#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SFMBT2	57713	broad.mit.edu	37	10	7290523	7290523	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr10:7290523G>A	ENST00000361972.4	-	8	1049	c.959C>T	c.(958-960)gCg>gTg	p.A320V	SFMBT2_ENST00000397167.1_Missense_Mutation_p.A320V	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	320					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.A320V(2)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						AGTCACCGACGCAGGAGAGAT	0.493																																					p.A320V												.	.	2	Substitution - Missense(2)	large_intestine(1)|stomach(1)	c.C959T	10						.						124.0	101.0	109.0					10																	7290523		2203	4300	6503	7330529	SO:0001583	missense	57713	exon8			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.959C>T	10.37:g.7290523G>A	ENSP00000355109:p.Ala320Val		7330529	NM_001029880	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	37	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571879	0.65765	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.55930	0.49;0.49	5.4	5.4	0.78164	.	0.050676	0.85682	D	0.000000	T	0.71779	0.3380	M	0.63169	1.94	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.73607	-0.3929	10	0.66056	D	0.02	.	19.1844	0.93637	0.0:0.0:1.0:0.0	.	320	Q5VUG0	SMBT2_HUMAN	V	320	ENSP00000355109:A320V;ENSP00000380353:A320V	ENSP00000355109:A320V	A	-	2	0	SFMBT2	7330529	1.000000	0.71417	1.000000	0.80357	0.357000	0.29423	5.325000	0.65869	2.519000	0.84933	0.650000	0.86243	GCG		0.493	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
MYOF	26509	broad.mit.edu	37	10	95093572	95093572	+	Silent	SNP	C	C	T	rs370636726		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr10:95093572C>T	ENST00000359263.4	-	42	4661	c.4662G>A	c.(4660-4662)acG>acA	p.T1554T	MYOF_ENST00000371501.4_Silent_p.T1554T|MYOF_ENST00000358334.5_Silent_p.T1541T|MYOF_ENST00000371502.4_Silent_p.T1573T	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1554	C2 5. {ECO:0000255|PROSITE- ProRule:PRU00041}.				blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)	p.T1554T(1)		NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						AAATCCTAACCGTGCATTCCT	0.552																																					p.T1541T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4623A	10						.	C	,	1,4029		0,1,2014	82.0	84.0	84.0		4662,4623	-1.4	1.0	10		84	0,8394		0,0,4197	no	coding-synonymous,coding-synonymous	MYOF	NM_013451.3,NM_133337.2	,	0,1,6211	TT,TC,CC		0.0,0.0248,0.0080	,	1554/2062,1541/2049	95093572	1,12423	2015	4197	6212	95083562	SO:0001819	synonymous_variant	26509	exon41			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4662G>A	10.37:g.95093572C>T			95083562	NM_133337	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Silent	SNP	ENST00000359263.4	37	CCDS41551.1																																																																																				0.552	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
LGI1	9211	broad.mit.edu	37	10	95517984	95517984	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr10:95517984C>T	ENST00000371418.4	+	1	343	c.83C>T	c.(82-84)gCg>gTg	p.A28V	LGI1_ENST00000542308.1_Missense_Mutation_p.A28V|LGI1_ENST00000478763.1_3'UTR|LGI1_ENST00000371413.3_Missense_Mutation_p.A28V	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	28					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)	p.A28V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				CTCTTATCTGCGCTTTTGCTG	0.433																																					p.A28V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C83T	10						.						130.0	138.0	135.0					10																	95517984		2203	4300	6503	95507974	SO:0001583	missense	9211	exon1			AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.83C>T	10.37:g.95517984C>T	ENSP00000360472:p.Ala28Val		95507974	NM_005097	A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	ENST00000371418.4	37	CCDS7431.1	.	.	.	.	.	.	.	.	.	.	C	0.191	-1.053683	0.01965	.	.	ENSG00000108231	ENST00000542308;ENST00000371418;ENST00000371413	T;T;T	0.75704	-0.96;-0.06;0.02	4.69	1.78	0.24846	.	0.601764	0.17412	N	0.175154	T	0.36880	0.0983	N	0.00823	-1.155	0.22819	N	0.998691	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31779	-0.9931	10	0.15499	T	0.54	-0.2553	5.4561	0.16592	0.0:0.4464:0.0:0.5536	.	28;28;28	O95970-3;O95970-2;O95970	.;.;LGI1_HUMAN	V	28	ENSP00000440763:A28V;ENSP00000360472:A28V;ENSP00000360467:A28V	ENSP00000360467:A28V	A	+	2	0	LGI1	95507974	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.164000	0.50770	0.684000	0.31448	0.455000	0.32223	GCG		0.433	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049445.1	NM_005097	
TSG101	7251	broad.mit.edu	37	11	18503399	18503400	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:18503399_18503400insT	ENST00000251968.3	-	9	1275_1276	c.860_861insA	c.(859-861)aacfs	p.N287fs	TSG101_ENST00000357193.3_Frame_Shift_Ins_p.N182fs|TSG101_ENST00000536719.1_Frame_Shift_Ins_p.N287fs	NM_006292.3	NP_006283.1	Q99816	TS101_HUMAN	tumor susceptibility 101	287					cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cellular protein modification process (GO:0006464)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|keratinocyte differentiation (GO:0030216)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell growth (GO:0001558)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral budding (GO:0046755)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transcription corepressor activity (GO:0003714)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.N287fs*10(1)		kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	22						AAAGTTCTATGTTTTTATCAAC	0.356																																					p.N287fs	GBM(99;1348 1396 8611 26475 50572)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.861_862insA	11						.																																			18459976	SO:0001589	frameshift_variant	7251	exon9			U82130	CCDS7842.1	11p15	2013-08-22	2013-08-22		ENSG00000074319	ENSG00000074319			15971	protein-coding gene	gene with protein product		601387	"""tumor susceptibility gene 10"", ""tumor susceptibility gene 101"""	TSG10		9019400, 9241264	Standard	NM_006292		Approved	VPS23	uc001mor.3	Q99816	OTTHUMG00000167725	ENST00000251968.3:c.861dupA	11.37:g.18503404_18503404dupT	ENSP00000251968:p.Asn287fs		18459975	NM_006292	Q9BUM5	Frame_Shift_Ins	INS	ENST00000251968.3	37	CCDS7842.1																																																																																				0.356	TSG101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395906.1	NM_006292	
RAPSN	5913	broad.mit.edu	37	11	47460263	47460264	+	Intron	INS	-	-	C			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:47460263_47460264insC	ENST00000298854.2	-	7	1380				RAPSN_ENST00000528356.1_Intron|RAPSN_ENST00000529341.1_Frame_Shift_Ins_p.W337fs|RAPSN_ENST00000352508.3_Intron|RAPSN_ENST00000524487.1_Intron|RNU6-1302P_ENST00000516518.1_RNA	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse						positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						ACCCCTGTCCACCCCCCCAGGA	0.604																																					.												.	.	0			.	11						.																																			47416840	SO:0001627	intron_variant	5913	.				CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.1166+18->G	11.37:g.47460270_47460270dupC			47416839	.	Q8TDF3|Q9BTD9	Frame_Shift_Ins	INS	ENST00000298854.2	37	CCDS7936.1																																																																																				0.604	RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391726.1		
DYNC2H1	79659	broad.mit.edu	37	11	103157039	103157039	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:103157039G>A	ENST00000375735.2	+	74	11090	c.10946G>A	c.(10945-10947)cGt>cAt	p.R3649H	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.R3656H|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3649					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R1089H(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GCTCTGTGGCGTACTTATTAT	0.348																																					p.R3649H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10946A	11						.						175.0	179.0	177.0					11																	103157039		1905	4152	6057	102662249	SO:0001583	missense	79659	exon74			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10946G>A	11.37:g.103157039G>A	ENSP00000364887:p.Arg3649His		102662249	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.313663	0.40996	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.09538	2.97;2.97	5.27	4.36	0.52297	Dynein heavy chain (1);	0.128723	0.56097	D	0.000038	T	0.10035	0.0246	L	0.36672	1.1	0.43061	D	0.994689	B;B	0.22983	0.078;0.029	B;B	0.21546	0.035;0.013	T	0.08289	-1.0729	10	0.52906	T	0.07	.	11.0169	0.47693	0.1528:0.0:0.8472:0.0	.	3649;3656	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	H	3649;3656	ENSP00000364887:R3649H;ENSP00000381167:R3656H	ENSP00000364887:R3649H	R	+	2	0	DYNC2H1	102662249	0.996000	0.38824	0.998000	0.56505	0.997000	0.91878	2.582000	0.46085	1.223000	0.43536	0.561000	0.74099	CGT		0.348	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
CASP4	837	broad.mit.edu	37	11	104819370	104819370	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:104819370G>T	ENST00000444739.2	-	6	1725	c.815C>A	c.(814-816)cCa>cAa	p.P272Q	CASP4_ENST00000393150.3_Missense_Mutation_p.P216Q|CASP4_ENST00000531333.1_5'Flank	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	272					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)	p.P272Q(1)		central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		CAAGGATGCTGGAGAGTCTCT	0.512																																					p.P216Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C647A	11						.						155.0	122.0	133.0					11																	104819370		2202	4299	6501	104324580	SO:0001583	missense	837	exon6			U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.815C>A	11.37:g.104819370G>T	ENSP00000388566:p.Pro272Gln		104324580	NM_033306	A2NHL8|A2NHM0	Missense_Mutation	SNP	ENST00000444739.2	37	CCDS8327.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.905947	0.33628	.	.	ENSG00000196954	ENST00000444739;ENST00000393150;ENST00000355546	T;T	0.20069	2.1;2.1	4.56	2.64	0.31445	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);	1.019510	0.07821	N	0.959876	T	0.38585	0.1046	M	0.77616	2.38	0.09310	N	1	D	0.57257	0.979	P	0.60345	0.873	T	0.25950	-1.0117	10	0.13853	T	0.58	.	7.2033	0.25893	0.2109:0.0:0.7891:0.0	.	272	P49662	CASP4_HUMAN	Q	272;216;225	ENSP00000388566:P272Q;ENSP00000376857:P216Q	ENSP00000347741:P225Q	P	-	2	0	CASP4	104324580	0.000000	0.05858	0.003000	0.11579	0.040000	0.13550	0.066000	0.14489	1.135000	0.42183	0.484000	0.47621	CCA		0.512	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387751.1	NM_001225	
BCL9L	283149	broad.mit.edu	37	11	118772425	118772425	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:118772425T>C	ENST00000334801.3	-	6	2991	c.2027A>G	c.(2026-2028)gAg>gGg	p.E676G	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	676					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.E676G(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		CAGCAGCTCCTCACGGACCCG	0.652																																					p.E676G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A2027G	11						.						35.0	35.0	35.0					11																	118772425		2200	4295	6495	118277635	SO:0001583	missense	283149	exon6			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.2027A>G	11.37:g.118772425T>C	ENSP00000335320:p.Glu676Gly		118277635	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	T	16.93	3.258378	0.59321	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000392849;ENST00000431085	T	0.70516	-0.49	4.67	4.67	0.58626	.	0.000000	0.44285	D	0.000471	T	0.80979	0.4728	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.83194	-0.0082	10	0.87932	D	0	-21.0803	13.9284	0.63978	0.0:0.0:0.0:1.0	.	671;676	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	G	676;639;676;676	ENSP00000335320:E676G	ENSP00000335320:E676G	E	-	2	0	BCL9L	118277635	1.000000	0.71417	0.994000	0.49952	0.539000	0.34962	7.861000	0.87004	1.958000	0.56883	0.260000	0.18958	GAG		0.652	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
USP2	9099	broad.mit.edu	37	11	119243487	119243487	+	Missense_Mutation	SNP	G	G	A	rs369895568		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:119243487G>A	ENST00000260187.2	-	2	998	c.704C>T	c.(703-705)aCg>aTg	p.T235M	USP2_ENST00000455332.2_Intron|RP11-334E6.3_ENST00000530918.2_RNA	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	235					cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.T235M(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		CTCCCACAGCGTGTAGCGGCC	0.647																																					p.T235M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C704T	11						.	G	MET/THR	0,4398		0,0,2199	41.0	45.0	44.0		704	1.1	0.9	11		44	1,8589	1.2+/-3.3	0,1,4294	no	missense	USP2	NM_004205.4	81	0,1,6493	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	235/606	119243487	1,12987	2199	4295	6494	118748697	SO:0001583	missense	9099	exon2			AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.704C>T	11.37:g.119243487G>A	ENSP00000260187:p.Thr235Met		118748697	NM_004205	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Missense_Mutation	SNP	ENST00000260187.2	37	CCDS8422.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631983	0.29068	0.0	1.16E-4	ENSG00000036672	ENST00000260187;ENST00000530918	T	0.19938	2.11	5.37	1.1	0.20463	.	0.643479	0.14775	N	0.299125	T	0.12433	0.0302	N	0.24115	0.695	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.21143	-1.0254	10	0.45353	T	0.12	-0.4324	7.0618	0.25129	0.1643:0.29:0.5458:0.0	.	235	O75604	UBP2_HUMAN	M	235;205	ENSP00000260187:T235M	ENSP00000260187:T235M	T	-	2	0	USP2	118748697	0.046000	0.20272	0.906000	0.35671	0.949000	0.60115	-0.099000	0.11007	0.628000	0.30357	0.655000	0.94253	ACG		0.647	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	NM_171997	
ESAM	90952	broad.mit.edu	37	11	124626447	124626447	+	Silent	SNP	G	G	A	rs574612946		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:124626447G>A	ENST00000278927.5	-	3	570	c.441C>T	c.(439-441)ctC>ctT	p.L147L	RP11-677M14.3_ENST00000504932.2_RNA|ESAM_ENST00000442070.2_Intron	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	147					blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.L147L(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		CCAGTACATTGAGTTCTAAGG	0.522																																					p.L147L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C441T	11						.						134.0	130.0	131.0					11																	124626447		2201	4299	6500	124131657	SO:0001819	synonymous_variant	90952	exon3			AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.441C>T	11.37:g.124626447G>A			124131657	NM_138961	B4DVN8|Q96T50	Silent	SNP	ENST00000278927.5	37	CCDS8453.1																																																																																				0.522	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	NM_138961	
OR4C6	219432	broad.mit.edu	37	11	55433101	55433101	+	Silent	SNP	C	C	T	rs144378683		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:55433101C>T	ENST00000314259.3	+	1	488	c.459C>T	c.(457-459)caC>caT	p.H153H		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H153H(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						GATTTATGCACGCAATGATAC	0.463																																					p.H153H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C459T	11						.						102.0	98.0	99.0					11																	55433101		2200	4296	6496	55189677	SO:0001819	synonymous_variant	219432	exon1			CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.459C>T	11.37:g.55433101C>T			55189677	NM_001004704	B2RP11|Q6IFD2	Silent	SNP	ENST00000314259.3	37	CCDS31506.1																																																																																				0.463	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1	NM_001004704	
OR8K5	219453	broad.mit.edu	37	11	55927436	55927436	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:55927436A>T	ENST00000313447.1	-	1	357	c.358T>A	c.(358-360)Tat>Aat	p.Y120N		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y120N(1)		large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				TAGCGGTCATAGGCCATGGCT	0.423																																					p.Y120N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T358A	11						.						84.0	84.0	84.0					11																	55927436		2201	4295	6496	55684012	SO:0001583	missense	219453	exon1			BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.358T>A	11.37:g.55927436A>T	ENSP00000323853:p.Tyr120Asn		55684012	NM_001004058	Q6IFB5	Missense_Mutation	SNP	ENST00000313447.1	37	CCDS31521.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.194983	0.58017	.	.	ENSG00000181752	ENST00000313447	T	0.00490	7.03	3.88	3.88	0.44766	GPCR, rhodopsin-like superfamily (1);	0.127324	0.36101	N	0.002781	T	0.02012	0.0063	H	0.95950	3.745	0.31003	N	0.720116	D	0.63046	0.992	P	0.60682	0.878	T	0.00909	-1.1518	10	0.87932	D	0	.	12.368	0.55240	1.0:0.0:0.0:0.0	.	120	Q8NH50	OR8K5_HUMAN	N	120	ENSP00000323853:Y120N	ENSP00000323853:Y120N	Y	-	1	0	OR8K5	55684012	0.030000	0.19436	1.000000	0.80357	0.502000	0.33828	3.161000	0.50747	1.750000	0.51863	0.462000	0.41574	TAT		0.423	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058	
FCHSD2	9873	broad.mit.edu	37	11	72560892	72560892	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:72560892C>T	ENST00000409418.4	-	14	1734	c.1351G>A	c.(1351-1353)Gat>Aat	p.D451N	FCHSD2_ENST00000409314.1_Missense_Mutation_p.D475N|FCHSD2_ENST00000458644.2_Missense_Mutation_p.D315N|FCHSD2_ENST00000311172.7_Missense_Mutation_p.D395N|FCHSD2_ENST00000409853.1_Missense_Mutation_p.D395N	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	451								p.D395N(1)|p.D451N(1)		endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			TCCATGTTATCTTCAAACTCT	0.383																																					p.D451N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1351A	11						.						162.0	166.0	164.0					11																	72560892		2200	4293	6493	72238540	SO:0001583	missense	9873	exon14			AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.1351G>A	11.37:g.72560892C>T	ENSP00000386722:p.Asp451Asn		72238540	NM_014824	B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Missense_Mutation	SNP	ENST00000409418.4	37	CCDS8218.2	.	.	.	.	.	.	.	.	.	.	C	35	5.589906	0.96590	.	.	ENSG00000137478	ENST00000311172;ENST00000409314;ENST00000409418;ENST00000458644;ENST00000409853	T;T;T;T;T	0.54279	2.26;2.37;2.4;2.18;0.58	5.6	5.6	0.85130	Src homology-3 domain (1);	0.272984	0.41396	D	0.000890	T	0.64438	0.2598	L	0.59436	1.845	0.58432	D	0.999999	D;P;P	0.59767	0.986;0.877;0.925	P;P;P	0.55455	0.776;0.494;0.691	T	0.61262	-0.7098	10	0.36615	T	0.2	-14.298	18.59	0.91206	0.0:1.0:0.0:0.0	.	315;451;395	E7ENZ2;O94868;O94868-3	.;FCSD2_HUMAN;.	N	395;475;451;315;395	ENSP00000308978:D395N;ENSP00000386987:D475N;ENSP00000386722:D451N;ENSP00000402972:D315N;ENSP00000386314:D395N	ENSP00000308978:D395N	D	-	1	0	FCHSD2	72238540	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.270000	0.78493	2.639000	0.89480	0.650000	0.86243	GAT		0.383	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329429.2	NM_014824	
CDON	50937	broad.mit.edu	37	11	125885329	125885329	+	Silent	SNP	A	A	C			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr11:125885329A>C	ENST00000392693.3	-	7	1132	c.1005T>G	c.(1003-1005)gtT>gtG	p.V335V	CDON_ENST00000263577.7_Silent_p.V335V	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	335	Ig-like C2-type 4.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V335V(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		GGTTCCCATGAACGTCGCAGG	0.448																																					p.V335V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1005G	11						.						95.0	81.0	85.0					11																	125885329		2201	4299	6500	125390539	SO:0001819	synonymous_variant	50937	exon7			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.1005T>G	11.37:g.125885329A>C			125390539	NM_016952	O14631	Silent	SNP	ENST00000392693.3	37	CCDS58192.1	.	.	.	.	.	.	.	.	.	.	A	0.541	-0.853721	0.02630	.	.	ENSG00000064309	ENST00000534661	.	.	.	5.58	1.82	0.25136	.	.	.	.	.	T	0.23766	0.0575	.	.	.	0.09310	N	0.999992	.	.	.	.	.	.	T	0.22977	-1.0201	4	.	.	.	-17.0199	3.087	0.06280	0.3668:0.3556:0.0657:0.2119	.	.	.	.	A	311	.	.	S	-	1	0	CDON	125390539	0.000000	0.05858	0.807000	0.32361	0.103000	0.19146	-0.237000	0.08990	0.044000	0.15775	0.459000	0.35465	TCA		0.448	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
MFSD5	84975	broad.mit.edu	37	12	53647039	53647040	+	Frame_Shift_Ins	INS	-	-	AGGGG			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr12:53647039_53647040insAGGGG	ENST00000329548.4	+	2	611_612	c.420_421insAGGGG	c.(421-423)acafs	p.T141fs	MFSD5_ENST00000534842.1_Frame_Shift_Ins_p.T248fs	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	141					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.T141fs*45(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						GTGGGCTGTCCACAGCCCTGCT	0.545																																					p.S247fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.741_742insAGGGG	12						.																																			51933307	SO:0001589	frameshift_variant	84975	exon2			AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	Exception_encountered	12.37:g.53647039_53647040insAGGGG	ENSP00000332624:p.Thr141fs		51933306	NM_001170790	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Frame_Shift_Ins	INS	ENST00000329548.4	37	CCDS8851.1																																																																																				0.545	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889	
FKBP11	51303	broad.mit.edu	37	12	49315961	49315961	+	Missense_Mutation	SNP	C	C	T	rs368324438		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr12:49315961C>T	ENST00000550765.1	-	6	810	c.412G>A	c.(412-414)Gtg>Atg	p.V138M	RP11-302B13.5_ENST00000398092.4_Intron|CCDC65_ENST00000266984.5_Intron|AC073610.5_ENST00000537495.1_3'UTR|FKBP11_ENST00000444214.2_Missense_Mutation_p.V36M	NM_016594.2	NP_057678.1	Q9NYL4	FKB11_HUMAN	FK506 binding protein 11, 19 kDa	138	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.V138M(1)		kidney(1)|large_intestine(3)|lung(1)	5						ATCAGCTCCACGTCATACTGC	0.542																																					p.V138M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G412A	12						.	C	MET/VAL,MET/VAL	0,4406		0,0,2203	87.0	81.0	83.0		106,412	5.8	1.0	12		83	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	FKBP11	NM_001143781.1,NM_016594.2	21,21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	36/100,138/202	49315961	1,13005	2203	4300	6503	47602228	SO:0001583	missense	51303	exon6			AF238079	CCDS8773.1, CCDS44870.1, CCDS44871.1	12q13.12	2008-08-04	2002-08-29			ENSG00000134285			18624	protein-coding gene	gene with protein product		610571	"""FK506 binding protein 11 (19 kDa)"""			12036304, 16596453	Standard	NM_016594		Approved	FKBP19	uc001rsp.3	Q9NYL4		ENST00000550765.1:c.412G>A	12.37:g.49315961C>T	ENSP00000449751:p.Val138Met		47602228	NM_016594	B4DWB7	Missense_Mutation	SNP	ENST00000550765.1	37	CCDS8773.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696003	0.88830	0.0	1.16E-4	ENSG00000134285	ENST00000444214;ENST00000550765	D;D	0.91351	-2.83;-2.83	5.85	5.85	0.93711	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.132931	0.51477	D	0.000087	D	0.94108	0.8111	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.93855	0.7148	10	0.87932	D	0	-16.0799	12.6306	0.56655	0.0:0.9235:0.0:0.0765	.	138	Q9NYL4	FKB11_HUMAN	M	36;138	ENSP00000412403:V36M;ENSP00000449751:V138M	ENSP00000412403:V36M	V	-	1	0	FKBP11	47602228	1.000000	0.71417	0.977000	0.42913	0.993000	0.82548	5.146000	0.64845	2.941000	0.99782	0.655000	0.94253	GTG		0.542	FKBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408927.1	NM_016594	
OR6C76	390326	broad.mit.edu	37	12	55820291	55820291	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr12:55820291G>A	ENST00000328314.3	+	1	254	c.254G>A	c.(253-255)gGg>gAg	p.G85E		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G85E(1)		NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						ATTCTAACAGGGGACAAATCC	0.403																																					p.G85E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G254A	12						.						141.0	152.0	149.0					12																	55820291		2203	4300	6503	54106558	SO:0001583	missense	390326	exon1				CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.254G>A	12.37:g.55820291G>A	ENSP00000328402:p.Gly85Glu		54106558	NM_001005183		Missense_Mutation	SNP	ENST00000328314.3	37	CCDS31823.1	.	.	.	.	.	.	.	.	.	.	g	10.92	1.485820	0.26686	.	.	ENSG00000185821	ENST00000328314	T	0.01516	4.81	4.35	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	0.338637	0.20739	U	0.086570	T	0.01976	0.0062	L	0.35414	1.06	0.09310	N	1	B	0.25772	0.134	B	0.32677	0.15	T	0.42258	-0.9462	10	0.62326	D	0.03	.	5.6043	0.17371	0.3525:0.0:0.6475:0.0	.	85	A6NM76	O6C76_HUMAN	E	85	ENSP00000328402:G85E	ENSP00000328402:G85E	G	+	2	0	OR6C76	54106558	0.000000	0.05858	0.067000	0.19924	0.901000	0.52897	0.011000	0.13264	1.170000	0.42753	0.598000	0.82781	GGG		0.403	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406675.1	NM_001005183	
KSR2	283455	broad.mit.edu	37	12	117969478	117969478	+	Silent	SNP	G	G	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr12:117969478G>T	ENST00000339824.5	-	11	2449	c.1722C>A	c.(1720-1722)atC>atA	p.I574I	KSR2_ENST00000302438.5_Silent_p.I271I|KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000425217.1_Silent_p.I545I			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	574					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.I606I(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CACCTGGGAAGATGAACTGCT	0.502																																					p.I545I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1635A	12						.						99.0	105.0	103.0					12																	117969478		1998	4178	6176	116453861	SO:0001819	synonymous_variant	283455	exon11			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1722C>A	12.37:g.117969478G>T			116453861	NM_173598	A0PJT2|Q3B828|Q8N775	Silent	SNP	ENST00000339824.5	37																																																																																					0.502	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	
MPHOSPH8	54737	broad.mit.edu	37	13	20244398	20244398	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr13:20244398C>T	ENST00000361479.5	+	12	2420	c.2352C>T	c.(2350-2352)atC>atT	p.I784I	MPHOSPH8_ENST00000414242.2_Silent_p.I784I	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	784					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)	p.I784I(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		TGCTGTTTATCTTCCATGCAA	0.438																																					p.I784I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2352T	13						.						236.0	216.0	223.0					13																	20244398		2203	4300	6503	19142398	SO:0001819	synonymous_variant	54737	exon12			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.2352C>T	13.37:g.20244398C>T			19142398	NM_017520	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Silent	SNP	ENST00000361479.5	37	CCDS9287.1	.	.	.	.	.	.	.	.	.	.	C	10.13	1.264914	0.23136	.	.	ENSG00000196199	ENST00000449056	.	.	.	5.63	-2.65	0.06095	.	.	.	.	.	T	0.39886	0.1095	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32771	-0.9894	4	.	.	.	.	2.6234	0.04923	0.1392:0.293:0.0857:0.4822	.	.	.	.	F	55	.	.	S	+	2	0	MPHOSPH8	19142398	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	0.552000	0.23376	-0.173000	0.10761	-0.355000	0.07637	TCT		0.438	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044028.2	NM_017520	
SACS	26278	broad.mit.edu	37	13	23910255	23910255	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr13:23910255G>A	ENST00000382292.3	-	9	8033	c.7760C>T	c.(7759-7761)gCa>gTa	p.A2587V	SACS_ENST00000402364.1_Missense_Mutation_p.A1837V|SACS_ENST00000382298.3_Missense_Mutation_p.A2587V			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2587					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.A2440V(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CACACAAAGTGCTGGCCCTTG	0.413																																					p.A2587V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7760T	13						.						103.0	105.0	104.0					13																	23910255		2203	4299	6502	22808255	SO:0001583	missense	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.7760C>T	13.37:g.23910255G>A	ENSP00000371729:p.Ala2587Val		22808255	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661851	0.88251	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.95788	-3.81;-3.81;-3.81	5.39	5.39	0.77823	ATPase-like, ATP-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.96119	0.8735	L	0.60957	1.885	0.54753	D	0.999989	D	0.59767	0.986	P	0.53266	0.722	D	0.96047	0.9028	10	0.54805	T	0.06	.	19.1346	0.93422	0.0:0.0:1.0:0.0	.	2587	Q9NZJ4	SACS_HUMAN	V	2587;1837;2587	ENSP00000371729:A2587V;ENSP00000385844:A1837V;ENSP00000371735:A2587V	ENSP00000371729:A2587V	A	-	2	0	SACS	22808255	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	9.471000	0.97696	2.519000	0.84933	0.462000	0.41574	GCA		0.413	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
KL	9365	broad.mit.edu	37	13	33628207	33628207	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr13:33628207T>G	ENST00000380099.3	+	2	1131	c.1123T>G	c.(1123-1125)Ttg>Gtg	p.L375V	KL_ENST00000487852.1_3'UTR|KL_ENST00000426690.2_Missense_Mutation_p.L68V	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	375	Glycosyl hydrolase-1 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)	p.L375V(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		TGGACCCACCTTGAGTTTTCA	0.413																																					p.L375V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1123G	13						.						175.0	180.0	178.0					13																	33628207		2203	4300	6503	32526207	SO:0001583	missense	9365	exon2			AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.1123T>G	13.37:g.33628207T>G	ENSP00000369442:p.Leu375Val		32526207	NM_004795	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	ENST00000380099.3	37	CCDS9347.1	.	.	.	.	.	.	.	.	.	.	T	12.40	1.928082	0.34002	.	.	ENSG00000133116	ENST00000426690;ENST00000380099	T;T	0.30448	1.53;1.55	5.9	3.56	0.40772	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	M	0.70842	2.15	0.58432	D	0.999991	D;D	0.89917	1.0;0.999	D;D	0.91635	0.996;0.999	T	0.44174	-0.9345	10	0.16420	T	0.52	-28.6559	8.0063	0.30327	0.0:0.3115:0.0:0.6885	.	375;68	Q9UEF7;B3KUJ4	KLOT_HUMAN;.	V	68;375	ENSP00000399513:L68V;ENSP00000369442:L375V	ENSP00000369442:L375V	L	+	1	2	KL	32526207	0.150000	0.22732	0.980000	0.43619	0.332000	0.28634	0.618000	0.24373	1.072000	0.40860	0.533000	0.62120	TTG		0.413	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		
YLPM1	56252	broad.mit.edu	37	14	75264371	75264371	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr14:75264371G>A	ENST00000325680.7	+	5	2495	c.2371G>A	c.(2371-2373)Gat>Aat	p.D791N	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Missense_Mutation_p.D596N	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	596					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.D596N(2)|p.D791N(1)		breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		AAATCGCCCCGATGGGCCAAG	0.498																																					p.D791N												.	.	3	Substitution - Missense(3)	cervix(2)|large_intestine(1)	c.G2371A	14						.						30.0	32.0	31.0					14																	75264371		1866	4097	5963	74334124	SO:0001583	missense	56252	exon5			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.2371G>A	14.37:g.75264371G>A	ENSP00000324463:p.Asp791Asn		74334124	NM_019589	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000325680.7	37	CCDS45135.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709986	0.68730	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.39	5.39	0.77823	.	0.264525	0.32593	N	0.005897	T	0.66127	0.2758	L	0.44542	1.39	0.43203	D	0.995054	D	0.69078	0.997	P	0.60789	0.879	T	0.60337	-0.7283	9	0.27082	T	0.32	-11.3669	17.7052	0.88306	0.0:0.0:1.0:0.0	.	791	P49750-4	.	N	791;596;504	.	ENSP00000238571:D596N	D	+	1	0	YLPM1	74334124	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.338000	0.72963	2.680000	0.91292	0.643000	0.83706	GAT		0.498	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404451.1	NM_019589	
DLL4	54567	broad.mit.edu	37	15	41227245	41227246	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr15:41227245_41227246insCC	ENST00000249749.5	+	8	1446_1447	c.1170_1171insCC	c.(1171-1173)cccfs	p.P391fs		NM_019074.3	NP_061947.1	Q9NR61	DLL4_HUMAN	delta-like 4 (Drosophila)	391	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|blood vessel lumenization (GO:0072554)|blood vessel remodeling (GO:0001974)|cardiac atrium morphogenesis (GO:0003209)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|dorsal aorta morphogenesis (GO:0035912)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of neural precursor cell proliferation (GO:2000179)|regulation of neural retina development (GO:0061074)|regulation of neurogenesis (GO:0050767)|signal transduction (GO:0007165)|ventral spinal cord interneuron fate commitment (GO:0060579)|ventricular trabecula myocardium morphogenesis (GO:0003222)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)	p.N393fs*27(1)		breast(3)|large_intestine(1)	4		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CTTGTGAATGTCCCCCCAACTT	0.614																																					p.C390fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1170_1171insCC	15						.																																			39014538	SO:0001589	frameshift_variant	54567	exon8			AF253468	CCDS45232.1	15q14	2008-07-03	2001-12-03			ENSG00000128917			2910	protein-coding gene	gene with protein product		605185	"""delta-like 4 homolog (Drosophila)"""			10837024	Standard	NM_019074		Approved		uc001zng.2	Q9NR61		ENST00000249749.5:c.1175_1176dupCC	15.37:g.41227250_41227251dupCC	ENSP00000249749:p.Pro391fs		39014537	NM_019074	Q3KP23|Q9NQT9	Frame_Shift_Ins	INS	ENST00000249749.5	37	CCDS45232.1																																																																																				0.614	DLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418859.1		
GABRB3	2562	broad.mit.edu	37	15	26793076	26793076	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr15:26793076C>T	ENST00000311550.5	-	9	1397	c.1286G>A	c.(1285-1287)cGg>cAg	p.R429Q	GABRB3_ENST00000545868.1_Missense_Mutation_p.R344Q|GABRB3_ENST00000400188.3_Missense_Mutation_p.R358Q|GABRB3_ENST00000299267.4_Missense_Mutation_p.R429Q|GABRB3_ENST00000541819.2_Missense_Mutation_p.R485Q	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3	429					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)	p.R429Q(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGACCTCCTCCGTAGATGGGT	0.488																																					p.R429Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1286A	15						.						92.0	79.0	83.0					15																	26793076		2203	4300	6503	24344169	SO:0001583	missense	2562	exon9				CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231	ENST00000311550.5:c.1286G>A	15.37:g.26793076C>T	ENSP00000308725:p.Arg429Gln		24344169	NM_021912	B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Missense_Mutation	SNP	ENST00000311550.5	37	CCDS10019.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.969278	0.53614	.	.	ENSG00000166206	ENST00000311550;ENST00000541819;ENST00000299267;ENST00000400188;ENST00000545868	D;D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13;-2.13	6.03	6.03	0.97812	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.051402	0.85682	D	0.000000	D	0.86506	0.5949	M	0.66378	2.025	0.80722	D	1	B;B;B	0.30511	0.282;0.188;0.06	B;B;B	0.24269	0.051;0.052;0.041	D	0.83560	0.0106	10	0.44086	T	0.13	.	19.545	0.95291	0.0:1.0:0.0:0.0	.	485;429;429	F5H7N0;P28472-2;P28472	.;.;GBRB3_HUMAN	Q	429;485;429;358;344	ENSP00000308725:R429Q;ENSP00000442408:R485Q;ENSP00000299267:R429Q;ENSP00000383049:R358Q;ENSP00000439169:R344Q	ENSP00000299267:R429Q	R	-	2	0	GABRB3	24344169	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.222000	0.51223	2.861000	0.98227	0.655000	0.94253	CGG		0.488	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251352.2		
HERC2	8924	broad.mit.edu	37	15	28456228	28456228	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr15:28456228C>T	ENST00000261609.7	-	44	7097	c.6989G>A	c.(6988-6990)cGg>cAg	p.R2330Q		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.R2330L(1)|p.R2330Q(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GAGCAGCGCCCGACCTGCTTT	0.542																																					p.R2330Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G6989A	15						.						66.0	62.0	63.0					15																	28456228		2202	4298	6500	26129823	SO:0001583	missense	8924	exon44			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.6989G>A	15.37:g.28456228C>T	ENSP00000261609:p.Arg2330Gln		26129823	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644060	0.47258	.	.	ENSG00000128731	ENST00000261609	T	0.41758	0.99	4.84	2.98	0.34508	.	0.152547	0.44285	D	0.000462	T	0.34542	0.0901	M	0.64997	1.995	0.58432	D	0.999995	P	0.43352	0.804	B	0.33392	0.163	T	0.18304	-1.0341	10	0.45353	T	0.12	.	11.0384	0.47816	0.0:0.8495:0.0:0.1505	.	2330	O95714	HERC2_HUMAN	Q	2330	ENSP00000261609:R2330Q	ENSP00000261609:R2330Q	R	-	2	0	HERC2	26129823	1.000000	0.71417	0.125000	0.21846	0.376000	0.30014	7.647000	0.83462	0.645000	0.30675	0.561000	0.74099	CGG		0.542	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
SYNM	23336	broad.mit.edu	37	15	99670386	99670386	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr15:99670386C>T	ENST00000560674.1	+	4	1432	c.963C>T	c.(961-963)acC>acT	p.T321T	SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000328642.7_Silent_p.T606T|SYNM_ENST00000336292.6_Silent_p.T606T|RP11-6O2.4_ENST00000566974.1_RNA			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	607	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)	p.T606T(2)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						GTGGTGGGACCGGTAGAGAGG	0.542																																					p.P607L	Pancreas(125;1071 1762 21750 40003 40381)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1820T	15						.						58.0	60.0	59.0					15																	99670386		2013	4175	6188	97487909	SO:0001819	synonymous_variant	23336	exon4			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.963C>T	15.37:g.99670386C>T			97487909	NM_015286	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Silent	SNP	ENST00000560674.1	37																																																																																					0.542	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000415698.2	NM_145728	
ADCY9	115	broad.mit.edu	37	16	4042274	4042274	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr16:4042274C>T	ENST00000294016.3	-	5	2618	c.2080G>A	c.(2080-2082)Gag>Aag	p.E694K	ADCY9_ENST00000571889.1_Intron	NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	694					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.E694K(1)		breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TGCAAGATCTCACACAGAGAA	0.582																																					p.E694K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2080A	16						.						90.0	81.0	84.0					16																	4042274		2197	4300	6497	3982275	SO:0001583	missense	115	exon5			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2080G>A	16.37:g.4042274C>T	ENSP00000294016:p.Glu694Lys		3982275	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219674	0.79464	.	.	ENSG00000162104	ENST00000294016	D	0.83914	-1.78	5.28	5.28	0.74379	.	0.106372	0.64402	D	0.000005	T	0.74550	0.3731	L	0.40543	1.245	0.58432	D	0.999999	P	0.38922	0.651	B	0.27262	0.078	T	0.74054	-0.3788	10	0.25106	T	0.35	.	18.9204	0.92523	0.0:1.0:0.0:0.0	.	694	O60503	ADCY9_HUMAN	K	694	ENSP00000294016:E694K	ENSP00000294016:E694K	E	-	1	0	ADCY9	3982275	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.506000	0.81665	2.463000	0.83235	0.643000	0.83706	GAG		0.582	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
SLC12A3	6559	broad.mit.edu	37	16	56912068	56912068	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr16:56912068C>G	ENST00000563236.1	+	9	1200	c.1175C>G	c.(1174-1176)aCc>aGc	p.T392S	SLC12A3_ENST00000438926.2_Missense_Mutation_p.T392S|SLC12A3_ENST00000566786.1_Missense_Mutation_p.T391S|SLC12A3_ENST00000262502.5_Missense_Mutation_p.T391S			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	392					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	ATCTCAGCCACCATTGGTAAG	0.617																																					p.T392S												.	.	0			c.C1175G	16						.						46.0	38.0	41.0					16																	56912068		2198	4300	6498	55469569	SO:0001583	missense	6559	exon9				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1175C>G	16.37:g.56912068C>G	ENSP00000456149:p.Thr392Ser		55469569	NM_000339	A8MSJ2|C9JNN9	Missense_Mutation	SNP	ENST00000563236.1	37	CCDS58464.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.444619	0.43429	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	5.77	5.77	0.91146	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	T	0.67608	0.2911	L	0.34521	1.04	0.80722	D	1	B;D;D	0.89917	0.336;1.0;1.0	B;D;D	0.97110	0.108;1.0;1.0	T	0.60291	-0.7292	9	0.21540	T	0.41	.	19.9785	0.97317	0.0:1.0:0.0:0.0	.	391;392;392	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	S	391;392	.	ENSP00000262502:T392S	T	+	2	0	SLC12A3	55469569	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.706000	0.84615	2.729000	0.93468	0.555000	0.69702	ACC		0.617	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1		
HYDIN	54768	broad.mit.edu	37	16	70941323	70941323	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr16:70941323G>A	ENST00000393567.2	-	50	8618	c.8468C>T	c.(8467-8469)aCg>aTg	p.T2823M		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2823					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.T2822M(1)|p.T2774M(1)|p.T380M(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GTACGTCTCCGTGCTCATAAC	0.428																																					p.T2822M												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C8465T	16						.						6.0	5.0	5.0					16																	70941323		1696	3851	5547	69498824	SO:0001583	missense	54768	exon50			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.8468C>T	16.37:g.70941323G>A	ENSP00000377197:p.Thr2823Met		69498824	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	2.672	-0.277312	0.05679	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00986	5.47	4.51	-5.91	0.02269	.	0.487767	0.14284	N	0.329325	T	0.00524	0.0017	N	0.04203	-0.255	0.09310	N	1	B	0.19073	0.033	B	0.15484	0.013	T	0.46005	-0.9222	10	0.29301	T	0.29	.	11.5273	0.50586	0.1602:0.0:0.6501:0.1897	.	2822	F8WD23	.	M	2823;2822	ENSP00000377197:T2823M	ENSP00000313052:T2822M	T	-	2	0	HYDIN	69498824	0.000000	0.05858	0.000000	0.03702	0.199000	0.23934	-0.088000	0.11198	-0.921000	0.03794	-0.331000	0.08364	ACG		0.428	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
WWOX	51741	broad.mit.edu	37	16	78458921	78458921	+	Missense_Mutation	SNP	C	C	T	rs369715848		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr16:78458921C>T	ENST00000566780.1	+	7	1126	c.760C>T	c.(760-762)Cgt>Tgt	p.R254C	WWOX_ENST00000406884.2_Intron|WWOX_ENST00000539474.2_Intron|WWOX_ENST00000408984.3_Missense_Mutation_p.R254C|WWOX_ENST00000402655.2_Intron	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	254	Interaction with MAPT. {ECO:0000250}.|Mediates targeting to the mitochondria. {ECO:0000250}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)	p.R254S(1)|p.R254C(1)|p.P96P(1)		large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		AGCTCCTGCCCGTGTCATTGT	0.507																																					p.R254C												.	.	3	Substitution - Missense(2)|Substitution - coding silent(1)	endometrium(2)|large_intestine(1)	c.C760T	16						.	C	CYS/ARG	0,4002		0,0,2001	131.0	131.0	131.0		760	4.7	1.0	16		131	1,8369		0,1,4184	no	missense	WWOX	NM_016373.2	180	0,1,6185	TT,TC,CC		0.0119,0.0,0.0081	probably-damaging	254/415	78458921	1,12371	2001	4185	6186	77016422	SO:0001583	missense	51741	exon7			AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.760C>T	16.37:g.78458921C>T	ENSP00000457230:p.Arg254Cys		77016422	NM_016373	A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	ENST00000566780.1	37	CCDS42196.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237500	0.58886	0.0	1.19E-4	ENSG00000186153	ENST00000408984	T	0.27402	1.67	5.66	4.7	0.59300	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.65512	0.2698	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75671	-0.3237	10	0.87932	D	0	.	13.0107	0.58729	0.4423:0.5577:0.0:0.0	.	254	Q9NZC7	WWOX_HUMAN	C	254	ENSP00000386161:R254C	ENSP00000386161:R254C	R	+	1	0	WWOX	77016422	0.999000	0.42202	0.995000	0.50966	0.998000	0.95712	3.005000	0.49521	1.370000	0.46153	0.655000	0.94253	CGT		0.507	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434328.1		
AXIN2	8313	broad.mit.edu	37	17	63537587	63537588	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr17:63537587_63537588insA	ENST00000375702.5	-	3	1152_1153	c.1044_1045insT	c.(1042-1047)tctctafs	p.L349fs	CTD-2535L24.2_ENST00000577662.1_3'UTR|AXIN2_ENST00000307078.5_Frame_Shift_Ins_p.L349fs			Q9Y2T1	AXIN2_HUMAN	axin 2	349	Interaction with GSK3B. {ECO:0000250}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.L349fs*25(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						AAATGAGGTAGAGACACTTGGC	0.49									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.L349fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1045_1046insT	17						.																																			60968050	SO:0001589	frameshift_variant	8313	exon4	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1045dupT	17.37:g.63537588_63537588dupA	ENSP00000364854:p.Leu349fs		60968049	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Frame_Shift_Ins	INS	ENST00000375702.5	37																																																																																					0.490	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655	
B9D1	27077	broad.mit.edu	37	17	19246689	19246689	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr17:19246689C>T	ENST00000261499.4	-	7	701	c.558G>A	c.(556-558)ggG>ggA	p.G186G	B9D1_ENST00000477478.2_3'UTR|B9D1_ENST00000395615.1_3'UTR|MIR1180_ENST00000408613.1_RNA|B9D1_ENST00000575403.1_Intron|B9D1_ENST00000461069.2_Intron	NM_015681.3	NP_056496.1	Q9UPM9	B9D1_HUMAN	B9 protein domain 1	186					camera-type eye development (GO:0043010)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|in utero embryonic development (GO:0001701)|neuroepithelial cell differentiation (GO:0060563)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)|vasculature development (GO:0001944)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)	hedgehog receptor activity (GO:0008158)	p.G186G(1)		large_intestine(3)|urinary_tract(1)	4	all_cancers(12;2.04e-05)|all_epithelial(12;0.000806)|Hepatocellular(7;0.00345)|Breast(13;0.143)					TATCAGAAGGCCCAGTGTCAT	0.587																																					p.G186G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G558A	17						.						87.0	75.0	79.0					17																	19246689		2203	4300	6503	19187282	SO:0001819	synonymous_variant	27077	exon7			BC002944	CCDS11205.1, CCDS58528.1	17p11.2	2014-09-17			ENSG00000108641	ENSG00000108641			24123	protein-coding gene	gene with protein product	"""endothelial precursor protein B9"""	614144				21493627	Standard	NM_015681		Approved	B9, EPPB9, MKS9	uc010vyr.2	Q9UPM9	OTTHUMG00000059586	ENST00000261499.4:c.558G>A	17.37:g.19246689C>T			19187282	NM_015681	Q9BU22	Silent	SNP	ENST00000261499.4	37	CCDS11205.1																																																																																				0.587	B9D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132494.1	NM_015681	
RHOT1	55288	broad.mit.edu	37	17	30510234	30510234	+	Silent	SNP	C	C	T	rs201021051		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr17:30510234C>T	ENST00000333942.6	+	8	722	c.483C>T	c.(481-483)taC>taT	p.Y161Y	RHOT1_ENST00000580976.1_Intron|RHOT1_ENST00000581094.1_Silent_p.Y161Y|RHOT1_ENST00000394692.2_Silent_p.Y161Y|RHOT1_ENST00000583994.1_Silent_p.Y34Y|RHOT1_ENST00000354266.3_Silent_p.Y140Y|RHOT1_ENST00000545287.2_Silent_p.Y161Y|RHOT1_ENST00000358365.3_Silent_p.Y161Y	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	161	Miro 1.				cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.Y161Y(1)		NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TCTTTTATTACGCACAGAAAG	0.388													C|||	1	0.000199681	0.0	0.0	5008	,	,		17176	0.001		0.0	False		,,,				2504	0.0				p.Y161Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C483T	17						.						79.0	85.0	83.0					17																	30510234		2203	4300	6503	27534347	SO:0001819	synonymous_variant	55288	exon8			AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.483C>T	17.37:g.30510234C>T			27534347	NM_001033566	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Silent	SNP	ENST00000333942.6	37	CCDS32612.1																																																																																				0.388	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000447097.1	NM_018307	
TP53	7157	broad.mit.edu	37	17	7574003	7574003	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr17:7574003G>A	ENST00000269305.4	-	10	1213	c.1024C>T	c.(1024-1026)Cga>Tga	p.R342*	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000445888.2_Nonsense_Mutation_p.R342*|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000359597.4_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	342	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> L (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R342*(70)|p.0?(8)|p.R342fs*3(8)|p.?(1)|p.R342_N345delRELN(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCAGCTCTCGGAACATCTCG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R342X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,breast,NS,Substitution - Nonsense,0 	.	89	Substitution - Nonsense(70)|Whole gene deletion(8)|Deletion - Frameshift(7)|Insertion - Frameshift(2)|Deletion - In frame(1)|Unknown(1)	breast(16)|upper_aerodigestive_tract(11)|large_intestine(9)|central_nervous_system(9)|ovary(7)|lung(6)|skin(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|pancreas(4)|bone(4)|stomach(2)|urinary_tract(2)|oesophagus(2)|kidney(1)|peritoneum(1)|endometrium(1)	c.C1024T	17	GRCh37	CM004908	TP53	M		.						62.0	48.0	53.0					17																	7574003		2203	4300	6503	7514728	SO:0001587	stop_gained	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1024C>T	17.37:g.7574003G>A	ENSP00000269305:p.Arg342*		7514728	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	37	6.061927	0.97246	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	3.43	0.39272	.	0.217683	0.37906	N	0.001893	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-0.3792	6.4477	0.21885	0.0845:0.0:0.5925:0.323	.	.	.	.	X	342;342;331	.	ENSP00000269305:R342X	R	-	1	2	TP53	7514728	0.820000	0.29190	0.702000	0.30337	0.859000	0.49053	2.169000	0.42434	0.657000	0.30906	0.561000	0.74099	CGA		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PGAP3	93210	broad.mit.edu	37	17	37829808	37829808	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr17:37829808C>A	ENST00000300658.4	-	6	745	c.653G>T	c.(652-654)cGc>cTc	p.R218L	PGAP3_ENST00000579146.1_Intron|PGAP3_ENST00000378011.4_Missense_Mutation_p.R167L|PGAP3_ENST00000429199.2_Missense_Mutation_p.R197L	NM_033419.3	NP_219487.3	Q96FM1	PGAP3_HUMAN	post-GPI attachment to proteins 3	218					GPI anchor biosynthetic process (GO:0006506)|GPI anchor metabolic process (GO:0006505)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	hydrolase activity, acting on ester bonds (GO:0016788)	p.R218L(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12						ATAGTCGAAGCGGATGAGGCT	0.637																																					p.R218L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G653T	17						.						102.0	100.0	101.0					17																	37829808		2203	4300	6503	35083334	SO:0001583	missense	93210	exon6			AB088396	CCDS32641.1	17q21.2	2009-06-02	2009-06-02	2009-06-02		ENSG00000161395			23719	protein-coding gene	gene with protein product	"""post-GPI attachment to proteins 3"""	611801	"""per1-like domain containing 1"""	PERLD1		15010812, 17021251, 17314402	Standard	NM_001291728		Approved	MGC9753, CAB2, PP1498, PER1	uc002hsj.3	Q96FM1		ENST00000300658.4:c.653G>T	17.37:g.37829808C>A	ENSP00000300658:p.Arg218Leu		35083334	NM_033419	B4DGK7|Q86Z03|Q8NBJ8	Missense_Mutation	SNP	ENST00000300658.4	37	CCDS32641.1	.	.	.	.	.	.	.	.	.	.	C	17.84	3.487244	0.63962	.	.	ENSG00000161395	ENST00000300658;ENST00000378011;ENST00000309862;ENST00000429199	.	.	.	5.01	-8.0	0.01126	.	0.479957	0.24700	N	0.036317	T	0.42966	0.1226	L	0.52364	1.645	0.39778	D	0.972262	P;P;P	0.39060	0.612;0.605;0.657	B;B;B	0.35607	0.206;0.13;0.206	T	0.50372	-0.8836	9	0.48119	T	0.1	-3.346	14.1654	0.65473	0.0:0.3964:0.0:0.6036	.	197;167;218	B4DGK7;Q96FM1-2;Q96FM1	.;.;PGAP3_HUMAN	L	218;167;162;197	.	ENSP00000300658:R218L	R	-	2	0	PGAP3	35083334	0.085000	0.21516	0.229000	0.23960	0.969000	0.65631	-0.300000	0.08243	-1.797000	0.01252	-0.768000	0.03414	CGC		0.637	PGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444825.2	NM_033419	
ENPP7	339221	broad.mit.edu	37	17	77709213	77709213	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr17:77709213C>T	ENST00000328313.5	+	3	992	c.771C>T	c.(769-771)ggC>ggT	p.G257G		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7									p.G257G(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			AACGGGCTGGCGACCTGGTTG	0.582																																					p.G257G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C771T	17						.						130.0	100.0	110.0					17																	77709213		2203	4300	6503	75323808	SO:0001819	synonymous_variant	339221	exon3			AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.771C>T	17.37:g.77709213C>T			75323808	NM_178543		Silent	SNP	ENST00000328313.5	37	CCDS11763.1																																																																																				0.582	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543	
EPG5	57724	broad.mit.edu	37	18	43450590	43450590	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr18:43450590C>T	ENST00000282041.5	-	36	6201	c.6167G>A	c.(6166-6168)cGg>cAg	p.R2056Q	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	2056			R -> W (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)			p.R2056Q(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TGGCAGTTTCCGGTACGTGCT	0.517																																					p.R2056Q												KIAA1632,breast,NS,Substitution - Missense,-1 	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6167A	18						.						106.0	107.0	107.0					18																	43450590		1993	4170	6163	41704588	SO:0001583	missense	57724	exon36			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.6167G>A	18.37:g.43450590C>T	ENSP00000282041:p.Arg2056Gln		41704588	NM_020964	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	C	8.527	0.870095	0.17322	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.09817	2.94	6.03	-12.1	0.00011	.	.	.	.	.	T	0.05960	0.0155	N	0.03154	-0.405	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.58126	-0.7691	9	0.21014	T	0.42	-0.1748	29.0522	0.99999	0.0:0.8579:0.0:0.1421	.	2056	Q9HCE0	EPG5_HUMAN	Q	2056;931	ENSP00000282041:R2056Q	ENSP00000282041:R2056Q	R	-	2	0	EPG5	41704588	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-1.613000	0.02059	-2.940000	0.00297	-0.880000	0.02959	CGG		0.517	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
PTPRM	5797	broad.mit.edu	37	18	8113512	8113512	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr18:8113512C>T	ENST00000332175.8	+	12	2922	c.1885C>T	c.(1885-1887)Cgt>Tgt	p.R629C	PTPRM_ENST00000400053.4_Missense_Mutation_p.R567C|PTPRM_ENST00000444013.1_Missense_Mutation_p.R416C|PTPRM_ENST00000400060.4_Missense_Mutation_p.R629C|PTPRM_ENST00000578571.1_3'UTR|PTPRM_ENST00000580170.1_Missense_Mutation_p.R629C	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	629	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R629C(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				TGAGGAAGAACGTCCTCGAAG	0.393																																					p.R629C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1885T	18						.						89.0	86.0	87.0					18																	8113512		2203	4300	6503	8103512	SO:0001583	missense	5797	exon12			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.1885C>T	18.37:g.8113512C>T	ENSP00000331418:p.Arg629Cys		8103512	NM_002845	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523671	0.85600	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.51071	1.04;1.03;0.87;0.72	5.84	4.9	0.64082	Fibronectin, type III (1);	0.053373	0.85682	D	0.000000	T	0.65883	0.2734	M	0.74881	2.28	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.59357	0.856;0.635;0.635	T	0.68918	-0.5282	10	0.59425	D	0.04	.	17.6844	0.88253	0.1312:0.8688:0.0:0.0	.	416;629;629	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	C	629;629;567;416	ENSP00000331418:R629C;ENSP00000382933:R629C;ENSP00000382927:R567C;ENSP00000387608:R416C	ENSP00000331418:R629C	R	+	1	0	PTPRM	8103512	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.713000	0.54882	2.764000	0.94973	0.650000	0.86243	CGT		0.393	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
SEC11C	90701	broad.mit.edu	37	18	56824868	56824868	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr18:56824868A>G	ENST00000587834.1	+	5	968	c.496A>G	c.(496-498)Ata>Gta	p.I166V	SEC11C_ENST00000588875.1_Intron	NM_033280.2	NP_150596.1	Q9BY50	SC11C_HUMAN	SEC11 homolog C (S. cerevisiae)	166					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	serine-type peptidase activity (GO:0008236)	p.I166V(1)		endometrium(1)|large_intestine(4)|liver(2)|lung(2)	9		Colorectal(73;0.175)				TATGGTCACCATAATAATGAA	0.308																																					p.I166V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A496G	18						.						177.0	158.0	165.0					18																	56824868		2203	4300	6503	54975848	SO:0001583	missense	90701	exon5			AF212233	CCDS11970.1	18q21.32	2006-11-07	2006-11-07	2006-11-07	ENSG00000166562	ENSG00000166562			23400	protein-coding gene	gene with protein product			"""SEC11-like 3 (S. cerevisiae)"""	SEC11L3			Standard	NM_033280		Approved	SPC21, SPCS4C	uc002lht.3	Q9BY50	OTTHUMG00000132762	ENST00000587834.1:c.496A>G	18.37:g.56824868A>G	ENSP00000468633:p.Ile166Val		54975848	NM_033280	B2RAA3	Missense_Mutation	SNP	ENST00000587834.1	37	CCDS11970.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.692674	0.88735	.	.	ENSG00000166562	ENST00000299714	.	.	.	6.17	6.17	0.99709	Peptidase S24/S26A/S26B/S26C (1);	0.000000	0.85682	D	0.000000	D	0.86887	0.6041	H	0.96777	3.88	0.80722	D	1	D	0.61080	0.989	P	0.61201	0.885	D	0.90593	0.4538	9	0.56958	D	0.05	-30.7589	16.4837	0.84171	1.0:0.0:0.0:0.0	.	166	Q9BY50	SC11C_HUMAN	V	166	.	ENSP00000299714:I166V	I	+	1	0	SEC11C	54975848	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.635000	0.91006	2.371000	0.80710	0.533000	0.62120	ATA		0.308	SEC11C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256134.2	NM_033280	
MYPOP	339344	broad.mit.edu	37	19	46393971	46393972	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr19:46393971_46393972insG	ENST00000322217.5	-	3	1195_1196	c.1109_1110insC	c.(1108-1110)ccafs	p.P370fs		NM_001012643.2	NP_001012661.1	Q86VE0	MYPOP_HUMAN	Myb-related transcription factor, partner of profilin	370	Pro-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.A371fs*>30(1)		large_intestine(2)|lung(1)|skin(1)	4						GGAGCGGGGCTGGGGGGGGCCG	0.658																																					p.P370fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1110_1111insC	19						.																																			51085812	SO:0001589	frameshift_variant	339344	exon3			BC044311	CCDS33055.1	19q13.32	2014-06-13			ENSG00000176182	ENSG00000176182			20178	protein-coding gene	gene with protein product	"""p42 Myb-related transcription factor, partner of profilin"""					15615774	Standard	NM_001012643		Approved	P42pop	uc002pdt.3	Q86VE0	OTTHUMG00000182486	ENST00000322217.5:c.1110dupC	19.37:g.46393979_46393979dupG	ENSP00000325402:p.Pro370fs		51085811	NM_001012643		Frame_Shift_Ins	INS	ENST00000322217.5	37	CCDS33055.1																																																																																				0.658	MYPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461684.1	NM_001012643	
CASP14	23581	broad.mit.edu	37	19	15166255	15166255	+	Nonsense_Mutation	SNP	C	C	T	rs546136139		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr19:15166255C>T	ENST00000427043.3	+	6	843	c.535C>T	c.(535-537)Cga>Tga	p.R179*	CASP14_ENST00000221740.1_Nonsense_Mutation_p.R179*|AC004699.1_ENST00000411269.1_RNA	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	179					cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)	p.R179*(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						CATCGCCTACCGACATGATCA	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		18249	0.0		0.001	False		,,,				2504	0.0				p.R179X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C535T	19						.						108.0	93.0	98.0					19																	15166255		2203	4300	6503	15027255	SO:0001587	stop_gained	23581	exon6				CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.535C>T	19.37:g.15166255C>T	ENSP00000393417:p.Arg179*		15027255	NM_012114	O95823|Q3SYC9	Nonsense_Mutation	SNP	ENST00000427043.3	37	CCDS12323.1	.	.	.	.	.	.	.	.	.	.	c	18.14	3.557660	0.65425	.	.	ENSG00000105141	ENST00000427043;ENST00000221740	.	.	.	4.5	2.0	0.26442	.	0.224065	0.30940	N	0.008578	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.8118	0.34971	0.4818:0.5181:0.0:0.0	.	.	.	.	X	179	.	ENSP00000221740:R179X	R	+	1	2	CASP14	15027255	0.998000	0.40836	0.999000	0.59377	0.061000	0.15899	1.156000	0.31712	0.681000	0.31386	-0.521000	0.04368	CGA		0.537	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465663.1	NM_012114	
NOTCH3	4854	broad.mit.edu	37	19	15300132	15300132	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr19:15300132C>T	ENST00000263388.2	-	7	1219	c.1144G>A	c.(1144-1146)Ggc>Agc	p.G382S		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	382	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.G382S(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CCCGTGAAGCCGGGAGGACAG	0.607																																					p.G382S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1144A	19	GRCh37	CM035644	NOTCH3	M		.						81.0	83.0	82.0					19																	15300132		2203	4300	6503	15161132	SO:0001583	missense	4854	exon7			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1144G>A	19.37:g.15300132C>T	ENSP00000263388:p.Gly382Ser		15161132	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.009352	0.75046	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.98192	-4.78	4.72	4.72	0.59763	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99202	0.9723	M	0.93507	3.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.99136	1.0854	9	0.87932	D	0	.	16.4748	0.84129	0.0:1.0:0.0:0.0	.	385;382	Q59FL3;Q9UM47	.;NOTC3_HUMAN	S	382;384	ENSP00000263388:G382S	ENSP00000263388:G382S	G	-	1	0	NOTCH3	15161132	1.000000	0.71417	0.703000	0.30354	0.212000	0.24457	7.339000	0.79282	2.179000	0.69175	0.313000	0.20887	GGC		0.607	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
COMP	1311	broad.mit.edu	37	19	18895074	18895074	+	Nonsense_Mutation	SNP	G	G	A	rs148554460		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr19:18895074G>A	ENST00000222271.2	-	17	2058	c.2014C>T	c.(2014-2016)Cga>Tga	p.R672*	COMP_ENST00000425807.1_Nonsense_Mutation_p.R619*|COMP_ENST00000542601.2_Nonsense_Mutation_p.R639*	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	672	Mediates cell survival and induction of the IAP family of survival proteins.|TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)	p.R672*(1)		breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						CCCACGTTTCGCGGGTCCTTC	0.622																																					p.R672X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2014T	19						.	G	stop/ARG	0,4406		0,0,2203	89.0	81.0	84.0		2014	2.3	1.0	19	dbSNP_134	84	2,8598	2.2+/-6.3	0,2,4298	no	stop-gained	COMP	NM_000095.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		672/758	18895074	2,13004	2203	4300	6503	18756074	SO:0001587	stop_gained	1311	exon17			L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.2014C>T	19.37:g.18895074G>A	ENSP00000222271:p.Arg672*		18756074	NM_000095	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Nonsense_Mutation	SNP	ENST00000222271.2	37	CCDS12385.1	.	.	.	.	.	.	.	.	.	.	G	39	7.762658	0.98477	0.0	2.33E-4	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	.	.	.	4.71	2.28	0.28536	.	0.176389	0.35349	U	0.003280	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.0044	12.8183	0.57677	0.0:0.0:0.6084:0.3916	.	.	.	.	X	639;672;619;659	.	ENSP00000222271:R672X	R	-	1	2	COMP	18756074	0.927000	0.31430	0.987000	0.45799	0.388000	0.30384	1.483000	0.35497	0.979000	0.38497	-0.488000	0.04728	CGA		0.622	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403457.1	NM_000095	
ZNF208	7757	broad.mit.edu	37	19	22156697	22156697	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr19:22156697C>G	ENST00000397126.4	-	4	1287	c.1139G>C	c.(1138-1140)tGg>tCg	p.W380S	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.W380S(3)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GGTTGAGGGCCACTTATAGGC	0.378																																					p.W380S												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G1139C	19						.						38.0	41.0	40.0					19																	22156697		2059	4217	6276	21948537	SO:0001583	missense	7757	exon4			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1139G>C	19.37:g.22156697C>G	ENSP00000380315:p.Trp380Ser		21948537	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	0.827	-0.746729	0.03065	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.06849	3.25	2.65	-5.3	0.02738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08179	0.0204	.	.	.	0.09310	N	1	P	0.46987	0.888	P	0.52710	0.707	T	0.11817	-1.0572	8	0.16420	T	0.52	.	5.0712	0.14608	0.1647:0.2179:0.0:0.6174	.	380	O43345	ZN208_HUMAN	S	380	ENSP00000380315:W380S	ENSP00000380315:W380S	W	-	2	0	ZNF208	21948537	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.698000	0.01908	-1.117000	0.02965	-0.667000	0.03836	TGG		0.378	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
FCGBP	8857	broad.mit.edu	37	19	40368844	40368844	+	Silent	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr19:40368844G>A	ENST00000221347.6	-	28	12511	c.12504C>T	c.(12502-12504)tcC>tcT	p.S4168S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4168	VWFD 10. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.S4168S(2)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CGTCGGCCACGGAGACAGGCA	0.622																																					p.S4168S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C12504T	19						.						172.0	170.0	171.0					19																	40368844		2203	4300	6503	45060684	SO:0001819	synonymous_variant	8857	exon28			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12504C>T	19.37:g.40368844G>A			45060684	NM_003890	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																				0.622	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
KCNA7	3743	broad.mit.edu	37	19	49574086	49574086	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr19:49574086C>T	ENST00000221444.1	-	2	960	c.605G>A	c.(604-606)cGc>cAc	p.R202H		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	202					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.R202H(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GAAGGGCAGGCGGGGTGGATT	0.592																																					p.R202H	Colon(74;686 1235 3793 23366 48562)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G605A	19						.						82.0	60.0	67.0					19																	49574086		2203	4300	6503	54265898	SO:0001583	missense	3743	exon2			AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.605G>A	19.37:g.49574086C>T	ENSP00000221444:p.Arg202His		54265898	NM_031886	A1KYX7|Q9BYS4	Missense_Mutation	SNP	ENST00000221444.1	37	CCDS12755.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.954400	0.53293	.	.	ENSG00000104848	ENST00000221444	D	0.97455	-4.39	4.49	3.38	0.38709	.	0.844493	0.09836	U	0.749531	D	0.92014	0.7470	N	0.11927	0.2	0.28261	N	0.924827	B	0.16603	0.018	B	0.04013	0.001	D	0.85800	0.1373	10	0.38643	T	0.18	.	11.0311	0.47774	0.0:0.8106:0.1894:0.0	.	202	Q96RP8	KCNA7_HUMAN	H	202	ENSP00000221444:R202H	ENSP00000221444:R202H	R	-	2	0	KCNA7	54265898	0.805000	0.28982	0.416000	0.26546	0.358000	0.29455	1.279000	0.33191	2.234000	0.73211	0.313000	0.20887	CGC		0.592	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886	
MUC16	94025	broad.mit.edu	37	19	9049663	9049663	+	Silent	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr19:9049663G>A	ENST00000397910.4	-	5	32171	c.31968C>T	c.(31966-31968)gtC>gtT	p.V10656V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10658	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.V6289V(1)|p.V10656V(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCGAAATAGTGACCAGTGGGG	0.488																																					p.V10656V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C31968T	19						.						135.0	122.0	126.0					19																	9049663		2022	4180	6202	8910663	SO:0001819	synonymous_variant	94025	exon5			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31968C>T	19.37:g.9049663G>A			8910663	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	broad.mit.edu	37	19	9057575	9057575	+	Silent	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr19:9057575G>A	ENST00000397910.4	-	3	30074	c.29871C>T	c.(29869-29871)acC>acT	p.T9957T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9959	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T9957T(1)|p.T5590T(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTTTTTGGGTGGTGATGGTCA	0.493																																					p.T9957T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C29871T	19						.						256.0	250.0	252.0					19																	9057575		1981	4170	6151	8918575	SO:0001819	synonymous_variant	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29871C>T	19.37:g.9057575G>A			8918575	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF616	90317	broad.mit.edu	37	19	52620088	52620088	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr19:52620088T>G	ENST00000600228.1	-	4	590	c.329A>C	c.(328-330)gAa>gCa	p.E110A	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	110					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E110A(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		CACTGGCACTTCTTTATCATT	0.338																																					p.E110A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A329C	19						.						200.0	181.0	187.0					19																	52620088		2202	4300	6502	57311900	SO:0001583	missense	90317	exon4			AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.329A>C	19.37:g.52620088T>G	ENSP00000471000:p.Glu110Ala		57311900	NM_178523	B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	ENST00000600228.1	37	CCDS33090.1	.	.	.	.	.	.	.	.	.	.	T	5.671	0.308367	0.10733	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.64	-3.27	0.05048	.	.	.	.	.	T	0.13157	0.0319	N	0.12182	0.205	0.09310	N	1	B	0.29627	0.252	B	0.20955	0.032	T	0.24657	-1.0154	8	0.12103	T	0.63	.	3.6519	0.08206	0.0:0.3078:0.2037:0.4885	.	110	Q08AN1	ZN616_HUMAN	A	110	.	ENSP00000328722:E110A	E	-	2	0	ZNF616	57311900	0.000000	0.05858	0.000000	0.03702	0.376000	0.30014	-1.556000	0.02168	-1.454000	0.01926	0.254000	0.18369	GAA		0.338	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1	XM_030892	
CASZ1	54897	broad.mit.edu	37	1	10725391	10725391	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:10725391C>T	ENST00000377022.3	-	5	571	c.254G>A	c.(253-255)cGg>cAg	p.R85Q	CASZ1_ENST00000344008.5_Missense_Mutation_p.R85Q|CASZ1_ENST00000478728.2_5'UTR	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	85					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R85Q(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GATCACTGCCCGTCTCTTGTC	0.706																																					p.R85Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G254A	1						.						58.0	71.0	67.0					1																	10725391		2178	4263	6441	10647978	SO:0001583	missense	54897	exon5			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.254G>A	1.37:g.10725391C>T	ENSP00000366221:p.Arg85Gln		10647978	NM_001079843	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802122	0.90538	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	4.42	4.42	0.53409	.	0.000000	0.64402	D	0.000010	T	0.66819	0.2828	L	0.29908	0.895	0.42190	D	0.991725	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.996;0.996;0.99	T	0.72640	-0.4232	9	0.87932	D	0	-16.159	17.4322	0.87542	0.0:1.0:0.0:0.0	.	109;85;85	B7Z1S3;Q86V15-2;Q86V15	.;.;CASZ1_HUMAN	Q	85	.	ENSP00000339445:R85Q	R	-	2	0	CASZ1	10647978	1.000000	0.71417	0.997000	0.53966	0.423000	0.31445	5.481000	0.66826	2.191000	0.70037	0.511000	0.50034	CGG		0.706	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
CELSR2	1952	broad.mit.edu	37	1	109814030	109814030	+	Missense_Mutation	SNP	G	G	A	rs372871589		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:109814030G>A	ENST00000271332.3	+	27	7760	c.7699G>A	c.(7699-7701)Gcc>Acc	p.A2567T	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2567					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.A2567T(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GCCCTCCTTCGCCGTCCTCCT	0.637																																					p.A2567T	NSCLC(158;1285 2011 34800 34852 42084)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7699A	1						.	G	THR/ALA	1,4403	2.1+/-5.4	0,1,2201	86.0	75.0	79.0		7699	1.7	0.3	1		79	0,8600		0,0,4300	no	missense	CELSR2	NM_001408.2	58	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	benign	2567/2924	109814030	1,13003	2202	4300	6502	109615553	SO:0001583	missense	1952	exon27			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7699G>A	1.37:g.109814030G>A	ENSP00000271332:p.Ala2567Thr		109615553	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	G	9.908	1.208665	0.22205	2.27E-4	0.0	ENSG00000143126	ENST00000271332	T	0.44881	0.91	4.59	1.66	0.24008	GPCR, family 2-like (1);	.	.	.	.	T	0.09730	0.0239	N	0.16233	0.39	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.34900	-0.9810	9	0.33940	T	0.23	.	7.7304	0.28783	0.2741:0.0:0.7259:0.0	.	2567	Q9HCU4	CELR2_HUMAN	T	2567	ENSP00000271332:A2567T	ENSP00000271332:A2567T	A	+	1	0	CELSR2	109615553	0.000000	0.05858	0.277000	0.24703	0.523000	0.34469	0.215000	0.17562	0.172000	0.19760	-0.291000	0.09656	GCC		0.637	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
NRAS	4893	broad.mit.edu	37	1	115258747	115258747	+	Missense_Mutation	SNP	C	C	T	rs121913237		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:115258747C>T	ENST00000369535.4	-	2	288	c.35G>A	c.(34-36)gGt>gAt	p.G12D	CSDE1_ENST00000483407.1_5'Flank	NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	12			G -> C (in leukemia). {ECO:0000269|PubMed:2998510}.|G -> D (in KNEN). {ECO:0000269|PubMed:22499344}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(375)|p.G12V(59)|p.G12A(42)|p.G12N(2)|p.G12E(1)|p.G12P(1)|p.G12Y(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCCAACACCACCTGCTCCAAC	0.493	G12D(697_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC151_ENDOMETRIUM)|G12D(KE37_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(THP1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(TYKNU_OVARY)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.G12D			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	481	Substitution - Missense(481)	haematopoietic_and_lymphoid_tissue(375)|skin(59)|large_intestine(21)|testis(5)|thyroid(4)|central_nervous_system(3)|endometrium(3)|biliary_tract(3)|ovary(3)|soft_tissue(2)|lung(2)|prostate(1)	c.G35A	1						.	C	ASP/GLY	0,4406		0,0,2203	206.0	184.0	191.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	35	5.6	1.0	1	dbSNP_133	191	1,8599	1.2+/-3.3	0,1,4299	no	missense	NRAS	NM_002524.4	94	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	12/190	115258747	1,13005	2203	4300	6503	115060270	SO:0001583	missense	4893	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.35G>A	1.37:g.115258747C>T	ENSP00000358548:p.Gly12Asp		115060270	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	C	35	5.524414	0.96431	0.0	1.16E-4	ENSG00000213281	ENST00000369535	T	0.78595	-1.19	5.58	5.58	0.84498	Small GTP-binding protein domain (1);	0.000000	0.56097	U	0.000025	D	0.85252	0.5654	M	0.92604	3.325	0.80722	D	1	B	0.32467	0.372	B	0.42827	0.399	D	0.86173	0.1601	10	0.87932	D	0	.	19.3769	0.94514	0.0:1.0:0.0:0.0	.	12	P01111	RASN_HUMAN	D	12	ENSP00000358548:G12D	ENSP00000358548:G12D	G	-	2	0	NRAS	115060270	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.906000	0.99361	0.655000	0.94253	GGT		0.493	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
TNR	7143	broad.mit.edu	37	1	175335259	175335259	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:175335259C>T	ENST00000367674.2	-	11	2777	c.2069G>A	c.(2068-2070)cGa>cAa	p.R690Q	TNR_ENST00000263525.2_Missense_Mutation_p.R690Q			Q92752	TENR_HUMAN	tenascin R	690	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)		p.R690Q(1)		NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CATGAGGTCTCGGGGACTGTC	0.512																																					p.R690Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2069A	1						.						103.0	77.0	86.0					1																	175335259		2203	4300	6503	173601882	SO:0001583	missense	7143	exon11			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2069G>A	1.37:g.175335259C>T	ENSP00000356646:p.Arg690Gln		173601882	NM_003285	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243086	0.39697	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.57273	0.41;0.41	5.92	5.0	0.66597	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.155756	0.44097	D	0.000494	T	0.32224	0.0822	L	0.31207	0.915	0.09310	N	1	P	0.51537	0.946	B	0.36418	0.224	T	0.19484	-1.0304	10	0.26408	T	0.33	.	7.3592	0.26737	0.0:0.7127:0.1401:0.1472	.	690	Q92752	TENR_HUMAN	Q	690	ENSP00000356646:R690Q;ENSP00000263525:R690Q	ENSP00000263525:R690Q	R	-	2	0	TNR	173601882	0.299000	0.24426	0.967000	0.41034	0.998000	0.95712	1.423000	0.34837	1.496000	0.48567	0.555000	0.69702	CGA		0.512	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
ZC3H11A	9877	broad.mit.edu	37	1	203821381	203821381	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:203821381G>A	ENST00000545588.1	+	17	6114	c.2287G>A	c.(2287-2289)Gga>Aga	p.G763R	ZC3H11A_ENST00000367210.1_Missense_Mutation_p.G763R|ZC3H11A_ENST00000367212.3_Missense_Mutation_p.G763R|ZC3H11A_ENST00000332127.4_Missense_Mutation_p.G763R|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.G763R	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	763					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.G763R(1)		central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGCCTCAACAGGAAAGCCCCC	0.512																																					p.G763R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2287A	1						.						34.0	37.0	36.0					1																	203821381		2202	4296	6498	202088004	SO:0001583	missense	9877	exon20				CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.2287G>A	1.37:g.203821381G>A	ENSP00000438527:p.Gly763Arg		202088004	NM_014827	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	ENST00000545588.1	37	CCDS30978.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.734856	0.30774	.	.	ENSG00000058673	ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.56	5.56	0.83823	.	0.170615	0.52532	D	0.000080	T	0.53965	0.1829	M	0.72894	2.215	0.46011	D	0.998812	P	0.47762	0.9	P	0.53593	0.73	T	0.46735	-0.9170	10	0.17832	T	0.49	-19.7612	14.5789	0.68271	0.0:0.147:0.8529:0.0	.	763	O75152	ZC11A_HUMAN	R	763;709;763;763;763;763	ENSP00000356183:G763R;ENSP00000356181:G763R;ENSP00000333253:G763R;ENSP00000438527:G763R;ENSP00000356179:G763R	ENSP00000333253:G763R	G	+	1	0	ZC3H11A	202088004	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	3.976000	0.56867	2.619000	0.88677	0.557000	0.71058	GGA		0.512	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087471.3	NM_014827	
PARK7	11315	broad.mit.edu	37	1	8045030	8045030	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:8045030C>T	ENST00000493678.1	+	7	553	c.486C>T	c.(484-486)ttC>ttT	p.F162F	PARK7_ENST00000377491.1_Silent_p.F162F|Y_RNA_ENST00000363474.1_RNA|PARK7_ENST00000377493.5_Silent_p.F142F|PARK7_ENST00000377488.1_Silent_p.F162F|PARK7_ENST00000338639.5_Silent_p.F162F			Q99497	PARK7_HUMAN	parkinson protein 7	162					adult locomotory behavior (GO:0008344)|autophagy (GO:0006914)|cellular response to glyoxal (GO:0036471)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to oxidative stress (GO:0034599)|dopamine uptake involved in synaptic transmission (GO:0051583)|glycolate biosynthetic process (GO:0046295)|glyoxal catabolic process (GO:1903190)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|lactate biosynthetic process (GO:0019249)|membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|methylglyoxal catabolic process to D-lactate (GO:0019243)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell death (GO:0060548)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of death-inducing signaling complex assembly (GO:1903073)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of hydrogen peroxide-induced neuron death (GO:1903208)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein acetylation (GO:1901984)|negative regulation of protein binding (GO:0032091)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of protein K48-linked deubiquitination (GO:1903094)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of TRAIL-activated apoptotic signaling pathway (GO:1903122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|negative regulation of ubiquitin-specific protease activity (GO:2000157)|positive regulation of androgen receptor activity (GO:2000825)|positive regulation of dopamine biosynthetic process (GO:1903181)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of L-dopa biosynthetic process (GO:1903197)|positive regulation of L-dopa decarboxylase activity (GO:1903200)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of oxidative phosphorylation uncoupler activity (GO:2000277)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of pyrroline-5-carboxylate reductase activity (GO:1903168)|positive regulation of superoxide dismutase activity (GO:1901671)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine 3-monooxygenase activity (GO:1903178)|protein stabilization (GO:0050821)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of fibril organization (GO:1902903)|regulation of inflammatory response (GO:0050727)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of neuron apoptotic process (GO:0043523)|single fertilization (GO:0007338)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|cupric ion binding (GO:1903135)|cuprous ion binding (GO:1903136)|cytokine binding (GO:0019955)|enzyme binding (GO:0019899)|glyoxalase (glycolic acid-forming) activity (GO:1990422)|glyoxalase III activity (GO:0019172)|identical protein binding (GO:0042802)|L-dopa decarboxylase activator activity (GO:0036478)|mRNA binding (GO:0003729)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|peptidase activity (GO:0008233)|peroxidase activity (GO:0004601)|peroxiredoxin activity (GO:0051920)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|repressing transcription factor binding (GO:0070491)|RNA binding (GO:0003723)|scaffold protein binding (GO:0097110)|small protein activating enzyme binding (GO:0044388)|small protein conjugating enzyme binding (GO:0044390)|superoxide dismutase copper chaperone activity (GO:0016532)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|tyrosine 3-monooxygenase activator activity (GO:0036470)|ubiquitin-specific protease binding (GO:1990381)	p.F162F(1)		large_intestine(1)	1	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;1.28e-70)|GBM - Glioblastoma multiforme(8;3.05e-36)|Colorectal(212;6.83e-08)|COAD - Colon adenocarcinoma(227;7.51e-06)|Kidney(185;5.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000414)|KIRC - Kidney renal clear cell carcinoma(229;0.000967)|STAD - Stomach adenocarcinoma(132;0.00102)|READ - Rectum adenocarcinoma(331;0.0649)		GGACCAGCTTCGAGTTTGCGC	0.507																																					p.F162F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C486T	1						.						103.0	106.0	105.0					1																	8045030		2203	4300	6503	7967617	SO:0001819	synonymous_variant	11315	exon7			D61380	CCDS93.1	1p36.23	2014-04-11	2011-07-21		ENSG00000116288	ENSG00000116288		"""Parkinson disease"""	16369	protein-coding gene	gene with protein product			"""Parkinson disease (autosomal recessive, early onset) 7"""			11462174, 9070310	Standard	NM_007262		Approved	DJ-1, DJ1	uc001aox.4	Q99497	OTTHUMG00000001210	ENST00000493678.1:c.486C>T	1.37:g.8045030C>T			7967617	NM_007262	B2R4Z1|O14805|Q6DR95|Q7LFU2	Silent	SNP	ENST00000493678.1	37	CCDS93.1																																																																																				0.507	PARK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003577.1	NM_007262	
MAP7D1	55700	broad.mit.edu	37	1	36636771	36636771	+	Silent	SNP	G	G	A	rs200123517		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:36636771G>A	ENST00000373151.2	+	2	462	c.246G>A	c.(244-246)ccG>ccA	p.P82P	MAP7D1_ENST00000373150.4_Silent_p.P82P|MAP7D1_ENST00000316156.4_Silent_p.P82P	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	82	Pro-rich.				microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)		p.P82P(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				CAGCCCCCCCGCAGGAAGAGT	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		13390	0.0		0.001	False		,,,				2504	0.0				p.P82P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G246A	1						.	G		0,4406		0,0,2203	39.0	42.0	41.0		246	-4.1	0.0	1		41	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MAP7D1	NM_018067.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		82/842	36636771	1,13005	2203	4300	6503	36409358	SO:0001819	synonymous_variant	55700	exon2			AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.246G>A	1.37:g.36636771G>A			36409358	NM_018067	D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Silent	SNP	ENST00000373151.2	37	CCDS30673.1																																																																																				0.647	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382095.1	NM_018067	
GUCA2B	2981	broad.mit.edu	37	1	42620364	42620364	+	Missense_Mutation	SNP	G	G	A	rs538392274		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:42620364G>A	ENST00000372581.1	+	2	134	c.104G>A	c.(103-105)cGg>cAg	p.R35Q		NM_007102.2	NP_009033.1	Q16661	GUC2B_HUMAN	guanylate cyclase activator 2B (uroguanylin)	35					body fluid secretion (GO:0007589)|cGMP biosynthetic process (GO:0006182)|excretion (GO:0007588)|negative regulation of blood pressure (GO:0045776)|positive regulation of guanylate cyclase activity (GO:0031284)	extracellular vesicular exosome (GO:0070062)	calcium sensitive guanylate cyclase activator activity (GO:0008048)	p.R35Q(1)		breast(1)|large_intestine(2)	3	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CAAGGCTTCCGGGTCCAGCTG	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		17363	0.001		0.0	False		,,,				2504	0.0				p.R35Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G104A	1						.						47.0	48.0	48.0					1																	42620364		2203	4300	6503	42392951	SO:0001583	missense	2981	exon2			BC069301	CCDS464.1	1p34-p33	2014-01-30			ENSG00000044012	ENSG00000044012		"""Endogenous ligands"""	4683	protein-coding gene	gene with protein product	"""prepro-uroguanylin"""	601271				8605041, 9268639	Standard	NM_007102		Approved		uc001chc.1	Q16661	OTTHUMG00000007024	ENST00000372581.1:c.104G>A	1.37:g.42620364G>A	ENSP00000361662:p.Arg35Gln		42392951	NM_007102	Q52LV0	Missense_Mutation	SNP	ENST00000372581.1	37	CCDS464.1	.	.	.	.	.	.	.	.	.	.	G	1.933	-0.445370	0.04604	.	.	ENSG00000044012	ENST00000372581	T	0.40225	1.04	5.24	-1.13	0.09775	.	0.995270	0.08157	N	0.989177	T	0.11707	0.0285	N	0.00642	-1.3	0.20563	N	0.999888	B	0.11235	0.004	B	0.04013	0.001	T	0.30621	-0.9972	10	0.05959	T	0.93	-9.14	8.9018	0.35499	0.5561:0.0:0.4439:0.0	.	35	Q16661	GUC2B_HUMAN	Q	35	ENSP00000361662:R35Q	ENSP00000361662:R35Q	R	+	2	0	GUCA2B	42392951	0.995000	0.38212	0.968000	0.41197	0.546000	0.35178	0.126000	0.15769	-0.494000	0.06669	-0.409000	0.06214	CGG		0.637	GUCA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000018307.1	NM_007102	
RNF220	55182	broad.mit.edu	37	1	45101824	45101824	+	Silent	SNP	T	T	C			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:45101824T>C	ENST00000355387.2	+	8	1566	c.1116T>C	c.(1114-1116)ggT>ggC	p.G372G	RNF220_ENST00000361799.2_Silent_p.G372G|TMEM53_ENST00000372243.3_3'UTR|RNF220_ENST00000443020.2_Silent_p.G159G|TMEM53_ENST00000372242.3_3'UTR|RNF220_ENST00000372247.2_Silent_p.G372G|TMEM53_ENST00000372244.3_3'UTR			Q5VTB9	RN220_HUMAN	ring finger protein 220	372					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G372G(2)		endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						TCCTGGAAGGTGGCTTCCGAG	0.567																																					p.G372G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1116C	1						.						128.0	116.0	120.0					1																	45101824		2203	4300	6503	44874411	SO:0001819	synonymous_variant	55182	exon8			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.1116T>C	1.37:g.45101824T>C			44874411	NM_018150	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Silent	SNP	ENST00000355387.2	37	CCDS510.1																																																																																				0.567	RNF220-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020683.4	NM_018150	
ROR1	4919	broad.mit.edu	37	1	64643639	64643639	+	Missense_Mutation	SNP	G	G	A	rs549316569		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:64643639G>A	ENST00000371079.1	+	9	2290	c.1915G>A	c.(1915-1917)Gaa>Aaa	p.E639K	ROR1_ENST00000545203.1_Missense_Mutation_p.E90K	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	639	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)	p.E639K(1)		breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						GCTTTCCAGAGAAATTTACTC	0.463																																					p.E639K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1915A	1						.						59.0	63.0	62.0					1																	64643639		2203	4300	6503	64416227	SO:0001583	missense	4919	exon9			M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.1915G>A	1.37:g.64643639G>A	ENSP00000360120:p.Glu639Lys		64416227	NM_005012	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673107	0.47781	.	.	ENSG00000185483	ENST00000371079;ENST00000544776;ENST00000545203	D;D	0.82433	-1.61;-1.61	5.97	4.11	0.48088	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43919	D	0.000505	T	0.56688	0.2002	N	0.05534	-0.03	0.54753	D	0.999983	B	0.34290	0.447	B	0.38500	0.275	T	0.60747	-0.7202	10	0.37606	T	0.19	.	12.6651	0.56837	0.1331:0.0:0.8669:0.0	.	639	Q01973	ROR1_HUMAN	K	639;642;90	ENSP00000360120:E639K;ENSP00000441637:E90K	ENSP00000360120:E639K	E	+	1	0	ROR1	64416227	1.000000	0.71417	0.925000	0.36789	0.906000	0.53458	6.843000	0.75384	0.864000	0.35578	-0.150000	0.13652	GAA		0.463	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
OR2T6	254879	broad.mit.edu	37	1	248551598	248551598	+	Missense_Mutation	SNP	C	C	T	rs61736247	byFrequency	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr1:248551598C>T	ENST00000355728.2	+	1	689	c.689C>T	c.(688-690)tCg>tTg	p.S230L		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S230L(1)		endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAGATGACATCGGCTGAAGGG	0.512													c|||	15	0.00299521	0.0098	0.0029	5008	,	,		23416	0.0		0.0	False		,,,				2504	0.0				p.S230L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C689T	1						.	C	LEU/SER	38,4368	43.1+/-76.7	0,38,2165	281.0	225.0	244.0		689	3.1	0.0	1	dbSNP_129	244	2,8598	2.2+/-6.3	0,2,4298	yes	missense	OR2T6	NM_001005471.1	145	0,40,6463	TT,TC,CC		0.0233,0.8625,0.3076	probably-damaging	230/309	248551598	40,12966	2203	4300	6503	246618221	SO:0001583	missense	254879	exon1			AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.689C>T	1.37:g.248551598C>T	ENSP00000347965:p.Ser230Leu		246618221	NM_001005471	A6NE36	Missense_Mutation	SNP	ENST00000355728.2	37	CCDS31114.1	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	C	11.29	1.593998	0.28445	0.008625	2.33E-4	ENSG00000198104	ENST00000355728	T	0.00330	8.08	4.02	3.08	0.35506	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38111	N	0.001807	T	0.00412	0.0013	M	0.92784	3.345	0.09310	N	1	P	0.51653	0.947	P	0.44696	0.458	T	0.31475	-0.9942	10	0.87932	D	0	.	12.8013	0.57588	0.1654:0.8345:0.0:0.0	rs61736247	230	Q8NHC8	OR2T6_HUMAN	L	230	ENSP00000347965:S230L	ENSP00000347965:S230L	S	+	2	0	OR2T6	246618221	0.002000	0.14202	0.003000	0.11579	0.005000	0.04900	1.573000	0.36472	0.997000	0.38969	0.643000	0.83706	TCG		0.512	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471	
PLCG1	5335	broad.mit.edu	37	20	39791294	39791294	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr20:39791294C>T	ENST00000373271.1	+	6	1015	c.610C>T	c.(610-612)Cgc>Tgc	p.R204C	PLCG1_ENST00000244007.3_Missense_Mutation_p.R204C|PLCG1_ENST00000373272.2_Missense_Mutation_p.R204C	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	204					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)	p.R204C(1)		breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				CCTGGAGCAGCGCAGCGGGGA	0.627																																					p.R204C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C610T	20						.						57.0	43.0	48.0					20																	39791294		2203	4300	6503	39224708	SO:0001583	missense	5335	exon6			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.610C>T	20.37:g.39791294C>T	ENSP00000362368:p.Arg204Cys		39224708	NM_002660	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	ENST00000373271.1	37	CCDS13314.1	.	.	.	.	.	.	.	.	.	.	C	19.63	3.863714	0.71949	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.44083	0.93;0.93;0.93	5.09	5.09	0.68999	EF-hand-like domain (1);	0.222920	0.41294	D	0.000919	T	0.57198	0.2037	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.66351	0.917;0.943	T	0.60161	-0.7317	10	0.87932	D	0	.	11.8087	0.52171	0.3012:0.6988:0.0:0.0	.	204;204	P19174;A2A284	PLCG1_HUMAN;.	C	204	ENSP00000244007:R204C;ENSP00000362368:R204C;ENSP00000362369:R204C	ENSP00000244007:R204C	R	+	1	0	PLCG1	39224708	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.050000	0.71063	2.376000	0.81061	0.561000	0.74099	CGC		0.627	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3	NM_182811	
MYBL2	4605	broad.mit.edu	37	20	42343849	42343849	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr20:42343849G>A	ENST00000217026.4	+	13	2027	c.1900G>A	c.(1900-1902)Ggc>Agc	p.G634S	MYBL2_ENST00000396863.4_Missense_Mutation_p.G610S	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	634					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G634S(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GCTCAACCAGGGCTTCTTGCA	0.577																																					p.G634S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1900A	20						.						170.0	175.0	174.0					20																	42343849		2203	4300	6503	41777263	SO:0001583	missense	4605	exon13				CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1900G>A	20.37:g.42343849G>A	ENSP00000217026:p.Gly634Ser		41777263	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	ENST00000217026.4	37	CCDS13322.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010672	0.75046	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.13778	2.56;2.57	4.29	4.29	0.51040	.	0.123947	0.53938	D	0.000058	T	0.16938	0.0407	L	0.42245	1.32	0.58432	D	0.999993	P;P	0.48089	0.905;0.748	P;B	0.48189	0.57;0.355	T	0.04029	-1.0983	10	0.21014	T	0.42	-29.6975	14.0517	0.64742	0.0:0.0:1.0:0.0	.	610;634	F8W6N6;P10244	.;MYBB_HUMAN	S	610;634	ENSP00000380072:G610S;ENSP00000217026:G634S	ENSP00000217026:G634S	G	+	1	0	MYBL2	41777263	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.446000	0.73460	2.114000	0.64651	0.491000	0.48974	GGC		0.577	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
SLC17A9	63910	broad.mit.edu	37	20	61595009	61595009	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr20:61595009G>A	ENST00000370351.4	+	7	930	c.799G>A	c.(799-801)Gag>Aag	p.E267K	SLC17A9_ENST00000488738.1_3'UTR|SLC17A9_ENST00000370349.3_Missense_Mutation_p.E261K	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	267					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.E267K(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						CACCTTCTTCGAGGAGACCTT	0.667																																					p.E267K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G799A	20						.						45.0	49.0	47.0					20																	61595009		2121	4229	6350	61065454	SO:0001583	missense	63910	exon7			AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.799G>A	20.37:g.61595009G>A	ENSP00000359376:p.Glu267Lys		61065454	NM_022082	B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Missense_Mutation	SNP	ENST00000370351.4	37	CCDS42901.1	.	.	.	.	.	.	.	.	.	.	G	2.976	-0.211340	0.06140	.	.	ENSG00000101194	ENST00000370351;ENST00000370349	T;T	0.57752	0.38;0.38	4.86	-2.28	0.06826	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.269329	0.40554	N	0.001074	T	0.11410	0.0278	N	0.00313	-1.665	0.20196	N	0.999922	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40608	-0.9554	10	0.02654	T	1	.	6.7596	0.23532	0.4563:0.4007:0.1429:0.0	.	287;267;261	B4DPU8;Q9BYT1;Q9BYT1-2	.;S17A9_HUMAN;.	K	267;261	ENSP00000359376:E267K;ENSP00000359374:E261K	ENSP00000359374:E261K	E	+	1	0	SLC17A9	61065454	1.000000	0.71417	0.793000	0.32043	0.487000	0.33371	2.233000	0.43027	-0.371000	0.08004	-0.959000	0.02639	GAG		0.667	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080100.1	NM_022082	
IL10RB	3588	broad.mit.edu	37	21	34640817	34640817	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr21:34640817C>T	ENST00000290200.2	+	2	276	c.168C>T	c.(166-168)taC>taT	p.Y56Y	AP000295.9_ENST00000433395.2_Missense_Mutation_p.T184I|IL10RB-AS1_ENST00000411998.1_RNA	NM_000628.4	NP_000619.3	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta	56	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.Y56Y(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	14						CAGCTCAGTACCTAAGGTGGG	0.527																																					p.Y56Y	Melanoma(67;315 1275 21667 21943 44564)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C168T	21						.						88.0	79.0	82.0					21																	34640817		2203	4300	6503	33562687	SO:0001819	synonymous_variant	3588	exon2			U08988	CCDS13623.1	21q22.11	2014-09-17			ENSG00000243646	ENSG00000243646		"""Interleukins and interleukin receptors"", ""CD molecules"""	5965	protein-coding gene	gene with protein product		123889		CRFB4, D21S58, D21S66		8314576, 9312047	Standard	NM_000628		Approved	CRF2-4, CDW210B, IL-10R2		Q08334	OTTHUMG00000065128	ENST00000290200.2:c.168C>T	21.37:g.34640817C>T			33562687	NM_000628	Q9BUU4	Silent	SNP	ENST00000290200.2	37	CCDS13623.1	.	.	.	.	.	.	.	.	.	.	C	6.890	0.533626	0.13188	.	.	ENSG00000249624	ENST00000433395	.	.	.	5.35	-2.24	0.06909	.	.	.	.	.	T	0.22360	0.0539	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32268	-0.9913	4	.	.	.	-3.7632	5.1008	0.14759	0.0:0.3203:0.2133:0.4664	.	.	.	.	I	184	.	.	T	+	2	0	AP000295.9	33562687	0.000000	0.05858	0.062000	0.19696	0.259000	0.26198	0.031000	0.13710	0.014000	0.14944	-0.136000	0.14681	ACC		0.527	IL10RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139831.3		
CLTCL1	8218	broad.mit.edu	37	22	19167743	19167743	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr22:19167743C>T	ENST00000263200.10	-	32	4984	c.4912G>A	c.(4912-4914)Ggg>Agg	p.G1638R	SLC25A1_ENST00000461267.1_5'Flank|SLC25A1_ENST00000215882.5_5'Flank|SLC25A1_ENST00000451283.1_5'Flank|CLTCL1_ENST00000427926.1_Missense_Mutation_p.G1638R|CLTCL1_ENST00000353891.5_Missense_Mutation_p.G1581R|CLTCL1_ENST00000442042.2_5'UTR	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1638	Heavy chain arm.|Proximal segment.|Trimerization. {ECO:0000250}.			RKQEEHVTEPAPLVFDFDGHE -> PPSKRSM (in Ref. 3; AAB40908/AAB40909). {ECO:0000305}.	anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)	p.G1638R(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					CATTCATGCCCATCAAAATCT	0.532			T	?	ALCL						OREG0026296	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G1581R			Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4741A	22						.						77.0	87.0	84.0					22																	19167743		2033	4189	6222	17547743	SO:0001583	missense	8218	exon31				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.4912G>A	22.37:g.19167743C>T	ENSP00000445677:p.Gly1638Arg	731	17547743	NM_001835	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.910490	0.52439	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.13420	2.59;2.73;2.73	3.99	3.99	0.46301	.	0.294803	0.25807	N	0.028165	T	0.13713	0.0332	N	0.08118	0	0.28187	N	0.927914	D;D;D	0.60160	0.979;0.987;0.964	P;P;P	0.56865	0.747;0.808;0.562	T	0.03863	-1.0997	10	0.72032	D	0.01	-16.1769	11.4565	0.50185	0.0:1.0:0.0:0.0	.	1581;367;1638	P53675-2;B7Z1Z7;P53675	.;.;CLH2_HUMAN	R	1581;1638;1638	ENSP00000439662:G1581R;ENSP00000445677:G1638R;ENSP00000441158:G1638R	ENSP00000445677:G1638R	G	-	1	0	CLTCL1	17547743	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.511000	0.35801	2.057000	0.61298	0.561000	0.74099	GGG		0.532	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
SREBF2	6721	broad.mit.edu	37	22	42273418	42273418	+	Silent	SNP	C	C	T	rs199689929		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr22:42273418C>T	ENST00000361204.4	+	8	1738	c.1572C>T	c.(1570-1572)ttC>ttT	p.F524F		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	524					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F524F(1)		NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						TCCTGTCATTCGAGTCAGGTA	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		17239	0.0		0.001	False		,,,				2504	0.0				p.F524F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1572T	22						.						57.0	52.0	54.0					22																	42273418		2203	4300	6503	40603364	SO:0001819	synonymous_variant	6721	exon8			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1572C>T	22.37:g.42273418C>T			40603364	NM_004599	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Silent	SNP	ENST00000361204.4	37	CCDS14023.1																																																																																				0.617	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
TTN	7273	broad.mit.edu	37	2	179435333	179435333	+	Missense_Mutation	SNP	G	G	A	rs368339903		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr2:179435333G>A	ENST00000591111.1	-	276	70827	c.70603C>T	c.(70603-70605)Cgt>Tgt	p.R23535C	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R16236C|TTN_ENST00000460472.2_Missense_Mutation_p.R16111C|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R16303C|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R22608C|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R25176C			Q8WZ42	TITIN_HUMAN	titin	23535	Ig-like 119.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R16111C(1)|p.R22606C(1)|p.R16303C(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTCGACACGTACTGCATCT	0.438																																					p.Y16110Y												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C48330T	2						.	G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,3871		0,1,1935	120.0	110.0	113.0		48331,67822,48706,48907	4.7	0.2	2		113	0,8274		0,0,4137	no	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	180,180,180,180	0,1,6072	AA,AG,GG		0.0,0.0258,0.0082	probably-damaging,probably-damaging,probably-damaging,probably-damaging	16111/26927,22608/33424,16236/27052,16303/27119	179435333	1,12145	1936	4137	6073	179143579	SO:0001583	missense	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70603C>T	2.37:g.179435333G>A	ENSP00000465570:p.Arg23535Cys		179143579	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	10.31	1.314076	0.23908	2.58E-4	0.0	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.57	4.69	0.59074	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75838	0.3904	H	0.96861	3.895	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.84898	0.0840	9	0.87932	D	0	.	14.8728	0.70471	0.0:0.0:0.7271:0.2729	.	16111;16236;16303;23535	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	C	22608;16111;16303;16236;16109	ENSP00000343764:R22608C;ENSP00000434586:R16111C;ENSP00000340554:R16303C;ENSP00000352154:R16236C	ENSP00000340554:R16303C	R	-	1	0	TTN	179143579	1.000000	0.71417	0.194000	0.23346	0.755000	0.42902	5.465000	0.66725	1.454000	0.47793	0.650000	0.86243	CGT		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FN1	2335	broad.mit.edu	37	2	216240361	216240361	+	Missense_Mutation	SNP	C	C	T	rs573992192		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr2:216240361C>T	ENST00000359671.1	-	36	5960	c.5695G>A	c.(5695-5697)Gcc>Acc	p.A1899T	FN1_ENST00000446046.1_Missense_Mutation_p.A1899T|FN1_ENST00000356005.4_Missense_Mutation_p.A1809T|FN1_ENST00000443816.1_Missense_Mutation_p.A1809T|FN1_ENST00000354785.4_Missense_Mutation_p.A1990T|FN1_ENST00000323926.6_Missense_Mutation_p.A1990T|FN1_ENST00000336916.4_Missense_Mutation_p.A1899T|FN1_ENST00000432072.2_Missense_Mutation_p.A1900T|FN1_ENST00000346544.3_Missense_Mutation_p.A1899T|FN1_ENST00000357009.2_Missense_Mutation_p.A1899T|FN1_ENST00000345488.5_Missense_Mutation_p.A1899T|FN1_ENST00000421182.1_Missense_Mutation_p.A1809T|FN1_ENST00000357867.4_Missense_Mutation_p.A1809T			P02751	FINC_HUMAN	fibronectin 1	1899	Binds to FBLN1.|Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Heparin-binding 2.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.A1899T(2)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CCAGTGGAGGCGTCGATGACC	0.433													C|||	1	0.000199681	0.0	0.0	5008	,	,		17936	0.001		0.0	False		,,,				2504	0.0				p.A1809T												.	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.G5425A	2						.						104.0	103.0	103.0					2																	216240361		2203	4300	6503	215948606	SO:0001583	missense	2335	exon35				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.5695G>A	2.37:g.216240361C>T	ENSP00000352696:p.Ala1899Thr		215948606	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	C	15.25	2.778447	0.49786	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923;ENST00000438981	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;1.97	5.68	5.68	0.88126	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.197714	0.35378	N	0.003251	T	0.70090	0.3184	L	0.58669	1.825	0.23896	N	0.996539	D;D;D;D;D;D;P;D;D;D;D;D	0.89917	1.0;0.999;0.987;0.989;1.0;0.998;0.794;1.0;1.0;1.0;1.0;0.998	D;P;P;P;D;P;B;D;D;D;D;P	0.83275	0.993;0.86;0.499;0.503;0.993;0.729;0.174;0.984;0.993;0.993;0.996;0.729	T	0.61922	-0.6963	10	0.30078	T	0.28	.	19.7939	0.96471	0.0:1.0:0.0:0.0	.	1899;1900;1990;1809;1809;1899;1899;1900;1809;1809;1990;1899	F8W7G7;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15;P02751	.;.;.;.;.;.;.;.;.;.;.;FINC_HUMAN	T	1809;1990;1899;1809;1990;1900;1899;1899;1899;1899;1899;1809;1900;1809;616;18	ENSP00000394423:A1809T;ENSP00000323534:A1990T;ENSP00000338200:A1899T;ENSP00000350534:A1809T;ENSP00000346839:A1990T;ENSP00000352696:A1899T;ENSP00000265312:A1899T;ENSP00000273049:A1899T;ENSP00000349509:A1899T;ENSP00000410422:A1899T;ENSP00000415018:A1809T;ENSP00000399538:A1900T;ENSP00000348285:A1809T;ENSP00000416139:A616T;ENSP00000392565:A18T	ENSP00000265313:A1900T	A	-	1	0	FN1	215948606	0.998000	0.40836	0.992000	0.48379	0.904000	0.53231	3.749000	0.55150	2.668000	0.90789	0.563000	0.77884	GCC		0.433	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
COL4A4	1286	broad.mit.edu	37	2	227924263	227924263	+	Silent	SNP	G	G	A	rs374510402	byFrequency	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr2:227924263G>A	ENST00000396625.3	-	28	2448	c.2241C>T	c.(2239-2241)ccC>ccT	p.P747P	COL4A4_ENST00000329662.7_Silent_p.P747P	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	747	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.P747P(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CTGGTGAGCCGGGAGGGCCTG	0.552													G|||	3	0.000599042	0.0015	0.0	5008	,	,		15345	0.0		0.0	False		,,,				2504	0.001				p.P747P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2241T	2						.	G		1,3663		0,1,1831	65.0	70.0	68.0		2241	-11.8	0.0	2		68	0,8152		0,0,4076	no	coding-synonymous	COL4A4	NM_000092.4		0,1,5907	AA,AG,GG		0.0,0.0273,0.0085		747/1691	227924263	1,11815	1832	4076	5908	227632507	SO:0001819	synonymous_variant	1286	exon28				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2241C>T	2.37:g.227924263G>A			227632507	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	ENST00000396625.3	37	CCDS42828.1																																																																																				0.552	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
SLC16A14	151473	broad.mit.edu	37	2	230911185	230911185	+	Silent	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr2:230911185G>A	ENST00000295190.4	-	4	1115	c.657C>T	c.(655-657)aaC>aaT	p.N219N		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	219						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.N219N(1)		NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		CTCCTGGGTCGTTTGGGTTTT	0.552																																					p.N219N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C657T	2						.						55.0	62.0	59.0					2																	230911185		2203	4300	6503	230619429	SO:0001819	synonymous_variant	151473	exon4			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.657C>T	2.37:g.230911185G>A			230619429	NM_152527	A8KA08|Q53R92|Q96NI7	Silent	SNP	ENST00000295190.4	37	CCDS2473.1																																																																																				0.552	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527	
ALMS1	7840	broad.mit.edu	37	2	73676134	73676134	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr2:73676134A>G	ENST00000264448.6	+	8	2588	c.2477A>G	c.(2476-2478)gAc>gGc	p.D826G	ALMS1_ENST00000377715.1_Missense_Mutation_p.D826G|ALMS1_ENST00000409009.1_Missense_Mutation_p.D784G	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	826	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.D826G(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GCCTTGCTGGACAGCCATCTA	0.532																																					p.D826G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2477G	2						.						84.0	86.0	86.0					2																	73676134		1909	4119	6028	73529642	SO:0001583	missense	7840	exon8			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.2477A>G	2.37:g.73676134A>G	ENSP00000264448:p.Asp826Gly		73529642	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	A	10.56	1.383637	0.25031	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.17054	3.19;3.19;2.3	4.15	1.81	0.25067	.	0.660193	0.12418	N	0.470711	T	0.17789	0.0427	L	0.46157	1.445	0.09310	N	1	P;B;B	0.52316	0.952;0.033;0.035	P;B;B	0.46659	0.523;0.016;0.015	T	0.12477	-1.0546	10	0.72032	D	0.01	.	5.6306	0.17508	0.7822:0.0:0.2178:0.0	.	826;784;826	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	G	784;826;826	ENSP00000386627:D784G;ENSP00000264448:D826G;ENSP00000366944:D826G	ENSP00000264448:D826G	D	+	2	0	ALMS1	73529642	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.611000	0.05622	0.410000	0.25675	0.533000	0.62120	GAC		0.532	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
IQCA1	79781	broad.mit.edu	37	2	237272583	237272583	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr2:237272583G>T	ENST00000409907.3	-	15	1983	c.1709C>A	c.(1708-1710)tCg>tAg	p.S570*	IQCA1_ENST00000431676.2_Nonsense_Mutation_p.S529*|IQCA1_ENST00000309507.5_Nonsense_Mutation_p.S567*	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	570							ATP binding (GO:0005524)	p.S570*(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						TAACAGTAGCGATTTCACCAA	0.498																																					p.S570X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1709A	2						.						105.0	102.0	103.0					2																	237272583		1942	4122	6064	236937322	SO:0001587	stop_gained	79781	exon15			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.1709C>A	2.37:g.237272583G>T	ENSP00000387347:p.Ser570*		236937322	NM_024726	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Nonsense_Mutation	SNP	ENST00000409907.3	37	CCDS46549.1	.	.	.	.	.	.	.	.	.	.	G	38	6.982867	0.97979	.	.	ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676;ENST00000412437	.	.	.	4.77	4.77	0.60923	.	0.219556	0.29100	N	0.013143	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.8107	0.88614	0.0:0.0:1.0:0.0	.	.	.	.	X	570;578;567;529;567	.	ENSP00000254653:S571X	S	-	2	0	IQCA1	236937322	1.000000	0.71417	0.473000	0.27253	0.223000	0.24884	9.611000	0.98342	2.201000	0.70794	0.561000	0.74099	TCG		0.498	IQCA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329266.1	NM_024726	
RHOA	387	broad.mit.edu	37	3	49405884	49405885	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr3:49405884_49405885insA	ENST00000418115.1	-	3	637_638	c.253_254insT	c.(253-255)tccfs	p.S85fs	RHOA_ENST00000454011.2_Intron|RHOA-IT1_ENST00000428083.1_RNA|RHOA_ENST00000422781.1_Frame_Shift_Ins_p.S85fs	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	85					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.S85fs*6(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GCTGTCGATGGAAAAACACATC	0.51																																					p.S85fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.254_255insT	3						.																																			49380889	SO:0001589	frameshift_variant	387	exon3			BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.254dupT	3.37:g.49405889_49405889dupA	ENSP00000400175:p.Ser85fs		49380888	NM_001664	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Frame_Shift_Ins	INS	ENST00000418115.1	37	CCDS2795.1																																																																																				0.510	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
NCKIPSD	51517	broad.mit.edu	37	3	48720447	48720448	+	Splice_Site	INS	-	-	G			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr3:48720447_48720448insG	ENST00000294129.2	-	2	291		c.e2-2		NCKIPSD_ENST00000341520.4_Splice_Site|NCKIPSD_ENST00000416649.2_Splice_Site	NM_016453.2	NP_057537.1	Q9NZQ3	SPN90_HUMAN	NCK interacting protein with SH3 domain						cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|NLS-bearing protein import into nucleus (GO:0006607)|signal transduction (GO:0007165)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	cytoskeletal protein binding (GO:0008092)	p.?(1)		endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTCCAGGCCCTGGGGGGGGCAG	0.619																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	3						.																																			48695452	SO:0001630	splice_region_variant	51517	.			AF178432	CCDS2776.1, CCDS46827.1	3p21	2008-07-18			ENSG00000213672	ENSG00000213672			15486	protein-coding gene	gene with protein product	"""dia interacting protein"", ""diaphanous protein interacting protein"", ""SH3 protein interacting with Nck, 90 kDa"""	606671				10648423, 10619843	Standard	NM_016453		Approved	AF3P21, SPIN90, ORF1, WISH, WASLBP, DIP1	uc003cun.3	Q9NZQ3	OTTHUMG00000133542	ENST00000294129.2:c.172-2->C	3.37:g.48720455_48720455dupG			48695451	.	B4DFL5|Q6GU34|Q6SPF3|Q8TC10|Q9UGM8	Splice_Site	INS	ENST00000294129.2	37	CCDS2776.1																																																																																				0.619	NCKIPSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257520.1	NM_016453	Intron
DCLK3	85443	broad.mit.edu	37	3	36778711	36778711	+	Silent	SNP	C	C	T	rs116865058	byFrequency	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr3:36778711C>T	ENST00000416516.2	-	2	1930	c.1440G>A	c.(1438-1440)ccG>ccA	p.P480P		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	480	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P480P(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						AAAGGTTTTCCGGCTTGAGGT	0.448													C|||	24	0.00479233	0.0	0.0	5008	,	,		20249	0.0218		0.0	False		,,,				2504	0.002				p.P480P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1440A	3						.	C		1,3799		0,1,1899	52.0	50.0	51.0		1440	-10.2	0.3	3	dbSNP_132	51	0,8250		0,0,4125	no	coding-synonymous	DCLK3	NM_033403.1		0,1,6024	TT,TC,CC		0.0,0.0263,0.0083		480/649	36778711	1,12049	1900	4125	6025	36753715	SO:0001819	synonymous_variant	85443	exon2			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1440G>A	3.37:g.36778711C>T			36753715	NM_033403		Silent	SNP	ENST00000416516.2	37	CCDS43064.1																																																																																				0.448	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341727.1	XM_047355	
WDR48	57599	broad.mit.edu	37	3	39104580	39104580	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr3:39104580C>T	ENST00000302313.5	+	2	116	c.88C>T	c.(88-90)Cga>Tga	p.R30*	WDR48_ENST00000544962.1_Intron|WDR48_ENST00000396258.3_5'UTR|WDR48_ENST00000418020.1_5'UTR	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	30					double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)		p.R30*(1)		breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GAAGTACAACCGAAATGGAGT	0.388																																					p.R30X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C88T	3						.						105.0	104.0	104.0					3																	39104580		2203	4300	6503	39079584	SO:0001587	stop_gained	57599	exon2			AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.88C>T	3.37:g.39104580C>T	ENSP00000307491:p.Arg30*		39079584	NM_020839	B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	Nonsense_Mutation	SNP	ENST00000302313.5	37	CCDS33738.1	.	.	.	.	.	.	.	.	.	.	C	34	5.294941	0.95546	.	.	ENSG00000114742	ENST00000302313	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.3427	19.8891	0.96923	0.0:1.0:0.0:0.0	.	.	.	.	X	30	.	ENSP00000307491:R30X	R	+	1	2	WDR48	39079584	1.000000	0.71417	0.984000	0.44739	0.992000	0.81027	6.075000	0.71261	2.689000	0.91719	0.655000	0.94253	CGA		0.388	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342529.1	NM_020839	
ACKR2	1238	broad.mit.edu	37	3	42906229	42906229	+	Missense_Mutation	SNP	C	C	T	rs371119755		TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr3:42906229C>T	ENST00000422265.1	+	3	410	c.235C>T	c.(235-237)Cgg>Tgg	p.R79W	ACKR2_ENST00000442925.1_Missense_Mutation_p.R79W|KRBOX1_ENST00000426937.1_Intron|CYP8B1_ENST00000437102.1_Intron|RP11-141M3.5_ENST00000471537.1_RNA|ACKR2_ENST00000273145.2_Missense_Mutation_p.R79W	NM_001296.4	NP_001287.2	O00590	ACKR2_HUMAN	atypical chemokine receptor 2	79					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|multicellular organismal development (GO:0007275)|neutrophil activation (GO:0042119)|receptor-mediated endocytosis (GO:0006898)	actin filament (GO:0005884)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-X-C chemokine receptor activity (GO:0016494)|chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.R79W(1)									GCCTCGCAGGCGGATGGTTGA	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		19073	0.001		0.0	False		,,,				2504	0.0				p.R79W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C235T	3						.	C	TRP/ARG	0,4406		0,0,2203	179.0	154.0	163.0		235	2.5	0.6	3		163	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCBP2	NM_001296.4	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	79/385	42906229	1,13005	2203	4300	6503	42881233	SO:0001583	missense	1238	exon3			U94888	CCDS2706.1	3p21.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144648	ENSG00000144648		"""GPCR / Class A : Chemokine receptors : Atypical"""	1565	protein-coding gene	gene with protein product		602648	"""chemokine binding protein 2"""	CMKBR9, CCBP2		9364936, 9405404, 16148	Standard	NM_001296		Approved	CCR10, D6, CCR9	uc003cme.3	O00590	OTTHUMG00000133040	ENST00000422265.1:c.235C>T	3.37:g.42906229C>T	ENSP00000416996:p.Arg79Trp		42881233	NM_001296	B2R8Y8|O00537|Q53YA1|Q86UN9|Q96A02	Missense_Mutation	SNP	ENST00000422265.1	37	CCDS2706.1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.088054	0.36855	0.0	1.16E-4	ENSG00000144648	ENST00000442925;ENST00000422265;ENST00000273145	T;T;T	0.37915	1.17;1.17;1.17	5.52	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.363501	0.19562	N	0.111309	T	0.50309	0.1608	M	0.75884	2.315	0.09310	N	1	D;D	0.67145	0.996;0.99	P;P	0.57846	0.828;0.745	T	0.37776	-0.9691	9	.	.	.	.	9.0267	0.36234	0.5247:0.3449:0.1305:0.0	.	79;79	O00590;Q7Z7I1	CCBP2_HUMAN;.	W	79	ENSP00000396150:R79W;ENSP00000416996:R79W;ENSP00000273145:R79W	.	R	+	1	2	CCBP2	42881233	0.001000	0.12720	0.601000	0.28877	0.307000	0.27823	0.750000	0.26334	0.638000	0.30545	0.563000	0.77884	CGG		0.537	ACKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256645.2	NM_001296	
CCR2	729230	broad.mit.edu	37	3	46399834	46399834	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr3:46399834C>T	ENST00000400888.2	+	1	855	c.816C>T	c.(814-816)ttC>ttT	p.F272F	CCR2_ENST00000292301.4_Silent_p.F272F|CCR2_ENST00000465202.1_3'UTR|CCR2_ENST00000445132.2_Silent_p.F272F			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	272					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)	p.F272F(1)		breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		AGGAATTCTTCGGCCTGAGTA	0.463																																					p.F272F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C816T	3						.						151.0	139.0	143.0					3																	46399834		1568	3582	5150	46374838	SO:0001819	synonymous_variant	729230	exon2				CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.816C>T	3.37:g.46399834C>T			46374838	NM_001123396	A0AVQ3|B2RMT0|Q4VBL2	Silent	SNP	ENST00000400888.2	37	CCDS43078.1																																																																																				0.463	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344292.1	NM_000647	
BSN	8927	broad.mit.edu	37	3	49689426	49689426	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr3:49689426G>A	ENST00000296452.4	+	5	2551	c.2437G>A	c.(2437-2439)Gac>Aac	p.D813N		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	813					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.D813N(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		ATTGAGGCACGACTATGTGGA	0.607																																					p.D813N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2437A	3						.						47.0	55.0	52.0					3																	49689426		2203	4300	6503	49664430	SO:0001583	missense	8927	exon5			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.2437G>A	3.37:g.49689426G>A	ENSP00000296452:p.Asp813Asn		49664430	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	g	14.98	2.698285	0.48307	.	.	ENSG00000164061	ENST00000296452	T	0.35048	1.33	5.06	4.18	0.49190	.	0.118551	0.53938	D	0.000045	T	0.48187	0.1486	M	0.73962	2.25	0.36724	D	0.881357	D	0.62365	0.991	P	0.50617	0.646	T	0.62034	-0.6939	10	0.59425	D	0.04	.	12.6798	0.56916	0.0809:0.0:0.9191:0.0	.	813	Q9UPA5	BSN_HUMAN	N	813	ENSP00000296452:D813N	ENSP00000296452:D813N	D	+	1	0	BSN	49664430	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	6.310000	0.72830	1.115000	0.41800	0.556000	0.70494	GAC		0.607	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
ZPLD1	131368	broad.mit.edu	37	3	102196369	102196369	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr3:102196369C>T	ENST00000491959.1	+	18	2037	c.1155C>T	c.(1153-1155)agC>agT	p.S385S	ZPLD1_ENST00000306176.1_Silent_p.S401S|ZPLD1_ENST00000466937.1_Silent_p.S385S			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	385						integral component of membrane (GO:0016021)		p.S401S(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						GAGTTACGAGCTTTTCTCTTC	0.468																																					p.S401S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1203T	3						.						203.0	196.0	199.0					3																	102196369		2203	4300	6503	103679059	SO:0001819	synonymous_variant	131368	exon11			AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.1155C>T	3.37:g.102196369C>T			103679059	NM_175056	Q49AS1|Q8WU36	Silent	SNP	ENST00000491959.1	37																																																																																					0.468	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056	
ZNF518B	85460	broad.mit.edu	37	4	10447233	10447233	+	Silent	SNP	T	T	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr4:10447233T>A	ENST00000326756.3	-	3	1158	c.720A>T	c.(718-720)ccA>ccT	p.P240P		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	240					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.P240P(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						TTAGAAGCTCTGGGTTTTGTT	0.443																																					p.P240P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A720T	4						.						177.0	182.0	180.0					4																	10447233		2203	4300	6503	10056331	SO:0001819	synonymous_variant	85460	exon3			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.720A>T	4.37:g.10447233T>A			10056331	NM_053042	Q96LN8	Silent	SNP	ENST00000326756.3	37	CCDS33960.1																																																																																				0.443	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042	
SYNPO2	171024	broad.mit.edu	37	4	119952723	119952723	+	Silent	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr4:119952723G>A	ENST00000429713.2	+	4	2975	c.2793G>A	c.(2791-2793)ccG>ccA	p.P931P	SYNPO2_ENST00000307142.4_Silent_p.P931P|SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000434046.2_Silent_p.P931P	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	931						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.P931P(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TCCACTCGCCGTCTTACCCAC	0.537																																					p.P931P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2793A	4						.						87.0	83.0	84.0					4																	119952723		2203	4300	6503	120172171	SO:0001819	synonymous_variant	171024	exon4			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.2793G>A	4.37:g.119952723G>A			120172171	NM_133477	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Silent	SNP	ENST00000429713.2	37	CCDS47129.1	.	.	.	.	.	.	.	.	.	.	G	1.290	-0.607743	0.03717	.	.	ENSG00000172403	ENST00000504178	.	.	.	5.66	-1.8	0.07907	.	.	.	.	.	T	0.39627	0.1085	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29274	-1.0017	4	.	.	.	-22.0002	1.6634	0.02796	0.2182:0.2729:0.3168:0.1922	.	.	.	.	I	883	.	.	V	+	1	0	SYNPO2	120172171	0.003000	0.15002	0.995000	0.50966	0.548000	0.35241	-1.309000	0.02728	-0.144000	0.11314	-1.777000	0.00654	GTC		0.537	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
TRPC3	7222	broad.mit.edu	37	4	122854059	122854059	+	Silent	SNP	G	G	A	rs151159120	byFrequency	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr4:122854059G>A	ENST00000379645.3	-	2	427	c.354C>T	c.(352-354)gaC>gaT	p.D118D	TRPC3_ENST00000513531.1_Silent_p.D45D|TRPC3_ENST00000264811.5_Silent_p.D45D	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	33					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.D45D(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						ACTCGGCGGCGTCGAGGAAGC	0.657													G|||	11	0.00219649	0.0083	0.0	5008	,	,		18532	0.0		0.0	False		,,,				2504	0.0				p.D45D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C135T	4						.	G	,	11,4395	17.9+/-39.9	0,11,2192	49.0	48.0	49.0		354,135	1.3	1.0	4	dbSNP_134	49	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TRPC3	NM_001130698.1,NM_003305.2	,	0,11,6492	AA,AG,GG		0.0,0.2497,0.0846	,	118/922,45/849	122854059	11,12995	2203	4300	6503	123073509	SO:0001819	synonymous_variant	7222	exon1			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.354C>T	4.37:g.122854059G>A			123073509	NM_003305	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Silent	SNP	ENST00000379645.3	37	CCDS47130.1																																																																																				0.657	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
ZNF595	152687	broad.mit.edu	37	4	59379	59379	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr4:59379T>G	ENST00000509152.2	+	2	245	c.60T>G	c.(58-60)tgT>tgG	p.C20W	ZNF595_ENST00000339368.6_3'UTR|ZNF595_ENST00000526473.2_Missense_Mutation_p.C20W			Q8IYB9	ZN595_HUMAN	zinc finger protein 595	20	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C20W(1)		endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		AGTGGAAATGTCTGGACCCTG	0.418																																					p.C20W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T60G	4						.						361.0	393.0	383.0					4																	59379		2203	4300	6503	49379	SO:0001583	missense	152687	exon2			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.60T>G	4.37:g.59379T>G	ENSP00000434858:p.Cys20Trp		49379	NM_001039127		Missense_Mutation	SNP	ENST00000509152.2	37		.	.	.	.	.	.	.	.	.	.	T	3.237	-0.156242	0.06544	.	.	ENSG00000197701	ENST00000509152;ENST00000526473	T;T	0.01767	4.65;4.65	1.26	-2.53	0.06326	Krueppel-associated box (8);	.	.	.	.	T	0.05868	0.0153	.	.	.	0.09310	N	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.11446	-1.0587	8	0.49607	T	0.09	.	3.6371	0.08153	0.0:0.4698:0.203:0.3273	.	20;20	Q8IYB9;Q3SXZ3	ZN595_HUMAN;ZN718_HUMAN	W	20	ENSP00000434858:C20W;ENSP00000437878:C20W	ENSP00000434858:C20W	C	+	3	2	ZNF595	49379	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.421000	0.01031	-2.465000	0.00533	-2.750000	0.00124	TGT		0.418	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000357817.2	NM_182524	
EVC	2121	broad.mit.edu	37	4	5735121	5735121	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr4:5735121C>A	ENST00000264956.6	+	5	845	c.661C>A	c.(661-663)Ctg>Atg	p.L221M	EVC_ENST00000509451.1_Missense_Mutation_p.L221M|EVC_ENST00000382674.2_Missense_Mutation_p.L221M	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	221					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L221M(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				CTTAAAAGACCTGCTGCATTT	0.463																																					p.L221M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C661A	4						.						329.0	310.0	316.0					4																	5735121		2203	4300	6503	5786022	SO:0001583	missense	2121	exon5			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.661C>A	4.37:g.5735121C>A	ENSP00000264956:p.Leu221Met		5786022	NM_153717		Missense_Mutation	SNP	ENST00000264956.6	37	CCDS3383.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.045935	0.36085	.	.	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.61627	0.18;0.18;0.09	4.73	3.88	0.44766	.	0.182885	0.37136	N	0.002226	T	0.70413	0.3221	M	0.68952	2.095	0.41978	D	0.990781	D	0.89917	1.0	D	0.91635	0.999	T	0.71761	-0.4495	10	0.66056	D	0.02	.	8.6703	0.34145	0.0:0.8261:0.0:0.1739	.	221	P57679	EVC_HUMAN	M	221	ENSP00000264956:L221M;ENSP00000372120:L221M;ENSP00000426774:L221M	ENSP00000264956:L221M	L	+	1	2	EVC	5786022	0.632000	0.27172	0.443000	0.26883	0.419000	0.31324	0.912000	0.28597	1.114000	0.41781	0.650000	0.86243	CTG		0.463	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
PDS5A	23244	broad.mit.edu	37	4	39891957	39891957	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr4:39891957G>A	ENST00000303538.8	-	17	2337	c.1798C>T	c.(1798-1800)Cct>Tct	p.P600S		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)									p.P600S(1)		breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						GGTTGCTTAGGATTTGCAAGT	0.358																																					p.P600S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1798T	4						.						75.0	69.0	71.0					4																	39891957		1818	4071	5889	39568352	SO:0001583	missense	23244	exon17			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1798C>T	4.37:g.39891957G>A	ENSP00000303427:p.Pro600Ser		39568352	NM_001100399		Missense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037749	0.75617	.	.	ENSG00000121892	ENST00000303538	.	.	.	5.26	5.26	0.73747	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78929	0.4361	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.78076	-0.2345	8	.	.	.	-11.8066	19.2198	0.93791	0.0:0.0:1.0:0.0	.	600	Q29RF7	PDS5A_HUMAN	S	600	.	.	P	-	1	0	PDS5A	39568352	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.730000	0.98797	2.615000	0.88500	0.655000	0.94253	CCT		0.358	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361287.1	NM_015200	
GABRA4	2557	broad.mit.edu	37	4	46967169	46967169	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr4:46967169C>T	ENST00000264318.3	-	8	1934	c.952G>A	c.(952-954)Gcc>Acc	p.A318T		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	318					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.A318T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CAGTCCATGGCGGTAGCATAG	0.438																																					p.A318T	Ovarian(6;283 369 8234 12290 33402)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G952A	4						.						158.0	132.0	141.0					4																	46967169		2203	4300	6503	46661926	SO:0001583	missense	2557	exon8				CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.952G>A	4.37:g.46967169C>T	ENSP00000264318:p.Ala318Thr		46661926	NM_000809	Q8IYR7	Missense_Mutation	SNP	ENST00000264318.3	37	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	C	33	5.232943	0.95207	.	.	ENSG00000109158	ENST00000264318	D	0.88741	-2.42	4.81	4.81	0.61882	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.059428	0.64402	D	0.000003	D	0.94006	0.8080	M	0.80982	2.52	0.80722	D	1	D	0.71674	0.998	D	0.64321	0.924	D	0.94812	0.7979	10	0.87932	D	0	.	17.0404	0.86488	0.0:1.0:0.0:0.0	.	318	P48169	GBRA4_HUMAN	T	318	ENSP00000264318:A318T	ENSP00000264318:A318T	A	-	1	0	GABRA4	46661926	1.000000	0.71417	0.953000	0.39169	0.906000	0.53458	7.651000	0.83577	2.481000	0.83766	0.591000	0.81541	GCC		0.438	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1		
GRID2	2895	broad.mit.edu	37	4	93225840	93225840	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr4:93225840C>T	ENST00000282020.4	+	1	291	c.33C>T	c.(31-33)tcC>tcT	p.S11S	RP11-9B6.1_ENST00000504213.1_5'Flank|GRID2_ENST00000510992.1_Silent_p.S11S|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	11					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.S11S(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TGGTTTTGTCCGTCTGGTGGT	0.448																																					p.S11S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C33T	4						.						204.0	187.0	193.0					4																	93225840		2203	4300	6503	93444863	SO:0001819	synonymous_variant	2895	exon1			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.33C>T	4.37:g.93225840C>T			93444863	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Silent	SNP	ENST00000282020.4	37	CCDS3637.1																																																																																				0.448	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
FAT1	2195	broad.mit.edu	37	4	187630269	187630269	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr4:187630269C>T	ENST00000441802.2	-	2	922	c.713G>A	c.(712-714)aGc>aAc	p.S238N		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	238	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S238N(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GGCCATGCTGCTGATGCCACT	0.512										HNSCC(5;0.00058)																											p.S238N	Colon(197;1040 2055 4143 4984 49344)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G713A	4						.						132.0	132.0	132.0					4																	187630269		2184	4287	6471	187867263	SO:0001583	missense	2195	exon2			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.713G>A	4.37:g.187630269C>T	ENSP00000406229:p.Ser238Asn		187867263	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.385885	0.82902	.	.	ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000509647	T;T	0.55413	0.52;0.52	5.3	5.3	0.74995	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.75679	0.3882	M	0.83692	2.655	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.75827	-0.3180	10	0.44086	T	0.13	.	19.1481	0.93476	0.0:1.0:0.0:0.0	.	238	Q14517	FAT1_HUMAN	N	238	ENSP00000406229:S238N;ENSP00000423736:S238N	ENSP00000260147:S238N	S	-	2	0	FAT1	187867263	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.651000	0.83577	2.762000	0.94881	0.591000	0.81541	AGC		0.512	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
PCDHB6	56130	broad.mit.edu	37	5	140530474	140530474	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:140530474C>T	ENST00000231136.1	+	1	636	c.636C>T	c.(634-636)atC>atT	p.I212I	PCDHB6_ENST00000543635.1_Silent_p.I76I	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	212	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.I212I(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAACGCTGATCGCGCTGGATG	0.602																																					p.I212I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C636T	5						.						55.0	59.0	58.0					5																	140530474		2203	4300	6503	140510658	SO:0001819	synonymous_variant	56130	exon1			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.636C>T	5.37:g.140530474C>T			140510658	NM_018939	B2R8R9	Silent	SNP	ENST00000231136.1	37	CCDS4248.1																																																																																				0.602	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDHGA12	26025	broad.mit.edu	37	5	140810510	140810510	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:140810510C>T	ENST00000252085.3	+	1	326	c.184C>T	c.(184-186)Cgc>Tgc	p.R62C	PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGA6_ENST00000517434.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	62	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R62C(2)		breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCGCGGAGCGCGGAGTCCG	0.652																																					p.R62C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C184T	5						.						58.0	72.0	67.0					5																	140810510		2202	4299	6501	140790694	SO:0001583	missense	26025	exon1			AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.184C>T	5.37:g.140810510C>T	ENSP00000252085:p.Arg62Cys		140790694	NM_032094	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	37	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	c	11.76	1.735727	0.30774	.	.	ENSG00000253159	ENST00000252085	T	0.42131	0.98	5.55	3.55	0.40652	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.78084	0.4228	H	0.99600	4.65	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.70487	0.961;0.969	T	0.72587	-0.4248	9	0.87932	D	0	.	11.5509	0.50721	0.2262:0.6643:0.1095:0.0	.	62;62	O60330-2;O60330	.;PCDGC_HUMAN	C	62	ENSP00000252085:R62C	ENSP00000252085:R62C	R	+	1	0	PCDHGA12	140790694	0.025000	0.19082	0.898000	0.35279	0.155000	0.21991	0.781000	0.26774	1.327000	0.45338	0.555000	0.69702	CGC		0.652	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
DPYSL3	1809	broad.mit.edu	37	5	146775256	146775256	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:146775256C>T	ENST00000398514.3	-	13	1861	c.1490G>A	c.(1489-1491)gGc>gAc	p.G497D	DPYSL3_ENST00000343218.5_Missense_Mutation_p.G611D|DPYSL3_ENST00000534907.1_Missense_Mutation_p.G123D	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	497					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)	p.G497D(1)		breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCGTACATGCCCCTTGGGAC	0.562																																					p.G497D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1490A	5						.						52.0	55.0	54.0					5																	146775256		2008	4180	6188	146755449	SO:0001583	missense	1809	exon13			D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.1490G>A	5.37:g.146775256C>T	ENSP00000381526:p.Gly497Asp		146755449	NM_001387	B3SXQ8|Q93012	Missense_Mutation	SNP	ENST00000398514.3	37	CCDS43381.1	.	.	.	.	.	.	.	.	.	.	C	32	5.160275	0.94727	.	.	ENSG00000113657	ENST00000398514;ENST00000343218;ENST00000534907	D;D;T	0.85171	-1.86;-1.95;-0.75	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.92064	0.7485	M	0.71206	2.165	0.80722	D	1	D;B	0.76494	0.999;0.083	D;B	0.76575	0.988;0.032	D	0.90952	0.4806	10	0.44086	T	0.13	-25.4288	19.8557	0.96758	0.0:1.0:0.0:0.0	.	611;497	B3SXQ8;Q14195	.;DPYL3_HUMAN	D	497;611;123	ENSP00000381526:G497D;ENSP00000343690:G611D;ENSP00000441819:G123D	ENSP00000343690:G611D	G	-	2	0	DPYSL3	146755449	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.797000	0.85911	2.688000	0.91661	0.591000	0.81541	GGC		0.562	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2	NM_001387	
ICE1	23379	broad.mit.edu	37	5	5461209	5461209	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:5461209C>T	ENST00000296564.7	+	13	1984	c.1762C>T	c.(1762-1764)Cta>Tta	p.L588L		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		588					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.L588L(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TTTTCACAGACTATCTAGAGA	0.398																																					p.L588L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1762T	5						.						113.0	111.0	112.0					5																	5461209		1856	4103	5959	5514209	SO:0001819	synonymous_variant	23379	exon13																														ENST00000296564.7:c.1762C>T	5.37:g.5461209C>T			5514209	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Silent	SNP	ENST00000296564.7	37	CCDS47187.1																																																																																				0.398	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
RXFP3	51289	broad.mit.edu	37	5	33937247	33937247	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:33937247C>T	ENST00000330120.3	+	1	757	c.402C>T	c.(400-402)acC>acT	p.T134T		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	134					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)	p.T134T(1)		endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						TTGTGCTCACCCTGCCCTTCT	0.547																																					p.T134T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C402T	5						.						141.0	128.0	133.0					5																	33937247		2203	4300	6503	33973004	SO:0001819	synonymous_variant	51289	exon1			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.402C>T	5.37:g.33937247C>T			33973004	NM_016568	Q14DA5	Silent	SNP	ENST00000330120.3	37	CCDS3900.1																																																																																				0.547	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
OSMR	9180	broad.mit.edu	37	5	38918990	38918990	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:38918990G>C	ENST00000274276.3	+	11	1813	c.1411G>C	c.(1411-1413)Gtt>Ctt	p.V471L		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	471	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)	p.V471L(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					CTATAATGTAGTTGTAGAAAA	0.358																																					p.V471L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1411C	5						.						98.0	96.0	96.0					5																	38918990		2203	4300	6503	38954747	SO:0001583	missense	9180	exon11			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.1411G>C	5.37:g.38918990G>C	ENSP00000274276:p.Val471Leu		38954747	NM_003999	Q6P4E8|Q96QJ6	Missense_Mutation	SNP	ENST00000274276.3	37	CCDS3928.1	.	.	.	.	.	.	.	.	.	.	G	10.04	1.240272	0.22711	.	.	ENSG00000145623	ENST00000274276;ENST00000513831	T;T	0.52295	0.67;0.67	4.87	-0.99	0.10238	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.168320	0.05852	N	0.621313	T	0.39759	0.1090	L	0.55103	1.725	0.09310	N	1	B	0.16166	0.016	B	0.12156	0.007	T	0.28170	-1.0052	10	0.12430	T	0.62	.	8.6754	0.34176	0.4916:0.0:0.5084:0.0	.	471	Q99650	OSMR_HUMAN	L	471;78	ENSP00000274276:V471L;ENSP00000423913:V78L	ENSP00000274276:V471L	V	+	1	0	OSMR	38954747	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.811000	0.04500	-0.452000	0.07087	-0.140000	0.14226	GTT		0.358	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999	
ISL1	3670	broad.mit.edu	37	5	50685630	50685630	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:50685630T>A	ENST00000230658.7	+	4	1214	c.629T>A	c.(628-630)aTg>aAg	p.M210K	ISL1_ENST00000505475.2_3'UTR|ISL1_ENST00000511384.1_Missense_Mutation_p.M210K	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	210					atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)	p.M210K(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				GATGCGCTCATGAAGGAGCAA	0.597																																					p.M210K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T629A	5						.						65.0	76.0	72.0					5																	50685630		2203	4300	6503	50721387	SO:0001583	missense	3670	exon4			BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.629T>A	5.37:g.50685630T>A	ENSP00000230658:p.Met210Lys		50721387	NM_002202	P20663|P47894	Missense_Mutation	SNP	ENST00000230658.7	37	CCDS43314.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.9|23.9	4.469583|4.469583	0.84533|0.84533	.|.	.|.	ENSG00000016082|ENSG00000016082	ENST00000505475|ENST00000230658;ENST00000503187;ENST00000511384	.|D;D	.|0.95272	.|-3.66;-3.66	5.58|5.58	5.58|5.58	0.84498|0.84498	.|Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94496|0.94496	0.8228|0.8228	N|N	0.21324|0.21324	0.655|0.655	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|D	.|0.66602	.|0.945	D|D	0.95552|0.95552	0.8621|0.8621	6|10	0.87932|0.72032	D|D	0|0.01	.|.	15.7421|15.7421	0.77905|0.77905	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|210	.|P61371	.|ISL1_HUMAN	Q|K	156|210	.|ENSP00000230658:M210K;ENSP00000422676:M210K	ENSP00000421737:H156Q|ENSP00000230658:M210K	H|M	+|+	3|2	2|0	ISL1|ISL1	50721387|50721387	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.716000|0.716000	0.41182|0.41182	7.942000|7.942000	0.87708|0.87708	2.099000|2.099000	0.63709|0.63709	0.477000|0.477000	0.44152|0.44152	CAT|ATG		0.597	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
CWC27	10283	broad.mit.edu	37	5	64077817	64077817	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:64077817G>A	ENST00000381070.3	+	3	426	c.209G>A	c.(208-210)gGc>gAc	p.G70D	CWC27_ENST00000508024.1_Missense_Mutation_p.G70D	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	70	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.G70D(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						GATCCTACTGGCACAGGGAGT	0.323																																					p.G70D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G209A	5						.						71.0	71.0	71.0					5																	64077817		2203	4300	6503	64113573	SO:0001583	missense	10283	exon3			AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.209G>A	5.37:g.64077817G>A	ENSP00000370460:p.Gly70Asp		64113573	NM_005869	O60529|O60530|Q96EM3	Missense_Mutation	SNP	ENST00000381070.3	37	CCDS3982.2	.	.	.	.	.	.	.	.	.	.	G	29.3	4.994045	0.93167	.	.	ENSG00000153015	ENST00000381070;ENST00000508024;ENST00000538793	T;T	0.50813	0.73;0.73	5.5	5.5	0.81552	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.76912	0.4054	M	0.92026	3.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.989;0.998;0.998;0.999	T	0.81424	-0.0939	10	0.87932	D	0	.	19.5916	0.95514	0.0:0.0:1.0:0.0	.	70;70;70;70	Q6UX04-2;Q6UX04;F5H636;D6REK3	.;CWC27_HUMAN;.;.	D	70	ENSP00000370460:G70D;ENSP00000426802:G70D	ENSP00000370460:G70D	G	+	2	0	CWC27	64113573	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.036000	0.93758	2.861000	0.98227	0.655000	0.94253	GGC		0.323	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157247.4	NM_005869	
FAM169A	26049	broad.mit.edu	37	5	74134802	74134802	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:74134802C>T	ENST00000389156.4	-	4	396	c.306G>A	c.(304-306)gaG>gaA	p.E102E	FAM169A_ENST00000380515.3_Silent_p.E102E|FAM169A_ENST00000510496.1_Silent_p.E102E	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	102						membrane (GO:0016020)|nucleus (GO:0005634)		p.E102E(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						GCTTAAGCCCCTCTCTTGAAG	0.383																																					p.E102E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G306A	5						.						221.0	214.0	216.0					5																	74134802		1880	4108	5988	74170558	SO:0001819	synonymous_variant	26049	exon4				CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.306G>A	5.37:g.74134802C>T			74170558	NM_015566	A8K1T9|Q6MZT0|Q9H989	Silent	SNP	ENST00000389156.4	37	CCDS43330.1																																																																																				0.383	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371092.2		
HAPLN1	1404	broad.mit.edu	37	5	82940460	82940460	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:82940460C>T	ENST00000274341.4	-	4	1347	c.497G>A	c.(496-498)cGa>cAa	p.R166Q		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	166	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)	p.R166Q(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	GCGCCCCAGTCGTGGAAAGTA	0.537																																					p.R166Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G497A	5						.						33.0	31.0	32.0					5																	82940460		2203	4300	6503	82976216	SO:0001583	missense	1404	exon4				CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.497G>A	5.37:g.82940460C>T	ENSP00000274341:p.Arg166Gln		82976216	NM_001884	B2R9A9	Missense_Mutation	SNP	ENST00000274341.4	37	CCDS4061.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.309493	0.60414	.	.	ENSG00000145681	ENST00000274341;ENST00000510978;ENST00000508307;ENST00000503117	T;T;T;T	0.09538	2.97;2.97;2.97;2.97	5.8	5.8	0.92144	C-type lectin fold (1);Link (3);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.10680	0.0261	L	0.48260	1.515	0.80722	D	1	B	0.28439	0.212	B	0.25405	0.06	T	0.13845	-1.0494	10	0.13108	T	0.6	.	14.2405	0.65954	0.0:0.9291:0.0:0.0709	.	166	P10915	HPLN1_HUMAN	Q	166;166;166;165	ENSP00000274341:R166Q;ENSP00000422592:R166Q;ENSP00000421341:R166Q;ENSP00000426610:R165Q	ENSP00000274341:R166Q	R	-	2	0	HAPLN1	82976216	0.987000	0.35691	0.996000	0.52242	0.994000	0.84299	3.105000	0.50314	2.733000	0.93635	0.650000	0.86243	CGA		0.537	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884	
APC	324	broad.mit.edu	37	5	112173831	112173831	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:112173831delA	ENST00000457016.1	+	16	2920	c.2540delA	c.(2539-2541)gaafs	p.E847fs	APC_ENST00000508376.2_Frame_Shift_Del_p.E847fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.E847fs			P25054	APC_HUMAN	adenomatous polyposis coli	847	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.D849fs*12(2)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCTCGTTCTGAAAAAGATAGA	0.418		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E829fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	3	Deletion - Frameshift(2)|Unknown(1)	large_intestine(2)|skin(1)	c.2486delA	5						.						59.0	60.0	60.0					5																	112173831		2202	4300	6502	112201730	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2540delA	5.37:g.112173831delA	ENSP00000413133:p.Glu847fs		112201730	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.418	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
GABRB2	2561	broad.mit.edu	37	5	160757997	160757997	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr5:160757997C>A	ENST00000393959.1	-	8	969	c.970G>T	c.(970-972)Gcc>Tcc	p.A324S	GABRB2_ENST00000353437.6_Missense_Mutation_p.A324S|GABRB2_ENST00000274547.2_Missense_Mutation_p.A324S|GABRB2_ENST00000520240.1_Missense_Mutation_p.A324S|GABRB2_ENST00000517547.1_Missense_Mutation_p.A164S|GABRB2_ENST00000517901.1_Missense_Mutation_p.A261S			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	324					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)	p.A324S(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTGACTAGGGCATATTCCAGA	0.517																																					p.A324S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G970T	5						.						123.0	124.0	124.0					5																	160757997		2203	4300	6503	160690575	SO:0001583	missense	2561	exon9				CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.970G>T	5.37:g.160757997C>A	ENSP00000377531:p.Ala324Ser		160690575	NM_000813	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	ENST00000393959.1	37	CCDS4355.1	.	.	.	.	.	.	.	.	.	.	C	32	5.155840	0.94686	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901;ENST00000517547	D;D;D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5;-2.5;-2.5	5.26	5.26	0.73747	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.054792	0.64402	D	0.000001	D	0.93989	0.8075	M	0.66506	2.035	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;0.999;0.997;1.0	D	0.94482	0.7694	10	0.87932	D	0	.	18.8686	0.92303	0.0:1.0:0.0:0.0	.	164;261;324;324	B7Z279;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	S	324;324;324;324;261;164	ENSP00000377531:A324S;ENSP00000274547:A324S;ENSP00000274546:A324S;ENSP00000429320:A324S;ENSP00000430532:A261S;ENSP00000429750:A164S	ENSP00000274547:A324S	A	-	1	0	GABRB2	160690575	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.726000	0.84824	2.451000	0.82905	0.563000	0.77884	GCC		0.517	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		
MAK	4117	broad.mit.edu	37	6	10818202	10818202	+	Silent	SNP	A	A	G			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr6:10818202A>G	ENST00000313243.2	-	4	541	c.159T>C	c.(157-159)tcT>tcC	p.S53S	MAK_ENST00000354489.2_Silent_p.S53S|RP11-637O19.3_ENST00000480294.1_Intron|MAK_ENST00000474039.1_Silent_p.S53S|SYCP2L_ENST00000543878.1_Intron|MAK_ENST00000536370.1_Silent_p.S53S|MAK_ENST00000538030.1_Silent_p.S53S			P20794	MAK_HUMAN	male germ cell-associated kinase	53	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|photoreceptor cell maintenance (GO:0045494)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|transcription coactivator activity (GO:0003713)	p.S53S(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)	22	Breast(50;0.107)|Ovarian(93;0.107)	all_hematologic(90;0.117)				GTTTCTTCAGAGACTGAAAAA	0.244																																					p.S53S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T159C	6						.						14.0	16.0	15.0					6																	10818202		2140	4216	6356	10926188	SO:0001819	synonymous_variant	4117	exon3				CCDS4516.1, CCDS75398.1, CCDS75399.1	6p24.2	2014-01-28			ENSG00000111837	ENSG00000111837			6816	protein-coding gene	gene with protein product		154235				16951154	Standard	NM_005906		Approved	dJ417M14.2, RP62	uc021ylk.1	P20794	OTTHUMG00000014247	ENST00000313243.2:c.159T>C	6.37:g.10818202A>G			10926188	NM_005906	F1T0K6|G1FL29|Q547D0|Q9NUH7	Silent	SNP	ENST00000313243.2	37	CCDS4516.1																																																																																				0.244	MAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039841.1	NM_005906	
GCM2	9247	broad.mit.edu	37	6	10874263	10874263	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr6:10874263C>T	ENST00000379491.4	-	5	1633	c.1486G>A	c.(1486-1488)Ggt>Agt	p.G496S	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	496					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.G496S(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				AAGAAGGGACCCACTCTGTCT	0.502																																					p.G496S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1486A	6						.						68.0	65.0	66.0					6																	10874263		2203	4300	6503	10982249	SO:0001583	missense	9247	exon5			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.1486G>A	6.37:g.10874263C>T	ENSP00000368805:p.Gly496Ser		10982249	NM_004752	D3GDV6|Q5THN5	Missense_Mutation	SNP	ENST00000379491.4	37	CCDS4517.1	.	.	.	.	.	.	.	.	.	.	C	0.852	-0.738343	0.03111	.	.	ENSG00000124827	ENST00000379491	T	0.68624	-0.34	5.27	3.34	0.38264	.	0.358324	0.29846	N	0.011053	T	0.14743	0.0356	N	0.03224	-0.385	0.09310	N	0.999997	B	0.11235	0.004	B	0.10450	0.005	T	0.32508	-0.9904	10	0.11182	T	0.66	-5.4876	6.0079	0.19557	0.0:0.7317:0.0:0.2683	.	496	O75603	GCM2_HUMAN	S	496	ENSP00000368805:G496S	ENSP00000368805:G496S	G	-	1	0	GCM2	10982249	0.189000	0.23263	0.002000	0.10522	0.001000	0.01503	1.011000	0.29911	0.590000	0.29694	0.591000	0.81541	GGT		0.502	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039844.1		
ELOVL2	54898	broad.mit.edu	37	6	11000322	11000322	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr6:11000322G>A	ENST00000354666.3	-	4	414	c.331C>T	c.(331-333)Cgg>Tgg	p.R111W		NM_017770.3	NP_060240.3	Q9NXB9	ELOV2_HUMAN	ELOVL fatty acid elongase 2	111					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	fatty acid elongase activity (GO:0009922)	p.R111W(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(2)	14	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)			TGGCTCACCCGGATGTCAGCT	0.478																																					p.R111W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C331T	6						.						159.0	138.0	145.0					6																	11000322		2203	4300	6503	11108308	SO:0001583	missense	54898	exon4			AK000341	CCDS4518.1	6p24.1	2011-05-25	2011-05-25		ENSG00000197977	ENSG00000197977			14416	protein-coding gene	gene with protein product		611814	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2"""			12371743, 16564093	Standard	NM_017770		Approved	Ssc2	uc003mzp.4	Q9NXB9	OTTHUMG00000014252	ENST00000354666.3:c.331C>T	6.37:g.11000322G>A	ENSP00000346693:p.Arg111Trp		11108308	NM_017770	Q6P9E1|Q86W94	Missense_Mutation	SNP	ENST00000354666.3	37	CCDS4518.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196875	0.79015	.	.	ENSG00000197977	ENST00000354666	T	0.23147	1.92	5.73	3.94	0.45596	.	0.145914	0.43747	D	0.000521	T	0.41119	0.1145	M	0.82433	2.59	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.47407	-0.9120	10	0.87932	D	0	-1.8313	10.9612	0.47387	0.0672:0.0:0.8027:0.1302	.	111	Q9NXB9	ELOV2_HUMAN	W	111	ENSP00000346693:R111W	ENSP00000346693:R111W	R	-	1	2	ELOVL2	11108308	1.000000	0.71417	0.985000	0.45067	0.957000	0.61999	3.349000	0.52217	0.759000	0.33084	0.591000	0.81541	CGG		0.478	ELOVL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039849.1		
HIST1H2AL	8332	broad.mit.edu	37	6	27833133	27833133	+	Start_Codon_SNP	SNP	A	A	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr6:27833133A>T	ENST00000357320.2	+	1	100	c.1A>T	c.(1-3)Atg>Ttg	p.M1L		NM_003511.2	NP_003502.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2al	1						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.M1L(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(2)	9						TTTCTTCGTCATGTCGGGACG	0.562																																					p.M1L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1T	6						.						80.0	89.0	86.0					6																	27833133		2202	4300	6502	27941112	SO:0001582	initiator_codon_variant	8332	exon1			X83549	CCDS4634.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198374	ENSG00000276903		"""Histones / Replication-dependent"""	4730	protein-coding gene	gene with protein product		602793	"""H2A histone family, member I"", ""histone 1, H2al"""	H2AFI		9439656, 9031620, 12408966	Standard	NM_003511		Approved	H2A/i, dJ193B12.9	uc003njw.3	P0C0S8	OTTHUMG00000014492	ENST00000357320.2:c.1A>T	6.37:g.27833133A>T	ENSP00000349873:p.Met1Leu		27941112	NM_003511	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000357320.2	37	CCDS4634.1	.	.	.	.	.	.	.	.	.	.	.	9.095	1.002792	0.19121	.	.	ENSG00000198374	ENST00000357320	D	0.92099	-2.97	4.69	3.5	0.40072	.	0.000000	0.36591	U	0.002515	D	0.91723	0.7383	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.91601	0.5295	7	0.87932	D	0	.	10.1453	0.42760	0.8504:0.0:0.0:0.1496	.	.	.	.	L	1	ENSP00000349873:M1L	ENSP00000349873:M1L	M	+	1	0	HIST1H2AL	27941112	1.000000	0.71417	0.589000	0.28718	0.016000	0.09150	5.519000	0.67074	0.738000	0.32606	-0.336000	0.08194	ATG		0.562	HIST1H2AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040160.1	NM_003511	Missense_Mutation
ELOVL4	6785	broad.mit.edu	37	6	80634669	80634669	+	Splice_Site	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr6:80634669C>T	ENST00000369816.4	-	3	669	c.369G>A	c.(367-369)agG>agA	p.R123R		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	123					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)	p.R123R(1)		central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	ATGTACTTACCCTGACTTCAT	0.303																																					p.R123R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G369A	6						.						70.0	74.0	73.0					6																	80634669		2202	4299	6501	80691388	SO:0001630	splice_region_variant	6785	exon3			AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.369+1G>A	6.37:g.80634669C>T			80691388	NM_022726	B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Silent	SNP	ENST00000369816.4	37	CCDS4992.1																																																																																				0.303	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041315.1		Silent
DGKI	9162	broad.mit.edu	37	7	137082151	137082151	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr7:137082151C>T	ENST00000288490.5	-	32	2953	c.2953G>A	c.(2953-2955)Gag>Aag	p.E985K	DGKI_ENST00000453654.2_Missense_Mutation_p.E654K|DGKI_ENST00000446122.1_Missense_Mutation_p.E967K|DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000424189.2_Missense_Mutation_p.E998K	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	985					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.E985K(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TCCAATAACTCGGAAGGTCCT	0.338																																					p.E985K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2953A	7						.						102.0	97.0	99.0					7																	137082151		2203	4299	6502	136732691	SO:0001583	missense	9162	exon32			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2953G>A	7.37:g.137082151C>T	ENSP00000288490:p.Glu985Lys		136732691	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.229940	0.39399	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.34859	1.93;1.34;1.54	4.54	4.54	0.55810	Ankyrin repeat-containing domain (3);	0.132495	0.50627	D	0.000108	T	0.23330	0.0564	N	0.17723	0.515	0.46078	D	0.998853	B;B	0.32829	0.16;0.386	B;B	0.25884	0.027;0.064	T	0.06041	-1.0849	10	0.32370	T	0.25	.	16.0109	0.80402	0.0:1.0:0.0:0.0	.	654;985	E9PFX6;O75912	.;DGKI_HUMAN	K	654;902;988;985;967	ENSP00000392161:E654K;ENSP00000288490:E985K;ENSP00000399131:E967K	ENSP00000288490:E985K	E	-	1	0	DGKI	136732691	0.998000	0.40836	0.956000	0.39512	0.598000	0.36846	4.991000	0.63883	2.520000	0.84964	0.655000	0.94253	GAG		0.338	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
ARHGEF5	7984	broad.mit.edu	37	7	144061070	144061070	+	Silent	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr7:144061070G>A	ENST00000056217.5	+	2	1482	c.1308G>A	c.(1306-1308)caG>caA	p.Q436Q	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	436					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q436Q(1)		breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					CCGGGACTCAGACAGAGTCCA	0.572																																					p.Q436Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1308A	7						.						26.0	26.0	26.0					7																	144061070		2009	3827	5836	143692003	SO:0001819	synonymous_variant	7984	exon2			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.1308G>A	7.37:g.144061070G>A			143692003	NM_005435	A6NNJ2|Q6ZML7	Silent	SNP	ENST00000056217.5	37	CCDS34771.1																																																																																				0.572	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
HDAC9	9734	broad.mit.edu	37	7	18631210	18631210	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr7:18631210A>C	ENST00000432645.2	+	4	478	c.478A>C	c.(478-480)Act>Cct	p.T160P	HDAC9_ENST00000417496.2_Missense_Mutation_p.T202P|HDAC9_ENST00000406072.1_Missense_Mutation_p.T191P|HDAC9_ENST00000441542.2_Missense_Mutation_p.T163P|HDAC9_ENST00000428307.2_Missense_Mutation_p.T160P|HDAC9_ENST00000456174.2_Missense_Mutation_p.T132P|HDAC9_ENST00000405010.3_Missense_Mutation_p.T160P|HDAC9_ENST00000401921.1_Missense_Mutation_p.T163P|HDAC9_ENST00000406451.4_Missense_Mutation_p.T160P|HDAC9_ENST00000524023.1_Missense_Mutation_p.T129P	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	160					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.T163P(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	AACGAAAGACACTCCAACTAA	0.453																																					p.T160P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A478C	7						.						79.0	80.0	80.0					7																	18631210		1952	4153	6105	18597735	SO:0001583	missense	9734	exon5			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.478A>C	7.37:g.18631210A>C	ENSP00000410337:p.Thr160Pro		18597735	NM_178423	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.146808	0.37923	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000456174;ENST00000524023;ENST00000341009	T;T;T;T;T;T;T;T;T;T	0.57273	1.02;1.02;0.42;1.02;1.02;0.43;0.41;0.42;1.02;1.01	5.74	4.55	0.56014	.	0.100140	0.44097	D	0.000500	T	0.20901	0.0503	N	0.01505	-0.83	0.33305	D	0.565365	B;B;B;B;B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B;B;B;B;B	0.04013	0.0;0.0;0.001;0.001;0.0;0.0;0.001;0.001;0.0;0.0;0.001;0.0;0.0	T	0.15435	-1.0437	10	0.27785	T	0.31	-10.9426	5.3034	0.15791	0.5406:0.1202:0.0:0.3391	.	129;132;160;191;202;163;163;163;160;132;160;160;182	E7EX34;C9JS87;Q9UKV0-4;B5MCF1;B7Z917;Q68D71;Q9UKV0-6;Q9UKV0-7;Q9UKV0;B7Z928;Q9UKV0-5;Q9UKV0-3;Q8N879	.;.;.;.;.;.;.;.;HDAC9_HUMAN;.;.;.;.	P	202;205;160;160;160;191;163;160;163;132;129;160	ENSP00000401669:T202P;ENSP00000384382:T160P;ENSP00000384657:T160P;ENSP00000395655:T160P;ENSP00000384017:T191P;ENSP00000383912:T163P;ENSP00000410337:T160P;ENSP00000408617:T163P;ENSP00000388568:T132P;ENSP00000430036:T129P	ENSP00000262069:T205P	T	+	1	0	HDAC9	18597735	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.179000	0.42528	2.191000	0.70037	0.528000	0.53228	ACT		0.453	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
GLI3	2737	broad.mit.edu	37	7	42005538	42005538	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr7:42005538C>T	ENST00000395925.3	-	15	3217	c.3133G>A	c.(3133-3135)Gtg>Atg	p.V1045M	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1045					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V1045M(1)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TTCTGAAGCACGAGACTGCGC	0.677									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.V1045M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3133A	7						.						39.0	44.0	42.0					7																	42005538		2203	4300	6503	41972063	SO:0001583	missense	2737	exon15	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.3133G>A	7.37:g.42005538C>T	ENSP00000379258:p.Val1045Met		41972063	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.826379	0.32329	.	.	ENSG00000106571	ENST00000395925	T	0.13657	2.57	5.47	5.47	0.80525	.	0.399236	0.29972	N	0.010736	T	0.17152	0.0412	L	0.51422	1.61	0.80722	D	1	D	0.61080	0.989	P	0.46339	0.513	T	0.01007	-1.1483	10	0.33141	T	0.24	.	12.6518	0.56766	0.0:0.9245:0.0:0.0755	.	1045	P10071	GLI3_HUMAN	M	1045	ENSP00000379258:V1045M	ENSP00000379258:V1045M	V	-	1	0	GLI3	41972063	0.931000	0.31567	0.904000	0.35570	0.114000	0.19823	2.055000	0.41345	2.561000	0.86390	0.563000	0.77884	GTG		0.677	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
RBM33	155435	broad.mit.edu	37	7	155499656	155499656	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr7:155499656G>A	ENST00000401878.3	+	7	1040	c.842G>A	c.(841-843)gGt>gAt	p.G281D	RBM33_ENST00000486747.1_3'UTR	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	281							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G281D(1)		breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		CGGCGAGGAGGTCCGCTGATG	0.592																																					p.G281D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G842A	7						.						45.0	57.0	53.0					7																	155499656		2113	4228	6341	155192417	SO:0001583	missense	155435	exon7			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.842G>A	7.37:g.155499656G>A	ENSP00000384160:p.Gly281Asp		155192417	NM_053043	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	ENST00000401878.3	37	CCDS5941.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.23|19.23	3.788115|3.788115	0.70337|0.70337	.|.	.|.	ENSG00000184863|ENSG00000184863	ENST00000401878;ENST00000440108|ENST00000392761	T|.	0.51574|.	0.7|.	5.87|5.87	4.99|4.99	0.66335|0.66335	.|.	.|.	.|.	.|.	.|.	T|T	0.68824|0.68824	0.3043|0.3043	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	D|.	0.53312|.	0.959|.	P|.	0.48030|.	0.564|.	T|T	0.66728|0.66728	-0.5850|-0.5850	9|5	0.87932|.	D|.	0|.	.|.	17.1008|17.1008	0.86649|0.86649	0.0:0.1267:0.8733:0.0|0.0:0.1267:0.8733:0.0	.|.	281|.	Q96EV2|.	RBM33_HUMAN|.	D|I	281;172|53	ENSP00000384160:G281D|.	ENSP00000303878:G236D|.	G|V	+|+	2|1	0|0	RBM33|RBM33	155192417|155192417	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.947000|0.947000	0.59692|0.59692	5.097000|5.097000	0.64542|0.64542	1.478000|1.478000	0.48253|0.48253	0.655000|0.655000	0.94253|0.94253	GGT|GTC		0.592	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317225.3	NM_001008408	
RIMS2	9699	broad.mit.edu	37	8	104898169	104898169	+	Silent	SNP	T	T	C			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr8:104898169T>C	ENST00000436393.2	+	2	917	c.676T>C	c.(676-678)Ttg>Ctg	p.L226L	RIMS2_ENST00000507740.1_Silent_p.L256L|RIMS2_ENST00000262231.10_Silent_p.L256L|RIMS2_ENST00000406091.3_Silent_p.L448L			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	479					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.L256L(1)|p.L226L(1)|p.L484L(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TAGACCAGACTTGAGGCGTAC	0.463										HNSCC(12;0.0054)																											p.L448L												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.T1342C	8						.						102.0	94.0	97.0					8																	104898169		1929	4148	6077	104967345	SO:0001819	synonymous_variant	9699	exon4			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.676T>C	8.37:g.104898169T>C			104967345	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000436393.2	37																																																																																					0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
SGCZ	137868	broad.mit.edu	37	8	13948038	13948038	+	Missense_Mutation	SNP	C	C	T	rs139184216	byFrequency	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr8:13948038C>T	ENST00000382080.1	-	8	1568	c.853G>A	c.(853-855)Gtc>Atc	p.V285I	SGCZ_ENST00000421524.2_Missense_Mutation_p.V238I	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	272					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)		p.V285I(1)		NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		TTGGGGCAGACGCAGAGTTCA	0.483													C|||	3	0.000599042	0.0023	0.0	5008	,	,		19070	0.0		0.0	False		,,,				2504	0.0				p.V285I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G853A	8						.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	165.0	148.0	154.0		853	4.6	0.9	8	dbSNP_134	154	0,8600		0,0,4300	no	missense	SGCZ	NM_139167.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	285/313	13948038	1,13005	2203	4300	6503	13992409	SO:0001583	missense	137868	exon8			AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.853G>A	8.37:g.13948038C>T	ENSP00000371512:p.Val285Ile		13992409	NM_139167	Q6REU0	Missense_Mutation	SNP	ENST00000382080.1	37	CCDS5992.2	.	.	.	.	.	.	.	.	.	.	C	13.58	2.281049	0.40394	2.27E-4	0.0	ENSG00000185053	ENST00000382080;ENST00000421524	T;T	0.11712	2.75;2.75	5.5	4.62	0.57501	.	0.355880	0.32593	N	0.005885	T	0.09598	0.0236	L	0.38531	1.155	0.32046	N	0.5976	B;B	0.10296	0.001;0.003	B;B	0.12156	0.007;0.004	T	0.03608	-1.1020	10	0.45353	T	0.12	.	9.7575	0.40513	0.0:0.8437:0.0:0.1563	.	238;285	Q08AT0;Q96LD1-2	.;.	I	285;238	ENSP00000371512:V285I;ENSP00000405224:V238I	ENSP00000371512:V285I	V	-	1	0	SGCZ	13992409	0.994000	0.37717	0.872000	0.34217	0.825000	0.46686	3.103000	0.50298	1.464000	0.47987	0.655000	0.94253	GTC		0.483	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167	
ASAP1	50807	broad.mit.edu	37	8	131104265	131104265	+	Silent	SNP	G	G	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr8:131104265G>T	ENST00000518721.1	-	25	2753	c.2526C>A	c.(2524-2526)ccC>ccA	p.P842P	ASAP1_ENST00000357668.1_Silent_p.P842P	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	842	Pro-rich.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.P842P(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						GTAGTGGGCTGGGAGGGTCGG	0.607																																					p.P842P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2526A	8						.						108.0	117.0	114.0					8																	131104265		2203	4300	6503	131173447	SO:0001819	synonymous_variant	50807	exon24			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.2526C>A	8.37:g.131104265G>T			131173447	NM_018482	B2RNV3	Silent	SNP	ENST00000518721.1	37	CCDS6362.1	.	.	.	.	.	.	.	.	.	.	G	9.556	1.117200	0.20795	.	.	ENSG00000153317	ENST00000524124	.	.	.	5.3	4.3	0.51218	.	.	.	.	.	T	0.61375	0.2342	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57866	-0.7737	4	.	.	.	.	10.7268	0.46072	0.0:0.0:0.6385:0.3615	.	.	.	.	K	663	.	.	Q	-	1	0	ASAP1	131173447	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.867000	0.63013	2.639000	0.89480	0.455000	0.32223	CAG		0.607	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	
DLGAP2	9228	broad.mit.edu	37	8	1626779	1626779	+	Silent	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr8:1626779C>T	ENST00000421627.2	+	9	2582	c.2448C>T	c.(2446-2448)aaC>aaT	p.N816N	DLGAP2_ENST00000524065.1_3'UTR	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	895					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.N824N(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CGGAGGAGAACGACCTCTCGG	0.502																																					p.N816N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2448T	8						.						17.0	19.0	18.0					8																	1626779		1945	4138	6083	1614186	SO:0001819	synonymous_variant	9228	exon9			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2448C>T	8.37:g.1626779C>T			1614186	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Silent	SNP	ENST00000421627.2	37	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	c	0.028	-1.351684	0.01256	.	.	ENSG00000198010	ENST00000520901	.	.	.	5.33	-4.68	0.03309	.	.	.	.	.	T	0.54631	0.1870	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54193	-0.8330	4	.	.	.	-13.3362	11.5158	0.50520	0.0:0.1703:0.0948:0.7349	.	.	.	.	M	819	.	.	T	+	2	0	DLGAP2	1614186	0.811000	0.29063	0.054000	0.19295	0.058000	0.15608	-0.102000	0.10956	-1.209000	0.02631	-1.551000	0.00897	ACG		0.502	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
PHYHIP	9796	broad.mit.edu	37	8	22079354	22079354	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr8:22079354C>T	ENST00000321613.3	-	6	961	c.505G>A	c.(505-507)Ggc>Agc	p.G169S	PHYHIP_ENST00000454243.2_Missense_Mutation_p.G169S	NM_001099335.1	NP_001092805.1	Q92561	PHYIP_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein	169								p.G169S(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	10				Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0629)		CCGTGGCTGCCACTGTTGTCC	0.637																																					p.G169S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G505A	8						.						10.0	15.0	14.0					8																	22079354		2034	4169	6203	22135299	SO:0001583	missense	9796	exon5			D87463	CCDS43723.1	8p21.2	2010-02-17	2006-01-09		ENSG00000168490	ENSG00000168490			16865	protein-coding gene	gene with protein product		608511	"""phytanoyl-CoA hydroxylase interacting protein"", ""DYRK1A interacting protein 3"""	DYRK1AP3		9039502, 10686344	Standard	NM_014759		Approved	KIAA0273, PAHX-AP	uc003xbj.4	Q92561	OTTHUMG00000163776	ENST00000321613.3:c.505G>A	8.37:g.22079354C>T	ENSP00000320017:p.Gly169Ser		22135299	NM_014759	D3DSR1|Q8N4I9	Missense_Mutation	SNP	ENST00000321613.3	37	CCDS43723.1	.	.	.	.	.	.	.	.	.	.	C	33	5.260099	0.95368	.	.	ENSG00000168490	ENST00000321613;ENST00000454243;ENST00000456132;ENST00000523252	T;T	0.70045	-0.45;-0.45	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.83303	0.5225	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86202	0.1619	10	0.87932	D	0	-41.2106	17.1912	0.86880	0.0:1.0:0.0:0.0	.	169	Q92561	PHYIP_HUMAN	S	169;169;76;121	ENSP00000320017:G169S;ENSP00000415491:G169S	ENSP00000320017:G169S	G	-	1	0	PHYHIP	22135299	1.000000	0.71417	0.956000	0.39512	0.985000	0.73830	6.017000	0.70805	2.352000	0.79861	0.555000	0.69702	GGC		0.637	PHYHIP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000375388.1	NM_014759	
TNFRSF10C	8794	broad.mit.edu	37	8	22974405	22974405	+	Missense_Mutation	SNP	C	C	A	rs61736406	byFrequency	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr8:22974405C>A	ENST00000356864.3	+	5	1173	c.641C>A	c.(640-642)aCc>aAc	p.T214N	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.T112N	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	214					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.T214N(7)		endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GAGACAATGACCACCAGCCCG	0.612																																					p.T214N												.	.	7	Substitution - Missense(7)	prostate(4)|large_intestine(3)	c.C641A	8						.						63.0	71.0	68.0					8																	22974405		2203	4298	6501	23030350	SO:0001583	missense	8794	exon5			AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.641C>A	8.37:g.22974405C>A	ENSP00000349324:p.Thr214Asn		23030350	NM_003841	O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	ENST00000356864.3	37	CCDS6037.1	.	.	.	.	.	.	.	.	.	.	c	0.310	-0.968378	0.02232	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.61510	0.1;0.39	.	.	.	.	7739.210000	0.00166	N	0.000000	T	0.32164	0.0820	N	0.08118	0	0.09310	N	1	B	0.22909	0.077	B	0.06405	0.002	T	0.16719	-1.0393	9	0.37606	T	0.19	.	5.2848	0.15696	0.3272:0.6728:0.0:0.0	rs61736406	214	O14798	TR10C_HUMAN	N	214;112;214	ENSP00000349324:T214N;ENSP00000437612:T112N	ENSP00000349324:T214N	T	+	2	0	TNFRSF10C	23030350	0.033000	0.19621	0.001000	0.08648	0.141000	0.21300	0.550000	0.23345	-2.089000	0.00860	-2.399000	0.00225	ACC		0.612	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215134.3		
GPR124	25960	broad.mit.edu	37	8	37704486	37704486	+	IGR	SNP	A	A	C			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr8:37704486A>C	ENST00000412232.2	+	0	5651				BRF2_ENST00000520601.1_Missense_Mutation_p.L141R|BRF2_ENST00000220659.6_Missense_Mutation_p.L141R|BRF2_ENST00000521170.1_3'UTR	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124						central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L141R(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGCATACAACAGCGTGCAGAT	0.527																																					p.L141R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T422G	8						.						234.0	217.0	223.0					8																	37704486		2203	4300	6503	37823644	SO:0001628	intergenic_variant	55290	exon3			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182		8.37:g.37704486A>C			37823644	NM_018310	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	A	26.3	4.727085	0.89390	.	.	ENSG00000104221	ENST00000220659;ENST00000545765;ENST00000520601	.	.	.	5.54	5.54	0.83059	Cyclin-like (3);	0.000000	0.64402	D	0.000001	T	0.76765	0.4033	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.78768	-0.2075	9	0.62326	D	0.03	.	15.6748	0.77307	1.0:0.0:0.0:0.0	.	141	Q9HAW0	BRF2_HUMAN	R	141;118;141	.	ENSP00000220659:L141R	L	-	2	0	BRF2	37823644	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	8.556000	0.90697	2.114000	0.64651	0.454000	0.30748	CTG		0.527	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
MOS	4342	broad.mit.edu	37	8	57025929	57025929	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr8:57025929C>T	ENST00000311923.1	-	1	612	c.613G>A	c.(613-615)Gcg>Acg	p.A205T		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	205	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)	p.A205T(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			AAGATGTTCGCGGGCTTCAGG	0.483																																					p.A205T	Esophageal Squamous(124;373 2870 4778)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G613A	8						.						59.0	57.0	58.0					8																	57025929		2203	4300	6503	57188483	SO:0001583	missense	4342	exon1				CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.613G>A	8.37:g.57025929C>T	ENSP00000310722:p.Ala205Thr		57188483	NM_005372	Q3KPG9|Q3KPH0	Missense_Mutation	SNP	ENST00000311923.1	37	CCDS6164.1	.	.	.	.	.	.	.	.	.	.	C	34	5.364616	0.95877	.	.	ENSG00000172680	ENST00000311923	D	0.93712	-3.27	5.8	5.8	0.92144	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96207	0.8763	L	0.58428	1.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96170	0.9122	10	0.87932	D	0	.	20.0537	0.97638	0.0:1.0:0.0:0.0	.	205	P00540	MOS_HUMAN	T	205	ENSP00000310722:A205T	ENSP00000310722:A205T	A	-	1	0	MOS	57188483	1.000000	0.71417	0.180000	0.23079	0.992000	0.81027	6.074000	0.71253	2.758000	0.94735	0.561000	0.74099	GCG		0.483	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378174.1	NM_005372	
THEM6	51337	broad.mit.edu	37	8	143816749	143816749	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3972-01A-01W-0995-10	TCGA-AA-3972-10A-01W-0999-10	g.chr8:143816749G>T	ENST00000336138.3	+	2	663	c.519G>T	c.(517-519)gaG>gaT	p.E173D		NM_016647.2	NP_057731.1	Q8WUY1	THEM6_HUMAN	thioesterase superfamily member 6	173						extracellular region (GO:0005576)		p.E173D(1)									TGCAGGTGGAGCCCCCTGAGC	0.637																																					p.E173D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G519T	8						.						53.0	35.0	41.0					8																	143816749		2188	4268	6456	143813751	SO:0001583	missense	51337	exon2			BC001311	CCDS6386.1	8q24.3	2012-05-03	2012-04-13	2012-04-13	ENSG00000130193	ENSG00000130193			29656	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 55"""	C8orf55		12477932	Standard	XM_005250955		Approved	DSCD75	uc003yww.1	Q8WUY1	OTTHUMG00000164673	ENST00000336138.3:c.519G>T	8.37:g.143816749G>T	ENSP00000338607:p.Glu173Asp		143813751	NM_016647	B2RDN6|Q8NBN2|Q9NYI2	Missense_Mutation	SNP	ENST00000336138.3	37	CCDS6386.1	.	.	.	.	.	.	.	.	.	.	G	6.870	0.529966	0.13127	.	.	ENSG00000130193	ENST00000336138	T	0.42900	0.96	4.6	2.8	0.32819	.	0.071606	0.56097	D	0.000039	T	0.32496	0.0831	L	0.28608	0.87	0.80722	D	1	P;B	0.48407	0.91;0.116	P;B	0.47864	0.559;0.04	T	0.03315	-1.1049	10	0.23302	T	0.38	-12.5122	7.2613	0.26205	0.2082:0.0:0.7918:0.0	.	120;173	B4DWJ7;Q8WUY1	.;CH055_HUMAN	D	173	ENSP00000338607:E173D	ENSP00000338607:E173D	E	+	3	2	C8orf55	143813751	0.992000	0.36948	0.961000	0.40146	0.395000	0.30598	0.766000	0.26560	0.387000	0.25024	-0.251000	0.11542	GAG		0.637	THEM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379706.1	NM_016647	
