#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CACNB2	783	broad.mit.edu	37	10	18827274	18827274	+	Missense_Mutation	SNP	A	A	C	rs575188082		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr10:18827274A>C	ENST00000324631.7	+	13	1528	c.1468A>C	c.(1468-1470)Acc>Ccc	p.T490P	CACNB2_ENST00000377319.3_Missense_Mutation_p.T397P|CACNB2_ENST00000396576.2_Missense_Mutation_p.T435P|CACNB2_ENST00000377315.4_Missense_Mutation_p.T442P|CACNB2_ENST00000377331.2_Missense_Mutation_p.T438P|CACNB2_ENST00000282343.8_Missense_Mutation_p.T462P|CACNB2_ENST00000352115.6_Missense_Mutation_p.T466P|CACNB2_ENST00000377329.4_Missense_Mutation_p.T436P|RP11-499P20.2_ENST00000425669.1_RNA|CACNB2_ENST00000377328.1_Missense_Mutation_p.T240P	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	490					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TCTTAGCCCCACCCTAGCCTC	0.478																																					p.T490P												.	.	0			c.A1468C	10						.						148.0	153.0	151.0					10																	18827274		2203	4300	6503	18867280	SO:0001583	missense	783	exon13			U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.1468A>C	10.37:g.18827274A>C	ENSP00000320025:p.Thr490Pro		18867280	NM_201596	A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Missense_Mutation	SNP	ENST00000324631.7	37	CCDS7125.1	.	.	.	.	.	.	.	.	.	.	A	18.88	3.716865	0.68844	.	.	ENSG00000165995	ENST00000324631;ENST00000352115;ENST00000377328;ENST00000282343;ENST00000377331;ENST00000396576;ENST00000377319;ENST00000377329;ENST00000377315	D;D;D;D;D;D;D;D;D	0.83419	-1.72;-1.71;-1.7;-1.72;-1.69;-1.69;-1.68;-1.69;-1.69	5.6	-2.45	0.06481	.	0.440958	0.26058	N	0.026587	T	0.78362	0.4271	L	0.42245	1.32	0.29204	N	0.875039	B;B;D;B;B;P;B;B;B;B;B;P;P	0.71674	0.146;0.357;0.998;0.357;0.042;0.49;0.0;0.256;0.041;0.321;0.256;0.579;0.586	B;B;P;B;B;B;B;B;B;B;B;B;B	0.56434	0.16;0.04;0.798;0.024;0.147;0.088;0.0;0.043;0.058;0.088;0.086;0.192;0.04	T	0.71024	-0.4712	10	0.40728	T	0.16	-3.0699	3.2829	0.06921	0.2479:0.1455:0.4643:0.1422	.	404;462;240;442;412;436;446;397;438;462;452;466;490	B7Z1U5;Q5QJA0;A6PVM6;Q5VVH1;Q6TME1;Q08289-3;Q59H42;Q08289-6;A6PVM7;Q08289-4;Q08289-7;Q08289-8;Q08289	.;.;.;.;.;.;.;.;.;.;.;.;CACB2_HUMAN	P	490;466;240;462;438;435;397;436;442	ENSP00000320025:T490P;ENSP00000344474:T466P;ENSP00000366545:T240P;ENSP00000282343:T462P;ENSP00000366548:T438P;ENSP00000379821:T435P;ENSP00000366536:T397P;ENSP00000366546:T436P;ENSP00000366532:T442P	ENSP00000282343:T462P	T	+	1	0	CACNB2	18867280	0.088000	0.21588	0.273000	0.24645	0.972000	0.66771	1.209000	0.32357	-0.443000	0.07180	0.528000	0.53228	ACC		0.478	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724	
BMI1	648	broad.mit.edu	37	10	22616535	22616535	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr10:22616535C>G	ENST00000376663.3	+	4	726	c.221C>G	c.(220-222)aCt>aGt	p.T74S	COMMD3-BMI1_ENST00000602390.1_Missense_Mutation_p.T217S	NM_005180.8	NP_005171.4	P35226	BMI1_HUMAN	BMI1 proto-oncogene, polycomb ring finger	74					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|regulation of gene expression (GO:0010468)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|ubiquitin ligase complex (GO:0000151)	RING-like zinc finger domain binding (GO:0071535)|zinc ion binding (GO:0008270)	p.T74S(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|urinary_tract(1)	12						TCAGATAAAACTCTCCAAGAT	0.274																																					p.T74S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C221G	10						.						45.0	53.0	50.0					10																	22616535		2181	4281	6462	22656541	SO:0001583	missense	648	exon4			BC011652	CCDS7138.1	10p13	2014-06-26	2014-06-26	2006-04-26	ENSG00000168283	ENSG00000168283		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	1066	protein-coding gene	gene with protein product		164831	"""polycomb group ring finger 4"", ""B lymphoma Mo-MLV insertion region 1 homolog (mouse)"""	PCGF4		8268912	Standard	NM_005180		Approved	RNF51		P35226	OTTHUMG00000017807	ENST00000376663.3:c.221C>G	10.37:g.22616535C>G	ENSP00000365851:p.Thr74Ser		22656541	NM_005180	Q16030|Q5T8Z3|Q96F37	Missense_Mutation	SNP	ENST00000376663.3	37	CCDS7138.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301429	0.40694	.	.	ENSG00000168283	ENST00000417470;ENST00000376663;ENST00000442508;ENST00000456675;ENST00000416820	T;T;T	0.37058	1.22;1.8;2.2	5.78	4.88	0.63580	Zinc finger, RING/FYVE/PHD-type (1);	0.045114	0.85682	D	0.000000	T	0.67202	0.2868	M	0.91406	3.205	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.98	T	0.76269	-0.3021	10	0.87932	D	0	-14.5485	14.667	0.68915	0.0:0.9294:0.0:0.0706	.	74;74	Q5U0M5;P35226	.;BMI1_HUMAN	S	74	ENSP00000365851:T74S;ENSP00000397912:T74S;ENSP00000399220:T74S	ENSP00000365851:T74S	T	+	2	0	BMI1	22656541	1.000000	0.71417	1.000000	0.80357	0.197000	0.23852	5.503000	0.66962	1.454000	0.47793	-0.150000	0.13652	ACT		0.274	BMI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047176.1	NM_005180	
PTCHD3	374308	broad.mit.edu	37	10	27702551	27702551	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr10:27702551G>A	ENST00000438700.3	-	1	746	c.629C>T	c.(628-630)tCg>tTg	p.S210L		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	210					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.S210L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						CACCAGAAGCGAGACGAAATT	0.637																																					p.S210L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C629T	10						.						51.0	53.0	52.0					10																	27702551		2203	4300	6503	27742557	SO:0001583	missense	374308	exon1			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.629C>T	10.37:g.27702551G>A	ENSP00000417658:p.Ser210Leu		27742557	NM_001034842	I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	37	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033607	0.54896	.	.	ENSG00000182077	ENST00000438700	D	0.84589	-1.87	3.77	0.731	0.18277	.	0.256122	0.39475	N	0.001359	D	0.82986	0.5156	M	0.73962	2.25	0.09310	N	1	D	0.53151	0.958	P	0.47864	0.559	T	0.72997	-0.4121	10	0.18276	T	0.48	-2.8463	7.3153	0.26498	0.091:0.3238:0.5852:0.0	.	210	Q3KNS1	PTHD3_HUMAN	L	210	ENSP00000417658:S210L	ENSP00000417658:S210L	S	-	2	0	PTCHD3	27742557	0.038000	0.19896	0.000000	0.03702	0.003000	0.03518	1.991000	0.40727	-0.022000	0.13986	0.555000	0.69702	TCG		0.637	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
PGBD3	267004	broad.mit.edu	37	10	50723614	50723614	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr10:50723614C>T	ENST00000374127.3	-	2	1748	c.1547G>A	c.(1546-1548)cGt>cAt	p.R516H	ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.R984H|PGBD3_ENST00000508005.2_Missense_Mutation_p.R516H|ERCC6_ENST00000355832.5_Intron|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.R984H|PGBD3_ENST00000603152.1_Missense_Mutation_p.R984H	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	516								p.R516H(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						CACACGTCGACGAAACTCCAG	0.428																																					p.R516H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1547A	10						.						139.0	125.0	130.0					10																	50723614		2203	4300	6503	50393620	SO:0001583	missense	267004	exon2			AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.1547G>A	10.37:g.50723614C>T	ENSP00000363242:p.Arg516His		50393620	NM_170753	B3KQC4|Q5W0M0|Q6PIH0	Missense_Mutation	SNP	ENST00000374127.3	37	CCDS7230.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.368364	0.42003	.	.	ENSG00000243251;ENSG00000243251;ENSG00000258838;ENSG00000258838	ENST00000374127;ENST00000508005;ENST00000515869;ENST00000447839	T;T;T;T	0.19250	2.16;2.16;3.07;3.07	0.706	-0.386	0.12466	.	.	.	.	.	T	0.11281	0.0275	N	0.19112	0.55	0.09310	N	1	B;B	0.15141	0.012;0.001	B;B	0.04013	0.001;0.0	T	0.28202	-1.0051	8	0.41790	T	0.15	-18.942	.	.	.	.	984;516	E7EV46;Q8N328	.;PGBD3_HUMAN	H	516;516;984;984	ENSP00000363242:R516H;ENSP00000426963:R516H;ENSP00000423550:R984H;ENSP00000387966:R984H	ENSP00000387966:R984H	R	-	2	0	PGBD3;RP11-123B3.6	50393620	0.981000	0.34729	0.002000	0.10522	0.964000	0.63967	0.367000	0.20382	-0.183000	0.10585	-0.339000	0.08088	CGT		0.428	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047988.1		
JMJD1C	221037	broad.mit.edu	37	10	64968353	64968353	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr10:64968353G>A	ENST00000399262.2	-	10	3294	c.3076C>T	c.(3076-3078)Ctt>Ttt	p.L1026F	JMJD1C_ENST00000399251.1_Missense_Mutation_p.L807F|JMJD1C_ENST00000542921.1_Missense_Mutation_p.L844F|JMJD1C_ENST00000402544.1_Missense_Mutation_p.L807F	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1026					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)	p.L1026F(1)|p.L807F(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CTTTCTTGAAGAATTCGACGG	0.423																																					p.L807F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2419T	10						.						220.0	204.0	209.0					10																	64968353		1884	4119	6003	64638359	SO:0001583	missense	221037	exon7			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.3076C>T	10.37:g.64968353G>A	ENSP00000382204:p.Leu1026Phe		64638359	NM_004241	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480051	0.63849	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.71579	-0.24;-0.58;1.22;-0.23	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.83695	0.5310	M	0.64997	1.995	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.83786	0.0228	10	0.72032	D	0.01	-14.2854	20.282	0.98514	0.0:0.0:1.0:0.0	.	567;1026;844	A6PW35;Q15652;A0T124	.;JHD2C_HUMAN;.	F	1026;807;807;844	ENSP00000382204:L1026F;ENSP00000384990:L807F;ENSP00000382195:L807F;ENSP00000444682:L844F	ENSP00000382195:L807F	L	-	1	0	JMJD1C	64638359	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.318000	0.72866	2.786000	0.95864	0.563000	0.77884	CTT		0.423	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
EXOC6	54536	broad.mit.edu	37	10	94818035	94818035	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr10:94818035C>T	ENST00000260762.6	+	22	2352	c.2338C>T	c.(2338-2340)Cga>Tga	p.R780*	EXOC6_ENST00000443748.2_Nonsense_Mutation_p.R677*|RP11-348J12.2_ENST00000444965.1_RNA|EXOC6_ENST00000371552.4_Nonsense_Mutation_p.R775*|EXOC6_ENST00000371547.4_Nonsense_Mutation_p.R796*|CYP26C1_ENST00000285949.5_5'Flank	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	780					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)		p.R780*(2)|p.R775*(2)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				GAAGAATGATCGAGACAAACA	0.383																																					p.R775X												.	.	4	Substitution - Nonsense(4)	large_intestine(2)|lung(2)	c.C2323T	10						.						129.0	120.0	123.0					10																	94818035		2203	4300	6503	94808025	SO:0001587	stop_gained	54536	exon22			BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.2338C>T	10.37:g.94818035C>T	ENSP00000260762:p.Arg780*		94808025	NM_001013848	E9PHI3|Q5VXH8|Q9NZ24	Nonsense_Mutation	SNP	ENST00000260762.6	37	CCDS7424.2	.	.	.	.	.	.	.	.	.	.	C	38	6.921059	0.97936	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000443748;ENST00000260762	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1391	15.1407	0.72609	0.1412:0.8587:0.0:0.0	.	.	.	.	X	796;775;677;780	.	ENSP00000260762:R780X	R	+	1	2	EXOC6	94808025	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.190000	0.50973	2.825000	0.97269	0.655000	0.94253	CGA		0.383	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049410.2	NM_019053	
ZDHHC16	84287	broad.mit.edu	37	10	99215749	99215749	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr10:99215749A>G	ENST00000370854.3	+	10	1156	c.967A>G	c.(967-969)Aac>Gac	p.N323D	ZDHHC16_ENST00000393760.1_Missense_Mutation_p.N323D|ZDHHC16_ENST00000345745.5_Missense_Mutation_p.N242D|ZDHHC16_ENST00000352634.4_Missense_Mutation_p.N307D|ZDHHC16_ENST00000370842.2_Missense_Mutation_p.N307D|ZDHHC16_ENST00000495735.1_3'UTR|ZDHHC16_ENST00000353979.3_Missense_Mutation_p.N284D|ZDHHC16_ENST00000370846.4_Missense_Mutation_p.N253D	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	323					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.N323D(1)		kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		GAATCCTTACAACTACGGCTG	0.403																																					p.N307D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A919G	10						.						113.0	106.0	108.0					10																	99215749		2203	4300	6503	99205739	SO:0001583	missense	84287	exon9			AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.967A>G	10.37:g.99215749A>G	ENSP00000359891:p.Asn323Asp		99205739	NM_198043	D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Missense_Mutation	SNP	ENST00000370854.3	37	CCDS7460.1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.605871	0.28623	.	.	ENSG00000171307	ENST00000370854;ENST00000393760;ENST00000370846;ENST00000352634;ENST00000353979;ENST00000370842;ENST00000345745	T;T;T;T;T;T	0.70399	0.81;0.81;-0.48;0.46;0.46;0.06	6.08	6.08	0.98989	.	0.168613	0.52532	D	0.000062	T	0.54255	0.1847	N	0.17248	0.465	0.49798	D	0.99982	P;B;B;P;B;B;B;B	0.41313	0.745;0.016;0.07;0.651;0.095;0.027;0.015;0.006	B;B;B;B;B;B;B;B	0.39379	0.298;0.019;0.068;0.115;0.172;0.042;0.02;0.009	T	0.56232	-0.8013	10	0.07175	T	0.84	-4.8451	16.643	0.85134	1.0:0.0:0.0:0.0	.	305;258;253;264;284;242;307;323	B4DNL2;E9PCL9;B1AMU0;B1AMU1;Q969W1-3;Q969W1-4;Q969W1-2;Q969W1	.;.;.;.;.;.;.;ZDH16_HUMAN	D	323;323;253;307;284;307;242	ENSP00000359891:N323D;ENSP00000377357:N323D;ENSP00000359883:N253D;ENSP00000345383:N307D;ENSP00000359879:N307D;ENSP00000304487:N242D	ENSP00000304487:N242D	N	+	1	0	ZDHHC16	99205739	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.689000	0.61723	2.330000	0.79161	0.533000	0.62120	AAC		0.403	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049658.2	NM_032327	
ADRB1	153	broad.mit.edu	37	10	115804410	115804410	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr10:115804410G>A	ENST00000369295.2	+	1	605	c.519G>A	c.(517-519)gcG>gcA	p.A173A		NM_000684.2	NP_000675.1	P08588	ADRB1_HUMAN	adrenoceptor beta 1	173					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|aging (GO:0007568)|apoptotic process (GO:0006915)|brown fat cell differentiation (GO:0050873)|diet induced thermogenesis (GO:0002024)|fear response (GO:0042596)|glycogen catabolic process (GO:0005980)|heat generation (GO:0031649)|lipid homeostasis (GO:0055088)|memory (GO:0007613)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of urine volume (GO:0035811)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cation channel activity (GO:2001259)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of heart rate by epinephrine-norepinephrine (GO:0001996)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of renin secretion into blood stream (GO:1900135)|positive regulation of saliva secretion (GO:0046878)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of the force of heart contraction by norepinephrine (GO:0003061)|protein localization to organelle (GO:0033365)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|response to cold (GO:0009409)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)|wound healing (GO:0042060)	early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|beta-adrenergic receptor activity (GO:0004939)|beta1-adrenergic receptor activity (GO:0004940)|dopamine binding (GO:0035240)|drug binding (GO:0008144)|epinephrine binding (GO:0051379)|norepinephrine binding (GO:0051380)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|receptor signaling protein activity (GO:0005057)	p.A173A(1)		large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)	6		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0124)|all cancers(201;0.0298)	Acebutolol(DB01193)|Alprenolol(DB00866)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Asenapine(DB06216)|Atenolol(DB00335)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dobutamine(DB00841)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Esmolol(DB00187)|Fenoterol(DB01288)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Loxapine(DB00408)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Practolol(DB01297)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Salbutamol(DB01001)|Sotalol(DB00489)|Timolol(DB00373)|Trimipramine(DB00726)	TGAcgcgcgcgcgggcgcggg	0.697																																					p.A173A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G519A	10						.						41.0	46.0	44.0					10																	115804410		2203	4299	6502	115794400	SO:0001819	synonymous_variant	153	exon1			J03019	CCDS7586.1	10q25.3	2012-08-08	2012-05-09		ENSG00000043591	ENSG00000043591		"""GPCR / Class A : Adrenoceptors : beta"""	285	protein-coding gene	gene with protein product		109630	"""adrenergic, beta-1-, receptor"""	ADRB1R			Standard	NM_000684		Approved		uc001lba.3	P08588	OTTHUMG00000019079	ENST00000369295.2:c.519G>A	10.37:g.115804410G>A			115794400	NM_000684	B0LPE2|Q5T5Y4|Q9UKG7|Q9UKG8	Silent	SNP	ENST00000369295.2	37	CCDS7586.1																																																																																				0.697	ADRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050448.1		
BCL9L	283149	broad.mit.edu	37	11	118773263	118773264	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr11:118773263_118773264insT	ENST00000334801.3	-	6	2152_2153	c.1188_1189insA	c.(1186-1191)tcagagfs	p.E397fs	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	397	Necessary for interaction with CTNNB1. {ECO:0000250}.|Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.E397fs*22(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		GACAAGCCCTCTGAGCCCACCA	0.678																																					p.E397fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.1189_1190insA	11						.																																			118278474	SO:0001589	frameshift_variant	283149	exon6			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.1189dupA	11.37:g.118773264_118773264dupT	ENSP00000335320:p.Glu397fs		118278473	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Frame_Shift_Ins	INS	ENST00000334801.3	37	CCDS8403.1																																																																																				0.678	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
OR51E1	143503	broad.mit.edu	37	11	4674582	4674582	+	Missense_Mutation	SNP	G	G	A	rs146565220	byFrequency	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr11:4674582G>A	ENST00000396952.5	+	2	1476	c.826G>A	c.(826-828)Gtc>Atc	p.V276I	OR51E1_ENST00000530215.1_Silent_p.P52P	NM_152430.3	NP_689643.2	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V275I(1)		NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCCGCTGCCCGTCATCTTGGC	0.483																																					p.V276I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G826A	11						.	A	ILE/VAL	6,4396	11.4+/-27.6	0,6,2195	164.0	153.0	157.0		826	-4.9	0.0	11	dbSNP_134	157	0,8596		0,0,4298	yes	missense	OR51E1	NM_152430.3	29	0,6,6493	AA,AG,GG		0.0,0.1363,0.0462	benign	276/319	4674582	6,12992	2201	4298	6499	4631158	SO:0001583	missense	143503	exon2			AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000396952.5:c.826G>A	11.37:g.4674582G>A	ENSP00000380155:p.Val276Ile		4631158	NM_152430	A8KAM6|Q5S4P5|Q66X57|Q6IF93	Missense_Mutation	SNP	ENST00000396952.5	37	CCDS31358.2	.	.	.	.	.	.	.	.	.	.	g	0.013	-1.608470	0.00842	0.001363	0.0	ENSG00000180785	ENST00000396952	T	0.71461	-0.57	4.77	-4.92	0.03075	GPCR, rhodopsin-like superfamily (1);	0.836308	0.10405	N	0.678707	T	0.46073	0.1374	N	0.16307	0.4	0.26776	N	0.96971	B	0.02656	0.0	B	0.06405	0.002	T	0.48479	-0.9032	10	0.02654	T	1	.	13.2922	0.60276	0.7394:0.0:0.2606:0.0	.	275	Q8TCB6	O51E1_HUMAN	I	276	ENSP00000380155:V276I	ENSP00000380155:V276I	V	+	1	0	OR51E1	4631158	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-0.468000	0.06656	-0.877000	0.04012	-1.564000	0.00881	GTC		0.483	OR51E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347136.2	NM_152430	
CCKBR	887	broad.mit.edu	37	11	6291427	6291427	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr11:6291427G>A	ENST00000334619.2	+	3	706	c.513G>A	c.(511-513)gcG>gcA	p.A171A	CCKBR_ENST00000525014.1_3'UTR|CCKBR_ENST00000532715.1_Silent_p.A87A|CCKBR_ENST00000525462.1_Silent_p.A171A	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	171				A -> P (in Ref. 11; AAA91831). {ECO:0000305}.	cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.A171A(2)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	GCTCCCACGCGGCTCGCGTGA	0.642																																					p.A171A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G513A	11						.						44.0	37.0	39.0					11																	6291427		2198	4290	6488	6248003	SO:0001819	synonymous_variant	887	exon3			D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.513G>A	11.37:g.6291427G>A			6248003	NM_176875	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Silent	SNP	ENST00000334619.2	37	CCDS7761.1																																																																																				0.642	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875	
FOXN4	121643	broad.mit.edu	37	12	109719495	109719495	+	Silent	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr12:109719495C>T	ENST00000299162.5	-	9	1115	c.1011G>A	c.(1009-1011)gcG>gcA	p.A337A	FOXN4_ENST00000355216.1_Silent_p.A157A	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	337					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A337A(1)|p.A157A(1)		large_intestine(5)|lung(9)|ovary(2)	16						GGCAGCCATGCGCCACGGCCA	0.687																																					p.A337A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1011A	12						.						25.0	17.0	20.0					12																	109719495		2191	4297	6488	108203878	SO:0001819	synonymous_variant	121643	exon9			AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.1011G>A	12.37:g.109719495C>T			108203878	NM_213596	Q6ZMR4|Q96NZ0	Silent	SNP	ENST00000299162.5	37	CCDS9126.2																																																																																				0.687	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328306.1	XM_062735	
HECTD4	283450	broad.mit.edu	37	12	112622834	112622834	+	Silent	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr12:112622834C>T	ENST00000430131.2	-	60	9815	c.8670G>A	c.(8668-8670)agG>agA	p.R2890R	HECTD4_ENST00000550722.1_Silent_p.R3166R|HECTD4_ENST00000377560.5_Silent_p.R3140R			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2890	Ser-rich.				glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R2890R(1)|p.R3140R(1)									TGACTTTTTTCCTCTTGGAGA	0.627																																					p.R3140R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G9420A	12						.						25.0	27.0	26.0					12																	112622834		2039	4179	6218	111107217	SO:0001819	synonymous_variant	283450	exon60			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.8670G>A	12.37:g.112622834C>T			111107217	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37																																																																																					0.627	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
PARP11	57097	broad.mit.edu	37	12	3931108	3931108	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr12:3931108G>A	ENST00000228820.4	-	6	623	c.479C>T	c.(478-480)aCg>aTg	p.T160M	PARP11_ENST00000397096.2_Missense_Mutation_p.T153M|PARP11_ENST00000447133.3_Missense_Mutation_p.T79M|PARP11_ENST00000476985.1_5'UTR|PARP11_ENST00000427057.2_Missense_Mutation_p.T79M	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	153	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.T153M(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			GCGATCCATCGTCTTCCCAAA	0.348																																					p.T160M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C479T	12						.						82.0	88.0	86.0					12																	3931108		2203	4300	6503	3801369	SO:0001583	missense	57097	exon6			AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.479C>T	12.37:g.3931108G>A	ENSP00000228820:p.Thr160Met		3801369	NM_020367	B4DRQ0|Q68DS1|Q8N5Y9	Missense_Mutation	SNP	ENST00000228820.4	37	CCDS8523.2	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323544	0.81580	.	.	ENSG00000111224	ENST00000397096;ENST00000427057;ENST00000228820;ENST00000447133	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.11	5.11	0.69529	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.051511	0.85682	D	0.000000	T	0.53658	0.1810	M	0.88512	2.96	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.973;0.984	T	0.62153	-0.6914	10	0.87932	D	0	.	16.0762	0.80969	0.0:0.0:1.0:0.0	.	79;160;153	Q9NR21-2;Q9NR21-4;Q9NR21	.;.;PAR11_HUMAN	M	153;79;160;79	ENSP00000380284:T153M;ENSP00000397058:T79M;ENSP00000228820:T160M;ENSP00000405385:T79M	ENSP00000228820:T160M	T	-	2	0	PARP11	3801369	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	8.893000	0.92498	2.633000	0.89246	0.637000	0.83480	ACG		0.348	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344213.1		
FIGNL2	401720	broad.mit.edu	37	12	52215893	52215893	+	lincRNA	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr12:52215893G>A	ENST00000562343.2	+	0	4188				RP11-923I11.4_ENST00000567167.1_lincRNA																							GGGTGGCTCCGGCCCTGGCCA	0.697																																					p.P102L												.	.	0			c.C305T	12						.						16.0	18.0	17.0					12																	52215893		1876	4077	5953	50502160			401720	exon1																															12.37:g.52215893G>A			50502160	NM_001013690		Missense_Mutation	SNP	ENST00000562343.2	37																																																																																					0.697	RP11-923I11.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000430848.2		
PAN2	9924	broad.mit.edu	37	12	56721305	56721305	+	Silent	SNP	G	G	A	rs200822157		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr12:56721305G>A	ENST00000425394.2	-	6	1138	c.762C>T	c.(760-762)ttC>ttT	p.F254F	PAN2_ENST00000257931.5_Silent_p.F254F|PAN2_ENST00000440411.3_Silent_p.F254F|PAN2_ENST00000548043.1_Silent_p.F254F	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)	p.F254F(1)		NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	GGCGGCTGGAGAAGCCACAGG	0.527																																					p.F254F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C762T	12						.						67.0	65.0	66.0					12																	56721305		2203	4300	6503	55007572	SO:0001819	synonymous_variant	9924	exon6			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.762C>T	12.37:g.56721305G>A			55007572	NM_001166279		Silent	SNP	ENST00000425394.2	37	CCDS44922.1																																																																																				0.527	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871	
LRP1	4035	broad.mit.edu	37	12	57550649	57550649	+	Missense_Mutation	SNP	A	A	C	rs199896480|rs368316421		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr12:57550649A>C	ENST00000243077.3	+	10	1973	c.1507A>C	c.(1507-1509)Acc>Ccc	p.T503P		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	503	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CAAGGCGCGGACCTGCCGCTG	0.642																																					p.T503P												.	.	0			c.A1507C	12						.						27.0	26.0	26.0					12																	57550649		2203	4300	6503	55836916	SO:0001583	missense	4035	exon10			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.1507A>C	12.37:g.57550649A>C	ENSP00000243077:p.Thr503Pro		55836916	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.049289	0.55218	.	.	ENSG00000123384	ENST00000243077	D	0.90563	-2.69	5.12	5.12	0.69794	Epidermal growth factor-like (1);	0.000000	0.64402	D	0.000001	D	0.95191	0.8441	M	0.85542	2.76	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	D	0.95411	0.8498	10	0.59425	D	0.04	.	13.2108	0.59822	1.0:0.0:0.0:0.0	.	503	Q07954	LRP1_HUMAN	P	503	ENSP00000243077:T503P	ENSP00000243077:T503P	T	+	1	0	LRP1	55836916	1.000000	0.71417	0.998000	0.56505	0.693000	0.40251	7.231000	0.78106	2.288000	0.76882	0.482000	0.46254	ACC		0.642	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
NAV3	89795	broad.mit.edu	37	12	78531117	78531117	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr12:78531117G>A	ENST00000397909.2	+	19	4775	c.4602G>A	c.(4600-4602)tcG>tcA	p.S1534S	NAV3_ENST00000228327.6_Silent_p.S1534S|NAV3_ENST00000536525.2_Silent_p.S1534S|NAV3_ENST00000266692.7_Silent_p.S1357S			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1534	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.S1534S(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TCAGTCATTCGGGCTCATTCA	0.488										HNSCC(70;0.22)																											p.S1534S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4602A	12						.						86.0	85.0	85.0					12																	78531117		1905	4133	6038	77055248	SO:0001819	synonymous_variant	89795	exon19			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4602G>A	12.37:g.78531117G>A			77055248	NM_014903	Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	g	4.828	0.153926	0.09185	.	.	ENSG00000067798	ENST00000552895	.	.	.	5.78	-6.4	0.01944	.	.	.	.	.	T	0.37865	0.1019	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39722	-0.9600	4	.	.	.	-10.6336	2.9817	0.05955	0.2131:0.1961:0.4021:0.1887	.	.	.	.	R	429	.	.	G	+	1	0	NAV3	77055248	0.003000	0.15002	0.857000	0.33713	0.598000	0.36846	-1.033000	0.03571	-1.272000	0.02427	-2.445000	0.00210	GGG		0.488	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
DCN	1634	broad.mit.edu	37	12	91546948	91546948	+	Missense_Mutation	SNP	G	G	A	rs144174426		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr12:91546948G>A	ENST00000052754.5	-	6	1172	c.671C>T	c.(670-672)aCg>aTg	p.T224M	DCN_ENST00000552962.1_Missense_Mutation_p.T224M|DCN_ENST00000420120.2_Missense_Mutation_p.T115M|DCN_ENST00000425043.1_Missense_Mutation_p.T77M|DCN_ENST00000393155.1_Missense_Mutation_p.T224M|DCN_ENST00000441303.2_Intron|DCN_ENST00000228329.5_Missense_Mutation_p.T115M|DCN_ENST00000303320.3_Intron|DCN_ENST00000547568.2_Missense_Mutation_p.T77M|DCN_ENST00000456569.2_Intron	NM_001920.3	NP_001911.1	P07585	PGS2_HUMAN	decorin	224					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|kidney development (GO:0001822)|organ morphogenesis (GO:0009887)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|placenta development (GO:0001890)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	collagen type VI trimer (GO:0005589)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)|poly(A) RNA binding (GO:0044822)	p.T224M(1)		central_nervous_system(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|skin(1)	20						ATGTAATTCCGTAAGGGAAGG	0.348																																					p.T224M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C671T	12						.	G	MET/THR,MET/THR,MET/THR,MET/THR,,	0,4406		0,0,2203	124.0	118.0	120.0		671,671,344,230,,	3.4	0.9	12	dbSNP_134	120	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense,missense,intron,intron	DCN	NM_001920.3,NM_133503.2,NM_133504.2,NM_133505.2,NM_133506.2,NM_133507.2	81,81,81,81,,	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging,probably-damaging,probably-damaging,,	224/360,224/360,115/251,77/213,,	91546948	3,13003	2203	4300	6503	90071079	SO:0001583	missense	1634	exon6			AF138300	CCDS9039.1, CCDS9040.1, CCDS9041.1, CCDS9042.1, CCDS44951.1	12q21.33	2014-04-16			ENSG00000011465	ENSG00000011465		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	2705	protein-coding gene	gene with protein product	"""decorin proteoglycan"""	125255				8432526	Standard	NM_133507		Approved	DSPG2, SLRR1B	uc001tbt.3	P07585	OTTHUMG00000169998	ENST00000052754.5:c.671C>T	12.37:g.91546948G>A	ENSP00000052754:p.Thr224Met		90071079	NM_001920	Q9P0Z0|Q9P0Z1|Q9Y5N8|Q9Y5N9	Missense_Mutation	SNP	ENST00000052754.5	37	CCDS9039.1	.	.	.	.	.	.	.	.	.	.	G	15.60	2.881672	0.51908	0.0	3.49E-4	ENSG00000011465	ENST00000052754;ENST00000228329;ENST00000393155;ENST00000425043;ENST00000552962;ENST00000420120;ENST00000547568;ENST00000546391	T;T;T;T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31;0.31;0.31;0.31	5.33	3.44	0.39384	.	0.219992	0.47455	D	0.000223	T	0.70806	0.3266	M	0.62016	1.91	0.46028	D	0.998829	D;D;D	0.89917	0.993;0.998;1.0	P;D;D	0.66716	0.709;0.933;0.946	T	0.68914	-0.5283	10	0.33940	T	0.23	.	15.7442	0.77926	0.0:0.2576:0.7424:0.0	.	224;77;115	P07585;P07585-3;P07585-2	PGS2_HUMAN;.;.	M	224;115;224;77;224;115;77;77	ENSP00000052754:T224M;ENSP00000228329:T115M;ENSP00000376862:T224M;ENSP00000401021:T77M;ENSP00000447654:T224M;ENSP00000413723:T115M;ENSP00000447674:T77M;ENSP00000446530:T77M	ENSP00000052754:T224M	T	-	2	0	DCN	90071079	1.000000	0.71417	0.939000	0.37840	0.920000	0.55202	4.746000	0.62133	0.580000	0.29522	0.591000	0.81541	ACG		0.348	DCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406799.3	NM_133507	
GLT1D1	144423	broad.mit.edu	37	12	129431952	129431952	+	Silent	SNP	C	C	T	rs12581064	byFrequency	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr12:129431952C>T	ENST00000442111.2	+	10	817	c.729C>T	c.(727-729)ttC>ttT	p.F243F	GLT1D1_ENST00000537468.1_Silent_p.F248F|GLT1D1_ENST00000542193.1_Silent_p.F160F|GLT1D1_ENST00000281703.6_Silent_p.F163F			Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	243					biosynthetic process (GO:0009058)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	transferase activity, transferring glycosyl groups (GO:0016757)	p.F163F(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		AGAATTGCTTCGCGGTGGTGA	0.483													C|||	89	0.0177716	0.0023	0.0029	5008	,	,		21243	0.0833		0.0	False		,,,				2504	0.0				p.F163F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C489T	12						.	C		1,4405	2.1+/-5.4	0,1,2202	189.0	157.0	168.0		489	-6.4	0.0	12	dbSNP_120	168	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	GLT1D1	NM_144669.1		0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308		163/267	129431952	4,13002	2203	4300	6503	127997905	SO:0001819	synonymous_variant	144423	exon6				CCDS9265.1	12q24.32	2013-02-22			ENSG00000151948	ENSG00000151948		"""Glycosyltransferase group 1 domain containing"""	26483	protein-coding gene	gene with protein product							Standard	NM_144669		Approved	FLJ31978	uc001uhx.1	Q96MS3	OTTHUMG00000168437	ENST00000442111.2:c.729C>T	12.37:g.129431952C>T			127997905	NM_144669	Q86XG8	Silent	SNP	ENST00000442111.2	37																																																																																					0.483	GLT1D1-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000399740.1	NM_144669	
SUGT1	10910	broad.mit.edu	37	13	53227187	53227187	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr13:53227187C>A	ENST00000343788.6	+	2	127	c.45C>A	c.(43-45)ttC>ttA	p.F15L	SUGT1_ENST00000310528.8_Missense_Mutation_p.F15L|SUGT1_ENST00000535397.1_5'UTR|SUGT1_ENST00000483074.1_3'UTR	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)	15					innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.F15L(1)		kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		ACAGGTTTTTCCAGAGCTTCT	0.522											OREG0022432	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F15L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C45A	13						.						125.0	135.0	131.0					13																	53227187		2203	4300	6503	52125188	SO:0001583	missense	10910	exon2			AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.45C>A	13.37:g.53227187C>A	ENSP00000367208:p.Phe15Leu	991	52125188	NM_001130912	A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Missense_Mutation	SNP	ENST00000343788.6	37	CCDS45050.1	.	.	.	.	.	.	.	.	.	.	C	14.02	2.411713	0.42817	.	.	ENSG00000165416	ENST00000343788;ENST00000310528	T;T	0.21031	2.03;2.06	4.02	3.17	0.36434	.	1.654180	0.02954	N	0.142081	T	0.14313	0.0346	N	0.14661	0.345	0.80722	D	1	B;B	0.12630	0.001;0.006	B;B	0.13407	0.001;0.009	T	0.16808	-1.0390	10	0.11485	T	0.65	2.3051	9.6628	0.39965	0.0:0.7875:0.2125:0.0	.	15;15	Q9Y2Z0;Q9Y2Z0-2	SUGT1_HUMAN;.	L	15	ENSP00000367208:F15L;ENSP00000308067:F15L	ENSP00000308067:F15L	F	+	3	2	SUGT1	52125188	0.996000	0.38824	0.968000	0.41197	0.926000	0.56050	2.346000	0.44027	0.897000	0.36392	-0.355000	0.07637	TTC		0.522	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045104.2		
LMO7	4008	broad.mit.edu	37	13	76335079	76335079	+	Missense_Mutation	SNP	C	C	A	rs75859487	byFrequency	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr13:76335079C>A	ENST00000341547.4	+	5	1638	c.378C>A	c.(376-378)aaC>aaA	p.N126K	LMO7_ENST00000321797.8_5'UTR|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000357063.3_Missense_Mutation_p.N126K|LMO7_ENST00000377534.3_Missense_Mutation_p.N126K|LMO7_ENST00000526202.1_Missense_Mutation_p.N35K|LMO7_ENST00000465261.2_5'UTR	NM_005358.5	NP_005349.3	Q8WWI1	LMO7_HUMAN	LIM domain 7	126	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N126K(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		ATAATATAAACGTTTTCTTGA	0.368																																					p.N126K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C378A	13						.						74.0	72.0	73.0					13																	76335079		2203	4300	6503	75233080	SO:0001583	missense	4008	exon5			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000341547.4:c.378C>A	13.37:g.76335079C>A	ENSP00000342112:p.Asn126Lys		75233080	NM_005358	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000341547.4	37	CCDS9454.1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140535	0.56936	.	.	ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000526202	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.85	5.66	-1.06	0.10002	.	0.000000	0.85682	D	0.000000	T	0.74921	0.3780	M	0.80982	2.52	0.39627	D	0.970118	D;D;D	0.89917	0.992;1.0;0.997	P;D;P	0.85130	0.889;0.997;0.851	T	0.74609	-0.3608	10	0.52906	T	0.07	-20.7505	10.3142	0.43727	0.0:0.3754:0.0:0.6246	.	35;126;74	E9PMS6;Q8WWI1-3;F8J2B5	.;.;.	K	126;126;126;74;35	ENSP00000342112:N126K;ENSP00000349571:N126K;ENSP00000366757:N126K;ENSP00000366719:N74K;ENSP00000431129:N35K	ENSP00000342112:N126K	N	+	3	2	LMO7	75233080	0.999000	0.42202	0.994000	0.49952	0.982000	0.71751	0.599000	0.24089	-0.134000	0.11516	-0.225000	0.12378	AAC		0.368	LMO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045297.1	NM_005358	
GPC5	2262	broad.mit.edu	37	13	92380805	92380805	+	Missense_Mutation	SNP	G	G	A	rs372530892		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr13:92380805G>A	ENST00000377067.3	+	4	1412	c.1040G>A	c.(1039-1041)cGc>cAc	p.R347H	GPC5_ENST00000483422.1_3'UTR	NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	347					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.R347L(2)|p.R347H(1)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ATTTGTGGCCGCCCTGTAAGA	0.418																																					p.R347H												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G1040A	13						.						110.0	113.0	112.0					13																	92380805		2203	4300	6503	91178806	SO:0001583	missense	2262	exon4			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1040G>A	13.37:g.92380805G>A	ENSP00000366267:p.Arg347His		91178806	NM_004466	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	.	.	.	.	.	.	.	.	.	.	G	2.216	-0.379434	0.05000	.	.	ENSG00000179399	ENST00000377067	T	0.48836	0.8	5.88	-6.19	0.02078	.	0.766929	0.12691	N	0.447174	T	0.16727	0.0402	N	0.05534	-0.03	0.09310	N	0.999995	B	0.06786	0.001	B	0.09377	0.004	T	0.30416	-0.9979	10	0.10377	T	0.69	-8.6529	4.9072	0.13804	0.622:0.1319:0.1513:0.0947	.	347	P78333	GPC5_HUMAN	H	347	ENSP00000366267:R347H	ENSP00000366267:R347H	R	+	2	0	GPC5	91178806	0.020000	0.18652	0.744000	0.31058	0.664000	0.39144	-0.447000	0.06828	-0.706000	0.05028	0.557000	0.71058	CGC		0.418	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466	
TPP2	7174	broad.mit.edu	37	13	103309451	103309451	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr13:103309451A>G	ENST00000376065.4	+	24	3034	c.2998A>G	c.(2998-3000)Act>Gct	p.T1000A	TPP2_ENST00000376052.3_Missense_Mutation_p.T1013A|TPP2_ENST00000466153.1_3'UTR	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	1000					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)	p.T1000A(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACCAACAAAGACTAAGAATGG	0.318																																					p.T1000A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2998G	13						.						97.0	96.0	97.0					13																	103309451		2203	4299	6502	102107452	SO:0001583	missense	7174	exon24			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2998A>G	13.37:g.103309451A>G	ENSP00000365233:p.Thr1000Ala		102107452	NM_003291	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	37	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	A	9.975	1.226552	0.22542	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.78	1.64	0.23874	.	0.478584	0.25302	N	0.031656	T	0.21631	0.0521	L	0.38175	1.15	0.30749	N	0.745343	B	0.06786	0.001	B	0.01281	0.0	T	0.26018	-1.0115	9	0.02654	T	1	.	2.7778	0.05352	0.5561:0.1286:0.0678:0.2475	.	1000	P29144	TPP2_HUMAN	A	1000;1013	.	ENSP00000365220:T1013A	T	+	1	0	TPP2	102107452	0.653000	0.27358	0.996000	0.52242	0.982000	0.71751	0.733000	0.26087	0.493000	0.27837	0.533000	0.62120	ACT		0.318	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
SEC23A	10484	broad.mit.edu	37	14	39510023	39510023	+	Silent	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr14:39510023C>T	ENST00000307712.6	-	18	2572	c.2055G>A	c.(2053-2055)ctG>ctA	p.L685L	SEC23A_ENST00000537403.1_Silent_p.L483L|SEC23A_ENST00000536508.1_Silent_p.L583L|SEC23A_ENST00000545328.2_Silent_p.L656L	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	685					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.L685L(1)		kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		CTGGGGCTTGCAGAAGGTGGC	0.418																																					p.L685L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2055A	14						.						108.0	99.0	102.0					14																	39510023		2203	4300	6503	38579774	SO:0001819	synonymous_variant	10484	exon18			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.2055G>A	14.37:g.39510023C>T			38579774	NM_006364	B2R5P4|B3KXI2|Q8NE16	Silent	SNP	ENST00000307712.6	37	CCDS9668.1																																																																																				0.418	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2		
C14orf183	196913	broad.mit.edu	37	14	50558473	50558473	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr14:50558473G>T	ENST00000305273.1	-	2	94	c.95C>A	c.(94-96)cCt>cAt	p.P32H	RP11-58E21.5_ENST00000603228.1_lincRNA|RP11-58E21.7_ENST00000556019.2_lincRNA	NM_001014830.1	NP_001014830.1	Q8WXQ3	CN183_HUMAN	chromosome 14 open reading frame 183	32								p.P32H(1)		endometrium(2)|large_intestine(2)|lung(3)	7						CTTCCCCTGAGGTTCGGGCTT	0.647																																					p.P32H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C95A	14						.						20.0	19.0	20.0					14																	50558473		2037	4213	6250	49628223	SO:0001583	missense	196913	exon2			AF390030	CCDS45101.1	14q21.3	2012-09-26			ENSG00000168260	ENSG00000168260			27285	protein-coding gene	gene with protein product							Standard	NM_001014830		Approved		uc010tqk.2	Q8WXQ3	OTTHUMG00000170858	ENST00000305273.1:c.95C>A	14.37:g.50558473G>T	ENSP00000303234:p.Pro32His		49628223	NM_001014830		Missense_Mutation	SNP	ENST00000305273.1	37	CCDS45101.1	.	.	.	.	.	.	.	.	.	.	G	7.548	0.662078	0.14645	.	.	ENSG00000168260	ENST00000305273	.	.	.	2.31	0.392	0.16288	.	.	.	.	.	T	0.24122	0.0584	N	0.08118	0	0.09310	N	1	D	0.71674	0.998	P	0.59012	0.85	T	0.10497	-1.0627	8	0.87932	D	0	.	3.48	0.07598	0.163:0.2691:0.5679:0.0	.	32	Q8WXQ3	CN183_HUMAN	H	32	.	ENSP00000303234:P32H	P	-	2	0	C14orf183	49628223	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	0.055000	0.14229	0.088000	0.17205	0.543000	0.68304	CCT		0.647	C14orf183-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000410705.1	NM_001014830	
SERPINA5	5104	broad.mit.edu	37	14	95056584	95056584	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr14:95056584C>A	ENST00000554866.1	+	3	940	c.826C>A	c.(826-828)Cag>Aag	p.Q276K	SERPINA5_ENST00000329597.7_Missense_Mutation_p.Q276K|SERPINA5_ENST00000553780.1_Missense_Mutation_p.Q276K|SERPINA5_ENST00000554276.1_Missense_Mutation_p.Q276K|RP11-986E7.7_ENST00000553947.1_5'Flank			P05154	IPSP_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5	276					fusion of sperm to egg plasma membrane (GO:0007342)|lipid transport (GO:0006869)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|spermatogenesis (GO:0007283)	acrosomal membrane (GO:0002080)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|platelet alpha granule (GO:0031091)|platelet dense tubular network (GO:0031094)|protein C inhibitor-coagulation factor V complex (GO:0097181)|protein C inhibitor-coagulation factor Xa complex (GO:0097182)|protein C inhibitor-coagulation factor XI complex (GO:0097183)|protein C inhibitor-KLK3 complex (GO:0036029)|protein C inhibitor-plasma kallikrein complex (GO:0036030)|protein C inhibitor-PLAT complex (GO:0036026)|protein C inhibitor-PLAU complex (GO:0036027)|protein C inhibitor-thrombin complex (GO:0036028)|protein C inhibitor-TMPRSS11E complex (GO:0036025)|protein C inhibitor-TMPRSS7 complex (GO:0036024)|protein complex (GO:0043234)	acrosin binding (GO:0032190)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|phosphatidylcholine binding (GO:0031210)|protease binding (GO:0002020)|retinoic acid binding (GO:0001972)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q276K(1)		endometrium(3)|large_intestine(5)|lung(18)|ovary(2)|skin(5)|upper_aerodigestive_tract(3)	36				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	GGGAAAGATGCAGCAGGTGGA	0.542																																					p.Q276K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C826A	14						.						79.0	79.0	79.0					14																	95056584		2203	4300	6503	94126337	SO:0001583	missense	5104	exon4			M68516	CCDS9928.1	14q32.1	2014-02-18	2005-08-18		ENSG00000188488	ENSG00000188488		"""Serine (or cysteine) peptidase inhibitors"""	8723	protein-coding gene	gene with protein product		601841	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5"""	PLANH3, PCI		1714450, 8381582, 24172014	Standard	NM_000624		Approved	PAI3, PROCI	uc001ydm.3	P05154	OTTHUMG00000170860	ENST00000554866.1:c.826C>A	14.37:g.95056584C>A	ENSP00000451126:p.Gln276Lys		94126337	NM_000624	Q07616|Q9UG30	Missense_Mutation	SNP	ENST00000554866.1	37	CCDS9928.1	.	.	.	.	.	.	.	.	.	.	C	4.976	0.181278	0.09495	.	.	ENSG00000188488	ENST00000553780;ENST00000554760;ENST00000554866;ENST00000329597;ENST00000554506;ENST00000537685;ENST00000438291;ENST00000554276	D;D;D;D;D	0.84442	-1.59;-1.85;-1.59;-1.59;-1.59	4.81	-2.82	0.05787	Serpin domain (3);	1.746550	0.03100	N	0.160941	T	0.69531	0.3121	N	0.11154	0.105	0.20489	N	0.999893	B;B	0.13594	0.008;0.005	B;B	0.14023	0.01;0.009	T	0.56475	-0.7973	10	0.23302	T	0.38	.	6.3523	0.21383	0.5624:0.2928:0.1448:0.0	.	276;276	G3V5Q9;P05154	.;IPSP_HUMAN	K	276;276;276;276;52;128;200;276	ENSP00000450837:Q276K;ENSP00000452469:Q276K;ENSP00000451126:Q276K;ENSP00000333203:Q276K;ENSP00000451610:Q276K	ENSP00000333203:Q276K	Q	+	1	0	SERPINA5	94126337	0.000000	0.05858	0.006000	0.13384	0.476000	0.33039	-0.359000	0.07632	-0.374000	0.07967	-0.311000	0.09066	CAG		0.542	SERPINA5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410726.1	NM_000624	
TUBGCP5	114791	broad.mit.edu	37	15	22846924	22846924	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr15:22846924G>A	ENST00000283645.4	+	8	929	c.799G>A	c.(799-801)Gag>Aag	p.E267K	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.E267K	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	267					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.E267K(1)		breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		TTTGGTTACTGAGACTCAGGT	0.358																																					p.E267K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G799A	15						.						138.0	119.0	126.0					15																	22846924		2203	4300	6503	20398365	SO:0001583	missense	114791	exon8			AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.799G>A	15.37:g.22846924G>A	ENSP00000283645:p.Glu267Lys		20398365	NM_052903	E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	ENST00000283645.4	37	CCDS10008.1	.	.	.	.	.	.	.	.	.	.	.	28.4	4.919380	0.92249	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.68765	-0.35;-0.33	4.93	4.02	0.46733	.	0.058995	0.64402	D	0.000003	T	0.60170	0.2248	L	0.34521	1.04	0.80722	D	1	P;P	0.46706	0.883;0.883	P;P	0.45232	0.474;0.474	T	0.65561	-0.6138	10	0.87932	D	0	-25.2648	13.3258	0.60459	0.0761:0.0:0.9239:0.0	.	267;267	Q96RT8;E9PB12	GCP5_HUMAN;.	K	267	ENSP00000283645:E267K;ENSP00000409217:E267K	ENSP00000283645:E267K	E	+	1	0	TUBGCP5	20398365	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	8.810000	0.91950	1.307000	0.44944	0.655000	0.94253	GAG		0.358	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250998.2	NM_052903	
RPAP1	26015	broad.mit.edu	37	15	41816091	41816091	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr15:41816091C>G	ENST00000304330.4	-	17	2430	c.2314G>C	c.(2314-2316)Gag>Cag	p.E772Q	RPAP1_ENST00000561603.1_Missense_Mutation_p.E772Q	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	772						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.E772Q(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		AGACACGGCTCAACAAGAGGC	0.582																																					p.E772Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2314C	15						.						33.0	32.0	32.0					15																	41816091		2203	4300	6503	39603383	SO:0001583	missense	26015	exon17			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.2314G>C	15.37:g.41816091C>G	ENSP00000306123:p.Glu772Gln		39603383	NM_015540	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.959072	0.74016	.	.	ENSG00000103932	ENST00000304330	T	0.66280	-0.2	5.0	5.0	0.66597	.	0.130139	0.52532	D	0.000066	T	0.60958	0.2309	L	0.50333	1.59	0.47308	D	0.99938	P	0.40302	0.712	B	0.40565	0.333	T	0.67515	-0.5651	10	0.87932	D	0	-20.2253	16.8474	0.85984	0.0:1.0:0.0:0.0	.	772	Q9BWH6	RPAP1_HUMAN	Q	772	ENSP00000306123:E772Q	ENSP00000306123:E772Q	E	-	1	0	RPAP1	39603383	0.994000	0.37717	0.988000	0.46212	0.882000	0.50991	3.736000	0.55052	2.309000	0.77851	0.563000	0.77884	GAG		0.582	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540	
ZNF174	7727	broad.mit.edu	37	16	3458832	3458832	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr16:3458832G>A	ENST00000268655.4	+	3	1722	c.1137G>A	c.(1135-1137)gaG>gaA	p.E379E	ZNF174_ENST00000571936.1_Silent_p.E379E	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	379					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.E379E(1)		endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						ACACTGGAGAGAAGCCATACC	0.557																																					p.E379E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1137A	16						.						48.0	55.0	52.0					16																	3458832		2197	4300	6497	3398833	SO:0001819	synonymous_variant	7727	exon3			U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.1137G>A	16.37:g.3458832G>A			3398833	NM_003450	Q53Y68|Q9BQ34	Silent	SNP	ENST00000268655.4	37	CCDS10504.1																																																																																				0.557	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251510.1	NM_003450	
NUP93	9688	broad.mit.edu	37	16	56867189	56867189	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr16:56867189G>A	ENST00000308159.5	+	13	1529	c.1408G>A	c.(1408-1410)Gcg>Acg	p.A470T	NUP93_ENST00000542526.1_Missense_Mutation_p.A347T|NUP93_ENST00000569842.1_Missense_Mutation_p.A470T|NUP93_ENST00000564887.1_Missense_Mutation_p.A347T	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	470					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.A470T(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						GTTCCTGACAGCGCAGTTTGA	0.527																																					p.A470T	Colon(33;610 796 1305 1705 38917)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1408A	16						.						158.0	134.0	142.0					16																	56867189		2198	4300	6498	55424690	SO:0001583	missense	9688	exon13			D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.1408G>A	16.37:g.56867189G>A	ENSP00000310668:p.Ala470Thr		55424690	NM_014669	B3KPQ8|Q14705	Missense_Mutation	SNP	ENST00000308159.5	37	CCDS10769.1	.	.	.	.	.	.	.	.	.	.	G	36	5.921052	0.97105	.	.	ENSG00000102900	ENST00000308159;ENST00000542526	T;T	0.44083	0.93;0.93	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.58424	0.2121	L	0.55481	1.735	0.80722	D	1	P	0.51147	0.942	P	0.58266	0.836	T	0.56444	-0.7978	10	0.51188	T	0.08	-14.9935	19.4936	0.95062	0.0:0.0:1.0:0.0	.	470	Q8N1F7	NUP93_HUMAN	T	470;347	ENSP00000310668:A470T;ENSP00000440235:A347T	ENSP00000310668:A470T	A	+	1	0	NUP93	55424690	1.000000	0.71417	0.474000	0.27266	0.986000	0.74619	9.869000	0.99810	2.605000	0.88082	0.655000	0.94253	GCG		0.527	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669	
SLC12A4	6560	broad.mit.edu	37	16	67980939	67980939	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr16:67980939G>A	ENST00000316341.3	-	17	2282	c.2142C>T	c.(2140-2142)ttC>ttT	p.F714F	SLC12A4_ENST00000576616.1_Silent_p.F714F|SLC12A4_ENST00000572037.1_Silent_p.F666F|CTC-479C5.17_ENST00000590594.1_lincRNA|SLC12A4_ENST00000338335.3_Silent_p.F714F|LCAT_ENST00000264005.5_5'Flank|SLC12A4_ENST00000422611.2_Silent_p.F716F|SLC12A4_ENST00000541864.2_Silent_p.F683F|SLC12A4_ENST00000537830.2_Silent_p.F708F	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	714					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.F714F(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCTGGGAGGCGAAGGTGAGGA	0.657																																					p.F683F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2049T	16						.						33.0	31.0	31.0					16																	67980939		2198	4300	6498	66538440	SO:0001819	synonymous_variant	6560	exon17				CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.2142C>T	16.37:g.67980939G>A			66538440	NM_001145964	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Silent	SNP	ENST00000316341.3	37	CCDS10855.1																																																																																				0.657	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072	
TP53	7157	broad.mit.edu	37	17	7578402	7578402	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr17:7578402G>T	ENST00000269305.4	-	5	717	c.528C>A	c.(526-528)tgC>tgA	p.C176*	TP53_ENST00000445888.2_Nonsense_Mutation_p.C176*|TP53_ENST00000420246.2_Nonsense_Mutation_p.C176*|TP53_ENST00000359597.4_Nonsense_Mutation_p.C176*|TP53_ENST00000413465.2_Nonsense_Mutation_p.C176*|TP53_ENST00000455263.2_Nonsense_Mutation_p.C176*|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176*(12)|p.C176W(11)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H178fs*69(3)|p.R175_E180delRCPHHE(3)|p.C83*(2)|p.V173fs*59(2)|p.C44*(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176F(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.P177fs*4(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATGGTGGGGGCAGCGCCTCA	0.647		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C176X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-1 	.	75	Deletion - Frameshift(21)|Substitution - Nonsense(16)|Deletion - In frame(13)|Substitution - Missense(12)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(2)	breast(15)|large_intestine(12)|upper_aerodigestive_tract(8)|lung(8)|oesophagus(8)|haematopoietic_and_lymphoid_tissue(5)|ovary(4)|bone(4)|stomach(2)|central_nervous_system(2)|liver(2)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|skin(1)|pancreas(1)	c.C528A	17						.						48.0	48.0	48.0					17																	7578402		2203	4300	6503	7519127	SO:0001587	stop_gained	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.528C>A	17.37:g.7578402G>T	ENSP00000269305:p.Cys176*		7519127	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.184208	0.78677	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.59	-1.32	0.09201	.	0.092184	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.1821	6.7443	0.23453	0.3734:0.1173:0.5093:0.0	.	.	.	.	X	176;176;176;176;176;176;165;83;44;83;44	.	ENSP00000269305:C176X	C	-	3	2	TP53	7519127	1.000000	0.71417	0.991000	0.47740	0.860000	0.49131	0.743000	0.26231	-0.094000	0.12374	-0.126000	0.14955	TGC		0.647	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	broad.mit.edu	37	17	7668735	7668735	+	Silent	SNP	C	C	T	rs201677291		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr17:7668735C>T	ENST00000572933.1	+	21	4823	c.3363C>T	c.(3361-3363)aaC>aaT	p.N1121N	DNAH2_ENST00000389173.2_Silent_p.N1121N			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1121	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.N1121N(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				ACAGTCTCAACGGGGAGTGGG	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		19226	0.001		0.0	False		,,,				2504	0.0				p.N1121N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3363T	17						.						96.0	88.0	91.0					17																	7668735		2203	4300	6503	7609460	SO:0001819	synonymous_variant	146754	exon20			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.3363C>T	17.37:g.7668735C>T			7609460	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																				0.547	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
ACE	1636	broad.mit.edu	37	17	61560880	61560880	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr17:61560880G>T	ENST00000290866.4	+	10	1571	c.1547G>T	c.(1546-1548)gGa>gTa	p.G516V	ACE_ENST00000421982.2_5'Flank|ACE_ENST00000490216.2_5'Flank|ACE_ENST00000428043.1_Missense_Mutation_p.G516V|ACE_ENST00000584529.1_3'UTR|ACE_ENST00000413513.3_5'Flank|ACE_ENST00000290863.6_5'Flank|ACE_ENST00000538928.1_Nonsense_Mutation_p.E468*|ACE_ENST00000577647.1_5'Flank	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	516	Peptidase M2 1.				angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)	p.G516V(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	TTTGATGCTGGAGCTAAGTTT	0.498																																					p.G516V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1547T	17						.						144.0	134.0	138.0					17																	61560880		2203	4300	6503	58914612	SO:0001583	missense	1636	exon10			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.1547G>T	17.37:g.61560880G>T	ENSP00000290866:p.Gly516Val		58914612	NM_000789	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.414988|5.414988	0.96092|0.96092	.|.	.|.	ENSG00000159640|ENSG00000159640	ENST00000538928|ENST00000290866;ENST00000428043	.|T;T	.|0.54866	.|0.55;0.55	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.78470	.|0.4288	M|M	0.93898|0.93898	3.47|3.47	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.997	.|D	.|0.83545	.|0.0098	.|10	0.87932|0.66056	D|D	0|0.02	-13.7745|-13.7745	13.6101|13.6101	0.62074|0.62074	0.0766:0.0:0.9234:0.0|0.0766:0.0:0.9234:0.0	.|.	.|516;516	.|P12821-2;P12821	.|.;ACE_HUMAN	X|V	468|516	.|ENSP00000290866:G516V;ENSP00000397593:G516V	ENSP00000439591:E468X|ENSP00000290866:G516V	E|G	+|+	1|2	0|0	ACE|ACE	58914612|58914612	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	5.772000|5.772000	0.68889|0.68889	2.541000|2.541000	0.85698|0.85698	0.455000|0.455000	0.32223|0.32223	GAG|GGA		0.498	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337675.2		
CDH20	28316	broad.mit.edu	37	18	59157873	59157873	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr18:59157873G>A	ENST00000262717.4	+	2	485	c.87G>A	c.(85-87)acG>acA	p.T29T	CDH20_ENST00000536675.2_Silent_p.T29T|CDH20_ENST00000538374.1_Silent_p.T29T			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	29					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T29T(1)		breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				TGGACCTTACGACCACCGTTC	0.522																																					p.T29T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G87A	18						.						140.0	120.0	127.0					18																	59157873		2203	4300	6503	57308853	SO:0001819	synonymous_variant	28316	exon1			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.87G>A	18.37:g.59157873G>A			57308853	NM_031891	Q495S3	Silent	SNP	ENST00000262717.4	37	CCDS11977.1																																																																																				0.522	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
RFX1	5989	broad.mit.edu	37	19	14094035	14094035	+	Silent	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:14094035C>T	ENST00000254325.4	-	4	711	c.477G>A	c.(475-477)tcG>tcA	p.S159S		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	159					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)	p.S159S(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			GCTGGAGGGGCGACACGTGGC	0.667																																					p.S159S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G477A	19						.						60.0	48.0	52.0					19																	14094035		2198	4288	6486	13955035	SO:0001819	synonymous_variant	5989	exon4				CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.477G>A	19.37:g.14094035C>T			13955035	NM_002918		Silent	SNP	ENST00000254325.4	37	CCDS12301.1																																																																																				0.667	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918	
JSRP1	126306	broad.mit.edu	37	19	2252653	2252653	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:2252653C>T	ENST00000300961.6	-	7	735	c.671G>A	c.(670-672)cGg>cAg	p.R224Q	MIR4321_ENST00000592276.1_RNA|JSRP1_ENST00000586471.2_Missense_Mutation_p.R224Q	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	224	Arg-rich.				protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)		p.R224Q(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACGGTCCTCCCGGACGGCCTC	0.692																																					p.R224Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G671A	19						.						46.0	56.0	52.0					19																	2252653		2197	4294	6491	2203653	SO:0001583	missense	126306	exon7			AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.671G>A	19.37:g.2252653C>T	ENSP00000300961:p.Arg224Gln		2203653	NM_144616		Missense_Mutation	SNP	ENST00000300961.6	37	CCDS12086.1	.	.	.	.	.	.	.	.	.	.	c	11.17	1.559718	0.27827	.	.	ENSG00000167476	ENST00000300961	T	0.17054	2.3	4.45	-1.97	0.07503	.	.	.	.	.	T	0.05868	0.0153	N	0.08118	0	0.09310	N	1	B	0.19935	0.04	B	0.15870	0.014	T	0.39663	-0.9603	9	0.22706	T	0.39	.	0.9174	0.01308	0.2484:0.3712:0.1254:0.255	.	224	Q96MG2	JSPR1_HUMAN	Q	224	ENSP00000300961:R224Q	ENSP00000300961:R224Q	R	-	2	0	JSRP1	2203653	0.000000	0.05858	0.302000	0.25058	0.154000	0.21943	-0.215000	0.09279	0.121000	0.18284	0.556000	0.70494	CGG		0.692	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451266.2	NM_144616	
USHBP1	83878	broad.mit.edu	37	19	17367447	17367447	+	Missense_Mutation	SNP	G	G	A	rs201299465		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:17367447G>A	ENST00000252597.3	-	9	1476	c.1303C>T	c.(1303-1305)Cgc>Tgc	p.R435C	AC010646.3_ENST00000594059.1_5'Flank|USHBP1_ENST00000431146.2_Missense_Mutation_p.R371C	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1									p.R435C(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						AGAGAACGGCGCTCCTGGAGA	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18468	0.0		0.0	False		,,,				2504	0.0				p.R435C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1303T	19						.						68.0	68.0	68.0					19																	17367447		2203	4300	6503	17228447	SO:0001583	missense	83878	exon9			AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.1303C>T	19.37:g.17367447G>A	ENSP00000252597:p.Arg435Cys		17228447	NM_031941		Missense_Mutation	SNP	ENST00000252597.3	37	CCDS12353.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	15.92	2.975013	0.53720	.	.	ENSG00000130307	ENST00000252597;ENST00000431146	T;T	0.19806	2.12;2.12	4.9	3.86	0.44501	.	0.439796	0.22930	N	0.053915	T	0.31765	0.0807	M	0.64997	1.995	0.52501	D	0.999956	B;D	0.76494	0.127;0.999	B;P	0.53146	0.017;0.719	T	0.05886	-1.0858	10	0.72032	D	0.01	-8.4245	9.2958	0.37815	0.1005:0.0:0.8995:0.0	.	371;435	B4DUE8;Q8N6Y0	.;USBP1_HUMAN	C	435;371	ENSP00000252597:R435C;ENSP00000407902:R371C	ENSP00000252597:R435C	R	-	1	0	USHBP1	17228447	0.006000	0.16342	0.919000	0.36401	0.428000	0.31595	1.392000	0.34486	1.069000	0.40788	0.655000	0.94253	CGC		0.577	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463328.1	NM_031941	
ZBTB7A	51341	broad.mit.edu	37	19	4054014	4054014	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:4054014C>A	ENST00000322357.4	-	2	1495	c.1217G>T	c.(1216-1218)gGc>gTc	p.G406V	ZBTB7A_ENST00000601588.1_Missense_Mutation_p.G406V	NM_015898.2	NP_056982.1	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	406					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)	p.G406V(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCTTCTCGCCCGTGTGGGT	0.667																																					p.G406V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1217T	19						.						57.0	52.0	54.0					19																	4054014		2203	4299	6502	4005014	SO:0001583	missense	51341	exon2			AF000561	CCDS12119.1	19p13.3	2013-01-08		2005-04-07		ENSG00000178951		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18078	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 7A, HIV-1 inducer of short transcripts binding protein"", ""lymphoma related factor"""	605878	"""zinc finger and BTB domain containing 7"""	ZBTB7		9973611, 9927193	Standard	NM_015898		Approved	FBI-1, LRF, DKFZp547O146, pokemon, ZNF857A	uc002lzi.3	O95365		ENST00000322357.4:c.1217G>T	19.37:g.4054014C>A	ENSP00000323670:p.Gly406Val		4005014	NM_015898	D6W619|O00456|Q14D41|Q5XG86	Missense_Mutation	SNP	ENST00000322357.4	37	CCDS12119.1	.	.	.	.	.	.	.	.	.	.	C	19.51	3.840971	0.71488	.	.	ENSG00000178951	ENST00000322357	T	0.23552	1.9	5.03	5.03	0.67393	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64816	-0.6318	10	0.87932	D	0	.	16.9262	0.86177	0.0:1.0:0.0:0.0	.	406	O95365	ZBT7A_HUMAN	V	406	ENSP00000323670:G406V	ENSP00000323670:G406V	G	-	2	0	ZBTB7A	4005014	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.707000	0.84623	2.336000	0.79503	0.462000	0.41574	GGC		0.667	ZBTB7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457621.2	NM_015898	
PLIN4	729359	broad.mit.edu	37	19	4511223	4511223	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:4511223C>T	ENST00000301286.3	-	3	2706	c.2707G>A	c.(2707-2709)Gtg>Atg	p.V903M		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	903	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)		p.V831M(3)		NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						CTGGTGTCCACGCCGGTCTGG	0.582																																					p.V903M												.	.	3	Substitution - Missense(3)	large_intestine(1)|NS(1)|skin(1)	c.G2707A	19						.						104.0	105.0	105.0					19																	4511223		2066	4200	6266	4462223	SO:0001583	missense	729359	exon3			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2707G>A	19.37:g.4511223C>T	ENSP00000301286:p.Val903Met		4462223	NM_001080400	A6NEI2	Missense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	c	7.460	0.644487	0.14451	.	.	ENSG00000167676	ENST00000301286	T	0.05786	3.39	4.86	-9.71	0.00518	.	1.181700	0.06524	N	0.740128	T	0.02848	0.0085	N	0.10972	0.075	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.43718	-0.9374	10	0.44086	T	0.13	-0.9896	7.067	0.25157	0.0612:0.4231:0.1216:0.3941	.	903	Q96Q06	PLIN4_HUMAN	M	903	ENSP00000301286:V903M	ENSP00000301286:V903M	V	-	1	0	PLIN4	4462223	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.575000	0.00213	-3.038000	0.00264	-2.920000	0.00090	GTG		0.582	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
TSHZ3	57616	broad.mit.edu	37	19	31769253	31769253	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:31769253G>A	ENST00000240587.4	-	2	1773	c.1446C>T	c.(1444-1446)gaC>gaT	p.D482D		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	482					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D299D(1)|p.D482D(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TAGGTTTCTCGTCAGTGACCG	0.478																																					p.D482D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1446T	19						.						185.0	187.0	187.0					19																	31769253		2203	4300	6503	36461093	SO:0001819	synonymous_variant	57616	exon2			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1446C>T	19.37:g.31769253G>A			36461093	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																				0.478	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
CYP2F1	1572	broad.mit.edu	37	19	41627913	41627913	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:41627913C>T	ENST00000331105.2	+	6	769	c.697C>T	c.(697-699)Cgc>Tgc	p.R233C		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	233					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.R233C(1)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						GCCGCACCAACGCATCTTCCA	0.597																																					p.R233C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C697T	19						.						66.0	68.0	68.0					19																	41627913		2202	4299	6501	46319753	SO:0001583	missense	1572	exon6			J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.697C>T	19.37:g.41627913C>T	ENSP00000333534:p.Arg233Cys		46319753	NM_000774	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Missense_Mutation	SNP	ENST00000331105.2	37	CCDS12572.1	.	.	.	.	.	.	.	.	.	.	N	13.88	2.367962	0.42003	.	.	ENSG00000197446	ENST00000331105	T	0.72167	-0.63	3.21	2.06	0.26882	.	0.680436	0.14730	U	0.301835	T	0.77239	0.4101	L	0.60012	1.86	0.09310	N	0.999999	P;D;D	0.89917	0.87;1.0;0.997	B;D;P	0.67103	0.293;0.949;0.84	T	0.63444	-0.6636	10	0.87932	D	0	.	7.9888	0.30229	0.408:0.592:0.0:0.0	.	19;233;233	B4DL83;Q32MN5;P24903	.;.;CP2F1_HUMAN	C	233	ENSP00000333534:R233C	ENSP00000333534:R233C	R	+	1	0	CYP2F1	46319753	0.000000	0.05858	0.267000	0.24556	0.484000	0.33280	0.327000	0.19663	1.641000	0.50575	0.398000	0.26397	CGC		0.597	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394527.2		
UHRF1	29128	broad.mit.edu	37	19	4960756	4960756	+	RNA	SNP	A	A	C			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:4960756A>C	ENST00000592666.1	+	0	2899							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.N787T(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		ATGCAGGTGAACCAGCCTCTG	0.597																																					p.T775P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2323C	19						.						9.0	12.0	11.0					19																	4960756		1857	4009	5866	4911756			29128	exon17			AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4960756A>C			4911756	NM_001048201	A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	Missense_Mutation	SNP	ENST00000592666.1	37		.	.	.	.	.	.	.	.	.	.	A	21.1	4.092564	0.76756	.	.	ENSG00000034063	ENST00000262952;ENST00000396708;ENST00000455180;ENST00000543616;ENST00000398240	.	.	.	4.43	4.43	0.53597	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.78616	0.4311	.	.	.	0.46499	D	0.999072	D;D	0.89917	0.997;1.0	D;D	0.97110	0.98;1.0	D	0.84930	0.0859	7	0.87932	D	0	-37.6672	14.018	0.64536	1.0:0.0:0.0:0.0	.	788;775	Q2HIX7;Q96T88	.;UHRF1_HUMAN	T	774;389;774;774;787	.	ENSP00000262952:N774T	N	+	2	0	UHRF1	4911756	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	9.191000	0.94940	1.781000	0.52344	0.459000	0.35465	AAC		0.597	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000450444.1	NM_001048201	
HNRNPUL1	11100	broad.mit.edu	37	19	41774205	41774205	+	Missense_Mutation	SNP	G	G	A	rs144715337		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:41774205G>A	ENST00000392006.3	+	2	546	c.373G>A	c.(373-375)Gag>Aag	p.E125K	HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.E125K|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.E25K|HNRNPUL1_ENST00000594207.1_3'UTR|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.E36K|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.E25K|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.E25K|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.E82K	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	125					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E125K(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						GTCAGGCTACGAGAGGAGACC	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		20122	0.0		0.0	False		,,,				2504	0.001				p.E25K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G73A	19						.	G	LYS/GLU,LYS/GLU	0,4406		0,0,2203	131.0	99.0	110.0		373,73	4.1	0.9	19	dbSNP_134	110	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	HNRNPUL1	NM_007040.3,NM_144732.2	56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	125/857,25/757	41774205	1,13005	2203	4300	6503	46466045	SO:0001583	missense	11100	exon2			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.373G>A	19.37:g.41774205G>A	ENSP00000375863:p.Glu125Lys		46466045	NM_144732	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	37	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384965	0.61956	0.0	1.16E-4	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;D;T;D	0.91843	0.77;-2.92;1.54;-2.91	5.11	4.07	0.47477	.	0.418838	0.27782	N	0.017869	T	0.81889	0.4918	N	0.20685	0.6	0.26592	N	0.973178	P;B;B;B;P	0.38300	0.493;0.0;0.0;0.002;0.626	B;B;B;B;B	0.24848	0.025;0.001;0.007;0.001;0.056	T	0.76997	-0.2751	10	0.59425	D	0.04	-9.312	9.77	0.40585	0.0932:0.0:0.9068:0.0	.	25;125;82;125;25	A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;HNRL1_HUMAN;.	K	25;125;82;36	ENSP00000340857:E25K;ENSP00000375863:E125K;ENSP00000367460:E82K;ENSP00000263367:E36K	ENSP00000263367:E36K	E	+	1	0	HNRNPUL1	46466045	1.000000	0.71417	0.929000	0.37066	0.981000	0.71138	4.641000	0.61375	1.532000	0.49169	0.655000	0.94253	GAG		0.433	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
ZNF180	7733	broad.mit.edu	37	19	44982133	44982133	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:44982133C>T	ENST00000221327.4	-	5	846	c.565G>A	c.(565-567)Gtc>Atc	p.V189I	ZNF180_ENST00000592529.1_Missense_Mutation_p.V162I|ZNF180_ENST00000585514.1_5'Flank|ZNF180_ENST00000586637.1_3'UTR|ZNF180_ENST00000391956.4_Missense_Mutation_p.V164I|AC069278.4_ENST00000591684.1_lincRNA	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	189					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V189I(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				CTTTTGCAGACTCTCTCATGA	0.393																																					p.V189I	Esophageal Squamous(180;1353 2003 32862 46574 49854)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G565A	19						.						135.0	130.0	132.0					19																	44982133		2203	4300	6503	49673973	SO:0001583	missense	7733	exon5			AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.565G>A	19.37:g.44982133C>T	ENSP00000221327:p.Val189Ile		49673973	NM_013256	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	ENST00000221327.4	37	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	C	5.804	0.332653	0.10956	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	T;T	0.07216	3.21;3.24	4.61	2.46	0.29980	.	0.463566	0.16018	N	0.233466	T	0.07188	0.0182	L	0.42245	1.32	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.10450	0.005;0.002;0.002	T	0.37314	-0.9711	10	0.22109	T	0.4	-1.6403	7.0257	0.24938	0.0:0.7278:0.0:0.2722	.	164;188;189	G5E9B8;Q58F03;Q9UJW8	.;.;ZN180_HUMAN	I	189;164	ENSP00000221327:V189I;ENSP00000375818:V164I	ENSP00000221327:V189I	V	-	1	0	ZNF180	49673973	0.000000	0.05858	0.002000	0.10522	0.903000	0.53119	-2.196000	0.01241	0.677000	0.31305	0.655000	0.94253	GTC		0.393	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256	
IGLON5	402665	broad.mit.edu	37	19	51831140	51831140	+	Splice_Site	SNP	C	C	T	rs536652682		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:51831140C>T	ENST00000270642.8	+	7	922	c.922C>T	c.(922-924)Cgc>Tgc	p.R308C		NM_001101372.1	NP_001094842.1	A6NGN9	IGLO5_HUMAN	IgLON family member 5	308						extracellular region (GO:0005576)		p.R308C(1)		large_intestine(5)|lung(6)|prostate(1)	12						GCGGCTCCTGCGTGCGTCTTC	0.711																																					p.R308C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C922T	19						.						5.0	5.0	5.0					19																	51831140		1503	3348	4851	56522952	SO:0001630	splice_region_variant	402665	exon7				CCDS46158.1	19q13.33	2013-01-29			ENSG00000142549	ENSG00000142549		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	34550	protein-coding gene	gene with protein product							Standard	NM_001101372		Approved	LOC402665	uc002pwc.2	A6NGN9	OTTHUMG00000154422	ENST00000270642.8:c.922+1C>T	19.37:g.51831140C>T			56522952	NM_001101372		Missense_Mutation	SNP	ENST00000270642.8	37	CCDS46158.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.641451	0.87859	.	.	ENSG00000142549	ENST00000270642	T	0.58506	0.33	5.06	5.06	0.68205	.	.	.	.	.	T	0.50871	0.1641	N	0.08118	0	0.58432	D	0.999995	D	0.69078	0.997	P	0.58391	0.838	T	0.57940	-0.7724	9	0.59425	D	0.04	-16.0785	11.0866	0.48091	0.1851:0.8149:0.0:0.0	.	308	A6NGN9	IGLO5_HUMAN	C	308	ENSP00000270642:R308C	ENSP00000270642:R308C	R	+	1	0	IGLON5	56522952	0.998000	0.40836	1.000000	0.80357	0.949000	0.60115	0.516000	0.22817	2.360000	0.80028	0.557000	0.71058	CGC		0.711	IGLON5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335149.1	NM_001101372	Missense_Mutation
CACNG7	59284	broad.mit.edu	37	19	54444825	54444825	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:54444825G>A	ENST00000391767.1	+	5	738	c.526G>A	c.(526-528)Ggg>Agg	p.G176R	CACNG7_ENST00000391766.1_Missense_Mutation_p.G176R|CACNG7_ENST00000222212.2_Missense_Mutation_p.G176R|CACNG7_ENST00000468076.1_3'UTR			P62955	CCG7_HUMAN	calcium channel, voltage-dependent, gamma subunit 7	176					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.G176R(1)		NS(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		TTATCGCTACGGGTGGTCTTT	0.537																																					p.G176R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G526A	19						.						168.0	147.0	154.0					19																	54444825		2203	4300	6503	59136637	SO:0001583	missense	59284	exon4			AF288387	CCDS12868.1	19q13.4	2008-05-02			ENSG00000105605	ENSG00000105605		"""Calcium channel subunits"""	13626	protein-coding gene	gene with protein product		606899				11170751	Standard	NM_031896		Approved		uc002qcr.2	P62955	OTTHUMG00000064852	ENST00000391767.1:c.526G>A	19.37:g.54444825G>A	ENSP00000375647:p.Gly176Arg		59136637	NM_031896	Q52LL8|Q8VBX3|Q8WXS6|Q9BXT1	Missense_Mutation	SNP	ENST00000391767.1	37	CCDS12868.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760934	0.89932	.	.	ENSG00000105605	ENST00000391767;ENST00000222212;ENST00000391766	D;D;D	0.94897	-3.55;-3.55;-3.55	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	D	0.97294	0.9115	M	0.86097	2.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98030	1.0376	10	0.87932	D	0	-23.7281	15.4355	0.75143	0.0:0.0:1.0:0.0	.	176	P62955	CCG7_HUMAN	R	176	ENSP00000375647:G176R;ENSP00000222212:G176R;ENSP00000375646:G176R	ENSP00000222212:G176R	G	+	1	0	CACNG7	59136637	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.376000	0.79658	2.323000	0.78572	0.462000	0.41574	GGG		0.537	CACNG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139240.2		
ZNF132	7691	broad.mit.edu	37	19	58945573	58945573	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr19:58945573C>T	ENST00000254166.3	-	3	1638	c.1238G>A	c.(1237-1239)aGc>aAc	p.S413N		NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S413N(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		AGAGCTTCGGCTGAAGGATTT	0.453																																					p.S413N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1238A	19						.						115.0	110.0	112.0					19																	58945573		2203	4300	6503	63637385	SO:0001583	missense	7691	exon3			U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.1238G>A	19.37:g.58945573C>T	ENSP00000254166:p.Ser413Asn		63637385	NM_003433	Q32MI9	Missense_Mutation	SNP	ENST00000254166.3	37	CCDS12980.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.364613	0.24684	.	.	ENSG00000131849	ENST00000254166;ENST00000391695	T	0.19394	2.15	3.21	2.13	0.27403	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21550	0.0519	M	0.66506	2.035	0.09310	N	1	B	0.14805	0.011	B	0.14578	0.011	T	0.19549	-1.0302	9	0.40728	T	0.16	.	6.9281	0.24426	0.1754:0.4975:0.327:0.0	.	413	P52740	ZN132_HUMAN	N	413;240	ENSP00000254166:S413N	ENSP00000254166:S413N	S	-	2	0	ZNF132	63637385	0.000000	0.05858	0.005000	0.12908	0.547000	0.35210	-6.041000	0.00084	0.620000	0.30215	0.655000	0.94253	AGC		0.453	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1	NM_003433	
PDE4DIP	9659	broad.mit.edu	37	1	144879319	144879319	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:144879319G>T	ENST00000369354.3	-	27	4320	c.4131C>A	c.(4129-4131)agC>agA	p.S1377R	AL138796.1_ENST00000582173.1_RNA|RP4-791M13.5_ENST00000531288.1_RNA|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.S1377R|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.S1513R|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.S1333R|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.S1513R			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1377					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.S1377R(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ACCGGACCCGGCTCTTGAGGT	0.483			T	PDGFRB	MPD																																p.S1333R			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3999A	1						.						121.0	138.0	132.0					1																	144879319		2203	4300	6503	143590676	SO:0001583	missense	9659	exon30			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.4131C>A	1.37:g.144879319G>T	ENSP00000358360:p.Ser1377Arg		143590676	NM_001198832	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.277952	0.23307	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.01981	4.52;4.62;4.62;4.63;4.64	5.55	5.55	0.83447	.	.	.	.	.	T	0.01387	0.0045	L	0.43152	1.355	0.80722	D	1	B;B	0.28850	0.225;0.085	B;B	0.20955	0.032;0.03	T	0.58645	-0.7600	9	0.38643	T	0.18	.	17.002	0.86383	0.0:0.0:1.0:0.0	.	1333;1377	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	R	1333;1377;1377;1513;1513	ENSP00000327209:S1333R;ENSP00000358360:S1377R;ENSP00000358363:S1377R;ENSP00000435654:S1513R;ENSP00000358366:S1513R	ENSP00000327209:S1333R	S	-	3	2	PDE4DIP	143590676	1.000000	0.71417	1.000000	0.80357	0.300000	0.27592	3.168000	0.50801	2.616000	0.88540	0.591000	0.81541	AGC		0.483	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
POGZ	23126	broad.mit.edu	37	1	151396565	151396565	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:151396565G>A	ENST00000271715.2	-	9	1697	c.1383C>T	c.(1381-1383)gtC>gtT	p.V461V	POGZ_ENST00000491586.1_Silent_p.V408V|POGZ_ENST00000368863.2_Silent_p.V366V|POGZ_ENST00000361398.3_Silent_p.V408V|POGZ_ENST00000409503.1_Silent_p.V452V|POGZ_ENST00000531094.1_Silent_p.V399V|POGZ_ENST00000540984.1_Intron|POGZ_ENST00000392723.1_Silent_p.V408V	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	461					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V461V(1)		NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTTTGGTCTGGACGGCATCGC	0.498																																					p.V366V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1098T	1						.						191.0	173.0	179.0					1																	151396565		2203	4300	6503	149663189	SO:0001819	synonymous_variant	23126	exon7			AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.1383C>T	1.37:g.151396565G>A			149663189	NM_145796	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Silent	SNP	ENST00000271715.2	37	CCDS997.1																																																																																				0.498	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
VANGL2	57216	broad.mit.edu	37	1	160389129	160389129	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:160389129G>A	ENST00000368061.2	+	4	1004	c.530G>A	c.(529-531)cGc>cAc	p.R177H		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	177					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)		p.R177H(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCGCTGCCCCGCGTCTTTGTG	0.627																																					p.R177H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G530A	1						.						111.0	99.0	103.0					1																	160389129		2203	4300	6503	158655753	SO:0001583	missense	57216	exon4			AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.530G>A	1.37:g.160389129G>A	ENSP00000357040:p.Arg177His		158655753	NM_020335	D3DVE9|Q5T212	Missense_Mutation	SNP	ENST00000368061.2	37	CCDS30915.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996891	0.93167	.	.	ENSG00000162738	ENST00000368061	D	0.84873	-1.91	5.08	5.08	0.68730	.	0.061174	0.64402	D	0.000006	D	0.92786	0.7706	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93896	0.7184	10	0.87932	D	0	-15.7246	17.3919	0.87434	0.0:0.0:1.0:0.0	.	177	Q9ULK5	VANG2_HUMAN	H	177	ENSP00000357040:R177H	ENSP00000357040:R177H	R	+	2	0	VANGL2	158655753	1.000000	0.71417	0.655000	0.29622	0.993000	0.82548	9.341000	0.97041	2.503000	0.84419	0.563000	0.77884	CGC		0.627	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080677.1	NM_020335	
QSOX1	5768	broad.mit.edu	37	1	180153054	180153054	+	Silent	SNP	C	C	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:180153054C>A	ENST00000367602.3	+	7	830	c.756C>A	c.(754-756)ctC>ctA	p.L252L	QSOX1_ENST00000367600.5_Silent_p.L252L			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	252					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)	p.L252L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTCACAGGCTCATGGAATCCA	0.537																																					p.L252L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C756A	1						.						301.0	300.0	300.0					1																	180153054		2203	4300	6503	178419677	SO:0001819	synonymous_variant	5768	exon7			U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.756C>A	1.37:g.180153054C>A			178419677	NM_002826	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Silent	SNP	ENST00000367602.3	37	CCDS1337.1																																																																																				0.537	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085289.1	NM_002826	
NFASC	23114	broad.mit.edu	37	1	204943373	204943373	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:204943373G>A	ENST00000401399.1	+	12	1545	c.1346G>A	c.(1345-1347)cGg>cAg	p.R449Q	NFASC_ENST00000338515.6_Missense_Mutation_p.R449Q|NFASC_ENST00000360049.4_Missense_Mutation_p.R460Q|NFASC_ENST00000403080.1_Missense_Mutation_p.R449Q|NFASC_ENST00000367172.4_Missense_Mutation_p.R449Q|NFASC_ENST00000539706.1_Missense_Mutation_p.R460Q|NFASC_ENST00000513543.1_Missense_Mutation_p.R460Q|NFASC_ENST00000339876.6_Missense_Mutation_p.R449Q|NFASC_ENST00000367170.4_Missense_Mutation_p.R449Q|NFASC_ENST00000338586.6_Missense_Mutation_p.R449Q|NFASC_ENST00000404076.1_Missense_Mutation_p.R443Q|NFASC_ENST00000367171.4_Missense_Mutation_p.R449Q|NFASC_ENST00000367169.4_Missense_Mutation_p.R449Q|NFASC_ENST00000404907.1_Missense_Mutation_p.R460Q			O94856	NFASC_HUMAN	neurofascin	449	Ig-like C2-type 5.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.R460Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AACCGGACGCGGCTGGACTGC	0.562																																					p.R460Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1379A	1						.						88.0	61.0	70.0					1																	204943373		2203	4300	6503	203209996	SO:0001583	missense	23114	exon11			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1346G>A	1.37:g.204943373G>A	ENSP00000385637:p.Arg449Gln		203209996	NM_001160331	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.36|18.36	3.607146|3.607146	0.66558|0.66558	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367173|ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.67865	.|-0.29;1.65;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;1.65;1.65;-0.29;-0.29;-0.29;-0.29	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.000000	.|0.47852	.|D	.|0.000212	T|T	0.40719|0.40719	0.1128|0.1128	N|N	0.12746|0.12746	0.255|0.255	0.38270|0.38270	D|D	0.942113|0.942113	.|B;B;B;P;B;B;B	.|0.35714	.|0.04;0.23;0.065;0.517;0.303;0.114;0.147	.|B;B;B;B;B;B;B	.|0.23018	.|0.013;0.043;0.032;0.014;0.029;0.043;0.013	T|T	0.48007|0.48007	-0.9072|-0.9072	5|10	.|0.35671	.|T	.|0.21	.|.	8.3954|8.3954	0.32553|0.32553	0.0779:0.0:0.7666:0.1555|0.0779:0.0:0.7666:0.1555	.|.	.|460;460;545;449;449;460;449	.|O94856-11;O94856-8;B4DRH7;F8W791;O94856-9;O94856-3;O94856-2	.|.;.;.;.;.;.;.	S|Q	419|449;449;449;449;449;449;460;460;460;449;449;443;449;460;460;436	.|ENSP00000356140:R449Q;ENSP00000356139:R449Q;ENSP00000356138:R449Q;ENSP00000342128:R449Q;ENSP00000344786:R449Q;ENSP00000343509:R449Q;ENSP00000438614:R460Q;ENSP00000353154:R460Q;ENSP00000356137:R449Q;ENSP00000384875:R449Q;ENSP00000385676:R443Q;ENSP00000385637:R449Q;ENSP00000384061:R460Q;ENSP00000425908:R460Q;ENSP00000415031:R436Q	.|ENSP00000295776:R460Q	G|R	+|+	1|2	0|0	NFASC|NFASC	203209996|203209996	1.000000|1.000000	0.71417|0.71417	0.948000|0.948000	0.38648|0.38648	0.981000|0.981000	0.71138|0.71138	3.994000|3.994000	0.56994|0.56994	2.612000|2.612000	0.88384|0.88384	0.585000|0.585000	0.79938|0.79938	GGC|CGG		0.562	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
CNTN2	6900	broad.mit.edu	37	1	205036254	205036254	+	Silent	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:205036254C>T	ENST00000331830.4	+	16	2285	c.2001C>T	c.(1999-2001)gcC>gcT	p.A667A		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	667	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.A667A(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGGGCAATGCCGAGACTGCAC	0.587																																					p.A667A	Melanoma(183;2548 2817 37099 41192)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2001T	1						.						88.0	83.0	85.0					1																	205036254		2203	4300	6503	203302877	SO:0001819	synonymous_variant	6900	exon16			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2001C>T	1.37:g.205036254C>T			203302877	NM_005076	P78432|Q5T054	Silent	SNP	ENST00000331830.4	37	CCDS1449.1																																																																																				0.587	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
RHD	6007	broad.mit.edu	37	1	25628156	25628156	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:25628156C>A	ENST00000328664.4	+	5	935	c.780C>A	c.(778-780)caC>caA	p.H260Q	RHD_ENST00000417538.2_Missense_Mutation_p.H260Q|RHD_ENST00000342055.5_Missense_Mutation_p.H260Q|RHD_ENST00000423253.1_3'UTR|RHD_ENST00000454452.2_Missense_Mutation_p.H260Q|RHD_ENST00000568195.1_Missense_Mutation_p.H260Q|RHD_ENST00000357542.4_Missense_Mutation_p.H260Q|RHD_ENST00000423810.2_Missense_Mutation_p.H260Q	NM_001282867.1|NM_016124.3	NP_001269796.1|NP_057208	Q02161	RHD_HUMAN	Rh blood group, D antigen	260						integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)	p.H260Q(1)		breast(2)|large_intestine(4)|lung(7)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCTTGGCTCACCCCCAAGGGA	0.557																																					p.H260Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C780A	1						.						150.0	114.0	127.0					1																	25628156		2124	3751	5875	25500743	SO:0001583	missense	6007	exon5			AB012623	CCDS262.1, CCDS53285.1, CCDS60027.1, CCDS60028.1, CCDS60029.1, CCDS60030.1, CCDS60031.1	1p36.11	2014-07-19	2013-10-02		ENSG00000187010	ENSG00000187010		"""CD molecules"", ""Blood group antigens"""	10009	protein-coding gene	gene with protein product		111680	"""Rhesus blood group, D antigen"", ""Rh blood group, D antigen"""	RH		8220426	Standard	NM_016124		Approved	Rh30a, Rh4, RhPI, RhII, DIIIc, CD240D	uc001bjz.3	Q02161	OTTHUMG00000003476	ENST00000328664.4:c.780C>A	1.37:g.25628156C>A	ENSP00000331871:p.His260Gln		25500743	NM_001127691	Q02162|Q07618|Q16147|Q16235|Q16355|Q5VSK0|Q5XLS9|Q5XLT1|Q5XLT2|Q9NPK0|Q9UQ20|Q9UQ21|Q9UQ22|Q9UQ23	Missense_Mutation	SNP	ENST00000328664.4	37	CCDS262.1	.	.	.	.	.	.	.	.	.	.	.	10.11	1.261602	0.23051	.	.	ENSG00000187010	ENST00000328664;ENST00000419831;ENST00000454452;ENST00000342055;ENST00000357542;ENST00000417538;ENST00000423810	T;T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95;1.95	3.8	2.87	0.33458	Ammonium transporter AmtB-like (3);	0.534254	0.19648	N	0.109285	T	0.36110	0.0955	M	0.64404	1.975	0.09310	N	0.999999	D;D;D;D;D;D;D;D	0.67145	0.985;0.992;0.987;0.996;0.985;0.986;0.996;0.972	P;D;D;D;P;P;D;D	0.75020	0.889;0.958;0.985;0.937;0.889;0.823;0.958;0.925	T	0.09662	-1.0664	10	0.29301	T	0.29	-2.9623	7.2078	0.25917	0.0:0.8691:0.0:0.1309	.	260;260;260;260;260;260;260;260	B4DLT8;Q5XLT1;Q5XLS9;Q5XLT2;Q5XLT3;E7EVW1;Q5XLT0;Q02161	.;.;.;.;.;.;.;RHD_HUMAN	Q	260	ENSP00000331871:H260Q;ENSP00000413849:H260Q;ENSP00000339577:H260Q;ENSP00000350150:H260Q;ENSP00000396420:H260Q;ENSP00000399640:H260Q	ENSP00000331871:H260Q	H	+	3	2	RHD	25500743	0.000000	0.05858	0.085000	0.20634	0.086000	0.17979	-0.043000	0.12043	0.579000	0.29504	0.184000	0.17185	CAC		0.557	RHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009660.5	NM_016124	
GRIK3	2899	broad.mit.edu	37	1	37270635	37270635	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:37270635C>T	ENST00000373091.3	-	15	2534	c.2518G>A	c.(2518-2520)Gtg>Atg	p.V840M	GRIK3_ENST00000373093.4_Missense_Mutation_p.V840M	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	840					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.V840M(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				AACTCGCCCACGGCCACCAGC	0.582																																					p.V840M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2518A	1						.						54.0	60.0	58.0					1																	37270635		2203	4300	6503	37043222	SO:0001583	missense	2899	exon15			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2518G>A	1.37:g.37270635C>T	ENSP00000362183:p.Val840Met		37043222	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414553	0.42817	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.12984	2.68;2.63	4.41	4.41	0.53225	.	0.211356	0.40302	N	0.001122	T	0.09335	0.0230	L	0.31065	0.9	0.35740	D	0.818638	B;B	0.18610	0.029;0.013	B;B	0.19666	0.026;0.011	T	0.14615	-1.0466	10	0.35671	T	0.21	.	5.792	0.18365	0.0:0.7398:0.0:0.2602	.	840;840	A9Z1Z8;Q13003	.;GRIK3_HUMAN	M	840	ENSP00000362183:V840M;ENSP00000362185:V840M	ENSP00000362183:V840M	V	-	1	0	GRIK3	37043222	0.998000	0.40836	0.994000	0.49952	0.998000	0.95712	3.327000	0.52045	1.979000	0.57680	0.551000	0.68910	GTG		0.582	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
PABPC4	8761	broad.mit.edu	37	1	40038204	40038204	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:40038204C>T	ENST00000372857.3	-	2	1040	c.248G>A	c.(247-249)cGc>cAc	p.R83H	PABPC4_ENST00000372856.3_Missense_Mutation_p.R83H|PABPC4_ENST00000529216.1_5'Flank|PABPC4_ENST00000372862.3_Missense_Mutation_p.R83H|PABPC4_ENST00000372858.3_Missense_Mutation_p.R83H|RP11-69E11.8_ENST00000415255.1_RNA	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	83	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)	p.R83H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CCACATGATGCGGATTGGCTT	0.433																																					p.R83H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G248A	1						.						103.0	96.0	98.0					1																	40038204		2203	4300	6503	39810791	SO:0001583	missense	8761	exon2			U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.248G>A	1.37:g.40038204C>T	ENSP00000361948:p.Arg83His		39810791	NM_001135653	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	ENST00000372857.3	37	CCDS438.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016839	0.93404	.	.	ENSG00000090621	ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856;ENST00000451091	T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28	5.7	3.81	0.43845	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.049063	0.85682	D	0.000000	T	0.42877	0.1222	M	0.84326	2.69	0.48185	D	0.999608	D;D;D	0.89917	0.997;1.0;0.999	P;D;D	0.70935	0.869;0.971;0.943	T	0.49781	-0.8903	10	0.87932	D	0	.	12.7852	0.57500	0.0:0.8652:0.0:0.1348	.	83;83;83	Q13310;Q13310-2;Q4VC03	PABP4_HUMAN;.;.	H	83	ENSP00000361953:R83H;ENSP00000361949:R83H;ENSP00000361948:R83H;ENSP00000361947:R83H;ENSP00000406675:R83H	ENSP00000361947:R83H	R	-	2	0	PABPC4	39810791	1.000000	0.71417	0.887000	0.34795	0.994000	0.84299	5.977000	0.70492	1.424000	0.47217	0.563000	0.77884	CGC		0.433	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025220.1	NM_001135653	
LPAR3	23566	broad.mit.edu	37	1	85331321	85331321	+	Silent	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:85331321C>T	ENST00000440886.1	-	1	521	c.483G>A	c.(481-483)gcG>gcA	p.A161A	LPAR3_ENST00000370611.3_Silent_p.A161A|LPAR3_ENST00000491034.1_Intron			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	161					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)	p.A161A(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						GTGTGGGGACCGCCCCCATAA	0.527																																					p.A161A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G483A	1						.						119.0	122.0	121.0					1																	85331321		2203	4300	6503	85103909	SO:0001819	synonymous_variant	23566	exon2			AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.483G>A	1.37:g.85331321C>T			85103909	NM_012152	A0AVA3	Silent	SNP	ENST00000440886.1	37	CCDS700.1																																																																																				0.527	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027467.1	NM_012152	
PLPPR5	163404	broad.mit.edu	37	1	99422281	99422281	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:99422281G>T	ENST00000263177.4	-	2	475	c.254C>A	c.(253-255)aCt>aAt	p.T85N	LPPR5_ENST00000370188.3_Missense_Mutation_p.T85N	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		85						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.T85N(1)									AAAGACAGCAGTTTCTCCAAC	0.308																																					p.T85N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C254A	1						.						61.0	64.0	63.0					1																	99422281		2202	4300	6502	99194869	SO:0001583	missense	163404	exon2																														ENST00000263177.4:c.254C>A	1.37:g.99422281G>T	ENSP00000263177:p.Thr85Asn		99194869	NM_001037317	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Missense_Mutation	SNP	ENST00000263177.4	37	CCDS30778.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627576	0.28978	.	.	ENSG00000117598	ENST00000370188;ENST00000263177	T;T	0.32753	1.44;1.44	4.74	4.74	0.60224	.	0.159635	0.53938	D	0.000043	T	0.20210	0.0486	L	0.54323	1.7	0.39736	D	0.97168	P;B	0.36909	0.573;0.437	B;B	0.37731	0.257;0.131	T	0.03453	-1.1035	10	0.27785	T	0.31	.	17.0811	0.86599	0.0:0.0:1.0:0.0	.	85;85	Q32ZL2-2;Q32ZL2	.;LPPR5_HUMAN	N	85	ENSP00000359207:T85N;ENSP00000263177:T85N	ENSP00000263177:T85N	T	-	2	0	AL161744.1	99194869	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.898000	0.63238	2.342000	0.79632	0.591000	0.81541	ACT		0.308	LPPR5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393221.1		
SPATA17	128153	broad.mit.edu	37	1	217856631	217856631	+	Missense_Mutation	SNP	G	G	A	rs35503371		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr1:217856631G>A	ENST00000366933.4	+	5	378	c.323G>A	c.(322-324)cGg>cAg	p.R108Q		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	108	IQ 3. {ECO:0000255|PROSITE- ProRule:PRU00116}.					cytoplasm (GO:0005737)		p.R108L(1)|p.R108Q(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TATAGGGTTCGGAAGTACCTC	0.323																																					p.R108Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G323A	1						.						92.0	110.0	104.0					1																	217856631		2198	4299	6497	215923254	SO:0001583	missense	128153	exon5			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.323G>A	1.37:g.217856631G>A	ENSP00000355900:p.Arg108Gln		215923254	NM_138796	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	G	31	5.082071	0.94050	.	.	ENSG00000162814	ENST00000366933	T	0.64803	-0.12	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.82351	0.5018	M	0.86028	2.79	0.45490	D	0.99845	D	0.89917	1.0	D	0.97110	1.0	D	0.85043	0.0924	10	0.87932	D	0	-20.1325	19.2545	0.93940	0.0:0.0:1.0:0.0	rs35503371	108	Q96L03	SPT17_HUMAN	Q	108	ENSP00000355900:R108Q	ENSP00000355900:R108Q	R	+	2	0	SPATA17	215923254	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	7.726000	0.84824	2.537000	0.85549	0.555000	0.69702	CGG		0.323	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796	
L3MBTL1	26013	broad.mit.edu	37	20	42163513	42163513	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr20:42163513G>A	ENST00000427442.2	+	16	1849	c.1690G>A	c.(1690-1692)Gct>Act	p.A564T	L3MBTL1_ENST00000373134.1_Missense_Mutation_p.A496T|L3MBTL1_ENST00000373135.3_Missense_Mutation_p.A496T|L3MBTL1_ENST00000444063.1_Missense_Mutation_p.A496T|L3MBTL1_ENST00000418998.1_Missense_Mutation_p.A564T			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	496					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.A496T(1)		breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						CTGGATCGACGCTGACCACCC	0.577																																					p.A564T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1690A	20						.						84.0	70.0	75.0					20																	42163513		2203	4300	6503	41596927	SO:0001583	missense	26013	exon16			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1690G>A	20.37:g.42163513G>A	ENSP00000402107:p.Ala564Thr		41596927	NM_032107	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	ENST00000427442.2	37	CCDS46602.2	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807150	0.50421	.	.	ENSG00000185513	ENST00000427442;ENST00000418998;ENST00000373135;ENST00000444063;ENST00000373134;ENST00000422861;ENST00000373133	T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47	5.85	3.68	0.42216	.	0.169417	0.52532	D	0.000067	T	0.38692	0.1050	M	0.65677	2.01	0.38515	D	0.948562	P;P;D;P	0.56035	0.851;0.818;0.974;0.889	B;B;P;P	0.51079	0.205;0.191;0.658;0.508	T	0.40924	-0.9537	10	0.08599	T	0.76	.	14.8369	0.70190	0.0:0.0:0.6874:0.3126	.	564;148;496;496	Q9Y468-5;Q9Y468-3;Q9Y468-2;Q9Y468-1	.;.;.;.	T	564;564;496;496;496;282;148	ENSP00000402107:A564T;ENSP00000398516:A564T;ENSP00000362227:A496T;ENSP00000403316:A496T;ENSP00000362226:A496T;ENSP00000410139:A282T	ENSP00000362225:A148T	A	+	1	0	L3MBTL1	41596927	0.999000	0.42202	0.741000	0.31004	0.992000	0.81027	2.580000	0.46068	1.434000	0.47414	0.655000	0.94253	GCT		0.577	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
ZNFX1	57169	broad.mit.edu	37	20	47864336	47864336	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr20:47864336G>C	ENST00000396105.1	-	14	5471	c.5225C>G	c.(5224-5226)gCc>gGc	p.A1742G	ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000371752.1_Missense_Mutation_p.A1742G	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1742							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GCGCTTCTTGGCCAGCCACTC	0.502																																					p.A1742G												.	.	0			c.C5225G	20						.						102.0	99.0	100.0					20																	47864336		2203	4300	6503	47297743	SO:0001583	missense	57169	exon14			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.5225C>G	20.37:g.47864336G>C	ENSP00000379412:p.Ala1742Gly		47297743	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	G	3.235	-0.156598	0.06544	.	.	ENSG00000124201	ENST00000371752;ENST00000396105	D;D	0.86562	-2.14;-2.14	6.17	0.241	0.15494	.	0.877466	0.10363	N	0.683755	T	0.79452	0.4448	L	0.41236	1.265	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.60224	-0.7305	10	0.16896	T	0.51	-0.1907	10.0364	0.42131	0.0:0.2139:0.2556:0.5305	.	1742	Q9P2E3	ZNFX1_HUMAN	G	1742	ENSP00000360817:A1742G;ENSP00000379412:A1742G	ENSP00000360817:A1742G	A	-	2	0	ZNFX1	47297743	0.000000	0.05858	0.006000	0.13384	0.852000	0.48524	-0.054000	0.11826	0.109000	0.17891	0.655000	0.94253	GCC		0.502	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
APCDD1L	164284	broad.mit.edu	37	20	57036161	57036161	+	Silent	SNP	G	G	A	rs569125300		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr20:57036161G>A	ENST00000371149.3	-	4	1421	c.1191C>T	c.(1189-1191)aaC>aaT	p.N397N	APCDD1L_ENST00000439429.1_Silent_p.N408N|APCDD1L_ENST00000491015.1_5'Flank	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	397						integral component of membrane (GO:0016021)		p.N397N(1)		large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			GTAGGCAGCCGTTGGTGGCTG	0.617																																					p.N397N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1191T	20						.						59.0	65.0	63.0					20																	57036161		2203	4300	6503	56469567	SO:0001819	synonymous_variant	164284	exon4			AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.1191C>T	20.37:g.57036161G>A			56469567	NM_153360		Silent	SNP	ENST00000371149.3	37	CCDS13467.1																																																																																				0.617	APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000079881.2	NM_153360	
SLCO4A1	28231	broad.mit.edu	37	20	61297900	61297900	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr20:61297900C>T	ENST00000370507.1	+	6	1541	c.1445C>T	c.(1444-1446)gCg>gTg	p.A482V	RP11-93B14.5_ENST00000451648.1_RNA|RP11-93B14.5_ENST00000411824.1_RNA|SLCO4A1_ENST00000217159.1_Missense_Mutation_p.A482V|RP11-93B14.5_ENST00000433126.1_RNA|SLCO4A1_ENST00000470412.1_3'UTR			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	482					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.A482V(1)		endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GTGCCCATGGCGGGCGTCACA	0.677																																					p.A482V	Pancreas(168;741 2006 10379 40139 45334)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1445T	20						.						118.0	113.0	114.0					20																	61297900		2203	4300	6503	60768345	SO:0001583	missense	28231	exon7			AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.1445C>T	20.37:g.61297900C>T	ENSP00000359538:p.Ala482Val		60768345	NM_016354	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	ENST00000370507.1	37	CCDS13501.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.221735	0.79464	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507;ENST00000342674	T;T	0.58506	0.33;0.33	4.85	4.85	0.62838	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.185810	0.46145	D	0.000319	T	0.69557	0.3124	M	0.76574	2.34	0.80722	D	1	D	0.55172	0.97	P	0.53549	0.729	T	0.74188	-0.3746	10	0.56958	D	0.05	.	16.1441	0.81551	0.0:1.0:0.0:0.0	.	482	Q96BD0	SO4A1_HUMAN	V	482;482;482;334	ENSP00000217159:A482V;ENSP00000359538:A482V	ENSP00000217159:A482V	A	+	2	0	SLCO4A1	60768345	0.998000	0.40836	0.929000	0.37066	0.206000	0.24218	3.689000	0.54706	2.240000	0.73641	0.655000	0.94253	GCG		0.677	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354	
IL17RA	23765	broad.mit.edu	37	22	17579695	17579695	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr22:17579695T>A	ENST00000319363.6	+	4	474	c.341T>A	c.(340-342)tTa>tAa	p.L114*	IL17RA_ENST00000477874.1_3'UTR	NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	114					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)	p.L114*(1)		endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GGTGCAGAGTTATCTGTCCTG	0.522																																					p.L114X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T341A	22						.						165.0	125.0	139.0					22																	17579695		2203	4300	6503	15959695	SO:0001587	stop_gained	23765	exon4			U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.341T>A	22.37:g.17579695T>A	ENSP00000320936:p.Leu114*		15959695	NM_014339	O43844|Q20WK1	Nonsense_Mutation	SNP	ENST00000319363.6	37	CCDS13739.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.587660	0.66105	.	.	ENSG00000177663	ENST00000425985;ENST00000319363	.	.	.	5.97	5.97	0.96955	.	0.355912	0.21323	N	0.076423	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.9717	13.8236	0.63338	0.0:0.0:0.0:1.0	.	.	.	.	X	114	.	ENSP00000320936:L114X	L	+	2	0	IL17RA	15959695	0.397000	0.25270	0.005000	0.12908	0.024000	0.10985	4.175000	0.58263	2.288000	0.76882	0.533000	0.62120	TTA		0.522	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339	
TFIP11	24144	broad.mit.edu	37	22	26895164	26895164	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr22:26895164T>C	ENST00000407690.1	-	9	1518	c.1235A>G	c.(1234-1236)tAt>tGt	p.Y412C	TFIP11_ENST00000496523.1_5'Flank|TFIP11_ENST00000407148.1_Missense_Mutation_p.Y412C|TFIP11_ENST00000405938.1_Missense_Mutation_p.Y412C|TFIP11_ENST00000407431.1_Missense_Mutation_p.Y412C	NM_012143.2	NP_036275.1	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	412					biomineral tissue development (GO:0031214)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|spliceosomal complex disassembly (GO:0000390)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	DNA binding (GO:0003677)	p.Y412C(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25						GTACTCCTCATAGTACTTGTC	0.577																																					p.Y412C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1235G	22						.						79.0	76.0	77.0					22																	26895164		2203	4300	6503	25225164	SO:0001583	missense	24144	exon9			AL050258	CCDS13838.1	22q12.1	2013-01-28			ENSG00000100109	ENSG00000100109		"""G patch domain containing"""	17165	protein-coding gene	gene with protein product		612747				10806191, 11230166	Standard	NM_012143		Approved	TIP39, DKFZP434B194, Spp382	uc003acs.2	Q9UBB9	OTTHUMG00000150883	ENST00000407690.1:c.1235A>G	22.37:g.26895164T>C	ENSP00000384421:p.Tyr412Cys		25225164	NM_012143	O95908|Q20WL0|Q5H8V8|Q9UGV7|Q9Y2Q8	Missense_Mutation	SNP	ENST00000407690.1	37	CCDS13838.1	.	.	.	.	.	.	.	.	.	.	T	17.93	3.508418	0.64410	.	.	ENSG00000100109	ENST00000407690;ENST00000407431;ENST00000407148;ENST00000442693;ENST00000405938	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.15	4.12	0.48240	GC-rich sequence DNA-binding factor domain (1);	0.000000	0.85682	D	0.000000	T	0.59636	0.2208	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.57866	-0.7737	10	0.39692	T	0.17	-23.4809	9.9457	0.41607	0.0:0.0792:0.0:0.9208	.	412	Q9UBB9	TFP11_HUMAN	C	412;412;412;97;412	ENSP00000384421:Y412C;ENSP00000383892:Y412C;ENSP00000385861:Y412C;ENSP00000384297:Y412C	ENSP00000384297:Y412C	Y	-	2	0	TFIP11	25225164	1.000000	0.71417	0.973000	0.42090	0.992000	0.81027	7.179000	0.77665	0.986000	0.38683	0.533000	0.62120	TAT		0.577	TFIP11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320750.1	NM_001008697	
RTCB	51493	broad.mit.edu	37	22	32788263	32788263	+	Silent	SNP	C	C	T	rs145049274		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr22:32788263C>T	ENST00000216038.5	-	11	1472	c.1374G>A	c.(1372-1374)gcG>gcA	p.A458A	RTCB_ENST00000451746.2_3'UTR	NM_014306.4	NP_055121.1			RNA 2',3'-cyclic phosphate and 5'-OH ligase									p.A458A(1)									CAACACGGATCGCAATTCCCA	0.398																																					p.A458A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1374A	22						.	C		0,4406		0,0,2203	113.0	107.0	109.0		1374	-3.7	1.0	22	dbSNP_134	109	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C22orf28	NM_014306.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		458/506	32788263	1,13005	2203	4300	6503	31118263	SO:0001819	synonymous_variant	51493	exon11			BC016707	CCDS13905.1	22q12.3	2013-05-22	2013-05-22	2013-05-22	ENSG00000100220	ENSG00000100220	6.5.1.3		26935	protein-coding gene	gene with protein product	"""focal adhesion-associated protein"""	613901	"""chromosome 22 open reading frame 28"""	C22orf28		11042152, 21209330, 21311021	Standard	NM_014306		Approved	HSPC117, FAAP		Q9Y3I0	OTTHUMG00000030300	ENST00000216038.5:c.1374G>A	22.37:g.32788263C>T			31118263	NM_014306		Silent	SNP	ENST00000216038.5	37	CCDS13905.1																																																																																				0.398	RTCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075188.3	NM_014306	
TRIOBP	11078	broad.mit.edu	37	22	38120006	38120006	+	Silent	SNP	T	T	C			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr22:38120006T>C	ENST00000406386.3	+	7	1698	c.1443T>C	c.(1441-1443)tgT>tgC	p.C481C		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	481					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.C481C(3)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GAACATCCTGTGCCCAGCGGG	0.592																																					p.C481C												.	.	3	Substitution - coding silent(3)	kidney(2)|large_intestine(1)	c.T1443C	22						.						52.0	51.0	51.0					22																	38120006		1899	4072	5971	36449952	SO:0001819	synonymous_variant	11078	exon7			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1443T>C	22.37:g.38120006T>C			36449952	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	CCDS43015.1																																																																																				0.592	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
ACO2	50	broad.mit.edu	37	22	41895860	41895860	+	Missense_Mutation	SNP	G	G	A	rs534016929	byFrequency	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr22:41895860G>A	ENST00000216254.4	+	2	189	c.167G>A	c.(166-168)cGc>cAc	p.R56H	ACO2_ENST00000396512.3_Missense_Mutation_p.R56H	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	56					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)	p.R56H(1)		breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						AACATTGTTCGCAAACGGTAA	0.537													G|||	2	0.000399361	0.0008	0.0	5008	,	,		23129	0.001		0.0	False		,,,				2504	0.0				p.R56H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G167A	22						.						203.0	185.0	191.0					22																	41895860		2203	4300	6503	40225806	SO:0001583	missense	50	exon2			AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.167G>A	22.37:g.41895860G>A	ENSP00000216254:p.Arg56His		40225806	NM_001098	O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Missense_Mutation	SNP	ENST00000216254.4	37	CCDS14017.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617468	0.87359	.	.	ENSG00000100412	ENST00000544234;ENST00000216254;ENST00000396512	T;T	0.77358	-1.09;-1.09	5.01	5.01	0.66863	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (1);	0.112229	0.64402	D	0.000010	D	0.87966	0.6311	M	0.83118	2.625	0.58432	D	0.999996	D;D	0.76494	0.999;0.998	P;P	0.60789	0.879;0.736	D	0.89936	0.4069	10	0.87932	D	0	.	18.692	0.91586	0.0:0.0:1.0:0.0	.	56;56	A2A274;Q99798	.;ACON_HUMAN	H	56	ENSP00000216254:R56H;ENSP00000379769:R56H	ENSP00000216254:R56H	R	+	2	0	ACO2	40225806	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.614000	0.54160	2.483000	0.83821	0.585000	0.79938	CGC		0.537	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259151.1	NM_001098	
KLHDC7B	113730	broad.mit.edu	37	22	50988034	50988034	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr22:50988034C>A	ENST00000395676.2	+	1	1573	c.1439C>A	c.(1438-1440)gCc>gAc	p.A480D	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	480								p.A381D(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCATACAGTGCCAGCCACCGG	0.662																																					p.A480D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1439A	22						.						62.0	66.0	64.0					22																	50988034		2203	4299	6502	49334900	SO:0001583	missense	113730	exon1			BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1439C>A	22.37:g.50988034C>A	ENSP00000379034:p.Ala480Asp		49334900	NM_138433		Missense_Mutation	SNP	ENST00000395676.2	37	CCDS14097.2	.	.	.	.	.	.	.	.	.	.	C	20.7	4.036272	0.75617	.	.	ENSG00000130487	ENST00000395676	T	0.66638	-0.22	5.35	5.35	0.76521	Kelch-type beta propeller (1);	0.000000	0.41294	U	0.000917	T	0.73442	0.3587	L	0.57536	1.79	0.35990	D	0.836606	D	0.55605	0.972	P	0.58454	0.839	T	0.77638	-0.2513	10	0.38643	T	0.18	.	11.6218	0.51121	0.1777:0.8223:0.0:0.0	.	480	Q96G42	KLD7B_HUMAN	D	480	ENSP00000379034:A480D	ENSP00000379034:A480D	A	+	2	0	KLHDC7B	49334900	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.912000	0.39946	2.528000	0.85240	0.491000	0.48974	GCC		0.662	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317089.2	NM_138433	
MERTK	10461	broad.mit.edu	37	2	112786101	112786101	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:112786101G>A	ENST00000295408.4	+	19	2917	c.2660G>A	c.(2659-2661)gGc>gAc	p.G887D	MERTK_ENST00000409780.1_Missense_Mutation_p.G711D|MERTK_ENST00000421804.2_Missense_Mutation_p.G887D			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	887					apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G887D(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						CTGGCCCAGGGCTCCACCCTT	0.522																																					p.G887D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2660A	2						.						133.0	134.0	133.0					2																	112786101		2203	4300	6503	112502572	SO:0001583	missense	10461	exon19			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2660G>A	2.37:g.112786101G>A	ENSP00000295408:p.Gly887Asp		112502572	NM_006343	Q9HBB4	Missense_Mutation	SNP	ENST00000295408.4	37	CCDS2094.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.222|6.222	0.409049|0.409049	0.11812|0.11812	.|.	.|.	ENSG00000153208|ENSG00000153208	ENST00000393237|ENST00000295408;ENST00000421804;ENST00000409780;ENST00000449344	.|T;T;T;D	.|0.83075	.|-0.83;-0.83;-0.83;-1.68	5.58|5.58	2.44|2.44	0.29823|0.29823	.|.	.|0.807415	.|0.10031	.|N	.|0.724671	.|T	.|0.66694	.|0.2815	N|N	0.20986|0.20986	0.625|0.625	0.09310|0.09310	N|N	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	.|T	.|0.50591	.|-0.8810	.|10	.|0.07990	.|T	.|0.79	.|-8.1914	5.2758|5.2758	0.15649|0.15649	0.5621:0.0:0.4379:0.0|0.5621:0.0:0.4379:0.0	.|.	.|887	.|Q12866	.|MERTK_HUMAN	.|D	-1|887;887;711;211	.|ENSP00000295408:G887D;ENSP00000389152:G887D;ENSP00000387277:G711D;ENSP00000412660:G211D	.|ENSP00000295408:G887D	.|G	+|+	.|2	.|0	MERTK|MERTK	112502572|112502572	0.972000|0.972000	0.33761|0.33761	0.011000|0.011000	0.14972|0.14972	0.472000|0.472000	0.32918|0.32918	2.233000|2.233000	0.43027|0.43027	0.746000|0.746000	0.32786|0.32786	0.655000|0.655000	0.94253|0.94253	.|GGC		0.522	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		
MARCO	8685	broad.mit.edu	37	2	119732133	119732133	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:119732133G>C	ENST00000327097.4	+	6	740	c.605G>C	c.(604-606)gGa>gCa	p.G202A	MARCO_ENST00000541757.1_Missense_Mutation_p.G124A	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	202	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.G202A(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GGAGTCAAGGGAGAGGCGGGT	0.567																																					p.G202A	GBM(8;18 374 7467 11269 32796)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G605C	2						.						62.0	65.0	64.0					2																	119732133		2203	4299	6502	119448603	SO:0001583	missense	8685	exon6			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.605G>C	2.37:g.119732133G>C	ENSP00000318916:p.Gly202Ala		119448603	NM_006770	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	37	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184368	0.38609	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.99418	-5.87;-5.5	5.02	5.02	0.67125	.	0.170023	0.37577	N	0.002023	D	0.99664	0.9875	H	0.96111	3.77	0.44388	D	0.997298	D	0.89917	1.0	D	0.91635	0.999	D	0.97590	1.0116	9	.	.	.	.	14.0192	0.64543	0.0:0.0:1.0:0.0	.	202	Q9UEW3	MARCO_HUMAN	A	202;202;124	ENSP00000318916:G202A;ENSP00000441769:G124A	.	G	+	2	0	MARCO	119448603	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.100000	0.57762	2.778000	0.95560	0.609000	0.83330	GGA		0.567	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
IMP4	92856	broad.mit.edu	37	2	131103038	131103038	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:131103038C>T	ENST00000259239.3	+	4	994	c.286C>T	c.(286-288)Cgc>Tgc	p.R96C	IMP4_ENST00000409935.1_Missense_Mutation_p.R96C	NM_033416.1	NP_219484.1	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein	96	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				rRNA processing (GO:0006364)	nucleolus (GO:0005730)|ribonucleoprotein complex (GO:0030529)		p.R96C(1)		central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	18	Colorectal(110;0.1)					CCCCAGTTCCCGCCTCAAGAT	0.577																																					p.R96C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C286T	2						.						85.0	77.0	80.0					2																	131103038		2203	4300	6503	130819508	SO:0001583	missense	92856	exon4			BC010042	CCDS2160.1	2q21.1	2014-02-19	2014-02-19		ENSG00000136718	ENSG00000136718			30856	protein-coding gene	gene with protein product		612981	"""IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			8619474, 9110174, 12655004	Standard	NM_033416		Approved	MGC19606, BXDC4	uc002tra.1	Q96G21	OTTHUMG00000131627	ENST00000259239.3:c.286C>T	2.37:g.131103038C>T	ENSP00000259239:p.Arg96Cys		130819508	NM_033416	Q3ZTT3	Missense_Mutation	SNP	ENST00000259239.3	37	CCDS2160.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062755	0.76187	.	.	ENSG00000136718	ENST00000259239;ENST00000409935;ENST00000409649;ENST00000428740	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	5.16	5.16	0.70880	Brix domain (3);Anticodon-binding (1);	0.000000	0.85682	D	0.000000	T	0.65964	0.2742	M	0.90425	3.115	0.80722	D	1	P	0.46277	0.875	P	0.44422	0.449	T	0.75611	-0.3258	10	0.66056	D	0.02	-21.4817	16.5321	0.84364	0.0:1.0:0.0:0.0	.	96	Q96G21	IMP4_HUMAN	C	96;96;11;41	ENSP00000259239:R96C;ENSP00000386411:R96C;ENSP00000386716:R11C;ENSP00000389701:R41C	ENSP00000259239:R96C	R	+	1	0	IMP4	130819508	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.947000	0.49058	2.574000	0.86865	0.655000	0.94253	CGC		0.577	IMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254520.2	NM_033416	
SCN2A	6326	broad.mit.edu	37	2	166187994	166187994	+	Silent	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:166187994C>T	ENST00000375437.2	+	14	2594	c.2304C>T	c.(2302-2304)tgC>tgT	p.C768C	SCN2A_ENST00000375427.2_Silent_p.C768C|SCN2A_ENST00000283256.6_Silent_p.C768C|SCN2A_ENST00000357398.3_Silent_p.C768C	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	768					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.C768C(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCACCATCTGCATTGTCTTAA	0.453																																					p.C768C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2304T	2						.						184.0	156.0	166.0					2																	166187994		2203	4300	6503	165896240	SO:0001819	synonymous_variant	6326	exon13			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2304C>T	2.37:g.166187994C>T			165896240	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	ENST00000375437.2	37	CCDS33314.1																																																																																				0.453	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
LRP2	4036	broad.mit.edu	37	2	170062116	170062116	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:170062116C>A	ENST00000263816.3	-	41	7873	c.7588G>T	c.(7588-7590)Gcc>Tcc	p.A2530S		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2530					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.A2530S(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TCGATTTTGGCATGTGTATCC	0.448																																					p.A2530S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7588T	2						.						106.0	99.0	101.0					2																	170062116		2203	4300	6503	169770362	SO:0001583	missense	4036	exon41				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7588G>T	2.37:g.170062116C>A	ENSP00000263816:p.Ala2530Ser		169770362	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.899350	0.72754	.	.	ENSG00000081479	ENST00000263816	D	0.97811	-4.55	5.9	4.06	0.47325	Six-bladed beta-propeller, TolB-like (1);	0.049137	0.85682	D	0.000000	D	0.98153	0.9390	M	0.63208	1.945	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97148	0.9829	10	0.24483	T	0.36	.	16.5558	0.84484	0.0:0.7543:0.2457:0.0	.	2530	P98164	LRP2_HUMAN	S	2530	ENSP00000263816:A2530S	ENSP00000263816:A2530S	A	-	1	0	LRP2	169770362	1.000000	0.71417	0.617000	0.29091	0.461000	0.32589	4.958000	0.63660	0.790000	0.33803	0.561000	0.74099	GCC		0.448	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
CCDC173	129881	broad.mit.edu	37	2	170537614	170537614	+	Missense_Mutation	SNP	G	G	A	rs368411685		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:170537614G>A	ENST00000447353.1	-	2	302	c.197C>T	c.(196-198)aCa>aTa	p.T66I		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	66								p.T60I(1)									TGCTTCTCTTGTCAACCTGTC	0.433																																					p.T66I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C197T	2						.						200.0	195.0	197.0					2																	170537614		2016	4178	6194	170245860	SO:0001583	missense	129881	exon2			BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.197C>T	2.37:g.170537614G>A	ENSP00000391504:p.Thr66Ile		170245860	NM_001085447	Q6PJF6	Missense_Mutation	SNP	ENST00000447353.1	37	CCDS46445.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890663	0.72524	.	.	ENSG00000154479	ENST00000447353;ENST00000419478	D	0.88818	-2.43	5.79	4.87	0.63330	.	0.523465	0.17068	U	0.188264	D	0.90109	0.6910	L	0.60455	1.87	0.24609	N	0.993736	D	0.60160	0.987	P	0.53912	0.737	D	0.83770	0.0219	10	0.56958	D	0.05	.	10.7607	0.46264	0.0:0.1918:0.6937:0.1145	.	66	Q0VFZ6	CB077_HUMAN	I	66;42	ENSP00000408143:T42I	ENSP00000408143:T42I	T	-	2	0	C2orf77	170245860	0.762000	0.28451	1.000000	0.80357	0.984000	0.73092	2.425000	0.44723	2.740000	0.93945	0.563000	0.77884	ACA		0.433	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333954.2	NM_001085447	
TTN	7273	broad.mit.edu	37	2	179428371	179428371	+	Missense_Mutation	SNP	G	G	T	rs373909196		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:179428371G>T	ENST00000591111.1	-	276	77789	c.77565C>A	c.(77563-77565)gaC>gaA	p.D25855E	TTN_ENST00000342175.6_Missense_Mutation_p.D18623E|TTN_ENST00000460472.2_Missense_Mutation_p.D18431E|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D24928E|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D18556E|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D27496E|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25855	Fibronectin type-III 88. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.D18623E(1)|p.D18431E(1)|p.D24926E(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGGTACCTCCGTCGTCTACTG	0.473																																					p.T18431K												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C55292A	2						.						132.0	129.0	130.0					2																	179428371		1962	4148	6110	179136617	SO:0001583	missense	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.77565C>A	2.37:g.179428371G>T	ENSP00000465570:p.Asp25855Glu		179136617	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	11.47	1.649409	0.29336	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.86	-2.62	0.06152	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.64649	0.2617	M	0.89601	3.045	0.41898	D	0.9904	P;P;P;P	0.51057	0.941;0.941;0.941;0.9	P;P;P;P	0.50270	0.636;0.636;0.636;0.623	T	0.72424	-0.4298	9	0.87932	D	0	.	11.667	0.51379	0.637:0.0:0.363:0.0	.	18431;18556;18623;25855	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	24928;18431;18623;18556;18429	ENSP00000343764:D24928E;ENSP00000434586:D18431E;ENSP00000340554:D18623E;ENSP00000352154:D18556E	ENSP00000340554:D18623E	D	-	3	2	TTN	179136617	1.000000	0.71417	0.911000	0.35937	0.983000	0.72400	1.468000	0.35332	-0.721000	0.04929	-0.294000	0.09567	GAC		0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZNF804A	91752	broad.mit.edu	37	2	185802743	185802743	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:185802743C>G	ENST00000302277.6	+	4	3214	c.2620C>G	c.(2620-2622)Caa>Gaa	p.Q874E		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	874							metal ion binding (GO:0046872)	p.Q874E(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						ACAAACAAACCAATTAAGAAA	0.358																																					p.Q874E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2620G	2						.						87.0	79.0	82.0					2																	185802743		2203	4300	6503	185510988	SO:0001583	missense	91752	exon4			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2620C>G	2.37:g.185802743C>G	ENSP00000303252:p.Gln874Glu		185510988	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	3.107	-0.183550	0.06340	.	.	ENSG00000170396	ENST00000302277	T	0.05649	3.41	5.42	-2.67	0.06059	.	1.070660	0.07245	N	0.864947	T	0.05273	0.0140	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44697	-0.9311	10	0.28530	T	0.3	-1.4825	10.1221	0.42627	0.3716:0.3235:0.3048:0.0	.	874	Q7Z570	Z804A_HUMAN	E	874	ENSP00000303252:Q874E	ENSP00000303252:Q874E	Q	+	1	0	ZNF804A	185510988	0.000000	0.05858	0.000000	0.03702	0.057000	0.15508	-0.284000	0.08422	-0.337000	0.08426	-0.274000	0.10170	CAA		0.358	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
INPP1	3628	broad.mit.edu	37	2	191236066	191236066	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:191236066C>T	ENST00000322522.4	+	6	1594	c.1138C>T	c.(1138-1140)Cgg>Tgg	p.R380W	INPP1_ENST00000541441.1_Missense_Mutation_p.R380W|INPP1_ENST00000392329.2_Missense_Mutation_p.R380W	NM_002194.3	NP_002185.1	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	380					dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-1,3,4-trisphosphate 1-phosphatase activity (GO:0052829)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|metal ion binding (GO:0046872)	p.R380W(1)		cervix(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)			ATCCAGGAAGCGGCTGGAGAC	0.537																																					p.R380W	Melanoma(130;184 1743 2185 19805 38428)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1138T	2						.						60.0	58.0	59.0					2																	191236066		2203	4300	6503	190944311	SO:0001583	missense	3628	exon6				CCDS2305.1	2q32	2008-02-07			ENSG00000151689	ENSG00000151689	3.1.3.57		6071	protein-coding gene	gene with protein product		147263				8390685	Standard	NM_002194		Approved		uc010fsb.3	P49441	OTTHUMG00000132672	ENST00000322522.4:c.1138C>T	2.37:g.191236066C>T	ENSP00000325423:p.Arg380Trp		190944311	NM_002194		Missense_Mutation	SNP	ENST00000322522.4	37	CCDS2305.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.268557	0.80469	.	.	ENSG00000151689	ENST00000392329;ENST00000322522;ENST00000541441	T;T;T	0.31247	1.5;1.5;1.5	5.38	5.38	0.77491	.	0.491866	0.23581	N	0.046652	T	0.34483	0.0899	L	0.40543	1.245	0.35932	D	0.832611	D	0.63880	0.993	P	0.47376	0.545	T	0.40308	-0.9570	10	0.62326	D	0.03	-7.2983	16.7267	0.85423	0.0:1.0:0.0:0.0	.	380	P49441	INPP_HUMAN	W	380	ENSP00000376142:R380W;ENSP00000325423:R380W;ENSP00000440650:R380W	ENSP00000325423:R380W	R	+	1	2	INPP1	190944311	0.836000	0.29430	0.688000	0.30117	0.884000	0.51177	3.680000	0.54641	2.821000	0.97095	0.555000	0.69702	CGG		0.537	INPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255932.2		
RASGRP3	25780	broad.mit.edu	37	2	33745019	33745019	+	Splice_Site	SNP	G	G	A	rs200007507		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:33745019G>A	ENST00000403687.3	+	5	914	c.174G>A	c.(172-174)atG>atA	p.M58I	RASGRP3_ENST00000407811.1_Splice_Site_p.M58I|RASGRP3_ENST00000402538.3_Splice_Site_p.M58I	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	58	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)	p.?(1)		large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					ACTGGTTTACGTATCGAAATG	0.373													G|||	1	0.000199681	0.0	0.0	5008	,	,		18408	0.0		0.001	False		,,,				2504	0.0				p.M58I												.	.	1	Unknown(1)	large_intestine(1)	c.G174A	2						.						122.0	130.0	127.0					2																	33745019		1864	4094	5958	33598523	SO:0001630	splice_region_variant	25780	exon6			AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.174-1G>A	2.37:g.33745019G>A			33598523	NM_170672	D6W583|O94931|Q53SD7	Missense_Mutation	SNP	ENST00000403687.3	37	CCDS46256.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	5.535	0.283565	0.10458	.	.	ENSG00000152689	ENST00000402538;ENST00000437184;ENST00000403687;ENST00000442390;ENST00000444784;ENST00000423159;ENST00000407811	T;T;T;T;T;T;T	0.45276	0.9;0.9;0.9;1.64;0.9;0.9;0.9	6.17	4.31	0.51392	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	1.132380	0.06429	N	0.723723	T	0.26593	0.0650	N	0.14661	0.345	0.39626	D	0.970103	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.13926	-1.0491	9	.	.	.	.	7.1577	0.25647	0.0633:0.3426:0.4761:0.118	.	58;58	D6W583;Q8IV61	.;GRP3_HUMAN	I	58	ENSP00000385886:M58I;ENSP00000393866:M58I;ENSP00000384192:M58I;ENSP00000405648:M58I;ENSP00000400602:M58I;ENSP00000388139:M58I;ENSP00000383917:M58I	.	M	+	3	0	RASGRP3	33598523	0.995000	0.38212	0.998000	0.56505	0.118000	0.20060	0.237000	0.17985	1.612000	0.50221	0.655000	0.94253	ATG		0.373	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376	Missense_Mutation
ETAA1	54465	broad.mit.edu	37	2	67630513	67630513	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:67630513T>G	ENST00000272342.5	+	5	829	c.699T>G	c.(697-699)gaT>gaG	p.D233E	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	233						cytoplasm (GO:0005737)		p.D233E(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						ATTATAAAGATAATATACAGA	0.303																																					p.D233E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T699G	2						.						38.0	46.0	43.0					2																	67630513		2188	4288	6476	67484017	SO:0001583	missense	54465	exon5			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.699T>G	2.37:g.67630513T>G	ENSP00000272342:p.Asp233Glu		67484017	NM_019002	Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	37	CCDS1882.1	.	.	.	.	.	.	.	.	.	.	T	10.69	1.420859	0.25639	.	.	ENSG00000143971	ENST00000272342	T	0.34072	1.38	5.96	2.01	0.26516	.	0.421784	0.24165	N	0.040949	T	0.28566	0.0707	L	0.52364	1.645	0.09310	N	1	B	0.27351	0.176	B	0.23419	0.046	T	0.19160	-1.0314	10	0.46703	T	0.11	-21.4492	8.1137	0.30930	0.2274:0.0:0.1177:0.6549	.	233	Q9NY74	ETAA1_HUMAN	E	233	ENSP00000272342:D233E	ENSP00000272342:D233E	D	+	3	2	ETAA1	67484017	0.945000	0.32115	0.636000	0.29352	0.059000	0.15707	0.589000	0.23939	1.026000	0.39733	0.528000	0.53228	GAT		0.303	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002	
KIF1A	547	broad.mit.edu	37	2	241712558	241712558	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr2:241712558C>T	ENST00000320389.7	-	13	1311	c.1153G>A	c.(1153-1155)Gcc>Acc	p.A385T	KIF1A_ENST00000498729.2_Missense_Mutation_p.A385T	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	385					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)	p.A385T(1)		NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		AGACCCTGGGCGTACAGAAGG	0.607																																					p.A385T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1153A	2						.						54.0	60.0	58.0					2																	241712558		2188	4280	6468	241361231	SO:0001583	missense	547	exon13			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.1153G>A	2.37:g.241712558C>T	ENSP00000322791:p.Ala385Thr		241361231	NM_004321	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.33|16.33	3.092092|3.092092	0.55968|0.55968	.|.	.|.	ENSG00000130294|ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283|ENST00000428768	T;T;T|.	0.74209|.	-0.68;-0.74;-0.82|.	3.83|3.83	3.83|3.83	0.44106|0.44106	.|.	0.059396|.	0.64402|.	U|.	0.000003|.	T|T	0.76278|0.76278	0.3965|0.3965	M|M	0.80982|0.80982	2.52|2.52	0.58432|0.58432	D|D	0.999993|0.999993	B;P;P|.	0.51351|.	0.402;0.93;0.944|.	B;B;B|.	0.42163|.	0.147;0.378;0.344|.	T|T	0.79434|0.79434	-0.1805|-0.1805	10|5	0.46703|.	T|.	0.11|.	.|.	15.7385|15.7385	0.77866|0.77866	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	385;385;385|.	F5H045;Q12756-2;Q12756|.	.;.;KIF1A_HUMAN|.	T|H	385|192	ENSP00000322791:A385T;ENSP00000438388:A385T;ENSP00000384231:A385T|.	ENSP00000322791:A385T|.	A|R	-|-	1|2	0|0	KIF1A|KIF1A	241361231|241361231	0.992000|0.992000	0.36948|0.36948	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	3.006000|3.006000	0.49529|0.49529	1.688000|1.688000	0.51068|0.51068	0.491000|0.491000	0.48974|0.48974	GCC|CGC		0.607	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
BSN	8927	broad.mit.edu	37	3	49697974	49697975	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr3:49697974_49697975insC	ENST00000296452.4	+	6	8810_8811	c.8696_8697insC	c.(8695-8700)agccccfs	p.SP2899fs		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2899					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		ACACTGCCCAGCCCCCCTCCAG	0.678																																					p.S2899fs												.	.	0			c.8696_8697insC	3						.																																			49672979	SO:0001589	frameshift_variant	8927	exon6			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.8702dupC	3.37:g.49697980_49697980dupC	ENSP00000296452:p.Ser2899fs		49672978	NM_003458	O43161|Q7LGH3	Frame_Shift_Ins	INS	ENST00000296452.4	37	CCDS2800.1																																																																																				0.678	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
PLXND1	23129	broad.mit.edu	37	3	129289975	129289975	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr3:129289975G>A	ENST00000324093.4	-	18	3686	c.3508C>T	c.(3508-3510)Ctg>Ttg	p.L1170L	PLXND1_ENST00000393239.1_Silent_p.L1170L	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1170					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)	p.L1170L(1)	PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						AGGTAGTCCAGGCGGAACCTG	0.627																																					p.L1170L	Ovarian(97;366 1484 3738 22084 39045)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3508T	3						.						124.0	136.0	132.0					3																	129289975		2203	4300	6503	130772665	SO:0001819	synonymous_variant	23129	exon18			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3508C>T	3.37:g.129289975G>A			130772665	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Silent	SNP	ENST00000324093.4	37	CCDS33854.1																																																																																				0.627	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
PFN2	5217	broad.mit.edu	37	3	149683984	149683984	+	3'UTR	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr3:149683984G>A	ENST00000239940.7	-	0	967				PFN2_ENST00000497148.1_3'UTR|PFN2_ENST00000494827.1_Silent_p.L82L|PFN2_ENST00000481767.1_Silent_p.L82L|PFN2_ENST00000423691.2_Silent_p.L131L|PFN2_ENST00000452853.2_Silent_p.L131L|PFN2_ENST00000490975.1_3'UTR			P35080	PROF2_HUMAN	profilin 2						actin cytoskeleton organization (GO:0030036)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of ATPase activity (GO:0032781)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|regulation of synaptic vesicle exocytosis (GO:2000300)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|terminal bouton (GO:0043195)	actin monomer binding (GO:0003785)|adenyl-nucleotide exchange factor activity (GO:0000774)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.L131L(1)		large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GGTATAAAGCGAGTTCATATG	0.433																																					p.L131L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C393T	3						.						246.0	247.0	247.0					3																	149683984		1999	4171	6170	151166674	SO:0001624	3_prime_UTR_variant	5217	exon3			L10678	CCDS3148.1, CCDS46934.1	3q25.1	2006-10-16			ENSG00000070087	ENSG00000070087			8882	protein-coding gene	gene with protein product		176590				8975700, 8365484	Standard	NM_002628		Approved		uc003ext.1	P35080	OTTHUMG00000159683	ENST00000239940.7:c.*292C>T	3.37:g.149683984G>A			151166674	NM_002628	B2R4C8|D3DNI4|Q4VBQ4|Q8WVF9|Q9HBK2	Silent	SNP	ENST00000239940.7	37	CCDS3148.1																																																																																				0.433	PFN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356873.2	NM_002628	
PIK3CA	5290	broad.mit.edu	37	3	178922321	178922321	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr3:178922321G>A	ENST00000263967.3	+	6	1247	c.1090G>A	c.(1090-1092)Gga>Aga	p.G364R		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	364	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		G -> R (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.G364R(4)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CTACCATGGAGGAGAACCCTT	0.348		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.G364R	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	.	.	4	Substitution - Missense(4)	endometrium(3)|large_intestine(1)	c.G1090A	3						.						216.0	178.0	189.0					3																	178922321		1844	4097	5941	180405015	SO:0001583	missense	5290	exon6				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1090G>A	3.37:g.178922321G>A	ENSP00000263967:p.Gly364Arg		180405015	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806104	0.70682	.	.	ENSG00000121879	ENST00000263967	T	0.73047	-0.71	5.53	5.53	0.82687	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.052670	0.85682	D	0.000000	T	0.71693	0.3370	M	0.64404	1.975	0.80722	D	1	P	0.35155	0.487	B	0.36289	0.221	T	0.72571	-0.4253	10	0.49607	T	0.09	-21.3917	19.431	0.94765	0.0:0.0:1.0:0.0	.	364	P42336	PK3CA_HUMAN	R	364	ENSP00000263967:G364R	ENSP00000263967:G364R	G	+	1	0	PIK3CA	180405015	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.335000	0.96500	2.600000	0.87896	0.655000	0.94253	GGA		0.348	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
CSPG5	10675	broad.mit.edu	37	3	47618907	47618907	+	Silent	SNP	C	C	T	rs199702237		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr3:47618907C>T	ENST00000383738.2	-	2	2707	c.609G>A	c.(607-609)ccG>ccA	p.P203P	CSPG5_ENST00000456150.1_Silent_p.P65P|CSPG5_ENST00000264723.4_Silent_p.P203P|CSPG5_ENST00000465441.1_5'Flank	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	203					axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)	p.P203P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TATCTGATGCCGGTTGGGGCT	0.597																																					p.P203P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G609A	3						.	C	,,,,	0,4406		0,0,2203	53.0	57.0	56.0		195,609,609,195,609	-8.5	0.0	3		56	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CSPG5	NM_001206942.1,NM_001206943.1,NM_001206944.1,NM_001206945.1,NM_006574.3	,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,	65/402,203/567,203/478,65/429,203/540	47618907	1,13005	2203	4300	6503	47593911	SO:0001819	synonymous_variant	10675	exon2			AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.609G>A	3.37:g.47618907C>T			47593911	NM_006574	Q71M39|Q71M40	Silent	SNP	ENST00000383738.2	37	CCDS56253.1																																																																																				0.597	CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257489.1	NM_006574	
COL7A1	1294	broad.mit.edu	37	3	48626111	48626111	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr3:48626111G>A	ENST00000328333.8	-	19	2658	c.2551C>T	c.(2551-2553)Cgc>Tgc	p.R851C	COL7A1_ENST00000454817.1_Missense_Mutation_p.R851C	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	851	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).			R -> H (in Ref. 4; BAA02853). {ECO:0000305}.	cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R851C(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GTGCCCTCGCGGTCCCCGACA	0.592																																					p.R851C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2551T	3						.						73.0	71.0	72.0					3																	48626111		2203	4300	6503	48601115	SO:0001583	missense	1294	exon19			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.2551C>T	3.37:g.48626111G>A	ENSP00000332371:p.Arg851Cys		48601115	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	G	9.665	1.145199	0.21288	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.54071	0.59;0.59	5.38	4.51	0.55191	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.42964	D	0.000636	T	0.42426	0.1202	L	0.44542	1.39	0.46678	D	0.99915	B	0.26775	0.159	B	0.22386	0.039	T	0.42783	-0.9431	10	0.87932	D	0	.	8.4161	0.32672	0.0795:0.0:0.7672:0.1533	.	851	Q02388	CO7A1_HUMAN	C	851	ENSP00000332371:R851C;ENSP00000412569:R851C	ENSP00000332371:R851C	R	-	1	0	COL7A1	48601115	1.000000	0.71417	0.994000	0.49952	0.474000	0.32979	4.896000	0.63222	1.417000	0.47077	-0.136000	0.14681	CGC		0.592	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
WDR6	11180	broad.mit.edu	37	3	49051263	49051263	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr3:49051263G>A	ENST00000608424.1	+	2	2335	c.2296G>A	c.(2296-2298)Gca>Aca	p.A766T	WDR6_ENST00000415265.2_Missense_Mutation_p.A214T|WDR6_ENST00000395474.3_Missense_Mutation_p.A796T|WDR6_ENST00000448293.1_Missense_Mutation_p.A715T			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	766					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.A766T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		CTCAGCCCACGCACTCACAGC	0.577											OREG0015565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A796T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2386A	3						.						88.0	83.0	84.0					3																	49051263		2203	4300	6503	49026267	SO:0001583	missense	11180	exon2			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.2296G>A	3.37:g.49051263G>A	ENSP00000477389:p.Ala766Thr	959	49026267	NM_018031	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	ENST00000608424.1	37		.	.	.	.	.	.	.	.	.	.	G	11.84	1.758369	0.31137	.	.	ENSG00000178252	ENST00000395474;ENST00000415265;ENST00000448293	T;T	0.59772	0.24;0.25	5.69	3.74	0.42951	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.429234	0.27231	N	0.020302	T	0.22244	0.0536	N	0.08118	0	0.09310	N	1	P;P;P	0.36909	0.573;0.513;0.513	B;B;B	0.20384	0.017;0.029;0.012	T	0.16394	-1.0404	10	0.09084	T	0.74	-22.5761	3.9444	0.09343	0.0895:0.2804:0.4936:0.1366	.	214;766;715	E9PBK6;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	T	796;214;715	ENSP00000378857:A796T;ENSP00000413432:A715T	ENSP00000378857:A796T	A	+	1	0	WDR6	49026267	0.842000	0.29525	0.321000	0.25320	0.925000	0.55904	2.233000	0.43027	2.689000	0.91719	0.561000	0.74099	GCA		0.577	WDR6-024	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471652.1		
ROBO1	6091	broad.mit.edu	37	3	78708890	78708890	+	Silent	SNP	A	A	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr3:78708890A>T	ENST00000464233.1	-	17	2501	c.2388T>A	c.(2386-2388)gtT>gtA	p.V796V	ROBO1_ENST00000467549.1_Silent_p.V760V|ROBO1_ENST00000436010.2_Silent_p.V757V|ROBO1_ENST00000495273.1_Silent_p.V760V	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	796	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.V773V(1)|p.V796V(1)|p.V760V(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GCTGCCAACTAACTAGAATTG	0.398																																					p.V796V												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.T2388A	3						.						54.0	53.0	53.0					3																	78708890		1841	4090	5931	78791580	SO:0001819	synonymous_variant	6091	exon17			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2388T>A	3.37:g.78708890A>T			78791580	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	37	CCDS54611.1																																																																																				0.398	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
FETUB	26998	broad.mit.edu	37	3	186370381	186370381	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr3:186370381G>A	ENST00000265029.3	+	7	1211	c.1110G>A	c.(1108-1110)ggG>ggA	p.G370G	RP11-134F2.2_ENST00000455926.1_RNA|FETUB_ENST00000450521.1_Silent_p.G370G|RP11-134F2.2_ENST00000428501.1_RNA|FETUB_ENST00000382134.3_Silent_p.G305G|FETUB_ENST00000382136.3_Silent_p.G333G|FETUB_ENST00000539949.1_Silent_p.G222G	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B	370					binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)	p.G370G(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		AGTGCCCAGGGCCAGCCCAGA	0.567																																					p.G370G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1110A	3						.						43.0	46.0	45.0					3																	186370381		2202	4300	6502	187853075	SO:0001819	synonymous_variant	26998	exon7			AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.1110G>A	3.37:g.186370381G>A			187853075	NM_014375	B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Silent	SNP	ENST00000265029.3	37	CCDS3279.1																																																																																				0.567	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1	NM_014375	
EVC2	132884	broad.mit.edu	37	4	5667362	5667362	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr4:5667362G>A	ENST00000344408.5	-	8	938	c.885C>T	c.(883-885)caC>caT	p.H295H	EVC2_ENST00000310917.2_Silent_p.H215H|EVC2_ENST00000344938.1_Silent_p.H295H	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	295					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.H295H(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CGTGGAGGCCGTGGTGCGGCA	0.562																																					p.H215H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C645T	4						.						135.0	87.0	103.0					4																	5667362		2203	4300	6503	5718263	SO:0001819	synonymous_variant	132884	exon8			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.885C>T	4.37:g.5667362G>A			5718263	NM_001166136	Q86YT3|Q86YT4|Q8NG49	Silent	SNP	ENST00000344408.5	37	CCDS3382.2																																																																																				0.562	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
KIAA0232	9778	broad.mit.edu	37	4	6863124	6863124	+	Missense_Mutation	SNP	G	G	A	rs367656934		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr4:6863124G>A	ENST00000307659.5	+	7	1470	c.1015G>A	c.(1015-1017)Ggt>Agt	p.G339S	KIAA0232_ENST00000425103.1_Missense_Mutation_p.G339S	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	339							ATP binding (GO:0005524)	p.G339S(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						TTTGAAGCACGGTGAAAAGGC	0.433																																					p.G339S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1015A	4						.	G	SER/GLY,SER/GLY	0,3824		0,0,1912	71.0	71.0	71.0		1015,1015	-3.4	0.0	4		71	1,8253		0,1,4126	no	missense,missense	KIAA0232	NM_001100590.1,NM_014743.2	56,56	0,1,6038	AA,AG,GG		0.0121,0.0,0.0083	benign,benign	339/1396,339/1396	6863124	1,12077	1912	4127	6039	6914025	SO:0001583	missense	9778	exon7			D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.1015G>A	4.37:g.6863124G>A	ENSP00000303928:p.Gly339Ser		6914025	NM_014743	A7E2D2	Missense_Mutation	SNP	ENST00000307659.5	37	CCDS43209.1	.	.	.	.	.	.	.	.	.	.	G	3.654	-0.070938	0.07228	0.0	1.21E-4	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.84	-3.4	0.04853	.	0.653769	0.17086	N	0.187591	T	0.22166	0.0534	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22730	-1.0208	9	0.17369	T	0.5	-26.2848	8.4854	0.33067	0.4166:0.0:0.4881:0.0953	.	339	Q92628	K0232_HUMAN	S	339	.	ENSP00000303928:G339S	G	+	1	0	KIAA0232	6914025	0.000000	0.05858	0.000000	0.03702	0.092000	0.18411	-0.140000	0.10342	-0.648000	0.05437	-0.140000	0.14226	GGT		0.433	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
SCFD2	152579	broad.mit.edu	37	4	53740161	53740161	+	Missense_Mutation	SNP	C	C	T	rs149034746		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr4:53740161C>T	ENST00000401642.3	-	9	2163	c.2030G>A	c.(2029-2031)cGa>cAa	p.R677Q	SCFD2_ENST00000388940.4_Missense_Mutation_p.R632Q	NM_152540.3	NP_689753.2	Q8WU76	SCFD2_HUMAN	sec1 family domain containing 2	677					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)			p.R677Q(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	30			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TGGATGCAGTCGGTCAGTTGC	0.498																																					p.R677Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2030A	4						.	C	GLN/ARG	0,4406		0,0,2203	133.0	116.0	122.0		2030	4.1	1.0	4	dbSNP_134	122	1,8599	1.2+/-3.3	0,1,4299	no	missense	SCFD2	NM_152540.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	677/685	53740161	1,13005	2203	4300	6503	53434918	SO:0001583	missense	152579	exon9			AY299407	CCDS33984.1	4q12	2004-01-15			ENSG00000184178	ENSG00000184178			30676	protein-coding gene	gene with protein product						12477932	Standard	NM_152540		Approved	STXBP1L1, FLJ39514	uc003gzu.3	Q8WU76	OTTHUMG00000160588	ENST00000401642.3:c.2030G>A	4.37:g.53740161C>T	ENSP00000384182:p.Arg677Gln		53434918	NM_152540	Q8N5F3|Q8N8H0|Q96ED3	Missense_Mutation	SNP	ENST00000401642.3	37	CCDS33984.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249632	0.59212	0.0	1.16E-4	ENSG00000184178	ENST00000401642;ENST00000388940	T;T	0.50813	0.73;0.8	5.04	4.13	0.48395	.	0.166521	0.36002	N	0.002860	T	0.48429	0.1499	N	0.19112	0.55	0.40204	D	0.97754	D;D	0.89917	1.0;1.0	D;P	0.67900	0.954;0.901	T	0.48422	-0.9037	10	0.49607	T	0.09	.	9.8066	0.40797	0.0:0.7778:0.1424:0.0798	.	632;677	Q8WU76-2;Q8WU76	.;SCFD2_HUMAN	Q	677;632	ENSP00000384182:R677Q;ENSP00000373592:R632Q	ENSP00000373592:R632Q	R	-	2	0	SCFD2	53434918	0.998000	0.40836	0.999000	0.59377	0.233000	0.25261	2.157000	0.42320	2.508000	0.84585	0.655000	0.94253	CGA		0.498	SCFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361311.3	NM_152540	
DDX60	55601	broad.mit.edu	37	4	169138105	169138105	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr4:169138105C>A	ENST00000393743.3	-	38	5409	c.5118G>T	c.(5116-5118)tgG>tgT	p.W1706C		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1706					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)	p.W1706C(2)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TTAACTTTTCCCAAAAAGTTG	0.338																																					p.W1706C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5118T	4						.						122.0	119.0	120.0					4																	169138105		2203	4300	6503	169374680	SO:0001583	missense	55601	exon38			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.5118G>T	4.37:g.169138105C>A	ENSP00000377344:p.Trp1706Cys		169374680	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	7.062	0.566672	0.13560	.	.	ENSG00000137628	ENST00000393743	T	0.16457	2.34	5.26	-5.51	0.02568	.	4.367920	0.00166	N	0.000006	T	0.11324	0.0276	N	0.22421	0.69	0.20638	N	0.999877	B	0.02656	0.0	B	0.04013	0.001	T	0.31475	-0.9942	10	0.38643	T	0.18	.	7.988	0.30224	0.2134:0.4808:0.0:0.3057	.	1706	Q8IY21	DDX60_HUMAN	C	1706	ENSP00000377344:W1706C	ENSP00000377344:W1706C	W	-	3	0	DDX60	169374680	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-4.421000	0.00236	-0.698000	0.05085	-0.319000	0.08680	TGG		0.338	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
APC	324	broad.mit.edu	37	5	112174394	112174394	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr5:112174394C>T	ENST00000457016.1	+	16	3483	c.3103C>T	c.(3103-3105)Cag>Tag	p.Q1035*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1035*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1035*			P25054	APC_HUMAN	adenomatous polyposis coli	1035	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1035*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTCAGATGAGCAGTTGAACTC	0.358		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1017X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.C3049T	5	GRCh37	CI995209	APC	I		.						66.0	68.0	67.0					5																	112174394		2202	4300	6502	112202293	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3103C>T	5.37:g.112174394C>T	ENSP00000413133:p.Gln1035*		112202293	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	6.788159	0.97837	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.76	4.89	0.63831	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-7.5939	13.2068	0.59803	0.1268:0.7512:0.1219:0.0	.	.	.	.	X	1035;1017;1035;1035;1035	.	ENSP00000257430:Q1035X	Q	+	1	0	APC	112202293	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.294000	0.78760	1.439000	0.47511	0.655000	0.94253	CAG		0.358	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PDGFRB	5159	broad.mit.edu	37	5	149495360	149495360	+	Missense_Mutation	SNP	G	G	A	rs114435947	byFrequency	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr5:149495360G>A	ENST00000261799.4	-	23	3756	c.3287C>T	c.(3286-3288)gCg>gTg	p.A1096V	CSF1R_ENST00000286301.3_5'Flank	NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	1096					adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)	p.A1096V(1)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CGCCCGAGGCGCAGGGCACCC	0.687			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""								G|||	6	0.00119808	0.0	0.0	5008	,	,		17381	0.0		0.005	False		,,,				2504	0.001				p.A1096V			Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3287T	5						.	G	VAL/ALA	5,4401	8.1+/-20.4	0,5,2198	27.0	30.0	29.0		3287	1.3	0.0	5	dbSNP_132	29	31,8569	21.6+/-65.8	0,31,4269	yes	missense	PDGFRB	NM_002609.3	64	0,36,6467	AA,AG,GG		0.3605,0.1135,0.2768	benign	1096/1107	149495360	36,12970	2203	4300	6503	149475553	SO:0001583	missense	5159	exon23			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.3287C>T	5.37:g.149495360G>A	ENSP00000261799:p.Ala1096Val		149475553	NM_002609	B5A957|Q8N5L4	Missense_Mutation	SNP	ENST00000261799.4	37	CCDS4303.1	4	0.0018315018315018315	0	0.0	0	0.0	0	0.0	4	0.005277044854881266	G	13.96	2.393219	0.42410	0.001135	0.003605	ENSG00000113721	ENST00000261799;ENST00000544453	T	0.75821	-0.97	5.18	1.33	0.21861	.	0.308756	0.23426	N	0.048318	T	0.39911	0.1096	N	0.08118	0	0.09310	N	1	B;B	0.27416	0.056;0.178	B;B	0.18561	0.013;0.022	T	0.37197	-0.9716	10	0.72032	D	0.01	.	5.3838	0.16206	0.0:0.4809:0.3368:0.1822	.	1096;1096	A8KAM8;P09619	.;PGFRB_HUMAN	V	1096;766	ENSP00000261799:A1096V	ENSP00000261799:A1096V	A	-	2	0	PDGFRB	149475553	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.385000	0.20685	0.055000	0.16094	-0.502000	0.04539	GCG		0.687	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609	
NDST1	3340	broad.mit.edu	37	5	149907757	149907757	+	Missense_Mutation	SNP	C	C	T	rs148852608		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr5:149907757C>T	ENST00000261797.6	+	3	1407	c.905C>T	c.(904-906)aCg>aTg	p.T302M	NDST1_ENST00000523767.1_Missense_Mutation_p.T302M	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	302	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.T302M(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCCTTCCTCACGGGGAAGCGC	0.602																																					p.T302M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C905T	5						.						105.0	90.0	95.0					5																	149907757		2203	4300	6503	149887950	SO:0001583	missense	3340	exon3			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.905C>T	5.37:g.149907757C>T	ENSP00000261797:p.Thr302Met		149887950	NM_001543	Q96E57	Missense_Mutation	SNP	ENST00000261797.6	37	CCDS34277.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944053	0.73672	.	.	ENSG00000070614	ENST00000523767;ENST00000261797	T;T	0.46819	0.86;1.18	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.67258	0.2874	M	0.63208	1.945	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.992;0.999;0.992	T	0.66077	-0.6013	10	0.42905	T	0.14	.	18.9017	0.92444	0.0:1.0:0.0:0.0	.	302;302;302	E7EVJ3;P52848-2;P52848	.;.;NDST1_HUMAN	M	302	ENSP00000428604:T302M;ENSP00000261797:T302M	ENSP00000261797:T302M	T	+	2	0	NDST1	149887950	1.000000	0.71417	0.948000	0.38648	0.742000	0.42306	7.712000	0.84684	2.529000	0.85273	0.555000	0.69702	ACG		0.602	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543	
PRDM9	56979	broad.mit.edu	37	5	23527052	23527052	+	Missense_Mutation	SNP	C	C	T	rs111393391		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr5:23527052C>T	ENST00000296682.3	+	11	2037	c.1855C>T	c.(1855-1857)Cgg>Tgg	p.R619W		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	619					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.R619W(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGGCTTTAGCCGGCAGTCAGT	0.622										HNSCC(3;0.000094)																											p.R619W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1855T	5						.						24.0	25.0	24.0					5																	23527052		1631	3494	5125	23562809	SO:0001583	missense	56979	exon11			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1855C>T	5.37:g.23527052C>T	ENSP00000296682:p.Arg619Trp		23562809	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	c	0.010	-1.750750	0.00663	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.36520	1.25	1.89	-3.45	0.04781	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	153.359000	0.00166	N	0.000000	T	0.35364	0.0929	L	0.60957	1.885	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.24728	-1.0152	10	0.37606	T	0.19	.	9.0349	0.36282	0.1506:0.2553:0.5941:0.0	.	619	Q9NQV7	PRDM9_HUMAN	W	619;385	ENSP00000296682:R619W	ENSP00000253473:R385W	R	+	1	2	PRDM9	23562809	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.201000	0.00560	-1.195000	0.02680	-5.417000	0.00001	CGG		0.622	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
CRHBP	1393	broad.mit.edu	37	5	76249497	76249497	+	Missense_Mutation	SNP	G	G	C	rs141268164|rs200529625		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr5:76249497G>C	ENST00000274368.4	+	2	575	c.153G>C	c.(151-153)gaG>gaC	p.E51D	CRHBP_ENST00000506501.1_Missense_Mutation_p.E51D	NM_001882.3	NP_001873.2	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	51					behavioral response to ethanol (GO:0048149)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cellular response to cocaine (GO:0071314)|cellular response to drug (GO:0035690)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to potassium ion (GO:0035865)|cellular response to stress (GO:0033554)|cellular response to tumor necrosis factor (GO:0071356)|female pregnancy (GO:0007565)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|inflammatory response (GO:0006954)|learning or memory (GO:0007611)|maternal aggressive behavior (GO:0002125)|negative regulation of corticotropin secretion (GO:0051460)|negative regulation of corticotropin-releasing hormone receptor activity (GO:1900011)|regulated secretory pathway (GO:0045055)|regulation of corticotropin secretion (GO:0051459)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|synaptic transmission, dopaminergic (GO:0001963)	axon terminus (GO:0043679)|dendrite (GO:0030425)|dense core granule (GO:0031045)|extracellular space (GO:0005615)|intracellular (GO:0005622)|microtubule (GO:0005874)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|perikaryon (GO:0043204)|secondary lysosome (GO:0005767)|secretory granule (GO:0030141)|varicosity (GO:0043196)	corticotropin-releasing hormone binding (GO:0051424)|peptide binding (GO:0042277)	p.E51D(2)		kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		TGGCTGGGGAGCAGCCGTACC	0.687																																					p.E51D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G153C	5						.						10.0	11.0	11.0					5																	76249497		2192	4280	6472	76285253	SO:0001583	missense	1393	exon2			X58022	CCDS4034.1	5q	2008-07-18	2001-11-28		ENSG00000145708	ENSG00000145708			2356	protein-coding gene	gene with protein product		122559	"""corticotropin releasing hormone-binding protein"""			8198617	Standard	NM_001882		Approved	CRF-BP, CRFBP	uc003ker.3	P24387	OTTHUMG00000102133	ENST00000274368.4:c.153G>C	5.37:g.76249497G>C	ENSP00000274368:p.Glu51Asp		76285253	NM_001882	Q53F32|Q6FHT5	Missense_Mutation	SNP	ENST00000274368.4	37	CCDS4034.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.080373	0.55753	.	.	ENSG00000145708	ENST00000274368;ENST00000506501	.	.	.	4.54	3.66	0.41972	CUB (1);	0.293159	0.37437	N	0.002095	T	0.50701	0.1631	L	0.46614	1.455	0.36296	D	0.856711	B;B	0.26708	0.157;0.157	B;B	0.34301	0.179;0.179	T	0.56438	-0.7979	9	0.33940	T	0.23	-24.1019	10.3303	0.43818	0.1548:0.0:0.8452:0.0	.	51;51	D6RHH7;P24387	.;CRHBP_HUMAN	D	51	.	ENSP00000274368:E51D	E	+	3	2	CRHBP	76285253	1.000000	0.71417	0.879000	0.34478	0.944000	0.59088	1.276000	0.33156	2.508000	0.84585	0.462000	0.41574	GAG		0.687	CRHBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219972.2	NM_001882	
SLIT3	6586	broad.mit.edu	37	5	168222516	168222516	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr5:168222516G>A	ENST00000519560.1	-	10	1422	c.1003C>T	c.(1003-1005)Cga>Tga	p.R335*	SLIT3_ENST00000404867.3_Nonsense_Mutation_p.R335*|SLIT3_ENST00000332966.8_Nonsense_Mutation_p.R335*	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	335					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.R335*(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACTCACATTCGCTTCAGTTTC	0.493																																					p.R335X	Ovarian(29;311 847 10864 17279 24903)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1003T	5						.						156.0	146.0	149.0					5																	168222516		2203	4300	6503	168155094	SO:0001587	stop_gained	6586	exon10			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1003C>T	5.37:g.168222516G>A	ENSP00000430333:p.Arg335*		168155094	NM_003062	A6H8U9|J3KNP3|O95804|Q9UFH5	Nonsense_Mutation	SNP	ENST00000519560.1	37	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	G	38	6.878283	0.97904	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	.	.	.	5.18	3.12	0.35913	.	0.094437	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7537	0.51863	0.0:0.0:0.3402:0.6598	.	.	.	.	X	335	.	ENSP00000332164:R335X	R	-	1	2	SLIT3	168155094	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.374000	0.44274	1.125000	0.41998	0.650000	0.86243	CGA		0.493	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
NEDD9	4739	broad.mit.edu	37	6	11191373	11191373	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr6:11191373G>A	ENST00000379446.5	-	5	895	c.729C>T	c.(727-729)ttC>ttT	p.F243F	NEDD9_ENST00000504387.1_Silent_p.F243F|RP3-510L9.1_ENST00000500636.2_RNA	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	243					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)		p.F243F(4)		endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			TGGGAGGGGGGAAGTCATAGT	0.527																																					p.F243F												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.C729T	6						.						48.0	46.0	47.0					6																	11191373		2203	4297	6500	11299359	SO:0001819	synonymous_variant	4739	exon5			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.729C>T	6.37:g.11191373G>A			11299359	NM_006403	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Silent	SNP	ENST00000379446.5	37	CCDS4520.1																																																																																				0.527	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2	NM_006403	
HIST1H2AL	8332	broad.mit.edu	37	6	27833231	27833231	+	Silent	SNP	A	A	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr6:27833231A>T	ENST00000357320.2	+	1	198	c.99A>T	c.(97-99)cgA>cgT	p.R33R		NM_003511.2	NP_003502.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2al	33						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.R33R(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(2)	9						GAGTGCACCGACTGCTCCGCA	0.682																																					p.R33R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A99T	6						.						55.0	64.0	61.0					6																	27833231		2203	4300	6503	27941210	SO:0001819	synonymous_variant	8332	exon1			X83549	CCDS4634.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198374	ENSG00000276903		"""Histones / Replication-dependent"""	4730	protein-coding gene	gene with protein product		602793	"""H2A histone family, member I"", ""histone 1, H2al"""	H2AFI		9439656, 9031620, 12408966	Standard	NM_003511		Approved	H2A/i, dJ193B12.9	uc003njw.3	P0C0S8	OTTHUMG00000014492	ENST00000357320.2:c.99A>T	6.37:g.27833231A>T			27941210	NM_003511	P02261|Q2M1R2|Q76PA6	Silent	SNP	ENST00000357320.2	37	CCDS4634.1																																																																																				0.682	HIST1H2AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040160.1	NM_003511	
OR5V1	81696	broad.mit.edu	37	6	29323445	29323445	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr6:29323445G>T	ENST00000377154.1	-	4	827	c.528C>A	c.(526-528)taC>taA	p.Y176*	OR5V1_ENST00000543825.1_Nonsense_Mutation_p.Y176*			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y176*(1)		breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CACAGAAGAAGTAATTAATCT	0.473																																					p.Y176X	Ovarian(32;43 883 21137 32120 42650)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C528A	6						.						89.0	84.0	86.0					6																	29323445		2203	4299	6502	29431424	SO:0001587	stop_gained	81696	exon1				CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.528C>A	6.37:g.29323445G>T	ENSP00000366359:p.Tyr176*		29431424	NM_030876	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Nonsense_Mutation	SNP	ENST00000377154.1	37	CCDS4657.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490668	0.84962	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	.	.	.	4.43	-2.07	0.07276	.	0.000000	0.30219	N	0.010125	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-28.8293	7.7885	0.29106	0.3956:0.1308:0.4736:0.0	.	.	.	.	X	176	.	ENSP00000366356:Y176X	Y	-	3	2	OR5V1	29431424	0.000000	0.05858	0.931000	0.37212	0.922000	0.55478	-1.697000	0.01910	-0.205000	0.10219	-0.484000	0.04775	TAC		0.473	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3		
NEU1	4758	broad.mit.edu	37	6	31829870	31829870	+	Silent	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr6:31829870C>T	ENST00000375631.4	-	2	387	c.258G>A	c.(256-258)ccG>ccA	p.P86P		NM_000434.3	NP_000425.1	Q99519	NEUR1_HUMAN	sialidase 1 (lysosomal sialidase)	86					glycosphingolipid metabolic process (GO:0006687)|lipid catabolic process (GO:0016042)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)	p.P86P(1)		kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10					Oseltamivir(DB00198)	GAGTGCCCCGCGGAGTGGCTG	0.612																																					p.P86P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G258A	6						.						63.0	52.0	56.0					6																	31829870		1511	2708	4219	31937849	SO:0001819	synonymous_variant	4758	exon2			AF040958	CCDS4723.1	6p21	2012-10-02			ENSG00000204386	ENSG00000204386	3.2.1.18		7758	protein-coding gene	gene with protein product		608272		NEU		9054950	Standard	NM_000434		Approved		uc003nxq.4	Q99519	OTTHUMG00000031284	ENST00000375631.4:c.258G>A	6.37:g.31829870C>T			31937849	NM_000434		Silent	SNP	ENST00000375631.4	37	CCDS4723.1																																																																																				0.612	NEU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076616.2		
NFKBIE	4794	broad.mit.edu	37	6	44232797	44232797	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr6:44232797C>G	ENST00000275015.5	-	1	703	c.704G>C	c.(703-705)cGc>cCc	p.R235P		NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	235					cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)		p.R235P(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GAGTGGCAGGCGTGGGGCCGG	0.672																																					p.R235P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G704C	6						.						13.0	18.0	16.0					6																	44232797		2186	4273	6459	44340775	SO:0001583	missense	4794	exon1			U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.704G>C	6.37:g.44232797C>G	ENSP00000275015:p.Arg235Pro		44340775	NM_004556	Q5T9V9	Missense_Mutation	SNP	ENST00000275015.5	37	CCDS34463.1	.	.	.	.	.	.	.	.	.	.	C	7.490	0.650514	0.14516	.	.	ENSG00000146232	ENST00000275015	T	0.23348	1.91	4.48	3.61	0.41365	.	0.963138	0.08577	N	0.925198	T	0.06645	0.0170	L	0.36672	1.1	0.09310	N	1	P	0.35307	0.494	B	0.27170	0.077	T	0.30822	-0.9965	10	0.25751	T	0.34	-29.7315	8.2993	0.32004	0.0:0.8889:0.0:0.1111	.	235	O00221	IKBE_HUMAN	P	235	ENSP00000275015:R235P	ENSP00000275015:R235P	R	-	2	0	NFKBIE	44340775	0.000000	0.05858	0.030000	0.17652	0.135000	0.20990	0.134000	0.15932	0.895000	0.36342	0.561000	0.74099	CGC		0.672	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040733.2		
OPN5	221391	broad.mit.edu	37	6	47763081	47763081	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr6:47763081G>A	ENST00000371211.2	+	4	566	c.538G>A	c.(538-540)Gga>Aga	p.G180R	OPN5_ENST00000393699.2_Missense_Mutation_p.G180R|OPN5_ENST00000489301.2_Missense_Mutation_p.G180R|OPN5_ENST00000244799.4_3'UTR	NM_181744.3	NP_859528.1	Q6U736	OPN5_HUMAN	opsin 5	180					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.G180R(1)		endometrium(1)|large_intestine(3)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	29						TGAGCCCTTCGGAACCTCGTG	0.607																																					p.G180R	Melanoma(28;740 973 10870 42660 45347)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G538A	6						.						88.0	77.0	81.0					6																	47763081		2203	4300	6503	47871040	SO:0001583	missense	221391	exon4			AY288419	CCDS4923.1	6p12.3	2012-08-08	2004-01-23		ENSG00000124818	ENSG00000124818		"""GPCR / Class A : Opsin receptors"""	19992	protein-coding gene	gene with protein product	"""neuropsin"""	609042	"""transmembrane protein 13"""	TMEM13		14623103, 14623098	Standard	NR_033806		Approved	neuropsin, dJ402H5.1	uc003ozc.3	Q6U736	OTTHUMG00000014803	ENST00000371211.2:c.538G>A	6.37:g.47763081G>A	ENSP00000360255:p.Gly180Arg		47871040	NM_181744	A0AV33|Q5T5B9|Q5T886|Q7Z603|Q86SL5	Missense_Mutation	SNP	ENST00000371211.2	37	CCDS4923.1	.	.	.	.	.	.	.	.	.	.	G	32	5.137040	0.94517	.	.	ENSG00000124818	ENST00000489301;ENST00000371211;ENST00000393699	T;T;T	0.37411	1.2;1.2;1.2	5.91	5.91	0.95273	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.55721	0.1938	M	0.68317	2.08	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.55179	-0.8181	10	0.66056	D	0.02	.	20.2857	0.98533	0.0:0.0:1.0:0.0	.	180	Q6U736	OPN5_HUMAN	R	180	ENSP00000426991:G180R;ENSP00000360255:G180R;ENSP00000377302:G180R	ENSP00000360255:G180R	G	+	1	0	OPN5	47871040	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.476000	0.97823	2.803000	0.96430	0.650000	0.86243	GGA		0.607	OPN5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359451.1	NM_181744	
CD109	135228	broad.mit.edu	37	6	74498307	74498307	+	Silent	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr6:74498307C>T	ENST00000287097.5	+	22	2785	c.2673C>T	c.(2671-2673)ggC>ggT	p.G891G	CD109_ENST00000437994.2_Silent_p.G891G|CD109_ENST00000422508.2_Silent_p.G814G			Q6YHK3	CD109_HUMAN	CD109 molecule	891					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.G891G(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CAGTGACTGGCAGTGAAAGAG	0.333																																					p.G891G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2673T	6						.						73.0	74.0	73.0					6																	74498307		2203	4300	6503	74555028	SO:0001819	synonymous_variant	135228	exon22			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.2673C>T	6.37:g.74498307C>T			74555028	NM_133493	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Silent	SNP	ENST00000287097.5	37	CCDS4982.1																																																																																				0.333	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
TTLL2	83887	broad.mit.edu	37	6	167753656	167753656	+	Missense_Mutation	SNP	C	C	T	rs374723694		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr6:167753656C>T	ENST00000239587.5	+	3	356	c.268C>T	c.(268-270)Cgc>Tgc	p.R90C		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	90	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)	p.R90C(1)		central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GCTGGTTTTTCGCGTTGACGA	0.517																																					p.R90C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C268T	6						.	C	CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	50.0	52.0	51.0		268	2.5	0.0	6		51	1,8599	1.2+/-3.3	0,1,4299	no	missense	TTLL2	NM_031949.4	180	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	probably-damaging	90/593	167753656	3,13003	2203	4300	6503	167673646	SO:0001583	missense	83887	exon3			AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.268C>T	6.37:g.167753656C>T	ENSP00000239587:p.Arg90Cys		167673646	NM_031949	B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	ENST00000239587.5	37	CCDS5301.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.460225	0.43736	4.54E-4	1.16E-4	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.02787	4.16	3.37	2.49	0.30216	.	0.282248	0.26582	N	0.023563	T	0.03178	0.0093	L	0.45352	1.415	0.21105	N	0.999789	D	0.89917	1.0	D	0.63957	0.92	T	0.33394	-0.9870	10	0.87932	D	0	.	9.3898	0.38365	0.0:0.89:0.0:0.11	.	90	Q9BWV7	TTLL2_HUMAN	C	90;17	ENSP00000239587:R90C	ENSP00000239587:R90C	R	+	1	0	TTLL2	167673646	0.007000	0.16637	0.044000	0.18714	0.010000	0.07245	0.187000	0.16998	0.748000	0.32831	0.484000	0.47621	CGC		0.517	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949	
ACHE	43	broad.mit.edu	37	7	100490873	100490873	+	Silent	SNP	C	C	A	rs529092085		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr7:100490873C>A	ENST00000412389.1	-	1	1136	c.981G>T	c.(979-981)cgG>cgT	p.R327R	ACHE_ENST00000428317.1_Silent_p.R327R|ACHE_ENST00000302913.4_Silent_p.R327R|ACHE_ENST00000497647.1_5'Flank|ACHE_ENST00000241069.5_Silent_p.R327R|ACHE_ENST00000419336.2_Silent_p.R327R|ACHE_ENST00000411582.1_Silent_p.R327R			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	327					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)	p.R327R(1)		large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	CGAAGGAGAACCGGAAGACGC	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		20282	0.001		0.0	False		,,,				2504	0.0				p.R327R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G981T	7						.						103.0	76.0	85.0					7																	100490873		2203	4300	6503	100328809	SO:0001819	synonymous_variant	43	exon2				CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.981G>T	7.37:g.100490873C>A			100328809	NM_000665	A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Silent	SNP	ENST00000412389.1	37	CCDS5709.1																																																																																				0.592	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	NM_015831	
AHR	196	broad.mit.edu	37	7	17374516	17374516	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr7:17374516G>A	ENST00000242057.4	+	8	1557	c.914G>A	c.(913-915)aGa>aAa	p.R305K		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	305	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R305K(2)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	AACAGAGGAAGAATTGTTTTA	0.333																																					p.R305K												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G914A	7						.						108.0	104.0	105.0					7																	17374516		2203	4300	6503	17341041	SO:0001583	missense	196	exon8			L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.914G>A	7.37:g.17374516G>A	ENSP00000242057:p.Arg305Lys		17341041	NM_001621	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	G	1.080	-0.667318	0.03428	.	.	ENSG00000106546	ENST00000242057	T	0.03951	3.75	5.65	-10.0	0.00425	PAS fold-3 (1);PAS (1);	0.637512	0.16386	N	0.216677	T	0.00967	0.0032	N	0.00808	-1.17	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32375	-0.9909	10	0.02654	T	1	.	10.1493	0.42782	0.3701:0.1987:0.4312:0.0	.	305	P35869	AHR_HUMAN	K	305	ENSP00000242057:R305K	ENSP00000242057:R305K	R	+	2	0	AHR	17341041	0.065000	0.20965	0.006000	0.13384	0.358000	0.29455	0.394000	0.20834	-1.648000	0.01510	-0.918000	0.02743	AGA		0.333	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
ELMO1	9844	broad.mit.edu	37	7	37382246	37382246	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr7:37382246C>T	ENST00000310758.4	-	2	696	c.49G>A	c.(49-51)Gcc>Acc	p.A17T	ELMO1_ENST00000442504.1_Missense_Mutation_p.A17T|ELMO1_ENST00000448602.1_Missense_Mutation_p.A17T	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	17					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.A17T(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						TTGGGGTAGGCGCCCGGCCAT	0.478																																					p.A17T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G49A	7						.						155.0	164.0	161.0					7																	37382246		2203	4300	6503	37348771	SO:0001583	missense	9844	exon2			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.49G>A	7.37:g.37382246C>T	ENSP00000312185:p.Ala17Thr		37348771	NM_014800	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	C	18.19	3.568800	0.65765	.	.	ENSG00000155849	ENST00000310758;ENST00000442504;ENST00000448602;ENST00000455119;ENST00000455879;ENST00000453399;ENST00000445322	T;T;T;T;T;T;T	0.47528	2.47;2.47;2.47;1.46;1.45;0.87;0.84	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.40272	0.1110	L	0.48642	1.525	0.80722	D	1	B	0.30104	0.268	B	0.20577	0.03	T	0.27872	-1.0061	10	0.32370	T	0.25	.	15.8091	0.78543	0.0:1.0:0.0:0.0	.	17	Q92556	ELMO1_HUMAN	T	17	ENSP00000312185:A17T;ENSP00000406952:A17T;ENSP00000394458:A17T;ENSP00000406610:A17T;ENSP00000416090:A17T;ENSP00000391734:A17T;ENSP00000397857:A17T	ENSP00000312185:A17T	A	-	1	0	ELMO1	37348771	1.000000	0.71417	0.991000	0.47740	0.995000	0.86356	5.031000	0.64134	2.336000	0.79503	0.591000	0.81541	GCC		0.478	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
GLI3	2737	broad.mit.edu	37	7	42065944	42065944	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr7:42065944G>A	ENST00000395925.3	-	8	1180	c.1096C>T	c.(1096-1098)Cga>Tga	p.R366*	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	366					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R366*(1)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CTCTGTTGTCGGCTTAGGATC	0.547									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.R366X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1096T	7	GRCh37	CI992014|HM971692	GLI3	I|M		.						129.0	121.0	124.0					7																	42065944		2203	4300	6503	42032469	SO:0001587	stop_gained	2737	exon8	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1096C>T	7.37:g.42065944G>A	ENSP00000379258:p.Arg366*		42032469	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Nonsense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	G	38	7.084391	0.98051	.	.	ENSG00000106571	ENST00000395925	.	.	.	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	.	.	.	X	366	.	ENSP00000379258:R366X	R	-	1	2	GLI3	42032469	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.188000	0.94921	2.788000	0.95919	0.650000	0.86243	CGA		0.547	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
C7orf62	219557	broad.mit.edu	37	7	88423735	88423735	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr7:88423735delA	ENST00000297203.2	-	2	707	c.522delT	c.(520-522)tttfs	p.F174fs	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	174								p.L175fs*15(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						TTTGTGTGAGAAAATCTGTGA	0.428																																					p.F174fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.522delT	7						.						189.0	155.0	167.0					7																	88423735		2203	4300	6503	88261671	SO:0001589	frameshift_variant	219557	exon2			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.522delT	7.37:g.88423735delA	ENSP00000297203:p.Phe174fs		88261671	NM_152706		Frame_Shift_Del	DEL	ENST00000297203.2	37	CCDS34678.1																																																																																				0.428	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332714.1	NM_152706	
SAMD9	54809	broad.mit.edu	37	7	92732874	92732874	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr7:92732874C>T	ENST00000379958.2	-	3	2806	c.2537G>A	c.(2536-2538)aGg>aAg	p.R846K		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	846						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.R846K(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GTCTGGGATCCTTGCACTTTT	0.343																																					p.R846K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2537A	7						.						63.0	62.0	62.0					7																	92732874		2203	4297	6500	92570810	SO:0001583	missense	54809	exon2			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.2537G>A	7.37:g.92732874C>T	ENSP00000369292:p.Arg846Lys		92570810	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.257146	0.00021	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	D;D	0.81908	-1.55;-1.55	4.59	-0.604	0.11626	.	0.689734	0.12399	N	0.472252	T	0.41604	0.1166	N	0.00327	-1.64	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50065	-0.8871	10	0.02654	T	1	-0.1342	2.6224	0.04920	0.122:0.1572:0.1252:0.5956	.	846	Q5K651	SAMD9_HUMAN	K	846	ENSP00000369292:R846K;ENSP00000414529:R846K	ENSP00000369292:R846K	R	-	2	0	SAMD9	92570810	0.295000	0.24389	0.055000	0.19348	0.024000	0.10985	0.678000	0.25277	-0.250000	0.09555	-2.267000	0.00277	AGG		0.343	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
MCM7	4176	broad.mit.edu	37	7	99693742	99693742	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr7:99693742G>C	ENST00000303887.5	-	11	1895	c.1250C>G	c.(1249-1251)gCt>gGt	p.A417G	MIR25_ENST00000384816.1_RNA|MIR93_ENST00000385024.1_RNA|MCM7_ENST00000343023.6_Intron|MCM7_ENST00000354230.3_Missense_Mutation_p.A241G|MIR106B_ENST00000385301.1_RNA	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	417	MCM.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)	p.A241G(1)|p.A417G(1)		endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCTCAGCACAGCTGCCGTAAG	0.547																																					p.A241G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C722G	7						.						31.0	32.0	32.0					7																	99693742		2203	4300	6503	99531678	SO:0001583	missense	4176	exon10				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1250C>G	7.37:g.99693742G>C	ENSP00000307288:p.Ala417Gly		99531678	NM_182776	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	ENST00000303887.5	37	CCDS5683.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.742207	0.89573	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	T;T	0.06218	3.33;3.33	5.02	5.02	0.67125	ATPase, AAA+ type, core (1);	0.110861	0.64402	D	0.000010	T	0.27798	0.0684	M	0.86343	2.81	0.80722	D	1	P	0.51791	0.948	P	0.62649	0.905	T	0.01702	-1.1292	10	0.51188	T	0.08	-16.261	15.8749	0.79154	0.0:0.0:1.0:0.0	.	417	P33993	MCM7_HUMAN	G	417;354;310;241	ENSP00000307288:A417G;ENSP00000346171:A241G	ENSP00000307288:A417G	A	-	2	0	MCM7	99531678	1.000000	0.71417	0.996000	0.52242	0.874000	0.50279	7.560000	0.82277	2.589000	0.87451	0.655000	0.94253	GCT		0.547	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3		
GRM8	2918	broad.mit.edu	37	7	126173579	126173579	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr7:126173579G>A	ENST00000339582.2	-	9	2665	c.1857C>T	c.(1855-1857)cgC>cgT	p.R619R	GRM8_ENST00000358373.3_Silent_p.R619R|GRM8_ENST00000444921.2_Silent_p.R619R|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	619					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.R619R(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				AACTAAGTTCGCGTCCTGAAG	0.458										HNSCC(24;0.065)																											p.R619R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1857T	7						.						114.0	110.0	112.0					7																	126173579		2203	4300	6503	125960815	SO:0001819	synonymous_variant	2918	exon9				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1857C>T	7.37:g.126173579G>A			125960815	NM_001127323	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Silent	SNP	ENST00000339582.2	37	CCDS5794.1																																																																																				0.458	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4		
KCNQ3	3786	broad.mit.edu	37	8	133187845	133187845	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr8:133187845G>A	ENST00000388996.4	-	5	1208	c.788C>T	c.(787-789)aCg>aTg	p.T263M	KCNQ3_ENST00000519445.1_Missense_Mutation_p.T263M|KCNQ3_ENST00000521134.1_Missense_Mutation_p.T143M	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	263					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.T263M(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GTACCAGGCCGTGATGAGTTC	0.498																																					p.T263M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C788T	8						.						84.0	83.0	83.0					8																	133187845		2203	4300	6503	133257027	SO:0001583	missense	3786	exon5			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.788C>T	8.37:g.133187845G>A	ENSP00000373648:p.Thr263Met		133257027	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688386	0.88639	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.98512	-4.97;-4.97;-4.97	5.39	5.39	0.77823	Ion transport (1);	0.048392	0.85682	D	0.000000	D	0.98378	0.9461	L	0.45422	1.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99891	1.1134	10	0.87932	D	0	-23.8772	18.5028	0.90888	0.0:0.0:1.0:0.0	.	263;263	E7ET42;O43525	.;KCNQ3_HUMAN	M	263;143;263;252;142	ENSP00000373648:T263M;ENSP00000429799:T143M;ENSP00000428790:T263M	ENSP00000373648:T263M	T	-	2	0	KCNQ3	133257027	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	9.864000	0.99589	2.674000	0.91012	0.655000	0.94253	ACG		0.498	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
DLGAP2	9228	broad.mit.edu	37	8	1626698	1626698	+	Silent	SNP	G	G	A	rs374343486		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr8:1626698G>A	ENST00000421627.2	+	9	2501	c.2367G>A	c.(2365-2367)tcG>tcA	p.S789S	DLGAP2_ENST00000524065.1_3'UTR	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	868					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.S797S(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GGGATGGCTCGTGGTTTTTGA	0.602																																					p.S789S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2367A	8						.	G		0,3938		0,0,1969	24.0	26.0	25.0		2367	-10.6	0.0	8		25	1,8343		0,1,4171	no	coding-synonymous	DLGAP2	NM_004745.3		0,1,6140	AA,AG,GG		0.012,0.0,0.0081		789/976	1626698	1,12281	1969	4172	6141	1614105	SO:0001819	synonymous_variant	9228	exon9			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2367G>A	8.37:g.1626698G>A			1614105	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	0.042	-1.282435	0.01398	0.0	1.2E-4	ENSG00000198010	ENST00000520901	.	.	.	5.32	-10.6	0.00265	.	.	.	.	.	T	0.39091	0.1065	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57997	-0.7714	4	.	.	.	-7.0113	3.2944	0.06961	0.371:0.171:0.3305:0.1276	.	.	.	.	H	792	.	.	R	+	2	0	DLGAP2	1614105	0.007000	0.16637	0.000000	0.03702	0.045000	0.14185	-1.104000	0.03326	-4.932000	0.00027	-1.956000	0.00482	CGT		0.602	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
CSMD1	64478	broad.mit.edu	37	8	3019723	3019723	+	Silent	SNP	G	G	A	rs374441217		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr8:3019723G>A	ENST00000520002.1	-	39	6360	c.5805C>T	c.(5803-5805)aaC>aaT	p.N1935N	CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000537824.1_Silent_p.N1934N|CSMD1_ENST00000539096.1_Silent_p.N1934N|CSMD1_ENST00000602723.1_Silent_p.N1935N|CSMD1_ENST00000542608.1_Silent_p.N1934N|CSMD1_ENST00000602557.1_Silent_p.N1935N|CSMD1_ENST00000400186.3_Silent_p.N1935N			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1935	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.N1663N(1)|p.N1934N(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGAGCACGTCGTTCACCATGT	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		16997	0.0		0.0	False		,,,				2504	0.001				p.R1935X												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C5803T	8						.	G		0,3950		0,0,1975	91.0	95.0	94.0		5802	-4.3	0.8	8		94	1,8323		0,1,4161	no	coding-synonymous	CSMD1	NM_033225.5		0,1,6136	AA,AG,GG		0.012,0.0,0.0081		1934/3565	3019723	1,12273	1975	4162	6137	3007130	SO:0001819	synonymous_variant	64478	exon38					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5805C>T	8.37:g.3019723G>A			3007130	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	5.779	0.328100	0.10956	0.0	1.2E-4	ENSG00000183117	ENST00000335551	.	.	.	5.38	-4.34	0.03666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3045	0.73982	0.8383:0.0:0.1617:0.0	.	.	.	.	X	1415	.	.	R	-	1	2	CSMD1	3007130	0.513000	0.26194	0.847000	0.33407	0.434000	0.31775	-0.143000	0.10296	-0.753000	0.04721	-0.742000	0.03525	CGA		0.507	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
TNFRSF10C	8794	broad.mit.edu	37	8	22974360	22974360	+	Missense_Mutation	SNP	C	C	A	rs12550828		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr8:22974360C>A	ENST00000356864.3	+	5	1128	c.596C>A	c.(595-597)aCc>aAc	p.T199N	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.T97N	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	199			T -> N (in dbSNP:rs12550828).		apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.T199N(3)		endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGACCACCAGCCCG	0.627																																					p.T199N												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C596A	8						.						63.0	81.0	75.0					8																	22974360		2203	4298	6501	23030305	SO:0001583	missense	8794	exon5			AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.596C>A	8.37:g.22974360C>A	ENSP00000349324:p.Thr199Asn		23030305	NM_003841	O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.942372	0.00479	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.61510	0.1;0.69	.	.	.	.	60.732300	0.00622	N	0.000444	T	0.35364	0.0929	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.42959	0.403	T	0.37842	-0.9688	9	0.13470	T	0.59	.	4.6548	0.12611	0.3618:0.6381:0.0:1.0E-4	rs12550828	199	O14798	TR10C_HUMAN	N	199;97;199	ENSP00000349324:T199N;ENSP00000437612:T97N	ENSP00000349324:T199N	T	+	2	0	TNFRSF10C	23030305	0.000000	0.05858	0.011000	0.14972	0.077000	0.17291	-1.773000	0.01786	-1.934000	0.01051	-1.966000	0.00469	ACC		0.627	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
STMN2	11075	broad.mit.edu	37	8	80577064	80577064	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr8:80577064G>A	ENST00000220876.7	+	5	877	c.495G>A	c.(493-495)gcG>gcA	p.A165A	STMN2_ENST00000518491.1_Silent_p.A154A|STMN2_ENST00000518111.1_3'UTR	NM_001199214.1|NM_007029.3	NP_001186143.1|NP_008960.2	Q93045	STMN2_HUMAN	stathmin 2	165	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cellular response to nerve growth factor stimulus (GO:1990090)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of neuron projection development (GO:0010977)|positive regulation of microtubule depolymerization (GO:0031117)|positive regulation of neuron projection development (GO:0010976)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)	p.A165A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11	all_lung(9;8.34e-05)		Epithelial(68;0.0229)|all cancers(69;0.0874)			GGCATGCTGCGGAGGTGCGCA	0.502																																					p.A165A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G495A	8						.						93.0	101.0	98.0					8																	80577064		1940	4144	6084	80739619	SO:0001819	synonymous_variant	11075	exon5				CCDS43748.1, CCDS56542.1	8q21.13	2014-04-01	2014-04-01	2001-07-13	ENSG00000104435	ENSG00000104435			10577	protein-coding gene	gene with protein product		600621	"""stathmin-like 2"""	SCGN10		8622778, 12140291	Standard	NM_007029		Approved	SCG10	uc022awk.1	Q93045	OTTHUMG00000164610	ENST00000220876.7:c.495G>A	8.37:g.80577064G>A			80739619	NM_007029	A8K9M2|G3V110|O14952|Q6PK68	Silent	SNP	ENST00000220876.7	37	CCDS43748.1																																																																																				0.502	STMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379261.2	NM_007029	
DCAF4L2	138009	broad.mit.edu	37	8	88885117	88885117	+	Silent	SNP	G	G	A	rs141776325	byFrequency	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr8:88885117G>A	ENST00000319675.3	-	1	1179	c.1083C>T	c.(1081-1083)aaC>aaT	p.N361N		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	361								p.N361N(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TGGGAATGTCGTTCTCCGAGG	0.622													G|||	6	0.00119808	0.0045	0.0	5008	,	,		16932	0.0		0.0	False		,,,				2504	0.0				p.N361N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1083T	8						.	G		13,4393	17.9+/-39.9	0,13,2190	74.0	81.0	79.0		1083	-2.8	0.0	8	dbSNP_134	79	0,8600		0,0,4300	no	coding-synonymous	DCAF4L2	NM_152418.3		0,13,6490	AA,AG,GG		0.0,0.2951,0.1		361/396	88885117	13,12993	2203	4300	6503	88954233	SO:0001819	synonymous_variant	138009	exon1			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.1083C>T	8.37:g.88885117G>A			88954233	NM_152418		Silent	SNP	ENST00000319675.3	37	CCDS6245.1																																																																																				0.622	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
NECAB1	64168	broad.mit.edu	37	8	91940479	91940479	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr8:91940479G>T	ENST00000417640.2	+	8	982	c.645G>T	c.(643-645)atG>atT	p.M215I		NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	215						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.M215I(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			ACCAGTGGATGACCCAGATAA	0.383																																					p.M215I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G645T	8						.						114.0	110.0	111.0					8																	91940479		1827	4084	5911	92009655	SO:0001583	missense	64168	exon8			AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.645G>T	8.37:g.91940479G>T	ENSP00000387380:p.Met215Ile		92009655	NM_022351	Q6NUS7|Q96AZ7|Q9HBW8	Missense_Mutation	SNP	ENST00000417640.2	37	CCDS47889.1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743689	0.30865	.	.	ENSG00000123119	ENST00000417640	T	0.16897	2.31	5.01	4.14	0.48551	.	0.206543	0.64402	D	0.000014	T	0.11196	0.0273	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09015	-1.0694	10	0.37606	T	0.19	-15.8427	10.6931	0.45884	0.1576:0.0:0.8424:0.0	.	215	Q8N987	NECA1_HUMAN	I	215	ENSP00000387380:M215I	ENSP00000387380:M215I	M	+	3	0	NECAB1	92009655	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	2.503000	0.45407	1.246000	0.43901	-0.140000	0.14226	ATG		0.383	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376728.1	NM_022351	
CDH17	1015	broad.mit.edu	37	8	95161037	95161037	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr8:95161037C>A	ENST00000027335.3	-	14	1986	c.1862G>T	c.(1861-1863)aGt>aTt	p.S621I	CDH17_ENST00000441892.2_Missense_Mutation_p.S407I|CDH17_ENST00000450165.2_Missense_Mutation_p.S621I	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	621	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.S621I(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TGGAGCCACACTAAAGATCTC	0.418																																					p.S621I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1862T	8						.						103.0	86.0	91.0					8																	95161037		2203	4300	6503	95230213	SO:0001583	missense	1015	exon14			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1862G>T	8.37:g.95161037C>A	ENSP00000027335:p.Ser621Ile		95230213	NM_001144663	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.581507	0.65992	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.50001	0.76;0.76;0.76	5.78	-2.72	0.05968	Cadherin (5);Cadherin-like (1);	0.694656	0.13613	N	0.374968	T	0.31575	0.0801	N	0.20574	0.59	0.09310	N	1	B;B	0.26902	0.067;0.163	B;B	0.33254	0.16;0.053	T	0.30060	-0.9991	10	0.28530	T	0.3	-5.6753	12.3277	0.55020	0.0:0.1768:0.6699:0.1534	.	407;621	E7EN24;Q12864	.;CAD17_HUMAN	I	621;407;621	ENSP00000027335:S621I;ENSP00000392811:S407I;ENSP00000401468:S621I	ENSP00000027335:S621I	S	-	2	0	CDH17	95230213	0.008000	0.16893	0.000000	0.03702	0.947000	0.59692	0.101000	0.15251	-0.439000	0.07222	0.313000	0.20887	AGT		0.418	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
CYP11B1	1584	broad.mit.edu	37	8	143957293	143957293	+	Splice_Site	SNP	G	G	A	rs104894068		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr8:143957293G>A	ENST00000292427.4	-	6	988	c.956C>T	c.(955-957)aCg>aTg	p.T319M	CYP11B1_ENST00000377675.3_Splice_Site_p.T390M|CYP11B1_ENST00000517471.1_Splice_Site_p.T319M	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	319			T -> M (in AH4; non-classic). {ECO:0000269|PubMed:9302260}.		aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.T319M(1)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	GGGAAACACCGTCTGCAGGAG	0.647									Familial Hyperaldosteronism type I																												p.T319M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C956T	8	GRCh37	CM970407	CYP11B1	M	rs104894068	.						83.0	80.0	81.0					8																	143957293		2203	4300	6503	143954295	SO:0001630	splice_region_variant	1584	exon6	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.955-1C>T	8.37:g.143957293G>A			143954295	NM_001026213	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	37	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	17.74	3.465145	0.63513	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.78364	-1.17;-1.17;-1.17	4.31	3.43	0.39272	.	0.123114	0.36665	N	0.002466	D	0.88217	0.6377	M	0.88181	2.935	0.52501	A	0.99995	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.996;0.996	D	0.91410	0.5150	9	0.87932	D	0	.	10.14	0.42730	0.1026:0.0:0.8974:0.0	.	390;319;319;35	Q4VAR0;Q4VAQ9;P15538;Q8N9P8	.;.;C11B1_HUMAN;.	M	319;319;390	ENSP00000292427:T319M;ENSP00000428043:T319M;ENSP00000366903:T390M	ENSP00000292427:T319M	T	-	2	0	CYP11B1	143954295	1.000000	0.71417	0.612000	0.29024	0.041000	0.13682	4.454000	0.60068	0.920000	0.36970	0.555000	0.69702	ACG		0.647	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		Missense_Mutation
OR13C8	138802	broad.mit.edu	37	9	107331862	107331862	+	Silent	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr9:107331862G>A	ENST00000335040.1	+	1	414	c.414G>A	c.(412-414)aaG>aaA	p.K138K		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K138K(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						TCATGAGCAAGGGTGCCTATG	0.547																																					p.K138K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G414A	9						.						102.0	89.0	93.0					9																	107331862		2203	4300	6503	106371683	SO:0001819	synonymous_variant	138802	exon1				CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.414G>A	9.37:g.107331862G>A			106371683	NM_001004483	Q5VVG0|Q96R44	Silent	SNP	ENST00000335040.1	37	CCDS35090.1																																																																																				0.547	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1		
FRMPD1	22844	broad.mit.edu	37	9	37740317	37740317	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr9:37740317C>T	ENST00000539465.1	+	15	2385	c.1792C>T	c.(1792-1794)Cgc>Tgc	p.R598C	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.R598C|FRMPD1_ENST00000541302.1_Missense_Mutation_p.R467C|FRMPD1_ENST00000536622.1_Missense_Mutation_p.R420C			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	598						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.R598C(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CACTGAGAGCCGCGGCTACAG	0.632																																					p.R598C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1792T	9						.						35.0	37.0	36.0					9																	37740317		2197	4289	6486	37730317	SO:0001583	missense	22844	exon15			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.1792C>T	9.37:g.37740317C>T	ENSP00000444411:p.Arg598Cys		37730317	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185691	0.78789	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	T;T;T;T	0.24723	2.73;2.73;1.84;1.86	5.81	3.83	0.44106	.	0.374327	0.28376	N	0.015561	T	0.42245	0.1194	L	0.59436	1.845	0.49582	D	0.9998	D;D	0.89917	1.0;1.0	P;P	0.61722	0.828;0.893	T	0.39035	-0.9633	10	0.72032	D	0.01	-6.1125	12.5056	0.55979	0.3023:0.6977:0.0:0.0	.	467;598	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	C	598;598;420;467	ENSP00000366995:R598C;ENSP00000444411:R598C;ENSP00000437762:R420C;ENSP00000444804:R467C	ENSP00000366995:R598C	R	+	1	0	FRMPD1	37730317	1.000000	0.71417	0.992000	0.48379	0.899000	0.52679	1.219000	0.32479	1.423000	0.47198	0.561000	0.74099	CGC		0.632	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
PCSK5	5125	broad.mit.edu	37	9	78686806	78686806	+	Missense_Mutation	SNP	G	G	A	rs200049619		TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr9:78686806G>A	ENST00000545128.1	+	7	1424	c.886G>A	c.(886-888)Gtt>Att	p.V296I	PCSK5_ENST00000376752.4_Missense_Mutation_p.V296I|PCSK5_ENST00000376767.3_Missense_Mutation_p.V296I	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	296	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.V296I(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TGAAAACGGCGTTAGAATGGT	0.517																																					p.V296I												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G886A	9						.						94.0	98.0	97.0					9																	78686806		2203	4300	6503	77876626	SO:0001583	missense	5125	exon7				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.886G>A	9.37:g.78686806G>A	ENSP00000446280:p.Val296Ile		77876626	NM_001190482	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	37	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	G	8.755	0.922230	0.17982	.	.	ENSG00000099139	ENST00000545128;ENST00000376767;ENST00000396108;ENST00000376752	D;D;D	0.87412	-2.25;-2.25;-2.25	5.66	3.82	0.43975	.	.	.	.	.	T	0.72581	0.3478	N	0.12920	0.275	0.30550	N	0.7656	B;B	0.06786	0.0;0.001	B;B	0.12156	0.006;0.007	T	0.61792	-0.6990	9	0.08599	T	0.76	.	7.7403	0.28837	0.3062:0.0:0.6938:0.0	.	296;296	Q92824-2;B1AMG5	.;.	I	296	ENSP00000446280:V296I;ENSP00000365958:V296I;ENSP00000365943:V296I	ENSP00000365943:V296I	V	+	1	0	PCSK5	77876626	1.000000	0.71417	0.889000	0.34880	0.992000	0.81027	4.647000	0.61418	1.403000	0.46800	0.655000	0.94253	GTT		0.517	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SEMA4D	10507	broad.mit.edu	37	9	91994492	91994492	+	Silent	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr9:91994492C>T	ENST00000450295.1	-	16	2492	c.1716G>A	c.(1714-1716)gcG>gcA	p.A572A	SEMA4D_ENST00000422704.2_Silent_p.A572A|SEMA4D_ENST00000455551.2_Intron|SEMA4D_ENST00000438547.2_Silent_p.A572A|SEMA4D_ENST00000356444.2_Silent_p.A572A|SEMA4D_ENST00000420987.1_Intron|SEMA4D_ENST00000339861.4_Intron|SEMA4D_ENST00000343780.4_Intron			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	572	Ig-like C2-type.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.A572A(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						ATTTCAGTTCCGCTGTGCCAC	0.488																																					p.A572A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1716A	9						.						95.0	109.0	104.0					9																	91994492		2203	4300	6503	91184312	SO:0001819	synonymous_variant	10507	exon18			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.1716G>A	9.37:g.91994492C>T			91184312	NM_006378	B2RPM6|Q7Z5S4|Q8N8B0	Silent	SNP	ENST00000450295.1	37	CCDS6685.1																																																																																				0.488	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1	NM_006378	
TSTD2	158427	broad.mit.edu	37	9	100368525	100368525	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr9:100368525C>A	ENST00000341170.4	-	7	1236	c.854G>T	c.(853-855)gGt>gTt	p.G285V	TSTD2_ENST00000354801.2_Missense_Mutation_p.G25V	NM_139246.4	NP_640339.4	Q5T7W7	TSTD2_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 2	285								p.G285V(1)		large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	15						ATGAAATTCACCTGGGGATAA	0.323																																					p.G285V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G854T	9						.						67.0	69.0	68.0					9																	100368525		2203	4300	6503	99408346	SO:0001583	missense	158427	exon7			AF258575	CCDS6727.2	9q22.33	2013-09-20	2009-08-12	2009-08-12	ENSG00000136925	ENSG00000136925			30087	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 97"""	C9orf97		12477932	Standard	NM_139246		Approved	PP4189	uc004axn.3	Q5T7W7	OTTHUMG00000020328	ENST00000341170.4:c.854G>T	9.37:g.100368525C>A	ENSP00000342499:p.Gly285Val		99408346	NM_139246	A6NMJ4|A8K584|Q6ZQZ6|Q8IYM3|Q8WY73|Q96ML6|Q96MU1	Missense_Mutation	SNP	ENST00000341170.4	37	CCDS6727.2	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297338	0.23650	.	.	ENSG00000136925	ENST00000375172;ENST00000341170;ENST00000375165;ENST00000354801	T;T;T	0.28454	1.61;1.61;1.61	5.33	3.48	0.39840	Rhodanese-like (2);	0.690686	0.15703	N	0.248836	T	0.15825	0.0381	N	0.12569	0.235	0.40975	D	0.984737	B;B	0.10296	0.001;0.003	B;B	0.11329	0.001;0.006	T	0.07404	-1.0774	10	0.25751	T	0.34	-2.27	7.2762	0.26286	0.0:0.6265:0.0:0.3735	.	59;285	B3KVC7;Q5T7W7	.;TSTD2_HUMAN	V	59;285;25;25	ENSP00000342499:G285V;ENSP00000364308:G25V;ENSP00000346856:G25V	ENSP00000342499:G285V	G	-	2	0	TSTD2	99408346	0.868000	0.29978	0.993000	0.49108	0.971000	0.66376	1.695000	0.37763	0.887000	0.36136	0.655000	0.94253	GGT		0.323	TSTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053325.4	NM_139246	
PTBP3	9991	broad.mit.edu	37	9	114989830	114989830	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chr9:114989830G>A	ENST00000374255.2	-	13	1456	c.1309C>T	c.(1309-1311)Ctt>Ttt	p.L437F	PTBP3_ENST00000334318.6_Missense_Mutation_p.L440F|PTBP3_ENST00000458258.1_Missense_Mutation_p.L443F|PTBP3_ENST00000374257.1_Missense_Mutation_p.L409F|PTBP3_ENST00000343327.2_Missense_Mutation_p.L342F			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	437					anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.L437F(1)									TCTCGAGGAAGCTGTACTGCT	0.428																																					p.L440F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1318T	9						.						130.0	123.0	125.0					9																	114989830		2203	4300	6503	114029651	SO:0001583	missense	9991	exon13			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.1309C>T	9.37:g.114989830G>A	ENSP00000363373:p.Leu437Phe		114029651	NM_001163790	B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	ENST00000374255.2	37	CCDS6784.1	.	.	.	.	.	.	.	.	.	.	G	35	5.485284	0.96323	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000343327	T;T;T;T;T	0.58797	3.35;3.35;0.31;3.35;1.34	5.65	5.65	0.86999	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.79353	0.4431	M	0.82630	2.6	0.80722	D	1	D;D;D;D;P;P	0.63046	0.975;0.975;0.975;0.992;0.942;0.911	D;D;D;D;P;P	0.85130	0.931;0.97;0.931;0.997;0.81;0.858	T	0.79284	-0.1867	10	0.46703	T	0.11	-7.6084	19.7278	0.96172	0.0:0.0:1.0:0.0	.	409;409;342;440;437;443	B1ALY5;O95758-2;B1ALY6;O95758-5;O95758;O95758-4	.;.;.;.;ROD1_HUMAN;.	F	409;440;443;437;342	ENSP00000363375:L409F;ENSP00000334499:L440F;ENSP00000414921:L443F;ENSP00000363373:L437F;ENSP00000340705:L342F	ENSP00000334499:L440F	L	-	1	0	ROD1	114029651	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	2.656000	0.90262	0.591000	0.81541	CTT		0.428	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053679.1		
FAM199X	139231	broad.mit.edu	37	X	103434424	103434424	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chrX:103434424G>T	ENST00000493442.1	+	6	1298	c.1132G>T	c.(1132-1134)Gaa>Taa	p.E378*	FAM199X_ENST00000299906.5_3'UTR	NM_207318.3	NP_997201.1	Q6PEV8	F199X_HUMAN	family with sequence similarity 199, X-linked	378								p.E378*(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						AGTGACTGAGGAAGACCATGA	0.468																																					p.E378X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1132T	X						.						151.0	125.0	134.0					X																	103434424		2203	4300	6503	103321080	SO:0001587	stop_gained	139231	exon6			BC016683	CCDS35364.1	Xq22	2010-02-11	2010-02-11	2010-02-11	ENSG00000123575	ENSG00000123575			25195	protein-coding gene	gene with protein product			"""chromosome X open reading frame 39"""	CXorf39			Standard	NM_207318		Approved		uc004elw.3	Q6PEV8	OTTHUMG00000022126	ENST00000493442.1:c.1132G>T	X.37:g.103434424G>T	ENSP00000417581:p.Glu378*		103321080	NM_207318	Q8WVP6|Q96AV3	Nonsense_Mutation	SNP	ENST00000493442.1	37	CCDS35364.1	.	.	.	.	.	.	.	.	.	.	G	38	6.917433	0.97932	.	.	ENSG00000123575	ENST00000493442	.	.	.	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.4885	16.8393	0.85964	0.0:0.0:1.0:0.0	.	.	.	.	X	378	.	.	E	+	1	0	FAM199X	103321080	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.809000	0.99208	2.269000	0.75478	0.594000	0.82650	GAA		0.468	FAM199X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057764.1	NM_207318	
ESX1	80712	broad.mit.edu	37	X	103499142	103499142	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chrX:103499142C>T	ENST00000372588.4	-	2	282	c.199G>A	c.(199-201)Gtc>Atc	p.V67I		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	67					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)	p.V67I(1)		endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						TCCGAGGGGACGGACCCTTCC	0.637																																					p.V67I	Pancreas(200;1705 2227 25194 28471 45274)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G199A	X						.						132.0	128.0	129.0					X																	103499142		2203	4299	6502	103385798	SO:0001583	missense	80712	exon2			AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.199G>A	X.37:g.103499142C>T	ENSP00000361669:p.Val67Ile		103385798	NM_153448	B0QYU3|Q7Z6K7	Missense_Mutation	SNP	ENST00000372588.4	37	CCDS14516.1	.	.	.	.	.	.	.	.	.	.	c	12.21	1.870436	0.33069	.	.	ENSG00000123576	ENST00000372588	D	0.90732	-2.72	4.04	-4.87	0.03123	.	.	.	.	.	T	0.69575	0.3126	N	0.14661	0.345	0.09310	N	1	P	0.40476	0.718	B	0.27076	0.076	T	0.68112	-0.5495	9	0.19590	T	0.45	6.4544	0.2438	0.00196	0.2585:0.1529:0.2562:0.3324	.	67	Q8N693	ESX1_HUMAN	I	67	ENSP00000361669:V67I	ENSP00000361669:V67I	V	-	1	0	ESX1	103385798	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.583000	0.02115	-1.408000	0.02040	0.411000	0.27672	GTC		0.637	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057763.2	NM_153448	
ZNF280C	55609	broad.mit.edu	37	X	129350045	129350045	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chrX:129350045G>A	ENST00000370978.4	-	14	1711	c.1558C>T	c.(1558-1560)Cag>Tag	p.Q520*		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	520					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q520*(1)		endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						AATTTTGACTGGAGAGGTCCA	0.378																																					p.Q520X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1558T	X						.						128.0	129.0	128.0					X																	129350045		2203	4300	6503	129177726	SO:0001587	stop_gained	55609	exon14			AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.1558C>T	X.37:g.129350045G>A	ENSP00000360017:p.Gln520*		129177726	NM_017666	A8K2V8|Q9NXR3	Nonsense_Mutation	SNP	ENST00000370978.4	37	CCDS14622.1	.	.	.	.	.	.	.	.	.	.	G	35	5.429046	0.96131	.	.	ENSG00000056277	ENST00000066465;ENST00000370978;ENST00000447817	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	11.3226	0.49430	0.0:0.0:1.0:0.0	.	.	.	.	X	471;520;471	.	ENSP00000066465:Q471X	Q	-	1	0	ZNF280C	129177726	0.813000	0.29090	0.007000	0.13788	0.305000	0.27757	3.435000	0.52849	2.148000	0.66965	0.429000	0.28392	CAG		0.378	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058251.1	NM_017666	
SAT1	6303	broad.mit.edu	37	X	23802053	23802053	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chrX:23802053T>A	ENST00000379253.3	+	3	434	c.255T>A	c.(253-255)agT>agA	p.S85R	SAT1_ENST00000379251.3_Missense_Mutation_p.S115R|Y_RNA_ENST00000365402.1_RNA|SAT1_ENST00000379270.4_Intron|RP13-314C10.5_ENST00000366134.2_RNA|SAT1_ENST00000489394.1_Intron|SAT1_ENST00000379254.1_Intron			Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1	0					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.S115R(1)		breast(1)|endometrium(3)|kidney(3)|lung(3)	10						ATGTAAGAAGTAGTGTCGGCT	0.483																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	X						.						47.0	37.0	40.0					X																	23802053		692	1591	2283	23711974	SO:0001583	missense	6303	.			M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	ENST00000379253.3:c.255T>A	X.37:g.23802053T>A	ENSP00000368555:p.Ser85Arg		23711974	.	A8K9N2|Q7Z5R3|Q96BK0	Missense_Mutation	SNP	ENST00000379253.3	37		.	.	.	.	.	.	.	.	.	.	T	9.352	1.065646	0.20067	.	.	ENSG00000130066	ENST00000379253;ENST00000379251	.	.	.	5.13	3.94	0.45596	.	.	.	.	.	T	0.27663	0.0680	.	.	.	0.21933	N	0.999466	B	0.02656	0.0	B	0.01281	0.0	T	0.19128	-1.0315	6	.	.	.	.	9.4558	0.38753	0.0:0.0:0.1759:0.8241	.	85	A6NM56	.	R	85;115	.	.	S	+	3	2	SAT1	23711974	0.972000	0.33761	0.020000	0.16555	0.101000	0.19017	1.457000	0.35212	0.834000	0.34852	0.486000	0.48141	AGT		0.483	SAT1-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000056058.1	NM_002970	
FAM127B	26071	broad.mit.edu	37	X	134186121	134186121	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3866-01A-01W-0995-10	TCGA-AA-3866-10A-01W-0995-10	g.chrX:134186121C>G	ENST00000370775.2	-	1	84	c.18G>C	c.(16-18)caG>caC	p.Q6H	FAM127B_ENST00000520964.1_5'UTR	NM_001078172.1	NP_001071640.1	Q9BWD3	F127B_HUMAN	family with sequence similarity 127, member B	6								p.Q6H(1)		breast(3)|endometrium(2)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;0.000127)					CCTTCATCAGCTGCACCCGAC	0.701																																					p.Q6H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G18C	X						.						39.0	42.0	41.0					X																	134186121		1943	4107	6050	134013787	SO:0001583	missense	26071	exon1			AL117556	CCDS43998.1	Xq26.3	2014-05-16			ENSG00000203950	ENSG00000203950			24514	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078172		Approved	DKFZP564B147, MAR8A, CXX1b	uc004eyf.3	Q9BWD3	OTTHUMG00000022466	ENST00000370775.2:c.18G>C	X.37:g.134186121C>G	ENSP00000375267:p.Gln6His		134013787	NM_001134321	A2A2V9|Q8TBU2	Missense_Mutation	SNP	ENST00000370775.2	37	CCDS43998.1	.	.	.	.	.	.	.	.	.	.	C	10.77	1.443056	0.25987	.	.	ENSG00000203950	ENST00000370775	T	0.30981	1.51	2.38	1.49	0.22878	.	.	.	.	.	T	0.28433	0.0703	L	0.48642	1.525	0.09310	N	1	P;B	0.47677	0.899;0.32	P;B	0.44990	0.466;0.264	T	0.09862	-1.0655	8	.	.	.	.	7.5315	0.27685	0.0:0.8412:0.0:0.1588	.	4;6	Q6IPB9;Q9BWD3	.;F127B_HUMAN	H	6	ENSP00000375267:Q6H	.	Q	-	3	2	FAM127B	134013787	0.935000	0.31712	0.120000	0.21714	0.015000	0.08874	0.947000	0.29082	0.027000	0.15297	-1.891000	0.00535	CAG		0.701	FAM127B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058393.2	NM_001078172	
