																				0.602	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
MAP3K12	7786	broad.mit.edu	37	12	53880256	53880256	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr12:53880256C>T	ENST00000267079.2	-	4	722	c.497G>A	c.(496-498)cGa>cAa	p.R166Q	MAP3K12_ENST00000547151.1_5'UTR|MAP3K12_ENST00000547035.1_Missense_Mutation_p.R199Q|MAP3K12_ENST00000547488.1_Missense_Mutation_p.R199Q	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	166	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.R166Q(1)		NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						CTTCAGCTTTCGCAAGTGCTT	0.587																																					p.R199Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G596A	12						.						159.0	118.0	132.0					12																	53880256		2203	4300	6503	52166523	SO:0001583	missense	7786	exon3			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.497G>A	12.37:g.53880256C>T	ENSP00000267079:p.Arg166Gln		52166523	NM_001193511	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	37	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979391	0.92982	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	D;D;D	0.82803	-1.65;-1.65;-1.65	5.36	5.36	0.76844	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.36972	N	0.002310	D	0.83691	0.5309	N	0.21583	0.68	0.80722	D	1	D;D	0.61080	0.987;0.989	P;P	0.58077	0.742;0.832	D	0.85468	0.1171	10	0.59425	D	0.04	.	18.2434	0.89977	0.0:1.0:0.0:0.0	.	199;166	G3V1Y2;Q12852	.;M3K12_HUMAN	Q	166;199;199	ENSP00000267079:R166Q;ENSP00000449038:R199Q;ENSP00000448689:R199Q	ENSP00000267079:R166Q	R	-	2	0	MAP3K12	52166523	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.089000	0.71384	2.688000	0.91661	0.561000	0.74099	CGA		0.587	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
DTX1	1840	broad.mit.edu	37	12	113515329	113515329	+	Silent	SNP	C	C	A	rs201802722		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr12:113515329C>A	ENST00000257600.3	+	2	863	c.360C>A	c.(358-360)gcC>gcA	p.A120A		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	120	WWE 2. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A120A(3)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CATGGACGGCCTACGATATGG	0.627																																					p.A120A												.	.	3	Substitution - coding silent(3)	large_intestine(1)|kidney(1)|endometrium(1)	c.C360A	12						.						97.0	77.0	84.0					12																	113515329		2203	4300	6503	111999712	SO:0001819	synonymous_variant	1840	exon2			AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.360C>A	12.37:g.113515329C>A			111999712	NM_004416	O60630|Q9BS04	Silent	SNP	ENST00000257600.3	37	CCDS9164.1																																																																																				0.627	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
FOXO1	2308	broad.mit.edu	37	13	41134890	41134890	+	Silent	SNP	G	G	A	rs374399783		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr13:41134890G>A	ENST00000379561.5	-	2	1122	c.738C>T	c.(736-738)agC>agT	p.S246S	FOXO1_ENST00000473775.1_5'Flank	NM_002015.3	NP_002006.2	Q12778	FOXO1_HUMAN	forkhead box O1	246					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blood vessel development (GO:0001568)|cellular glucose homeostasis (GO:0001678)|cellular response to cold (GO:0070417)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hyperoxia (GO:0071455)|cellular response to insulin stimulus (GO:0032869)|cellular response to nitric oxide (GO:0071732)|cellular response to oxidative stress (GO:0034599)|cellular response to starvation (GO:0009267)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|regulation of cell proliferation (GO:0042127)|regulation of energy homeostasis (GO:2000505)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|protein phosphatase 2A binding (GO:0051721)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)	p.S246S(2)	PAX7/FOXO1(197)|PAX3/FOXO1(749)	central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	20		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)		GAGATTTCCCGCTCTTGCCAC	0.478																																					p.S246S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C738T	13						.	G		1,4405	2.1+/-5.4	0,1,2202	92.0	94.0	93.0		738	-6.3	0.7	13		93	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FOXO1	NM_002015.3		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		246/656	41134890	2,13004	2203	4300	6503	40032890	SO:0001819	synonymous_variant	2308	exon2				CCDS9371.1	13q14.1	2011-08-01	2007-05-02	2007-05-02	ENSG00000150907	ENSG00000150907		"""Forkhead boxes"""	3819	protein-coding gene	gene with protein product		136533	"""forkhead homolog in rhabdomyosarcoma"""	FKHR, FOXO1A		8275086, 15057823	Standard	NM_002015		Approved	FKH1	uc001uxl.4	Q12778	OTTHUMG00000016775	ENST00000379561.5:c.738C>T	13.37:g.41134890G>A			40032890	NM_002015	O43523|Q5VYC7|Q6NSK6	Silent	SNP	ENST00000379561.5	37	CCDS9371.1																																																																																				0.478	FOXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044634.3	NM_002015	
MRPS31	10240	broad.mit.edu	37	13	41345272	41345273	+	Start_Codon_SNP	DNP	TC	TC	GA			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	TC	TC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr13:41345272_41345273TC>GA	ENST00000323563.6	-	1	36_37	c.0_1GA>TC	c.(-2-3)gcGAtg>gcTCtg	p.0_1insAL		NM_005830.3	NP_005821.2	Q92665	RT31_HUMAN	mitochondrial ribosomal protein S31	0						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|structural constituent of ribosome (GO:0003735)	p.?(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)		CTAGGAAACATCGCCGAGACAC	0.589																																					.												.	.	2	Unknown(2)	large_intestine(2)	c.0_1TC	13						.																																			40243273	SO:0001582	initiator_codon_variant	10240	exon1			Z68747	CCDS9372.1	13q14.11	2012-09-13			ENSG00000102738	ENSG00000102738		"""Mitochondrial ribosomal proteins / small subunits"""	16632	protein-coding gene	gene with protein product		611992				11279123, 8567980	Standard	NM_005830		Approved	IMOGN38	uc001uxm.4	Q92665	OTTHUMG00000016777	ENST00000323563.6:c.1_1delinsGA	13.37:g.41345272_41345273delinsGA	Exception_encountered		40243272	NM_005830	B2RCS3|Q5VYC8|Q8WTV8	Translation_Start_Site	DNP	ENST00000323563.6	37	CCDS9372.1																																																																																				0.589	MRPS31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044640.2		Missense_Mutation
NALCN	259232	broad.mit.edu	37	13	101759892	101759892	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr13:101759892C>T	ENST00000251127.6	-	22	2606	c.2525G>A	c.(2524-2526)cGa>cAa	p.R842Q		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	842					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.R842Q(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CCTGTGTTCTCGCCCGACAAT	0.498																																					p.R842Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2525A	13						.						145.0	127.0	133.0					13																	101759892		2203	4300	6503	100557893	SO:0001583	missense	259232	exon22			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2525G>A	13.37:g.101759892C>T	ENSP00000251127:p.Arg842Gln		100557893	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.969700	0.92855	.	.	ENSG00000102452	ENST00000251127	D	0.97870	-4.58	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.98560	0.9519	M	0.77103	2.36	0.80722	D	1	D	0.76494	0.999	D	0.64237	0.923	D	0.99267	1.0892	10	0.62326	D	0.03	.	19.6572	0.95847	0.0:1.0:0.0:0.0	.	842	Q8IZF0	NALCN_HUMAN	Q	842	ENSP00000251127:R842Q	ENSP00000251127:R842Q	R	-	2	0	NALCN	100557893	1.000000	0.71417	0.167000	0.22817	0.582000	0.36321	7.731000	0.84895	2.630000	0.89119	0.650000	0.86243	CGA		0.498	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
PDE8A	5151	broad.mit.edu	37	15	85656642	85656642	+	Silent	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr15:85656642G>A	ENST00000310298.4	+	14	1401	c.1149G>A	c.(1147-1149)cgG>cgA	p.R383R	PDE8A_ENST00000394553.1_Silent_p.R383R|PDE8A_ENST00000557957.1_Silent_p.R311R|PDE8A_ENST00000339708.5_Silent_p.R337R			O60658	PDE8A_HUMAN	phosphodiesterase 8A	383					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R383R(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	CCATGGCCCGGATACATTCCA	0.517																																					p.R383R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1149A	15						.						166.0	138.0	148.0					15																	85656642		2203	4299	6502	83457646	SO:0001819	synonymous_variant	5151	exon13			AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.1149G>A	15.37:g.85656642G>A			83457646	NM_002605	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Silent	SNP	ENST00000310298.4	37	CCDS10336.1																																																																																				0.517	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605	
SPECC1	92521	broad.mit.edu	37	17	20000031	20000031	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr17:20000031C>T	ENST00000261503.5	+	2	118	c.67C>T	c.(67-69)Cgg>Tgg	p.R23W	SPECC1_ENST00000395527.4_Missense_Mutation_p.R23W|SPECC1_ENST00000395529.3_Missense_Mutation_p.R23W|SPECC1_ENST00000472876.1_Intron	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	23					cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.R23W(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		AGACCGGGTGCGGCCTCTGCC	0.582																																					p.R23W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C67T	17						.						64.0	72.0	69.0					17																	20000031		2203	4300	6503	19940623	SO:0001583	missense	92521	exon2			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.67C>T	17.37:g.20000031C>T	ENSP00000261503:p.Arg23Trp		19940623	NM_152904	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343619	0.61073	.	.	ENSG00000128487	ENST00000395530;ENST00000413167;ENST00000261503;ENST00000395529	T;T	0.67345	-0.26;2.71	5.06	5.06	0.68205	.	0.414784	0.20885	N	0.083922	T	0.74824	0.3767	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.67231	0.95;0.857	T	0.76729	-0.2852	10	0.87932	D	0	-20.2255	14.2857	0.66245	0.0:1.0:0.0:0.0	.	23;23	Q5M775-2;Q5M775	.;CYTSB_HUMAN	W	23	ENSP00000261503:R23W;ENSP00000378900:R23W	ENSP00000261503:R23W	R	+	1	2	SPECC1	19940623	0.981000	0.34729	0.941000	0.38009	0.002000	0.02628	2.716000	0.47219	2.540000	0.85666	0.563000	0.77884	CGG		0.582	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
GSG2	83903	broad.mit.edu	37	17	3628123	3628124	+	Missense_Mutation	DNP	CT	CT	TC			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr17:3628123_3628124CT>TC	ENST00000325418.4	+	1	913_914	c.894_895CT>TC	c.(892-897)gaCTct>gaTCct	p.S299P	ITGAE_ENST00000571185.1_Intron|CTD-3195I5.3_ENST00000571741.1_RNA|ITGAE_ENST00000263087.4_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	299					histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)	p.D298>?(1)									CAGGCCAGGACTCTTGTCAAGA	0.569																																					.												.	.	1	Complex(1)	large_intestine(1)	c.894_895TC	17						.																																			3574873	SO:0001583	missense	83903	exon1			AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	Exception_encountered	17.37:g.3628123_3628124delinsTC	ENSP00000325290:p.Ser299Pro		3574872	NM_031965	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	DNP	ENST00000325418.4	37	CCDS11036.1																																																																																				0.569	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965	
ASIC2	40	broad.mit.edu	37	17	31416002	31416002	+	Missense_Mutation	SNP	G	G	A	rs147403420		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr17:31416002G>A	ENST00000359872.6	-	3	1474	c.713C>T	c.(712-714)aCg>aTg	p.T238M	ASIC2_ENST00000448983.1_5'UTR|ASIC2_ENST00000225823.2_Missense_Mutation_p.T289M	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	238					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)	p.T289M(1)|p.T238M(1)								Amiloride(DB00594)	TTCAAATGTCGTTTCCTCTGA	0.493																																					p.T289M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C866T	17						.	G	MET/THR,MET/THR	0,4406		0,0,2203	86.0	76.0	80.0		713,866	5.1	1.0	17	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	ACCN1	NM_001094.4,NM_183377.1	81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	238/513,289/564	31416002	1,13005	2203	4300	6503	28440115	SO:0001583	missense	40	exon3			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.713C>T	17.37:g.31416002G>A	ENSP00000352934:p.Thr238Met		28440115	NM_183377	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.886341	0.72410	0.0	1.16E-4	ENSG00000108684	ENST00000225823;ENST00000359872;ENST00000448983	T;T	0.70164	-0.24;-0.46	5.12	5.12	0.69794	.	0.052108	0.85682	D	0.000000	D	0.84456	0.5476	M	0.90252	3.1	0.58432	D	0.999999	D;D	0.89917	1.0;0.998	D;D	0.70227	0.968;0.95	D	0.87871	0.2671	10	0.62326	D	0.03	-5.1503	16.0262	0.80548	0.0:0.0:1.0:0.0	.	238;289	Q16515;E9PBX2	ACCN1_HUMAN;.	M	289;238;44	ENSP00000225823:T289M;ENSP00000352934:T238M	ENSP00000225823:T289M	T	-	2	0	ACCN1	28440115	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.769000	0.74985	1.928000	0.55862	0.260000	0.18958	ACG		0.493	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
G6PC3	92579	broad.mit.edu	37	17	42152707	42152707	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr17:42152707C>T	ENST00000269097.4	+	5	796	c.565C>T	c.(565-567)Cga>Tga	p.R189*		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	189			R -> Q (in SCN4; dbSNP:rs140294222). {ECO:0000269|PubMed:20220065}.		carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)	p.R189*(1)		endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GATGACTCCCCGAGTGCCTAT	0.597																																					p.R189X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C565T	17						.						108.0	96.0	100.0					17																	42152707		2203	4300	6503	39508233	SO:0001587	stop_gained	92579	exon5			BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.565C>T	17.37:g.42152707C>T	ENSP00000269097:p.Arg189*		39508233	NM_138387	Q8WU15	Nonsense_Mutation	SNP	ENST00000269097.4	37	CCDS11476.1	.	.	.	.	.	.	.	.	.	.	C	37	6.021208	0.97211	.	.	ENSG00000141349	ENST00000269097	.	.	.	5.27	4.3	0.51218	.	0.694222	0.14365	N	0.324157	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.3508	11.1556	0.48486	0.0:0.9139:0.0:0.0861	.	.	.	.	X	189	.	ENSP00000269097:R189X	R	+	1	2	G6PC3	39508233	0.260000	0.24053	0.969000	0.41365	0.892000	0.51952	2.643000	0.46604	1.471000	0.48121	-0.251000	0.11542	CGA		0.597	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457675.1	NM_138387	
TP53	7157	broad.mit.edu	37	17	7576881	7576881	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr17:7576881delG	ENST00000269305.4	-	9	1154	c.965delC	c.(964-966)ccafs	p.P322fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.P322fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Frame_Shift_Del_p.P322fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.P322fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.P322fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	322	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.		P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.P322fs*23(2)|p.P322L(2)|p.P322R(2)|p.P318fs*21(1)|p.S315fs*22(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCATCCAGTGGTTTCTTCTT	0.458		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.P322fs	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	17	Whole gene deletion(8)|Substitution - Missense(4)|Deletion - Frameshift(4)|Unknown(1)	bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|peritoneum(1)|stomach(1)|lung(1)|skin(1)	c.965delC	17						.						130.0	120.0	124.0					17																	7576881		2203	4300	6503	7517606	SO:0001589	frameshift_variant	7157	exon9	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.965delC	17.37:g.7576881delG	ENSP00000269305:p.Pro322fs		7517606	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																				0.458	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CCDC103	388389	broad.mit.edu	37	17	42979874	42979874	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr17:42979874G>A	ENST00000417826.2	+	4	513	c.418G>A	c.(418-420)Gga>Aga	p.G140R	EFTUD2_ENST00000426333.2_5'Flank|FAM187A_ENST00000331733.4_5'UTR|FAM187A_ENST00000412523.2_Intron|CCDC103_ENST00000410006.2_Missense_Mutation_p.G140R|AC015936.3_ENST00000441312.1_RNA	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	140					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)	p.G140R(1)		endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				GACAGATGTGGGATTTGGACT	0.637																																					p.G140R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G418A	17						.						69.0	74.0	73.0					17																	42979874		2203	4300	6503	40335400	SO:0001583	missense	388389	exon4			AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.418G>A	17.37:g.42979874G>A	ENSP00000391692:p.Gly140Arg		40335400	NM_213607	A8K145|B8ZZU0	Missense_Mutation	SNP	ENST00000417826.2	37	CCDS11490.1	.	.	.	.	.	.	.	.	.	.	G	33	5.208257	0.95033	.	.	ENSG00000167131	ENST00000357776;ENST00000417826;ENST00000410006	T;T;T	0.54675	0.56;0.56;0.56	6.16	6.16	0.99307	.	0.108387	0.35378	U	0.003246	T	0.69242	0.3089	M	0.62723	1.935	0.58432	D	0.999995	D	0.76494	0.999	D	0.66602	0.945	T	0.61734	-0.7002	10	0.28530	T	0.3	-7.9395	19.0403	0.92995	0.0:0.0:1.0:0.0	.	140	Q8IW40	CC103_HUMAN	R	140	ENSP00000350420:G140R;ENSP00000391692:G140R;ENSP00000387252:G140R	ENSP00000350420:G140R	G	+	1	0	CCDC103	40335400	1.000000	0.71417	0.992000	0.48379	0.856000	0.48823	7.808000	0.86044	2.937000	0.99478	0.650000	0.86243	GGA		0.637	CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334578.1	NM_213607	
SEC11C	90701	broad.mit.edu	37	18	56819896	56819896	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr18:56819896G>C	ENST00000587834.1	+	3	798	c.326G>C	c.(325-327)aGa>aCa	p.R109T	SEC11C_ENST00000588875.1_Missense_Mutation_p.R109T	NM_033280.2	NP_150596.1	Q9BY50	SC11C_HUMAN	SEC11 homolog C (S. cerevisiae)	109					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	serine-type peptidase activity (GO:0008236)	p.R109T(1)		endometrium(1)|large_intestine(4)|liver(2)|lung(2)	9		Colorectal(73;0.175)				ATAGTTCACAGAGTAATCAAA	0.358																																					p.R109T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G326C	18						.						76.0	80.0	79.0					18																	56819896		2203	4300	6503	54970876	SO:0001583	missense	90701	exon3			AF212233	CCDS11970.1	18q21.32	2006-11-07	2006-11-07	2006-11-07	ENSG00000166562	ENSG00000166562			23400	protein-coding gene	gene with protein product			"""SEC11-like 3 (S. cerevisiae)"""	SEC11L3			Standard	NM_033280		Approved	SPC21, SPCS4C	uc002lht.3	Q9BY50	OTTHUMG00000132762	ENST00000587834.1:c.326G>C	18.37:g.56819896G>C	ENSP00000468633:p.Arg109Thr		54970876	NM_033280	B2RAA3	Missense_Mutation	SNP	ENST00000587834.1	37	CCDS11970.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875716	0.91664	.	.	ENSG00000166562	ENST00000299714;ENST00000509791	.	.	.	5.48	5.48	0.80851	Peptidase S24/S26A/S26B/S26C (1);Peptidase S24/S26A/S26B/S26C, beta-ribbon domain (1);Peptidase S24/S26A/S26B (1);	0.069820	0.64402	N	0.000014	D	0.92519	0.7624	H	0.99909	4.93	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.96128	0.9090	9	0.87932	D	0	-20.7696	18.9821	0.92758	0.0:0.0:1.0:0.0	.	109	Q9BY50	SC11C_HUMAN	T	109	.	ENSP00000299714:R109T	R	+	2	0	SEC11C	54970876	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.572000	0.86782	0.655000	0.94253	AGA		0.358	SEC11C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256134.2	NM_033280	
ARHGAP33	115703	broad.mit.edu	37	19	36269256	36269256	+	Silent	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr19:36269256C>T	ENST00000007510.4	+	4	408	c.264C>T	c.(262-264)acC>acT	p.T88T	ARHGAP33_ENST00000221905.1_3'UTR|ARHGAP33_ENST00000314737.5_Silent_p.T88T|ARHGAP33_ENST00000378944.5_5'UTR			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	88	PX; atypical.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)	p.T88T(1)		endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						TGCAGGTGACCTGTCAGGTGA	0.617																																					p.T88T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C264T	19						.						82.0	80.0	81.0					19																	36269256		2203	4300	6503	40961096	SO:0001819	synonymous_variant	115703	exon4			AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.264C>T	19.37:g.36269256C>T			40961096	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Silent	SNP	ENST00000007510.4	37																																																																																					0.617	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
MYH14	79784	broad.mit.edu	37	19	50779258	50779258	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr19:50779258G>A	ENST00000596571.1	+	25	3355	c.3355G>A	c.(3355-3357)Gag>Aag	p.E1119K	MYH14_ENST00000425460.1_Missense_Mutation_p.E1127K|MYH14_ENST00000262269.8_Missense_Mutation_p.E1160K|MYH14_ENST00000376970.2_Missense_Mutation_p.E1152K|MYH14_ENST00000601313.1_Missense_Mutation_p.E1160K|MYH14_ENST00000598205.1_Missense_Mutation_p.E1127K|MYH14_ENST00000440075.2_Missense_Mutation_p.E1160K			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1119					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.E1119K(1)|p.E1160K(1)		central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GGCAGAAGACGAGGGTGGGGC	0.642																																					p.E1127K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3379A	19						.						13.0	16.0	15.0					19																	50779258		1897	4112	6009	55471070	SO:0001583	missense	79784	exon27			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.3355G>A	19.37:g.50779258G>A	ENSP00000472819:p.Glu1119Lys		55471070	NM_001077186	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672546	0.88348	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7	4.53	4.53	0.55603	Myosin tail (1);	.	.	.	.	D	0.90525	0.7031	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.984;0.991;0.97	D	0.91794	0.5446	9	0.72032	D	0.01	.	15.1363	0.72569	0.0:0.0:1.0:0.0	.	1160;1119;1127	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	K	1119;1160;1152;1127;1119;1160	ENSP00000406273:E1160K;ENSP00000366169:E1152K;ENSP00000407879:E1127K;ENSP00000262269:E1160K	ENSP00000262269:E1160K	E	+	1	0	MYH14	55471070	1.000000	0.71417	0.946000	0.38457	0.734000	0.41952	8.667000	0.91153	2.255000	0.74692	0.455000	0.32223	GAG		0.642	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
ZNF528	84436	broad.mit.edu	37	19	52919382	52919382	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr19:52919382G>A	ENST00000360465.3	+	7	1703	c.1277G>A	c.(1276-1278)cGa>cAa	p.R426Q	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R426Q(1)		breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		GACCTTATACGACATCGAAAA	0.393																																					p.R426Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1277A	19						.						77.0	78.0	78.0					19																	52919382		2203	4300	6503	57611194	SO:0001583	missense	84436	exon7			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1277G>A	19.37:g.52919382G>A	ENSP00000353652:p.Arg426Gln		57611194	NM_032423	B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	ENST00000360465.3	37	CCDS33091.1	.	.	.	.	.	.	.	.	.	.	G	1.969	-0.436942	0.04636	.	.	ENSG00000167555	ENST00000360465	T	0.26223	1.75	1.81	-3.4	0.04853	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12518	0.0304	L	0.56340	1.77	0.09310	N	1	P	0.37955	0.612	B	0.17433	0.018	T	0.25606	-1.0127	9	0.20519	T	0.43	.	1.0203	0.01516	0.2734:0.1666:0.3928:0.1672	.	426	Q3MIS6	ZN528_HUMAN	Q	426	ENSP00000353652:R426Q	ENSP00000353652:R426Q	R	+	2	0	ZNF528	57611194	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-11.162000	0.00004	-0.328000	0.08539	-0.768000	0.03414	CGA		0.393	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	NM_032423	
ZNF264	9422	broad.mit.edu	37	19	57723880	57723880	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr19:57723880G>T	ENST00000263095.6	+	4	1829	c.1415G>T	c.(1414-1416)cGc>cTc	p.R472L	ZNF264_ENST00000536056.1_Missense_Mutation_p.R472L	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	472					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R472L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		GACCTCATTCGCCACTTCAGC	0.522																																					p.R472L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1415T	19						.						64.0	64.0	64.0					19																	57723880		2203	4300	6503	62415692	SO:0001583	missense	9422	exon4			AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1415G>T	19.37:g.57723880G>T	ENSP00000263095:p.Arg472Leu		62415692	NM_003417	A8K8Y9|Q9P1V0	Missense_Mutation	SNP	ENST00000263095.6	37	CCDS33127.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.943229	0.34283	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.07444	3.19;3.19	2.35	1.23	0.21249	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18593	0.0446	M	0.65498	2.005	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.19418	-1.0306	9	0.21540	T	0.41	.	3.2298	0.06745	0.2775:0.2249:0.4976:0.0	.	472	O43296	ZN264_HUMAN	L	472	ENSP00000263095:R472L;ENSP00000440376:R472L	ENSP00000263095:R472L	R	+	2	0	ZNF264	62415692	0.000000	0.05858	0.502000	0.27614	0.776000	0.43924	-1.628000	0.02031	0.530000	0.28619	0.491000	0.48974	CGC		0.522	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1		
KCND3	3752	broad.mit.edu	37	1	112524738	112524738	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr1:112524738G>A	ENST00000315987.2	-	2	1090	c.611C>T	c.(610-612)aCg>aTg	p.T204M	KCND3_ENST00000302127.4_Missense_Mutation_p.T204M|KCND3_ENST00000369697.1_Missense_Mutation_p.T204M	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	204					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.T204M(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GCACGGCACCGTCTCCACCAC	0.647																																					p.T204M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C611T	1						.						33.0	32.0	32.0					1																	112524738		2203	4300	6503	112326261	SO:0001583	missense	3752	exon2			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.611C>T	1.37:g.112524738G>A	ENSP00000319591:p.Thr204Met		112326261	NM_004980	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	ENST00000315987.2	37	CCDS843.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226236	0.79576	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.97791	-4.54;-4.54;-4.54	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.99130	0.9700	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99517	1.0957	10	0.87932	D	0	.	18.9981	0.92821	0.0:0.0:1.0:0.0	.	204;204	Q14D71;Q9UK17	.;KCND3_HUMAN	M	204	ENSP00000358711:T204M;ENSP00000319591:T204M;ENSP00000306923:T204M	ENSP00000306923:T204M	T	-	2	0	KCND3	112326261	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.590000	0.87494	0.563000	0.77884	ACG		0.647	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
SEMA6C	10500	broad.mit.edu	37	1	151109040	151109040	+	Silent	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr1:151109040G>A	ENST00000341697.3	-	12	2681	c.990C>T	c.(988-990)gcC>gcT	p.A330A				Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	330	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.A330A(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGGCGCAGACGGCAGAGCCAG	0.562																																					p.A330A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C990T	1						.						106.0	107.0	106.0					1																	151109040		2203	4300	6503	149375664	SO:0001819	synonymous_variant	10500	exon12			AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.990C>T	1.37:g.151109040G>A			149375664	NM_001178061	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Silent	SNP	ENST00000341697.3	37	CCDS984.1																																																																																				0.562	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	
NTRK1	4914	broad.mit.edu	37	1	156849818	156849818	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr1:156849818C>T	ENST00000524377.1	+	16	2115	c.2074C>T	c.(2074-2076)Cgc>Tgc	p.R692C	NTRK1_ENST00000531606.1_3'UTR|NTRK1_ENST00000358660.3_Missense_Mutation_p.R689C|NTRK1_ENST00000392302.2_Missense_Mutation_p.R656C|NTRK1_ENST00000368196.3_Missense_Mutation_p.R686C	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	692	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R692C(1)|p.R656C(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GCTGCCCATTCGCTGGATGCC	0.647			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.R686C			Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2056T	1						.						56.0	55.0	55.0					1																	156849818		2203	4300	6503	155116442	SO:0001583	missense	4914	exon15			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.2074C>T	1.37:g.156849818C>T	ENSP00000431418:p.Arg692Cys		155116442	NM_001012331	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958507	0.92726	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	4.23	4.23	0.50019	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000028	D	0.90789	0.7108	M	0.87758	2.905	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.986;0.998	D	0.92340	0.5881	10	0.87932	D	0	.	15.7052	0.77573	0.0:1.0:0.0:0.0	.	689;686;692;656	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	C	656;686;692;689	ENSP00000376120:R656C;ENSP00000357179:R686C;ENSP00000431418:R692C;ENSP00000351486:R689C	ENSP00000351486:R689C	R	+	1	0	NTRK1	155116442	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.330000	0.79181	2.362000	0.80069	0.561000	0.74099	CGC		0.647	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
ASTN1	460	broad.mit.edu	37	1	177001756	177001756	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr1:177001756C>T	ENST00000367654.3	-	3	912	c.701G>A	c.(700-702)cGg>cAg	p.R234Q	ASTN1_ENST00000361833.2_Missense_Mutation_p.R234Q|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Missense_Mutation_p.R234Q|ASTN1_ENST00000367657.3_Missense_Mutation_p.R234Q	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	234					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R234Q(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AGGTGTCTCCCGGATGCTCAG	0.602																																					p.R234Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G701A	1						.						134.0	94.0	108.0					1																	177001756		2203	4300	6503	175268379	SO:0001583	missense	460	exon3			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.701G>A	1.37:g.177001756C>T	ENSP00000356626:p.Arg234Gln		175268379	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	C	28.0	4.879948	0.91740	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.24723	1.84;2.25;2.24;1.85	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.997	D;D;D	0.77557	0.99;0.964;0.964	T	0.33214	-0.9877	10	0.87932	D	0	-21.4735	19.2616	0.93970	0.0:1.0:0.0:0.0	.	234;234;234	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	Q	234	ENSP00000356629:R234Q;ENSP00000354536:R234Q;ENSP00000356626:R234Q;ENSP00000395041:R234Q	ENSP00000354536:R234Q	R	-	2	0	ASTN1	175268379	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.345000	0.79337	2.614000	0.88457	0.655000	0.94253	CGG		0.602	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
CAMTA1	23261	broad.mit.edu	37	1	7724441	7724441	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr1:7724441C>T	ENST00000303635.7	+	9	2041	c.1834C>T	c.(1834-1836)Ccc>Tcc	p.P612S	CAMTA1_ENST00000439411.2_Missense_Mutation_p.P612S	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	612					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P612S(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CCACCAGACCCCCTCCCCGAG	0.637			T	WWTR1	epitheliod hemangioendothelioma																																p.P612S			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1834T	1						.						72.0	86.0	81.0					1																	7724441		2203	4300	6503	7647028	SO:0001583	missense	23261	exon9			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.1834C>T	1.37:g.7724441C>T	ENSP00000306522:p.Pro612Ser		7647028	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	c	13.94	2.385717	0.42308	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.19669	2.13;2.13	5.12	5.12	0.69794	.	0.063133	0.64402	D	0.000003	T	0.18923	0.0454	L	0.34521	1.04	0.49483	D	0.999794	P	0.43094	0.799	B	0.40066	0.318	T	0.03130	-1.1069	10	0.19147	T	0.46	-11.3038	18.5592	0.91094	0.0:1.0:0.0:0.0	.	612	Q9Y6Y1	CMTA1_HUMAN	S	612	ENSP00000306522:P612S;ENSP00000402561:P612S	ENSP00000306522:P612S	P	+	1	0	CAMTA1	7647028	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.709000	0.84645	2.408000	0.81797	0.498000	0.49722	CCC		0.637	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
C8A	731	broad.mit.edu	37	1	57383376	57383376	+	Missense_Mutation	SNP	C	C	T	rs143726641	byFrequency	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr1:57383376C>T	ENST00000361249.3	+	11	1838	c.1742C>T	c.(1741-1743)aCg>aTg	p.T581M		NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	581	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)		p.T581M(1)|p.T581K(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						AAAGTACAGACGCAGGCTTGC	0.537													C|||	3	0.000599042	0.0	0.0	5008	,	,		17869	0.0		0.003	False		,,,				2504	0.0				p.T581M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1742T	1						.	C	MET/THR	0,4406		0,0,2203	52.0	52.0	52.0		1742	2.9	0.5	1	dbSNP_134	52	1,8599	1.2+/-3.3	0,1,4299	yes	missense	C8A	NM_000562.2	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	581/585	57383376	1,13005	2203	4300	6503	57155964	SO:0001583	missense	731	exon11			M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1742C>T	1.37:g.57383376C>T	ENSP00000354458:p.Thr581Met		57155964	NM_000562	A2RUI4|A2RUI5|Q13668|Q9H130	Missense_Mutation	SNP	ENST00000361249.3	37	CCDS606.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	15.25	2.778938	0.49891	0.0	1.16E-4	ENSG00000157131	ENST00000361249	T	0.58652	0.32	4.82	2.86	0.33363	.	0.335476	0.36268	N	0.002698	T	0.75072	0.3800	M	0.86740	2.835	0.31674	N	0.643969	D	0.89917	1.0	D	0.76071	0.987	T	0.77978	-0.2384	10	0.62326	D	0.03	-20.7724	9.1602	0.37019	0.0:0.7117:0.1964:0.0919	.	581	P07357	CO8A_HUMAN	M	581	ENSP00000354458:T581M	ENSP00000354458:T581M	T	+	2	0	C8A	57155964	0.780000	0.28664	0.460000	0.27093	0.003000	0.03518	1.169000	0.31871	1.254000	0.44035	-0.222000	0.12452	ACG		0.537	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022890.1	NM_000562	
SLC44A5	204962	broad.mit.edu	37	1	75685021	75685021	+	Missense_Mutation	SNP	G	G	A	rs202241076		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr1:75685021G>A	ENST00000370855.5	-	16	1300	c.1187C>T	c.(1186-1188)gCg>gTg	p.A396V	SLC44A5_ENST00000535611.1_Missense_Mutation_p.A266V|SLC44A5_ENST00000370859.3_Missense_Mutation_p.A396V	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	396					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A396V(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CCCCGATGTCGCCAAGAAACT	0.393													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17063	0.0		0.0	False		,,,				2504	0.0				p.A396V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1187T	1						.						86.0	80.0	82.0					1																	75685021		2203	4300	6503	75457609	SO:0001583	missense	204962	exon16			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1187C>T	1.37:g.75685021G>A	ENSP00000359892:p.Ala396Val		75457609	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	19.18	3.778685	0.70107	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535611;ENST00000535790	T;T;T	0.22945	1.93;1.93;1.93	5.04	5.04	0.67666	.	0.216170	0.47852	D	0.000216	T	0.40398	0.1115	M	0.83118	2.625	0.80722	D	1	D;D;D;D;D	0.65815	0.99;0.991;0.99;0.995;0.988	P;P;P;P;P	0.57324	0.818;0.745;0.818;0.807;0.629	T	0.24941	-1.0146	10	0.27082	T	0.32	-12.0802	18.7654	0.91869	0.0:0.0:1.0:0.0	.	390;435;396;396;435	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2;F5GYS0	.;.;CTL5_HUMAN;.;.	V	396;435;396;266;389	ENSP00000359896:A396V;ENSP00000359892:A396V;ENSP00000443090:A266V	ENSP00000359892:A396V	A	-	2	0	SLC44A5	75457609	1.000000	0.71417	0.998000	0.56505	0.103000	0.19146	7.142000	0.77339	2.504000	0.84457	0.655000	0.94253	GCG		0.393	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
LPHN2	23266	broad.mit.edu	37	1	82433849	82433849	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr1:82433849A>G	ENST00000370728.1	+	16	3122	c.2477A>G	c.(2476-2478)aAt>aGt	p.N826S	LPHN2_ENST00000370717.2_Missense_Mutation_p.N826S|LPHN2_ENST00000370725.1_Missense_Mutation_p.N826S|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370727.1_Missense_Mutation_p.N826S|LPHN2_ENST00000319517.6_Missense_Mutation_p.N813S|LPHN2_ENST00000359929.3_Missense_Mutation_p.N813S|LPHN2_ENST00000370730.1_Missense_Mutation_p.N826S|LPHN2_ENST00000335786.5_Missense_Mutation_p.N826S|LPHN2_ENST00000370715.1_Missense_Mutation_p.N813S|LPHN2_ENST00000271029.4_Missense_Mutation_p.N826S|LPHN2_ENST00000370723.1_Missense_Mutation_p.N813S|LPHN2_ENST00000394879.1_Missense_Mutation_p.N813S|LPHN2_ENST00000370713.1_Missense_Mutation_p.N813S|LPHN2_ENST00000370721.1_Missense_Mutation_p.N751S			O95490	LPHN2_HUMAN	latrophilin 2	826	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)	p.N813S(1)|p.N826S(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		CACCTAACCAATTTTGCAATT	0.413																																					p.N813S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2438G	1						.						108.0	107.0	107.0					1																	82433849		2203	4300	6503	82206437	SO:0001583	missense	23266	exon12			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.2477A>G	1.37:g.82433849A>G	ENSP00000359763:p.Asn826Ser		82206437	NM_012302	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.41|18.41	3.617558|3.617558	0.66787|0.66787	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000449420|ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.66815	.|-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49440|0.49440	0.1557|0.1557	N|N	0.13168|0.13168	0.305|0.305	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.54397	.|0.851;0.504;0.966	.|P;B;P	.|0.51266	.|0.45;0.227;0.664	T|T	0.58031|0.58031	-0.7708|-0.7708	5|10	.|0.45353	.|T	.|0.12	.|.	15.6195|15.6195	0.76796|0.76796	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|813;813;813	.|O95490-3;O95490-4;O95490-2	.|.;.;.	V|S	694|751;826;826;826;826;813;813;813;813;813;826;813;826;826	.|ENSP00000359756:N751S;ENSP00000359763:N826S;ENSP00000359765:N826S;ENSP00000359762:N826S;ENSP00000359760:N826S;ENSP00000359758:N813S;ENSP00000353006:N813S;ENSP00000359750:N813S;ENSP00000359748:N813S;ENSP00000322270:N813S;ENSP00000359752:N826S;ENSP00000378344:N813S;ENSP00000271029:N826S;ENSP00000337306:N826S	.|ENSP00000271029:N826S	I|N	+|+	1|2	0|0	LPHN2|LPHN2	82206437|82206437	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.339000|9.339000	0.96797|0.96797	2.090000|2.090000	0.63153|0.63153	0.477000|0.477000	0.44152|0.44152	ATT|AAT		0.413	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302	
RGS13	6003	broad.mit.edu	37	1	192628485	192628485	+	Silent	SNP	G	G	C	rs149936703		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr1:192628485G>C	ENST00000391995.2	+	7	600	c.312G>C	c.(310-312)tcG>tcC	p.S104S	RGS13_ENST00000543215.1_Silent_p.S104S|RGS13_ENST00000482095.1_3'UTR	NM_002927.4	NP_002918.1	O14921	RGS13_HUMAN	regulator of G-protein signaling 13	104	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.S104S(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|skin(1)	19						TTGACAGTTCGACAAGAGAGA	0.338																																					p.S104S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G312C	1						.						105.0	86.0	93.0					1																	192628485		2203	4300	6503	190895108	SO:0001819	synonymous_variant	6003	exon6			AF030107	CCDS1376.1	1q31.2	2008-02-05	2007-08-14		ENSG00000127074	ENSG00000127074		"""Regulators of G-protein signaling"""	9995	protein-coding gene	gene with protein product		607190	"""regulator of G-protein signalling 13"""			11875076	Standard	NM_144766		Approved		uc001gsk.3	O14921	OTTHUMG00000035601	ENST00000391995.2:c.312G>C	1.37:g.192628485G>C			190895108	NM_144766	Q6PGR2|Q8TD63|Q9BX45	Silent	SNP	ENST00000391995.2	37	CCDS1376.1																																																																																				0.338	RGS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086400.1	NM_002927	
CFAP61	26074	broad.mit.edu	37	20	20278936	20278936	+	Missense_Mutation	SNP	G	G	A	rs114442015	byFrequency	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr20:20278936G>A	ENST00000245957.5	+	25	3404	c.3328G>A	c.(3328-3330)Gcc>Acc	p.A1110T	C20orf26_ENST00000377309.2_3'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		1110								p.A1110T(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		GCCCTTCCCCGCCTCCAACTA	0.478													G|||	3	0.000599042	0.0	0.0	5008	,	,		17117	0.003		0.0	False		,,,				2504	0.0				p.A1110T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3328A	20						.						71.0	65.0	67.0					20																	20278936		2203	4300	6503	20226936	SO:0001583	missense	26074	exon25																														ENST00000245957.5:c.3328G>A	20.37:g.20278936G>A	ENSP00000245957:p.Ala1110Thr		20226936	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	CCDS33447.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	0.006	-2.027032	0.00410	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.42513	0.97	5.41	-6.65	0.01795	.	0.941209	0.08994	N	0.864006	T	0.19406	0.0466	L	0.42245	1.32	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35649	-0.9780	10	0.09843	T	0.71	.	9.3378	0.38060	0.5337:0.0:0.3747:0.0916	.	1110	Q8NHU2	CT026_HUMAN	T	1050;1076;1110	ENSP00000245957:A1110T	ENSP00000245957:A1110T	A	+	1	0	C20orf26	20226936	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.413000	0.21148	-1.615000	0.01573	-2.870000	0.00099	GCC		0.478	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
CST9	128822	broad.mit.edu	37	20	23584311	23584311	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr20:23584311A>G	ENST00000376971.3	-	2	327	c.316T>C	c.(316-318)Ttt>Ctt	p.F106L		NM_001008693.2	NP_001008693.2	Q5W186	CST9_HUMAN	cystatin 9 (testatin)	106						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.F106L(1)		central_nervous_system(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Colorectal(13;0.0993)					TCATCTTCAAATTTCCTACAT	0.473																																					p.F106L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T316C	20						.						209.0	192.0	198.0					20																	23584311		2203	4300	6503	23532311	SO:0001583	missense	128822	exon2			AF494536	CCDS33450.1	20p11.21	2012-08-14			ENSG00000173335	ENSG00000173335			13261	protein-coding gene	gene with protein product						20565543	Standard	NM_001008693		Approved	CLM, CTES7A	uc002wtl.3	Q5W186	OTTHUMG00000032076	ENST00000376971.3:c.316T>C	20.37:g.23584311A>G	ENSP00000366170:p.Phe106Leu		23532311	NM_001008693	B2RP76|Q8TD53	Missense_Mutation	SNP	ENST00000376971.3	37	CCDS33450.1	.	.	.	.	.	.	.	.	.	.	A	10.21	1.287999	0.23478	.	.	ENSG00000173335	ENST00000376971	T	0.26518	1.73	2.43	-0.016	0.13974	Proteinase inhibitor I25, cystatin (1);	0.243411	0.21639	N	0.071373	T	0.14614	0.0353	L	0.31371	0.925	0.09310	N	1	P	0.35551	0.509	B	0.39119	0.291	T	0.11155	-1.0599	10	0.30078	T	0.28	.	1.9434	0.03352	0.5708:0.0:0.162:0.2672	.	106	Q5W186	CST9_HUMAN	L	106	ENSP00000366170:F106L	ENSP00000366170:F106L	F	-	1	0	CST9	23532311	0.006000	0.16342	0.000000	0.03702	0.009000	0.06853	0.856000	0.27818	-0.042000	0.13535	0.459000	0.35465	TTT		0.473	CST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078341.1	NM_001008693.1	
KRTAP19-6	337973	broad.mit.edu	37	21	31914097	31914097	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr21:31914097C>A	ENST00000334046.5	-	1	86	c.56G>T	c.(55-57)gGt>gTt	p.G19V		NM_181612.2	NP_853643.1	Q3LI70	KR196_HUMAN	keratin associated protein 19-6	19						intermediate filament (GO:0005882)		p.G19V(1)		breast(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	9						GCCCAGACCACCAAAGCCTCC	0.512																																					p.G19V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G56T	21						.						107.0	111.0	110.0					21																	31914097		2203	4300	6503	30835968	SO:0001583	missense	337973	exon1			AP001708	CCDS13598.1	21q22.1	2010-09-30			ENSG00000186925	ENSG00000186925		"""Keratin associated proteins"""	18941	protein-coding gene	gene with protein product						12359730	Standard	NM_181612		Approved	KAP19.6	uc002yok.1	Q3LI70	OTTHUMG00000057779	ENST00000334046.5:c.56G>T	21.37:g.31914097C>A	ENSP00000375107:p.Gly19Val		30835968	NM_181612	Q3LI71	Missense_Mutation	SNP	ENST00000334046.5	37	CCDS13598.1	.	.	.	.	.	.	.	.	.	.	c	7.560	0.664477	0.14710	.	.	ENSG00000186925	ENST00000334046;ENST00000437381	T	0.34275	1.37	4.75	3.84	0.44239	.	0.346542	0.20330	U	0.094453	T	0.44767	0.1309	.	.	.	0.09310	N	0.999998	D	0.55385	0.971	P	0.53518	0.728	T	0.31861	-0.9928	9	0.87932	D	0	.	9.5667	0.39402	0.0:0.8943:0.0:0.1057	.	19	Q3LI70	KR196_HUMAN	V	19	ENSP00000375107:G19V	ENSP00000375107:G19V	G	-	2	0	KRTAP19-6	30835968	0.006000	0.16342	0.022000	0.16811	0.003000	0.03518	2.709000	0.47160	2.379000	0.81126	0.597000	0.82753	GGT		0.512	KRTAP19-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128231.4		
WDR75	84128	broad.mit.edu	37	2	190333287	190333287	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr2:190333287G>A	ENST00000314761.4	+	15	1775	c.1715G>A	c.(1714-1716)aGc>aAc	p.S572N		NM_032168.1	NP_115544.1	Q8IWA0	WDR75_HUMAN	WD repeat domain 75	572						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.S572N(1)		breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			AATCTGCTGAGCTGTGCATGT	0.388																																					p.S572N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1715A	2						.						189.0	168.0	175.0					2																	190333287		2203	4300	6503	190041532	SO:0001583	missense	84128	exon15			AK091546	CCDS2298.1	2q32.2	2013-01-09			ENSG00000115368	ENSG00000115368		"""WD repeat domain containing"""	25725	protein-coding gene	gene with protein product	"""UTP17, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_032168		Approved	FLJ12519, NET16, UTP17	uc002uql.1	Q8IWA0	OTTHUMG00000132660	ENST00000314761.4:c.1715G>A	2.37:g.190333287G>A	ENSP00000314193:p.Ser572Asn		190041532	NM_032168	Q96J10|Q9H8U8|Q9H9U5|Q9H9V8|Q9UIX2	Missense_Mutation	SNP	ENST00000314761.4	37	CCDS2298.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.541722	0.65198	.	.	ENSG00000115368	ENST00000314761	T	0.05081	3.5	4.96	2.98	0.34508	WD40/YVTN repeat-like-containing domain (1);	0.141792	0.64402	D	0.000007	T	0.07548	0.0190	L	0.42245	1.32	0.39813	D	0.972732	P;P	0.40144	0.704;0.704	B;B	0.36719	0.231;0.165	T	0.37244	-0.9714	10	0.45353	T	0.12	-18.3439	16.7274	0.85426	0.0:0.4022:0.5978:0.0	.	572;572	A8K330;Q8IWA0	.;WDR75_HUMAN	N	572	ENSP00000314193:S572N	ENSP00000314193:S572N	S	+	2	0	WDR75	190041532	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.722000	0.47269	1.420000	0.47138	0.655000	0.94253	AGC		0.388	WDR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255913.1	NM_032168	
APOB	338	broad.mit.edu	37	2	21255246	21255246	+	Silent	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr2:21255246C>T	ENST00000233242.1	-	10	1459	c.1332G>A	c.(1330-1332)gcG>gcA	p.A444A	APOB_ENST00000399256.4_Silent_p.A444A	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	444	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.A444A(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGTGGCTCAGCGCATACAAGG	0.547																																					p.A444A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1332A	2						.						85.0	83.0	83.0					2																	21255246		2203	4300	6503	21108751	SO:0001819	synonymous_variant	338	exon10			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1332G>A	2.37:g.21255246C>T			21108751	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																				0.547	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
CYP20A1	57404	broad.mit.edu	37	2	204161223	204161223	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr2:204161223A>C	ENST00000356079.4	+	12	1298	c.1175A>C	c.(1174-1176)gAa>gCa	p.E392A	CYP20A1_ENST00000429815.2_Missense_Mutation_p.E400A|CYP20A1_ENST00000461371.1_3'UTR	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	392						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)	p.E392A(1)		cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						TTTGATGATGAATTAGTAATG	0.368																																					p.E392A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1175C	2						.						104.0	103.0	103.0					2																	204161223		2203	4300	6503	203869468	SO:0001583	missense	57404	exon12			AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.1175A>C	2.37:g.204161223A>C	ENSP00000348380:p.Glu392Ala		203869468	NM_177538	Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Missense_Mutation	SNP	ENST00000356079.4	37	CCDS2357.1	.	.	.	.	.	.	.	.	.	.	A	15.65	2.897211	0.52121	.	.	ENSG00000119004	ENST00000356079;ENST00000421618;ENST00000429815	T;T	0.70749	-0.51;-0.51	5.84	4.67	0.58626	.	0.093790	0.64402	D	0.000001	T	0.67608	0.2911	L	0.56769	1.78	0.50632	D	0.999883	B;B	0.26744	0.158;0.1	B;B	0.29942	0.109;0.098	T	0.64664	-0.6354	10	0.48119	T	0.1	-3.831	12.3351	0.55062	0.8732:0.0:0.0:0.1268	.	400;392	E9PHG5;Q6UW02	.;CP20A_HUMAN	A	392;365;400	ENSP00000348380:E392A;ENSP00000407860:E400A	ENSP00000348380:E392A	E	+	2	0	CYP20A1	203869468	1.000000	0.71417	0.950000	0.38849	0.324000	0.28378	6.302000	0.72788	1.005000	0.39183	-0.468000	0.05107	GAA		0.368	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256328.3	NM_020674	
NHEJ1	79840	broad.mit.edu	37	2	219942889	219942889	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr2:219942889A>C	ENST00000356853.5	-	6	761	c.628T>G	c.(628-630)Ttt>Gtt	p.F210V	NHEJ1_ENST00000409720.1_Missense_Mutation_p.F210V|NHEJ1_ENST00000483627.1_5'UTR	NM_024782.2	NP_079058.1	Q9H9Q4	NHEJ1_HUMAN	nonhomologous end-joining factor 1	210					B cell differentiation (GO:0030183)|central nervous system development (GO:0007417)|DNA recombination (GO:0006310)|double-strand break repair via nonhomologous end joining (GO:0006303)|positive regulation of ligase activity (GO:0051351)|response to ionizing radiation (GO:0010212)|T cell differentiation (GO:0030217)	nonhomologous end joining complex (GO:0070419)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.F210V(1)		kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	12		Renal(207;0.0915)		Epithelial(149;2.15e-06)|all cancers(144;0.000339)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0112)		TTCATGACAAAGGGCTTTCCA	0.493								Non-homologous end-joining																													p.F210V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T628G	2						.						142.0	117.0	125.0					2																	219942889		2203	4300	6503	219651133	SO:0001583	missense	79840	exon6			AJ972687	CCDS2432.1	2q35	2014-09-17			ENSG00000187736	ENSG00000187736			25737	protein-coding gene	gene with protein product		611290				16439204, 16439205	Standard	NM_024782		Approved	Cernunnos, XLF, FLJ12610	uc002vjp.4	Q9H9Q4	OTTHUMG00000133127	ENST00000356853.5:c.628T>G	2.37:g.219942889A>C	ENSP00000349313:p.Phe210Val		219651133	NM_024782	B8ZZA4|Q4ZFW7|Q6IA64|Q96JS9	Missense_Mutation	SNP	ENST00000356853.5	37	CCDS2432.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.339124	0.81911	.	.	ENSG00000187736	ENST00000409720;ENST00000356853;ENST00000426304;ENST00000457600	T;T;T;T	0.68025	-0.06;-0.01;0.04;-0.3	5.04	5.04	0.67666	.	0.000000	0.85682	U	0.000000	T	0.79052	0.4381	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81072	-0.1098	10	0.72032	D	0.01	-9.1619	12.278	0.54747	1.0:0.0:0.0:0.0	.	210	Q9H9Q4	NHEJ1_HUMAN	V	210;210;130;210	ENSP00000387290:F210V;ENSP00000349313:F210V;ENSP00000394896:F130V;ENSP00000407201:F210V	ENSP00000349313:F210V	F	-	1	0	NHEJ1	219651133	0.997000	0.39634	0.998000	0.56505	0.935000	0.57460	4.716000	0.61916	2.119000	0.64992	0.533000	0.62120	TTT		0.493	NHEJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256817.2	NM_024782	
PER2	8864	broad.mit.edu	37	2	239169565	239169565	+	Nonsense_Mutation	SNP	G	G	T	rs200408737	byFrequency	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr2:239169565G>T	ENST00000254657.3	-	13	1725	c.1446C>A	c.(1444-1446)taC>taA	p.Y482*	PER2_ENST00000254658.3_3'UTR	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	482	Important for protein stability. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CCAGACTCCCGTAGCCACTGG	0.657																																					p.Y482X												.	.	0			c.C1446A	2						.																																			238834304	SO:0001587	stop_gained	8864	exon13			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.1446C>A	2.37:g.239169565G>T	ENSP00000254657:p.Tyr482*		238834304	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Nonsense_Mutation	SNP	ENST00000254657.3	37	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	G	39	7.871400	0.98537	.	.	ENSG00000132326	ENST00000254657	.	.	.	4.55	-1.84	0.07809	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-29.4355	9.4064	0.38464	0.5356:0.0:0.4644:0.0	.	.	.	.	X	482	.	ENSP00000254657:Y482X	Y	-	3	2	PER2	238834304	0.001000	0.12720	0.988000	0.46212	0.985000	0.73830	-1.270000	0.02831	-0.393000	0.07739	-0.136000	0.14681	TAC		0.657	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
ROPN1B	152015	broad.mit.edu	37	3	125690980	125690980	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr3:125690980C>A	ENST00000514116.1	+	3	398	c.83C>A	c.(82-84)gCg>gAg	p.A28E	ROPN1B_ENST00000251776.4_Missense_Mutation_p.A28E|ROPN1B_ENST00000511862.1_3'UTR|ROPN1B_ENST00000504401.1_Missense_Mutation_p.A28E			Q9BZX4	ROP1B_HUMAN	rhophilin associated tail protein 1B	28	RIIa.				acrosome reaction (GO:0007340)|cytokinesis (GO:0000910)|fusion of sperm to egg plasma membrane (GO:0007342)|Rho protein signal transduction (GO:0007266)|single organismal cell-cell adhesion (GO:0016337)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor signaling complex scaffold activity (GO:0030159)	p.A28E(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(114;0.151)		GCCATTCGGGCGCAGCCGCAG	0.587																																					p.A28E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C83A	3						.						42.0	46.0	45.0					3																	125690980		2203	4300	6503	127173670	SO:0001583	missense	152015	exon2			AF231410	CCDS33841.1	3q21.2	2011-01-20	2011-01-20		ENSG00000114547	ENSG00000114547			31927	protein-coding gene	gene with protein product			"""ropporin, rhophilin associated protein 1B"""				Standard	XM_005247137		Approved		uc003eih.3	Q9BZX4	OTTHUMG00000162651	ENST00000514116.1:c.83C>A	3.37:g.125690980C>A	ENSP00000426271:p.Ala28Glu		127173670	NM_001012337	D3DNA6|Q96BM7	Missense_Mutation	SNP	ENST00000514116.1	37	CCDS33841.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.476571	0.26511	.	.	ENSG00000114547	ENST00000514116;ENST00000251776;ENST00000504401;ENST00000513830;ENST00000508088;ENST00000509879	T;T;T;T	0.77489	2.43;2.43;-1.1;-1.1	3.37	3.37	0.38596	cAMP-dependent protein kinase, regulatory subunit, type I/II alpha/beta (1);	0.283163	0.29266	N	0.012656	T	0.61274	0.2334	N	0.12182	0.205	0.80722	D	1	B;B	0.17667	0.023;0.019	B;B	0.23419	0.046;0.027	T	0.61441	-0.7062	10	0.62326	D	0.03	-36.0235	10.5983	0.45352	0.0:1.0:0.0:0.0	.	28;28	B7Z7H1;Q9BZX4	.;ROP1B_HUMAN	E	28	ENSP00000426271:A28E;ENSP00000251776:A28E;ENSP00000425548:A28E;ENSP00000423058:A28E	ENSP00000251776:A28E	A	+	2	0	ROPN1B	127173670	1.000000	0.71417	0.991000	0.47740	0.118000	0.20060	1.480000	0.35464	1.578000	0.49821	0.305000	0.20034	GCG		0.587	ROPN1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369931.1	NM_001012337	
PCOLCE2	26577	broad.mit.edu	37	3	142539794	142539794	+	Missense_Mutation	SNP	G	G	A	rs375192412		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr3:142539794G>A	ENST00000295992.3	-	8	1349	c.1043C>T	c.(1042-1044)gCg>gTg	p.A348V	PCOLCE2_ENST00000485766.1_Silent_p.G268G	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	348	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.A348V(2)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						CTGCTGAATCGCCAAATTTCC	0.522																																					p.A348V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1043T	3						.	G	VAL/ALA	0,4406		0,0,2203	124.0	110.0	114.0		1043	5.6	1.0	3		114	1,8599	1.2+/-3.3	0,1,4299	no	missense	PCOLCE2	NM_013363.3	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	348/416	142539794	1,13005	2203	4300	6503	144022484	SO:0001583	missense	26577	exon8			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.1043C>T	3.37:g.142539794G>A	ENSP00000295992:p.Ala348Val		144022484	NM_013363	B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	ENST00000295992.3	37	CCDS3127.1	.	.	.	.	.	.	.	.	.	.	G	35	5.453592	0.96223	0.0	1.16E-4	ENSG00000163710	ENST00000295992	T	0.32272	1.46	5.64	5.64	0.86602	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.000000	0.85682	D	0.000000	T	0.45478	0.1344	M	0.73962	2.25	0.80722	D	1	P	0.52061	0.95	P	0.48030	0.564	T	0.37526	-0.9702	10	0.36615	T	0.2	-12.213	19.6912	0.96002	0.0:0.0:1.0:0.0	.	348	Q9UKZ9	PCOC2_HUMAN	V	348	ENSP00000295992:A348V	ENSP00000295992:A348V	A	-	2	0	PCOLCE2	144022484	1.000000	0.71417	0.976000	0.42696	0.962000	0.63368	9.410000	0.97335	2.641000	0.89580	0.655000	0.94253	GCG		0.522	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363	
GNB4	59345	broad.mit.edu	37	3	179134312	179134312	+	Nonsense_Mutation	SNP	A	A	C			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr3:179134312A>C	ENST00000232564.3	-	5	522	c.236T>G	c.(235-237)tTa>tGa	p.L79*	GNB4_ENST00000465153.1_5'Flank|GNB4_ENST00000468623.1_Nonsense_Mutation_p.L79*	NM_021629.3	NP_067642.1	Q9HAV0	GBB4_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 4	79					cell death (GO:0008219)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)	p.L79*(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	16	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			CCAAATAATTAATTTTCCATC	0.303																																					p.L79X	Melanoma(105;1405 1491 7265 20440 33721)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T236G	3						.						47.0	51.0	50.0					3																	179134312		2202	4283	6485	180617006	SO:0001587	stop_gained	59345	exon5			AF300648	CCDS3230.1	3q27.1	2013-01-10			ENSG00000114450	ENSG00000114450		"""WD repeat domain containing"""	20731	protein-coding gene	gene with protein product		610863				10644457, 11842130	Standard	NM_021629		Approved		uc003fjv.4	Q9HAV0	OTTHUMG00000157440	ENST00000232564.3:c.236T>G	3.37:g.179134312A>C	ENSP00000232564:p.Leu79*		180617006	NM_021629	B3KMH5|D3DNR8	Nonsense_Mutation	SNP	ENST00000232564.3	37	CCDS3230.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	38|38	7.245353|7.245353	0.98161|0.98161	.|.	.|.	ENSG00000114450|ENSG00000114450	ENST00000466899|ENST00000232564;ENST00000468623;ENST00000497513	.|.	.|.	.|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	.|0.072839	.|0.56097	.|D	.|0.000039	T|.	0.37732|.	0.1014|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35226|.	-0.9797|.	3|.	.|0.02654	.|T	.|1	-45.0162|-45.0162	15.4944|15.4944	0.75637|0.75637	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	M|X	1|79	.|.	.|ENSP00000232564:L79X	I|L	-|-	3|2	3|0	GNB4|GNB4	180617006|180617006	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.157000|9.157000	0.94714|0.94714	2.061000|2.061000	0.61500|0.61500	0.533000|0.533000	0.62120|0.62120	ATT|TTA		0.303	GNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258218.1	NM_021629	
DCUN1D1	54165	broad.mit.edu	37	3	182665370	182665370	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr3:182665370T>G	ENST00000292782.4	-	5	724	c.571A>C	c.(571-573)Aaa>Caa	p.K191Q	DCUN1D1_ENST00000469954.1_Missense_Mutation_p.K176Q	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1	191	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.			KF -> RL (in Ref. 2; AAL78673). {ECO:0000305}.		ubiquitin ligase complex (GO:0000151)		p.K191Q(1)		endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TCTAAGAATTTAAATCTTCCA	0.269																																					p.K191Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A571C	3						.						48.0	52.0	51.0					3																	182665370		2199	4276	6475	184148064	SO:0001583	missense	54165	exon5			AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.571A>C	3.37:g.182665370T>G	ENSP00000292782:p.Lys191Gln		184148064	NM_020640	B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Missense_Mutation	SNP	ENST00000292782.4	37	CCDS3240.1	.	.	.	.	.	.	.	.	.	.	T	16.29	3.081437	0.55753	.	.	ENSG00000043093	ENST00000292782;ENST00000458486;ENST00000469954	.	.	.	5.34	5.34	0.76211	Domain of unknown function DUF298 (2);	0.044428	0.85682	D	0.000000	T	0.74951	0.3784	M	0.85945	2.785	0.80722	D	1	B	0.26547	0.152	B	0.36766	0.232	T	0.75382	-0.3337	9	0.49607	T	0.09	-14.0879	15.3303	0.74203	0.0:0.0:0.0:1.0	.	191	Q96GG9	DCNL1_HUMAN	Q	191;151;176	.	ENSP00000292782:K191Q	K	-	1	0	DCUN1D1	184148064	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.599000	0.82757	2.009000	0.58944	0.450000	0.29827	AAA		0.269	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350658.1	NM_020640	
GABRA4	2557	broad.mit.edu	37	4	46930282	46930282	+	Nonsense_Mutation	SNP	A	A	C			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr4:46930282A>C	ENST00000264318.3	-	9	2607	c.1625T>G	c.(1624-1626)tTa>tGa	p.L542*		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	542					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.L542*(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	GTCCTTAGATAAATAAACAAC	0.343																																					p.L542X	Ovarian(6;283 369 8234 12290 33402)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T1625G	4						.						56.0	59.0	58.0					4																	46930282		2203	4299	6502	46625039	SO:0001587	stop_gained	2557	exon9				CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.1625T>G	4.37:g.46930282A>C	ENSP00000264318:p.Leu542*		46625039	NM_000809	Q8IYR7	Nonsense_Mutation	SNP	ENST00000264318.3	37	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	A	46	12.167617	0.99643	.	.	ENSG00000109158	ENST00000264318	.	.	.	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3777	0.74625	1.0:0.0:0.0:0.0	.	.	.	.	X	542	.	ENSP00000264318:L542X	L	-	2	0	GABRA4	46625039	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	9.233000	0.95337	2.232000	0.73038	0.528000	0.53228	TTA		0.343	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1		
PCDH18	54510	broad.mit.edu	37	4	138452683	138452683	+	Missense_Mutation	SNP	C	C	T	rs140746327		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr4:138452683C>T	ENST00000344876.4	-	1	946	c.560G>A	c.(559-561)cGg>cAg	p.R187Q	PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.R187Q|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000507846.1_5'UTR	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	187	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R187Q(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					AGTCCTGGTCCGAACCTCGAT	0.488																																					p.R187Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G560A	4						.	C	GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	59.0	59.0	59.0		560	3.2	0.9	4	dbSNP_134	59	0,8600		0,0,4300	no	missense	PCDH18	NM_019035.3	43	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign	187/1136	138452683	3,13003	2203	4300	6503	138672133	SO:0001583	missense	54510	exon1			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.560G>A	4.37:g.138452683C>T	ENSP00000355082:p.Arg187Gln		138672133	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	C	2.576	-0.298587	0.05532	6.81E-4	0.0	ENSG00000189184	ENST00000344876;ENST00000412923	T;T	0.20069	2.1;2.1	5.89	3.22	0.36961	Cadherin (4);Cadherin-like (1);	0.000000	0.41001	D	0.000979	T	0.05090	0.0136	N	0.01297	-0.9	0.80722	D	1	B;B	0.21309	0.041;0.054	B;B	0.19148	0.007;0.024	T	0.29941	-0.9995	10	0.02654	T	1	.	5.9988	0.19509	0.1353:0.6628:0.0:0.2019	.	187;187	Q9HCL0-2;Q9HCL0	.;PCD18_HUMAN	Q	187	ENSP00000355082:R187Q;ENSP00000390688:R187Q	ENSP00000355082:R187Q	R	-	2	0	PCDH18	138672133	0.613000	0.27009	0.922000	0.36590	0.237000	0.25408	1.614000	0.36911	0.824000	0.34613	0.557000	0.71058	CGG		0.488	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
APC	324	broad.mit.edu	37	5	112173917	112173917	+	Nonsense_Mutation	SNP	C	C	T	rs121913333		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr5:112173917C>T	ENST00000457016.1	+	16	3006	c.2626C>T	c.(2626-2628)Cga>Tga	p.R876*	APC_ENST00000508376.2_Nonsense_Mutation_p.R876*|APC_ENST00000257430.4_Nonsense_Mutation_p.R876*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	876	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R876*(38)|p.S874_R876>*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTCTTCAAAGCGAGGTTTGCA	0.463		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R858X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	40	Substitution - Nonsense(38)|Unknown(1)|Complex - deletion inframe(1)	large_intestine(37)|lung(1)|breast(1)|skin(1)	c.C2572T	5	GRCh37	CM942020	APC	M	rs121913333	.						70.0	72.0	71.0					5																	112173917		2202	4300	6502	112201816	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2626C>T	5.37:g.112173917C>T	ENSP00000413133:p.Arg876*		112201816	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.588996	0.97688	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.92	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2738	14.8639	0.70401	0.3912:0.6088:0.0:0.0	.	.	.	.	X	876;858;876;876;876	.	ENSP00000257430:R876X	R	+	1	2	APC	112201816	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.385000	0.34408	0.785000	0.33685	0.557000	0.71058	CGA		0.463	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHB16	57717	broad.mit.edu	37	5	140563763	140563763	+	Missense_Mutation	SNP	C	C	A	rs17844658	byFrequency	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr5:140563763C>A	ENST00000361016.2	+	1	2784	c.1629C>A	c.(1627-1629)agC>agA	p.S543R		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	543	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.			S -> R (in Ref. 1; AAF81914/AAG10030 and 7; AAH36062). {ECO:0000305}.	calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S543R(2)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTTTGAGCAGCGAGGCGCTGG	0.692													C|||	1002	0.20008	0.1407	0.196	5008	,	,		12178	0.2133		0.2893	False		,,,				2504	0.1779				p.S543R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1629A	5						.						18.0	20.0	19.0					5																	140563763		1828	3387	5215	140543947	SO:0001583	missense	57717	exon1			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1629C>A	5.37:g.140563763C>A	ENSP00000354293:p.Ser543Arg		140543947	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	690	0.3159340659340659	122	0.24796747967479674	135	0.3729281767955801	162	0.28321678321678323	271	0.3575197889182058	c	17.84	3.487245	0.63962	.	.	ENSG00000196963	ENST00000361016	T	0.54866	0.55	4.12	2.25	0.28309	Cadherin (5);Cadherin-like (1);	0.000000	0.40908	D	0.000982	T	0.00012	0.0000	H	0.95850	3.73	0.34623	P	0.281168	P	0.46064	0.872	P	0.48982	0.597	T	0.07158	-1.0787	9	0.72032	D	0.01	.	6.473	0.22020	0.1418:0.6907:0.0:0.1675	rs17844658;rs17857092	543	Q9NRJ7	PCDBG_HUMAN	R	543	ENSP00000354293:S543R	ENSP00000354293:S543R	S	+	3	2	PCDHB16	140543947	0.269000	0.24143	1.000000	0.80357	0.909000	0.53808	0.506000	0.22658	0.706000	0.31912	0.479000	0.44913	AGC		0.692	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHB10	56126	broad.mit.edu	37	5	140573991	140573991	+	Silent	SNP	G	G	C	rs372116572		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr5:140573991G>C	ENST00000239446.4	+	1	2050	c.1866G>C	c.(1864-1866)ggG>ggC	p.G622G		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	622	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G622G(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCACAATGGGGAGGTGCGCA	0.692																																					p.G622G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1866C	5						.						15.0	15.0	15.0					5																	140573991		1844	3568	5412	140554175	SO:0001819	synonymous_variant	56126	exon1			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1866G>C	5.37:g.140573991G>C			140554175	NM_018930	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																				0.692	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCDHB14	56122	broad.mit.edu	37	5	140605445	140605445	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr5:140605445C>T	ENST00000239449.4	+	1	2368	c.2368C>T	c.(2368-2370)Cga>Tga	p.R790*	PCDHB14_ENST00000515856.2_Nonsense_Mutation_p.R637*	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	790					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R790*(2)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGAGAACTTTCGAAATAGCTT	0.343																																					p.R790X	Ovarian(141;50 1831 27899 33809 37648)											.	.	2	Substitution - Nonsense(2)	large_intestine(1)|prostate(1)	c.C2368T	5						.						66.0	73.0	71.0					5																	140605445		2203	4300	6503	140585629	SO:0001587	stop_gained	56122	exon1			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2368C>T	5.37:g.140605445C>T	ENSP00000239449:p.Arg790*		140585629	NM_018934	B4DPE2|Q4FZA4|Q4KN11	Nonsense_Mutation	SNP	ENST00000239449.4	37	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	19.03	3.748491	0.69533	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	.	.	.	4.07	-0.837	0.10766	.	.	.	.	.	.	.	.	.	.	.	0.31292	N	0.689291	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2849	0.37751	0.2957:0.5843:0.12:0.0	.	.	.	.	X	637;790	.	ENSP00000239449:R790X	R	+	1	2	PCDHB14	140585629	0.000000	0.05858	0.000000	0.03702	0.145000	0.21501	-1.168000	0.03123	-0.071000	0.12886	0.585000	0.79938	CGA		0.343	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
ANKS1A	23294	broad.mit.edu	37	6	35027963	35027963	+	Missense_Mutation	SNP	A	A	G	rs78252531		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr6:35027963A>G	ENST00000360359.3	+	13	2255	c.2117A>G	c.(2116-2118)gAg>gGg	p.E706G	ANKS1A_ENST00000535627.1_Intron|ANKS1A_ENST00000470698.1_3'UTR	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	706	SAM 1. {ECO:0000255|PROSITE- ProRule:PRU00184}.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GAGTGGCTGGAGTCGATTGGG	0.547																																					p.E706G												.	.	0			c.A2117G	6						.						104.0	83.0	90.0					6																	35027963		2203	4300	6503	35135941	SO:0001583	missense	23294	exon13			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.2117A>G	6.37:g.35027963A>G	ENSP00000353518:p.Glu706Gly		35135941	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	37	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	A	16.91	3.252556	0.59212	.	.	ENSG00000064999	ENST00000360359;ENST00000373990	D	0.85171	-1.95	5.68	3.28	0.37604	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.47093	D	0.000251	T	0.80808	0.4694	L	0.59912	1.85	0.80722	D	1	B;B;P	0.40638	0.019;0.016;0.725	B;B;P	0.49829	0.045;0.115;0.623	T	0.81665	-0.0830	10	0.66056	D	0.02	-20.3704	8.1208	0.30969	0.7937:0.1365:0.0698:0.0	.	32;32;706	Q49AR9;E7EM84;Q92625	.;.;ANS1A_HUMAN	G	706;32	ENSP00000353518:E706G	ENSP00000353518:E706G	E	+	2	0	ANKS1A	35135941	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.286000	0.72665	0.956000	0.37904	0.260000	0.18958	GAG		0.547	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
STK38	11329	broad.mit.edu	37	6	36466147	36466147	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr6:36466147T>C	ENST00000229812.7	-	11	1354	c.1069A>G	c.(1069-1071)Att>Gtt	p.I357V		NM_007271.2	NP_009202.1			serine/threonine kinase 38									p.I357V(1)		NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TACCTCAAAATTAGATCCTTG	0.363																																					p.I357V	Colon(180;997 3561 16158)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1069G	6						.						119.0	123.0	122.0					6																	36466147		2203	4300	6503	36574125	SO:0001583	missense	11329	exon11				CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.1069A>G	6.37:g.36466147T>C	ENSP00000229812:p.Ile357Val		36574125	NM_007271		Missense_Mutation	SNP	ENST00000229812.7	37	CCDS4822.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.710133	0.68730	.	.	ENSG00000112079	ENST00000229812	T	0.67698	-0.28	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.48447	0.1500	L	0.28115	0.83	0.80722	D	1	B	0.26483	0.15	B	0.34931	0.192	T	0.55768	-0.8089	10	0.62326	D	0.03	.	16.3469	0.83138	0.0:0.0:0.0:1.0	.	357	Q15208	STK38_HUMAN	V	357	ENSP00000229812:I357V	ENSP00000229812:I357V	I	-	1	0	STK38	36574125	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.036000	0.88901	2.263000	0.75096	0.528000	0.53228	ATT		0.363	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040346.1	NM_007271	
COL12A1	1303	broad.mit.edu	37	6	75893069	75893069	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr6:75893069T>A	ENST00000322507.8	-	10	1897	c.1588A>T	c.(1588-1590)Ata>Tta	p.I530L	COL12A1_ENST00000416123.2_Missense_Mutation_p.I530L|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.I530L	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	530	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.I530fs*5(1)|p.I530L(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GGCACAAATATTTTCTCTCTG	0.388																																					p.I530L												.	.	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(1)|breast(1)	c.A1588T	6						.						158.0	151.0	153.0					6																	75893069		1873	4101	5974	75949789	SO:0001583	missense	1303	exon10			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1588A>T	6.37:g.75893069T>A	ENSP00000325146:p.Ile530Leu		75949789	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	T	12.41	1.929452	0.34096	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.79352	-1.26;-1.26;-1.26	5.56	5.56	0.83823	von Willebrand factor, type A (3);	0.078879	0.56097	D	0.000030	T	0.40522	0.1120	N	0.10733	0.035	0.32362	N	0.557096	B;B	0.34103	0.437;0.437	B;B	0.29942	0.109;0.109	T	0.51124	-0.8745	10	0.66056	D	0.02	.	8.1715	0.31258	0.0:0.1544:0.0:0.8456	.	530;530	D6RGG3;Q99715	.;COCA1_HUMAN	L	530	ENSP00000325146:I530L;ENSP00000412864:I530L;ENSP00000421216:I530L	ENSP00000325146:I530L	I	-	1	0	COL12A1	75949789	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.574000	0.46016	2.241000	0.73720	0.533000	0.62120	ATA		0.388	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
GPR6	2830	broad.mit.edu	37	6	110300544	110300544	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr6:110300544G>A	ENST00000275169.3	+	1	247	c.229G>A	c.(229-231)Gtg>Atg	p.V77M	GPR6_ENST00000414000.2_Missense_Mutation_p.V92M	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	77					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.V77M(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		TCCGTGGGACGTGCTCCTGTG	0.672																																					p.V77M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G229A	6						.						72.0	76.0	75.0					6																	110300544		2203	4300	6503	110407237	SO:0001583	missense	2830	exon1				CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.229G>A	6.37:g.110300544G>A	ENSP00000275169:p.Val77Met		110407237	NM_005284	B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Missense_Mutation	SNP	ENST00000275169.3	37	CCDS5079.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062921	0.55432	.	.	ENSG00000146360	ENST00000428489;ENST00000414000;ENST00000275169	T;T	0.41758	0.99;0.99	4.7	4.7	0.59300	.	0.076483	0.53938	D	0.000045	T	0.40694	0.1127	L	0.42245	1.32	0.44985	D	0.998005	D;D	0.76494	0.999;0.997	P;D	0.64144	0.862;0.922	T	0.38265	-0.9669	10	0.62326	D	0.03	.	8.761	0.34674	0.168:0.0:0.832:0.0	.	92;77	B4DHS9;P46095	.;GPR6_HUMAN	M	77;92;77	ENSP00000406986:V92M;ENSP00000275169:V77M	ENSP00000275169:V77M	V	+	1	0	GPR6	110407237	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.660000	0.54496	2.434000	0.82447	0.462000	0.41574	GTG		0.672	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041774.1		
SDK1	221935	broad.mit.edu	37	7	4153732	4153732	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr7:4153732C>T	ENST00000404826.2	+	25	3788	c.3649C>T	c.(3649-3651)Cgc>Tgc	p.R1217C	SDK1_ENST00000389531.3_Missense_Mutation_p.R1217C	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1217	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R1217C(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TAAGTACTGGCGCTCAGACCT	0.577																																					p.R1217C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3649T	7						.						68.0	67.0	68.0					7																	4153732		2203	4300	6503	4120258	SO:0001583	missense	221935	exon25			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3649C>T	7.37:g.4153732C>T	ENSP00000385899:p.Arg1217Cys		4120258	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	12.31	1.898315	0.33535	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.57595	0.39;0.39	5.38	3.59	0.41128	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.158761	0.42682	N	0.000676	T	0.51244	0.1663	M	0.87269	2.87	0.58432	D	0.999999	P;P	0.45902	0.868;0.483	B;B	0.37422	0.249;0.141	T	0.55444	-0.8140	10	0.66056	D	0.02	.	5.7275	0.18020	0.265:0.5898:0.0:0.1452	.	1217;1217	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	C	1217	ENSP00000385899:R1217C;ENSP00000374182:R1217C	ENSP00000374182:R1217C	R	+	1	0	SDK1	4120258	1.000000	0.71417	0.977000	0.42913	0.520000	0.34377	1.513000	0.35823	0.650000	0.30769	-0.140000	0.14226	CGC		0.577	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
ARPC1A	10552	broad.mit.edu	37	7	98951579	98951579	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr7:98951579C>T	ENST00000262942.5	+	6	672	c.548C>T	c.(547-549)aCg>aTg	p.T183M	ARPC1A_ENST00000471960.1_3'UTR|ARPC1A_ENST00000432884.2_Missense_Mutation_p.T136M	NM_001190996.1|NM_006409.3	NP_001177925.1|NP_006400.2	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex, subunit 1A, 41kDa	183					actin cytoskeleton organization (GO:0030036)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of actin filament polymerization (GO:0030833)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	actin binding (GO:0003779)	p.T183M(2)		endometrium(3)|large_intestine(5)|liver(2)|lung(7)|ovary(1)|prostate(1)	19	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			CCAGCCAGCACGCCCTGGGGC	0.488																																					p.T169M												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C506T	7						.						70.0	74.0	73.0					7																	98951579		2203	4300	6503	98789515	SO:0001583	missense	10552	exon6			Y08999	CCDS5660.1	7q22.1	2013-03-14	2002-08-29		ENSG00000241685	ENSG00000241685		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	703	protein-coding gene	gene with protein product	"""actin binding protein (Schizosaccharomyces pombe sop2-like)"", ""SOP2-like protein"""	604220	"""actin related protein 2/3 complex, subunit 1A (41 kD)"""			8978670, 9230079	Standard	NM_006409		Approved	SOP2Hs, SOP2L, Arc40	uc003upx.2	Q92747	OTTHUMG00000154553	ENST00000262942.5:c.548C>T	7.37:g.98951579C>T	ENSP00000262942:p.Thr183Met		98789515	NM_001190996	A4D276|B4DLQ7|D6W5S1|Q7Z5U8|Q86WU5|Q8IXQ0	Missense_Mutation	SNP	ENST00000262942.5	37	CCDS5660.1	.	.	.	.	.	.	.	.	.	.	c	29.3	4.994501	0.93167	.	.	ENSG00000241685	ENST00000432884;ENST00000262942	T;T	0.66280	-0.2;-0.2	5.05	5.05	0.67936	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.81044	0.4741	M	0.87097	2.86	0.80722	D	1	D;D	0.89917	1.0;0.994	P;B	0.61940	0.896;0.42	D	0.84928	0.0858	10	0.87932	D	0	.	18.7488	0.91806	0.0:1.0:0.0:0.0	.	178;183	Q53GB6;Q92747	.;ARC1A_HUMAN	M	136;183	ENSP00000408578:T136M;ENSP00000262942:T183M	ENSP00000262942:T183M	T	+	2	0	ARPC1A	98789515	1.000000	0.71417	0.990000	0.47175	0.988000	0.76386	7.779000	0.85648	2.516000	0.84829	0.555000	0.69702	ACG		0.488	ARPC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335908.1	NM_006409	
CSMD1	64478	broad.mit.edu	37	8	2832079	2832079	+	Silent	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr8:2832079G>A	ENST00000520002.1	-	57	9192	c.8637C>T	c.(8635-8637)ggC>ggT	p.G2879G	CSMD1_ENST00000602723.1_Silent_p.G2821G|CSMD1_ENST00000400186.3_Silent_p.G2821G|CSMD1_ENST00000542608.1_Silent_p.G2820G|CSMD1_ENST00000602557.1_Silent_p.G2879G|CSMD1_ENST00000537824.1_Silent_p.G2878G			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2879	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.G2607G(1)|p.G2878G(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCACGACGGCGCCATAGGTAA	0.557																																					p.R2879C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C8635T	8						.						45.0	48.0	47.0					8																	2832079		2003	4163	6166	2819486	SO:0001819	synonymous_variant	64478	exon56					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8637C>T	8.37:g.2832079G>A			2819486	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	5.485	0.274553	0.10403	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.66	-7.93	0.01156	.	.	.	.	.	T	0.34366	0.0895	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39860	-0.9593	4	.	.	.	.	1.8228	0.03114	0.2475:0.0938:0.3635:0.2952	.	.	.	.	C	2296	.	.	R	-	1	0	CSMD1	2819486	0.002000	0.14202	0.005000	0.12908	0.002000	0.02628	-0.924000	0.03996	-1.462000	0.01907	-0.878000	0.02970	CGC		0.557	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
LOXL2	4017	broad.mit.edu	37	8	23191122	23191122	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr8:23191122C>T	ENST00000389131.3	-	5	1127	c.758G>A	c.(757-759)cGg>cAg	p.R253Q	LOXL2_ENST00000518472.1_5'Flank|RP11-177H13.2_ENST00000519692.1_RNA	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	253	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)	p.R253Q(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		CTGCTTCCTCCGTGAGGCAAA	0.607																																					p.R253Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G758A	8						.						55.0	44.0	48.0					8																	23191122		2203	4300	6503	23247067	SO:0001583	missense	4017	exon5			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.758G>A	8.37:g.23191122C>T	ENSP00000373783:p.Arg253Gln		23247067	NM_002318	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	ENST00000389131.3	37	CCDS34864.1	.	.	.	.	.	.	.	.	.	.	c	25.0	4.591705	0.86953	.	.	ENSG00000134013	ENST00000389131	T	0.34667	1.35	5.78	5.78	0.91487	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.167097	0.49916	D	0.000126	T	0.38719	0.1051	M	0.62723	1.935	0.49051	D	0.999741	P	0.41848	0.763	B	0.40444	0.329	T	0.16129	-1.0413	10	0.11485	T	0.65	.	18.6444	0.91406	0.0:1.0:0.0:0.0	.	253	Q9Y4K0	LOXL2_HUMAN	Q	253	ENSP00000373783:R253Q	ENSP00000373783:R253Q	R	-	2	0	LOXL2	23247067	0.959000	0.32827	0.972000	0.41901	0.955000	0.61496	2.591000	0.46163	2.742000	0.94016	0.645000	0.84053	CGG		0.607	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375603.1		
RALYL	138046	broad.mit.edu	37	8	85441713	85441713	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr8:85441713G>A	ENST00000521268.1	+	2	1262	c.157G>A	c.(157-159)Gtt>Att	p.V53I	RALYL_ENST00000517638.1_Missense_Mutation_p.V66I|RALYL_ENST00000522455.1_Missense_Mutation_p.V53I|RALYL_ENST00000521695.1_Missense_Mutation_p.V53I|RALYL_ENST00000518566.1_Missense_Mutation_p.V53I	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	53	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.V53I(3)		endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						TGGATGTTCCGTTCACAAAGG	0.438																																					p.V53I												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G157A	8						.						61.0	63.0	62.0					8																	85441713		2014	4193	6207	85604268	SO:0001583	missense	138046	exon3				CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.157G>A	8.37:g.85441713G>A	ENSP00000430367:p.Val53Ile		85604268	NM_001100392	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	ENST00000521268.1	37	CCDS55253.1	.	.	.	.	.	.	.	.	.	.	G	36	5.659636	0.96734	.	.	ENSG00000184672	ENST00000522613;ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517988;ENST00000517638	T;T;T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41;2.41;2.41	5.45	5.45	0.79879	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000001	T	0.22085	0.0532	N	0.02685	-0.53	0.80722	D	1	P;P;D	0.89917	0.951;0.865;1.0	P;B;D	0.78314	0.792;0.335;0.991	T	0.50617	-0.8807	10	0.62326	D	0.03	.	19.7001	0.96049	0.0:0.0:1.0:0.0	.	53;66;53	B3KT61;G3V129;Q86SE5	.;.;RALYL_HUMAN	I	53;53;53;53;53;53;66	ENSP00000427787:V53I;ENSP00000430394:V53I;ENSP00000428667:V53I;ENSP00000430367:V53I;ENSP00000430065:V53I;ENSP00000428711:V53I;ENSP00000430128:V66I	ENSP00000430128:V66I	V	+	1	0	RALYL	85604268	1.000000	0.71417	0.979000	0.43373	0.969000	0.65631	9.812000	0.99227	2.732000	0.93576	0.551000	0.68910	GTT		0.438	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1		
GOLGA2	2801	broad.mit.edu	37	9	131019484	131019484	+	Silent	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr9:131019484G>A	ENST00000421699.2	-	26	2883	c.2871C>T	c.(2869-2871)aaC>aaT	p.N957N	AL590708.1_ENST00000408370.1_RNA|GOLGA2_ENST00000609374.1_Silent_p.N945N	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	957					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)		p.N945N(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						GTGCAGTGGGGTTGTCACGGG	0.617																																					p.N957N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2871T	9						.						50.0	53.0	52.0					9																	131019484		2203	4300	6503	130059305	SO:0001819	synonymous_variant	2801	exon26			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.2871C>T	9.37:g.131019484G>A			130059305	NM_004486	Q6GRM9|Q9BRB0|Q9NYF9	Silent	SNP	ENST00000421699.2	37	CCDS6896.2																																																																																				0.617	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486	
DAPK1	1612	broad.mit.edu	37	9	90264907	90264907	+	Silent	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr9:90264907C>T	ENST00000408954.3	+	16	1835	c.1500C>T	c.(1498-1500)gcC>gcT	p.A500A	DAPK1_ENST00000491893.1_Silent_p.A500A|DAPK1_ENST00000469640.2_Silent_p.A500A|DAPK1_ENST00000472284.1_Silent_p.A500A|DAPK1_ENST00000358077.5_Silent_p.A500A	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	500					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A501A(1)|p.A500A(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TTTGTGAAGCCGGCTGTAACG	0.577									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.A500A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1500T	9						.						63.0	66.0	65.0					9																	90264907		1929	4138	6067	89454727	SO:0001819	synonymous_variant	1612	exon16	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.1500C>T	9.37:g.90264907C>T			89454727	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	ENST00000408954.3	37	CCDS43842.1																																																																																				0.577	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
LRRC8A	56262	broad.mit.edu	37	9	131670712	131670712	+	Silent	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chr9:131670712C>T	ENST00000259324.5	+	3	1792	c.1269C>T	c.(1267-1269)aaC>aaT	p.N423N	LRRC8A_ENST00000372599.3_Silent_p.N423N|LRRC8A_ENST00000372600.4_Silent_p.N423N	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	423					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.N423N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						TCACCAAGAACGCGCAGGACA	0.597																																					p.N423N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1269T	9						.						46.0	44.0	45.0					9																	131670712		2203	4300	6503	130710533	SO:0001819	synonymous_variant	56262	exon3			AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.1269C>T	9.37:g.131670712C>T			130710533	NM_019594	Q6UXM2|Q8NCI0|Q9P2B1	Silent	SNP	ENST00000259324.5	37	CCDS35155.1																																																																																				0.597	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594	
MID2	11043	broad.mit.edu	37	X	107160962	107160962	+	Silent	SNP	G	G	A	rs534271877		TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chrX:107160962G>A	ENST00000262843.6	+	7	1976	c.1428G>A	c.(1426-1428)gcG>gcA	p.A476A	MID2_ENST00000443968.2_Intron|RP6-191P20.4_ENST00000430140.1_RNA	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	476	Fibronectin type-III.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.A456A(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						TGGCCGGGGCGCCACGAGGCA	0.483													G|||	7	0.0018543	0.0	0.0	3775	,	,		15961	0.0		0.0	False		,,,				2504	0.0072				p.A476A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1428A	X						.						107.0	90.0	96.0					X																	107160962		2203	4300	6503	107047618	SO:0001819	synonymous_variant	11043	exon7				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.1428G>A	X.37:g.107160962G>A			107047618	NM_012216	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Silent	SNP	ENST00000262843.6	37	CCDS14532.2																																																																																				0.483	MID2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057852.2	NM_012216	
ACSL4	2182	broad.mit.edu	37	X	108906630	108906630	+	Splice_Site	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chrX:108906630G>A	ENST00000469796.2	-	13	1911	c.1515C>T	c.(1513-1515)ggC>ggT	p.G505G	ACSL4_ENST00000348502.6_Splice_Site_p.G464G|ACSL4_ENST00000340800.2_Splice_Site_p.G505G			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	505					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.G505G(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	TTGTATAACCGCCTGGAAATC	0.318																																					p.G464G	Pancreas(188;358 2127 38547 41466 45492)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1392T	X						.						138.0	147.0	144.0					X																	108906630		2203	4300	6503	108793286	SO:0001630	splice_region_variant	2182	exon13			BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.1514-1C>T	X.37:g.108906630G>A			108793286	NM_004458	D3DUY2|O60848|O60849|Q5JWV8	Silent	SNP	ENST00000469796.2	37	CCDS14548.1																																																																																				0.318	ACSL4-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358155.2	NM_004458	Silent
FAM47A	158724	broad.mit.edu	37	X	34149811	34149811	+	Silent	SNP	C	C	T			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chrX:34149811C>T	ENST00000346193.3	-	1	636	c.585G>A	c.(583-585)ccG>ccA	p.P195P		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	195	Pro-rich.							p.P195P(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GATGGGACACCGGAGTCTCGG	0.612																																					p.P195P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G585A	X						.						54.0	57.0	56.0					X																	34149811		2198	4297	6495	34059732	SO:0001819	synonymous_variant	158724	exon1			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.585G>A	X.37:g.34149811C>T			34059732	NM_203408	A8K8I9|Q8TAA0	Silent	SNP	ENST00000346193.3	37	CCDS43926.1																																																																																				0.612	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
ATP6AP2	10159	broad.mit.edu	37	X	40448352	40448352	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chrX:40448352G>C	ENST00000378438.4	+	2	310	c.152G>C	c.(151-153)gGc>gCc	p.G51A	ATP6AP2_ENST00000486558.1_Intron|ATP6AP2_ENST00000535539.1_Missense_Mutation_p.G51A|ATP6AP2_ENST00000535777.1_Missense_Mutation_p.G51A|ATP6AP2_ENST00000544975.1_Intron	NM_005765.2	NP_005756.2	O75787	RENR_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 2	51					angiotensin maturation (GO:0002003)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|eye pigmentation (GO:0048069)|head morphogenesis (GO:0060323)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of Wnt signaling pathway (GO:0030177)|proteolysis (GO:0006508)|regulation of MAPK cascade (GO:0043408)|rostrocaudal neural tube patterning (GO:0021903)	cell body (GO:0044297)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|receptor activity (GO:0004872)	p.G51A(1)		endometrium(1)|large_intestine(1)|lung(2)	4						TTGTCCATGGGCTTCTCTGTG	0.378																																					p.G51A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G152C	X						.						68.0	65.0	66.0					X																	40448352		2203	4300	6503	40333296	SO:0001583	missense	10159	exon2			AF248966	CCDS14252.1	Xp11.4	2014-06-17	2003-08-28	2003-08-29	ENSG00000182220	ENSG00000182220			18305	protein-coding gene	gene with protein product	"""prorenin receptor"", ""renin receptor"""	300556	"""ATPase, H+ transporting, lysosomal interacting protein 2"""	ATP6IP2		9556572, 11590366	Standard	NM_005765		Approved	M8-9, APT6M8-9, ATP6M8-9, PRR, RENR	uc004det.3	O75787	OTTHUMG00000024103	ENST00000378438.4:c.152G>C	X.37:g.40448352G>C	ENSP00000367697:p.Gly51Ala		40333296	NM_005765	B7Z9I3|Q5QTQ7|Q6T7F5|Q8NBP3|Q8NG15|Q96FV6|Q96LB5|Q9H2P8|Q9UG89	Missense_Mutation	SNP	ENST00000378438.4	37	CCDS14252.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.180833	0.78677	.	.	ENSG00000182220	ENST00000535539;ENST00000378438;ENST00000436783;ENST00000535777;ENST00000538655	D;T;T;D	0.83591	-1.74;-0.15;-0.46;-1.74	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.91095	0.7197	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	0.999;0.997;1.0	D;P;D	0.83275	0.996;0.769;0.966	D	0.92281	0.5833	10	0.66056	D	0.02	-12.4846	15.7156	0.77667	0.0:0.0:1.0:0.0	.	51;51;51	B7Z1I9;B7Z9I3;O75787	.;.;RENR_HUMAN	A	51;51;83;51;51	ENSP00000438415:G51A;ENSP00000367697:G51A;ENSP00000403969:G83A;ENSP00000441536:G51A	ENSP00000367697:G51A	G	+	2	0	ATP6AP2	40333296	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.434000	0.97515	2.158000	0.67659	0.529000	0.55759	GGC		0.378	ATP6AP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060679.1	NM_005765	
GPR50	9248	broad.mit.edu	37	X	150345286	150345286	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3856-01A-01W-0900-09	TCGA-AA-3856-10A-01W-0900-09	g.chrX:150345286G>A	ENST00000218316.3	+	1	162	c.93G>A	c.(91-93)atG>atA	p.M31I	GPR50-AS1_ENST00000454196.1_RNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	31					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)	p.M31I(2)		breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					TCATCTTTATGTTCTGCGCGA	0.522																																					p.M31I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G93A	X						.						122.0	119.0	120.0					X																	150345286		1896	4102	5998	150095944	SO:0001583	missense	9248	exon1			U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.93G>A	X.37:g.150345286G>A	ENSP00000218316:p.Met31Ile		150095944	NM_004224	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	CCDS44012.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978674	0.34942	.	.	ENSG00000102195	ENST00000218316	T	0.34072	1.38	4.21	4.21	0.49690	.	0.350121	0.27202	N	0.020442	T	0.19927	0.0479	N	0.08118	0	0.37603	D	0.920626	B	0.12630	0.006	B	0.14023	0.01	T	0.10019	-1.0648	10	0.56958	D;D	0.05;0.05	-4.9268	10.872	0.46889	0.0:0.0:1.0:0.0	.	31	Q13585	MTR1L_HUMAN	I	31	ENSP00000218316:M31I	ENSP00000218316:M31I;ENSP00000218316:M31I	M	+	3	0	GPR50	150095944	1.000000	0.71417	0.987000	0.45799	0.580000	0.36256	1.939000	0.40213	1.932000	0.55993	0.292000	0.19580	ATG		0.522	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224	
