#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HPS1	3257	broad.mit.edu	37	10	100186986	100186987	+	Frame_Shift_Ins	INS	-	-	G	rs281865082|rs281865083		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr10:100186986_100186987insG	ENST00000325103.6	-	11	1205_1206	c.972_973insC	c.(970-975)cccatgfs	p.M325fs	HPS1_ENST00000467246.1_5'UTR|HPS1_ENST00000361490.4_Frame_Shift_Ins_p.M325fs	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	325					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)	p.M325fs*128(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		AGGGCATCCATGGGGGGGGTGC	0.574									Hermansky-Pudlak syndrome																												p.M325fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.973_974insC	10	GRCh37	CD982691|CI962292	HPS1	D|I		.			33,3769		3,27,1871						1.7	0.2			27	89,7175		13,63,3556	no	frameshift	HPS1	NM_000195.3		16,90,5427	A1A1,A1R,RR		1.2252,0.868,1.1025				122,10944				100176977	SO:0001589	frameshift_variant	3257	exon11	Familial Cancer Database	HPS, HPS1-8	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.973dupC	10.37:g.100186994_100186994dupG	ENSP00000326649:p.Met325fs		100176976	NM_000195	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Frame_Shift_Ins	INS	ENST00000325103.6	37	CCDS7475.1																																																																																				0.574	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049776.1	NM_000195, NM_182637, NM_182638, NM_182639	
PTEN	5728	broad.mit.edu	37	10	89711898	89711898	+	Silent	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr10:89711898G>A	ENST00000371953.3	+	6	1873	c.516G>A	c.(514-516)agG>agA	p.R172R		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	172	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(4)|p.V166fs*17(3)|p.G165fs*9(3)|p.Y27fs*1(2)|p.G165_*404del(1)|p.R172R(1)|p.R172fs*5(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CCAGTCAGAGGCGCTATGTGT	0.348		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.R172R		yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	.	57	Whole gene deletion(37)|Deletion - Frameshift(11)|Unknown(4)|Complex - frameshift(3)|Deletion - In frame(1)|Substitution - coding silent(1)	prostate(16)|central_nervous_system(13)|skin(8)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|endometrium(3)|breast(3)|ovary(3)|large_intestine(1)|soft_tissue(1)|urinary_tract(1)|kidney(1)	c.G516A	10						.						126.0	130.0	128.0					10																	89711898		2203	4300	6503	89701878	SO:0001819	synonymous_variant	5728	exon6	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.516G>A	10.37:g.89711898G>A			89701878	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Silent	SNP	ENST00000371953.3	37	CCDS31238.1																																																																																				0.348	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
MYOF	26509	broad.mit.edu	37	10	95069820	95069820	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr10:95069820A>T	ENST00000359263.4	-	53	6103	c.6104T>A	c.(6103-6105)cTt>cAt	p.L2035H	MYOF_ENST00000358334.5_Missense_Mutation_p.L2022H|MYOF_ENST00000371502.4_Missense_Mutation_p.L2025H|MYOF_ENST00000371501.4_Missense_Mutation_p.L2035H	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	2035					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)	p.L2035H(1)		NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CAGCAGGATAAGCAGGAACAG	0.547																																					p.L2022H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T6065A	10						.						75.0	83.0	80.0					10																	95069820		2175	4282	6457	95059810	SO:0001583	missense	26509	exon52			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.6104T>A	10.37:g.95069820A>T	ENSP00000352208:p.Leu2035His		95059810	NM_133337	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	A	18.25	3.582584	0.65992	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.85629	-2.0;-2.0;-2.01;-1.97	4.84	4.84	0.62591	.	0.381500	0.27609	N	0.018618	D	0.91868	0.7426	M	0.81942	2.565	0.50632	D	0.999883	D;D	0.71674	0.998;0.998	D;P	0.68621	0.959;0.885	D	0.93057	0.6471	10	0.87932	D	0	-5.8327	14.5892	0.68351	1.0:0.0:0.0:0.0	.	2022;2035	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	H	2022;2035;2035;2025	ENSP00000351094:L2022H;ENSP00000352208:L2035H;ENSP00000360556:L2035H;ENSP00000360557:L2025H	ENSP00000351094:L2022H	L	-	2	0	MYOF	95059810	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	7.325000	0.79124	2.012000	0.59069	0.459000	0.35465	CTT		0.547	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
NRXN2	9379	broad.mit.edu	37	11	64421196	64421197	+	Splice_Site	INS	-	-	G	rs561690501	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr11:64421196_64421197insG	ENST00000377551.1	-	11	2601		c.e11-2		NRXN2_ENST00000377559.3_Intron|AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000409571.1_Splice_Site|NRXN2_ENST00000265459.6_Splice_Site			Q9P2S2	NRX2A_HUMAN	neurexin 2						adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.?(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GCAGGCAGTCTGGGGGGGCCAT	0.589																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	11						.																																			64177773	SO:0001630	splice_region_variant	9379	.				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.2390-2->C	11.37:g.64421203_64421203dupG			64177772	.	A7E2C1|Q9Y2D6	Splice_Site	INS	ENST00000377551.1	37	CCDS8077.1																																																																																				0.589	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	Intron
MICAL2	9645	broad.mit.edu	37	11	12248653	12248653	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr11:12248653C>T	ENST00000256194.4	+	15	2258	c.1970C>T	c.(1969-1971)aCa>aTa	p.T657I	MICAL2_ENST00000537344.1_Missense_Mutation_p.T657I|MICAL2_ENST00000527546.1_Missense_Mutation_p.T657I|MICAL2_ENST00000342902.5_Missense_Mutation_p.T657I|MICAL2_ENST00000379612.3_Missense_Mutation_p.T657I	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	657					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)	p.T657I(1)		breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		CTCAACCTCACATTTCCAAGG	0.443																																					p.T657I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1970T	11						.						115.0	105.0	109.0					11																	12248653		2201	4294	6495	12205229	SO:0001583	missense	9645	exon15			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.1970C>T	11.37:g.12248653C>T	ENSP00000256194:p.Thr657Ile		12205229	NM_014632	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	37	CCDS7809.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393696	0.62066	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.61742	0.11;0.08;0.11;0.08;0.19	4.88	4.88	0.63580	.	0.191986	0.45361	D	0.000373	T	0.56819	0.2011	L	0.59436	1.845	0.44956	D	0.997974	B;P;B;B;B;B	0.34864	0.409;0.473;0.205;0.059;0.205;0.409	B;B;B;B;B;B	0.34489	0.122;0.135;0.021;0.025;0.035;0.184	T	0.61884	-0.6971	10	0.54805	T	0.06	.	17.843	0.88720	0.0:1.0:0.0:0.0	.	190;657;657;657;657;657	B4DYS3;G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;.;MICA2_HUMAN	I	657;190;657;657;657;657	ENSP00000441689:T657I;ENSP00000256194:T657I;ENSP00000433965:T657I;ENSP00000344894:T657I;ENSP00000368932:T657I	ENSP00000256194:T657I	T	+	2	0	MICAL2	12205229	0.997000	0.39634	0.994000	0.49952	0.992000	0.81027	3.935000	0.56560	2.535000	0.85469	0.655000	0.94253	ACA		0.443	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632	
SF3B2	10992	broad.mit.edu	37	11	65823020	65823020	+	Silent	SNP	G	G	A	rs201233817	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr11:65823020G>A	ENST00000322535.6	+	5	562	c.513G>A	c.(511-513)tcG>tcA	p.S171S	SF3B2_ENST00000528302.1_Intron|snoU13_ENST00000459530.1_RNA	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	171					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)	p.S171S(1)		breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						GAGATCATTCGCTGAAGGAAC	0.483													G|||	3	0.000599042	0.0008	0.0	5008	,	,		17100	0.002		0.0	False		,,,				2504	0.0				p.S171S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G513A	11						.	G		1,4401	2.1+/-5.4	0,1,2200	157.0	147.0	151.0		513	2.2	1.0	11		151	0,8590		0,0,4295	no	coding-synonymous	SF3B2	NM_006842.2		0,1,6495	AA,AG,GG		0.0,0.0227,0.0077		171/896	65823020	1,12991	2201	4295	6496	65579596	SO:0001819	synonymous_variant	10992	exon5			U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.513G>A	11.37:g.65823020G>A			65579596	NM_006842	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Silent	SNP	ENST00000322535.6	37	CCDS31612.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	9.668	1.146054	0.21288	2.27E-4	0.0	ENSG00000087365	ENST00000533421	.	.	.	4.71	2.2	0.27929	.	.	.	.	.	T	0.46776	0.1410	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34129	-0.9841	4	.	.	.	-5.455	3.9225	0.09250	0.668:0.2162:0.1158:0.0	.	.	.	.	H	124	.	.	R	+	2	0	SF3B2	65579596	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.664000	0.37439	0.904000	0.36572	-0.302000	0.09304	CGC		0.483	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
RELT	84957	broad.mit.edu	37	11	73103392	73103392	+	Silent	SNP	C	C	T	rs552980658		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr11:73103392C>T	ENST00000064780.2	+	6	765	c.504C>T	c.(502-504)atC>atT	p.I168I	RELT_ENST00000393580.2_Silent_p.I168I	NM_152222.1	NP_689408.1	Q969Z4	TR19L_HUMAN	RELT tumor necrosis factor receptor	168						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.I168I(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	12						TCATCGCCATCGTCCCTGTCT	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		16058	0.0		0.0	False		,,,				2504	0.001				p.I168I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C504T	11						.						66.0	66.0	66.0					11																	73103392		2200	4293	6493	72781040	SO:0001819	synonymous_variant	84957	exon6			AF319553	CCDS8222.1	11q13.2	2013-05-22	2007-06-14	2007-06-14		ENSG00000054967		"""Tumor necrosis factor receptor superfamily"""	13764	protein-coding gene	gene with protein product		611211	"""tumor necrosis factor receptor superfamily, member 19-like"""	TNFRSF19L		11313261, 16547002, 16950202, 16389068	Standard	NM_032871		Approved	FLJ14993	uc001otv.3	Q969Z4		ENST00000064780.2:c.504C>T	11.37:g.73103392C>T			72781040	NM_152222	Q86V34|Q96JU1|Q9BUX7	Silent	SNP	ENST00000064780.2	37	CCDS8222.1																																																																																				0.682	RELT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397380.2	NM_032871	
TENM4	26011	broad.mit.edu	37	11	78412996	78412996	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr11:78412996G>T	ENST00000278550.7	-	28	5124	c.4662C>A	c.(4660-4662)gaC>gaA	p.D1554E		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1554					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.D1554E(1)									TGTTCCCAAGGTCGGCCACGT	0.483																																					p.D1554E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4662A	11						.						86.0	94.0	91.0					11																	78412996		2133	4240	6373	78090644	SO:0001583	missense	26011	exon28			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.4662C>A	11.37:g.78412996G>T	ENSP00000278550:p.Asp1554Glu		78090644	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.079634	0.36662	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.91464	-2.85;0.84	5.11	2.04	0.26737	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.89259	0.6664	M	0.86740	2.835	0.47341	D	0.999398	B	0.14012	0.009	B	0.14578	0.011	D	0.83726	0.0195	9	.	.	.	.	7.2469	0.26127	0.4127:0.0:0.5873:0.0	.	1554	Q6N022	TEN4_HUMAN	E	1554;18	ENSP00000278550:D1554E;ENSP00000431711:D18E	.	D	-	3	2	ODZ4	78090644	0.984000	0.35163	0.997000	0.53966	0.954000	0.61252	0.184000	0.16939	0.739000	0.32628	0.650000	0.86243	GAC		0.483	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
TYR	7299	broad.mit.edu	37	11	88911358	88911358	+	Silent	SNP	G	G	A	rs376813190		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr11:88911358G>A	ENST00000263321.5	+	1	739	c.237G>A	c.(235-237)tcG>tcA	p.S79S	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	79			S -> L (in OCA1A). {ECO:0000269|PubMed:15146472}.		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.S79S(4)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	ACCGGGAGTCGTGGCCTTCCG	0.517																																					p.S79S												TYR,central_nervous_system,brain,Substitution - coding silent,0 	.	4	Substitution - coding silent(4)	large_intestine(2)|urinary_tract(1)|central_nervous_system(1)	c.G237A	11						.	G		1,4401	2.1+/-5.4	0,1,2200	47.0	43.0	44.0		237	-5.7	1.0	11		44	0,8598		0,0,4299	no	coding-synonymous	TYR	NM_000372.4		0,1,6499	AA,AG,GG		0.0,0.0227,0.0077		79/530	88911358	1,12999	2201	4299	6500	88551006	SO:0001819	synonymous_variant	7299	exon1			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.237G>A	11.37:g.88911358G>A			88551006	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Silent	SNP	ENST00000263321.5	37	CCDS8284.1																																																																																				0.517	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
CNTN5	53942	broad.mit.edu	37	11	99426989	99426989	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr11:99426989T>C	ENST00000524871.1	+	3	334	c.44T>C	c.(43-45)aTg>aCg	p.M15T	CNTN5_ENST00000528682.1_Missense_Mutation_p.M15T|CNTN5_ENST00000527185.1_Missense_Mutation_p.M15T|CNTN5_ENST00000418526.2_Missense_Mutation_p.M15T|CNTN5_ENST00000279463.3_Missense_Mutation_p.M15T	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	15					cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.M15T(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TCAGTCACCATGTGTCTTTCA	0.353																																					p.M15T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T44C	11						.						110.0	101.0	104.0					11																	99426989		1804	4024	5828	98932199	SO:0001583	missense	53942	exon3			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.44T>C	11.37:g.99426989T>C	ENSP00000435637:p.Met15Thr		98932199	NM_175566	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	T	2.824	-0.244081	0.05906	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000530458;ENST00000279463	T;T;T;T;T	0.54071	0.59;0.65;0.65;0.63;0.65	5.83	4.91	0.64330	.	.	.	.	.	T	0.29423	0.0733	N	0.08118	0	0.19575	N	0.999962	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.18147	-1.0346	9	0.15952	T	0.53	.	8.4238	0.32716	0.0778:0.0:0.7603:0.1619	.	15;15;15	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	T	15	ENSP00000433575:M15T;ENSP00000436185:M15T;ENSP00000435637:M15T;ENSP00000393229:M15T;ENSP00000279463:M15T	ENSP00000279463:M15T	M	+	2	0	CNTN5	98932199	1.000000	0.71417	0.575000	0.28536	0.428000	0.31595	2.198000	0.42705	1.433000	0.47394	-0.468000	0.05107	ATG		0.353	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
IL10RA	3587	broad.mit.edu	37	11	117869491	117869491	+	Missense_Mutation	SNP	A	A	T	rs3741310		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr11:117869491A>T	ENST00000227752.3	+	7	992	c.872A>T	c.(871-873)gAc>gTc	p.D291V	IL10RA_ENST00000545409.1_Missense_Mutation_p.D142V|IL10RA_ENST00000541785.1_Missense_Mutation_p.D271V|IL10RA_ENST00000533700.1_3'UTR	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	291					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.D291V(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		GAGACCCAAGACACCATCCAC	0.582																																					p.D291V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A872T	11						.						99.0	79.0	86.0					11																	117869491		2200	4296	6496	117374701	SO:0001583	missense	3587	exon7			U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.872A>T	11.37:g.117869491A>T	ENSP00000227752:p.Asp291Val		117374701	NM_001558	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	37	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.698108	0.88830	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000545409;ENST00000536858	T;T;T	0.19669	2.13;2.13;2.13	5.26	5.26	0.73747	.	0.646704	0.16647	N	0.205391	T	0.44074	0.1276	M	0.72894	2.215	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.988	T	0.15178	-1.0446	10	0.31617	T	0.26	-39.32	12.833	0.57756	1.0:0.0:0.0:0.0	.	271;291	F5GYV8;Q13651	.;I10R1_HUMAN	V	291;271;142;271	ENSP00000227752:D291V;ENSP00000441397:D271V;ENSP00000443019:D142V	ENSP00000227752:D291V	D	+	2	0	IL10RA	117374701	0.113000	0.22115	0.363000	0.25875	0.642000	0.38348	2.141000	0.42168	2.107000	0.64212	0.460000	0.39030	GAC		0.582	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
ALDH1L2	160428	broad.mit.edu	37	12	105464408	105464408	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr12:105464408C>A	ENST00000258494.9	-	3	508	c.368G>T	c.(367-369)gGc>gTc	p.G123V	RP11-61E11.1_ENST00000547750.1_RNA|ALDH1L2_ENST00000424857.2_Missense_Mutation_p.G123V	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	123	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.G123V(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						AATGATAGAGCCGTGCTTTGG	0.448																																					p.G123V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G368T	12						.						107.0	96.0	100.0					12																	105464408		2203	4300	6503	103988538	SO:0001583	missense	160428	exon3			AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.368G>T	12.37:g.105464408C>A	ENSP00000258494:p.Gly123Val		103988538	NM_001034173	Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	ENST00000258494.9	37	CCDS31891.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.845759	0.91197	.	.	ENSG00000136010	ENST00000258494;ENST00000424857	T;T	0.78126	-1.15;-1.15	5.27	5.27	0.74061	Formyl transferase, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.92244	0.7540	H	0.96547	3.84	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.94373	0.7597	10	0.87932	D	0	.	19.2583	0.93955	0.0:1.0:0.0:0.0	.	123	Q3SY69	AL1L2_HUMAN	V	123	ENSP00000258494:G123V;ENSP00000389608:G123V	ENSP00000258494:G123V	G	-	2	0	ALDH1L2	103988538	1.000000	0.71417	0.731000	0.30826	0.958000	0.62258	7.782000	0.85680	2.640000	0.89533	0.655000	0.94253	GGC		0.448	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406098.1	XM_090294	
CLEC2B	9976	broad.mit.edu	37	12	10005899	10005899	+	Nonstop_Mutation	SNP	T	T	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr12:10005899T>G	ENST00000228438.2	-	5	1383	c.450A>C	c.(448-450)taA>taC	p.*150Y	CLEC2B_ENST00000538152.1_Nonstop_Mutation_p.*81Y	NM_005127.2	NP_005118.2	Q92478	CLC2B_HUMAN	C-type lectin domain family 2, member B	0						integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.*150Y(1)		endometrium(1)|large_intestine(3)|lung(1)	5						AGACATTAACTTAGTGTATTC	0.358																																					p.X150Y												.	.	1	Nonstop extension(1)	large_intestine(1)	c.A450C	12						.						156.0	134.0	141.0					12																	10005899		2203	4300	6503	9897166	SO:0001578	stop_lost	9976	exon5			X96719	CCDS8605.1	12p13-p12	2005-02-09	2005-02-09	2005-02-09		ENSG00000110852		"""C-type lectin domain containing"""	2053	protein-coding gene	gene with protein product		603242	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced)"""	CLECSF2		9038101	Standard	NM_005127		Approved	AICL, HP10085	uc001qwn.3	Q92478		ENST00000228438.2:c.450A>C	12.37:g.10005899T>G			9897166	NM_005127	B2R9U1|Q8IZE9|Q9BS74|Q9UQB4	Nonstop_Mutation	SNP	ENST00000228438.2	37	CCDS8605.1	.	.	.	.	.	.	.	.	.	.	T	0.035	-1.311072	0.01342	.	.	ENSG00000110852	ENST00000228438;ENST00000538152	.	.	.	2.82	-5.65	0.02459	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.4349	0.04480	0.1561:0.4433:0.1587:0.2419	.	.	.	.	Y	150;81	.	.	X	-	3	2	CLEC2B	9897166	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.725000	0.04942	-1.657000	0.01492	-0.256000	0.11100	TAA		0.358	CLEC2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399881.1	NM_005127	
SLCO1B3	28234	broad.mit.edu	37	12	21036503	21036503	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr12:21036503C>G	ENST00000381545.3	+	13	1868	c.1649C>G	c.(1648-1650)aCa>aGa	p.T550R	SLCO1B7_ENST00000554957.1_Intron|SLCO1B3_ENST00000261196.2_Missense_Mutation_p.T550R|LST3_ENST00000540229.1_Missense_Mutation_p.T550R|LST3_ENST00000381541.3_Intron|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.T550R	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	550					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.T550R(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	TTCTCTGCAACAGGAGGTACC	0.348																																					p.T550R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1649G	12						.						104.0	102.0	103.0					12																	21036503		2203	4300	6503	20927770	SO:0001583	missense	28234	exon12				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1649C>G	12.37:g.21036503C>G	ENSP00000370956:p.Thr550Arg		20927770	NM_019844	E7EMT8|Q5JAR4	Missense_Mutation	SNP	ENST00000381545.3	37	CCDS8684.1	.	.	.	.	.	.	.	.	.	.	.	8.594	0.885213	0.17540	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000261196;ENST00000381545;ENST00000553473;ENST00000544370;ENST00000540229	T;T;T;T;T	0.81163	0.27;0.27;0.27;-1.46;0.27	3.58	-0.449	0.12226	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	2.361290	0.02161	N	0.058821	T	0.72374	0.3452	L	0.36672	1.1	0.09310	N	1	P;B;B	0.41313	0.745;0.045;0.045	B;B;B	0.39027	0.288;0.041;0.041	T	0.61163	-0.7118	10	0.72032	D	0.01	.	4.753	0.13070	0.0:0.1099:0.3762:0.5139	.	550;550;550	Q5JAR4;B3KP78;Q9NPD5	.;.;SO1B3_HUMAN	R	550;550;550;374;550	ENSP00000261196:T550R;ENSP00000370956:T550R;ENSP00000451758:T550R;ENSP00000443225:T374R;ENSP00000441269:T550R	ENSP00000441269:T550R	T	+	2	0	SLCO1B3;RP11-545J16.1	20927770	0.005000	0.15991	0.000000	0.03702	0.006000	0.05464	0.730000	0.26043	-0.278000	0.09180	-0.802000	0.03209	ACA		0.348	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844	
KRAS	3845	broad.mit.edu	37	12	25380254	25380254	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr12:25380254C>A	ENST00000256078.4	-	3	267	c.204G>T	c.(202-204)agG>agT	p.R68S	KRAS_ENST00000311936.3_Missense_Mutation_p.R68S|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000557334.1_Intron	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	68					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.R68S(2)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TGTACTGGTCCCTCATTGCAC	0.408		119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.R68S	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G204T	12						.						119.0	107.0	111.0					12																	25380254		2203	4300	6503	25271521	SO:0001583	missense	3845	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.204G>T	12.37:g.25380254C>A	ENSP00000256078:p.Arg68Ser		25271521	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091667	0.76756	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	T;T	0.80653	-1.4;-0.59	5.77	3.95	0.45737	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.87438	0.6177	M	0.66560	2.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.87687	0.2551	10	0.87932	D	0	.	11.8579	0.52449	0.0:0.8586:0.0:0.1414	.	68;68	P01116-2;P01116	.;RASK_HUMAN	S	68	ENSP00000308495:R68S;ENSP00000256078:R68S	ENSP00000256078:R68S	R	-	3	2	KRAS	25271521	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.532000	0.45659	0.897000	0.36392	0.655000	0.94253	AGG		0.408	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
KRT73	319101	broad.mit.edu	37	12	53012005	53012005	+	Missense_Mutation	SNP	C	C	T	rs199866943		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr12:53012005C>T	ENST00000305748.3	-	1	338	c.304G>A	c.(304-306)Ggg>Agg	p.G102R	RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	102	Gly-rich.|Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.G102R(1)|p.G102W(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGGATACCCCCGGGCGGGCAC	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15938	0.0		0.0	False		,,,				2504	0.0				p.G102R												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G304A	12						.						109.0	115.0	113.0					12																	53012005		2203	4300	6503	51298272	SO:0001583	missense	319101	exon1			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.304G>A	12.37:g.53012005C>T	ENSP00000307014:p.Gly102Arg		51298272	NM_175068	Q32MB2	Missense_Mutation	SNP	ENST00000305748.3	37	CCDS8834.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	10.72	1.429754	0.25726	.	.	ENSG00000186049	ENST00000305748	D	0.92299	-3.01	4.64	3.75	0.43078	.	0.000000	0.53938	D	0.000055	D	0.93360	0.7883	M	0.92367	3.3	0.30865	N	0.733057	P	0.47302	0.893	B	0.40741	0.339	D	0.92966	0.6393	10	0.72032	D	0.01	.	13.7729	0.63036	0.0:0.9237:0.0:0.0763	.	102	Q86Y46	K2C73_HUMAN	R	102	ENSP00000307014:G102R	ENSP00000307014:G102R	G	-	1	0	KRT73	51298272	0.013000	0.17824	0.801000	0.32222	0.004000	0.04260	2.627000	0.46469	1.276000	0.44395	-0.123000	0.14984	GGG		0.632	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068	
SLC16A7	9194	broad.mit.edu	37	12	60168668	60168668	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr12:60168668C>A	ENST00000261187.4	+	4	756	c.592C>A	c.(592-594)Ctt>Att	p.L198I	SLC16A7_ENST00000552432.1_Missense_Mutation_p.L198I|SLC16A7_ENST00000552024.1_Missense_Mutation_p.L198I|SLC16A7_ENST00000547379.1_Missense_Mutation_p.L198I|SLC16A7_ENST00000543448.1_Missense_Mutation_p.L99I	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	198					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.L198I(1)		endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	CATGAGACCCCTTGGACCCAA	0.403																																					p.L198I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C592A	12						.						49.0	49.0	49.0					12																	60168668		2203	4300	6503	58454935	SO:0001583	missense	9194	exon4			AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.592C>A	12.37:g.60168668C>A	ENSP00000261187:p.Leu198Ile		58454935	NM_004731	Q8NEM3|Q9UPB3	Missense_Mutation	SNP	ENST00000261187.4	37	CCDS8961.1	.	.	.	.	.	.	.	.	.	.	C	1.991	-0.431689	0.04669	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000548610;ENST00000261187;ENST00000543448;ENST00000548444	T;T;T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42;-1.42;-1.42	6.06	-4.27	0.03744	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.495222	0.22782	N	0.055701	T	0.51907	0.1702	N	0.04063	-0.285	0.19945	N	0.999948	B	0.06786	0.001	B	0.15870	0.014	T	0.46816	-0.9164	9	.	.	.	.	9.1585	0.37007	0.4254:0.2101:0.3645:0.0	.	198	O60669	MOT2_HUMAN	I	198;198;198;198;198;99;83	ENSP00000449547:L198I;ENSP00000448071:L198I;ENSP00000448742:L198I;ENSP00000446722:L198I;ENSP00000261187:L198I;ENSP00000443731:L99I;ENSP00000447814:L83I	.	L	+	1	0	SLC16A7	58454935	0.000000	0.05858	0.016000	0.15963	0.834000	0.47266	-0.165000	0.09968	-0.622000	0.05626	0.650000	0.86243	CTT		0.403	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731	
ZFC3H1	196441	broad.mit.edu	37	12	72025985	72025985	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr12:72025985G>A	ENST00000378743.3	-	15	3485	c.3127C>T	c.(3127-3129)Cga>Tga	p.R1043*		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1043					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R1043*(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GATCTTCTTCGCTCTCTGCTT	0.333																																					p.R1043X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3127T	12						.						153.0	146.0	149.0					12																	72025985		1826	4095	5921	70312252	SO:0001587	stop_gained	196441	exon15			AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.3127C>T	12.37:g.72025985G>A	ENSP00000368017:p.Arg1043*		70312252	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Nonsense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	G	41	8.661407	0.98905	.	.	ENSG00000133858	ENST00000378743	.	.	.	5.77	4.87	0.63330	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2057	0.65732	0.0:0.0:0.7139:0.2861	.	.	.	.	X	1043	.	ENSP00000368017:R1043X	R	-	1	2	ZFC3H1	70312252	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.478000	0.53158	1.531000	0.49152	0.585000	0.79938	CGA		0.333	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
OSBPL8	114882	broad.mit.edu	37	12	76765261	76765261	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr12:76765261T>G	ENST00000261183.3	-	19	2500	c.2021A>C	c.(2020-2022)aAa>aCa	p.K674T	OSBPL8_ENST00000393249.2_Missense_Mutation_p.K632T|OSBPL8_ENST00000393250.4_Missense_Mutation_p.K632T	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	674					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)	p.K674T(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						TTCTTCAAATTTTACAGTGTG	0.323																																					p.K674T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2021C	12						.						157.0	154.0	155.0					12																	76765261		2202	4298	6500	75289392	SO:0001583	missense	114882	exon19			AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.2021A>C	12.37:g.76765261T>G	ENSP00000261183:p.Lys674Thr		75289392	NM_020841	A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Missense_Mutation	SNP	ENST00000261183.3	37	CCDS31862.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.468942	0.43839	.	.	ENSG00000091039	ENST00000393249;ENST00000261183;ENST00000446075;ENST00000393250;ENST00000438913;ENST00000547540;ENST00000546946	T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62	5.51	5.51	0.81932	.	0.141737	0.64402	D	0.000004	T	0.22003	0.0530	N	0.12831	0.26	0.44417	D	0.997338	B;B	0.19073	0.033;0.025	B;B	0.25759	0.039;0.063	T	0.04946	-1.0916	10	0.49607	T	0.09	-22.2922	15.9189	0.79544	0.0:0.0:0.0:1.0	.	649;674	F8VUA7;Q9BZF1	.;OSBL8_HUMAN	T	632;674;659;632;674;674;649	ENSP00000376939:K632T;ENSP00000261183:K674T;ENSP00000376940:K632T;ENSP00000450238:K674T;ENSP00000447893:K649T	ENSP00000261183:K674T	K	-	2	0	OSBPL8	75289392	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.336000	0.52113	2.226000	0.72624	0.377000	0.23210	AAA		0.323	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406357.1	NM_020841	
DHX37	57647	broad.mit.edu	37	12	125451344	125451344	+	Missense_Mutation	SNP	C	C	G	rs142965739	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr12:125451344C>G	ENST00000308736.2	-	12	1683	c.1585G>C	c.(1585-1587)Gct>Cct	p.A529P	DHX37_ENST00000544745.1_Missense_Mutation_p.A316P	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	529	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.A529P(1)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CGTACCTCAGCCCGCGCCTTC	0.582																																					p.A529P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1585C	12						.						90.0	86.0	88.0					12																	125451344		2203	4300	6503	124017297	SO:0001583	missense	57647	exon12			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1585G>C	12.37:g.125451344C>G	ENSP00000311135:p.Ala529Pro		124017297	NM_032656	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	c	7.652	0.683072	0.14907	.	.	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.03358	4.04;3.96	3.75	2.85	0.33270	Helicase, C-terminal (1);	0.895712	0.09613	N	0.778621	T	0.02571	0.0078	N	0.04959	-0.14	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.48091	-0.9065	10	0.30078	T	0.28	-17.0004	12.1469	0.54028	0.0:0.905:0.0:0.095	.	529	Q8IY37	DHX37_HUMAN	P	529;316	ENSP00000311135:A529P;ENSP00000439009:A316P	ENSP00000311135:A529P	A	-	1	0	DHX37	124017297	0.057000	0.20700	0.004000	0.12327	0.037000	0.13140	0.607000	0.24209	0.586000	0.29626	-0.810000	0.03169	GCT		0.582	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
RXFP2	122042	broad.mit.edu	37	13	32349470	32349470	+	Silent	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr13:32349470C>T	ENST00000298386.2	+	7	656	c.585C>T	c.(583-585)aaC>aaT	p.N195N	RXFP2_ENST00000380314.1_Silent_p.N195N	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	195					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)	p.N195N(1)		cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		TCAACCACAACTGCATCACAA	0.373																																					p.N195N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C585T	13						.						210.0	175.0	187.0					13																	32349470		2203	4300	6503	31247470	SO:0001819	synonymous_variant	122042	exon7			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.585C>T	13.37:g.32349470C>T			31247470	NM_001166058	B1ALE9|Q3KU23	Silent	SNP	ENST00000298386.2	37	CCDS9342.1																																																																																				0.373	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
SLITRK1	114798	broad.mit.edu	37	13	84453921	84453921	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr13:84453921A>T	ENST00000377084.2	-	1	2607	c.1722T>A	c.(1720-1722)aaT>aaA	p.N574K		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	574	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.N574K(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		AGATCTCGTCATTGGAGAGGA	0.542																																					p.N574K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1722A	13						.						85.0	73.0	77.0					13																	84453921		2203	4300	6503	83351922	SO:0001583	missense	114798	exon1			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1722T>A	13.37:g.84453921A>T	ENSP00000366288:p.Asn574Lys		83351922	NM_052910	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	A	11.88	1.771099	0.31320	.	.	ENSG00000178235	ENST00000377084	T	0.51325	0.71	5.22	-1.21	0.09524	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.22820	0.0551	N	0.17474	0.49	0.50467	D	0.999874	B	0.25390	0.125	B	0.24006	0.05	T	0.20107	-1.0285	10	0.06625	T	0.88	-10.9755	9.4637	0.38800	0.6061:0.0:0.3939:0.0	.	574	Q96PX8	SLIK1_HUMAN	K	574	ENSP00000366288:N574K	ENSP00000366288:N574K	N	-	3	2	SLITRK1	83351922	0.816000	0.29132	0.997000	0.53966	0.999000	0.98932	-0.036000	0.12185	-0.122000	0.11766	0.533000	0.62120	AAT		0.542	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
MYO16	23026	broad.mit.edu	37	13	109475517	109475517	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr13:109475517G>A	ENST00000357550.2	+	8	963	c.922G>A	c.(922-924)Gaa>Aaa	p.E308K	MYO16_ENST00000251041.5_Missense_Mutation_p.E308K|MYO16_ENST00000356711.2_Missense_Mutation_p.E308K	NM_001198950.1	NP_001185879.1			myosin XVI									p.E308K(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GCTGAAAGCCGAAATTGCCTG	0.388																																					p.E330K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G988A	13						.						127.0	141.0	136.0					13																	109475517		2203	4300	6503	108273518	SO:0001583	missense	23026	exon9				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.922G>A	13.37:g.109475517G>A	ENSP00000350160:p.Glu308Lys		108273518	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.151074	0.78001	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857	T;T;T	0.80994	-1.44;-1.44;-1.18	5.36	5.36	0.76844	Ankyrin repeat-containing domain (2);	0.000000	0.41500	U	0.000861	D	0.89012	0.6594	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.981;0.994	D	0.88953	0.3388	9	.	.	.	.	16.2259	0.82288	0.0:0.0:1.0:0.0	.	308;308	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	K	308;308;308;308;96	ENSP00000349145:E308K;ENSP00000350160:E308K;ENSP00000251041:E308K	.	E	+	1	0	MYO16	108273518	1.000000	0.71417	0.096000	0.21009	0.907000	0.53573	6.052000	0.71080	2.504000	0.84457	0.591000	0.81541	GAA		0.388	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
PRKD1	5587	broad.mit.edu	37	14	30068292	30068292	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr14:30068292C>T	ENST00000331968.5	-	15	2336	c.2107G>A	c.(2107-2109)Gtt>Att	p.V703I	PRKD1_ENST00000415220.2_Missense_Mutation_p.V711I	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	703	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.V703I(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TCACAGTGAACGATATTTTTA	0.388																																					p.V703I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2107A	14						.						129.0	128.0	128.0					14																	30068292		2203	4300	6503	29138043	SO:0001583	missense	5587	exon15				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2107G>A	14.37:g.30068292C>T	ENSP00000333568:p.Val703Ile		29138043	NM_002742	A6NL64|B2RAF6	Missense_Mutation	SNP	ENST00000331968.5	37	CCDS9637.1	.	.	.	.	.	.	.	.	.	.	C	35	5.505666	0.96371	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	D;D	0.81579	-1.51;-1.51	5.58	5.58	0.84498	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.81451	0.4825	N	0.13140	0.3	0.80722	D	1	D	0.58970	0.984	P	0.60886	0.88	D	0.84005	0.0345	10	0.62326	D	0.03	-15.9558	19.9348	0.97133	0.0:1.0:0.0:0.0	.	703	Q15139	KPCD1_HUMAN	I	703;711	ENSP00000333568:V703I;ENSP00000390535:V711I	ENSP00000333568:V703I	V	-	1	0	PRKD1	29138043	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.720000	0.84759	2.789000	0.95967	0.591000	0.81541	GTT		0.388	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
HEATR4	399671	broad.mit.edu	37	14	73958552	73958552	+	Intron	DEL	A	A	-			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr14:73958552delA	ENST00000553558.1	-	17	3166				HEATR4_ENST00000560393.1_Intron|C14orf169_ENST00000531973.1_RNA|HEATR4_ENST00000334988.2_Intron	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4											breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		CCCTGAACCCACCCGGCCGCG	0.667																																					p.H277fs												.	.	0			c.830delA	14						.						12.0	13.0	12.0					14																	73958552		1968	4149	6117	73028305	SO:0001627	intron_variant	79697	exon1			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2844+1217T>-	14.37:g.73958552delA			73028305	NM_024644	B7Z7V9|E9KL41	Frame_Shift_Del	DEL	ENST00000553558.1	37	CCDS9815.2																																																																																				0.667	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309	
EML5	161436	broad.mit.edu	37	14	89124581	89124581	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr14:89124581T>A	ENST00000380664.5	-	26	3826	c.3827A>T	c.(3826-3828)aAa>aTa	p.K1276I	EML5_ENST00000352093.5_Missense_Mutation_p.K1238I|EML5_ENST00000554922.1_Missense_Mutation_p.K1276I			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1276						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)	p.K1276I(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						ACAAGGCCTTTTTTCTCGATA	0.388																																					p.K1276I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3827T	14						.						124.0	114.0	117.0					14																	89124581		1872	4102	5974	88194334	SO:0001583	missense	161436	exon26			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.3827A>T	14.37:g.89124581T>A	ENSP00000370039:p.Lys1276Ile		88194334	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	37	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	T	12.64	1.997986	0.35226	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.50277	0.99;0.75;1.03	4.61	0.899	0.19271	WD40 repeat-like-containing domain (1);	0.447569	0.24633	N	0.036862	T	0.30008	0.0751	L	0.34521	1.04	0.25532	N	0.987268	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.12502	-1.0545	10	0.34782	T	0.22	-8.9275	5.2577	0.15555	0.0:0.4141:0.1701:0.4157	.	1276;1276	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	I	1276;1238;1276	ENSP00000451998:K1276I;ENSP00000298315:K1238I;ENSP00000370039:K1276I	ENSP00000298315:K1238I	K	-	2	0	EML5	88194334	1.000000	0.71417	0.995000	0.50966	0.948000	0.59901	0.829000	0.27449	0.060000	0.16281	0.455000	0.32223	AAA		0.388	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
ATP10A	57194	broad.mit.edu	37	15	25963437	25963437	+	Silent	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr15:25963437C>T	ENST00000356865.6	-	8	1584	c.1473G>A	c.(1471-1473)cgG>cgA	p.R491R		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	491					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R491R(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TGTGCACCACCCGGACACTCT	0.687																																					p.R491R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1473A	15						.						30.0	29.0	29.0					15																	25963437		2199	4299	6498	23514530	SO:0001819	synonymous_variant	57194	exon8			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.1473G>A	15.37:g.25963437C>T			23514530	NM_024490	Q4G0S9|Q969I4	Silent	SNP	ENST00000356865.6	37	CCDS32178.1																																																																																				0.687	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
TMCO5A	145942	broad.mit.edu	37	15	38229148	38229148	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr15:38229148C>A	ENST00000319669.4	+	3	343	c.241C>A	c.(241-243)Ctg>Atg	p.L81M	TMCO5A_ENST00000558158.1_Missense_Mutation_p.L81M|TMCO5A_ENST00000559502.1_Missense_Mutation_p.L81M|TMCO5A_ENST00000540944.1_Missense_Mutation_p.L81M	NM_152453.2	NP_689666.2	Q8N6Q1	TMC5A_HUMAN	transmembrane and coiled-coil domains 5A	81						integral component of membrane (GO:0016021)		p.L81M(1)		central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	15						CTTGCAGGAGCTGGAGGAAGA	0.483																																					p.L81M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C241A	15						.						99.0	107.0	105.0					15																	38229148		2200	4297	6497	36016440	SO:0001583	missense	145942	exon3			BC029221	CCDS10046.1	15q14	2008-06-10	2008-06-10	2008-06-10	ENSG00000166069	ENSG00000166069			28558	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 5"""	TMCO5		12477932	Standard	NM_152453		Approved	MGC35118	uc001zjw.3	Q8N6Q1	OTTHUMG00000129787	ENST00000319669.4:c.241C>A	15.37:g.38229148C>A	ENSP00000327234:p.Leu81Met		36016440	NM_152453	Q8NA63	Missense_Mutation	SNP	ENST00000319669.4	37	CCDS10046.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.428009	0.43122	.	.	ENSG00000166069	ENST00000540944;ENST00000319669	.	.	.	4.52	-2.13	0.07144	.	0.305715	0.23664	N	0.045792	T	0.24044	0.0582	L	0.55103	1.725	0.26575	N	0.973496	P;P	0.46277	0.496;0.875	B;B	0.40825	0.178;0.341	T	0.18555	-1.0333	9	0.59425	D	0.04	0.82	1.0604	0.01599	0.2789:0.2816:0.2725:0.167	.	81;81	Q8N6Q1;Q8N6Q1-2	TMC5A_HUMAN;.	M	81	.	ENSP00000327234:L81M	L	+	1	2	TMCO5A	36016440	0.988000	0.35896	0.876000	0.34364	0.389000	0.30415	0.105000	0.15333	-0.358000	0.08162	-0.175000	0.13238	CTG		0.483	TMCO5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252012.1	NM_152453	
SPTBN5	51332	broad.mit.edu	37	15	42168313	42168313	+	Splice_Site	DEL	T	T	-			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr15:42168313delT	ENST00000320955.6	-	21	4348	c.4121delA	c.(4120-4122)cag>cg	p.Q1374fs		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1374					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GTCCCCCACCTGCTGCAGGGC	0.582																																					p.Q1339fs												.	.	0			c.4016delA	15						.						36.0	41.0	39.0					15																	42168313		2107	4241	6348	39955605	SO:0001630	splice_region_variant	51332	exon21			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.4122+1A>-	15.37:g.42168313delT			39955605	NM_016642		Frame_Shift_Del	DEL	ENST00000320955.6	37																																																																																					0.582	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	Frame_Shift_Del
SLCO3A1	28232	broad.mit.edu	37	15	92647678	92647678	+	Silent	SNP	C	C	T	rs367736458		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr15:92647678C>T	ENST00000318445.6	+	4	1129	c.915C>T	c.(913-915)tcC>tcT	p.S305S	SLCO3A1_ENST00000555549.1_3'UTR|SLCO3A1_ENST00000424469.2_Silent_p.S305S	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	305					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.S305S(2)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	CCATGCTCTCCGAAAGAGAAT	0.587																																					p.S305S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C915T	15						.	C	,	1,4395	2.1+/-5.4	0,1,2197	85.0	75.0	78.0		915,915	-0.9	1.0	15		78	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous	SLCO3A1	NM_001145044.1,NM_013272.3	,	0,1,6495	TT,TC,CC		0.0,0.0227,0.0077	,	305/693,305/711	92647678	1,12991	2198	4298	6496	90448682	SO:0001819	synonymous_variant	28232	exon4			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.915C>T	15.37:g.92647678C>T			90448682	NM_013272	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Silent	SNP	ENST00000318445.6	37	CCDS10371.1																																																																																				0.587	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272	
BCKDK	10295	broad.mit.edu	37	16	31123556	31123556	+	Silent	SNP	C	C	T	rs377552512		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr16:31123556C>T	ENST00000394951.1	+	13	1832	c.1209C>T	c.(1207-1209)atC>atT	p.I403I	BCKDK_ENST00000287507.3_3'UTR|BCKDK_ENST00000219794.6_Silent_p.I403I|BCKDK_ENST00000394950.3_3'UTR|AC135050.1_ENST00000517000.2_RNA			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	403	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)	p.I403I(1)		breast(1)|stomach(1)	2						TCCGCCACATCGATGGCCGGG	0.677																																					p.I403I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1209T	16						.	C	,	1,4393	2.1+/-5.4	0,1,2196	47.0	48.0	47.0		,1209	-7.9	0.6	16		47	0,8600		0,0,4300	no	utr-3,coding-synonymous	BCKDK	NM_001122957.1,NM_005881.2	,	0,1,6496	TT,TC,CC		0.0,0.0228,0.0077	,	,403/413	31123556	1,12993	2197	4300	6497	31031057	SO:0001819	synonymous_variant	10295	exon12			AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.1209C>T	16.37:g.31123556C>T			31031057	NM_005881	A8MY43|Q6FGL4|Q96G95|Q96IN5	Silent	SNP	ENST00000394951.1	37	CCDS10705.1																																																																																				0.677	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108514.1	NM_005881	
HEATR3	55027	broad.mit.edu	37	16	50118086	50118086	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr16:50118086G>A	ENST00000299192.7	+	9	1365	c.1174G>A	c.(1174-1176)Gaa>Aaa	p.E392K	HEATR3_ENST00000285767.4_Missense_Mutation_p.E306K|HEATR3_ENST00000564942.1_3'UTR	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	392								p.E392K(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						TAGCAGTGATGAAAGTGACGC	0.498																																					p.E392K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1174A	16						.						133.0	131.0	132.0					16																	50118086		2198	4300	6498	48675587	SO:0001583	missense	55027	exon9			BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.1174G>A	16.37:g.50118086G>A	ENSP00000299192:p.Glu392Lys		48675587	NM_182922	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Missense_Mutation	SNP	ENST00000299192.7	37	CCDS10739.1	.	.	.	.	.	.	.	.	.	.	G	35	5.461634	0.96240	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	T;T	0.34859	1.34;1.34	6.04	6.04	0.98038	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59418	0.2192	M	0.71581	2.175	0.80722	D	1	P;D	0.76494	0.949;0.999	B;D	0.80764	0.389;0.994	T	0.48536	-0.9027	10	0.11794	T	0.64	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	306;392	B7WNW7;Q7Z4Q2	.;HEAT3_HUMAN	K	306;392	ENSP00000285767:E306K;ENSP00000299192:E392K	ENSP00000285767:E306K	E	+	1	0	HEATR3	48675587	1.000000	0.71417	0.989000	0.46669	0.906000	0.53458	8.993000	0.93524	2.873000	0.98535	0.563000	0.77884	GAA		0.498	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	
PSMD7	5713	broad.mit.edu	37	16	74339609	74339617	+	In_Frame_Del	DEL	AGGAGAAAA	AGGAGAAAA	-	rs3208882|rs3208888		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	AGGAGAAAA	AGGAGAAAA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr16:74339609_74339617delAGGAGAAAA	ENST00000219313.4	+	7	1093_1101	c.953_961delAGGAGAAAA	c.(952-963)gaggagaaaaag>gag	p.EKK322del	AC009120.6_ENST00000565313.1_RNA|PSMD7_ENST00000540379.1_In_Frame_Del_p.EKK245del|AC009120.6_ENST00000566411.1_RNA	NM_002811.4	NP_002802.2	P51665	PSMD7_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 7	322	Glu/Lys-rich.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	protein homodimerization activity (GO:0042803)	p.E322_K324delEKK(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	15						gtaaagaaagaggagaaaaaggagaaaaa	0.33																																					p.318_321del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.953_961del	16						.																																			72897118	SO:0001651	inframe_deletion	5713	exon7			D50063	CCDS10910.1	16q22.3	2010-10-15	2007-07-06		ENSG00000103035	ENSG00000103035		"""Proteasome (prosome, macropain) subunits"""	9565	protein-coding gene	gene with protein product	"""Mov34 homolog"""	157970	"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog)"""			7755639	Standard	NM_002811		Approved	S12, P40, MOV34, Rpn8	uc002fcq.3	P51665	OTTHUMG00000137601	ENST00000219313.4:c.953_961delAGGAGAAAA	16.37:g.74339618_74339626delAGGAGAAAA	ENSP00000219313:p.Glu322_Lys324del		72897110	NM_002811	D3DWS9|Q6PKI2|Q96E97	In_Frame_Del	DEL	ENST00000219313.4	37	CCDS10910.1																																																																																				0.330	PSMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269010.2	NM_002811	
TIAF1	9220	broad.mit.edu	37	17	27401881	27401881	+	De_novo_Start_OutOfFrame	SNP	G	G	A	rs567111157		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr17:27401881G>A	ENST00000359450.6	-	0	3994				MYO18A_ENST00000354329.4_Silent_p.H2024H|MYO18A_ENST00000529578.1_5'UTR|MYO18A_ENST00000527372.1_Silent_p.H2024H|MYO18A_ENST00000533112.1_Silent_p.H1972H|MYO18A_ENST00000531253.1_Silent_p.H2009H|TIAF1_ENST00000408971.2_De_novo_Start_OutOfFrame	NM_004740.3	NP_004731.2	O95411	TIAF1_HUMAN	TGFB1-induced anti-apoptotic factor 1						apoptotic process (GO:0006915)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of apoptotic process (GO:0043066)	nucleus (GO:0005634)		p.H2024H(1)		kidney(1)|lung(1)|urinary_tract(1)	3	Lung NSC(42;0.015)		Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CGAGAGGGTCGTGCTCATCAT	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19028	0.0		0.0	False		,,,				2504	0.0				p.H2009H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6027T	17						.						137.0	143.0	141.0					17																	27401881		2129	4222	6351	24426007			9220	exon41			AF105277	CCDS32599.1	17q11.2	2006-08-07				ENSG00000221995			11803	protein-coding gene	gene with protein product		609517				9918798	Standard	NM_004740		Approved		uc002hdv.1	O95411		ENST00000359450.6:c.-664C>T	17.37:g.27401881G>A			24426007	NM_203318	A2RRE2|Q6PEG2	De_novo_Start_OutOfFrame	SNP	ENST00000359450.6	37	CCDS32599.1																																																																																				0.562	TIAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372394.2	NM_004740	
CCL7	6354	broad.mit.edu	37	17	32597315	32597315	+	Silent	SNP	A	A	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr17:32597315A>G	ENST00000378569.2	+	1	76	c.6A>G	c.(4-6)aaA>aaG	p.K2K	CCL7_ENST00000394630.3_Silent_p.K2K|CCL7_ENST00000394627.1_Silent_p.K2K|CCL7_ENST00000200307.4_Silent_p.K12K	NM_006273.2	NP_006264.2	P80098	CCL7_HUMAN	chemokine (C-C motif) ligand 7	2					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular response to ethanol (GO:0071361)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|immune response (GO:0006955)|inflammatory response (GO:0006954)|monocyte chemotaxis (GO:0002548)|positive regulation of cell migration (GO:0030335)|positive regulation of natural killer cell chemotaxis (GO:2000503)|regulation of cell shape (GO:0008360)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)	p.K2K(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		CCAACATGAAAGCCTCTGCAG	0.567																																					p.K2K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A6G	17						.						79.0	68.0	72.0					17																	32597315		2203	4300	6503	29621428	SO:0001819	synonymous_variant	6354	exon1			AF043338	CCDS11278.1	17q11.2-q12	2013-02-25	2002-08-22	2002-08-23	ENSG00000108688	ENSG00000108688		"""Chemokine ligands"", ""Endogenous ligands"""	10634	protein-coding gene	gene with protein product	"""monocyte chemoattractant protein 3"", ""monocyte chemotactic protein 3"""	158106	"""small inducible cytokine A7 (monocyte chemotactic protein 3)"""	SCYA6, SCYA7		8461011	Standard	NM_006273		Approved	MCP-3, NC28, FIC, MARC, MCP3	uc002hhz.4	P80098	OTTHUMG00000132889	ENST00000378569.2:c.6A>G	17.37:g.32597315A>G			29621428	NM_006273	Q569J6	Silent	SNP	ENST00000378569.2	37	CCDS11278.1																																																																																				0.567	CCL7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256386.2	NM_006273	
PLEKHH3	79990	broad.mit.edu	37	17	40828478	40828478	+	Missense_Mutation	SNP	T	T	C	rs575311542	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr17:40828478T>C	ENST00000591022.1	-	1	491	c.104A>G	c.(103-105)gAg>gGg	p.E35G	PLEKHH3_ENST00000412503.1_Missense_Mutation_p.E35G|PLEKHH3_ENST00000293349.6_Missense_Mutation_p.E35G|PLEKHH3_ENST00000456950.2_5'Flank	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	35					signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)		p.E35G(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GTCCTCGTCCTCGTCCCCGTC	0.672																																					p.E35G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A104G	17						.						4.0	5.0	5.0					17																	40828478		2131	4127	6258	38082004	SO:0001583	missense	79990	exon1			BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.104A>G	17.37:g.40828478T>C	ENSP00000468678:p.Glu35Gly		38082004	NM_024927	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Missense_Mutation	SNP	ENST00000591022.1	37	CCDS11434.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.548062	0.86022	.	.	ENSG00000068137	ENST00000293349;ENST00000412503	D;D	0.88586	-2.12;-2.4	4.66	4.66	0.58398	.	0.210334	0.23211	N	0.050676	D	0.86364	0.5915	N	0.22421	0.69	0.26818	N	0.968848	D;D	0.61697	0.99;0.982	P;P	0.53146	0.719;0.624	T	0.80372	-0.1410	10	0.56958	D	0.05	-12.2895	11.6126	0.51069	0.0:0.0:0.0:1.0	.	35;35	Q7Z736-2;Q7Z736	.;PKHH3_HUMAN	G	35	ENSP00000293349:E35G;ENSP00000411885:E35G	ENSP00000293349:E35G	E	-	2	0	PLEKHH3	38082004	0.678000	0.27586	1.000000	0.80357	0.934000	0.57294	0.813000	0.27225	1.719000	0.51432	0.460000	0.39030	GAG		0.672	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452332.1	NM_024927	
HOXB7	3217	broad.mit.edu	37	17	46685380	46685380	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr17:46685380G>A	ENST00000239165.7	-	2	576	c.478C>T	c.(478-480)Cgc>Tgc	p.R160C	HOXB7_ENST00000567101.2_5'UTR|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000491264.1_RNA|HOXB-AS3_ENST00000494420.1_RNA	NM_004502.3	NP_004493.3	P09629	HXB7_HUMAN	homeobox B7	160					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R160C(1)		NS(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	8						GTCAGGTAGCGATTGTAGTGA	0.557																																					p.R160C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C478T	17						.						92.0	92.0	92.0					17																	46685380		2203	4300	6503	44040379	SO:0001583	missense	3217	exon2				CCDS11532.1	17q21.32	2013-05-22	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	5118	protein-coding gene	gene with protein product		142962	"""homeo box B7"""	HOX2, HOX2C		1973146, 1358459	Standard	NM_004502		Approved		uc002inv.3	P09629	OTTHUMG00000170231	ENST00000239165.7:c.478C>T	17.37:g.46685380G>A	ENSP00000239165:p.Arg160Cys		44040379	NM_004502	A8K3N8|Q15957|Q53FN3|Q96BQ6	Missense_Mutation	SNP	ENST00000239165.7	37	CCDS11532.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137468	0.77775	.	.	ENSG00000120087	ENST00000239165	D	0.96745	-4.11	4.58	4.58	0.56647	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98425	0.9476	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.99671	1.0996	10	0.87932	D	0	.	17.1969	0.86895	0.0:0.0:1.0:0.0	.	160	P09629	HXB7_HUMAN	C	160	ENSP00000239165:R160C	ENSP00000239165:R160C	R	-	1	0	HOXB7	44040379	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.496000	0.60360	2.357000	0.79964	0.563000	0.77884	CGC		0.557	HOXB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358097.3		
SDK2	54549	broad.mit.edu	37	17	71410855	71410855	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr17:71410855A>C	ENST00000392650.3	-	18	2412	c.2412T>G	c.(2410-2412)aaT>aaG	p.N804K	SDK2_ENST00000388726.3_Missense_Mutation_p.N804K	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	804	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.N804K(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TGGTCGTGGAATTGGTGGCTT	0.612																																					p.N804K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2412G	17						.						101.0	83.0	89.0					17																	71410855		2203	4300	6503	68922450	SO:0001583	missense	54549	exon18			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.2412T>G	17.37:g.71410855A>C	ENSP00000376421:p.Asn804Lys		68922450	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	a	21.9	4.218439	0.79464	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.58210	0.35;0.35	5.39	-3.93	0.04143	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.75583	0.3869	M	0.93678	3.445	0.48395	D	0.999647	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.80830	-0.1207	10	0.72032	D	0.01	.	15.8246	0.78690	0.3203:0.0:0.6797:0.0	.	804;804	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	K	428;804;804;804	ENSP00000376421:N804K;ENSP00000373378:N804K	ENSP00000324967:N804K	N	-	3	2	SDK2	68922450	0.997000	0.39634	0.967000	0.41034	0.967000	0.64934	0.454000	0.21827	-0.787000	0.04510	-0.405000	0.06341	AAT		0.612	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
TP53	7157	broad.mit.edu	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr17:7577114C>T	ENST00000269305.4	-	8	1013	c.824G>A	c.(823-825)tGt>tAt	p.C275Y	TP53_ENST00000359597.4_Missense_Mutation_p.C275Y|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.C275Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C275Y|TP53_ENST00000445888.2_Missense_Mutation_p.C275Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C275Y	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-1 	.	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	c.G824A	17	GRCh37	CM076568|CM951234	TP53	M		.						71.0	61.0	64.0					17																	7577114		2203	4300	6503	7517839	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824G>A	17.37:g.7577114C>T	ENSP00000269305:p.Cys275Tyr		7517839	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605675	0.87157	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.997;0.997	D	0.96317	0.9233	10	0.87932	D	0	-17.2181	15.662	0.77193	0.0:1.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	Y	275;275;275;275;275;264;143	ENSP00000352610:C275Y;ENSP00000269305:C275Y;ENSP00000398846:C275Y;ENSP00000391127:C275Y;ENSP00000391478:C275Y;ENSP00000425104:C143Y	ENSP00000269305:C275Y	C	-	2	0	TP53	7517839	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	TGT		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ACOX1	51	broad.mit.edu	37	17	73951742	73951742	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr17:73951742C>T	ENST00000301608.4	-	6	739	c.679G>A	c.(679-681)Ggc>Agc	p.G227S	ACOX1_ENST00000293217.5_Missense_Mutation_p.G227S|ACOX1_ENST00000537812.1_Missense_Mutation_p.G189S|ACOX1_ENST00000591857.1_5'Flank	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	227					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)	p.G227S(1)		large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	AATTTGGGGCCGATGTCACCA	0.453																																					p.G227S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G679A	17						.						117.0	101.0	107.0					17																	73951742		2203	4300	6503	71463337	SO:0001583	missense	51	exon6			U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.679G>A	17.37:g.73951742C>T	ENSP00000301608:p.Gly227Ser		71463337	NM_007292	A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	ENST00000301608.4	37	CCDS11735.1	.	.	.	.	.	.	.	.	.	.	C	36	5.877637	0.97055	.	.	ENSG00000161533	ENST00000301608;ENST00000293217;ENST00000537812;ENST00000539791;ENST00000538781	T;T;T	0.63913	-0.07;-0.07;-0.07	5.87	5.87	0.94306	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.000000	0.85682	D	0.000000	D	0.86535	0.5956	H	0.95151	3.63	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.992;0.996	D	0.89220	0.3570	10	0.87932	D	0	-24.1552	20.5827	0.99408	0.0:1.0:0.0:0.0	.	159;189;227;227	F5H0M0;F5GYQ8;Q15067;Q15067-2	.;.;ACOX1_HUMAN;.	S	227;227;189;227;159	ENSP00000301608:G227S;ENSP00000293217:G227S;ENSP00000441257:G189S	ENSP00000293217:G227S	G	-	1	0	ACOX1	71463337	1.000000	0.71417	0.990000	0.47175	0.959000	0.62525	7.419000	0.80179	2.941000	0.99782	0.655000	0.94253	GGC		0.453	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439503.1		
ALOX15B	247	broad.mit.edu	37	17	7951863	7951863	+	Missense_Mutation	SNP	G	G	A	rs200284741	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr17:7951863G>A	ENST00000380183.4	+	14	2150	c.2011G>A	c.(2011-2013)Gag>Aag	p.E671K	ALOX15B_ENST00000572022.1_Missense_Mutation_p.E659K|ALOX15B_ENST00000573359.1_Missense_Mutation_p.E597K|ALOX15B_ENST00000380173.2_Missense_Mutation_p.E642K	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	671	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)	p.E671K(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						TCCCCTCATCGAGAACAGCGT	0.597																																					p.E642K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1924A	17						.						90.0	90.0	90.0					17																	7951863		2203	4300	6503	7892588	SO:0001583	missense	247	exon13			U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.2011G>A	17.37:g.7951863G>A	ENSP00000369530:p.Glu671Lys		7892588	NM_001039130	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	ENST00000380183.4	37	CCDS11128.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927700	0.73327	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	D;D	0.90261	-2.64;-2.64	3.76	3.76	0.43208	Lipoxygenase, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.96128	0.8738	M	0.92367	3.3	0.44539	D	0.99749	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.995;0.998;0.999;0.998	D	0.97053	0.9765	10	0.72032	D	0.01	-33.595	14.8492	0.70284	0.0:0.0:1.0:0.0	.	659;597;642;671	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	K	642;597;671	ENSP00000369520:E642K;ENSP00000369530:E671K	ENSP00000344337:E597K	E	+	1	0	ALOX15B	7892588	0.999000	0.42202	0.998000	0.56505	0.921000	0.55340	3.229000	0.51278	2.093000	0.63338	0.462000	0.41574	GAG		0.597	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2		
RNF213	57674	broad.mit.edu	37	17	78321469	78321469	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr17:78321469C>G	ENST00000582970.1	+	29	9477	c.9334C>G	c.(9334-9336)Ctc>Gtc	p.L3112V	RNF213_ENST00000508628.2_Missense_Mutation_p.L3161V|RNF213_ENST00000336301.6_Missense_Mutation_p.L1185V	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3112					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L1185V(1)|p.L3161V(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CTACGAGAGCCTCTACGACGC	0.552																																					p.L3161V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C9481G	17						.						86.0	86.0	86.0					17																	78321469		2203	4300	6503	75936064	SO:0001583	missense	57674	exon30			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9334C>G	17.37:g.78321469C>G	ENSP00000464087:p.Leu3112Val		75936064	NM_020914	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.097582	0.37048	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.45668	0.89	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000002	T	0.70885	0.3275	M	0.88570	2.965	0.38157	D	0.938925	D	0.67145	0.996	D	0.71870	0.975	T	0.79196	-0.1903	10	0.72032	D	0.01	.	18.9569	0.92662	0.0:1.0:0.0:0.0	.	1185	Q63HN8	RN213_HUMAN	V	3112;3161;1185	ENSP00000338218:L1185V	ENSP00000338218:L1185V	L	+	1	0	RNF213	75936064	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.790000	0.62453	2.542000	0.85734	0.563000	0.77884	CTC		0.552	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
RNF165	494470	broad.mit.edu	37	18	44036579	44036579	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr18:44036579C>A	ENST00000269439.7	+	8	1072	c.1021C>A	c.(1021-1023)Caa>Aaa	p.Q341K	RNF165_ENST00000543885.1_Missense_Mutation_p.Q149K	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	341							zinc ion binding (GO:0008270)	p.Q341K(1)		NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		CATTGAGACACAACTGGGAGC	0.572																																					p.Q341K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1021A	18						.						106.0	97.0	100.0					18																	44036579		2203	4300	6503	42290577	SO:0001583	missense	494470	exon8			BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.1021C>A	18.37:g.44036579C>A	ENSP00000269439:p.Gln341Lys		42290577	NM_152470	B3KVD1	Missense_Mutation	SNP	ENST00000269439.7	37	CCDS32823.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905040	0.52333	.	.	ENSG00000141622	ENST00000269439;ENST00000543885	T;T	0.67345	-0.21;-0.26	5.1	5.1	0.69264	.	0.000000	0.64402	D	0.000001	T	0.60064	0.2240	L	0.28608	0.87	0.80722	D	1	B	0.19200	0.034	B	0.27076	0.076	T	0.57843	-0.7741	10	0.51188	T	0.08	-2.7141	18.116	0.89555	0.0:1.0:0.0:0.0	.	341	Q6ZSG1	RN165_HUMAN	K	341;149	ENSP00000269439:Q341K;ENSP00000444285:Q149K	ENSP00000269439:Q341K	Q	+	1	0	RNF165	42290577	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.818000	0.86416	2.383000	0.81215	0.313000	0.20887	CAA		0.572	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445358.1	NM_152470	
PRKD2	25865	broad.mit.edu	37	19	47219558	47219559	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr19:47219558_47219559insG	ENST00000291281.4	-	1	294_295	c.69_70insC	c.(67-72)cccggcfs	p.G24fs	PRKD2_ENST00000600194.1_5'Flank|PRKD2_ENST00000433867.1_Frame_Shift_Ins_p.G24fs|PRKD2_ENST00000595515.1_Frame_Shift_Ins_p.G24fs|PRKD2_ENST00000601806.1_Intron			Q9BZL6	KPCD2_HUMAN	protein kinase D2	24					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.G24fs*60(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		TCTAGGCCGCCGGGGGGCGGAG	0.752																																					p.G24fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.70_71insC	19						.																																			51911399	SO:0001589	frameshift_variant	25865	exon2			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.70dupC	19.37:g.47219564_47219564dupG	ENSP00000291281:p.Gly24fs		51911398	NM_001079880	Q8TB08|Q9P0T6|Q9Y3X8	Frame_Shift_Ins	INS	ENST00000291281.4	37	CCDS12689.1																																																																																				0.752	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
NCAN	1463	broad.mit.edu	37	19	19349172	19349172	+	Missense_Mutation	SNP	G	G	A	rs376145430		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr19:19349172G>A	ENST00000252575.6	+	11	3460	c.3361G>A	c.(3361-3363)Ggc>Agc	p.G1121S	NCAN_ENST00000538881.1_Missense_Mutation_p.G572S	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1121	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.G1135S(1)|p.G1121S(1)		breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	CCGCCGCTCCGGCCACCTGAC	0.647																																					p.G1121S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3361A	19						.	G	SER/GLY	1,4403		0,1,2201	42.0	51.0	48.0		3361	4.8	0.9	19		48	0,8598		0,0,4299	no	missense	NCAN	NM_004386.2	56	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1121/1322	19349172	1,13001	2202	4299	6501	19210172	SO:0001583	missense	1463	exon11			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3361G>A	19.37:g.19349172G>A	ENSP00000252575:p.Gly1121Ser		19210172	NM_004386	Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	37	CCDS12397.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.885952	0.91814	2.27E-4	0.0	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	T;T	0.19938	2.11;2.11	4.75	4.75	0.60458	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.37669	N	0.001995	T	0.32556	0.0833	L	0.31065	0.9	0.53688	D	0.99997	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.991	T	0.02109	-1.1212	10	0.25106	T	0.35	-28.9715	15.3064	0.73995	0.0:0.0:1.0:0.0	.	1135;1121	Q4LE67;O14594	.;NCAN_HUMAN	S	1135;1121;572	ENSP00000252575:G1121S;ENSP00000442202:G572S	ENSP00000252575:G1121S	G	+	1	0	NCAN	19210172	1.000000	0.71417	0.922000	0.36590	0.781000	0.44180	6.288000	0.72679	2.464000	0.83262	0.561000	0.74099	GGC		0.647	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386	
ZNF429	353088	broad.mit.edu	37	19	21720365	21720365	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr19:21720365A>G	ENST00000358491.4	+	4	1718	c.1510A>G	c.(1510-1512)Agt>Ggt	p.S504G	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S504G(1)		endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						AAAAATTCATAGTGGAGAGAA	0.373																																					p.S504G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1510G	19						.						38.0	42.0	41.0					19																	21720365		2115	4256	6371	21512205	SO:0001583	missense	353088	exon4			AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1510A>G	19.37:g.21720365A>G	ENSP00000351280:p.Ser504Gly		21512205	NM_001001415	A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	37	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	7.886	0.731301	0.15507	.	.	ENSG00000197013	ENST00000358491	T	0.19669	2.13	0.81	0.81	0.18732	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19565	0.0470	L	0.46567	1.45	0.18873	N	0.999988	B	0.28783	0.222	B	0.33960	0.173	T	0.30357	-0.9981	9	0.87932	D	0	.	6.5745	0.22557	1.0:0.0:0.0:0.0	.	504	Q86V71	ZN429_HUMAN	G	504	ENSP00000351280:S504G	ENSP00000351280:S504G	S	+	1	0	ZNF429	21512205	0.965000	0.33210	0.622000	0.29159	0.622000	0.37654	4.626000	0.61269	0.156000	0.19299	0.155000	0.16302	AGT		0.373	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415	
HIPK4	147746	broad.mit.edu	37	19	40887059	40887059	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr19:40887059C>T	ENST00000291823.2	-	3	1123	c.839G>A	c.(838-840)cGc>cAc	p.R280H		NM_144685.3	NP_653286.2	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	280	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of signal transduction by p53 class mediator (GO:1901796)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R280H(2)		breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	20			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			ATACTTGCGGCGCTCCAATGG	0.627																																					p.R280H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G839A	19						.						36.0	33.0	34.0					19																	40887059		2193	4285	6478	45578899	SO:0001583	missense	147746	exon3			BC034501	CCDS12555.1	19q13.2	2008-02-05				ENSG00000160396			19007	protein-coding gene	gene with protein product		611712					Standard	NM_144685		Approved	FLJ32818	uc002onp.3	Q8NE63		ENST00000291823.2:c.839G>A	19.37:g.40887059C>T	ENSP00000291823:p.Arg280His		45578899	NM_144685	A8K863|Q96M54	Missense_Mutation	SNP	ENST00000291823.2	37	CCDS12555.1	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885890	0.72410	.	.	ENSG00000160396	ENST00000291823;ENST00000452139	T	0.67698	-0.28	5.67	5.67	0.87782	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000029	T	0.53094	0.1775	N	0.19112	0.55	0.39878	D	0.973599	P	0.43519	0.809	B	0.39379	0.298	T	0.56111	-0.8033	10	0.32370	T	0.25	.	16.6992	0.85344	0.0:1.0:0.0:0.0	.	280	Q8NE63	HIPK4_HUMAN	H	280;245	ENSP00000291823:R280H	ENSP00000291823:R280H	R	-	2	0	HIPK4	45578899	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	3.493000	0.53266	2.677000	0.91161	0.561000	0.74099	CGC		0.627	HIPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462593.1	NM_144685	
CATSPERD	257062	broad.mit.edu	37	19	5751773	5751773	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr19:5751773A>T	ENST00000381624.3	+	12	1164	c.1103A>T	c.(1102-1104)aAg>aTg	p.K368M	CATSPERD_ENST00000381614.2_Missense_Mutation_p.K26M	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	368					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)		p.K368M(1)									GATTTCCAGAAGTGCCTCGTG	0.493																																					p.K368M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1103T	19						.						66.0	62.0	63.0					19																	5751773		1882	4113	5995	5702773	SO:0001583	missense	257062	exon12			BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.1103A>T	19.37:g.5751773A>T	ENSP00000371037:p.Lys368Met		5702773	NM_152784	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	37	CCDS12149.2	.	.	.	.	.	.	.	.	.	.	A	15.61	2.885577	0.51908	.	.	ENSG00000174898	ENST00000394548;ENST00000381624;ENST00000381614	T;T	0.28895	1.59;1.59	3.53	1.13	0.20643	.	0.537282	0.14216	U	0.333722	T	0.41419	0.1158	L	0.54323	1.7	0.09310	N	1	D;D	0.89917	0.994;1.0	P;D	0.73380	0.896;0.98	T	0.19192	-1.0313	10	0.87932	D	0	-10.5065	2.1378	0.03767	0.5924:0.0:0.1555:0.2521	.	294;368	B7WNK5;Q86XM0	.;TM146_HUMAN	M	294;368;26	ENSP00000371037:K368M;ENSP00000371027:K26M	ENSP00000371027:K26M	K	+	2	0	TMEM146	5702773	0.137000	0.22531	0.013000	0.15412	0.420000	0.31355	0.423000	0.21313	0.558000	0.29135	0.372000	0.22366	AAG		0.493	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
ZNF473	25888	broad.mit.edu	37	19	50548739	50548739	+	Missense_Mutation	SNP	T	T	C	rs143412784		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr19:50548739T>C	ENST00000595661.1	+	6	1534	c.1039T>C	c.(1039-1041)Tat>Cat	p.Y347H	ZNF473_ENST00000601364.1_Intron|CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000270617.3_Missense_Mutation_p.Y347H|ZNF473_ENST00000445728.3_Missense_Mutation_p.Y335H|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000391821.2_Missense_Mutation_p.Y347H			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	347	Interaction with SLBP/pre-mRNA complex.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y347H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		TCGGAAACGCTATGAGTGTTC	0.483																																					p.Y347H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1039C	19						.	T	HIS/TYR,HIS/TYR	0,4406		0,0,2203	81.0	71.0	74.0		1039,1039	3.0	0.7	19	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ZNF473	NM_001006656.1,NM_015428.1	83,83	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,probably-damaging	347/872,347/872	50548739	1,13005	2203	4300	6503	55240551	SO:0001583	missense	25888	exon5			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.1039T>C	19.37:g.50548739T>C	ENSP00000472808:p.Tyr347His		55240551	NM_001006656	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	ENST00000595661.1	37	CCDS33077.1	.	.	.	.	.	.	.	.	.	.	T	18.07	3.542228	0.65198	0.0	1.16E-4	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.79141	-1.24;-1.24;-1.24	4.06	3.04	0.35103	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.191567	0.25991	N	0.027003	T	0.61553	0.2356	N	0.17278	0.47	0.31954	N	0.609293	B	0.27380	0.177	B	0.29942	0.109	T	0.65059	-0.6260	10	0.62326	D	0.03	-19.0446	7.9606	0.30068	0.0:0.1008:0.0:0.8992	.	347	Q8WTR7	ZN473_HUMAN	H	347;347;335	ENSP00000270617:Y347H;ENSP00000375697:Y347H;ENSP00000388961:Y335H	ENSP00000270617:Y347H	Y	+	1	0	ZNF473	55240551	0.005000	0.15991	0.685000	0.30070	0.056000	0.15407	1.216000	0.32443	0.908000	0.36671	-0.250000	0.11733	TAT		0.483	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390	
MUC16	94025	broad.mit.edu	37	19	9057760	9057760	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr19:9057760C>A	ENST00000397910.4	-	3	29889	c.29686G>T	c.(29686-29688)Gca>Tca	p.A9896S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9898	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.A9896S(1)|p.A5529S(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TAAAGGACTGCACTTGTTTCT	0.468																																					p.A9896S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G29686T	19						.						128.0	120.0	123.0					19																	9057760		1940	4149	6089	8918760	SO:0001583	missense	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29686G>T	19.37:g.9057760C>A	ENSP00000381008:p.Ala9896Ser		8918760	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	5.413	0.261331	0.10239	.	.	ENSG00000181143	ENST00000397910	T	0.02631	4.22	2.51	-5.01	0.02991	.	.	.	.	.	T	0.01320	0.0043	N	0.08118	0	.	.	.	B	0.20988	0.05	B	0.15870	0.014	T	0.47209	-0.9135	8	0.87932	D	0	.	0.3973	0.00420	0.3512:0.2736:0.1652:0.21	.	9896	B5ME49	.	S	9896	ENSP00000381008:A9896S	ENSP00000381008:A9896S	A	-	1	0	MUC16	8918760	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.429000	0.01025	-1.486000	0.01851	-0.484000	0.04775	GCA		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
LILRB1	10859	broad.mit.edu	37	19	55144531	55144531	+	Silent	SNP	C	C	T	rs201120319		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr19:55144531C>T	ENST00000396331.1	+	8	1380	c.1023C>T	c.(1021-1023)aaC>aaT	p.N341N	LILRB1_ENST00000396315.1_Silent_p.N341N|LILRB1_ENST00000427581.2_Silent_p.N377N|LILRB1_ENST00000434867.2_Silent_p.N341N|LILRB1_ENST00000448689.1_Silent_p.N341N|LILRB1_ENST00000396332.4_Silent_p.N341N|LILRB1_ENST00000396327.3_Silent_p.N341N|LILRB1_ENST00000396321.2_Silent_p.N341N|LILRB1_ENST00000324602.7_Silent_p.N341N|LILRB1_ENST00000418536.2_Silent_p.N341N|LILRB1_ENST00000396317.1_Silent_p.N341N	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	341	Ig-like C2-type 4.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.N341N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CAGGAGAGAACGTGACCCTGC	0.587										HNSCC(37;0.09)																											p.N341N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1023T	19						.	C	,,,	1,4405	2.1+/-5.4	0,1,2202	83.0	86.0	85.0		1023,1023,1023,1023	-4.5	0.6	19		85	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LILRB1	NM_001081637.1,NM_001081638.1,NM_001081639.1,NM_006669.3	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	341/653,341/652,341/652,341/651	55144531	1,13005	2203	4300	6503	59836343	SO:0001819	synonymous_variant	10859	exon7			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1023C>T	19.37:g.55144531C>T			59836343	NM_001081639	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	ENST00000396331.1	37	CCDS42617.1																																																																																				0.587	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
FCGR1A	2209	broad.mit.edu	37	1	149760030	149760030	+	Missense_Mutation	SNP	G	G	A	rs374578876		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:149760030G>A	ENST00000369168.4	+	4	470	c.416G>A	c.(415-417)cGa>cAa	p.R139Q	HIST2H2BF_ENST00000545683.1_Intron|RP11-196G18.21_ENST00000420462.1_RNA|RP11-196G18.3_ENST00000428289.1_RNA	NM_000566.3	NP_000557.1	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor (CD64)	139	Ig-like C2-type 2.				antibody-dependent cellular cytotoxicity (GO:0001788)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intracellular signal transduction (GO:0035556)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of phagocytosis (GO:0050766)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG receptor activity (GO:0019770)|receptor signaling protein activity (GO:0005057)	p.R139Q(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	10	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CTTTACTATCGAAATGGCAAA	0.468																																					p.R139Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G416A	1						.	G	GLN/ARG,	2,4400	2.1+/-5.4	0,2,2199	46.0	44.0	44.0		416,	-2.7	0.0	1		44	3,8557	2.2+/-6.3	0,3,4277	no	missense,intron	FCGR1A,HIST2H2BF	NM_000566.3,NM_001161334.1	43,	0,5,6476	AA,AG,GG		0.035,0.0454,0.0386	benign,	139/375,	149760030	5,12957	2201	4280	6481	148026654	SO:0001583	missense	2209	exon4			BC032634	CCDS933.1	1q21.2-q21.3	2014-09-17	2005-02-02		ENSG00000150337	ENSG00000150337		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3613	protein-coding gene	gene with protein product		146760	"""Fc fragment of IgG, high affinity Ia, receptor for (CD64)"""			8697799, 9763663	Standard	NM_000566		Approved	CD64, CD64A	uc001esp.4	P12314	OTTHUMG00000012089	ENST00000369168.4:c.416G>A	1.37:g.149760030G>A	ENSP00000358165:p.Arg139Gln		148026654	NM_000566	P12315|Q5QNW7|Q92495|Q92663	Missense_Mutation	SNP	ENST00000369168.4	37	CCDS933.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.078741	0.00375	4.54E-4	3.5E-4	ENSG00000150337	ENST00000444948;ENST00000369168	T;T	0.12879	2.64;2.64	4.0	-2.74	0.05932	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.777959	0.11196	N	0.589335	T	0.01092	0.0036	N	0.03084	-0.415	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.47315	-0.9127	10	0.17369	T	0.5	.	3.9545	0.09383	0.5045:0.0:0.3335:0.162	.	139	P12314	FCGR1_HUMAN	Q	47;139	ENSP00000394279:R47Q;ENSP00000358165:R139Q	ENSP00000358165:R139Q	R	+	2	0	FCGR1A	148026654	0.000000	0.05858	0.009000	0.14445	0.064000	0.16182	-0.710000	0.05024	-0.385000	0.07833	-1.468000	0.01013	CGA		0.468	FCGR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033446.1	NM_000566	
LCE1A	353131	broad.mit.edu	37	1	152800031	152800031	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:152800031A>G	ENST00000335123.2	+	1	83	c.83A>G	c.(82-84)aAg>aGg	p.K28R		NM_178348.2	NP_848125.1	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A	28	Cys-rich.				keratinization (GO:0031424)			p.K28R(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	8	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			cccactcctaagtgcccccca	0.662																																					p.K28R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A83G	1						.						59.0	65.0	63.0					1																	152800031		2203	4300	6503	151066655	SO:0001583	missense	353131	exon1				CCDS1028.1	1q21.3	2011-01-28			ENSG00000186844	ENSG00000186844		"""Late cornified envelopes"""	29459	protein-coding gene	gene with protein product		612603				11698679	Standard	NM_178348		Approved	LEP1	uc010pdw.2	Q5T7P2	OTTHUMG00000012447	ENST00000335123.2:c.83A>G	1.37:g.152800031A>G	ENSP00000334869:p.Lys28Arg		151066655	NM_178348		Missense_Mutation	SNP	ENST00000335123.2	37	CCDS1028.1	.	.	.	.	.	.	.	.	.	.	A	2.967	-0.213393	0.06140	.	.	ENSG00000186844	ENST00000368766;ENST00000335123	T;T	0.07908	3.15;3.15	4.02	4.02	0.46733	.	0.000000	0.37304	N	0.002142	T	0.18467	0.0443	M	0.86864	2.845	0.09310	N	1	D	0.67145	0.996	D	0.73708	0.981	T	0.04065	-1.0980	10	0.87932	D	0	.	9.4713	0.38844	1.0:0.0:0.0:0.0	.	28	Q5T7P2	LCE1A_HUMAN	R	28	ENSP00000357755:K28R;ENSP00000334869:K28R	ENSP00000334869:K28R	K	+	2	0	LCE1A	151066655	0.762000	0.28451	0.115000	0.21578	0.018000	0.09664	2.479000	0.45197	1.808000	0.52836	0.460000	0.39030	AAG		0.662	LCE1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034660.2	NM_178348	
TMEM79	84283	broad.mit.edu	37	1	156261183	156261183	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:156261183T>C	ENST00000405535.2	+	4	1150	c.979T>C	c.(979-981)Tac>Cac	p.Y327H	TMEM79_ENST00000295694.5_Missense_Mutation_p.Y327H|TMEM79_ENST00000357501.2_Missense_Mutation_p.L88P|C1orf85_ENST00000482579.1_5'Flank|TMEM79_ENST00000495881.1_3'UTR	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	327					cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)		p.Y327H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					TAGGCTGATCTACTGGCTGAC	0.587																																					p.Y327H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T979C	1						.						103.0	101.0	102.0					1																	156261183		2203	4300	6503	154527807	SO:0001583	missense	84283	exon4			BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.979T>C	1.37:g.156261183T>C	ENSP00000384748:p.Tyr327His		154527807	NM_032323	B2RE22|D3DVB8	Missense_Mutation	SNP	ENST00000405535.2	37	CCDS1138.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.1|20.1	3.940382|3.940382	0.73557|0.73557	.|.	.|.	ENSG00000163472|ENSG00000163472	ENST00000357501;ENST00000456810|ENST00000295694;ENST00000405535	.|T;T	.|0.64438	.|-0.1;-0.1	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.69415|0.69415	0.3108|0.3108	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.81914	.|0.995	T|T	0.74124|0.74124	-0.3766|-0.3766	6|10	0.87932|0.87932	D|D	0|0	-8.4093|-8.4093	14.8012|14.8012	0.69916|0.69916	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|327	.|Q9BSE2	.|TMM79_HUMAN	P|H	88|327	.|ENSP00000295694:Y327H;ENSP00000384748:Y327H	ENSP00000350100:L88P|ENSP00000295694:Y327H	L|Y	+|+	2|1	0|0	TMEM79|TMEM79	154527807|154527807	1.000000|1.000000	0.71417|0.71417	0.942000|0.942000	0.38095|0.38095	0.268000|0.268000	0.26511|0.26511	5.607000|5.607000	0.67648|0.67648	2.170000|2.170000	0.68504|0.68504	0.533000|0.533000	0.62120|0.62120	CTA|TAC		0.587	TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052101.1	NM_032323	
IQGAP3	128239	broad.mit.edu	37	1	156500097	156500097	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:156500097T>A	ENST00000361170.2	-	34	4214	c.4204A>T	c.(4204-4206)Aag>Tag	p.K1402*	snoU13_ENST00000458777.1_RNA	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1402					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.K1402*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ATCAGCTGCTTGTGGGCTGCT	0.622																																					p.K1402X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A4204T	1						.						51.0	51.0	51.0					1																	156500097		2203	4300	6503	154766721	SO:0001587	stop_gained	128239	exon34			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4204A>T	1.37:g.156500097T>A	ENSP00000354451:p.Lys1402*		154766721	NM_178229	Q5T3H8	Nonsense_Mutation	SNP	ENST00000361170.2	37	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	T	39	7.423731	0.98275	.	.	ENSG00000183856	ENST00000361170	.	.	.	4.5	-3.39	0.04868	.	0.850362	0.10709	N	0.643117	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-2.7742	9.7221	0.40308	0.0:0.1738:0.6315:0.1947	.	.	.	.	X	1402	.	ENSP00000354451:K1402X	K	-	1	0	IQGAP3	154766721	0.000000	0.05858	0.432000	0.26747	0.192000	0.23643	0.029000	0.13666	-0.368000	0.08040	0.459000	0.35465	AAG		0.622	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
SPTA1	6708	broad.mit.edu	37	1	158606472	158606472	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:158606472G>A	ENST00000368147.4	-	37	5449	c.5269C>T	c.(5269-5271)Cgc>Tgc	p.R1757C		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1757					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R1757C(2)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CCCTCTAGGCGTTTGTGCTTC	0.473																																					p.R1757C												.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.C5269T	1						.						119.0	116.0	117.0					1																	158606472		1866	4097	5963	156873096	SO:0001583	missense	6708	exon37			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5269C>T	1.37:g.158606472G>A	ENSP00000357129:p.Arg1757Cys		156873096	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146494	0.77888	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.53423	0.62;0.62	5.26	5.26	0.73747	.	.	.	.	.	T	0.66954	0.2842	M	0.84433	2.695	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.71163	-0.4673	9	0.66056	D	0.02	.	15.7406	0.77891	0.0:0.0:1.0:0.0	.	1757	P02549	SPTA1_HUMAN	C	1757	ENSP00000357130:R1757C;ENSP00000357129:R1757C	ENSP00000357129:R1757C	R	-	1	0	SPTA1	156873096	1.000000	0.71417	0.531000	0.27976	0.951000	0.60555	6.107000	0.71517	2.744000	0.94065	0.650000	0.86243	CGC		0.473	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
PRELP	5549	broad.mit.edu	37	1	203452396	203452396	+	Silent	SNP	C	C	T	rs562945346		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:203452396C>T	ENST00000343110.2	+	2	211	c.84C>T	c.(82-84)ccC>ccT	p.P28P		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	28					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.P28P(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			GACCAAGACCCGGGACTGGGC	0.652													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13411	0.0		0.0	False		,,,				2504	0.0				p.P28P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C84T	1						.						47.0	55.0	52.0					1																	203452396		2203	4300	6503	201719019	SO:0001819	synonymous_variant	5549	exon2			BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.84C>T	1.37:g.203452396C>T			201719019	NM_002725	Q6FG38	Silent	SNP	ENST00000343110.2	37	CCDS1438.1																																																																																				0.652	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087474.1	NM_002725	
SYT14	255928	broad.mit.edu	37	1	210334372	210334372	+	Silent	SNP	G	G	A	rs371789098		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:210334372G>A	ENST00000472886.1	+	8	1667	c.1653G>A	c.(1651-1653)gcG>gcA	p.A551A	SYT14_ENST00000537238.1_Silent_p.A513A|SYT14_ENST00000399639.2_3'UTR|SYT14_ENST00000367019.1_Silent_p.A570A|SYT14_ENST00000422431.1_Silent_p.A615A|SYT14_ENST00000367015.1_Silent_p.A513A|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000534859.1_Silent_p.A577A			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	551					cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)	p.A551A(2)		endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		GATGGCATGCGTTGCTAGAGT	0.403																																					p.A551A												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.G1653A	1						.	G	,,,	1,4405		0,1,2202	92.0	90.0	91.0		1845,1710,1788,1653	-9.3	0.0	1		91	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SYT14	NM_001146261.1,NM_001146262.1,NM_001146264.1,NM_153262.2	,,,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,,,	615/620,570/575,596/601,551/556	210334372	2,13004	2203	4300	6503	208400995	SO:0001819	synonymous_variant	255928	exon8			AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.1653G>A	1.37:g.210334372G>A			208400995	NM_153262	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Silent	SNP	ENST00000472886.1	37	CCDS31014.1																																																																																				0.403	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
NVL	4931	broad.mit.edu	37	1	224418933	224418933	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:224418933T>G	ENST00000281701.6	-	22	2780	c.2521A>C	c.(2521-2523)Aaa>Caa	p.K841Q	NVL_ENST00000469075.1_Missense_Mutation_p.K750Q|NVL_ENST00000391875.2_Missense_Mutation_p.K735Q|NVL_ENST00000482491.1_Missense_Mutation_p.K565Q|NVL_ENST00000340871.4_Missense_Mutation_p.K652Q	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	841						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.K841Q(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		CTTACCTTTTTTGATATAGAT	0.303																																					p.K841Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2521C	1						.						154.0	151.0	152.0					1																	224418933		2203	4300	6503	222485556	SO:0001583	missense	4931	exon22			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.2521A>C	1.37:g.224418933T>G	ENSP00000281701:p.Lys841Gln		222485556	NM_002533	B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	ENST00000281701.6	37	CCDS1541.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.08|12.08	1.831391|1.831391	0.32329|0.32329	.|.	.|.	ENSG00000143748|ENSG00000143748	ENST00000281701;ENST00000391875;ENST00000469075;ENST00000482491;ENST00000340871|ENST00000469968	D;D;D;D;D|.	0.97575|.	-4.44;-4.44;-4.44;-4.44;-4.44|.	5.79|5.79	2.13|2.13	0.27403|0.27403	.|.	0.306760|0.306760	0.39615|0.39615	N|N	0.001305|0.001305	T|T	0.41673|0.41673	0.1169|0.1169	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	B;B;B|.	0.25850|.	0.136;0.136;0.134|.	B;B;B|.	0.31016|.	0.09;0.123;0.07|.	T|T	0.11567|0.11567	-1.0582|-1.0582	10|6	0.35671|.	T|.	0.21|.	-0.8684|-0.8684	4.2217|4.2217	0.10561|0.10561	0.0:0.1709:0.1814:0.6477|0.0:0.1709:0.1814:0.6477	.|.	652;750;841|.	B4DMC4;B4DP98;O15381|.	.;.;NVL_HUMAN|.	Q|T	841;735;750;565;652|723	ENSP00000281701:K841Q;ENSP00000375747:K735Q;ENSP00000417826:K750Q;ENSP00000417213:K565Q;ENSP00000341362:K652Q|.	ENSP00000281701:K841Q|.	K|K	-|-	1|2	0|0	NVL|NVL	222485556|222485556	1.000000|1.000000	0.71417|0.71417	0.796000|0.796000	0.32109|0.32109	0.906000|0.906000	0.53458|0.53458	1.295000|1.295000	0.33377|0.33377	0.106000|0.106000	0.17784|0.17784	0.528000|0.528000	0.53228|0.53228	AAA|AAA		0.303	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533	
CCSAP	126731	broad.mit.edu	37	1	229460994	229460994	+	Silent	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:229460994C>T	ENST00000366687.1	-	3	852	c.801G>A	c.(799-801)tcG>tcA	p.S267S	CCSAP_ENST00000284617.2_Silent_p.S267S|RP4-803J11.2_ENST00000418348.1_RNA|CCSAP_ENST00000366686.1_Silent_p.S153S|CCSAP_ENST00000483092.1_5'UTR			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein	267					multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)		p.S267S(1)									AAGCTCTTGCCGAATAGCACC	0.428																																					p.S267S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G801A	1						.						152.0	143.0	146.0					1																	229460994		2203	4300	6503	227527617	SO:0001819	synonymous_variant	126731	exon4			BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.801G>A	1.37:g.229460994C>T			227527617	NM_145257	A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	Silent	SNP	ENST00000366687.1	37	CCDS1577.1																																																																																				0.428	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091839.1	NM_145257	
PCNXL2	80003	broad.mit.edu	37	1	233231607	233231607	+	Silent	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:233231607G>A	ENST00000258229.9	-	22	4074	c.3840C>T	c.(3838-3840)ctC>ctT	p.L1280L		NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1280						integral component of membrane (GO:0016021)		p.L1280L(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GCAGGTCCCCGAGCTGAAAGT	0.453																																					p.L1280L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3840T	1						.						54.0	54.0	54.0					1																	233231607		1922	4122	6044	231298230	SO:0001819	synonymous_variant	80003	exon22			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.3840C>T	1.37:g.233231607G>A			231298230	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Silent	SNP	ENST00000258229.9	37	CCDS44335.1																																																																																				0.453	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
SMPDL3B	27293	broad.mit.edu	37	1	28275598	28275598	+	Missense_Mutation	SNP	G	G	A	rs145333269		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:28275598G>A	ENST00000373894.3	+	3	489	c.298G>A	c.(298-300)Gat>Aat	p.D100N	SMPDL3B_ENST00000373888.4_Missense_Mutation_p.D100N|SMPDL3B_ENST00000549094.1_Missense_Mutation_p.D100N|RP11-460I13.2_ENST00000448015.1_RNA	NM_014474.2	NP_055289.2	Q92485	ASM3B_HUMAN	sphingomyelin phosphodiesterase, acid-like 3B	100					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)	p.D100N(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	16		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)		TCATGTGCCCGATGAGAAACT	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		21367	0.001		0.0	False		,,,				2504	0.0				p.D100N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G298A	1						.	G	ASN/ASP,ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	112.0	99.0	104.0		298,298	-4.7	0.0	1	dbSNP_134	104	0,8600		0,0,4300	no	missense,missense	SMPDL3B	NM_001009568.1,NM_014474.2	23,23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	100/374,100/456	28275598	1,13005	2203	4300	6503	28148185	SO:0001583	missense	27293	exon3			Y08134	CCDS30655.1, CCDS30656.1	1p35.3	2008-02-05			ENSG00000130768	ENSG00000130768			21416	protein-coding gene	gene with protein product							Standard	NM_014474		Approved	ASML3B	uc001bpg.3	Q92485	OTTHUMG00000003910	ENST00000373894.3:c.298G>A	1.37:g.28275598G>A	ENSP00000363001:p.Asp100Asn		28148185	NM_014474	B7ZB35|Q5T0Z0|Q96CB7	Missense_Mutation	SNP	ENST00000373894.3	37	CCDS30655.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	6.605	0.480045	0.12581	2.27E-4	0.0	ENSG00000130768	ENST00000373894;ENST00000373890;ENST00000411604;ENST00000373888;ENST00000549094;ENST00000412515	D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86	5.85	-4.74	0.03249	Metallophosphoesterase domain (1);	0.304925	0.42964	N	0.000640	T	0.71239	0.3316	N	0.26162	0.8	0.09310	N	1	B;B;B	0.26483	0.124;0.15;0.061	B;B;B	0.17433	0.013;0.015;0.018	T	0.53655	-0.8408	10	0.22706	T	0.39	-6.266	15.9703	0.80008	0.4267:0.0:0.5733:0.0	.	100;100;100	F8VWW8;Q92485;Q92485-2	.;ASM3B_HUMAN;.	N	100;130;130;100;100;100	ENSP00000363001:D100N;ENSP00000388092:D130N;ENSP00000362995:D100N;ENSP00000449450:D100N	ENSP00000362995:D100N	D	+	1	0	SMPDL3B	28148185	0.005000	0.15991	0.007000	0.13788	0.005000	0.04900	-0.092000	0.11129	-0.652000	0.05408	-0.150000	0.13652	GAT		0.527	SMPDL3B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011170.1	NM_014474	
C1orf50	79078	broad.mit.edu	37	1	43240424	43240424	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:43240424A>G	ENST00000372525.5	+	4	342	c.299A>G	c.(298-300)cAc>cGc	p.H100R	C1orf50_ENST00000468913.2_3'UTR|RP5-994D16.9_ENST00000447572.1_RNA|C1orf50_ENST00000536543.1_5'UTR	NM_024097.3	NP_077002.2	Q9BV19	CA050_HUMAN	chromosome 1 open reading frame 50	100								p.H100R(1)		large_intestine(2)|ovary(1)|pancreas(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GAAGATGCTCACAGAGATGCC	0.388																																					p.H100R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A299G	1						.						143.0	138.0	140.0					1																	43240424		2203	4300	6503	43013011	SO:0001583	missense	79078	exon4			BC001711	CCDS473.1	1p34.2	2012-06-25			ENSG00000164008	ENSG00000164008			28795	protein-coding gene	gene with protein product						12477932	Standard	NM_024097		Approved	MGC955	uc001cia.4	Q9BV19	OTTHUMG00000007568	ENST00000372525.5:c.299A>G	1.37:g.43240424A>G	ENSP00000361603:p.His100Arg		43013011	NM_024097		Missense_Mutation	SNP	ENST00000372525.5	37	CCDS473.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.453329	0.01071	.	.	ENSG00000164008	ENST00000372525	T	0.38722	1.12	6.17	-7.42	0.01388	.	0.616524	0.17376	N	0.176480	T	0.15305	0.0369	N	0.04203	-0.255	0.19945	N	0.999948	B	0.02656	0.0	B	0.01281	0.0	T	0.19224	-1.0312	9	0.20046	T	0.44	.	12.0735	0.53630	0.6894:0.0:0.2204:0.0902	.	100	Q9BV19	CA050_HUMAN	R	100	ENSP00000361603:H100R	ENSP00000361603:H100R	H	+	2	0	C1orf50	43013011	0.919000	0.31177	0.006000	0.13384	0.116000	0.19942	0.280000	0.18790	-1.445000	0.01948	-1.252000	0.01501	CAC		0.388	C1orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020001.2	NM_024097	
OR2T34	127068	broad.mit.edu	37	1	248737763	248737763	+	Missense_Mutation	SNP	G	G	A	rs200941698		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr1:248737763G>A	ENST00000328782.2	-	1	317	c.296C>T	c.(295-297)cCg>cTg	p.P99L		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P99L(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACAGCCTGACGGGGAAATGGT	0.552																																					p.P99L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C296T	1						.						72.0	64.0	67.0					1																	248737763		2141	4267	6408	246804386	SO:0001583	missense	127068	exon1			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.296C>T	1.37:g.248737763G>A	ENSP00000330904:p.Pro99Leu		246804386	NM_001001821	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	37	CCDS31120.1	.	.	.	.	.	.	.	.	.	.	.	0.009	-1.819519	0.00595	.	.	ENSG00000183310	ENST00000328782	T	0.00321	8.11	2.35	-4.69	0.03299	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.02103	-0.685	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.32798	-0.9893	9	0.32370	T	0.25	.	1.2233	0.01928	0.3852:0.1082:0.2909:0.2157	.	99	Q8NGX1	O2T34_HUMAN	L	99	ENSP00000330904:P99L	ENSP00000330904:P99L	P	-	2	0	OR2T34	246804386	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-1.198000	0.03035	-2.986000	0.00281	-0.879000	0.02964	CCG		0.552	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821	
SNPH	9751	broad.mit.edu	37	20	1277023	1277023	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr20:1277023T>A	ENST00000381873.3	+	3	244	c.8T>A	c.(7-9)aTg>aAg	p.M3K	SNPH_ENST00000381867.1_Missense_Mutation_p.M47K|RAD21L1_ENST00000402452.1_Missense_Mutation_p.H516Q|RAD21L1_ENST00000381882.2_Missense_Mutation_p.H516Q	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	3					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)	p.M3K(1)|p.H516Q(1)|p.M47K(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CTCATGGCCATGTCCCTGCCA	0.697																																					p.M3K												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.T8A	20						.						75.0	62.0	66.0					20																	1277023		2203	4300	6503	1225023	SO:0001583	missense	9751	exon3				CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.8T>A	20.37:g.1277023T>A	ENSP00000371297:p.Met3Lys		1225023	NM_014723	Q8IYI3	Missense_Mutation	SNP	ENST00000381873.3	37	CCDS13012.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.6|20.6	4.021516|4.021516	0.75275|0.75275	.|.	.|.	ENSG00000244588|ENSG00000101298	ENST00000402452;ENST00000381882|ENST00000381873;ENST00000381867	T;T|.	0.45668|.	0.89;0.89|.	4.29|4.29	4.29|4.29	0.51040|0.51040	.|.	.|0.073244	.|0.52532	.|D	.|0.000070	T|T	0.50599|0.50599	0.1625|0.1625	L|L	0.40543|0.40543	1.245|1.245	0.38324|0.38324	D|D	0.943619|0.943619	.|D;D	.|0.56968	.|0.978;0.978	.|P;P	.|0.50537	.|0.643;0.643	T|T	0.52852|0.52852	-0.8520|-0.8520	7|9	0.40728|0.31617	T|T	0.16|0.26	-30.6391|-30.6391	12.4355|12.4355	0.55596|0.55596	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|47;3	.|O15079-2;O15079	.|.;SNPH_HUMAN	Q|K	516|3;47	ENSP00000385925:H516Q;ENSP00000371306:H516Q|.	ENSP00000371306:H516Q|ENSP00000371291:M47K	H|M	+|+	3|2	2|0	RAD21L1|SNPH	1225023|1225023	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	3.928000|3.928000	0.56506|0.56506	1.914000|1.914000	0.55421|0.55421	0.459000|0.459000	0.35465|0.35465	CAT|ATG		0.697	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145240.2	NM_014723	
STK4	6789	broad.mit.edu	37	20	43629841	43629841	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr20:43629841C>T	ENST00000372806.3	+	9	1089	c.994C>T	c.(994-996)Cga>Tga	p.R332*	STK4_ENST00000396731.4_Nonsense_Mutation_p.R332*|STK4_ENST00000372801.1_Nonsense_Mutation_p.R332*|STK4_ENST00000499879.2_Nonsense_Mutation_p.R277*	NM_006282.2	NP_006273.1	Q13043	STK4_HUMAN	serine/threonine kinase 4	332					apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|cell morphogenesis (GO:0000902)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|keratinocyte differentiation (GO:0030216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.R332*(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Myeloproliferative disorder(115;0.0122)				CACGATGGTTCGAGCAGTGGG	0.443																																					p.R332X	GBM(187;1039 2137 11798 21916 33213)											.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C994T	20						.						129.0	106.0	114.0					20																	43629841		2203	4300	6503	43063255	SO:0001587	stop_gained	6789	exon9				CCDS13341.1	20q11.2-q13.2	2014-09-17			ENSG00000101109	ENSG00000101109			11408	protein-coding gene	gene with protein product	"""mammalian sterile 20-like 1"", ""yeast Ste20-like"", ""kinase responsive to stress 2"""	604965				8816758, 9545236, 11517310	Standard	NM_006282		Approved	MST1, KRS2, YSK3	uc002xnb.3	Q13043	OTTHUMG00000033059	ENST00000372806.3:c.994C>T	20.37:g.43629841C>T	ENSP00000361892:p.Arg332*		43063255	NM_006282	B2RCR8|Q15802|Q4G156|Q5H982|Q6PD60|Q9BR32|Q9NTZ4	Nonsense_Mutation	SNP	ENST00000372806.3	37	CCDS13341.1	.	.	.	.	.	.	.	.	.	.	C	37	6.199965	0.97371	.	.	ENSG00000101109	ENST00000372806;ENST00000396731;ENST00000372801;ENST00000499879	.	.	.	5.99	5.99	0.97316	.	0.069366	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.0966	0.81129	0.1416:0.8583:0.0:0.0	.	.	.	.	X	332;332;332;277	.	ENSP00000361887:R332X	R	+	1	2	STK4	43063255	0.983000	0.35010	1.000000	0.80357	0.998000	0.95712	1.790000	0.38734	2.840000	0.97914	0.655000	0.94253	CGA		0.443	STK4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080401.4	NM_006282	
SEMG1	6406	broad.mit.edu	37	20	43836326	43836326	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr20:43836326C>T	ENST00000372781.3	+	2	445	c.388C>T	c.(388-390)Cat>Tat	p.H130Y	SEMG1_ENST00000244069.6_Missense_Mutation_p.H130Y	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	130	Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)	p.H130Y(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				AGTTATACACCATAAAGGAGG	0.413																																					p.H130Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C388T	20						.						100.0	88.0	92.0					20																	43836326		2203	4300	6503	43269740	SO:0001583	missense	6406	exon2				CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.388C>T	20.37:g.43836326C>T	ENSP00000361867:p.His130Tyr		43269740	NM_003007	Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Missense_Mutation	SNP	ENST00000372781.3	37	CCDS13345.1	.	.	.	.	.	.	.	.	.	.	C	11.69	1.713527	0.30413	.	.	ENSG00000124233	ENST00000244069;ENST00000372781	T;T	0.08282	3.11;3.11	1.07	1.07	0.20283	.	.	.	.	.	T	0.21022	0.0506	M	0.73962	2.25	0.09310	N	1	D;P;D	0.61080	0.983;0.807;0.989	P;P;D	0.63113	0.811;0.728;0.911	T	0.05273	-1.0895	9	0.87932	D	0	.	5.4711	0.16670	0.0:1.0:0.0:0.0	.	130;130;130	P04279-2;P04279;E7EPD3	.;SEMG1_HUMAN;.	Y	130	ENSP00000244069:H130Y;ENSP00000361867:H130Y	ENSP00000244069:H130Y	H	+	1	0	SEMG1	43269740	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.234000	0.17930	0.871000	0.35750	0.557000	0.71058	CAT		0.413	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079416.3	NM_003007	
SEMG2	6407	broad.mit.edu	37	20	43851202	43851202	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr20:43851202C>T	ENST00000372769.3	+	2	1019	c.929C>T	c.(928-930)tCc>tTc	p.S310F		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	310	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)	p.S310F(1)		autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				AAAGATGTATCCAAAGGCAGC	0.408																																					p.S310F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C929T	20						.						88.0	82.0	84.0					20																	43851202		2203	4300	6503	43284616	SO:0001583	missense	6407	exon2				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.929C>T	20.37:g.43851202C>T	ENSP00000361855:p.Ser310Phe		43284616	NM_003008	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	37	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	C	1.223	-0.626266	0.03610	.	.	ENSG00000124157	ENST00000372769	T	0.10005	2.92	1.2	1.2	0.21068	.	.	.	.	.	T	0.16557	0.0398	L	0.60455	1.87	0.09310	N	1	D;B;B	0.58970	0.984;0.02;0.02	P;B;B	0.61328	0.887;0.047;0.047	T	0.11179	-1.0598	9	0.02654	T	1	.	5.7734	0.18265	0.0:1.0:0.0:0.0	.	310;310;310	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	F	310	ENSP00000361855:S310F	ENSP00000361855:S310F	S	+	2	0	SEMG2	43284616	0.001000	0.12720	0.001000	0.08648	0.005000	0.04900	0.218000	0.17622	0.964000	0.38108	0.411000	0.27672	TCC		0.408	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008	
CBLN4	140689	broad.mit.edu	37	20	54575884	54575884	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr20:54575884T>A	ENST00000064571.2	-	2	1611	c.311A>T	c.(310-312)aAt>aTt	p.N104I		NM_080617.5	NP_542184.1	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	104	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein secretion (GO:0009306)	cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)		p.N104I(1)		endometrium(2)|large_intestine(1)|lung(10)|ovary(3)|pancreas(1)	17			Colorectal(105;0.202)			TGTGAAAAAATTACCCACATT	0.318																																					p.N104I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A311T	20						.						96.0	97.0	97.0					20																	54575884		2203	4300	6503	54009291	SO:0001583	missense	140689	exon2			AY358527	CCDS13448.1	20q13	2004-08-19	2004-08-19	2004-08-19	ENSG00000054803	ENSG00000054803			16231	protein-coding gene	gene with protein product		615029	"""cerebellin precursor-like 1"""	CBLNL1			Standard	NM_080617		Approved	dJ885A10.1	uc002xxa.4	Q9NTU7	OTTHUMG00000032782	ENST00000064571.2:c.311A>T	20.37:g.54575884T>A	ENSP00000064571:p.Asn104Ile		54009291	NM_080617	A8K0S5	Missense_Mutation	SNP	ENST00000064571.2	37	CCDS13448.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.005734	0.74932	.	.	ENSG00000054803	ENST00000064571	T	0.41065	1.01	5.66	5.66	0.87406	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	T	0.62356	0.2421	M	0.92219	3.285	0.58432	D	0.999999	D	0.54397	0.966	P	0.52066	0.689	T	0.71889	-0.4456	10	0.72032	D	0.01	-10.2461	10.2673	0.43462	0.0:0.0737:0.0:0.9263	.	104	Q9NTU7	CBLN4_HUMAN	I	104	ENSP00000064571:N104I	ENSP00000064571:N104I	N	-	2	0	CBLN4	54009291	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.904000	0.56325	2.166000	0.68216	0.454000	0.30748	AAT		0.318	CBLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079783.2	NM_080617	
TIAM1	7074	broad.mit.edu	37	21	32598199	32598199	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr21:32598199G>A	ENST00000286827.3	-	8	2123	c.1652C>T	c.(1651-1653)gCg>gTg	p.A551V	TIAM1_ENST00000541036.1_Missense_Mutation_p.A551V|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	551					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A551V(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GTGGTGCCTCGCGACCGCAGT	0.512																																					p.A551V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1652T	21						.						121.0	111.0	114.0					21																	32598199		2203	4300	6503	31520070	SO:0001583	missense	7074	exon8				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1652C>T	21.37:g.32598199G>A	ENSP00000286827:p.Ala551Val		31520070	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	G	18.28	3.588277	0.66105	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.27402	1.67;1.67	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.55832	0.1945	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79784	0.993;0.99;0.983;0.99	T	0.61917	-0.6964	10	0.87932	D	0	.	17.4195	0.87511	0.0:0.0:1.0:0.0	.	551;551;392;551	F5GZ53;B7ZLR6;E9PD83;Q13009	.;.;.;TIAM1_HUMAN	V	551;392;551	ENSP00000286827:A551V;ENSP00000441570:A551V	ENSP00000286827:A551V	A	-	2	0	TIAM1	31520070	1.000000	0.71417	0.091000	0.20842	0.017000	0.09413	9.627000	0.98412	2.330000	0.79161	0.655000	0.94253	GCG		0.512	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
TUBA8	51807	broad.mit.edu	37	22	18607051	18607051	+	Silent	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr22:18607051C>T	ENST00000330423.3	+	3	428	c.355C>T	c.(355-357)Ctg>Ttg	p.L119L	TUBA8_ENST00000316027.6_Silent_p.L53L	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	119					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.L119L(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						TGACCTGGTGCTGGACCGCAT	0.602																																					p.L53L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C157T	22						.						77.0	62.0	67.0					22																	18607051		2203	4300	6503	16987051	SO:0001819	synonymous_variant	51807	exon3			AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.355C>T	22.37:g.18607051C>T			16987051	NM_001193414	B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Silent	SNP	ENST00000330423.3	37	CCDS13751.1																																																																																				0.602	TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316232.3	NM_018943	
KCNJ3	3760	broad.mit.edu	37	2	155711775	155711775	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr2:155711775G>A	ENST00000295101.2	+	3	1933	c.1456G>A	c.(1456-1458)Ggg>Agg	p.G486R		NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	486					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)	p.G486R(1)		breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	TAGGATGGAAGGGAACCTTCC	0.413																																					p.G486R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1456A	2						.						28.0	29.0	29.0					2																	155711775		2203	4300	6503	155420021	SO:0001583	missense	3760	exon3			U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.1456G>A	2.37:g.155711775G>A	ENSP00000295101:p.Gly486Arg		155420021	NM_002239	B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452548	0.84209	.	.	ENSG00000162989	ENST00000295101	D	0.89050	-2.46	5.66	5.66	0.87406	.	0.447066	0.21785	N	0.069153	D	0.86997	0.6068	N	0.19112	0.55	0.80722	D	1	P	0.48911	0.917	P	0.49226	0.603	D	0.88557	0.3120	10	0.72032	D	0.01	.	19.1131	0.93326	0.0:0.0:1.0:0.0	.	486	P48549	IRK3_HUMAN	R	486	ENSP00000295101:G486R	ENSP00000295101:G486R	G	+	1	0	KCNJ3	155420021	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.567000	0.82357	2.832000	0.97577	0.655000	0.94253	GGG		0.413	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239	
XIRP2	129446	broad.mit.edu	37	2	168104353	168104353	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr2:168104353A>G	ENST00000409195.1	+	9	6540	c.6451A>G	c.(6451-6453)Aaa>Gaa	p.K2151E	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.K2151E|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.K1929E|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1976	Pro-rich.				actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.K2151E(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CAAAAATATTAAAATATTAAC	0.413																																					p.K1929E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5785G	2						.						38.0	36.0	37.0					2																	168104353		1828	4080	5908	167812599	SO:0001583	missense	129446	exon7			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6451A>G	2.37:g.168104353A>G	ENSP00000386840:p.Lys2151Glu		167812599	NM_001199144	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	A	6.420	0.445693	0.12164	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.21734	1.99;1.99;1.99	5.66	1.96	0.26148	.	0.707951	0.13637	N	0.373257	T	0.16685	0.0401	L	0.56769	1.78	0.09310	N	1	B;B;B	0.17268	0.012;0.021;0.021	B;B;B	0.16289	0.006;0.015;0.015	T	0.40327	-0.9569	10	0.10902	T	0.67	-3.4512	5.3137	0.15845	0.5674:0.2826:0.1499:0.0	.	1976;1976;1929	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	E	2151;2151;1929	ENSP00000386840:K2151E;ENSP00000295237:K2151E;ENSP00000387255:K1929E	ENSP00000295237:K2151E	K	+	1	0	XIRP2	167812599	0.016000	0.18221	0.001000	0.08648	0.020000	0.10135	1.246000	0.32803	0.098000	0.17522	-0.263000	0.10527	AAA		0.413	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
EPAS1	2034	broad.mit.edu	37	2	46607639	46607639	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr2:46607639G>A	ENST00000263734.3	+	12	2338	c.1828G>A	c.(1828-1830)Gat>Aat	p.D610N		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	610					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)	p.D610N(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			CATCTTCTTTGATGCCGGAAG	0.612																																					p.D610N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1828A	2						.						75.0	87.0	83.0					2																	46607639		2203	4300	6503	46461143	SO:0001583	missense	2034	exon12			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1828G>A	2.37:g.46607639G>A	ENSP00000263734:p.Asp610Asn		46461143	NM_001430	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	37	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	G	9.584	1.124247	0.20959	.	.	ENSG00000116016	ENST00000263734	T	0.48522	0.81	5.18	4.28	0.50868	.	0.419826	0.25741	N	0.028608	T	0.19287	0.0463	N	0.03608	-0.345	0.32226	N	0.574625	B	0.02656	0.0	B	0.09377	0.004	T	0.19647	-1.0299	10	0.10111	T	0.7	.	6.0518	0.19789	0.3512:0.0:0.6488:0.0	.	610	Q99814	EPAS1_HUMAN	N	610	ENSP00000263734:D610N	ENSP00000263734:D610N	D	+	1	0	EPAS1	46461143	0.590000	0.26815	0.888000	0.34837	0.516000	0.34256	3.062000	0.49971	1.137000	0.42214	0.585000	0.79938	GAT		0.612	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250752.2	NM_001430	
LOXL3	84695	broad.mit.edu	37	2	74763574	74763574	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr2:74763574C>T	ENST00000264094.3	-	6	1008	c.937G>A	c.(937-939)Gcc>Acc	p.A313T	LOXL3_ENST00000409549.1_Missense_Mutation_p.A313T|LOXL3_ENST00000409249.1_Missense_Mutation_p.A313T|LOXL3_ENST00000409986.1_Missense_Mutation_p.A168T|LOXL3_ENST00000393937.2_Missense_Mutation_p.A168T	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	313	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.A313T(1)		endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						CCAGGGTGGGCGCCGCCCTTT	0.612																																					p.A313T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G937A	2						.						32.0	29.0	30.0					2																	74763574		2202	4300	6502	74617082	SO:0001583	missense	84695	exon6			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.937G>A	2.37:g.74763574C>T	ENSP00000264094:p.Ala313Thr		74617082	NM_032603	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	ENST00000264094.3	37	CCDS1953.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.26|17.26	3.344871|3.344871	0.61073|0.61073	.|.	.|.	ENSG00000115318|ENSG00000115318	ENST00000264094;ENST00000409249;ENST00000393937;ENST00000409549;ENST00000409986|ENST00000420535	T;T;T;T;T|.	0.34859|.	1.34;1.34;1.34;1.34;1.34|.	4.9|4.9	3.02|3.02	0.34903|0.34903	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);|.	0.184400|.	0.47455|.	D|.	0.000239|.	T|T	0.60702|0.60702	0.2289|0.2289	L|L	0.54908|0.54908	1.71|1.71	0.40857|0.40857	D|D	0.983807|0.983807	B;P;P;P|.	0.46064|.	0.209;0.535;0.872;0.837|.	B;B;P;B|.	0.47118|.	0.149;0.407;0.538;0.291|.	T|T	0.58126|0.58126	-0.7691|-0.7691	10|5	0.27082|.	T|.	0.32|.	.|.	11.6325|11.6325	0.51185|0.51185	0.3598:0.6402:0.0:0.0|0.3598:0.6402:0.0:0.0	.|.	168;313;168;313|.	B9A025;E7END4;Q6IPL7;P58215|.	.;.;.;LOXL3_HUMAN|.	T|H	313;313;168;313;168|39	ENSP00000264094:A313T;ENSP00000387103:A313T;ENSP00000377512:A168T;ENSP00000386696:A313T;ENSP00000386545:A168T|.	ENSP00000264094:A313T|.	A|R	-|-	1|2	0|0	LOXL3|LOXL3	74617082|74617082	0.315000|0.315000	0.24571|0.24571	0.630000|0.630000	0.29268|0.29268	0.674000|0.674000	0.39518|0.39518	1.151000|1.151000	0.31651|0.31651	0.710000|0.710000	0.31997|0.31997	0.563000|0.563000	0.77884|0.77884	GCC|CGC		0.612	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603	
TRABD2A	129293	broad.mit.edu	37	2	85108089	85108089	+	Silent	SNP	C	C	T	rs534782823	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr2:85108089C>T	ENST00000409520.2	-	1	117	c.75G>A	c.(73-75)gcG>gcA	p.A25A	TRABD2A_ENST00000409133.1_Silent_p.A25A|TRABD2A_ENST00000335459.5_Silent_p.A25A	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	25					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)	p.A25A(2)									CGGTGCCGGGCGCCCCGCGCC	0.701																																					p.A25A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G75A	2						.						7.0	10.0	9.0					2																	85108089		1829	4027	5856	84961600	SO:0001819	synonymous_variant	129293	exon1			BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.75G>A	2.37:g.85108089C>T			84961600	NM_001080824	B4DKK8|I6UMB9	Silent	SNP	ENST00000409520.2	37																																																																																					0.701	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001080824	
TTN	7273	broad.mit.edu	37	2	179444479	179444479	+	Missense_Mutation	SNP	C	C	T	rs200146608	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr2:179444479C>T	ENST00000591111.1	-	269	62746	c.62522G>A	c.(62521-62523)cGg>cAg	p.R20841Q	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R13542Q|TTN_ENST00000460472.2_Missense_Mutation_p.R13417Q|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R22482Q|TTN_ENST00000342175.6_Missense_Mutation_p.R13609Q|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R19914Q|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20841	Fibronectin type-III 51. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R13417Q(1)|p.R19912Q(1)|p.R13609Q(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCAATAATCCGACTTCCACC	0.413													C|||	2	0.000399361	0.0008	0.0	5008	,	,		20808	0.001		0.0	False		,,,				2504	0.0				p.G13417R												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G40249A	2						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	2,3798		0,2,1898	105.0	99.0	101.0		40250,59741,40625,40826	5.2	1.0	2		101	0,8240		0,0,4120	yes	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	43,43,43,43	0,2,6018	TT,TC,CC		0.0,0.0526,0.0166	probably-damaging,probably-damaging,probably-damaging,probably-damaging	13417/26927,19914/33424,13542/27052,13609/27119	179444479	2,12038	1900	4120	6020	179152725	SO:0001583	missense	7273	exon147			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.62522G>A	2.37:g.179444479C>T	ENSP00000465570:p.Arg20841Gln		179152725	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	12.99	2.102471	0.37145	5.26E-4	0.0	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.25	5.25	0.73442	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55049	0.1896	L	0.32530	0.975	0.45415	D	0.998398	D;D;D;D	0.63046	0.992;0.992;0.992;0.992	P;P;P;P	0.50617	0.646;0.646;0.646;0.646	T	0.60105	-0.7328	9	0.87932	D	0	.	19.1902	0.93663	0.0:1.0:0.0:0.0	.	13417;13542;13609;20841	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	19914;13417;13609;13542;13415	ENSP00000343764:R19914Q;ENSP00000434586:R13417Q;ENSP00000340554:R13609Q;ENSP00000352154:R13542Q	ENSP00000340554:R13609Q	R	-	2	0	TTN	179152725	1.000000	0.71417	0.999000	0.59377	0.792000	0.44763	2.517000	0.45529	2.602000	0.87976	0.313000	0.20887	CGG		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
MUC4	4585	broad.mit.edu	37	3	195512373	195512374	+	In_Frame_Ins	INS	-	-	GAT	rs112774151|rs63118461		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr3:195512373_195512374insGAT	ENST00000463781.3	-	2	6536_6537	c.6077_6078insATC	c.(6076-6078)tcc>tcATCc	p.2026_2026S>SS	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_In_Frame_Ins_p.2026_2026S>SS	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S2026_T2027insS(3)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTCACCAGTGGATGCTGAGGA	0.579																																					p.S2026delinsSS												.	.	3	Insertion - In frame(3)	large_intestine(2)|breast(1)	c.6078_6079insATC	3						.		,,	1110,2296		177,756,770					,,		0.0		dbSNP_130	24	1888,5346		82,1724,1811	no	intron,coding,intron	MUC4	NM_138297.4,NM_018406.6,NM_004532.5	,,	259,2480,2581	A1A1,A1R,RR		26.099,32.5895,28.1767	,,	,,		2998,7642				196996769	SO:0001652	inframe_insertion	4585	exon2			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6075_6077dupATC	3.37:g.195512374_195512376dupGAT	ENSP00000417498:p.Ser2026dup		196996768	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	In_Frame_Ins	INS	ENST00000463781.3	37	CCDS54700.1																																																																																				0.579	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
UPK1B	7348	broad.mit.edu	37	3	118906628	118906628	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr3:118906628G>A	ENST00000264234.3	+	3	225	c.76G>A	c.(76-78)Ggc>Agc	p.G26S	UPK1B_ENST00000460625.1_Missense_Mutation_p.G26S|RP11-484M3.5_ENST00000490594.1_Missense_Mutation_p.G74S|UPK1B_ENST00000497685.1_5'UTR	NM_006952.3	NP_008883.2	O75841	UPK1B_HUMAN	uroplakin 1B	26					epithelial cell differentiation (GO:0030855)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)	p.G26S(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	14				GBM - Glioblastoma multiforme(114;0.222)		CCAGTGTTGCGGCATTGCCCT	0.562																																					p.G26S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G76A	3						.						155.0	132.0	140.0					3																	118906628		2203	4300	6503	120389318	SO:0001583	missense	7348	exon3			AF082888	CCDS2985.1	3q13.32	2013-02-14			ENSG00000114638	ENSG00000114638		"""Tetraspanins"""	12578	protein-coding gene	gene with protein product		602380		UPK1		9935153, 9846985	Standard	NM_006952		Approved	TSPAN20	uc003ecc.3	O75841	OTTHUMG00000159354	ENST00000264234.3:c.76G>A	3.37:g.118906628G>A	ENSP00000264234:p.Gly26Ser		120389318	NM_006952	O60753|Q9UIM2|Q9UNX6	Missense_Mutation	SNP	ENST00000264234.3	37	CCDS2985.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372602	0.61624	.	.	ENSG00000251012;ENSG00000114638;ENSG00000114638;ENSG00000114638;ENSG00000114638	ENST00000490594;ENST00000264234;ENST00000479520;ENST00000494855;ENST00000460625	T;D;D;D;D	0.86627	0.4;-2.15;-2.15;-2.15;-2.15	5.52	4.65	0.58169	.	0.063724	0.64402	N	0.000008	D	0.86682	0.5991	M	0.66939	2.045	0.47862	D	0.99953	B;B	0.22746	0.048;0.074	B;B	0.29598	0.104;0.04	D	0.84849	0.0812	10	0.87932	D	0	-28.2805	13.3964	0.60856	0.0764:0.0:0.9236:0.0	.	26;26	C9J9M7;O75841	.;UPK1B_HUMAN	S	74;26;26;26;26	ENSP00000424708:G74S;ENSP00000264234:G26S;ENSP00000418399:G26S;ENSP00000418597:G26S;ENSP00000418116:G26S	ENSP00000424708:G74S	G	+	1	0	UPK1B;RP11-484M3.5	120389318	1.000000	0.71417	0.987000	0.45799	0.795000	0.44927	5.317000	0.65822	1.332000	0.45431	0.655000	0.94253	GGC		0.562	UPK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354883.2		
CPB1	1360	broad.mit.edu	37	3	148558743	148558743	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr3:148558743G>A	ENST00000491148.1	+	6	789	c.455G>A	c.(454-456)cGc>cAc	p.R152H	CPB1_ENST00000282957.4_Missense_Mutation_p.R152H			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	152						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R152H(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TTTGAGGGACGCGCTATTTAC	0.433																																					p.R152H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G455A	3						.						142.0	124.0	130.0					3																	148558743		2203	4300	6503	150041433	SO:0001583	missense	1360	exon5			AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.455G>A	3.37:g.148558743G>A	ENSP00000417222:p.Arg152His		150041433	NM_001871	O60834|Q53XJ0|Q96BQ8	Missense_Mutation	SNP	ENST00000491148.1	37	CCDS33874.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.740860	0.49151	.	.	ENSG00000153002	ENST00000491148;ENST00000282957	T;T	0.28454	1.61;1.61	5.29	4.4	0.53042	Peptidase M14, carboxypeptidase A (3);	0.171581	0.51477	D	0.000097	T	0.53384	0.1793	M	0.87900	2.915	0.58432	D	0.999997	D	0.69078	0.997	P	0.58331	0.837	T	0.60449	-0.7261	10	0.62326	D	0.03	.	10.9676	0.47421	0.1592:0.0:0.8408:0.0	.	152	P15086	CBPB1_HUMAN	H	152	ENSP00000417222:R152H;ENSP00000282957:R152H	ENSP00000282957:R152H	R	+	2	0	CPB1	150041433	0.998000	0.40836	0.528000	0.27938	0.333000	0.28666	3.617000	0.54181	1.189000	0.43028	0.655000	0.94253	CGC		0.433	CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355928.1	NM_001871	
VPS8	23355	broad.mit.edu	37	3	184612651	184612651	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr3:184612651T>A	ENST00000437079.3	+	23	2113	c.1942T>A	c.(1942-1944)Tta>Ata	p.L648I	VPS8_ENST00000436792.2_Missense_Mutation_p.L646I|VPS8_ENST00000446204.2_Intron|VPS8_ENST00000287546.4_Missense_Mutation_p.L648I	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	648							zinc ion binding (GO:0008270)	p.L648I(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AGATAAAAAATTAATGGAAAA	0.343																																					p.L648I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1942A	3						.						54.0	50.0	51.0					3																	184612651		1815	4079	5894	186095345	SO:0001583	missense	23355	exon22			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.1942T>A	3.37:g.184612651T>A	ENSP00000397879:p.Leu648Ile		186095345	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	T	11.33	1.605552	0.28623	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792	T;T;T	0.17691	2.26;2.27;2.27	5.53	1.94	0.25998	Quinonprotein alcohol dehydrogenase-like (1);	0.201132	0.47093	D	0.000242	T	0.08537	0.0212	N	0.11201	0.11	0.09310	N	1	B;B	0.32717	0.381;0.279	B;B	0.37601	0.254;0.124	T	0.25047	-1.0143	10	0.33940	T	0.23	-17.4208	4.6088	0.12391	0.1444:0.3013:0.0:0.5543	.	648;646	Q8N3P4;Q8N3P4-3	VPS8_HUMAN;.	I	648;648;646	ENSP00000287546:L648I;ENSP00000397879:L648I;ENSP00000404704:L646I	ENSP00000287546:L648I	L	+	1	2	VPS8	186095345	0.028000	0.19301	0.982000	0.44146	0.983000	0.72400	0.252000	0.18278	0.103000	0.17682	0.528000	0.53228	TTA		0.343	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
MASP1	5648	broad.mit.edu	37	3	186944220	186944220	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr3:186944220G>T	ENST00000337774.5	-	12	1919	c.1530C>A	c.(1528-1530)agC>agA	p.S510R		NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	510	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.S510R(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		AGTCAGAAGGGCTGAGCAAGT	0.572																																					p.S510R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1530A	3						.						143.0	118.0	126.0					3																	186944220		2203	4300	6503	188426914	SO:0001583	missense	5648	exon12			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1530C>A	3.37:g.186944220G>T	ENSP00000336792:p.Ser510Arg		188426914	NM_001879	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	37	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.458187	0.43634	.	.	ENSG00000127241	ENST00000337774	D	0.93019	-3.15	5.86	-3.67	0.04476	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.80628	0.4659	N	0.04768	-0.165	0.09310	N	1	B	0.06786	0.001	B	0.14578	0.011	T	0.67369	-0.5688	9	0.33940	T	0.23	.	4.3211	0.11018	0.4054:0.0:0.2924:0.3022	.	510	P48740	MASP1_HUMAN	R	510	ENSP00000336792:S510R	ENSP00000336792:S510R	S	-	3	2	MASP1	188426914	0.975000	0.34042	0.464000	0.27143	0.994000	0.84299	0.011000	0.13264	-0.664000	0.05324	0.563000	0.77884	AGC		0.572	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
CHL1	10752	broad.mit.edu	37	3	407665	407666	+	Missense_Mutation	DNP	CC	CC	AA	rs542132907		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	CC	CC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr3:407665_407666CC>AA	ENST00000256509.2	+	15	2260_2261	c.1618_1619CC>AA	c.(1618-1620)CCt>AAt	p.P540N	CHL1-AS1_ENST00000608098.1_RNA|CHL1_ENST00000397491.2_Missense_Mutation_p.P524N|CHL1-AS1_ENST00000417612.1_RNA	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.P540>?(1)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TCCTAAGAATCCTCGTATCCCC	0.347																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1618_1619AA	3						.																																			382666	SO:0001583	missense	10752	exon15			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	Exception_encountered	3.37:g.407665_407666delinsAA	ENSP00000256509:p.Pro540Asn		382665	NM_006614	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	DNP	ENST00000256509.2	37	CCDS2556.1																																																																																				0.347	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
SETD5	55209	broad.mit.edu	37	3	9486849	9486849	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr3:9486849T>G	ENST00000406341.1	+	11	1495	c.1305T>G	c.(1303-1305)atT>atG	p.I435M	SETD5_ENST00000302463.6_Missense_Mutation_p.I337M|SETD5_ENST00000402198.1_Missense_Mutation_p.I435M|SETD5_ENST00000407969.1_Missense_Mutation_p.I454M|SETD5_ENST00000402466.1_Missense_Mutation_p.I337M			Q9C0A6	SETD5_HUMAN	SET domain containing 5	435								p.I435M(1)|p.I337M(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TACCCACCATTGGAGCAGAGA	0.483																																					p.I435M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1305G	3						.						79.0	79.0	79.0					3																	9486849		1941	4148	6089	9461849	SO:0001583	missense	55209	exon12			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.1305T>G	3.37:g.9486849T>G	ENSP00000383939:p.Ile435Met		9461849	NM_001080517	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	De_novo_Start_OutOfFrame	SNP	ENST00000406341.1	37	CCDS46741.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.32|17.32	3.360459|3.360459	0.61403|0.61403	.|.	.|.	ENSG00000168137|ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463|ENST00000399686	D;D;D;D;D|.	0.92199|.	-2.67;-2.99;-2.67;-2.67;-2.99|.	5.63|5.63	-7.44|-7.44	0.01379|0.01379	.|.	0.675620|.	0.15531|.	N|.	0.257518|.	T|T	0.34600|0.34600	0.0903|0.0903	L|L	0.50333|0.50333	1.59|1.59	0.28411|0.28411	N|N	0.918186|0.918186	B;B;B;B;B|.	0.34200|.	0.338;0.314;0.441;0.119;0.075|.	P;B;B;B;B|.	0.45856|.	0.495;0.329;0.32;0.092;0.176|.	T|T	0.40079|0.40079	-0.9582|-0.9582	10|5	0.46703|.	T|.	0.11|.	-1.0228|-1.0228	7.1744|7.1744	0.25736|0.25736	0.1934:0.4229:0.0:0.3837|0.1934:0.4229:0.0:0.3837	.|.	104;337;337;435;454|.	B3KXG4;B3KRD6;Q9C0A6-3;Q9C0A6;E7EWN3|.	.;.;.;SETD5_HUMAN;.|.	M|G	435;337;435;454;337|103	ENSP00000385852:I435M;ENSP00000384429:I337M;ENSP00000383939:I435M;ENSP00000384114:I454M;ENSP00000302028:I337M|.	ENSP00000302028:I337M|.	I|W	+|+	3|1	3|0	SETD5|SETD5	9461849|9461849	0.017000|0.017000	0.18338|0.18338	0.101000|0.101000	0.21167|0.21167	0.981000|0.981000	0.71138|0.71138	-0.741000|-0.741000	0.04855|0.04855	-1.596000|-1.596000	0.01611|0.01611	0.533000|0.533000	0.62120|0.62120	ATT|TGG		0.483	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
ROBO1	6091	broad.mit.edu	37	3	78685122	78685122	+	Silent	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr3:78685122C>T	ENST00000464233.1	-	23	3287	c.3174G>A	c.(3172-3174)ctG>ctA	p.L1058L	ROBO1_ENST00000436010.2_Silent_p.L1019L|ROBO1_ENST00000495273.1_Silent_p.L1013L|ROBO1_ENST00000467549.1_Intron	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1058					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.L1058L(1)|p.L1035L(1)|p.L1013L(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GCCCATCCTTCAGATTTGGGC	0.448																																					p.L1058L												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G3174A	3						.						137.0	139.0	139.0					3																	78685122		2051	4216	6267	78767812	SO:0001819	synonymous_variant	6091	exon23			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3174G>A	3.37:g.78685122C>T			78767812	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	37	CCDS54611.1																																																																																				0.448	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
MASP1	5648	broad.mit.edu	37	3	186953749	186953749	+	Intron	SNP	C	C	T	rs115022399	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr3:186953749C>T	ENST00000337774.5	-	10	1693				MASP1_ENST00000392472.2_Missense_Mutation_p.R524H|MASP1_ENST00000495249.1_5'UTR|MASP1_ENST00000296280.6_Missense_Mutation_p.R637H	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)						complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.R637H(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		ATTGCCCGAGCGGGACTCATA	0.552																																					p.R637H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1910A	3						.						106.0	86.0	93.0					3																	186953749		2203	4300	6503	188436443	SO:0001627	intron_variant	5648	exon11			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1303+5519G>A	3.37:g.186953749C>T			188436443	NM_139125	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	37	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463935	0.63513	.	.	ENSG00000127241	ENST00000296280;ENST00000392472	D;D	0.89196	-2.48;-2.48	5.87	5.87	0.94306	.	0.160360	0.56097	D	0.000034	T	0.81861	0.4912	N	0.21508	0.67	0.80722	D	1	P;P	0.40681	0.478;0.727	B;B	0.32090	0.14;0.14	T	0.82884	-0.0236	10	0.48119	T	0.1	.	19.5705	0.95413	0.0:1.0:0.0:0.0	.	524;637	P48740-4;P48740-2	.;.	H	637;524	ENSP00000296280:R637H;ENSP00000376264:R524H	ENSP00000296280:R637H	R	-	2	0	MASP1	188436443	1.000000	0.71417	0.972000	0.41901	0.962000	0.63368	5.970000	0.70431	2.941000	0.99782	0.655000	0.94253	CGC		0.552	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
PSAPL1	768239	broad.mit.edu	37	4	7435875	7435876	+	Frame_Shift_Ins	INS	-	-	G	rs200558117|rs182795537	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr4:7435875_7435876insG	ENST00000319098.4	-	1	824_825	c.731_732insC	c.(730-732)ccgfs	p.P244fs	SORCS2_ENST00000329016.9_Intron|SORCS2_ENST00000511199.1_Intron|SORCS2_ENST00000507866.2_Intron	NM_001085382.1	NP_001078851.1	Q6NUJ1	SAPL1_HUMAN	prosaposin-like 1 (gene/pseudogene)	244	Saposin B-type 2. {ECO:0000255|PROSITE- ProRule:PRU00415}.				sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)		p.Q245fs*11(1)		lung(4)	4						AGAGCTCCTGCGGGGGGAGAAG	0.619																																					p.R244fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.731_732insC	4						.																																			7486777	SO:0001589	frameshift_variant	768239	exon1			DQ991252	CCDS47009.1	4p16.1	2010-03-12	2010-03-12			ENSG00000178597			33131	protein-coding gene	gene with protein product			"""prosaposin-like 1"""				Standard	NM_001085382		Approved		uc011bwj.2	Q6NUJ1		ENST00000319098.4:c.732dupC	4.37:g.7435881_7435881dupG	ENSP00000317445:p.Pro244fs		7486776	NM_001085382	A0A184|Q8N7T4	Frame_Shift_Ins	INS	ENST00000319098.4	37	CCDS47009.1																																																																																				0.619	PSAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358859.1		
SPON2	10417	broad.mit.edu	37	4	1165639	1165640	+	Splice_Site	DNP	CC	CC	AA	rs529981694		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	CC	CC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr4:1165639_1165640CC>AA	ENST00000290902.5	-	2	552_553	c.220_221GG>TT	c.(220-222)GGg>TTg	p.G74L	SPON2_ENST00000431380.1_Splice_Site_p.G74L	NM_012445.3	NP_036577	Q9BUD6	SPON2_HUMAN	spondin 2, extracellular matrix protein	74	Spondin. {ECO:0000255|PROSITE- ProRule:PRU00364}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)	p.?(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(23;0.00805)	UCEC - Uterine corpus endometrioid carcinoma (64;0.139)|Colorectal(103;0.19)		GCTGTACTTACCCAGCAGCGAA	0.693																																					.												.	.	1	Unknown(1)	large_intestine(1)	c.220_220TT	4						.																																			1155640	SO:0001630	splice_region_variant	10417	exon4			AB027466	CCDS3347.1	4p16.3	2008-07-29			ENSG00000159674	ENSG00000159674			11253	protein-coding gene	gene with protein product	"""Mindin"", ""M-spondin"""	605918				10512675, 15094111	Standard	NM_012445		Approved	DIL1	uc003gco.4	Q9BUD6	OTTHUMG00000089002	ENST00000290902.5:c.220_221delinsAA	4.37:g.1165639_1165640delinsAA			1155639	NM_001199021	D3DVN9|Q4W5N4|Q9ULW1	Splice_Site	DNP	ENST00000290902.5	37	CCDS3347.1																																																																																				0.693	SPON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000202080.2		Missense_Mutation
ARFIP1	27236	broad.mit.edu	37	4	153809416	153809416	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr4:153809416G>A	ENST00000451320.2	+	8	1087	c.923G>A	c.(922-924)cGc>cAc	p.R308H	ARFIP1_ENST00000356064.3_Missense_Mutation_p.R276H|ARFIP1_ENST00000405727.2_Missense_Mutation_p.R276H|ARFIP1_ENST00000353617.2_Missense_Mutation_p.R308H|ARFIP1_ENST00000429148.2_Missense_Mutation_p.R128H			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	308	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)		p.R308H(2)	ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					GATAAAATGCGCAATGATGTT	0.378																																					p.R276H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G827A	4						.						81.0	77.0	78.0					4																	153809416		2203	4299	6502	154028866	SO:0001583	missense	27236	exon7			U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.923G>A	4.37:g.153809416G>A	ENSP00000395083:p.Arg308His		154028866	NM_001025593	Q2M2X4|Q3SYL4|Q9Y2X6	Missense_Mutation	SNP	ENST00000451320.2	37	CCDS34080.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880783	0.91740	.	.	ENSG00000164144	ENST00000451320;ENST00000429148;ENST00000353617;ENST00000405727;ENST00000356064	D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51	5.85	5.0	0.66597	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.88926	0.6570	M	0.73598	2.24	0.80722	D	1	P;D;D	0.89917	0.863;0.988;1.0	B;P;D	0.91635	0.325;0.694;0.999	D	0.89218	0.3569	10	0.59425	D	0.04	-5.3162	15.3772	0.74615	0.0678:0.0:0.9322:0.0	.	128;276;308	B4DS69;Q2M2X4;P53367	.;.;ARFP1_HUMAN	H	308;128;308;276;276	ENSP00000395083:R308H;ENSP00000396653:R128H;ENSP00000296557:R308H;ENSP00000384189:R276H;ENSP00000348360:R276H	ENSP00000296557:R308H	R	+	2	0	ARFIP1	154028866	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.642000	0.83385	2.768000	0.95171	0.655000	0.94253	CGC		0.378	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365032.1	NM_014447	
CRMP1	1400	broad.mit.edu	37	4	5862812	5862812	+	Missense_Mutation	SNP	G	G	A	rs201508359		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr4:5862812G>A	ENST00000397890.2	-	3	468	c.254C>T	c.(253-255)gCg>gTg	p.A85V	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000512574.1_Missense_Mutation_p.A83V|CRMP1_ENST00000324989.7_Missense_Mutation_p.A199V	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	85					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.A199V(1)		NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		GTCATCAGCCGCAGTCATCCC	0.577																																					p.A85V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C254T	4						.						103.0	98.0	100.0					4																	5862812		2203	4300	6503	5913713	SO:0001583	missense	1400	exon3			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.254C>T	4.37:g.5862812G>A	ENSP00000380987:p.Ala85Val		5913713	NM_001313	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	ENST00000397890.2	37	CCDS43207.1	.	.	.	.	.	.	.	.	.	.	G	14.81	2.647005	0.47258	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.89270	-2.49;-2.49;-2.49	4.37	4.37	0.52481	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.420899	0.26334	N	0.024975	D	0.85660	0.5748	L	0.60455	1.87	0.09310	N	1	B;P;B	0.40230	0.157;0.708;0.145	B;B;B	0.32805	0.153;0.06;0.067	T	0.82165	-0.0592	10	0.72032	D	0.01	-9.7982	16.0708	0.80928	0.0:0.0:1.0:0.0	.	199;83;85	A0EJG6;E9PD68;Q14194	.;.;DPYL1_HUMAN	V	199;85;85;83	ENSP00000321606:A199V;ENSP00000380987:A85V;ENSP00000425742:A83V	ENSP00000321606:A199V	A	-	2	0	CRMP1	5913713	0.998000	0.40836	0.007000	0.13788	0.249000	0.25844	8.981000	0.93465	2.251000	0.74343	0.561000	0.74099	GCG		0.577	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313	
FIP1L1	81608	broad.mit.edu	37	4	54308824	54308824	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr4:54308824T>A	ENST00000337488.6	+	14	1373	c.1179T>A	c.(1177-1179)ttT>ttA	p.F393L	FIP1L1_ENST00000507166.1_Intron|FIP1L1_ENST00000358575.5_Missense_Mutation_p.F387L|FIP1L1_ENST00000306932.6_Missense_Mutation_p.F319L	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	393	Pro-rich.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.F393L(1)		large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TTTCAGGTTTTCCTCCTCCAC	0.363			T	PDGFRA	idiopathic hypereosinophilic syndrome																																p.F393L			Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1179A	4						.						132.0	127.0	129.0					4																	54308824		2203	4300	6503	54003581	SO:0001583	missense	81608	exon14			AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.1179T>A	4.37:g.54308824T>A	ENSP00000336752:p.Phe393Leu		54003581	NM_030917	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Missense_Mutation	SNP	ENST00000337488.6	37	CCDS3491.1	.	.	.	.	.	.	.	.	.	.	T	18.61	3.661583	0.67700	.	.	ENSG00000145216	ENST00000337488;ENST00000358575;ENST00000306932;ENST00000504094	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.52	1.8	0.24995	.	0.000000	0.64402	D	0.000001	T	0.46658	0.1404	N	0.14661	0.345	0.80722	D	1	P;P;P;P	0.52577	0.954;0.924;0.954;0.924	D;P;D;P	0.63597	0.916;0.827;0.916;0.827	T	0.26155	-1.0111	10	0.22109	T	0.4	-19.9133	7.8694	0.29556	0.0:0.2406:0.0:0.7594	.	387;387;319;393	G3XAD6;B4DIR3;Q6UN15-3;Q6UN15	.;.;.;FIP1_HUMAN	L	393;387;319;50	ENSP00000336752:F393L;ENSP00000351383:F387L;ENSP00000302993:F319L;ENSP00000421691:F50L	ENSP00000302993:F319L	F	+	3	2	FIP1L1	54003581	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.687000	0.37680	0.147000	0.19030	-0.353000	0.07706	TTT		0.363	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	
SLC4A4	8671	broad.mit.edu	37	4	72338474	72338474	+	Silent	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr4:72338474C>T	ENST00000264485.5	+	14	1807	c.1690C>T	c.(1690-1692)Cta>Tta	p.L564L	SLC4A4_ENST00000351898.6_Silent_p.L564L|SLC4A4_ENST00000340595.3_Silent_p.L520L|SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000512686.1_Silent_p.L520L|SLC4A4_ENST00000425175.1_Silent_p.L564L	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	564					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.L564L(1)|p.L520L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	GTCCGCCTTCCTATGTCTCAT	0.428																																					p.L564L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1690T	4						.						176.0	173.0	174.0					4																	72338474		2203	4300	6503	72557338	SO:0001819	synonymous_variant	8671	exon14			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.1690C>T	4.37:g.72338474C>T			72557338	NM_001134742	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	37	CCDS43236.1																																																																																				0.428	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
SLC9B1	150159	broad.mit.edu	37	4	103822483	103822484	+	Frame_Shift_Del	DEL	AC	AC	-	rs3974499		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	AC	AC	AC	AC	AC	AC	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr4:103822483_103822484delAC	ENST00000296422.7	-	12	1479_1480	c.1338_1339delGT	c.(1336-1341)gtgttafs	p.L447fs	SLC9B1_ENST00000512651.2_5'UTR|SLC9B1_ENST00000394789.3_Intron	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	447					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										AGAGGACCTAACACAGCCTGCA	0.386																																					p.446_447del												.	.	0			c.1338_1339del	4						.																																			104041933	SO:0001589	frameshift_variant	150159	exon12			AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.1338_1339delGT	4.37:g.103822485_103822486delAC	ENSP00000296422:p.Leu447fs		104041932	NM_139173	A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Frame_Shift_Del	DEL	ENST00000296422.7	37	CCDS34041.1																																																																																				0.386	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363841.1	NM_139173	
NPY1R	4886	broad.mit.edu	37	4	164246631	164246631	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr4:164246631A>C	ENST00000296533.2	-	3	1510	c.979T>G	c.(979-981)Ttc>Gtc	p.F327V	NPY1R_ENST00000509586.1_Missense_Mutation_p.F84V	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	327					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)	p.F327V(1)		breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TCTCTCTGGAAGTTTTTGTTC	0.433																																					p.F327V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T979G	4						.						109.0	120.0	116.0					4																	164246631		2203	4300	6503	164466081	SO:0001583	missense	4886	exon3				CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.979T>G	4.37:g.164246631A>C	ENSP00000354652:p.Phe327Val		164466081	NM_000909	B2R6H5	Missense_Mutation	SNP	ENST00000296533.2	37	CCDS34089.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.123153	0.77436	.	.	ENSG00000164128	ENST00000296533;ENST00000509586	T;T	0.69926	-0.44;-0.44	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.81503	0.4836	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.83684	0.0173	10	0.66056	D	0.02	.	15.5707	0.76333	1.0:0.0:0.0:0.0	.	327	P25929	NPY1R_HUMAN	V	327;84	ENSP00000354652:F327V;ENSP00000427284:F84V	ENSP00000354652:F327V	F	-	1	0	NPY1R	164466081	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.283000	0.95860	2.074000	0.62210	0.533000	0.62120	TTC		0.433	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364685.1		
EFNA5	1946	broad.mit.edu	37	5	106716963	106716963	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr5:106716963G>A	ENST00000333274.6	-	5	961	c.680C>T	c.(679-681)aCa>aTa	p.T227I	EFNA5_ENST00000509503.1_Missense_Mutation_p.T200I|EFNA5_ENST00000510359.1_5'UTR	NM_001962.2	NP_001953.1	P52803	EFNA5_HUMAN	ephrin-A5	227					axon guidance (GO:0007411)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell-cell adhesion (GO:0022407)|regulation of focal adhesion assembly (GO:0051893)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rho GTPase activity (GO:0032319)|retinal ganglion cell axon guidance (GO:0031290)	anchored component of external side of plasma membrane (GO:0031362)|plasma membrane (GO:0005886)	chemorepellent activity (GO:0045499)|ephrin receptor binding (GO:0046875)	p.T227I(1)		large_intestine(6)	6		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		GTGCTATAATGTCAAAAGCAT	0.522																																					p.T227I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C680T	5						.						174.0	160.0	165.0					5																	106716963		2202	4300	6502	106744862	SO:0001583	missense	1946	exon5			U26403	CCDS4097.1	5q21	2011-03-09			ENSG00000184349	ENSG00000184349		"""Ephrins"""	3225	protein-coding gene	gene with protein product		601535		EPLG7		8661153, 9245480	Standard	NM_001962		Approved	AF1, LERK7	uc003kol.3	P52803	OTTHUMG00000128741	ENST00000333274.6:c.680C>T	5.37:g.106716963G>A	ENSP00000328777:p.Thr227Ile		106744862	NM_001962		Missense_Mutation	SNP	ENST00000333274.6	37	CCDS4097.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.566836	0.45694	.	.	ENSG00000184349	ENST00000333274;ENST00000509503	D;D	0.96011	-3.88;-3.88	5.85	5.85	0.93711	.	0.256383	0.43416	D	0.000572	D	0.89336	0.6686	N	0.08118	0	0.44142	D	0.996933	B	0.02656	0.0	B	0.01281	0.0	D	0.85076	0.0943	10	0.72032	D	0.01	-9.8093	13.7862	0.63110	0.0786:0.0:0.9214:0.0	.	227	P52803	EFNA5_HUMAN	I	227;200	ENSP00000328777:T227I;ENSP00000426989:T200I	ENSP00000328777:T227I	T	-	2	0	EFNA5	106744862	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.859000	0.62954	2.767000	0.95098	0.655000	0.94253	ACA		0.522	EFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250652.1	NM_001962	
APC	324	broad.mit.edu	37	5	112162891	112162891	+	Nonsense_Mutation	SNP	C	C	T	rs137854580		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr5:112162891C>T	ENST00000457016.1	+	12	1875	c.1495C>T	c.(1495-1497)Cga>Tga	p.R499*	CTC-554D6.1_ENST00000520401.1_5'Flank|APC_ENST00000257430.4_Nonsense_Mutation_p.R499*|APC_ENST00000508376.2_Nonsense_Mutation_p.R499*			P25054	APC_HUMAN	adenomatous polyposis coli	499	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R499*(5)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TACACTAAGACGATATGCTGG	0.373		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R481X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	6	Substitution - Nonsense(5)|Unknown(1)	large_intestine(5)|skin(1)	c.C1441T	5	GRCh37	CM930023	APC	M	rs137854580	.						135.0	123.0	127.0					5																	112162891		2202	4300	6502	112190790	SO:0001587	stop_gained	324	exon10	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1495C>T	5.37:g.112162891C>T	ENSP00000413133:p.Arg499*		112190790	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	8.025077	0.98616	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.85	4.98	0.66077	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.3767	14.9298	0.70906	0.2732:0.7267:0.0:0.0	.	.	.	.	X	499;481;499;499;499	.	ENSP00000257430:R499X	R	+	1	2	APC	112190790	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.513000	0.35823	1.461000	0.47929	0.655000	0.94253	CGA		0.373	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175207	112175207	+	Nonsense_Mutation	SNP	G	G	T	rs121913462		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr5:112175207G>T	ENST00000457016.1	+	16	4296	c.3916G>T	c.(3916-3918)Gaa>Taa	p.E1306*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.E1306*|APC_ENST00000508376.2_Nonsense_Mutation_p.E1306*			P25054	APC_HUMAN	adenomatous polyposis coli	1306	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1306*(25)|p.E1306K(2)|p.K1192fs*3(1)|p.?(1)|p.E1306fs*8(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCAAATAGCAGAAATAAAAGA	0.428		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1288X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,pancreas,NS,Substitution - Missense,0 	.	30	Substitution - Nonsense(25)|Substitution - Missense(2)|Deletion - Frameshift(2)|Unknown(1)	large_intestine(26)|pancreas(1)|soft_tissue(1)|liver(1)|skin(1)	c.G3862T	5	GRCh37	CM077502	APC	M	rs121913462	.						53.0	55.0	54.0					5																	112175207		2202	4300	6502	112203106	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3916G>T	5.37:g.112175207G>T	ENSP00000413133:p.Glu1306*		112203106	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	37	6.245438	0.97408	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	5.73	5.73	0.89815	.	0.179091	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.6779	14.1203	0.65182	0.0727:0.0:0.9273:0.0	.	.	.	.	X	1306	.	.	E	+	1	0	APC	112203106	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	4.734000	0.62043	2.861000	0.98227	0.655000	0.94253	GAA		0.428	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PRR16	51334	broad.mit.edu	37	5	120021968	120021968	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr5:120021968C>A	ENST00000407149.2	+	2	688	c.479C>A	c.(478-480)cCa>cAa	p.P160Q	PRR16_ENST00000505123.1_Missense_Mutation_p.P90Q|PRR16_ENST00000379551.2_Missense_Mutation_p.P137Q|PRR16_ENST00000446965.1_Missense_Mutation_p.P90Q			Q569H4	LARGN_HUMAN	proline rich 16	160	Pro-rich.				positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)			p.P137Q(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		GGAGGCTTACCAGGTGGACCT	0.468																																					p.P137Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C410A	5						.						68.0	62.0	64.0					5																	120021968		2203	4300	6503	120049867	SO:0001583	missense	51334	exon3			AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.479C>A	5.37:g.120021968C>A	ENSP00000385118:p.Pro160Gln		120049867	NM_016644	D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	ENST00000407149.2	37		.	.	.	.	.	.	.	.	.	.	C	14.76	2.631842	0.46944	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000509923;ENST00000505123;ENST00000446965	T;T;T;T;T	0.63417	0.03;-0.04;0.46;0.34;0.34	5.6	3.71	0.42584	.	0.119053	0.56097	D	0.000022	T	0.54743	0.1877	L	0.58101	1.795	0.09310	N	1	B;B	0.22346	0.004;0.068	B;B	0.23419	0.008;0.046	T	0.44267	-0.9339	9	.	.	.	-1.2014	8.9386	0.35715	0.1783:0.745:0.0:0.0768	.	160;137	Q569H4;Q569H4-3	PRR16_HUMAN;.	Q	160;137;90;90;90	ENSP00000385118:P160Q;ENSP00000368869:P137Q;ENSP00000421256:P90Q;ENSP00000423446:P90Q;ENSP00000405491:P90Q	.	P	+	2	0	PRR16	120049867	0.290000	0.24343	0.005000	0.12908	0.978000	0.69477	2.604000	0.46274	0.598000	0.29829	0.644000	0.83932	CCA		0.468	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644	
HAVCR1	26762	broad.mit.edu	37	5	156456746	156456746	+	Nonstop_Mutation	SNP	A	A	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr5:156456746A>G	ENST00000339252.3	-	8	1625	c.1093T>C	c.(1093-1095)Taa>Caa	p.*365Q	HAVCR1_ENST00000517644.1_5'Flank|HAVCR1_ENST00000522693.1_Silent_p.T353T|HAVCR1_ENST00000425854.1_Silent_p.T353T|HAVCR1_ENST00000544197.1_Nonstop_Mutation_p.*365Q|HAVCR1_ENST00000523175.1_Nonstop_Mutation_p.*365Q	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0					viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)	p.*365Q(1)		endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACTGGGTCTTAGTCCGTGGCA	0.413																																					p.X365Q												.	.	1	Nonstop extension(1)	large_intestine(1)	c.T1093C	5						.						115.0	104.0	107.0					5																	156456746		1888	4112	6000	156389324	SO:0001578	stop_lost	26762	exon8			AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.1093T>C	5.37:g.156456746A>G	ENSP00000344844:p.*365Gluext*12		156389324	NM_012206	O43656	Nonstop_Mutation	SNP	ENST00000339252.3	37	CCDS43392.1	.	.	.	.	.	.	.	.	.	.	A	8.668	0.902231	0.17760	.	.	ENSG00000113249	ENST00000523175;ENST00000339252;ENST00000544197	.	.	.	3.69	1.29	0.21616	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.3812	0.26856	0.7931:0.0:0.2069:0.0	.	.	.	.	Q	365	.	.	X	-	1	0	HAVCR1	156389324	0.002000	0.14202	0.004000	0.12327	0.032000	0.12392	0.384000	0.20668	-0.004000	0.14419	-1.447000	0.01057	TAA		0.413	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
ADAMTS12	81792	broad.mit.edu	37	5	33751623	33751623	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr5:33751623A>C	ENST00000504830.1	-	3	855	c.520T>G	c.(520-522)Ttt>Gtt	p.F174V	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.F174V|ADAMTS12_ENST00000515401.1_Missense_Mutation_p.F174V	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	174					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.F174V(2)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TCAATGAAAAAGTCTCCATGT	0.403										HNSCC(64;0.19)																											p.F174V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T520G	5						.						116.0	118.0	117.0					5																	33751623		2203	4300	6503	33787380	SO:0001583	missense	81792	exon3			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.520T>G	5.37:g.33751623A>C	ENSP00000422554:p.Phe174Val		33787380	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.249142	0.80024	.	.	ENSG00000151388	ENST00000504830;ENST00000352040;ENST00000515401	T;T;T	0.06849	3.25;3.25;3.25	5.8	5.8	0.92144	Peptidase M12B, propeptide (1);	0.122077	0.56097	D	0.000038	T	0.18841	0.0452	L	0.48642	1.525	0.34849	D	0.74146	P;D;B	0.64830	0.827;0.994;0.387	P;P;B	0.61070	0.526;0.883;0.309	T	0.11421	-1.0588	10	0.46703	T	0.11	.	12.5524	0.56233	1.0:0.0:0.0:0.0	.	174;174;174	P58397-3;D6REX0;P58397	.;.;ATS12_HUMAN	V	174	ENSP00000422554:F174V;ENSP00000344847:F174V;ENSP00000421638:F174V	ENSP00000344847:F174V	F	-	1	0	ADAMTS12	33787380	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.202000	0.65169	2.227000	0.72691	0.460000	0.39030	TTT		0.403	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
HCN1	348980	broad.mit.edu	37	5	45262488	45262488	+	Silent	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr5:45262488C>T	ENST00000303230.4	-	8	2265	c.2208G>A	c.(2206-2208)caG>caA	p.Q736Q		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	736	Gln-rich.				apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.Q736Q(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						gctgtacctgctgctgcggct	0.632																																					p.Q736Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2208A	5						.						26.0	29.0	28.0					5																	45262488		2203	4298	6501	45298245	SO:0001819	synonymous_variant	348980	exon8			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2208G>A	5.37:g.45262488C>T			45298245	NM_021072		Silent	SNP	ENST00000303230.4	37	CCDS3952.1																																																																																				0.632	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
ATP6AP1L	92270	broad.mit.edu	37	5	81614006	81614006	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr5:81614006C>T	ENST00000380167.4	+	10	1887	c.562C>T	c.(562-564)Cac>Tac	p.H188Y	ATP6AP1L_ENST00000508366.1_Intron|ATP6AP1L_ENST00000439350.1_Missense_Mutation_p.H188Y			Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1-like	188					ATP hydrolysis coupled proton transport (GO:0015991)	integral component of membrane (GO:0016021)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.H188Y(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	12						CTCTCCTGCCCACTTCTCGCA	0.537																																					p.H188Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C562T	5						.						69.0	71.0	70.0					5																	81614006		2203	4300	6503	81649762	SO:0001583	missense	92270	exon4			AK022625	CCDS34196.1	5q14.2	2010-03-10				ENSG00000205464			28091	protein-coding gene	gene with protein product							Standard	XR_112744		Approved		uc003khw.3	Q52LC2		ENST00000380167.4:c.562C>T	5.37:g.81614006C>T	ENSP00000369513:p.His188Tyr		81649762	NM_001017971		Missense_Mutation	SNP	ENST00000380167.4	37	CCDS34196.1	.	.	.	.	.	.	.	.	.	.	C	8.279	0.815066	0.16607	.	.	ENSG00000205464	ENST00000380167;ENST00000439350	.	.	.	5.54	4.56	0.56223	.	0.211314	0.41712	D	0.000836	T	0.21962	0.0529	N	0.17474	0.49	0.33796	D	0.626042	B	0.16603	0.018	B	0.10450	0.005	T	0.33163	-0.9879	9	0.02654	T	1	.	3.6148	0.08073	0.0:0.6481:0.0:0.3519	.	188	Q52LC2	VAS1L_HUMAN	Y	188	.	ENSP00000369513:H188Y	H	+	1	0	ATP6AP1L	81649762	1.000000	0.71417	0.732000	0.30844	0.045000	0.14185	4.839000	0.62810	2.601000	0.87937	0.563000	0.77884	CAC		0.537	ATP6AP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369562.3	NM_001017971	
GRM6	2916	broad.mit.edu	37	5	178413430	178413430	+	Missense_Mutation	SNP	G	G	A	rs200398972	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr5:178413430G>A	ENST00000517717.1	-	9	1863	c.1825C>T	c.(1825-1827)Cgg>Tgg	p.R609W	RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Missense_Mutation_p.R609W			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	609					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)	p.R609W(1)		NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		TTGTTGTACCGCACGAAGGTG	0.667													G|||	3	0.000599042	0.0	0.0	5008	,	,		16134	0.003		0.0	False		,,,				2504	0.0				p.R609W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1825T	5						.	G	TRP/ARG	0,4406		0,0,2203	32.0	31.0	31.0		1825	3.1	0.6	5		31	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GRM6	NM_000843.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	609/878	178413430	1,13005	2203	4300	6503	178346036	SO:0001583	missense	2916	exon8			U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.1825C>T	5.37:g.178413430G>A	ENSP00000430767:p.Arg609Trp		178346036	NM_000843		Missense_Mutation	SNP	ENST00000517717.1	37	CCDS4442.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	14.84	2.654772	0.47467	0.0	1.16E-4	ENSG00000113262	ENST00000319065;ENST00000231188;ENST00000517717	D;D	0.89552	-2.53;-2.53	5.02	3.1	0.35709	GPCR, family 3, C-terminal (2);	.	.	.	.	D	0.93416	0.7900	M	0.79475	2.455	0.47214	D	0.999357	D;P	0.89917	1.0;0.946	D;P	0.80764	0.994;0.661	D	0.93548	0.6884	9	0.62326	D	0.03	.	12.4809	0.55842	0.0:0.0:0.7019:0.2981	.	765;609	E7EX65;O15303	.;GRM6_HUMAN	W	765;609;609	ENSP00000231188:R609W;ENSP00000430767:R609W	ENSP00000231188:R609W	R	-	1	2	GRM6	178346036	1.000000	0.71417	0.607000	0.28956	0.030000	0.12068	4.643000	0.61390	1.229000	0.43630	-0.521000	0.04368	CGG		0.667	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253474.2		
TFAP2A	7020	broad.mit.edu	37	6	10410329	10410329	+	Silent	SNP	G	G	C			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:10410329G>C	ENST00000482890.1	-	3	637	c.285C>G	c.(283-285)ggC>ggG	p.G95G	TFAP2A_ENST00000497266.1_5'UTR|TFAP2A_ENST00000379608.3_Silent_p.G89G|TFAP2A_ENST00000319516.4_Silent_p.G91G|TFAP2A_ENST00000379613.3_Silent_p.G97G|TFAP2A-AS1_ENST00000420777.1_RNA|TFAP2A_ENST00000379604.2_Silent_p.G95G			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	95	Gln/Pro-rich (transactivation domain).				anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.G95G(1)|p.G89G(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				GGCCGGGCCAGCCTGGGTGCT	0.682																																					p.G95G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C285G	6						.						30.0	37.0	34.0					6																	10410329		2198	4296	6494	10518315	SO:0001819	synonymous_variant	7020	exon2			X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.285C>G	6.37:g.10410329G>C			10518315	NM_003220	Q13777|Q5TAV5|Q8N1C6	Silent	SNP	ENST00000482890.1	37	CCDS4510.1																																																																																				0.682	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353619.2	NM_003220	
ROS1	6098	broad.mit.edu	37	6	117658405	117658405	+	Silent	SNP	A	A	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:117658405A>G	ENST00000368508.3	-	31	5376	c.5178T>C	c.(5176-5178)aaT>aaC	p.N1726N	ROS1_ENST00000368507.3_Silent_p.N1720N|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1726	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N1726N(2)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CTACTCTGACATTATATGAAG	0.358			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.N1726N			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T5178C	6						.						128.0	123.0	124.0					6																	117658405		2203	4298	6501	117765098	SO:0001819	synonymous_variant	6098	exon31			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.5178T>C	6.37:g.117658405A>G			117765098	NM_002944	Q15368|Q5TDB5	Silent	SNP	ENST00000368508.3	37	CCDS5116.1																																																																																				0.358	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
BCLAF1	9774	broad.mit.edu	37	6	136590680	136590680	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:136590680C>A	ENST00000531224.1	-	9	2366	c.2114G>T	c.(2113-2115)aGt>aTt	p.S705I	BCLAF1_ENST00000530767.1_Missense_Mutation_p.S532I|BCLAF1_ENST00000392348.2_Missense_Mutation_p.S703I|BCLAF1_ENST00000031135.9_5'Flank|BCLAF1_ENST00000527759.1_Missense_Mutation_p.S703I|BCLAF1_ENST00000353331.4_Missense_Mutation_p.S703I|BCLAF1_ENST00000527536.1_Missense_Mutation_p.S705I|BCLAF1_ENST00000529917.1_5'UTR	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	705					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.S705I(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CCGTTCTTTACTTCTTTCTTT	0.378																																					p.S705I	Colon(142;1534 1789 5427 7063 28491)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2114T	6						.						91.0	90.0	90.0					6																	136590680		2203	4299	6502	136632373	SO:0001583	missense	9774	exon9			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2114G>T	6.37:g.136590680C>A	ENSP00000435210:p.Ser705Ile		136632373	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882191	0.33255	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.15256	2.44;2.44;2.44;2.44;2.44;2.44;2.44	5.01	5.01	0.66863	.	0.169164	0.41823	D	0.000802	T	0.17450	0.0419	N	0.14661	0.345	0.80722	D	1	D;D;D;D	0.71674	0.998;0.986;0.998;0.994	D;P;D;P	0.74348	0.983;0.862;0.983;0.806	T	0.16897	-1.0387	10	0.38643	T	0.18	-4.7213	18.6599	0.91469	0.0:1.0:0.0:0.0	.	703;703;705;532	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	I	705;703;705;532;703;703;704	ENSP00000435210:S705I;ENSP00000229446:S703I;ENSP00000435441:S705I;ENSP00000436501:S532I;ENSP00000434826:S703I;ENSP00000376159:S703I;ENSP00000431734:S704I	ENSP00000229446:S703I	S	-	2	0	BCLAF1	136632373	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.392000	0.73213	2.496000	0.84212	0.591000	0.81541	AGT		0.378	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
TNFAIP3	7128	broad.mit.edu	37	6	138200278	138200278	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:138200278G>T	ENST00000237289.4	+	7	1762	c.1696G>T	c.(1696-1698)Gat>Tat	p.D566Y		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	566	Interaction with TNIP1. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.D566Y(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		TTCCAAGTCAGATCCCTCGCG	0.612			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.D566Y	GBM(130;153 1739 22295 28918 47987)		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	.	26	Whole gene deletion(25)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(25)|large_intestine(1)	c.G1696T	6						.						72.0	78.0	76.0					6																	138200278		2203	4300	6503	138241971	SO:0001583	missense	7128	exon7			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.1696G>T	6.37:g.138200278G>T	ENSP00000237289:p.Asp566Tyr		138241971	NM_006290	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	ENST00000237289.4	37	CCDS5187.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717119	0.68844	.	.	ENSG00000118503	ENST00000237289;ENST00000535574;ENST00000544646	T	0.25912	1.77	5.84	5.84	0.93424	.	0.140388	0.64402	D	0.000005	T	0.42291	0.1196	M	0.62723	1.935	0.58432	D	0.999999	D	0.89917	1.0	D	0.68192	0.956	T	0.22626	-1.0211	10	0.72032	D	0.01	-18.5097	18.3096	0.90194	0.0:0.0:1.0:0.0	.	566	P21580	TNAP3_HUMAN	Y	566	ENSP00000237289:D566Y	ENSP00000237289:D566Y	D	+	1	0	TNFAIP3	138241971	1.000000	0.71417	0.892000	0.35008	0.386000	0.30323	8.482000	0.90439	2.764000	0.94973	0.561000	0.74099	GAT		0.612	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
KIAA1244	57221	broad.mit.edu	37	6	138611069	138611069	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:138611069G>A	ENST00000251691.4	+	18	3177	c.3011G>A	c.(3010-3012)gGa>gAa	p.G1004E		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CTGGAGATGGGAAGCCACAAC	0.622																																					p.G1004E												.	.	0			c.G3011A	6						.						87.0	76.0	80.0					6																	138611069		2203	4300	6503	138652762	SO:0001583	missense	57221	exon18			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.3011G>A	6.37:g.138611069G>A	ENSP00000251691:p.Gly1004Glu		138652762	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	G	32	5.152378	0.94645	.	.	ENSG00000112379	ENST00000251691	T	0.39229	1.09	5.44	5.44	0.79542	.	0.102013	0.64402	D	0.000002	T	0.61949	0.2388	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65109	-0.6248	10	0.87932	D	0	-21.3078	19.6328	0.95718	0.0:0.0:1.0:0.0	.	1004	Q5TH69	BIG3_HUMAN	E	1004	ENSP00000251691:G1004E	ENSP00000251691:G1004E	G	+	2	0	KIAA1244	138652762	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.813000	0.99286	2.695000	0.91970	0.655000	0.94253	GGA		0.622	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
NHLRC1	378884	broad.mit.edu	37	6	18122199	18122199	+	Silent	SNP	G	G	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:18122199G>T	ENST00000340650.3	-	1	652	c.639C>A	c.(637-639)ggC>ggA	p.G213G		NM_198586.2	NP_940988.2	Q6VVB1	NHLC1_HUMAN	NHL repeat containing E3 ubiquitin protein ligase 1	213					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|positive regulation of protein ubiquitination (GO:0031398)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G213G(1)		breast(1)|kidney(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(2)	11	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			AGGAGAATTGGCCTCCAATGA	0.542																																					p.G213G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C639A	6						.						60.0	62.0	62.0					6																	18122199		2203	4300	6503	18230178	SO:0001819	synonymous_variant	378884	exon1			AY324849	CCDS4542.1	6p22.3	2014-01-28	2013-12-12		ENSG00000187566	ENSG00000187566			21576	protein-coding gene	gene with protein product	"""epilepsy, progressive myoclonus type 2B"""	608072	"""NHL repeat containing 1"""			12958597	Standard	NM_198586		Approved	bA204B7.2, EPM2B, malin	uc003ncl.1	Q6VVB1	OTTHUMG00000014315	ENST00000340650.3:c.639C>A	6.37:g.18122199G>T			18230178	NM_198586	Q3SYB1|Q5VUK7|Q6IMH1	Silent	SNP	ENST00000340650.3	37	CCDS4542.1																																																																																				0.542	NHLRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039958.1		
GPX6	257202	broad.mit.edu	37	6	28483503	28483503	+	Silent	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:28483503C>T	ENST00000474923.1	-	1	61	c.18G>A	c.(16-18)caG>caA	p.Q6Q	GPX6_ENST00000361902.1_Silent_p.Q6Q|GPX6_ENST00000483058.1_Intron			P59796	GPX6_HUMAN	glutathione peroxidase 6 (olfactory)	6			Q -> L (in dbSNP:rs35510314). {ECO:0000269|Ref.2}.		response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)	p.Q6Q(1)		NS(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Glutathione(DB00143)	GACAGGAGGCCTGGAACTGCT	0.532																																					p.Q6Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G18A	6						.						91.0	104.0	100.0					6																	28483503		1960	4156	6116	28591482	SO:0001819	synonymous_variant	257202	exon1				CCDS43432.1	6p22.1	2012-03-01			ENSG00000198704	ENSG00000198704	1.11.1.9		4558	protein-coding gene	gene with protein product		607913	"""glutathione peroxidase pseudogene 3"""	GPXP3			Standard	NM_182701		Approved		uc021yrx.1	P59796	OTTHUMG00000044828	ENST00000474923.1:c.18G>A	6.37:g.28483503C>T			28591482	NM_182701	Q4PJ17	Silent	SNP	ENST00000474923.1	37																																																																																					0.532	GPX6-002	PUTATIVE	basic|exp_conf|seleno	protein_coding	protein_coding	OTTHUMT00000356246.5		
DNAH8	1769	broad.mit.edu	37	6	38862492	38862492	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:38862492A>T	ENST00000359357.3	+	57	8202	c.7948A>T	c.(7948-7950)Act>Tct	p.T2650S	DNAH8_ENST00000449981.2_Missense_Mutation_p.T2867S|DNAH8_ENST00000441566.1_Missense_Mutation_p.T2614S			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2650	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T2650S(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GATGCTGCCAACTCCTTCTAA	0.363																																					p.T2650S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A7948T	6						.						85.0	82.0	83.0					6																	38862492		2203	4300	6503	38970470	SO:0001583	missense	1769	exon57			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7948A>T	6.37:g.38862492A>T	ENSP00000352312:p.Thr2650Ser		38970470	NM_001371	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	A	21.0	4.085386	0.76642	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.43688	0.94;0.94;0.94	5.33	5.33	0.75918	.	0.055076	0.64402	D	0.000001	T	0.62122	0.2402	M	0.90542	3.125	0.52501	D	0.99995	D	0.65815	0.995	D	0.63283	0.913	T	0.71790	-0.4486	10	0.62326	D	0.03	.	15.2987	0.73931	1.0:0.0:0.0:0.0	.	2650	Q96JB1	DYH8_HUMAN	S	2855;2855;2650;2614	ENSP00000333363:T2855S;ENSP00000352312:T2650S;ENSP00000402294:T2614S	ENSP00000333363:T2855S	T	+	1	0	DNAH8	38970470	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.242000	0.78210	1.999000	0.58509	0.455000	0.32223	ACT		0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
PRIM2	5558	broad.mit.edu	37	6	57189026	57189026	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:57189026C>T	ENST00000607273.1	+	4	373	c.286C>T	c.(286-288)Cga>Tga	p.R96*	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	96					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.R96*(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATATGAACCACGAAGAAGAGA	0.333																																					p.R96X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C286T	6						.						99.0	92.0	94.0					6																	57189026		1832	4077	5909	57296985	SO:0001587	stop_gained	5558	exon4				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.286C>T	6.37:g.57189026C>T	ENSP00000475738:p.Arg96*		57296985	NM_000947	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Nonsense_Mutation	SNP	ENST00000607273.1	37																																																																																					0.333	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000947	
SPACA1	81833	broad.mit.edu	37	6	88769239	88769239	+	Silent	SNP	C	C	T	rs201338817		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:88769239C>T	ENST00000237201.1	+	5	660	c.543C>T	c.(541-543)ttC>ttT	p.F181F	SPACA1_ENST00000462690.1_3'UTR	NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	181					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)		p.F181F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		CCTTGGCTTTCGAGTGTGACA	0.348													C|||	1	0.000199681	0.0	0.0	5008	,	,		21022	0.001		0.0	False		,,,				2504	0.0				p.F181F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C543T	6						.						93.0	91.0	92.0					6																	88769239		2203	4300	6503	88825958	SO:0001819	synonymous_variant	81833	exon5			AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.543C>T	6.37:g.88769239C>T			88825958	NM_030960		Silent	SNP	ENST00000237201.1	37	CCDS5014.1																																																																																				0.348	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041459.1		
ANKRD6	22881	broad.mit.edu	37	6	90337365	90337365	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:90337365C>T	ENST00000522441.1	+	14	2076	c.1435C>T	c.(1435-1437)Cgc>Tgc	p.R479C	ANKRD6_ENST00000520793.1_Missense_Mutation_p.R420C|ANKRD6_ENST00000339746.4_Missense_Mutation_p.R479C|ANKRD6_ENST00000369408.5_Missense_Mutation_p.R444C|LYRM2_ENST00000520441.1_Intron|ANKRD6_ENST00000447838.2_Missense_Mutation_p.R479C	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	479					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R479C(2)		NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		GTGCCTGAACCGCCTGCAACA	0.512																																					p.R479C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1435T	6						.						78.0	87.0	84.0					6																	90337365		2047	4212	6259	90394086	SO:0001583	missense	22881	exon14			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.1435C>T	6.37:g.90337365C>T	ENSP00000430985:p.Arg479Cys		90394086	NM_014942	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Missense_Mutation	SNP	ENST00000522441.1	37	CCDS56441.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.06|19.06	3.753786|3.753786	0.69648|0.69648	.|.	.|.	ENSG00000135299|ENSG00000135299	ENST00000492158|ENST00000369408;ENST00000339746;ENST00000447838;ENST00000522441;ENST00000518150;ENST00000520793;ENST00000521004	.|T;T;T;T;T	.|0.80393	.|0.33;0.14;0.12;0.14;-1.37	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.000000	.|0.56097	.|D	.|0.000039	D|D	0.87382|0.87382	0.6163|0.6163	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.988;0.998;0.999;0.98	D|D	0.88178|0.88178	0.2869|0.2869	5|10	.|0.87932	.|D	.|0	-18.8383|-18.8383	19.3118|19.3118	0.94189|0.94189	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|420;479;444;479	.|B3KUC3;Q9Y2G4;Q9Y2G4-1;C9JJE8	.|.;ANKR6_HUMAN;.;.	L|C	52|444;479;479;479;220;420;34	.|ENSP00000358416:R444C;ENSP00000345767:R479C;ENSP00000396771:R479C;ENSP00000430985:R479C;ENSP00000429782:R420C	.|ENSP00000345767:R479C	P|R	+|+	2|1	0|0	ANKRD6|ANKRD6	90394086|90394086	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.423000|0.423000	0.31445|0.31445	5.104000|5.104000	0.64584|0.64584	2.558000|2.558000	0.86282|0.86282	0.563000|0.563000	0.77884|0.77884	CCG|CGC		0.512	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376594.1		
BACH2	60468	broad.mit.edu	37	6	90660534	90660534	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:90660534C>T	ENST00000257749.4	-	7	1998	c.1291G>A	c.(1291-1293)Gtg>Atg	p.V431M	BACH2_ENST00000343122.3_Missense_Mutation_p.V431M|RP3-512E2.2_ENST00000413986.1_RNA|BACH2_ENST00000537989.1_Missense_Mutation_p.V431M|RP3-512E2.2_ENST00000445838.1_RNA	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	431						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)	p.V431M(2)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		GAGAAGATCACGCTCCTCCGG	0.592																																					p.V431M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1291A	6						.						34.0	37.0	36.0					6																	90660534		2203	4299	6502	90717255	SO:0001583	missense	60468	exon7			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1291G>A	6.37:g.90660534C>T	ENSP00000257749:p.Val431Met		90717255	NM_021813	E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	ENST00000257749.4	37	CCDS5026.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954263	0.73902	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.57436	0.4;0.4;0.4	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.57403	0.2051	L	0.29908	0.895	0.58432	D	0.999994	D	0.89917	1.0	D	0.85130	0.997	T	0.60840	-0.7183	10	0.59425	D	0.04	-21.4631	19.5376	0.95260	0.0:1.0:0.0:0.0	.	431	Q9BYV9	BACH2_HUMAN	M	431	ENSP00000257749:V431M;ENSP00000437473:V431M;ENSP00000345642:V431M	ENSP00000257749:V431M	V	-	1	0	BACH2	90717255	1.000000	0.71417	0.989000	0.46669	0.935000	0.57460	7.487000	0.81328	2.620000	0.88729	0.655000	0.94253	GTG		0.592	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
ZDHHC14	79683	broad.mit.edu	37	6	158053896	158053896	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr6:158053896T>A	ENST00000359775.5	+	5	1623	c.734T>A	c.(733-735)cTt>cAt	p.L245H	ZDHHC14_ENST00000341375.8_3'UTR|ZDHHC14_ENST00000414563.2_Missense_Mutation_p.L245H			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	245					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.L245H(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		CTAAATGCCCTTAAGGACAGT	0.433																																					p.L245H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T734A	6						.						381.0	361.0	367.0					6																	158053896		2203	4296	6499	157973884	SO:0001583	missense	79683	exon5			AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.734T>A	6.37:g.158053896T>A	ENSP00000352821:p.Leu245His		157973884	NM_153746	A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Missense_Mutation	SNP	ENST00000359775.5	37	CCDS5252.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.2|24.2	4.505701|4.505701	0.85282|0.85282	.|.	.|.	ENSG00000175048|ENSG00000175048	ENST00000359775;ENST00000414563;ENST00000538483|ENST00000340347	T;T|D	0.25414|0.84070	1.8;1.8|-1.8	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.287055|0.287055	0.29260|0.29260	N|N	0.012663|0.012663	T|T	0.81168|0.81168	0.4766|0.4766	M|M	0.78456|0.78456	2.415|2.415	0.49687|0.49687	D|D	0.999817|0.999817	D;D|.	0.71674|.	0.998;0.998|.	D;D|.	0.67231|.	0.95;0.917|.	T|T	0.74423|0.74423	-0.3670|-0.3670	10|8	0.87932|0.16896	D|T	0|0.51	-5.3419|-5.3419	15.6409|15.6409	0.77001|0.77001	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	245;245|.	Q8IZN3;Q8IZN3-2|.	ZDH14_HUMAN;.|.	H|I	245;245;249|70	ENSP00000352821:L245H;ENSP00000410713:L245H|ENSP00000345721:L70I	ENSP00000352821:L245H|ENSP00000345721:L70I	L|L	+|+	2|1	0|2	ZDHHC14|ZDHHC14	157973884|157973884	0.998000|0.998000	0.40836|0.40836	0.972000|0.972000	0.41901|0.41901	0.997000|0.997000	0.91878|0.91878	7.603000|7.603000	0.82811|0.82811	-0.503000|-0.503000	0.06586|0.06586	0.528000|0.528000	0.53228|0.53228	CTT|TTA		0.433	ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042841.2	NM_153746	
SDK1	221935	broad.mit.edu	37	7	4014110	4014110	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr7:4014110G>A	ENST00000404826.2	+	13	2066	c.1927G>A	c.(1927-1929)Ggt>Agt	p.G643S	SDK1_ENST00000389531.3_Missense_Mutation_p.G643S	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	643	Ig-like C2-type 6.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.G643S(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGGCGACATCGGTGACTACAG	0.562																																					p.G643S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1927A	7						.						157.0	116.0	130.0					7																	4014110		2203	4300	6503	3980636	SO:0001583	missense	221935	exon13			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1927G>A	7.37:g.4014110G>A	ENSP00000385899:p.Gly643Ser		3980636	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263732	0.80358	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.80994	-1.44;-1.44	5.35	5.35	0.76521	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	D	0.94479	0.8223	H	0.98701	4.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96764	0.9563	10	0.87932	D	0	.	19.0581	0.93074	0.0:0.0:1.0:0.0	.	643	Q7Z5N4	SDK1_HUMAN	S	643	ENSP00000385899:G643S;ENSP00000374182:G643S	ENSP00000374182:G643S	G	+	1	0	SDK1	3980636	1.000000	0.71417	0.978000	0.43139	0.080000	0.17528	9.229000	0.95273	2.484000	0.83849	0.563000	0.77884	GGT		0.562	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
USP17L2	377630	broad.mit.edu	37	8	11996136	11996136	+	Missense_Mutation	SNP	G	G	C	rs199901434	byFrequency	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr8:11996136G>C	ENST00000333796.3	-	1	450	c.134C>G	c.(133-135)tCt>tGt	p.S45C	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	45					apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.S45C(1)		central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						ACGGGCCTCAGATGAGAGTGG	0.532																																					p.S45C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C134G	8						.																																			12033545	SO:0001583	missense	377630	exon1			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.134C>G	8.37:g.11996136G>C	ENSP00000333329:p.Ser45Cys		12033545	NM_201402		Missense_Mutation	SNP	ENST00000333796.3	37	CCDS43713.1	.	.	.	.	.	.	.	.	.	.	g	2.716	-0.267639	0.05754	.	.	ENSG00000223443	ENST00000333796	T	0.12879	2.64	0.36	-0.721	0.11189	.	2.990610	0.02120	U	0.055540	T	0.11324	0.0276	L	0.32530	0.975	0.22866	N	0.998637	B	0.06786	0.001	B	0.04013	0.001	T	0.28681	-1.0036	10	0.41790	T	0.15	.	4.6065	0.12380	0.3032:0.0:0.6968:0.0	.	45	Q6R6M4	U17L2_HUMAN	C	45	ENSP00000333329:S45C	ENSP00000333329:S45C	S	-	2	0	USP17L2	12033545	0.933000	0.31639	0.006000	0.13384	0.006000	0.05464	2.649000	0.46656	-0.387000	0.07809	-0.385000	0.06624	TCT		0.532	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2	NM_201402	
SLC25A37	51312	broad.mit.edu	37	8	23423812	23423812	+	Silent	SNP	C	C	T	rs568296478		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr8:23423812C>T	ENST00000519973.1	+	2	600	c.402C>T	c.(400-402)gaC>gaT	p.D134D	SLC25A37_ENST00000517923.1_3'UTR	NM_016612.2	NP_057696.2	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 37	134					iron ion homeostasis (GO:0055072)|mitochondrial iron ion transport (GO:0048250)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	iron ion transmembrane transporter activity (GO:0005381)	p.D134D(1)		NS(1)|endometrium(3)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		CTTTAAATGACGTTTTCCACC	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		18953	0.0		0.001	False		,,,				2504	0.0				p.D134D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C402T	8						.						86.0	84.0	84.0					8																	23423812		1963	4148	6111	23479757	SO:0001819	synonymous_variant	51312	exon2			AF495725	CCDS47828.1	8p21.2	2013-05-22	2012-03-29		ENSG00000147454	ENSG00000147454		"""Solute carriers"""	29786	protein-coding gene	gene with protein product	"""mitoferrin"""	610387	"""solute carrier family 25, member 37"""			16511496	Standard	XM_006716352		Approved	MSCP, MFRN, MFRN1	uc003xdo.3	Q9NYZ2	OTTHUMG00000163865	ENST00000519973.1:c.402C>T	8.37:g.23423812C>T			23479757	NM_016612	A2RU93|Q53FT7|Q69YJ8|Q969S1|Q9P0J2	Silent	SNP	ENST00000519973.1	37	CCDS47828.1																																																																																				0.502	SLC25A37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376039.1	NM_016612	
ADRA1A	148	broad.mit.edu	37	8	26721998	26721998	+	Silent	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr8:26721998G>A	ENST00000519229.1	-	1	495	c.489C>T	c.(487-489)ttC>ttT	p.F163F	ADRA1A_ENST00000380586.1_Silent_p.F163F|ADRA1A_ENST00000358857.5_Silent_p.F163F|ADRA1A_ENST00000380572.3_Silent_p.F163F|ADRA1A_ENST00000380587.1_Silent_p.F163F|ADRA1A_ENST00000380573.3_Silent_p.F163F|ADRA1A_ENST00000276393.4_Silent_p.F163F|ADRA1A_ENST00000380581.2_Silent_p.F163F|ADRA1A_ENST00000380582.3_Silent_p.F163F|ADRA1A_ENST00000354550.4_Silent_p.F163F			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	233					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)	p.F163F(5)		breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	GCCTCCAGCCGAACAGGGGTC	0.642																																					p.F163F												.	.	5	Substitution - coding silent(5)	large_intestine(5)	c.C489T	8						.						40.0	45.0	43.0					8																	26721998		2203	4300	6503	26777915	SO:0001819	synonymous_variant	148	exon1			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.489C>T	8.37:g.26721998G>A			26777915	NM_033302	Q9NPY0	Silent	SNP	ENST00000519229.1	37																																																																																					0.642	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000376207.1	NM_033303	
FAM110B	90362	broad.mit.edu	37	8	59059232	59059232	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr8:59059232G>A	ENST00000361488.3	+	5	1323	c.443G>A	c.(442-444)cGg>cAg	p.R148Q	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	148						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R148Q(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				CCGCCCCACCGGTCGGAAGCC	0.657																																					p.R148Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G443A	8						.						16.0	18.0	17.0					8																	59059232		2201	4295	6496	59221786	SO:0001583	missense	90362	exon5			U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.443G>A	8.37:g.59059232G>A	ENSP00000355204:p.Arg148Gln		59221786	NM_147189	Q5BM08|Q9Y4K2	Missense_Mutation	SNP	ENST00000361488.3	37	CCDS6170.1	.	.	.	.	.	.	.	.	.	.	G	9.015	0.983383	0.18889	.	.	ENSG00000169122	ENST00000361488	T	0.31510	1.49	5.53	5.53	0.82687	.	0.160431	0.40385	N	0.001113	T	0.21841	0.0526	L	0.27053	0.805	0.32314	N	0.563382	B	0.16802	0.019	B	0.04013	0.001	T	0.13764	-1.0497	9	.	.	.	-17.8355	13.7092	0.62659	0.0742:0.0:0.9258:0.0	.	148	Q8TC76	F110B_HUMAN	Q	148	ENSP00000355204:R148Q	.	R	+	2	0	FAM110B	59221786	0.977000	0.34250	0.021000	0.16686	0.006000	0.05464	3.969000	0.56816	2.596000	0.87737	0.561000	0.74099	CGG		0.657	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378095.2	NM_147189	
POP1	10940	broad.mit.edu	37	8	99161071	99161071	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr8:99161071T>G	ENST00000401707.2	+	13	1820	c.1739T>G	c.(1738-1740)cTg>cGg	p.L580R	POP1_ENST00000349693.3_Missense_Mutation_p.L580R	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	580					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)	p.L580R(1)		autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			AGTGAATTGCTGGTGCCTGGG	0.443																																					p.L580R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1739G	8						.						83.0	79.0	80.0					8																	99161071		2203	4300	6503	99230247	SO:0001583	missense	10940	exon13			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.1739T>G	8.37:g.99161071T>G	ENSP00000385787:p.Leu580Arg		99230247	NM_001145860	A8K5W9|Q15037	Missense_Mutation	SNP	ENST00000401707.2	37	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.202041	0.79127	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.46819	0.86;0.86	5.46	5.46	0.80206	.	0.087450	0.48286	D	0.000190	T	0.68778	0.3038	M	0.79926	2.475	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.71873	-0.4461	10	0.49607	T	0.09	-10.3548	14.1177	0.65164	0.0:0.0:0.0:1.0	.	580	Q99575	POP1_HUMAN	R	580	ENSP00000385787:L580R;ENSP00000339529:L580R	ENSP00000339529:L580R	L	+	2	0	POP1	99230247	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.299000	0.72770	2.077000	0.62373	0.533000	0.62120	CTG		0.443	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	
KLHL38	340359	broad.mit.edu	37	8	124663888	124663888	+	Missense_Mutation	SNP	C	C	T	rs374238365		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr8:124663888C>T	ENST00000325995.7	-	1	1302	c.1279G>A	c.(1279-1281)Gct>Act	p.A427T	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	427								p.A427T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						TCTTTCACAGCGACTGCGGGG	0.552																																					p.A427T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1279A	8						.						109.0	107.0	107.0					8																	124663888		2020	4188	6208	124733069	SO:0001583	missense	340359	exon1				CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.1279G>A	8.37:g.124663888C>T	ENSP00000321475:p.Ala427Thr		124733069	NM_001081675	A0PK12	Missense_Mutation	SNP	ENST00000325995.7	37	CCDS43766.1	.	.	.	.	.	.	.	.	.	.	C	14.75	2.629836	0.46944	.	.	ENSG00000175946	ENST00000325995	T	0.67523	-0.27	5.48	5.48	0.80851	Kelch-type beta propeller (1);	0.046996	0.85682	D	0.000000	T	0.61912	0.2385	M	0.71581	2.175	0.58432	D	0.999999	P	0.37122	0.583	B	0.29663	0.105	T	0.62191	-0.6906	10	0.25106	T	0.35	.	15.0156	0.71581	0.1429:0.8571:0.0:0.0	.	427	Q2WGJ6	KLH38_HUMAN	T	427	ENSP00000321475:A427T	ENSP00000321475:A427T	A	-	1	0	KLHL38	124733069	1.000000	0.71417	0.859000	0.33776	0.452000	0.32318	5.940000	0.70187	2.571000	0.86741	0.561000	0.74099	GCT		0.552	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381288.1		
ZMYND19	116225	broad.mit.edu	37	9	140481541	140481542	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr9:140481541_140481542insC	ENST00000298585.2	-	4	462_463	c.236_237insG	c.(235-237)ggcfs	p.G79fs	ZMYND19_ENST00000471957.1_5'UTR	NM_138462.2	NP_612471.1	Q96E35	ZMY19_HUMAN	zinc finger, MYND-type containing 19	79						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|synapse (GO:0045202)	metal ion binding (GO:0046872)	p.V80fs*34(2)		endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		CCGGGGCCACGCCCCCCCGGTG	0.634																																					p.G79fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.237_238insG	9						.																																			139601363	SO:0001589	frameshift_variant	116225	exon4			BC012948	CCDS7048.1	9q34.3	2008-02-05			ENSG00000165724	ENSG00000165724		"""Zinc fingers, MYND-type"""	21146	protein-coding gene	gene with protein product		611424					Standard	NM_138462		Approved	MIZIP	uc004cno.1	Q96E35	OTTHUMG00000020992	ENST00000298585.2:c.237dupG	9.37:g.140481548_140481548dupC	ENSP00000298585:p.Gly79fs		139601362	NM_138462	Q5T366	Frame_Shift_Ins	INS	ENST00000298585.2	37	CCDS7048.1																																																																																				0.634	ZMYND19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055356.1	NM_138462	
AKAP2	11217	broad.mit.edu	37	9	112899612	112899612	+	Missense_Mutation	SNP	C	C	A	rs201181068		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr9:112899612C>A	ENST00000259318.7	+	2	1302	c.1095C>A	c.(1093-1095)gaC>gaA	p.D365E	AKAP2_ENST00000374525.1_Missense_Mutation_p.D454E|AKAP2_ENST00000555236.1_Missense_Mutation_p.D596E|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.D596E|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.D596E|AKAP2_ENST00000434623.2_Missense_Mutation_p.D454E|AKAP2_ENST00000510514.5_Missense_Mutation_p.D596E	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	365										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						TCAACTCAGACAAGCCACTGA	0.587																																					p.D596E												.	.	0			c.C1788A	9						.						54.0	59.0	58.0					9																	112899612		2203	4300	6503	111939433	SO:0001583	missense	445815	exon8			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1095C>A	9.37:g.112899612C>A	ENSP00000259318:p.Asp365Glu		111939433	NM_147150	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000259318.7	37	CCDS48003.1	.	.	.	.	.	.	.	.	.	.	C	8.798	0.932246	0.18131	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.48522	2.14;2.14;2.14;2.14;1.39;0.81;0.81;1.42	5.82	0.372	0.16173	.	0.456370	0.24447	N	0.038444	T	0.22975	0.0555	L	0.33485	1.01	0.19300	N	0.999979	B;B;P;B;B;B;B;B	0.41313	0.004;0.047;0.745;0.047;0.028;0.01;0.01;0.006	B;B;B;B;B;B;B;B	0.34931	0.004;0.056;0.192;0.056;0.025;0.009;0.009;0.004	T	0.09422	-1.0675	10	0.12103	T	0.63	-20.9083	2.4458	0.04506	0.1233:0.4354:0.2404:0.2009	.	365;454;448;454;455;596;596;414	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	E	596;596;596;596;454;454;414;365	ENSP00000363654:D596E;ENSP00000305861:D596E;ENSP00000451476:D596E;ENSP00000421522:D596E;ENSP00000404782:D454E;ENSP00000363649:D454E;ENSP00000419268:D414E;ENSP00000259318:D365E	ENSP00000259318:D365E	D	+	3	2	PALM2-AKAP2;AKAP2	111939433	0.632000	0.27172	0.943000	0.38184	0.336000	0.28762	-0.234000	0.09028	0.773000	0.33404	-0.137000	0.14449	GAC		0.587	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065	
NUTM2F	54754	broad.mit.edu	37	9	97082793	97082793	+	Missense_Mutation	SNP	C	C	G	rs577940402		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr9:97082793C>G	ENST00000253262.4	-	5	1085	c.1065G>C	c.(1063-1065)aaG>aaC	p.K355N	NUTM2F_ENST00000341207.4_Missense_Mutation_p.K355N|NUTM2F_ENST00000335456.7_Missense_Mutation_p.K355N	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	355	Pro-rich.							p.K236N(5)									GCAGGTGGGCCTTGGTCTCCG	0.706													.|||	1	0.000199681	0.0	0.0	5008	,	,		14002	0.0		0.0	False		,,,				2504	0.001				p.K355N												.	.	5	Substitution - Missense(5)	large_intestine(5)	c.G1065C	9						.						17.0	24.0	21.0					9																	97082793		1985	4123	6108	96122614	SO:0001583	missense	54754	exon5				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1065G>C	9.37:g.97082793C>G	ENSP00000253262:p.Lys355Asn		96122614	NM_017561	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	ENST00000253262.4	37	CCDS47994.1	.	.	.	.	.	.	.	.	.	.	.	10.88	1.475748	0.26511	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207	T;T;T	0.24151	1.87;2.67;2.67	0.1	0.1	0.14510	.	.	.	.	.	T	0.30070	0.0753	N	0.24115	0.695	0.09310	N	1	D	0.57899	0.981	D	0.69824	0.966	T	0.14062	-1.0486	9	0.62326	D	0.03	.	5.97	0.19346	0.0:0.9994:0.0:6.0E-4	.	355	A1L443	FA22F_HUMAN	N	355	ENSP00000335067:K355N;ENSP00000253262:K355N;ENSP00000343865:K355N	ENSP00000253262:K355N	K	-	3	2	FAM22F	96122614	0.001000	0.12720	0.113000	0.21522	0.093000	0.18481	0.349000	0.20055	0.170000	0.19704	0.173000	0.16961	AAG		0.706	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053173.2	NM_017561	
SURF6	6838	broad.mit.edu	37	9	136198836	136198836	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chr9:136198836G>T	ENST00000372022.4	-	5	1220	c.955C>A	c.(955-957)Cag>Aag	p.Q319K	SURF6_ENST00000468290.1_5'UTR	NM_006753.4	NP_006744.2	O75683	SURF6_HUMAN	surfeit 6	319					ribosome biogenesis (GO:0042254)	granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.Q319K(1)		endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	12				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)		TGGCGCTGCTGCATCTTCTCC	0.731																																					p.Q319K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C955A	9						.						14.0	15.0	15.0					9																	136198836		2199	4294	6493	135188657	SO:0001583	missense	6838	exon5			AF186772	CCDS6962.1	9q33-q34	2010-07-06			ENSG00000148296	ENSG00000148296			11478	protein-coding gene	gene with protein product	"""surfeit locus protein 6"""	185642				9740673, 15629442	Standard	NM_006753		Approved	FLJ30322, RRP14	uc004cdb.4	O75683	OTTHUMG00000020871	ENST00000372022.4:c.955C>A	9.37:g.136198836G>T	ENSP00000361092:p.Gln319Lys		135188657	NM_006753	Q5T8U1|Q9BRK9|Q9BTZ5|Q9UK24	Missense_Mutation	SNP	ENST00000372022.4	37	CCDS6962.1	.	.	.	.	.	.	.	.	.	.	G	33	5.248895	0.95305	.	.	ENSG00000148296	ENST00000372022	T	0.13901	2.55	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.29061	0.0722	L	0.47190	1.495	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.02789	-1.1110	10	0.09843	T	0.71	-25.8049	18.0046	0.89207	0.0:0.0:1.0:0.0	.	319	O75683	SURF6_HUMAN	K	319	ENSP00000361092:Q319K	ENSP00000361092:Q319K	Q	-	1	0	SURF6	135188657	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.770000	0.68873	2.490000	0.84030	0.467000	0.42956	CAG		0.731	SURF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054905.1	NM_006753	
TRMT2B	79979	broad.mit.edu	37	X	100292052	100292052	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chrX:100292052T>C	ENST00000372936.3	-	6	1221	c.449A>G	c.(448-450)aAt>aGt	p.N150S	TRMT2B_ENST00000338687.7_Missense_Mutation_p.N105S|TRMT2B_ENST00000545398.1_Missense_Mutation_p.N150S|TRMT2B_ENST00000372931.5_Missense_Mutation_p.N150S|TRMT2B_ENST00000372935.1_Missense_Mutation_p.N150S|TRMT2B_ENST00000478422.1_5'UTR|TRMT2B_ENST00000372939.1_Missense_Mutation_p.N105S	NM_024917.5	NP_079193.2	Q96GJ1	TRM2_HUMAN	tRNA methyltransferase 2 homolog B (S. cerevisiae)	150						mitochondrion (GO:0005739)	S-adenosylmethionine-dependent tRNA (m5U54) methyltransferase activity (GO:0030697)	p.N150S(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	24						TCGGTAACCATTGATGACAGG	0.488																																					p.N150S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A449G	X						.						100.0	88.0	92.0					X																	100292052		2203	4300	6503	100178708	SO:0001583	missense	79979	exon6			BC020116	CCDS14477.1, CCDS55464.1	Xq22.1	2012-06-12	2012-06-12	2008-09-17	ENSG00000188917	ENSG00000188917			25748	protein-coding gene	gene with protein product			"""chromosome X open reading frame 34"""	CXorf34		14702039	Standard	NM_024917		Approved	FLJ12687	uc004egq.3	Q96GJ1	OTTHUMG00000022017	ENST00000372936.3:c.449A>G	X.37:g.100292052T>C	ENSP00000362027:p.Asn150Ser		100178708	NM_001167970	A6NDG5|A6NEI9|A6NMG6|Q5JPF0|Q5JVY6|Q96HU7|Q96IH9|Q9H9K2	Missense_Mutation	SNP	ENST00000372936.3	37	CCDS14477.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.914074	0.33815	.	.	ENSG00000188917	ENST00000338687;ENST00000545398;ENST00000372939;ENST00000372935;ENST00000372936;ENST00000372931	T;T;T;T;T;T	0.42513	1.01;0.97;1.01;0.97;0.97;0.97	4.97	-0.512	0.11966	.	0.449943	0.22370	N	0.060944	T	0.23806	0.0576	L	0.35542	1.07	0.34335	D	0.688153	B;B;B	0.16166	0.007;0.016;0.005	B;B;B	0.15052	0.012;0.007;0.007	T	0.12604	-1.0541	10	0.21540	T	0.41	-9.5541	4.7088	0.12863	0.0:0.3337:0.1655:0.5008	.	105;150;150	Q96GJ1-3;F2Z384;Q96GJ1	.;.;TRM2_HUMAN	S	105;150;105;150;150;150	ENSP00000340970:N105S;ENSP00000438134:N150S;ENSP00000362030:N105S;ENSP00000362026:N150S;ENSP00000362027:N150S;ENSP00000362022:N150S	ENSP00000340970:N105S	N	-	2	0	TRMT2B	100178708	0.461000	0.25783	0.986000	0.45419	0.977000	0.68977	0.132000	0.15891	-0.117000	0.11872	-0.438000	0.05819	AAT		0.488	TRMT2B-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057512.1	NM_024917	
IGSF1	3547	broad.mit.edu	37	X	130409533	130409533	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chrX:130409533G>A	ENST00000361420.3	-	16	3182	c.3103C>T	c.(3103-3105)Cgt>Tgt	p.R1035C	IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370903.3_Missense_Mutation_p.R1040C|IGSF1_ENST00000370904.1_Missense_Mutation_p.R1026C|IGSF1_ENST00000370910.1_Missense_Mutation_p.R1026C			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1035	Ig-like C2-type 10.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)	p.R1035C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						CAGCTGTAACGCCCCATGCTA	0.517																																					p.R1026C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3076T	X						.						151.0	126.0	134.0					X																	130409533		2203	4300	6503	130237214	SO:0001583	missense	3547	exon15			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3103C>T	X.37:g.130409533G>A	ENSP00000355010:p.Arg1035Cys		130237214	NM_001170962	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.748617	0.49257	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.13420	2.59;2.59;2.59;2.59	4.67	4.67	0.58626	Immunoglobulin-like fold (1);	0.000000	0.47852	D	0.000220	T	0.38692	0.1050	M	0.84326	2.69	0.44000	D	0.996709	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.989;0.976;0.997	T	0.22208	-1.0223	10	0.66056	D	0.02	.	11.8031	0.52139	0.0:0.0:1.0:0.0	.	1026;479;1035	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	C	1026;1035;1026;1040	ENSP00000359947:R1026C;ENSP00000355010:R1035C;ENSP00000359941:R1026C;ENSP00000359940:R1040C	ENSP00000355010:R1035C	R	-	1	0	IGSF1	130237214	0.896000	0.30565	0.991000	0.47740	0.643000	0.38383	2.156000	0.42310	2.562000	0.86427	0.600000	0.82982	CGT		0.517	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1		
BMP15	9210	broad.mit.edu	37	X	50653875	50653875	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chrX:50653875C>T	ENST00000252677.3	+	1	92	c.92C>T	c.(91-93)tCc>tTc	p.S31F		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	31					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.S31F(1)		NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					GGAGGGCAGTCCTCTATTGCC	0.527																																					p.S31F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C92T	X						.						50.0	44.0	46.0					X																	50653875		2203	4298	6501	50670615	SO:0001583	missense	9210	exon1			AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.92C>T	X.37:g.50653875C>T	ENSP00000252677:p.Ser31Phe		50670615	NM_005448	Q17RM6|Q5JST1|Q9UMS1	Missense_Mutation	SNP	ENST00000252677.3	37	CCDS14334.1	.	.	.	.	.	.	.	.	.	.	c	7.164	0.586201	0.13749	.	.	ENSG00000130385	ENST00000252677	D	0.83419	-1.72	4.99	4.12	0.48240	.	1.722310	0.02667	N	0.108179	T	0.79429	0.4444	L	0.36672	1.1	0.09310	N	1	P	0.39964	0.697	B	0.38712	0.28	T	0.66148	-0.5996	10	0.39692	T	0.17	.	10.2135	0.43156	0.1988:0.8012:0.0:0.0	.	31	O95972	BMP15_HUMAN	F	31	ENSP00000252677:S31F	ENSP00000252677:S31F	S	+	2	0	BMP15	50670615	0.107000	0.21998	0.067000	0.19924	0.042000	0.13812	1.130000	0.31393	1.159000	0.42565	0.544000	0.68410	TCC		0.527	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448	
PGK1	5230	broad.mit.edu	37	X	77365405	77365405	+	Missense_Mutation	SNP	A	A	C	rs141397576		TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chrX:77365405A>C	ENST00000373316.4	+	2	274	c.107A>C	c.(106-108)aAc>aCc	p.N36T	PGK1_ENST00000537456.1_Missense_Mutation_p.N8T|PGK1_ENST00000442431.1_Missense_Mutation_p.N36T	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	36					carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.N36T(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	CAGATAACAAACAACCAGAGG	0.383																																					p.N36T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A107C	X						.	A	THR/ASN	0,3835		0,0,1632,571	190.0	151.0	164.0		107	5.9	1.0	X	dbSNP_134	164	1,6722		0,1,2426,1869	no	missense	PGK1	NM_000291.3	65	0,1,4058,2440	CC,CA,AA,A		0.0149,0.0,0.0095	possibly-damaging	36/418	77365405	1,10557	2203	4296	6499	77252061	SO:0001583	missense	5230	exon2			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.107A>C	X.37:g.77365405A>C	ENSP00000362413:p.Asn36Thr		77252061	NM_000291	A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Missense_Mutation	SNP	ENST00000373316.4	37	CCDS14438.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.663356	0.88251	0.0	1.49E-4	ENSG00000102144	ENST00000373316;ENST00000442431;ENST00000537456	D;D;D	0.92099	-2.97;-2.97;-2.97	5.88	5.88	0.94601	Phosphoglycerate kinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97467	0.9171	H	0.98005	4.125	0.49483	D	0.999799	D	0.55800	0.973	D	0.64595	0.927	D	0.98630	1.0671	10	0.87932	D	0	-38.032	14.3501	0.66694	1.0:0.0:0.0:0.0	.	36	P00558	PGK1_HUMAN	T	36;36;8	ENSP00000362413:N36T;ENSP00000405452:N36T;ENSP00000444708:N8T	ENSP00000362413:N36T	N	+	2	0	PGK1	77252061	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.512000	0.90538	1.987000	0.57996	0.486000	0.48141	AAC		0.383	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057310.1		
MAGEC1	9947	broad.mit.edu	37	X	140996328	140996328	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3975-01A-01W-0995-10	TCGA-AA-3975-10A-01W-0999-10	g.chrX:140996328A>C	ENST00000285879.4	+	4	3424	c.3138A>C	c.(3136-3138)aaA>aaC	p.K1046N	MAGEC1_ENST00000406005.2_Missense_Mutation_p.K113N	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1046	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.K1046N(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTCACTAAAGTTTGGGTGC	0.552										HNSCC(15;0.026)																											p.K1046N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3138C	X						.						89.0	88.0	88.0					X																	140996328		2203	4300	6503	140823994	SO:0001583	missense	9947	exon4			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3138A>C	X.37:g.140996328A>C	ENSP00000285879:p.Lys1046Asn		140823994	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	a	11.45	1.643067	0.29246	.	.	ENSG00000155495	ENST00000285879;ENST00000406005	T;T	0.05081	3.5;3.5	0.837	0.837	0.18896	.	.	.	.	.	T	0.11965	0.0291	L	0.61218	1.895	0.09310	N	1	P	0.52061	0.95	P	0.50791	0.65	T	0.14309	-1.0477	8	0.72032	D	0.01	.	.	.	.	.	1046	O60732	MAGC1_HUMAN	N	1046;113	ENSP00000285879:K1046N;ENSP00000385500:K113N	ENSP00000285879:K1046N	K	+	3	2	MAGEC1	140823994	0.016000	0.18221	0.031000	0.17742	0.493000	0.33554	0.375000	0.20518	0.575000	0.29434	0.231000	0.17811	AAA		0.552	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
