#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CPN1	1369	broad.mit.edu	37	10	101835750	101835750	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr10:101835750C>T	ENST00000370418.3	-	2	589	c.338G>A	c.(337-339)cGc>cAc	p.R113H		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	113	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R113H(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		CTGGACGATGCGCTGGTTCCT	0.607																																					p.R113H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G338A	10						.						143.0	116.0	125.0					10																	101835750		2203	4300	6503	101825740	SO:0001583	missense	1369	exon2			X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.338G>A	10.37:g.101835750C>T	ENSP00000359446:p.Arg113His		101825740	NM_001308	B1AP59	Missense_Mutation	SNP	ENST00000370418.3	37	CCDS7486.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.716691	0.68844	.	.	ENSG00000120054	ENST00000370418	T	0.11495	2.77	5.59	5.59	0.84812	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.42698	0.1214	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.44772	-0.9306	10	0.56958	D	0.05	-25.8137	19.5966	0.95541	0.0:1.0:0.0:0.0	.	113	P15169	CBPN_HUMAN	H	113	ENSP00000359446:R113H	ENSP00000359446:R113H	R	-	2	0	CPN1	101825740	1.000000	0.71417	0.992000	0.48379	0.003000	0.03518	4.943000	0.63554	2.647000	0.89833	0.655000	0.94253	CGC		0.607	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049828.1	NM_001308	
APBB1IP	54518	broad.mit.edu	37	10	26792203	26792203	+	Splice_Site	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr10:26792203G>T	ENST00000376236.4	+	6	986	c.531G>T	c.(529-531)aaG>aaT	p.K177N		NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	177	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)		p.K177N(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						AGGTTAAGAAGGTGAATCATG	0.443																																					p.K177N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G531T	10						.						76.0	80.0	78.0					10																	26792203		2203	4300	6503	26832209	SO:0001630	splice_region_variant	54518	exon6			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.531+1G>T	10.37:g.26792203G>T			26832209	NM_019043	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	ENST00000376236.4	37	CCDS31167.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862772	0.91511	.	.	ENSG00000077420	ENST00000445780;ENST00000376236	T	0.77489	-1.1	5.62	5.62	0.85841	Ras-association (2);	0.000000	0.85682	D	0.000000	D	0.89227	0.6655	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.979;0.996	D	0.89871	0.4023	10	0.72032	D	0.01	.	19.6528	0.95823	0.0:0.0:1.0:0.0	.	177;177	B4E100;Q7Z5R6	.;AB1IP_HUMAN	N	177	ENSP00000365411:K177N	ENSP00000365411:K177N	K	+	3	2	APBB1IP	26832209	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	8.684000	0.91242	2.646000	0.89796	0.655000	0.94253	AAG		0.443	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047270.1	NM_019043	Missense_Mutation
RASGEF1A	221002	broad.mit.edu	37	10	43693560	43693560	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr10:43693560G>A	ENST00000395809.1	-	10	3622	c.1116C>T	c.(1114-1116)agC>agT	p.S372S	RASGEF1A_ENST00000472864.1_5'Flank|RASGEF1A_ENST00000395810.1_Silent_p.S372S|RASGEF1A_ENST00000374459.1_Silent_p.S380S			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	372	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)	p.S372S(1)|p.S319S(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						TTTCACGGCTGCTGTTGGCCA	0.557											OREG0020135	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S372S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1116T	10						.						183.0	165.0	171.0					10																	43693560		2203	4300	6503	43013566	SO:0001819	synonymous_variant	221002	exon10			AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.1116C>T	10.37:g.43693560G>A		918	43013566	NM_145313	Q8TBF1	Silent	SNP	ENST00000395809.1	37	CCDS7202.2																																																																																				0.557	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313989.1	NM_145313	
C10orf105	414152	broad.mit.edu	37	10	73468927	73468927	+	IGR	SNP	G	G	T	rs536438868		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr10:73468927G>T	ENST00000441508.2	-	0	4837				CDH23_ENST00000224721.6_Missense_Mutation_p.R1065L	NM_001164375.2	NP_001157847.1	Q8TEF2	CJ105_HUMAN	chromosome 10 open reading frame 105							integral component of membrane (GO:0016021)		p.R1065L(1)									GGCCTGGACCGGGAGACCACA	0.617																																					p.R1060L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3179T	10						.						87.0	109.0	101.0					10																	73468927		2135	4242	6377	73138933	SO:0001628	intergenic_variant	64072	exon26			AK074172	CCDS44430.1	10q22.1	2012-06-01			ENSG00000214688	ENSG00000214688			20304	protein-coding gene	gene with protein product							Standard	NM_001164375		Approved	FLJ00245	uc001jsa.2	Q8TEF2	OTTHUMG00000018427		10.37:g.73468927G>T			73138933	NM_022124		Missense_Mutation	SNP	ENST00000441508.2	37	CCDS44430.1	.	.	.	.	.	.	.	.	.	.	G	35	5.596025	0.96602	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000224721;ENST00000442677	.	.	.	4.97	4.97	0.65823	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000001	D	0.83562	0.5281	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.995	D	0.84180	0.0439	9	0.38643	T	0.18	.	18.2684	0.90060	0.0:0.0:1.0:0.0	.	1060;1060	Q6P152;Q9H251	.;CAD23_HUMAN	L	1065;1060;1060;1063;577	.	ENSP00000224721:R1065L	R	+	2	0	CDH23	73138933	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.771000	0.98977	2.313000	0.78055	0.650000	0.86243	CGG		0.617	C10orf105-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048551.2	NM_001164375	
GRK5	2869	broad.mit.edu	37	10	121212742	121212742	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr10:121212742C>T	ENST00000392870.2	+	15	1957	c.1628C>T	c.(1627-1629)cCg>cTg	p.P543L	GRK5_ENST00000473264.1_3'UTR|GRK5_ENST00000369108.3_Missense_Mutation_p.P438L	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	543					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)	p.P543L(1)		endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		AACCACCCTCCGGAACCGCCC	0.572																																					p.P543L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1628T	10						.						104.0	106.0	105.0					10																	121212742		2203	4300	6503	121202732	SO:0001583	missense	2869	exon15			L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.1628C>T	10.37:g.121212742C>T	ENSP00000376609:p.Pro543Leu		121202732	NM_005308	D3DRD0|Q5T059	Missense_Mutation	SNP	ENST00000392870.2	37	CCDS7612.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.458849	0.63401	.	.	ENSG00000198873	ENST00000392870;ENST00000457057;ENST00000369108	T;T	0.69685	-0.4;-0.42	4.69	3.79	0.43588	Protein kinase-like domain (1);	0.000000	0.56097	D	0.000023	T	0.63034	0.2477	L	0.59436	1.845	0.80722	D	1	D;D	0.71674	0.998;0.998	P;P	0.44897	0.463;0.463	T	0.61347	-0.7081	10	0.27785	T	0.31	-16.0401	12.6975	0.57012	0.0:0.9197:0.0:0.0803	.	543;543	B2R7K0;P34947	.;GRK5_HUMAN	L	543;286;438	ENSP00000376609:P543L;ENSP00000358104:P438L	ENSP00000358104:P438L	P	+	2	0	GRK5	121202732	1.000000	0.71417	0.955000	0.39395	0.950000	0.60333	5.996000	0.70639	0.972000	0.38314	0.655000	0.94253	CCG		0.572	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050652.2	NM_005308	
DNAJB13	374407	broad.mit.edu	37	11	73679469	73679470	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr11:73679469_73679470insCC	ENST00000339764.1	+	6	1437_1438	c.686_687insCC	c.(685-690)aacctcfs	p.L230fs	DNAJB13_ENST00000537753.1_Frame_Shift_Ins_p.L55fs|RP11-167N4.2_ENST00000537019.1_RNA|DNAJB13_ENST00000543947.1_Frame_Shift_Ins_p.L55fs	NM_153614.2	NP_705842.2	P59910	DJB13_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 13	230					protein folding (GO:0006457)			p.L230fs*5(1)		large_intestine(3)|lung(2)	5	Breast(11;7.42e-05)					GAGAATGACAACCTCTTCTTCG	0.584																																					p.N229fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.686_687insCC	11						.																																			73357118	SO:0001589	frameshift_variant	374407	exon6			AF516185	CCDS8227.1	11q13.3	2011-09-02	2010-04-21		ENSG00000187726	ENSG00000187726		"""Heat shock proteins / DNAJ (HSP40)"""	30718	protein-coding gene	gene with protein product	"""radial spoke 16 homolog A (Chlamydomonas)"""	610263	"""DnaJ (Hsp40) related, subfamily B, member 13"""				Standard	NM_153614		Approved	TSARG6, RSPH16A	uc001ouo.3	P59910	OTTHUMG00000168093	ENST00000339764.1:c.687_688dupCC	11.37:g.73679470_73679471dupCC	ENSP00000344431:p.Leu230fs		73357117	NM_153614	B3LEP4|Q8IZW5	Frame_Shift_Ins	INS	ENST00000339764.1	37	CCDS8227.1																																																																																				0.584	DNAJB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398100.1	NM_153614	
PHRF1	57661	broad.mit.edu	37	11	592602	592602	+	Missense_Mutation	SNP	C	C	T	rs200929014		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr11:592602C>T	ENST00000264555.5	+	6	676	c.548C>T	c.(547-549)cCg>cTg	p.P183L	PHRF1_ENST00000533464.1_Missense_Mutation_p.P179L|PHRF1_ENST00000413872.2_Missense_Mutation_p.P182L|PHRF1_ENST00000416188.2_Missense_Mutation_p.P183L	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	183					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)	p.P183L(1)		breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GAGGAGGACCCGACCTTCTGT	0.617																																					p.P183L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C548T	11						.	C	LEU/PRO	1,4351		0,1,2175	134.0	156.0	148.0		548	4.1	0.9	11		148	0,8514		0,0,4257	yes	missense	PHRF1	NM_020901.2	98	0,1,6432	TT,TC,CC		0.0,0.023,0.0078	possibly-damaging	183/1649	592602	1,12865	2176	4257	6433	582602	SO:0001583	missense	57661	exon6			BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.548C>T	11.37:g.592602C>T	ENSP00000264555:p.Pro183Leu		582602	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37		.	.	.	.	.	.	.	.	.	.	C	15.16	2.749594	0.49257	2.3E-4	0.0	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	D;D;D;D	0.86627	-2.15;-2.15;-2.15;-2.15	4.11	4.11	0.48088	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.38778	N	0.001580	D	0.87977	0.6314	L	0.27053	0.805	0.49798	D	0.999824	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	P;D;D;P	0.66716	0.885;0.946;0.946;0.885	D	0.87352	0.2338	10	0.35671	T	0.21	-11.0856	15.2746	0.73732	0.0:1.0:0.0:0.0	.	179;182;183;183	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	L	183;182;183;179	ENSP00000264555:P183L;ENSP00000388589:P182L;ENSP00000410626:P183L;ENSP00000431870:P179L	ENSP00000264555:P183L	P	+	2	0	PHRF1	582602	0.999000	0.42202	0.921000	0.36526	0.196000	0.23810	4.318000	0.59190	2.131000	0.65755	0.655000	0.94253	CCG		0.617	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
MRGPRX3	117195	broad.mit.edu	37	11	18159092	18159092	+	Missense_Mutation	SNP	G	G	A	rs201248611		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr11:18159092G>A	ENST00000396275.2	+	3	704	c.343G>A	c.(343-345)Gcc>Acc	p.A115T		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.A115T(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CATGCTGAGCGCCATCAGCAC	0.562													g|||	1	0.000199681	0.0	0.0	5008	,	,		20751	0.001		0.0	False		,,,				2504	0.0				p.A115T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G343A	11						.						124.0	116.0	119.0					11																	18159092		2200	4293	6493	18115668	SO:0001583	missense	117195	exon3				CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.343G>A	11.37:g.18159092G>A	ENSP00000379571:p.Ala115Thr		18115668	NM_054031	B0M0L1|Q8TDE0|Q8TDE1	Missense_Mutation	SNP	ENST00000396275.2	37	CCDS7830.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	13.54	2.268403	0.40095	.	.	ENSG00000179826	ENST00000396275;ENST00000531264	T;T	0.44482	0.92;0.92	1.46	-0.83	0.10792	GPCR, rhodopsin-like superfamily (1);	0.179558	0.39407	N	0.001380	T	0.50599	0.1625	M	0.73962	2.25	0.18873	N	0.999984	D	0.69078	0.997	P	0.59487	0.858	T	0.41752	-0.9491	10	0.44086	T	0.13	.	5.8933	0.18925	0.3331:0.0:0.6669:0.0	.	115	Q96LB0	MRGX3_HUMAN	T	115	ENSP00000379571:A115T;ENSP00000436242:A115T	ENSP00000379571:A115T	A	+	1	0	MRGPRX3	18115668	0.055000	0.20627	0.000000	0.03702	0.004000	0.04260	1.505000	0.35736	-0.245000	0.09625	-0.450000	0.05554	GCC		0.562	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389767.1	NM_054031	
QSER1	79832	broad.mit.edu	37	11	32956227	32956227	+	Silent	SNP	A	A	G			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr11:32956227A>G	ENST00000399302.2	+	4	3371	c.3036A>G	c.(3034-3036)agA>agG	p.R1012R	QSER1_ENST00000527788.1_Silent_p.R773R	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1012								p.R1012R(1)		breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					CTAGTAGTAGAAGTATAAGTG	0.408																																					p.R1012R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3036G	11						.						79.0	78.0	78.0					11																	32956227		1875	4108	5983	32912803	SO:0001819	synonymous_variant	79832	exon4			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.3036A>G	11.37:g.32956227A>G			32912803	NM_001076786	Q6ZU30|Q6ZUR5	Silent	SNP	ENST00000399302.2	37	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	A	3.915	-0.019207	0.07634	.	.	ENSG00000060749	ENST00000524678	.	.	.	5.83	3.51	0.40186	.	.	.	.	.	T	0.57784	0.2077	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51012	-0.8759	4	.	.	.	.	7.951	0.30014	0.6999:0.0:0.3001:0.0	.	.	.	.	G	33	.	.	E	+	2	0	QSER1	32912803	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	0.929000	0.28844	0.480000	0.27534	0.533000	0.62120	GAA		0.408	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
NAT10	55226	broad.mit.edu	37	11	34158192	34158192	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr11:34158192G>T	ENST00000257829.3	+	20	2238	c.2032G>T	c.(2032-2034)Gtc>Ttc	p.V678F	NAT10_ENST00000527971.1_Intron|NAT10_ENST00000531159.2_Missense_Mutation_p.V606F	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	678	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.					membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)	p.V678F(1)		endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				TTCCCAGGCTGTCAGCTTGTT	0.552																																					p.V606F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1816T	11						.						95.0	84.0	88.0					11																	34158192		2202	4298	6500	34114768	SO:0001583	missense	55226	exon18			AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.2032G>T	11.37:g.34158192G>T	ENSP00000257829:p.Val678Phe		34114768	NM_001144030	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	ENST00000257829.3	37	CCDS7889.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.412784	0.42817	.	.	ENSG00000135372	ENST00000257829;ENST00000531159	T;T	0.31769	1.48;1.48	5.4	4.48	0.54585	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (1);	0.053328	0.85682	N	0.000000	T	0.41581	0.1165	M	0.84683	2.71	0.80722	D	1	B	0.27853	0.191	B	0.27608	0.081	T	0.45556	-0.9253	10	0.59425	D	0.04	-22.0724	15.4202	0.75006	0.0:0.0:0.8597:0.1403	.	678	Q9H0A0	NAT10_HUMAN	F	678;606	ENSP00000257829:V678F;ENSP00000433011:V606F	ENSP00000257829:V678F	V	+	1	0	NAT10	34114768	1.000000	0.71417	0.889000	0.34880	0.222000	0.24845	7.998000	0.88491	1.257000	0.44085	0.561000	0.74099	GTC		0.552	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662	
PGA5	5222	broad.mit.edu	37	11	61017154	61017154	+	Missense_Mutation	SNP	G	G	A	rs200405121		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr11:61017154G>A	ENST00000312403.5	+	7	972	c.787G>A	c.(787-789)Gga>Aga	p.G263R	CTD-2331C18.5_ENST00000537594.1_RNA|PGA4_ENST00000422676.2_Missense_Mutation_p.G263R|PGA5_ENST00000541528.1_Missense_Mutation_p.G3R|PGA5_ENST00000451616.2_Missense_Mutation_p.G109R	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)	263					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.G263R(4)		large_intestine(1)|skin(1)	2						CACCATGAACGGAGAGACCAT	0.587													g|||	1	0.000199681	0.0	0.0014	5008	,	,		19361	0.0		0.0	False		,,,				2504	0.0				p.G263R												.	.	4	Substitution - Missense(4)	large_intestine(2)|skin(2)	c.G787A	11						.						137.0	136.0	136.0					11																	61017154		2202	4299	6501	60773730	SO:0001583	missense	5222	exon7			BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.787G>A	11.37:g.61017154G>A	ENSP00000309542:p.Gly263Arg		60773730	NM_014224	A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	ENST00000312403.5	37	CCDS8001.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	16.70	3.195527	0.58126	.	.	ENSG00000229183;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713	ENST00000422676;ENST00000312403;ENST00000537359;ENST00000544083;ENST00000451616;ENST00000541528	T;T;T;T	0.62639	0.01;0.01;0.01;0.01	2.91	2.91	0.33838	.	0.163977	0.36972	N	0.002318	T	0.76758	0.4032	M	0.81802	2.56	0.34158	D	0.668378	D	0.89917	1.0	D	0.77004	0.989	T	0.81404	-0.0948	10	0.25751	T	0.34	.	13.8637	0.63576	0.0:0.0:1.0:0.0	.	263	B7ZW62	.	R	263;263;220;122;109;3	ENSP00000395402:G263R;ENSP00000309542:G263R;ENSP00000408739:G109R;ENSP00000441981:G3R	ENSP00000395402:G263R	G	+	1	0	PGA4;PGA5	60773730	1.000000	0.71417	0.146000	0.22360	0.229000	0.25112	5.535000	0.67173	1.991000	0.58162	0.420000	0.28162	GGA		0.587	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397972.1	NM_014224	
AHNAK	79026	broad.mit.edu	37	11	62259228	62259228	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr11:62259228C>A	ENST00000257247.7	-	5	653	c.418G>T	c.(418-420)Gtt>Ttt	p.V140F	AHNAK_ENST00000525875.1_5'UTR|AHNAK_ENST00000530124.1_Intron	NM_024060.2	NP_076965.2	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	229					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.V140F(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GAGACTGAAACTGCCCCGGCT	0.473																																					p.V140F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G418T	11						.						91.0	101.0	98.0					11																	62259228		2042	4194	6236	62015804	SO:0001583	missense	79026	exon5			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000257247.7:c.418G>T	11.37:g.62259228C>A	ENSP00000257247:p.Val140Phe		62015804	NM_024060	A1A586	Missense_Mutation	SNP	ENST00000257247.7	37	CCDS44625.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604229	0.28534	.	.	ENSG00000124942	ENST00000257247	T	0.54071	0.59	3.54	1.59	0.23543	.	.	.	.	.	T	0.30792	0.0776	N	0.14661	0.345	0.09310	N	1	B	0.25169	0.119	B	0.16289	0.015	T	0.19647	-1.0299	9	0.62326	D	0.03	.	5.2178	0.15352	0.0:0.6732:0.2092:0.1176	.	140	A1A586	.	F	140	ENSP00000257247:V140F	ENSP00000257247:V140F	V	-	1	0	AHNAK	62015804	0.017000	0.18338	0.003000	0.11579	0.967000	0.64934	0.382000	0.20635	0.461000	0.27071	0.579000	0.79373	GTT		0.473	AHNAK-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395014.1	NM_024060	
ZBTB16	7704	broad.mit.edu	37	11	113935103	113935103	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr11:113935103G>T	ENST00000335953.4	+	2	1461	c.1081G>T	c.(1081-1083)Gcc>Tcc	p.A361S	ZBTB16_ENST00000392996.2_Missense_Mutation_p.A361S	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	361					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A361S(1)		central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		CGTGCAGCCTGCCCTGGCTGT	0.617																																					p.A361S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1081T	11						.						59.0	59.0	59.0					11																	113935103		2201	4296	6497	113440313	SO:0001583	missense	7704	exon2			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1081G>T	11.37:g.113935103G>T	ENSP00000338157:p.Ala361Ser		113440313	NM_006006	Q8TAL4	Missense_Mutation	SNP	ENST00000335953.4	37	CCDS8367.1	.	.	.	.	.	.	.	.	.	.	G	9.889	1.203688	0.22121	.	.	ENSG00000109906	ENST00000335953;ENST00000392996	T;T	0.09817	2.94;2.94	5.2	1.23	0.21249	.	0.187590	0.46442	D	0.000288	T	0.04952	0.0133	N	0.14661	0.345	0.42093	D	0.991301	B;B	0.12630	0.006;0.002	B;B	0.11329	0.003;0.006	T	0.40098	-0.9581	10	0.07482	T	0.82	-2.3437	9.0797	0.36545	0.3499:0.0:0.6501:0.0	.	361;366	Q05516;Q59H43	ZBT16_HUMAN;.	S	361	ENSP00000338157:A361S;ENSP00000376721:A361S	ENSP00000338157:A361S	A	+	1	0	ZBTB16	113440313	0.993000	0.37304	0.301000	0.25044	0.982000	0.71751	1.881000	0.39638	0.072000	0.16694	0.563000	0.77884	GCC		0.617	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006	
CEP164	22897	broad.mit.edu	37	11	117282524	117282525	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr11:117282524_117282525delCT	ENST00000278935.3	+	32	4324_4325	c.4177_4178delCT	c.(4177-4179)ctcfs	p.L1394fs	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1394					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.L1393fs*10(1)		breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GCAGCTCCGGCTCCTACAGCAC	0.594																																					p.1393_1393del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.4177_4178del	11						.																																			116787735	SO:0001589	frameshift_variant	22897	exon32			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.4177_4178delCT	11.37:g.117282524_117282525delCT	ENSP00000278935:p.Leu1394fs		116787734	NM_014956	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Frame_Shift_Del	DEL	ENST00000278935.3	37	CCDS31683.1																																																																																				0.594	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
OSBP	5007	broad.mit.edu	37	11	59382784	59382786	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	GCT	GCT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr11:59382784_59382786delGCT	ENST00000263847.1	-	1	831_833	c.352_354delAGC	c.(352-354)agcdel	p.S118del	AP000442.1_ENST00000531108.1_RNA	NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	118	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)	p.S118delS(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		ACCTGTAGTAGCTCAGGAGCCCG	0.616																																					p.118_118del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.352_354del	11						.																																			59139362	SO:0001651	inframe_deletion	5007	exon1			AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.352_354delAGC	11.37:g.59382784_59382786delGCT	ENSP00000263847:p.Ser118del		59139360	NM_002556	Q6P524	In_Frame_Del	DEL	ENST00000263847.1	37	CCDS7974.1																																																																																				0.616	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1		
MYO1H	283446	broad.mit.edu	37	12	109858794	109858795	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:109858794_109858795insA	ENST00000431443.2	+	15	1588_1589	c.1588_1589insA	c.(1588-1590)gaafs	p.E530fs	MYO1H_ENST00000310903.5_Frame_Shift_Ins_p.E520fs	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	530	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.N522fs*9(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						AGGATTCTTGGAAAAAAACAAT	0.302																																					p.E520fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1558_1559insA	12						.																																			108343178	SO:0001589	frameshift_variant	283446	exon15				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1595dupA	12.37:g.109858801_109858801dupA	ENSP00000444076:p.Glu530fs		108343177	NM_001101421	F5H3C6	Frame_Shift_Ins	INS	ENST00000431443.2	37																																																																																					0.302	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
CACNA1C	775	broad.mit.edu	37	12	2786288	2786288	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:2786288C>T	ENST00000347598.4	+	42	5001	c.5001C>T	c.(4999-5001)taC>taT	p.Y1667Y	CACNA1C_ENST00000399637.1_Silent_p.Y1638Y|CACNA1C_ENST00000399603.1_Silent_p.Y1619Y|CACNA1C_ENST00000399621.1_Silent_p.Y1638Y|CACNA1C_ENST00000406454.3_Silent_p.Y1619Y|CACNA1C_ENST00000399595.1_Silent_p.Y1627Y|CACNA1C_ENST00000399597.1_Silent_p.Y1619Y|CACNA1C_ENST00000402845.3_Silent_p.Y1638Y|CACNA1C_ENST00000399634.1_Silent_p.Y1619Y|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399655.1_Silent_p.Y1619Y|CACNA1C_ENST00000399641.1_Silent_p.Y1619Y|CACNA1C_ENST00000399644.1_Silent_p.Y1619Y|CACNA1C_ENST00000399617.1_Silent_p.Y1619Y|CACNA1C_ENST00000399649.1_Silent_p.Y1625Y|CACNA1C_ENST00000327702.7_Silent_p.Y1619Y|CACNA1C_ENST00000335762.5_Silent_p.Y1644Y|CACNA1C_ENST00000399629.1_Silent_p.Y1636Y|CACNA1C_ENST00000399606.1_Silent_p.Y1639Y|CACNA1C_ENST00000399591.1_Silent_p.Y1627Y|CACNA1C_ENST00000344100.3_Silent_p.Y1660Y|CACNA1C_ENST00000399638.1_Silent_p.Y1647Y|CACNA1C_ENST00000399601.1_Silent_p.Y1619Y	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1667					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.Y1154Y(1)|p.Y1697Y(1)|p.Y1660Y(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCAAGTTCTACGCCACGTTCC	0.542																																					p.Y1619Y												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C4857T	12						.						38.0	40.0	40.0					12																	2786288		2082	4244	6326	2656549	SO:0001819	synonymous_variant	775	exon40			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5001C>T	12.37:g.2786288C>T			2656549	NM_001129842	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	CCDS44788.1																																																																																				0.542	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ACVR1B	91	broad.mit.edu	37	12	52370255	52370255	+	Missense_Mutation	SNP	G	G	A	rs200366489		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:52370255G>A	ENST00000257963.4	+	3	553	c.476G>A	c.(475-477)cGc>cAc	p.R159H	ACVR1B_ENST00000415850.2_Missense_Mutation_p.R159H|ACVR1B_ENST00000426655.2_Missense_Mutation_p.R159H|ACVR1B_ENST00000542485.1_Missense_Mutation_p.R107H|ACVR1B_ENST00000541224.1_Missense_Mutation_p.R159H	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	159					activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.R159H(2)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TATCACAACCGCCAGAGACTG	0.512																																					p.R107H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G320A	12						.						178.0	165.0	169.0					12																	52370255		2203	4300	6503	50656522	SO:0001583	missense	91	exon3				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.476G>A	12.37:g.52370255G>A	ENSP00000257963:p.Arg159His		50656522	NM_020327	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935809	0.73442	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	D;D;D;D;D	0.93426	-2.16;-3.22;-2.02;-1.94;-2.0	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.89047	0.6604	N	0.24115	0.695	0.80722	D	1	B;B;B;B	0.27791	0.052;0.003;0.103;0.189	B;B;B;B	0.26094	0.022;0.003;0.021;0.066	D	0.85672	0.1295	10	0.39692	T	0.17	.	19.35	0.94379	0.0:0.0:1.0:0.0	.	159;159;159;159	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	H	159;159;159;159;107	ENSP00000257963:R159H;ENSP00000442656:R159H;ENSP00000390477:R159H;ENSP00000397550:R159H;ENSP00000442885:R107H	ENSP00000257963:R159H	R	+	2	0	ACVR1B	50656522	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.702000	0.84576	2.652000	0.90054	0.462000	0.41574	CGC		0.512	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
KRT6B	3854	broad.mit.edu	37	12	52841175	52841175	+	Silent	SNP	G	G	A	rs147867894	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:52841175G>A	ENST00000252252.3	-	9	1541	c.1494C>T	c.(1492-1494)ggC>ggT	p.G498G		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	498	Tail.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.G498G(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CGCTGGCACCGCCATAGCCAC	0.617													G|||	5	0.000998403	0.0008	0.0014	5008	,	,		20104	0.001		0.002	False		,,,				2504	0.0				p.G498G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1494T	12						.	G		1,4405	2.1+/-5.4	0,1,2202	43.0	44.0	43.0		1494	1.3	0.4	12	dbSNP_134	43	27,8573	19.2+/-60.6	0,27,4273	no	coding-synonymous	KRT6B	NM_005555.3		0,28,6475	AA,AG,GG		0.314,0.0227,0.2153		498/565	52841175	28,12978	2203	4300	6503	51127442	SO:0001819	synonymous_variant	3854	exon9			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1494C>T	12.37:g.52841175G>A			51127442	NM_005555	P48669	Silent	SNP	ENST00000252252.3	37	CCDS8828.1																																																																																				0.617	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555	
ESPL1	9700	broad.mit.edu	37	12	53675382	53675382	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:53675382G>A	ENST00000257934.4	+	13	2682	c.2591G>A	c.(2590-2592)cGa>cAa	p.R864Q	ESPL1_ENST00000552462.1_Missense_Mutation_p.R864Q	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	864					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)	p.R864Q(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GATCTGCTTCGAAGTCAACTC	0.453																																					p.R864Q	Colon(53;1069 1201 2587 5382)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2591A	12						.						170.0	148.0	156.0					12																	53675382		2203	4300	6503	51961649	SO:0001583	missense	9700	exon13			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.2591G>A	12.37:g.53675382G>A	ENSP00000257934:p.Arg864Gln		51961649	NM_012291		Missense_Mutation	SNP	ENST00000257934.4	37	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.278226	0.40294	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.14022	2.54;2.54	5.1	-2.87	0.05700	.	1.005060	0.07997	N	0.988111	T	0.11067	0.0270	L	0.40543	1.245	0.09310	N	1	B;B	0.26258	0.145;0.001	B;B	0.17722	0.019;0.001	T	0.30650	-0.9971	10	0.38643	T	0.18	.	10.6383	0.45577	0.6541:0.0:0.3459:0.0	.	75;864	B4DRU1;Q14674	.;ESPL1_HUMAN	Q	864;539;864	ENSP00000257934:R864Q;ENSP00000449831:R864Q	ENSP00000257934:R864Q	R	+	2	0	ESPL1	51961649	0.008000	0.16893	0.000000	0.03702	0.969000	0.65631	-0.148000	0.10219	-0.722000	0.04922	-0.254000	0.11334	CGA		0.453	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
CDK2	1017	broad.mit.edu	37	12	56362610	56362610	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:56362610C>G	ENST00000266970.4	+	4	604	c.364C>G	c.(364-366)Cgg>Ggg	p.R122G	CDK2_ENST00000556656.1_3'UTR|PMEL_ENST00000360714.4_5'Flank|PMEL_ENST00000550447.1_5'Flank|PMEL_ENST00000548689.1_5'Flank|PMEL_ENST00000539511.1_5'Flank|PMEL_ENST00000550464.1_5'Flank|PMEL_ENST00000548493.1_5'Flank|PMEL_ENST00000552882.1_5'Flank|CDK2_ENST00000354056.4_Missense_Mutation_p.R122G|PMEL_ENST00000548747.1_5'Flank|PMEL_ENST00000449260.2_5'Flank|PMEL_ENST00000536427.1_5'Flank|CDK2_ENST00000553376.1_Missense_Mutation_p.R122G|CDK2_ENST00000440311.2_Missense_Mutation_p.R96G|RP11-973D8.4_ENST00000554022.1_RNA	NM_001798.3	NP_001789.2	P24941	CDK2_HUMAN	cyclin-dependent kinase 2	122	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|blood coagulation (GO:0007596)|cellular response to nitric oxide (GO:0071732)|centrosome duplication (GO:0051298)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone phosphorylation (GO:0016572)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transport (GO:0006813)|Ras protein signal transduction (GO:0007265)|regulation of gene silencing (GO:0060968)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	Cajal body (GO:0015030)|centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|condensed chromosome (GO:0000793)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|X chromosome (GO:0000805)|Y chromosome (GO:0000806)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)	p.R122G(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	18			UCEC - Uterine corpus endometrioid carcinoma (6;0.123)|OV - Ovarian serous cystadenocarcinoma(18;0.235)		Bosutinib(DB06616)	CCATTCTCATCGGGTCCTCCA	0.507																																					p.R122G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C364G	12						.						130.0	119.0	123.0					12																	56362610		2203	4300	6503	54648877	SO:0001583	missense	1017	exon4			M68520	CCDS8898.1, CCDS8899.1	12q13	2011-11-08				ENSG00000123374		"""Cyclin-dependent kinases"""	1771	protein-coding gene	gene with protein product		116953				1717994, 8275715	Standard	NM_001798		Approved		uc001sit.4	P24941		ENST00000266970.4:c.364C>G	12.37:g.56362610C>G	ENSP00000266970:p.Arg122Gly		54648877	NM_052827	A8K7C6|O75100	Missense_Mutation	SNP	ENST00000266970.4	37	CCDS8898.1	.	.	.	.	.	.	.	.	.	.	C	19.00	3.741475	0.69304	.	.	ENSG00000123374	ENST00000266970;ENST00000553376;ENST00000440311;ENST00000354056	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	4.53	3.56	0.40772	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.30324	0.0761	N	0.01284	-0.91	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.988;0.999;0.999	T	0.55736	-0.8094	10	0.72032	D	0.01	-9.2148	13.5298	0.61615	0.1564:0.8436:0.0:0.0	.	96;122;122	E7ESI2;P24941-2;P24941	.;.;CDK2_HUMAN	G	122;122;96;122	ENSP00000266970:R122G;ENSP00000452514:R122G;ENSP00000393605:R96G;ENSP00000243067:R122G	ENSP00000266970:R122G	R	+	1	2	CDK2	54648877	0.995000	0.38212	1.000000	0.80357	0.990000	0.78478	2.060000	0.41394	2.526000	0.85167	0.462000	0.41574	CGG		0.507	CDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409650.1		
SHMT2	6472	broad.mit.edu	37	12	57626343	57626343	+	Silent	SNP	C	C	T	rs561041442		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:57626343C>T	ENST00000328923.3	+	6	1154	c.702C>T	c.(700-702)taC>taT	p.Y234Y	SHMT2_ENST00000393827.4_Silent_p.Y138Y|SHMT2_ENST00000449049.3_Silent_p.Y213Y|SHMT2_ENST00000554600.1_3'UTR|SHMT2_ENST00000553474.1_Silent_p.Y213Y|SHMT2_ENST00000414700.3_Silent_p.Y213Y|SHMT2_ENST00000557487.1_Silent_p.Y224Y	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	234					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)	p.Y234Y(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	TCATTGACTACGCCCGCATGA	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		17958	0.0		0.0	False		,,,				2504	0.001				p.Y213Y	Esophageal Squamous(150;1369 2416 49071 49364)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C639T	12						.						75.0	80.0	78.0					12																	57626343		2203	4300	6503	55912610	SO:0001819	synonymous_variant	6472	exon6			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.702C>T	12.37:g.57626343C>T			55912610	NM_001166359	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Silent	SNP	ENST00000328923.3	37	CCDS8934.1	.	.	.	.	.	.	.	.	.	.	C	4.645	0.119853	0.08881	.	.	ENSG00000182199	ENST00000557529	.	.	.	5.09	-10.2	0.00374	.	.	.	.	.	T	0.65037	0.2653	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.76105	-0.3081	4	.	.	.	-7.8069	19.6253	0.95676	0.0:0.7285:0.0:0.2715	.	.	.	.	C	34	.	.	R	+	1	0	SHMT2	55912610	0.001000	0.12720	0.213000	0.23690	0.664000	0.39144	-1.608000	0.02068	-2.397000	0.00581	-1.305000	0.01319	CGC		0.642	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
GLI1	2735	broad.mit.edu	37	12	57863474	57863474	+	Silent	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:57863474C>A	ENST00000228682.2	+	11	1660	c.1569C>A	c.(1567-1569)tcC>tcA	p.S523S	GLI1_ENST00000543426.1_Silent_p.S395S|GLI1_ENST00000546141.1_Silent_p.S482S	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	523					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)	p.S523S(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CCAGCTTGTCCCACACCGGTG	0.612																																					p.S395S	Pancreas(157;841 1936 10503 41495 50368)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1185A	12						.						32.0	32.0	32.0					12																	57863474		2203	4300	6503	56149741	SO:0001819	synonymous_variant	2735	exon9				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1569C>A	12.37:g.57863474C>A			56149741	NM_001160045	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Silent	SNP	ENST00000228682.2	37	CCDS8940.1																																																																																				0.612	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269	
CDK17	5128	broad.mit.edu	37	12	96692676	96692676	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:96692676T>C	ENST00000261211.3	-	7	1289	c.686A>G	c.(685-687)gAa>gGa	p.E229G	CDK17_ENST00000553042.1_5'UTR|CDK17_ENST00000543119.2_Missense_Mutation_p.E229G|CDK17_ENST00000542666.1_Missense_Mutation_p.E176G	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	229	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.E229G(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						GGGTGCACCTTCTTCATGTTC	0.303																																					p.E229G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A686G	12						.						162.0	151.0	155.0					12																	96692676		2203	4298	6501	95216807	SO:0001583	missense	5128	exon7				CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.686A>G	12.37:g.96692676T>C	ENSP00000261211:p.Glu229Gly		95216807	NM_002595	A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	ENST00000261211.3	37	CCDS9061.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.925634	0.92319	.	.	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000542666	T;T;T	0.66460	-0.21;-0.21;-0.21	5.72	5.72	0.89469	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81555	0.4847	M	0.81341	2.54	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.64042	0.921;0.921	D	0.84451	0.0588	10	0.87932	D	0	-19.1789	15.9998	0.80285	0.0:0.0:0.0:1.0	.	229;229	A8K1U6;Q00537	.;CDK17_HUMAN	G	229;229;176	ENSP00000261211:E229G;ENSP00000444459:E229G;ENSP00000442926:E176G	ENSP00000261211:E229G	E	-	2	0	CDK17	95216807	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.978000	0.88095	2.167000	0.68274	0.533000	0.62120	GAA		0.303	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408751.1	NM_002595	
ANO4	121601	broad.mit.edu	37	12	101473025	101473025	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:101473025G>A	ENST00000392977.3	+	15	1577	c.1367G>A	c.(1366-1368)tGg>tAg	p.W456*	ANO4_ENST00000299222.9_Nonsense_Mutation_p.W23*|ANO4_ENST00000392979.3_Nonsense_Mutation_p.W421*|ANO4_ENST00000550015.1_Nonsense_Mutation_p.W23*			Q32M45	ANO4_HUMAN	anoctamin 4	456					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.W421*(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						GCTTATGACTGGGATTTGATA	0.408										HNSCC(74;0.22)																											p.W421X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1262A	12						.						150.0	146.0	147.0					12																	101473025		2203	4300	6503	99997156	SO:0001587	stop_gained	121601	exon14			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1367G>A	12.37:g.101473025G>A	ENSP00000376703:p.Trp456*		99997156	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Nonsense_Mutation	SNP	ENST00000392977.3	37		.	.	.	.	.	.	.	.	.	.	G	35	5.581206	0.96565	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9783	0.92746	0.0:0.0:1.0:0.0	.	.	.	.	X	421;23;456;23	.	ENSP00000299222:W23X	W	+	2	0	ANO4	99997156	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.110000	0.94302	2.552000	0.86080	0.655000	0.94253	TGG		0.408	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
ASCL4	121549	broad.mit.edu	37	12	108169003	108169003	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr12:108169003C>T	ENST00000342331.4	+	1	842	c.11C>T	c.(10-12)aCg>aTg	p.T4M		NM_203436.2	NP_982260.2	Q6XD76	ASCL4_HUMAN	achaete-scute family bHLH transcription factor 4	3					regulation of transcription from RNA polymerase II promoter (GO:0006357)|skin development (GO:0043588)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T3M(1)		breast(2)|central_nervous_system(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	13						ATGATGGAGACGCGTAAACCG	0.597																																					p.T4M	GBM(170;776 3695 11650)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C11T	12						.						73.0	81.0	78.0					12																	108169003		2203	4300	6503	106693133	SO:0001583	missense	121549	exon1			AY238895	CCDS31894.2	12q24.11	2013-10-17	2013-10-17		ENSG00000187855	ENSG00000187855		"""Basic helix-loop-helix proteins"""	24311	protein-coding gene	gene with protein product		609155	"""achaete-scute complex-like 4 (Drosophila)"", ""achaete-scute complex homolog 4 (Drosophila)"""				Standard	NM_203436		Approved	HASH4, bHLHa44	uc001tmr.3	Q6XD76	OTTHUMG00000156964	ENST00000342331.4:c.11C>T	12.37:g.108169003C>T	ENSP00000345420:p.Thr4Met		106693133	NM_203436	Q7RTS2	Missense_Mutation	SNP	ENST00000342331.4	37	CCDS31894.2	.	.	.	.	.	.	.	.	.	.	C	3.940	-0.014398	0.07681	.	.	ENSG00000187855	ENST00000342331	D	0.96427	-4.01	4.74	-9.49	0.00587	.	1.458410	0.04410	N	0.365924	D	0.88220	0.6378	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.78401	-0.2218	10	0.45353	T	0.12	-12.0382	3.9153	0.09220	0.1792:0.4787:0.1372:0.2049	.	3	Q6XD76	ASCL4_HUMAN	M	4	ENSP00000345420:T4M	ENSP00000345420:T4M	T	+	2	0	ASCL4	106693133	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.353000	0.07691	-1.750000	0.01328	-1.563000	0.00883	ACG		0.597	ASCL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346845.1	NM_203436	
NBEA	26960	broad.mit.edu	37	13	36239252	36239252	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr13:36239252C>A	ENST00000400445.3	+	55	8864	c.8330C>A	c.(8329-8331)aCa>aAa	p.T2777K	NBEA_ENST00000310336.4_Missense_Mutation_p.T2777K|NBEA_ENST00000379922.3_Missense_Mutation_p.T355K|NBEA_ENST00000537702.1_Missense_Mutation_p.T570K|NBEA_ENST00000540320.1_Missense_Mutation_p.T2777K|NBEA_ENST00000379939.2_Missense_Mutation_p.T2774K	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2777					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.T2777K(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GCCGTCCTCACAGGCCATGAC	0.488																																					p.T2777K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8330A	13						.						84.0	86.0	86.0					13																	36239252		2040	4186	6226	35137252	SO:0001583	missense	26960	exon55			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.8330C>A	13.37:g.36239252C>A	ENSP00000383295:p.Thr2777Lys		35137252	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	C	33	5.249888	0.95305	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000402346;ENST00000537702;ENST00000379922	T;T;T;T;T;T	0.57907	0.67;0.68;0.68;0.67;0.5;0.37	5.52	5.52	0.82312	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.72061	0.3414	M	0.72118	2.19	0.80722	D	1	P;D;D	0.89917	0.846;1.0;0.979	P;D;P	0.78314	0.573;0.991;0.671	T	0.68081	-0.5503	10	0.30078	T	0.28	.	19.4311	0.94768	0.0:1.0:0.0:0.0	.	2777;355;2774	Q8NFP9;Q8NFP9-2;Q5T321	NBEA_HUMAN;.;.	K	2777;2777;2774;2777;1406;355;570;355	ENSP00000440951:T2777K;ENSP00000383295:T2777K;ENSP00000369271:T2774K;ENSP00000308534:T2777K;ENSP00000440233:T570K;ENSP00000369254:T355K	ENSP00000308534:T2777K	T	+	2	0	NBEA	35137252	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	7.135000	0.77276	2.582000	0.87167	0.655000	0.94253	ACA		0.488	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
TRPC4	7223	broad.mit.edu	37	13	38320286	38320286	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr13:38320286C>A	ENST00000379705.3	-	3	1542	c.685G>T	c.(685-687)Gaa>Taa	p.E229*	TRPC4_ENST00000338947.5_Intron|TRPC4_ENST00000355779.2_Nonsense_Mutation_p.E229*|TRPC4_ENST00000379681.3_Nonsense_Mutation_p.E229*|TRPC4_ENST00000379673.2_Nonsense_Mutation_p.E229*|TRPC4_ENST00000358477.2_Nonsense_Mutation_p.E229*|TRPC4_ENST00000426868.2_Nonsense_Mutation_p.E229*|TRPC4_ENST00000447043.1_Nonsense_Mutation_p.E229*|TRPC4_ENST00000379679.1_Intron			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	229					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.E229*(2)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TTGCTCAGTTCCTGAAGTTCC	0.468																																					p.E229X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G685T	13						.						123.0	111.0	115.0					13																	38320286		2203	4300	6503	37218286	SO:0001587	stop_gained	7223	exon3			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.685G>T	13.37:g.38320286C>A	ENSP00000369027:p.Glu229*		37218286	NM_001135957	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Nonsense_Mutation	SNP	ENST00000379705.3	37	CCDS9365.1	.	.	.	.	.	.	.	.	.	.	C	40	8.466915	0.98825	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	.	.	.	6.07	6.07	0.98685	.	0.043091	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-27.6852	20.6593	0.99626	0.0:1.0:0.0:0.0	.	.	.	.	X	229	.	ENSP00000348025:E229X	E	-	1	0	TRPC4	37218286	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	GAA		0.468	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
KDELC1	79070	broad.mit.edu	37	13	103446058	103446058	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr13:103446058C>T	ENST00000376004.4	-	3	823	c.487G>A	c.(487-489)Gat>Aat	p.D163N	KDELC1_ENST00000460338.1_5'UTR	NM_024089.2	NP_076994.2	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1	163				D -> G (in Ref. 2; BAD96287). {ECO:0000305}.		endoplasmic reticulum lumen (GO:0005788)		p.D163N(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TGTGCCAGATCTCTCTGAATC	0.483																																					p.D163N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G487A	13						.						161.0	157.0	158.0					13																	103446058		2203	4300	6503	102244059	SO:0001583	missense	79070	exon3			BC001297	CCDS9504.1	13q33	2010-11-18			ENSG00000134901	ENSG00000134901			19350	protein-coding gene	gene with protein product		611613					Standard	NM_024089		Approved	MGC5302, EP58	uc001vpq.4	Q6UW63	OTTHUMG00000017307	ENST00000376004.4:c.487G>A	13.37:g.103446058C>T	ENSP00000365172:p.Asp163Asn		102244059	NM_024089	Q53HL3|Q9BVD2	Missense_Mutation	SNP	ENST00000376004.4	37	CCDS9504.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862504	0.91511	.	.	ENSG00000134901	ENST00000376004	T	0.54071	0.59	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.75369	0.3840	M	0.81682	2.555	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.77635	-0.2514	10	0.72032	D	0.01	.	19.8418	0.96692	0.0:1.0:0.0:0.0	.	163	Q6UW63	KDEL1_HUMAN	N	163	ENSP00000365172:D163N	ENSP00000365172:D163N	D	-	1	0	KDELC1	102244059	1.000000	0.71417	1.000000	0.80357	0.475000	0.33008	7.752000	0.85141	2.685000	0.91497	0.561000	0.74099	GAT		0.483	KDELC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045699.1		
MDGA2	161357	broad.mit.edu	37	14	47566248	47566248	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr14:47566248G>T	ENST00000399232.2	-	6	1161	c.797C>A	c.(796-798)aCa>aAa	p.T266K	MDGA2_ENST00000439988.3_Missense_Mutation_p.T335K|MDGA2_ENST00000426342.1_Missense_Mutation_p.T37K|MDGA2_ENST00000357362.3_Missense_Mutation_p.T37K	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	266	Ig-like 3.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.T37K(2)|p.T37I(2)|p.T335K(1)|p.T335I(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TCCTCCTGTTGTAACACATAC	0.443																																					p.T37K												.	.	6	Substitution - Missense(6)	large_intestine(3)|lung(3)	c.C110A	14						.						125.0	118.0	120.0					14																	47566248		1912	4119	6031	46635998	SO:0001583	missense	161357	exon6			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.797C>A	14.37:g.47566248G>T	ENSP00000382178:p.Thr266Lys		46635998	NM_182830	F6W3S7|J3KPX6	Missense_Mutation	SNP	ENST00000399232.2	37		.	.	.	.	.	.	.	.	.	.	G	16.98	3.271388	0.59649	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	5.65	5.65	0.86999	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	U	0.000066	T	0.16300	0.0392	L	0.42245	1.32	0.80722	D	1	P	0.41188	0.741	B	0.38755	0.281	T	0.00712	-1.1598	10	0.59425	D	0.04	.	18.6475	0.91416	0.0:0.0:1.0:0.0	.	266	Q7Z553	MDGA2_HUMAN	K	266;37;335;37	ENSP00000400011:T266K;ENSP00000405456:T37K;ENSP00000382178:T335K;ENSP00000349925:T37K	ENSP00000349925:T37K	T	-	2	0	MDGA2	46635998	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.938000	0.70170	2.821000	0.97095	0.650000	0.86243	ACA		0.443	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830	
PPP1R36	145376	broad.mit.edu	37	14	65054850	65054850	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr14:65054850A>T	ENST00000298705.1	+	11	1015	c.919A>T	c.(919-921)Aaa>Taa	p.K307*	RP11-973N13.3_ENST00000554454.1_RNA|RP11-973N13.3_ENST00000556634.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	307					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)	p.K307*(2)									CCCAGCAATTAAAAAAGCTAT	0.433																																					p.K307X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|lung(1)	c.A919T	14						.						95.0	95.0	95.0					14																	65054850		2203	4300	6503	64124603	SO:0001587	stop_gained	145376	exon11				CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.919A>T	14.37:g.65054850A>T	ENSP00000298705:p.Lys307*		64124603	NM_172365	Q6NTH6	Nonsense_Mutation	SNP	ENST00000298705.1	37	CCDS9767.1	.	.	.	.	.	.	.	.	.	.	A	36	5.939459	0.97128	.	.	ENSG00000165807	ENST00000298705	.	.	.	5.55	5.55	0.83447	.	0.170296	0.41605	D	0.000857	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.5151	12.1096	0.53831	1.0:0.0:0.0:0.0	.	.	.	.	X	307	.	ENSP00000298705:K307X	K	+	1	0	C14orf50	64124603	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.967000	0.49216	2.099000	0.63709	0.533000	0.62120	AAA		0.433	PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280667.1	NM_172365	
SYNE3	161176	broad.mit.edu	37	14	95921762	95921762	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr14:95921762C>T	ENST00000334258.5	-	5	1103	c.1089G>A	c.(1087-1089)gcG>gcA	p.A363A	SYNE3_ENST00000553340.1_Silent_p.A363A|SYNE3_ENST00000557275.1_Silent_p.A363A|SYNE3_ENST00000554873.1_Silent_p.A120A	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	363					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)	p.A363A(1)		breast(1)|endometrium(2)|lung(25)	28						TCCCCGCTTTCGCCGCAGGCT	0.657																																					p.A363A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1089A	14						.						30.0	34.0	32.0					14																	95921762		2203	4300	6503	94991515	SO:0001819	synonymous_variant	161176	exon5			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1089G>A	14.37:g.95921762C>T			94991515	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Silent	SNP	ENST00000334258.5	37	CCDS9935.1																																																																																				0.657	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
APBA2	321	broad.mit.edu	37	15	29346497	29346497	+	Missense_Mutation	SNP	C	C	T	rs143649138		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr15:29346497C>T	ENST00000558402.1	+	5	1009	c.410C>T	c.(409-411)gCg>gTg	p.A137V	APBA2_ENST00000558330.1_Missense_Mutation_p.A137V|APBA2_ENST00000558259.1_Missense_Mutation_p.A137V|APBA2_ENST00000561069.1_Missense_Mutation_p.A137V|APBA2_ENST00000411764.1_Missense_Mutation_p.A137V			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	137					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.A137V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		TGCCAGGAGGCGGTGGAGGAG	0.662													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18531	0.0		0.0	False		,,,				2504	0.0				p.A137V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C410T	15						.	C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	77.0	67.0	70.0		410,410	5.2	1.0	15	dbSNP_134	70	8,8592	5.7+/-21.5	0,8,4292	yes	missense,missense	APBA2	NM_001130414.1,NM_005503.3	64,64	0,8,6495	TT,TC,CC		0.093,0.0,0.0615	benign,benign	137/738,137/750	29346497	8,12998	2203	4300	6503	27133789	SO:0001583	missense	321	exon3			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.410C>T	15.37:g.29346497C>T	ENSP00000453293:p.Ala137Val		27133789	NM_005503	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	37	CCDS10022.1	.	.	.	.	.	.	.	.	.	.	C	16.67	3.186928	0.57909	0.0	9.3E-4	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.50813	0.73	5.25	5.25	0.73442	.	0.121159	0.52532	D	0.000066	T	0.46229	0.1382	M	0.68952	2.095	0.54753	D	0.999986	P;B;B	0.35575	0.51;0.104;0.104	B;B;B	0.23419	0.046;0.013;0.012	T	0.54794	-0.8240	10	0.72032	D	0.01	.	17.832	0.88685	0.0:1.0:0.0:0.0	.	137;137;137	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	V	137	ENSP00000409312:A137V	ENSP00000219865:A137V	A	+	2	0	APBA2	27133789	0.999000	0.42202	0.995000	0.50966	0.701000	0.40568	4.232000	0.58645	2.423000	0.82170	0.650000	0.86243	GCG		0.662	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
GPR176	11245	broad.mit.edu	37	15	40093733	40093733	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr15:40093733G>A	ENST00000561100.1	-	3	2013	c.1148C>T	c.(1147-1149)cCc>cTc	p.P383L	GPR176_ENST00000299092.3_Missense_Mutation_p.P382L|GPR176_ENST00000560729.1_5'Flank|RP11-37C7.1_ENST00000558616.1_RNA|GPR176_ENST00000543580.1_Missense_Mutation_p.P338L	NM_007223.1	NP_009154.1	Q14439	GP176_HUMAN	G protein-coupled receptor 176	383					G-protein coupled receptor signaling pathway (GO:0007186)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.P383L(1)		central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(9)|ovary(2)|pancreas(1)|skin(2)	23		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		ATCCTCTGTGGGCTTAAAGAT	0.577																																					p.P383L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1148T	15						.						186.0	172.0	177.0					15																	40093733		2203	4300	6503	37881025	SO:0001583	missense	11245	exon3			BC067106	CCDS10051.1, CCDS61588.1, CCDS61589.1	15q14-q15.1	2012-08-21			ENSG00000166073	ENSG00000166073		"""GPCR / Class A : Orphans"""	32370	protein-coding gene	gene with protein product		612183				7893747	Standard	NM_007223		Approved	Gm1012	uc010uck.2	Q14439	OTTHUMG00000129873	ENST00000561100.1:c.1148C>T	15.37:g.40093733G>A	ENSP00000453076:p.Pro383Leu		37881025	NM_007223	Q6NXF6	Missense_Mutation	SNP	ENST00000561100.1	37	CCDS10051.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.391032	0.62066	.	.	ENSG00000166073	ENST00000299092;ENST00000543580	T	0.79653	-1.29	6.17	6.17	0.99709	.	0.192064	0.56097	D	0.000023	T	0.78084	0.4228	L	0.46157	1.445	0.80722	D	1	P	0.35656	0.514	B	0.33196	0.159	T	0.76515	-0.2931	10	0.51188	T	0.08	-12.595	20.8794	0.99867	0.0:0.0:1.0:0.0	.	383	Q14439	GP176_HUMAN	L	383;338	ENSP00000439361:P338L	ENSP00000299092:P383L	P	-	2	0	GPR176	37881025	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.641000	0.83368	2.941000	0.99782	0.655000	0.94253	CCC		0.577	GPR176-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252117.2	NM_007223	
ZNF609	23060	broad.mit.edu	37	15	64792199	64792199	+	Missense_Mutation	SNP	G	G	A	rs370398646		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr15:64792199G>A	ENST00000326648.3	+	1	709	c.581G>A	c.(580-582)cGg>cAg	p.R194Q	ZNF609_ENST00000416172.1_Missense_Mutation_p.R194Q	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	194						nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.R194Q(1)		breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTGGGAGGACGGGGTGGTCAG	0.552																																					p.R194Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G581A	15						.		GLN/ARG	0,4406		0,0,2203	70.0	64.0	66.0		581	5.5	1.0	15		66	2,8596		0,2,4297	no	missense	ZNF609	NM_015042.1	43	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	194/1412	64792199	2,13002	2203	4299	6502	62579252	SO:0001583	missense	23060	exon1			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.581G>A	15.37:g.64792199G>A	ENSP00000316527:p.Arg194Gln		62579252	NM_015042	Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	37	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	.	24.3	4.510735	0.85389	0.0	2.33E-4	ENSG00000180357	ENST00000416172;ENST00000326648	T	0.44881	0.91	5.5	5.5	0.81552	.	0.077571	0.51477	D	0.000092	T	0.60274	0.2256	L	0.57536	1.79	0.53688	D	0.999971	D;D	0.89917	1.0;0.999	D;D	0.66847	0.947;0.923	T	0.50381	-0.8835	10	0.22706	T	0.39	-19.6033	19.7614	0.96319	0.0:0.0:1.0:0.0	.	194;194	E7ERY8;O15014	.;ZN609_HUMAN	Q	194	ENSP00000316527:R194Q	ENSP00000316527:R194Q	R	+	2	0	ZNF609	62579252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.674000	0.83992	2.747000	0.94245	0.651000	0.88453	CGG		0.552	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833	
CLN6	54982	broad.mit.edu	37	15	68506722	68506722	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr15:68506722A>G	ENST00000249806.5	-	3	360	c.203T>C	c.(202-204)gTa>gCa	p.V68A	RP11-315D16.2_ENST00000562767.1_Intron|CLN6_ENST00000564752.1_Missense_Mutation_p.V68A|CLN6_ENST00000418702.2_Missense_Mutation_p.Y34H|CLN6_ENST00000538696.1_Missense_Mutation_p.V100A|CLN6_ENST00000565471.1_Intron|CLN6_ENST00000566347.1_Missense_Mutation_p.V68A	NM_017882.2	NP_060352.1	Q9NWW5	CLN6_HUMAN	ceroid-lipofuscinosis, neuronal 6, late infantile, variant	68					cell death (GO:0008219)|cellular macromolecule catabolic process (GO:0044265)|cholesterol metabolic process (GO:0008203)|ganglioside metabolic process (GO:0001573)|glycosaminoglycan metabolic process (GO:0030203)|locomotion involved in locomotory behavior (GO:0031987)|lysosomal lumen acidification (GO:0007042)|positive regulation of proteolysis (GO:0045862)|protein catabolic process (GO:0030163)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.V68A(1)		large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						GAGAGGGAATACCAGCTGCGG	0.592																																					p.V68A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T203C	15						.						153.0	127.0	135.0					15																	68506722		2200	4298	6498	66293776	SO:0001583	missense	54982	exon3			AK000568	CCDS10227.1	15q23	2014-09-17			ENSG00000128973	ENSG00000128973			2077	protein-coding gene	gene with protein product		606725				9097964, 11727201	Standard	NM_017882		Approved	FLJ20561, HsT18960, nclf	uc002arf.3	Q9NWW5	OTTHUMG00000133286	ENST00000249806.5:c.203T>C	15.37:g.68506722A>G	ENSP00000249806:p.Val68Ala		66293776	NM_017882	A8K560|B4DDH6|Q6IAB1|Q96SR0	Missense_Mutation	SNP	ENST00000249806.5	37	CCDS10227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	14.66|14.66	2.601236|2.601236	0.46423|0.46423	.|.	.|.	ENSG00000128973|ENSG00000128973	ENST00000249806;ENST00000538696|ENST00000418702	D;D|D	0.95035|0.90444	-3.59;-3.59|-2.67	5.36|5.36	4.23|4.23	0.50019|0.50019	.|.	0.202930|.	0.42682|.	N|.	0.000666|.	D|D	0.84401|0.84401	0.5464|0.5464	N|N	0.19112|0.19112	0.55|0.55	0.21878|0.21878	N|N	0.999497|0.999497	B;B|P	0.11235|0.35456	0.004;0.001|0.502	B;B|B	0.11329|0.37198	0.006;0.003|0.243	T|T	0.76271|0.76271	-0.3020|-0.3020	10|9	0.32370|0.87932	T|D	0.25|0	-24.9343|-24.9343	11.0082|11.0082	0.47646|0.47646	0.927:0.0:0.073:0.0|0.927:0.0:0.073:0.0	.|.	100;68|34	B4DDH6;Q9NWW5|E7ESV1	.;CLN6_HUMAN|.	A|H	68;100|34	ENSP00000249806:V68A;ENSP00000445770:V100A|ENSP00000393826:Y34H	ENSP00000249806:V68A|ENSP00000393826:Y34H	V|Y	-|-	2|1	0|0	CLN6|CLN6	66293776|66293776	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.820000|0.820000	0.46376|0.46376	4.852000|4.852000	0.62904|0.62904	0.875000|0.875000	0.35847|0.35847	0.375000|0.375000	0.23000|0.23000	GTA|TAT		0.592	CLN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257066.1	NM_017882	
FAM154B	283726	broad.mit.edu	37	15	82574764	82574764	+	Silent	SNP	T	T	C			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr15:82574764T>C	ENST00000339465.5	+	3	627	c.558T>C	c.(556-558)tgT>tgC	p.C186C	FAM154B_ENST00000565501.1_3'UTR|FAM154B_ENST00000427381.2_Silent_p.C171C	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B	186								p.C186C(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						CTCACCGGTGTGACTTTCAGG	0.443																																					p.C186C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T558C	15						.						60.0	55.0	57.0					15																	82574764		2203	4300	6503	80361819	SO:0001819	synonymous_variant	283726	exon3			AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.558T>C	15.37:g.82574764T>C			80361819	NM_001008226	B4E2M2	Silent	SNP	ENST00000339465.5	37	CCDS32310.1																																																																																				0.443	FAM154B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419644.1	NM_001008226	
RCCD1	91433	broad.mit.edu	37	15	91504995	91504995	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr15:91504995G>A	ENST00000394258.2	+	8	1329	c.1127G>A	c.(1126-1128)aGc>aAc	p.S376N	RCCD1_ENST00000556618.1_Missense_Mutation_p.S376N|RCCD1_ENST00000555155.1_Missense_Mutation_p.S374N	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	376						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.S376N(1)		breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			AAAGGGAAGAGCTGACATGTG	0.512																																					p.S376N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1127A	15						.						149.0	145.0	146.0					15																	91504995		2198	4298	6496	89305999	SO:0001583	missense	91433	exon9				CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.1127G>A	15.37:g.91504995G>A	ENSP00000377801:p.Ser376Asn		89305999	NM_033544	B2RTP9|Q29RX6	Missense_Mutation	SNP	ENST00000394258.2	37	CCDS32333.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494899	0.44352	.	.	ENSG00000166965	ENST00000394258;ENST00000555155;ENST00000556618;ENST00000556333	T;T;T	0.41065	1.01;1.01;1.01	4.03	0.778	0.18543	.	1.418860	0.04402	N	0.364447	T	0.35480	0.0933	L	0.44542	1.39	0.09310	N	1	B;B	0.32160	0.358;0.244	B;B	0.32864	0.154;0.055	T	0.38329	-0.9666	10	0.87932	D	0	.	4.306	0.10947	0.0954:0.1531:0.595:0.1565	.	374;376	G3V2I3;A6NED2	.;RCCD1_HUMAN	N	376;374;376;165	ENSP00000377801:S376N;ENSP00000450678:S374N;ENSP00000451963:S376N	ENSP00000377801:S376N	S	+	2	0	RCCD1	89305999	0.119000	0.22226	0.005000	0.12908	0.002000	0.02628	0.676000	0.25247	0.468000	0.27243	-0.310000	0.09108	AGC		0.512	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414748.1	NM_033544	
CPPED1	55313	broad.mit.edu	37	16	12875118	12875118	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr16:12875118G>A	ENST00000381774.4	-	2	453	c.213C>T	c.(211-213)gcC>gcT	p.A71A	CPPED1_ENST00000261660.4_Silent_p.A71A|CPPED1_ENST00000433677.2_Silent_p.A71A	NM_018340.2	NP_060810.2	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain containing 1	71	Catalytic.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.A71A(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|urinary_tract(1)	18						TGGCCTGGACGGCTTGCTCAG	0.572																																					p.A71A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C213T	16						.						125.0	131.0	129.0					16																	12875118		2079	4207	6286	12782619	SO:0001819	synonymous_variant	55313	exon2			AK022710	CCDS42119.1, CCDS42120.1	16p13.12	2014-02-12	2009-03-13		ENSG00000103381	ENSG00000103381			25632	protein-coding gene	gene with protein product	"""complete S transactivated protein 1"""	615603				12477932	Standard	NM_018340		Approved	CSTP1, FLJ11151	uc002dca.4	Q9BRF8	OTTHUMG00000167711	ENST00000381774.4:c.213C>T	16.37:g.12875118G>A			12782619	NM_001099455	B4DQ68|Q6MZY9|Q9H9M9|Q9NUT6	Silent	SNP	ENST00000381774.4	37	CCDS42120.1																																																																																				0.572	CPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395795.2	NM_018340	
SALL1	6299	broad.mit.edu	37	16	51173325	51173325	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr16:51173325C>A	ENST00000251020.4	-	2	2841	c.2808G>T	c.(2806-2808)caG>caT	p.Q936H	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.Q839H|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	936					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q936H(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TGTGGAACTCCTGCGTGCTGT	0.572																																					p.Q936H	GBM(103;1352 1446 1855 4775 8890)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2808T	16						.						89.0	73.0	79.0					16																	51173325		2198	4300	6498	49730826	SO:0001583	missense	6299	exon2			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2808G>T	16.37:g.51173325C>A	ENSP00000251020:p.Gln936His		49730826	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	C	7.617	0.675970	0.14841	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.79749	-1.3;-1.3	5.46	2.23	0.28157	.	0.473076	0.25140	N	0.032828	T	0.50034	0.1592	N	0.02539	-0.55	0.29381	N	0.863341	B	0.02656	0.0	B	0.04013	0.001	T	0.36841	-0.9731	10	0.27785	T	0.31	.	2.5812	0.04818	0.3346:0.2936:0.2825:0.0892	.	936	Q9NSC2	SALL1_HUMAN	H	936;839;900	ENSP00000251020:Q936H;ENSP00000407914:Q839H	ENSP00000251020:Q936H	Q	-	3	2	SALL1	49730826	0.998000	0.40836	1.000000	0.80357	0.984000	0.73092	0.486000	0.22340	1.271000	0.44313	0.455000	0.32223	CAG		0.572	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
NAE1	8883	broad.mit.edu	37	16	66860652	66860652	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr16:66860652C>A	ENST00000290810.3	-	2	182	c.85G>T	c.(85-87)Gaa>Taa	p.E29*	NAE1_ENST00000359087.4_Nonsense_Mutation_p.E29*|NAE1_ENST00000394074.2_Intron|NAE1_ENST00000379463.2_Nonsense_Mutation_p.E23*|NAE1_ENST00000564040.2_5'UTR			Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1	29					mitotic DNA replication checkpoint (GO:0033314)|neuron apoptotic process (GO:0051402)|protein neddylation (GO:0045116)|regulation of apoptotic process (GO:0042981)|regulation of neuron apoptotic process (GO:0043523)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|protein heterodimerization activity (GO:0046982)|ubiquitin protein ligase binding (GO:0031625)	p.E29*(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	TGAGCAGATTCTAAAGCCTCT	0.363																																					p.E23X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G67T	16						.						96.0	97.0	97.0					16																	66860652		2200	4300	6500	65418153	SO:0001587	stop_gained	8883	exon3			U50939	CCDS10820.1, CCDS42171.1, CCDS42172.1, CCDS67050.1	16q22	2013-09-26	2007-12-11	2007-12-11	ENSG00000159593	ENSG00000159593		"""Ubiquitin-like modifier activating enzymes"""	621	protein-coding gene	gene with protein product		603385	"""amyloid beta precursor protein binding protein 1, 59kDa"""	APPBP1		8626687, 12740388	Standard	XM_005256215		Approved	ula-1	uc002eqf.3	Q13564	OTTHUMG00000137513	ENST00000290810.3:c.85G>T	16.37:g.66860652C>A	ENSP00000290810:p.Glu29*		65418153	NM_001018159	A6NCK0|A6NFN4|A8MU28|B2R700|B3KUP9	Nonsense_Mutation	SNP	ENST00000290810.3	37	CCDS10820.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533603	0.85812	.	.	ENSG00000159593	ENST00000359087;ENST00000290810;ENST00000379463	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-19.3146	19.4352	0.94788	0.0:1.0:0.0:0.0	.	.	.	.	X	29;29;23	.	ENSP00000290810:E29X	E	-	1	0	NAE1	65418153	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.018000	0.76406	2.665000	0.90641	0.591000	0.81541	GAA		0.363	NAE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268832.1	NM_003905	
SREBF1	6720	broad.mit.edu	37	17	17718605	17718605	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr17:17718605G>A	ENST00000261646.5	-	13	2606	c.2422C>T	c.(2422-2424)Cat>Tat	p.H808Y	MIR33B_ENST00000385104.1_RNA|SREBF1_ENST00000395757.1_Missense_Mutation_p.H554Y|SREBF1_ENST00000355815.4_Missense_Mutation_p.H838Y|SREBF1_ENST00000338854.5_Missense_Mutation_p.H808Y	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	808					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)	p.H838Y(1)		cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						TCTAAGAGATGTTCCCGGAAT	0.617																																					p.H838Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2512T	17						.						105.0	104.0	104.0					17																	17718605		2203	4300	6503	17659330	SO:0001583	missense	6720	exon14			BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.2422C>T	17.37:g.17718605G>A	ENSP00000261646:p.His808Tyr		17659330	NM_001005291	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	ENST00000261646.5	37	CCDS11189.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	15.16|15.16	2.751000|2.751000	0.49257|0.49257	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000395756;ENST00000418712;ENST00000423161;ENST00000447641|ENST00000395751	T;T;T;T|.	0.14516|.	2.5;2.5;2.5;2.5|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77961|0.77961	0.4209|0.4209	M|M	0.77820|0.77820	2.39|2.39	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;0.998|.	D;D;D|.	0.80764|.	0.987;0.994;0.964|.	T|T	0.77422|0.77422	-0.2594|-0.2594	10|5	0.33141|.	T|.	0.24|.	-16.9477|-16.9477	18.5716|18.5716	0.91137|0.91137	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	808;838;427|.	P36956;P36956-4;A8MTU8|.	SRBP1_HUMAN;.;.|.	Y|I	808;838;808;554;427;645;734;133|815	ENSP00000345822:H808Y;ENSP00000348069:H838Y;ENSP00000261646:H808Y;ENSP00000379106:H554Y|.	ENSP00000261646:H808Y|.	H|T	-|-	1|2	0|0	SREBF1|SREBF1	17659330|17659330	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.698000|3.698000	0.54771|0.54771	2.678000|2.678000	0.91216|0.91216	0.556000|0.556000	0.70494|0.70494	CAT|ACA		0.617	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
TVP23B	51030	broad.mit.edu	37	17	18700923	18700923	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr17:18700923G>A	ENST00000307767.8	+	4	571	c.272G>A	c.(271-273)cGt>cAt	p.R91H	TVP23B_ENST00000476139.1_Missense_Mutation_p.R27H|TVP23B_ENST00000574226.1_Missense_Mutation_p.R91H|TVP23B_ENST00000581733.1_Missense_Mutation_p.R27H	NM_016078.4	NP_057162.4	Q9NYZ1	TV23B_HUMAN	trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)	91						integral component of membrane (GO:0016021)		p.R91H(1)									GTTGGCCTACGTTGGTGGAAT	0.343																																					p.R91H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G272A	17						.						51.0	52.0	52.0					17																	18700923		2192	4271	6463	18641648	SO:0001583	missense	51030	exon4			AF151906	CCDS42274.1	17p11.2	2012-11-29	2012-11-29	2012-11-29	ENSG00000171928	ENSG00000171928			20399	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B"", ""family with sequence similarity 18, member B1"""	FAM18B, FAM18B1		10810093	Standard	NM_016078		Approved	CGI-148, YDR084C	uc002gum.2	Q9NYZ1	OTTHUMG00000059052	ENST00000307767.8:c.272G>A	17.37:g.18700923G>A	ENSP00000305654:p.Arg91His		18641648	NM_016078	A8K448|Q96HK5|Q9Y3E6	Missense_Mutation	SNP	ENST00000307767.8	37	CCDS42274.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.848429	0.71603	.	.	ENSG00000171928	ENST00000307767	T	0.55588	0.51	3.13	3.13	0.36017	.	0.000000	0.85682	D	0.000000	T	0.79375	0.4435	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.84772	0.0768	10	0.59425	D	0.04	-10.8629	11.7443	0.51811	0.0:0.0:1.0:0.0	.	91	Q9NYZ1	F18B1_HUMAN	H	91	ENSP00000305654:R91H	ENSP00000305654:R91H	R	+	2	0	FAM18B1	18641648	1.000000	0.71417	0.998000	0.56505	0.822000	0.46500	9.575000	0.98187	1.573000	0.49748	0.194000	0.17425	CGT		0.343	TVP23B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130667.2	NM_016078	
SPACA3	124912	broad.mit.edu	37	17	31322568	31322568	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr17:31322568C>A	ENST00000269053.3	+	2	246	c.176C>A	c.(175-177)gCt>gAt	p.A59D	SPACA3_ENST00000394637.2_3'UTR|SPACA3_ENST00000394638.1_Intron|SPACA3_ENST00000580599.1_5'UTR	NM_173847.3	NP_776246.1	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	59					cell wall macromolecule catabolic process (GO:0016998)|defense response to Gram-positive bacterium (GO:0050830)|monocyte activation (GO:0042117)|peptidoglycan catabolic process (GO:0009253)|positive regulation of macrophage activation (GO:0043032)|positive regulation of phagocytosis (GO:0050766)|response to virus (GO:0009615)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|secretory granule (GO:0030141)	lysozyme activity (GO:0003796)	p.A59D(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(9;0.193)			AGGAGCAGGGCTCTCAGAAGG	0.632																																					p.A59D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C176A	17						.						80.0	64.0	69.0					17																	31322568		2203	4300	6503	28346681	SO:0001583	missense	124912	exon2			AF216311, AF099029	CCDS11275.1	17q12	2014-07-23			ENSG00000141316	ENSG00000141316			16260	protein-coding gene	gene with protein product	"""cancer/testis antigen 54"", ""sperm lyzozyme-like acrosomal protein 1"""	612749				12606493	Standard	NM_173847		Approved	ALLP17, SLLP1, LYC3, LYZL3, CT54	uc002hhs.1	Q8IXA5	OTTHUMG00000132886	ENST00000269053.3:c.176C>A	17.37:g.31322568C>A	ENSP00000269053:p.Ala59Asp		28346681	NM_173847	Q7Z4Y5	Missense_Mutation	SNP	ENST00000269053.3	37	CCDS11275.1	.	.	.	.	.	.	.	.	.	.	c	15.38	2.817220	0.50633	.	.	ENSG00000141316	ENST00000269053;ENST00000394637	T	0.69806	-0.43	3.12	1.12	0.20585	.	1.141880	0.06675	N	0.767025	T	0.61135	0.2323	L	0.29908	0.895	0.21355	N	0.999713	D	0.54964	0.969	P	0.50352	0.638	T	0.50329	-0.8841	10	0.87932	D	0	-3.4545	5.0559	0.14533	0.0:0.7196:0.0:0.2804	.	59	Q8IXA5	SACA3_HUMAN	D	59;60	ENSP00000269053:A59D	ENSP00000269053:A59D	A	+	2	0	SPACA3	28346681	0.070000	0.21116	0.228000	0.23943	0.101000	0.19017	0.019000	0.13444	-0.170000	0.10816	0.359000	0.22050	GCT		0.632	SPACA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256380.1	NM_173847	
ERBB2	2064	broad.mit.edu	37	17	37881000	37881000	+	Missense_Mutation	SNP	G	G	T	rs121913471		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr17:37881000G>T	ENST00000269571.5	+	20	2488	c.2329G>T	c.(2329-2331)Gtg>Ttg	p.V777L	ERBB2_ENST00000541774.1_Missense_Mutation_p.V762L|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000445658.2_Missense_Mutation_p.V501L|ERBB2_ENST00000540147.1_Missense_Mutation_p.V747L|ERBB2_ENST00000584601.1_Missense_Mutation_p.V747L|ERBB2_ENST00000406381.2_Missense_Mutation_p.V747L|ERBB2_ENST00000584450.1_Missense_Mutation_p.V777L			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	777	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.V777L(6)|p.V777M(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GATGGCTGGTGTGGGCTCCCC	0.577		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.V747L			Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	ERBB2,central_nervous_system,brain,Substitution - Missense,-1 	.	7	Substitution - Missense(7)	large_intestine(3)|stomach(2)|lung(1)|breast(1)	c.G2239T	17						.						91.0	90.0	90.0					17																	37881000		2203	4300	6503	35134526	SO:0001583	missense	2064	exon23			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2329G>T	17.37:g.37881000G>T	ENSP00000269571:p.Val777Leu		35134526	NM_001005862	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.186331	0.57909	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45	5.3	5.3	0.74995	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.19485	0.0468	N	0.00165	-1.945	0.80722	D	1	B;B;B	0.13594	0.003;0.001;0.008	B;B;B	0.15484	0.013;0.002;0.013	T	0.30475	-0.9977	9	0.18710	T	0.47	.	18.5686	0.91126	0.0:0.0:1.0:0.0	.	501;762;777	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	L	747;762;501;777;747	ENSP00000385185:V747L;ENSP00000446466:V762L;ENSP00000404047:V501L;ENSP00000269571:V777L;ENSP00000443562:V747L	ENSP00000269571:V777L	V	+	1	0	ERBB2	35134526	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.847000	0.99503	2.478000	0.83669	0.563000	0.77884	GTG		0.577	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
ERBB2	2064	broad.mit.edu	37	17	37881332	37881332	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr17:37881332G>A	ENST00000269571.5	+	21	2683	c.2524G>A	c.(2524-2526)Gta>Ata	p.V842I	ERBB2_ENST00000541774.1_Missense_Mutation_p.V827I|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000445658.2_Missense_Mutation_p.V566I|ERBB2_ENST00000540147.1_Missense_Mutation_p.V812I|ERBB2_ENST00000584601.1_Missense_Mutation_p.V812I|ERBB2_ENST00000406381.2_Missense_Mutation_p.V812I|ERBB2_ENST00000584450.1_Missense_Mutation_p.V842I			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	842	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.V842I(6)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TGTGCGGCTCGTACACAGGGA	0.597		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.V812I			Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	ERBB2,stomach,NS,Substitution - Missense,0 	.	6	Substitution - Missense(6)	large_intestine(5)|stomach(1)	c.G2434A	17						.						70.0	61.0	64.0					17																	37881332		2203	4300	6503	35134858	SO:0001583	missense	2064	exon24			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2524G>A	17.37:g.37881332G>A	ENSP00000269571:p.Val842Ile		35134858	NM_001005862	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241303	0.58995	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69	5.09	5.09	0.68999	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.85106	0.5621	N	0.21142	0.635	0.80722	D	1	D;D;D	0.76494	0.997;0.979;0.999	D;P;D	0.64506	0.92;0.559;0.926	D	0.87344	0.2333	9	0.87932	D	0	.	18.2846	0.90110	0.0:0.0:1.0:0.0	.	566;827;842	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	I	812;827;566;842;812	ENSP00000385185:V812I;ENSP00000446466:V827I;ENSP00000404047:V566I;ENSP00000269571:V842I;ENSP00000443562:V812I	ENSP00000269571:V842I	V	+	1	0	ERBB2	35134858	1.000000	0.71417	0.919000	0.36401	0.900000	0.52787	9.657000	0.98554	2.651000	0.90000	0.563000	0.77884	GTA		0.597	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
HEATR6	63897	broad.mit.edu	37	17	58121390	58121390	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr17:58121390G>A	ENST00000184956.6	-	20	3096	c.3080C>T	c.(3079-3081)cCg>cTg	p.P1027L	AC005702.3_ENST00000582298.1_RNA|HEATR6_ENST00000585976.1_Missense_Mutation_p.P915L|AC005702.1_ENST00000581326.1_RNA|MIR4737_ENST00000583979.1_RNA|AC005702.2_ENST00000577558.1_RNA|AC005702.4_ENST00000583144.1_RNA	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	1027							poly(A) RNA binding (GO:0044822)	p.P1027L(1)		NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			TCTCTTCCCCGGGACGGAAAG	0.532																																					p.P1027L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3080T	17						.						115.0	113.0	114.0					17																	58121390		2203	4300	6503	55476172	SO:0001583	missense	63897	exon20			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.3080C>T	17.37:g.58121390G>A	ENSP00000184956:p.Pro1027Leu		55476172	NM_022070	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	ENST00000184956.6	37	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029107	0.93518	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.37411	1.2	5.15	5.15	0.70609	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.42268	0.1195	L	0.46885	1.475	0.54753	D	0.999987	B;D	0.63880	0.201;0.993	B;P	0.52627	0.087;0.704	T	0.12016	-1.0564	10	0.09843	T	0.71	-15.4586	18.0669	0.89394	0.0:0.0:1.0:0.0	.	762;1027	E7ESB9;Q6AI08	.;HEAT6_HUMAN	L	1027;762	ENSP00000184956:P1027L	ENSP00000184956:P1027L	P	-	2	0	HEATR6	55476172	1.000000	0.71417	0.641000	0.29422	0.984000	0.73092	9.569000	0.98170	2.578000	0.87016	0.650000	0.86243	CCG		0.532	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
SCN4A	6329	broad.mit.edu	37	17	62034639	62034639	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr17:62034639G>A	ENST00000435607.1	-	13	2335	c.2259C>T	c.(2257-2259)atC>atT	p.I753I	SCN4A_ENST00000578147.1_Silent_p.I753I	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	753					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.I753I(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCGGAAGACGATGAGGAAGG	0.577																																					p.I753I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2259T	17						.						85.0	87.0	87.0					17																	62034639		2203	4300	6503	59388371	SO:0001819	synonymous_variant	6329	exon13			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.2259C>T	17.37:g.62034639G>A			59388371	NM_000334	Q15478|Q16447|Q7Z6B1	Silent	SNP	ENST00000435607.1	37	CCDS45761.1																																																																																				0.577	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
KDM6B	23135	broad.mit.edu	37	17	7750178	7750186	+	In_Frame_Del	DEL	ACCACCACC	ACCACCACC	-	rs576442057|rs537249930	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	ACCACCACC	ACCACCACC	ACCACCACC	-	ACCACCACC	-	Unknown	Valid	Germline	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr17:7750178_7750186delACCACCACC	ENST00000448097.2	+	9	1084_1092	c.753_761delACCACCACC	c.(751-762)ttaccaccacca>tta	p.PPP261del	KDM6B_ENST00000254846.5_In_Frame_Del_p.PPP261del			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	261	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						caccaccattaccaccaccaccaccacca	0.608																																					p.251_254del												.	.	0			c.753_761del	17						.																																			7690911	SO:0001651	inframe_deletion	23135	exon9			AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.753_761delACCACCACC	17.37:g.7750187_7750195delACCACCACC	ENSP00000412513:p.Pro261_Pro263del		7690903	NM_001080424	C9IZ40|Q96G33	In_Frame_Del	DEL	ENST00000448097.2	37																																																																																					0.608	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
MYH10	4628	broad.mit.edu	37	17	8424545	8424545	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr17:8424545G>A	ENST00000269243.4	-	16	2061	c.1923C>T	c.(1921-1923)tcC>tcT	p.S641S	MYH10_ENST00000360416.3_Silent_p.S672S|MYH10_ENST00000396239.1_Silent_p.S662S|MYH10_ENST00000379980.4_Silent_p.S657S	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	641	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.S641S(1)		breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TTTTATATGCGGAGCCAAAAG	0.468																																					p.S641S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1923T	17						.						172.0	164.0	167.0					17																	8424545		2203	4300	6503	8365270	SO:0001819	synonymous_variant	4628	exon16			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.1923C>T	17.37:g.8424545G>A			8365270	NM_005964	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Silent	SNP	ENST00000269243.4	37	CCDS11144.1																																																																																				0.468	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
WIPI1	55062	broad.mit.edu	37	17	66426283	66426283	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr17:66426283C>T	ENST00000262139.5	-	9	818	c.819G>A	c.(817-819)tcG>tcA	p.S273S	WIPI1_ENST00000546360.1_Silent_p.S191S|WIPI1_ENST00000589459.1_5'UTR|RP11-120M18.2_ENST00000592030.1_RNA	NM_017983.5	NP_060453.3	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting 1	273					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|autophagy (GO:0006914)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	autophagic vacuole membrane (GO:0000421)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|trans-Golgi network (GO:0005802)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|receptor binding (GO:0005102)	p.S273S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	18						CACTCCAGGTCGAAGGCTCTT	0.557																																					p.S273S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G819A	17						.						107.0	88.0	95.0					17																	66426283		2203	4300	6503	63937878	SO:0001819	synonymous_variant	55062	exon9				CCDS11677.1	17q24.2	2014-02-12				ENSG00000070540		"""WD repeat domain containing"""	25471	protein-coding gene	gene with protein product		609224				15020712, 15602573	Standard	NM_017983		Approved	FLJ10055, WIPI49, Atg18, ATG18A	uc010dey.3	Q5MNZ9		ENST00000262139.5:c.819G>A	17.37:g.66426283C>T			63937878	NM_017983	Q8IXM5|Q9NWF8	Silent	SNP	ENST00000262139.5	37	CCDS11677.1																																																																																				0.557	WIPI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448739.1	NM_017983	
SS18	6760	broad.mit.edu	37	18	23632745	23632745	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr18:23632745C>A	ENST00000415083.2	-	5	505	c.450G>T	c.(448-450)atG>atT	p.M150I	SS18_ENST00000269137.7_Missense_Mutation_p.M150I|SS18_ENST00000585241.1_5'UTR|SS18_ENST00000542743.1_Missense_Mutation_p.M98I|SS18_ENST00000542420.2_Missense_Mutation_p.M127I|SS18_ENST00000539849.1_Missense_Mutation_p.M68I|SS18_ENST00000545952.1_Missense_Mutation_p.M98I	NM_001007559.1|NM_005637.2	NP_001007560.1|NP_005628.2	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	150	Transcriptional activation.				cell morphogenesis (GO:0000902)|ephrin receptor signaling pathway (GO:0048013)|intracellular signal transduction (GO:0035556)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)	p.M150I(1)	SS18/SSX2(706)|SS18/SSX1(1169)|SS18/SSX4(12)	endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(1)	19	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					AAGGCATATTCATGGAACTGT	0.433			T	"""SSX1,  SSX2"""	synovial sarcoma																																p.M150I			Dom	yes		18	18q11.2	6760	"""synovial sarcoma translocation, chromosome 18"""		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G450T	18						.						213.0	193.0	199.0					18																	23632745		2203	4300	6503	21886743	SO:0001583	missense	6760	exon5			X79201	CCDS32807.1, CCDS54183.1	18q11.2	2008-07-28				ENSG00000141380			11340	protein-coding gene	gene with protein product		600192		SSXT		8152806, 7951320, 16484776	Standard	XM_005258334		Approved	SYT	uc002kvm.3	Q15532		ENST00000415083.2:c.450G>T	18.37:g.23632745C>A	ENSP00000414516:p.Met150Ile		21886743	NM_005637	B0YJ95|Q16404|Q4VAX1|Q9BXC6	Missense_Mutation	SNP	ENST00000415083.2	37	CCDS32807.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.147706	0.57151	.	.	ENSG00000141380	ENST00000415083;ENST00000269138;ENST00000269137;ENST00000542420;ENST00000542743;ENST00000539849;ENST00000545952	T;T;T;T;T	0.34275	1.47;1.42;1.41;1.37;1.41	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.51363	0.1670	L	0.49350	1.555	0.80722	D	1	P;P;P	0.45126	0.851;0.851;0.777	P;P;B	0.58391	0.775;0.838;0.391	T	0.13388	-1.0511	10	0.12766	T	0.61	-3.2653	20.3627	0.98863	0.0:1.0:0.0:0.0	.	98;150;150	B4E2J6;Q4VAX0;Q15532	.;.;SSXT_HUMAN	I	153;150;150;127;98;68;98	ENSP00000269137:M150I;ENSP00000438066:M127I;ENSP00000444551:M98I;ENSP00000444647:M68I;ENSP00000443097:M98I	ENSP00000269137:M150I	M	-	3	0	SS18	21886743	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.605000	0.61119	2.885000	0.99019	0.655000	0.94253	ATG		0.433	SS18-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000446226.1		
EPB41L3	23136	broad.mit.edu	37	18	5406823	5406823	+	Missense_Mutation	SNP	C	C	A	rs558098862		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr18:5406823C>A	ENST00000341928.2	-	16	2642	c.2302G>T	c.(2302-2304)Gcc>Tcc	p.A768S	EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000342933.3_Missense_Mutation_p.A768S|EPB41L3_ENST00000427684.2_Missense_Mutation_p.A40S|EPB41L3_ENST00000400111.3_Missense_Mutation_p.A587S|EPB41L3_ENST00000540638.2_Missense_Mutation_p.A587S|EPB41L3_ENST00000544123.1_Missense_Mutation_p.A599S|EPB41L3_ENST00000542146.1_Missense_Mutation_p.A40S	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	768	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.A768S(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						TCCTGCCTGGCGGCCAGTCGC	0.532																																					p.A768S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2302T	18						.						120.0	100.0	107.0					18																	5406823		2203	4300	6503	5396823	SO:0001583	missense	23136	exon16			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2302G>T	18.37:g.5406823C>A	ENSP00000343158:p.Ala768Ser		5396823	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.210157	0.39003	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;D;T;T;T;D	0.82344	-1.42;-1.58;-0.05;-0.06;-1.42;-1.6	6.02	4.98	0.66077	.	0.283151	0.40818	N	0.001004	D	0.86719	0.6000	L	0.60455	1.87	0.33351	D	0.571021	P;D;D;P;P;B;P;P	0.89917	0.841;0.999;1.0;0.892;0.682;0.045;0.551;0.938	P;D;D;B;B;B;B;P	0.87578	0.47;0.994;0.998;0.38;0.349;0.052;0.278;0.503	T	0.82808	-0.0274	10	0.08381	T	0.77	.	12.5199	0.56054	0.0:0.8598:0.0:0.1402	.	599;40;40;160;478;587;768;40	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	S	768;478;599;478;40;40;768;587	ENSP00000343158:A768S;ENSP00000441174:A599S;ENSP00000392195:A40S;ENSP00000442233:A40S;ENSP00000341138:A768S;ENSP00000382981:A587S	ENSP00000343158:A768S	A	-	1	0	EPB41L3	5396823	0.513000	0.26194	0.973000	0.42090	0.716000	0.41182	0.855000	0.27805	2.865000	0.98341	0.655000	0.94253	GCC		0.532	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
DCC	1630	broad.mit.edu	37	18	50923746	50923746	+	Silent	SNP	G	G	A	rs144874430	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr18:50923746G>A	ENST00000442544.2	+	18	3373	c.2757G>A	c.(2755-2757)tcG>tcA	p.S919S	DCC_ENST00000412726.1_Silent_p.S747S|DCC_ENST00000581580.1_Silent_p.S554S	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	919	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.S919S(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ATGAATTCTCGGTCATGGTAA	0.413													G|||	3	0.000599042	0.0008	0.0029	5008	,	,		19473	0.0		0.0	False		,,,				2504	0.0				p.S919S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2757A	18						.	G		1,4405	2.1+/-5.4	0,1,2202	121.0	105.0	110.0		2757	-6.7	0.9	18	dbSNP_134	110	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	DCC	NM_005215.3		0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231		919/1448	50923746	3,13003	2203	4300	6503	49177744	SO:0001819	synonymous_variant	1630	exon18			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.2757G>A	18.37:g.50923746G>A			49177744	NM_005215		Silent	SNP	ENST00000442544.2	37	CCDS11952.1																																																																																				0.413	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
FAM129C	199786	broad.mit.edu	37	19	17643088	17643088	+	Missense_Mutation	SNP	G	G	A	rs140354498		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr19:17643088G>A	ENST00000335393.4	+	4	434	c.296G>A	c.(295-297)cGt>cAt	p.R99H	FAM129C_ENST00000352727.3_Missense_Mutation_p.R99H|FAM129C_ENST00000595684.1_Missense_Mutation_p.R99H|FAM129C_ENST00000332386.5_Missense_Mutation_p.R99H|FAM129C_ENST00000601861.1_Missense_Mutation_p.R68H|FAM129C_ENST00000599164.1_Missense_Mutation_p.R68H|FAM129C_ENST00000600871.1_Missense_Mutation_p.R45H|FAM129C_ENST00000599124.1_Missense_Mutation_p.R68H|FAM129C_ENST00000449408.2_5'UTR|FAM129C_ENST00000300971.2_Missense_Mutation_p.R99H|FAM129C_ENST00000597887.1_3'UTR	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	99								p.R99H(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						CCCCGAGTCCGTGAGCACCGA	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		16422	0.0		0.001	False		,,,				2504	0.0				p.R99H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G296A	19						.	G	HIS/ARG,HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	54.0	49.0	51.0		296,296	3.0	0.6	19	dbSNP_134	51	29,8571	20.4+/-63.3	0,29,4271	yes	missense,missense	FAM129C	NM_001098524.1,NM_173544.4	29,29	0,31,6472	AA,AG,GG		0.3372,0.0454,0.2384	probably-damaging,probably-damaging	99/652,99/698	17643088	31,12975	2203	4300	6503	17504088	SO:0001583	missense	199786	exon4			AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.296G>A	19.37:g.17643088G>A	ENSP00000335040:p.Arg99His		17504088	NM_173544	B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	ENST00000335393.4	37	CCDS12362.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.988428	0.53934	4.54E-4	0.003372	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000300971;ENST00000435646	T;T;T;T	0.23950	2.17;2.19;1.88;1.88	4.13	3.02	0.34903	Pleckstrin homology domain (1);	0.717711	0.11763	N	0.531902	T	0.47135	0.1429	M	0.73962	2.25	0.20764	N	0.99986	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	T	0.15607	-1.0431	10	0.44086	T	0.13	-16.7736	8.1287	0.31014	0.0:0.0:0.7399:0.2601	.	99;99	Q86XR2;Q86XR2-3	NIBL2_HUMAN;.	H	99;99;99;99;45	ENSP00000335040:R99H;ENSP00000333447:R99H;ENSP00000341067:R99H;ENSP00000300971:R99H	ENSP00000300971:R99H	R	+	2	0	FAM129C	17504088	0.068000	0.21057	0.552000	0.28243	0.946000	0.59487	1.925000	0.40074	2.134000	0.65973	0.491000	0.48974	CGT		0.667	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464206.1	NM_173544	
ATP4A	495	broad.mit.edu	37	19	36041988	36041988	+	Missense_Mutation	SNP	C	C	T	rs200663366		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr19:36041988C>T	ENST00000262623.3	-	20	2939	c.2911G>A	c.(2911-2913)Gtg>Atg	p.V971M		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	971					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.V971M(2)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	ACCTGGAACACGATGGCGATC	0.552																																					p.V971M												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G2911A	19						.	C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	62.0	48.0	53.0		2911	4.9	1.0	19		53	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ATP4A	NM_000704.2	21	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging	971/1036	36041988	2,13004	2203	4300	6503	40733828	SO:0001583	missense	495	exon20				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.2911G>A	19.37:g.36041988C>T	ENSP00000262623:p.Val971Met		40733828	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188383	0.78789	2.27E-4	1.16E-4	ENSG00000105675	ENST00000262623	D	0.96168	-3.93	4.9	4.9	0.64082	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.56097	D	0.000029	D	0.93979	0.8072	L	0.27053	0.805	0.53688	D	0.999979	P	0.48911	0.917	P	0.51895	0.683	D	0.94522	0.7728	10	0.59425	D	0.04	.	15.6082	0.76692	0.0:1.0:0.0:0.0	.	971	P20648	ATP4A_HUMAN	M	971	ENSP00000262623:V971M	ENSP00000262623:V971M	V	-	1	0	ATP4A	40733828	0.295000	0.24389	1.000000	0.80357	0.996000	0.88848	0.594000	0.24014	2.536000	0.85505	0.491000	0.48974	GTG		0.552	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
RYR1	6261	broad.mit.edu	37	19	38976509	38976509	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr19:38976509G>A	ENST00000359596.3	+	34	5214	c.5214G>A	c.(5212-5214)acG>acA	p.T1738T	RYR1_ENST00000360985.3_Silent_p.T1738T|RYR1_ENST00000355481.4_Silent_p.T1738T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1738	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.T1738T(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGCCCCTCACGCCTGAGACCC	0.622																																					p.T1738T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5214A	19						.						69.0	68.0	68.0					19																	38976509		2203	4300	6503	43668349	SO:0001819	synonymous_variant	6261	exon34			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5214G>A	19.37:g.38976509G>A			43668349	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																				0.622	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
PPP5C	5536	broad.mit.edu	37	19	46878953	46878953	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr19:46878953C>T	ENST00000012443.4	+	3	559	c.456C>T	c.(454-456)atC>atT	p.I152I	PPP5C_ENST00000391919.1_Silent_p.I46I	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	152					cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)	p.I152I(1)		endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		AGCGGGCCATCGCGGGCGACG	0.582																																					p.I152I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C456T	19						.						65.0	53.0	57.0					19																	46878953		2203	4299	6502	51570793	SO:0001819	synonymous_variant	5536	exon3				CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.456C>T	19.37:g.46878953C>T			51570793	NM_006247	Q16722|Q53XV2	Silent	SNP	ENST00000012443.4	37	CCDS12684.1																																																																																				0.582	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247	
HRC	3270	broad.mit.edu	37	19	49658098	49658098	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr19:49658098C>T	ENST00000252825.4	-	1	583	c.397G>A	c.(397-399)Ggg>Agg	p.G133R	TRPM4_ENST00000427978.2_5'Flank|TRPM4_ENST00000252826.5_5'Flank|HRC_ENST00000595625.1_Missense_Mutation_p.G133R	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	133	4 X tandem repeats, acidic.|6 X approximate tandem repeats.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)	p.G133R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		CCTCTGTGCCCACGGGCCTGC	0.617																																					p.G133R	Melanoma(37;75 1097 24567 25669 30645)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G397A	19						.						145.0	112.0	123.0					19																	49658098		2203	4300	6503	54349910	SO:0001583	missense	3270	exon1				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.397G>A	19.37:g.49658098C>T	ENSP00000252825:p.Gly133Arg		54349910	NM_002152	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042574	0.55003	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.06687	3.27	2.97	1.89	0.25635	.	.	.	.	.	T	0.06325	0.0163	L	0.29908	0.895	0.09310	N	1	P	0.47841	0.901	B	0.41571	0.36	T	0.32981	-0.9886	9	0.44086	T	0.13	-18.6118	5.4786	0.16710	0.232:0.5418:0.2262:0.0	.	133	P23327	SRCH_HUMAN	R	133;103	ENSP00000252825:G133R	ENSP00000252825:G133R	G	-	1	0	HRC	54349910	0.002000	0.14202	0.017000	0.16124	0.332000	0.28634	0.089000	0.15002	0.779000	0.33543	0.462000	0.41574	GGG		0.617	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
SIGLEC8	27181	broad.mit.edu	37	19	51955687	51955687	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr19:51955687C>A	ENST00000321424.3	-	7	1512	c.1446G>T	c.(1444-1446)gaG>gaT	p.E482D	SIGLEC8_ENST00000340550.5_Missense_Mutation_p.E389D|SIGLEC8_ENST00000430817.1_Missense_Mutation_p.E373D	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	482					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.E482D(1)		NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		AGGCCTGAGTCTCTGCAGTTT	0.522																																					p.E482D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1446T	19						.						132.0	120.0	124.0					19																	51955687		2203	4300	6503	56647499	SO:0001583	missense	27181	exon7			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.1446G>T	19.37:g.51955687C>A	ENSP00000321077:p.Glu482Asp		56647499	NM_014442	Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	11.04	1.523037	0.27211	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.61980	1.4;0.06;1.16	1.31	1.31	0.21738	.	.	.	.	.	T	0.53818	0.1820	N	0.08118	0	0.09310	N	1	D;D;D	0.60575	0.98;0.988;0.98	P;P;P	0.62184	0.794;0.899;0.794	T	0.41945	-0.9480	9	0.87932	D	0	.	6.0643	0.19854	0.0:1.0:0.0:0.0	.	373;389;482	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	D	373;482;389	ENSP00000389142:E373D;ENSP00000321077:E482D;ENSP00000339448:E389D	ENSP00000321077:E482D	E	-	3	2	SIGLEC8	56647499	0.012000	0.17670	0.003000	0.11579	0.011000	0.07611	1.105000	0.31086	1.035000	0.39972	0.502000	0.49764	GAG		0.522	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
LILRA6	79168	broad.mit.edu	37	19	54745665	54745665	+	Missense_Mutation	SNP	C	C	T	rs1052966	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr19:54745665C>T	ENST00000396365.2	-	4	484	c.445G>A	c.(445-447)Gga>Aga	p.G149R	LILRA6_ENST00000419410.2_Missense_Mutation_p.G149R|LILRA6_ENST00000391735.3_Missense_Mutation_p.G149R|LILRA6_ENST00000270464.5_Missense_Mutation_p.G149R|LILRA6_ENST00000245621.5_Missense_Mutation_p.G149R|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000440558.2_Missense_Mutation_p.G149R	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	149			G -> R (in dbSNP:rs1052966).		immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.G149R(2)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGGTGATATCCCTTCTGTGAG	0.582																																					p.G149R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G445A	19						.						25.0	40.0	35.0					19																	54745665		2106	4268	6374	59437477	SO:0001583	missense	11025	exon4			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.445G>A	19.37:g.54745665C>T	ENSP00000379651:p.Gly149Arg		59437477	NM_024318		Missense_Mutation	SNP	ENST00000396365.2	37	CCDS42610.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825878	0.32237	.	.	ENSG00000244482	ENST00000440558;ENST00000270464;ENST00000419410;ENST00000391735;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T;T;T;T	0.11604	2.76;2.76;2.76;3.85;2.76;2.76	3.1	-6.21	0.02065	Immunoglobulin-like fold (1);	2.192950	0.01626	N	0.023278	T	0.12050	0.0293	L	0.39326	1.205	0.09310	N	1	P;B;P;P;B;P	0.41978	0.64;0.037;0.767;0.555;0.383;0.716	P;B;B;B;B;B	0.47044	0.535;0.085;0.444;0.211;0.344;0.276	T	0.27773	-1.0064	10	0.44086	T	0.13	.	4.765	0.13128	0.0:0.4155:0.3207:0.2638	rs1052966;rs3193450;rs13346484	149;149;149;149;149;149	C9JFH3;Q6PI73-2;Q6PI73;F8WCY4;D3YTC4;F8W6G6	.;.;LIRA6_HUMAN;.;.;.	R	149	ENSP00000390120:G149R;ENSP00000270464:G149R;ENSP00000411227:G149R;ENSP00000375615:G149R;ENSP00000379651:G149R;ENSP00000245621:G149R	ENSP00000245621:G149R	G	-	1	0	LILRA6	59437477	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-2.553000	0.00927	-1.315000	0.02297	0.162000	0.16502	GGA		0.582	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313725.1	NM_024318	
MUC16	94025	broad.mit.edu	37	19	9046602	9046602	+	Silent	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr19:9046602G>T	ENST00000397910.4	-	5	35232	c.35029C>A	c.(35029-35031)Cgg>Agg	p.R11677R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11679	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.R7310R(1)|p.R11677R(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGAACAGTCCGAATTGGAACA	0.512																																					p.R11677R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C35029A	19						.						107.0	106.0	106.0					19																	9046602		2049	4196	6245	8907602	SO:0001819	synonymous_variant	94025	exon5			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35029C>A	19.37:g.9046602G>T			8907602	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
C3P1	388503	broad.mit.edu	37	19	10166291	10166291	+	RNA	SNP	G	G	A	rs563514269		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr19:10166291G>A	ENST00000495140.1	+	0	1649							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)	p.V202I(1)		endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						TGTGTTCCGCGTCTTTGCCCT	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		21662	0.0		0.0	False		,,,				2504	0.001				.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	19						.						188.0	167.0	174.0					19																	10166291		2070	4215	6285	10027291			388503	.			AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10166291G>A			10027291	.		Missense_Mutation	SNP	ENST00000495140.1	37																																																																																					0.562	C3P1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000351284.1	NR_027300	
NLRP9	338321	broad.mit.edu	37	19	56243756	56243756	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr19:56243756C>A	ENST00000332836.2	-	2	1468	c.1441G>T	c.(1441-1443)Gtg>Ttg	p.V481L		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	481						cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.V481L(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		GGCTGAACCACACTTGCTCTT	0.468																																					p.V481L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1441T	19						.						102.0	100.0	101.0					19																	56243756		2203	4300	6503	60935568	SO:0001583	missense	338321	exon2			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1441G>T	19.37:g.56243756C>A	ENSP00000331857:p.Val481Leu		60935568	NM_176820	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.138136	0.00335	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.71817	-0.6	2.44	-4.87	0.03123	.	.	.	.	.	T	0.38453	0.1041	N	0.11154	0.105	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.25916	-1.0118	9	0.10636	T	0.68	.	1.4865	0.02447	0.1352:0.1667:0.2682:0.4299	.	481	Q7RTR0	NALP9_HUMAN	L	481	ENSP00000331857:V481L	ENSP00000331857:V481L	V	-	1	0	NLRP9	60935568	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.087000	0.01360	-2.039000	0.00917	-0.268000	0.10319	GTG		0.468	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
NPR1	4881	broad.mit.edu	37	1	153661483	153661483	+	Silent	SNP	G	G	A	rs372297612		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:153661483G>A	ENST00000368680.3	+	16	2944	c.2472G>A	c.(2470-2472)gcG>gcA	p.A824A		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	824					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)	p.A824A(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	AGCAGTACGCGAACAATCTGG	0.622																																					p.A824A	Pancreas(141;1349 1870 15144 15830 40702)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2472A	1						.	G		0,4406		0,0,2203	145.0	129.0	134.0		2472	0.3	1.0	1		134	1,8599		0,1,4299	no	coding-synonymous	NPR1	NM_000906.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		824/1062	153661483	1,13005	2203	4300	6503	151928107	SO:0001819	synonymous_variant	4881	exon16			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2472G>A	1.37:g.153661483G>A			151928107	NM_000906	B0ZBF0|Q5SR08|Q6P4Q3	Silent	SNP	ENST00000368680.3	37	CCDS1051.1																																																																																				0.622	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906	
ZNF648	127665	broad.mit.edu	37	1	182025763	182025763	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:182025763C>T	ENST00000339948.3	-	2	1590	c.1383G>A	c.(1381-1383)tcG>tcA	p.S461S		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	461					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S461S(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						GCACGAGGCGCGAGGGCTGCG	0.667																																					p.S461S	NSCLC(71;908 1374 5429 20458 35642)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1383A	1						.						35.0	32.0	33.0					1																	182025763		2200	4299	6499	180292386	SO:0001819	synonymous_variant	127665	exon2			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1383G>A	1.37:g.182025763C>T			180292386	NM_001009992	B2RP16	Silent	SNP	ENST00000339948.3	37	CCDS30952.1																																																																																				0.667	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
CFH	3075	broad.mit.edu	37	1	196694261	196694261	+	Silent	SNP	C	C	T	rs144976181	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:196694261C>T	ENST00000367429.4	+	12	1947	c.1707C>T	c.(1705-1707)tgC>tgT	p.C569C		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	569	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.C569C(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						AAAGAGAATGCGAACTTCCTA	0.318													C|||	3	0.000599042	0.0023	0.0	5008	,	,		17401	0.0		0.0	False		,,,				2504	0.0				p.C569C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1707T	1						.	C		24,4382	30.8+/-60.4	0,24,2179	45.0	41.0	43.0		1707	1.8	0.2	1	dbSNP_134	43	0,8598		0,0,4299	no	coding-synonymous	CFH	NM_000186.3		0,24,6478	TT,TC,CC		0.0,0.5447,0.1846		569/1232	196694261	24,12980	2203	4299	6502	194960884	SO:0001819	synonymous_variant	3075	exon12			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.1707C>T	1.37:g.196694261C>T			194960884	NM_000186	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	ENST00000367429.4	37	CCDS1385.1																																																																																				0.318	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
HLX	3142	broad.mit.edu	37	1	221055545	221055545	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:221055545C>T	ENST00000366903.6	+	3	2313	c.812C>T	c.(811-813)aCg>aTg	p.T271M	HLA-AS1_ENST00000552026.1_RNA|HLX_ENST00000549319.1_Missense_Mutation_p.T57M	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	271					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.T271M(1)		breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		ATGCCGCAGACGTACAAAAGG	0.557																																					p.T271M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C812T	1						.						66.0	54.0	58.0					1																	221055545		2203	4300	6503	219122168	SO:0001583	missense	3142	exon3			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.812C>T	1.37:g.221055545C>T	ENSP00000355870:p.Thr271Met		219122168	NM_021958	B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	ENST00000366903.6	37	CCDS1527.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.840941	0.91197	.	.	ENSG00000136630	ENST00000366903;ENST00000427693;ENST00000549319	T;D;T	0.95447	1.33;-3.71;3.0	5.84	5.84	0.93424	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000010	D	0.96334	0.8804	L	0.34521	1.04	0.58432	D	0.999999	D	0.71674	0.998	D	0.74023	0.982	D	0.96218	0.9158	10	0.51188	T	0.08	-28.0125	20.1278	0.97990	0.0:1.0:0.0:0.0	.	271	Q14774	HLX_HUMAN	M	271;4;57	ENSP00000355870:T271M;ENSP00000408248:T4M;ENSP00000449882:T57M	ENSP00000355870:T271M	T	+	2	0	HLX	219122168	1.000000	0.71417	0.951000	0.38953	0.636000	0.38137	7.788000	0.85771	2.768000	0.95171	0.561000	0.74099	ACG		0.557	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090902.3	NM_021958	
TP53BP2	7159	broad.mit.edu	37	1	224002053	224002053	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:224002053G>A	ENST00000391878.2	-	0	559				TP53BP2_ENST00000343537.7_Missense_Mutation_p.R60C	NM_005426.2	NP_005417.1	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2						cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)	p.R60C(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GCAACTGGACGTTCTAAAGCA	0.383																																					p.R60C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C178T	1						.						98.0	96.0	97.0					1																	224002053		1897	4112	6009	222068676			7159	exon3			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000391878.2:c.-210C>T	1.37:g.224002053G>A			222068676	NM_001031685	B4DG66|Q12892|Q86X75|Q96KQ3	De_novo_Start_OutOfFrame	SNP	ENST00000391878.2	37	CCDS1538.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.786413	0.90367	.	.	ENSG00000143514	ENST00000343537	T	0.56776	0.44	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.74238	0.3690	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.76424	-0.2964	10	0.87932	D	0	.	19.6333	0.95719	0.0:0.0:1.0:0.0	.	60	B4DG66	.	C	60	ENSP00000341957:R60C	ENSP00000341957:R60C	R	-	1	0	TP53BP2	222068676	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.560000	0.67332	2.654000	0.90174	0.563000	0.77884	CGT		0.383	TP53BP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090986.3	NM_001031685, NM_005426	
PLCH2	9651	broad.mit.edu	37	1	2422736	2422736	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:2422736G>A	ENST00000419816.2	+	11	1895	c.1621G>A	c.(1621-1623)Gtc>Atc	p.V541I	PLCH2_ENST00000378486.3_Missense_Mutation_p.V541I|PLCH2_ENST00000449969.1_Missense_Mutation_p.V514I|RP3-395M20.2_ENST00000424657.1_RNA|RP3-395M20.3_ENST00000442305.1_RNA|PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000378488.3_Missense_Mutation_p.V541I			O75038	PLCH2_HUMAN	phospholipase C, eta 2	541					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.V541I(1)|p.V388I(1)		central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CAACTTCTCCGTCTCCACACT	0.557																																					p.V541I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1621A	1						.						85.0	93.0	91.0					1																	2422736		1998	4157	6155	2412596	SO:0001583	missense	9651	exon11			AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.1621G>A	1.37:g.2422736G>A	ENSP00000389803:p.Val541Ile		2412596	NM_014638	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37		.	.	.	.	.	.	.	.	.	.	G	9.409	1.079955	0.20309	.	.	ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000343889;ENST00000278878	T;T;T	0.47528	0.84;0.84;0.84	4.85	2.97	0.34412	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.965118	0.08439	U	0.945798	T	0.42314	0.1197	L	0.51914	1.62	0.80722	D	1	B;B;B;B	0.23540	0.087;0.028;0.03;0.057	B;B;B;B	0.16289	0.014;0.008;0.015;0.012	T	0.08868	-1.0701	10	0.36615	T	0.2	.	9.7701	0.40585	0.1679:0.0:0.8321:0.0	.	388;329;514;541	B9DI81;B9DI82;O75038-2;O75038	.;.;.;PLCH2_HUMAN	I	514;541;541;388;329	ENSP00000397289:V514I;ENSP00000367747:V541I;ENSP00000367749:V541I	ENSP00000278878:V329I	V	+	1	0	PLCH2	2412596	0.998000	0.40836	0.034000	0.17996	0.338000	0.28826	2.874000	0.48483	0.463000	0.27118	0.561000	0.74099	GTC		0.557	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
ZNF436	80818	broad.mit.edu	37	1	23689309	23689309	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:23689309G>C	ENST00000314011.4	-	4	702	c.566C>G	c.(565-567)aCt>aGt	p.T189S	ZNF436_ENST00000374608.3_Missense_Mutation_p.T189S	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	189					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T189S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		CCTCTCCCCAGTATGTGTTCT	0.458																																					p.T189S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C566G	1						.						131.0	130.0	130.0					1																	23689309		2203	4300	6503	23561896	SO:0001583	missense	80818	exon3			AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.566C>G	1.37:g.23689309G>C	ENSP00000313582:p.Thr189Ser		23561896	NM_030634	Q658I9	Missense_Mutation	SNP	ENST00000314011.4	37	CCDS233.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492200	0.64074	.	.	ENSG00000125945	ENST00000314011;ENST00000374609;ENST00000374608	T;T;T	0.24151	1.87;1.87;1.87	5.79	5.79	0.91817	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000011	T	0.26376	0.0644	N	0.13352	0.335	0.39321	D	0.965248	P	0.52170	0.951	P	0.50270	0.636	T	0.05852	-1.0860	10	0.62326	D	0.03	-23.697	17.535	0.87827	0.0:0.0:1.0:0.0	.	189	Q9C0F3	ZN436_HUMAN	S	189	ENSP00000313582:T189S;ENSP00000363737:T189S;ENSP00000363736:T189S	ENSP00000313582:T189S	T	-	2	0	ZNF436	23561896	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	4.764000	0.62264	2.739000	0.93911	0.655000	0.94253	ACT		0.458	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
CCDC28B	79140	broad.mit.edu	37	1	32669526	32669526	+	Missense_Mutation	SNP	G	G	A	rs145792550		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:32669526G>A	ENST00000373602.5	+	3	558	c.211G>A	c.(211-213)Ggc>Agc	p.G71S	IQCC_ENST00000537469.1_5'Flank|CCDC28B_ENST00000483009.1_3'UTR|CCDC28B_ENST00000421922.2_Missense_Mutation_p.G71S|IQCC_ENST00000291358.6_5'Flank|RP4-622L5.7_ENST00000373604.4_RNA|RP4-622L5.7_ENST00000421616.1_RNA	NM_024296.3	NP_077272.2	Q9BUN5	CC28B_HUMAN	coiled-coil domain containing 28B	71					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.G71S(1)		large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AGGTGGAAGCGGCTCTGCAGG	0.602																																					p.G71S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G211A	1						.	G	SER/GLY	0,4406		0,0,2203	46.0	43.0	44.0		211	5.3	1.0	1	dbSNP_134	44	2,8598	2.2+/-6.3	0,2,4298	no	missense	CCDC28B	NM_024296.3	56	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	71/201	32669526	2,13004	2203	4300	6503	32442113	SO:0001583	missense	79140	exon3			BC022848	CCDS354.2, CCDS72749.1	1p36.11-p34.2	2008-02-05			ENSG00000160050	ENSG00000160050			28163	protein-coding gene	gene with protein product		610162				16327777	Standard	XM_006710892		Approved	MGC1203, RP4-622L5.5	uc001bul.1	Q9BUN5	OTTHUMG00000005738	ENST00000373602.5:c.211G>A	1.37:g.32669526G>A	ENSP00000362704:p.Gly71Ser		32442113	NM_024296	A8K789|Q8TBV8	Missense_Mutation	SNP	ENST00000373602.5	37	CCDS354.2	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207016	0.39003	0.0	2.33E-4	ENSG00000160050	ENST00000373602;ENST00000421922	T;T	0.47177	0.92;0.85	5.33	5.33	0.75918	.	0.171896	0.50627	D	0.000113	T	0.28962	0.0719	L	0.40543	1.245	0.31610	N	0.651677	B;P	0.45176	0.009;0.852	B;B	0.28305	0.002;0.088	T	0.38222	-0.9671	10	0.21014	T	0.42	-4.2985	9.8234	0.40896	0.0775:0.1428:0.7797:0.0	.	71;71	Q9BUN5;E9PM81	CC28B_HUMAN;.	S	71	ENSP00000362704:G71S;ENSP00000413017:G71S	ENSP00000362704:G71S	G	+	1	0	CCDC28B	32442113	0.992000	0.36948	0.956000	0.39512	0.545000	0.35147	2.075000	0.41538	2.662000	0.90505	0.561000	0.74099	GGC		0.602	CCDC28B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015723.4	NM_024296	
CSMD2	114784	broad.mit.edu	37	1	34158603	34158603	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:34158603C>T	ENST00000373380.1	-	4	818	c.598G>A	c.(598-600)Ggg>Agg	p.G200R	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.G1327R			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G1287R(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCTGGATACCCGGGTGACAGC	0.557																																					p.G1287R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3859A	1						.						161.0	160.0	160.0					1																	34158603		2203	4300	6503	33931190	SO:0001583	missense	114784	exon25			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.598G>A	1.37:g.34158603C>T	ENSP00000362478:p.Gly200Arg		33931190	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37		.	.	.	.	.	.	.	.	.	.	C	28.8	4.949358	0.92660	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.61859	0.07;0.07	5.52	5.52	0.82312	CUB (5);	0.000000	0.85682	D	0.000000	T	0.77631	0.4159	M	0.79343	2.45	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.981;0.991;0.992	T	0.80079	-0.1532	10	0.87932	D	0	.	18.4386	0.90656	0.0:1.0:0.0:0.0	.	200;1287;1327	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	R	1327;200	ENSP00000362479:G1327R;ENSP00000362478:G200R	ENSP00000241312:G1287R	G	-	1	0	CSMD2	33931190	1.000000	0.71417	0.892000	0.35008	0.794000	0.44872	7.747000	0.85070	2.597000	0.87782	0.655000	0.94253	GGG		0.557	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
UQCRH	7388	broad.mit.edu	37	1	46775948	46775948	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:46775948C>T	ENST00000311672.5	+	3	339	c.203C>T	c.(202-204)aCg>aTg	p.T68M		NM_001089591.1|NM_006004.2	NP_001083060.1|NP_005995.2	P07919	QCR6_HUMAN	ubiquinol-cytochrome c reductase hinge protein	68					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|protein heterooligomerization (GO:0051291)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ubiquinol-cytochrome-c reductase activity (GO:0008121)	p.T68M(1)		large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					GAGGATTGCACGGAGGAGCTC	0.532																																					p.T68M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C203T	1						.						134.0	134.0	134.0					1																	46775948		2203	4300	6503	46548535	SO:0001583	missense	7388	exon3			BC001934	CCDS30704.1	1p34.1	2011-07-04			ENSG00000173660	ENSG00000173660	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12590	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit VIII"""	613844				2826252	Standard	XM_005271167		Approved	QCR6, UQCR8	uc001cpp.3	P07919	OTTHUMG00000007813	ENST00000311672.5:c.203C>T	1.37:g.46775948C>T	ENSP00000309565:p.Thr68Met		46548535	NM_006004	B2R4V9|D3DQ18|Q5TDF6|Q6LDB8|Q9BQ91	Missense_Mutation	SNP	ENST00000311672.5	37	CCDS30704.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.591317	0.86851	.	.	ENSG00000173660	ENST00000311672	T	0.46819	0.86	5.34	5.34	0.76211	Ubiquinol-cytochrome C reductase hinge domain (3);	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68957	-0.5272	9	0.45353	T	0.12	-13.5696	19.2408	0.93881	0.0:1.0:0.0:0.0	.	68	P07919	QCR6_HUMAN	M	68	ENSP00000309565:T68M	ENSP00000309565:T68M	T	+	2	0	UQCRH	46548535	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.202000	0.77856	2.785000	0.95823	0.655000	0.94253	ACG		0.532	UQCRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021451.1	NM_006004	
ELAVL4	1996	broad.mit.edu	37	1	50666631	50666631	+	Silent	SNP	C	C	T	rs138724011		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:50666631C>T	ENST00000371823.4	+	7	1148	c.924C>T	c.(922-924)tcC>tcT	p.S308S	ELAVL4_ENST00000371821.1_Silent_p.S313S|ELAVL4_ENST00000371819.1_Silent_p.S299S|ELAVL4_ENST00000371827.1_Silent_p.S294S|ELAVL4_ENST00000357083.4_Silent_p.S311S|ELAVL4_ENST00000371824.1_Silent_p.S294S|ELAVL4_ENST00000448907.2_Silent_p.S297S	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4	308	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.S311S(1)|p.S308S(1)		NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						CCCCCGATTCCGATGAGAGTG	0.502																																					p.S294S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C882T	1						.	C	,,,,	0,4406		0,0,2203	125.0	118.0	120.0		882,933,882,891,924	-11.2	0.2	1	dbSNP_134	120	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ELAVL4	NM_001144774.1,NM_001144775.1,NM_001144776.1,NM_001144777.1,NM_021952.3	,,,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,	294/367,311/384,294/367,297/370,308/381	50666631	1,13005	2203	4300	6503	50439218	SO:0001819	synonymous_variant	1996	exon7			AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.924C>T	1.37:g.50666631C>T			50439218	NM_001144774	B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Silent	SNP	ENST00000371823.4	37	CCDS553.1																																																																																				0.502	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000021712.1	NM_021952	
TMEM63A	9725	broad.mit.edu	37	1	226054314	226054314	+	Missense_Mutation	SNP	C	C	T	rs368334549		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr1:226054314C>T	ENST00000366835.3	-	9	905	c.635G>A	c.(634-636)cGg>cAg	p.R212Q	TMEM63A_ENST00000474478.1_5'Flank|TMEM63A_ENST00000537914.1_5'UTR	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	212					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)	p.R212Q(1)		breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					AGTGTGGTGCCGCATGAAACC	0.552																																					p.R212Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G635A	1						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	118.0	99.0	105.0		635	4.6	1.0	1		105	0,8600		0,0,4300	no	missense	TMEM63A	NM_014698.2	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	212/808	226054314	1,13005	2203	4300	6503	224120937	SO:0001583	missense	9725	exon9				CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.635G>A	1.37:g.226054314C>T	ENSP00000355800:p.Arg212Gln		224120937	NM_014698	Q53GI7|Q5TE96|Q8N2U2	Missense_Mutation	SNP	ENST00000366835.3	37	CCDS31042.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957265	0.73902	2.27E-4	0.0	ENSG00000196187	ENST00000366835	T	0.41758	0.99	5.49	4.58	0.56647	.	0.210323	0.46442	D	0.000295	T	0.53578	0.1805	M	0.75264	2.295	0.80722	D	1	D;D	0.58620	0.983;0.983	P;P	0.56700	0.804;0.804	T	0.50197	-0.8856	10	0.30078	T	0.28	-18.1462	9.6082	0.39645	0.0:0.8472:0.0:0.1528	.	212;212	B3KMR6;O94886	.;TM63A_HUMAN	Q	212	ENSP00000355800:R212Q	ENSP00000355800:R212Q	R	-	2	0	TMEM63A	224120937	0.011000	0.17503	1.000000	0.80357	0.944000	0.59088	2.424000	0.44714	2.579000	0.87056	0.563000	0.77884	CGG		0.552	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091154.2	NM_014698	
BPIFB4	149954	broad.mit.edu	37	20	31676807	31676807	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr20:31676807G>A	ENST00000375483.3	+	6	962	c.962G>A	c.(961-963)cGa>cAa	p.R321Q		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	321						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.R282Q(1)									TTAGTGAACCGAGTCCTGGCC	0.592																																					p.R321Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G962A	20						.						159.0	148.0	151.0					20																	31676807		2203	4300	6503	31140468	SO:0001583	missense	149954	exon6			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.962G>A	20.37:g.31676807G>A	ENSP00000364632:p.Arg321Gln		31140468	NM_182519	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	37	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	G	16.01	3.000389	0.54147	.	.	ENSG00000186191	ENST00000375483	T	0.04551	3.6	5.01	5.01	0.66863	.	0.277589	0.29715	N	0.011382	T	0.01940	0.0061	N	0.02539	-0.55	0.31796	N	0.629061	P	0.39903	0.694	B	0.29716	0.106	T	0.44590	-0.9318	10	0.22706	T	0.39	-4.7231	13.808	0.63246	0.0:0.0:1.0:0.0	.	321	P59827	BPIB4_HUMAN	Q	321	ENSP00000364632:R321Q	ENSP00000364632:R321Q	R	+	2	0	BPIFB4	31140468	0.995000	0.38212	1.000000	0.80357	0.927000	0.56198	5.342000	0.65970	2.329000	0.79093	0.591000	0.81541	CGA		0.592	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
BPIFB1	92747	broad.mit.edu	37	20	31890183	31890183	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr20:31890183C>T	ENST00000253354.1	+	10	1107	c.946C>T	c.(946-948)Cgg>Tgg	p.R316W	BPIFB1_ENST00000464032.1_3'UTR	NM_033197.2	NP_149974.2	Q8TDL5	BPIB1_HUMAN	BPI fold containing family B, member 1	316					innate immune response in mucosa (GO:0002227)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)	p.R316W(1)									GAGTGCCCATCGGCTGAAGTC	0.582																																					p.R316W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C946T	20						.						225.0	192.0	203.0					20																	31890183		2203	4300	6503	31353844	SO:0001583	missense	92747	exon10			BC008429	CCDS13218.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000125999	ENSG00000125999		"""BPI fold containing"""	16108	protein-coding gene	gene with protein product	"""von Ebner minor salivary gland protein"""		"""chromosome 20 open reading frame 114"""	C20orf114		11971875, 21787333	Standard	NM_033197		Approved	dJ1187J4.1, MGC14597, bA49G10.6, LPLUNC1, VEMSGP	uc002wyw.1	Q8TDL5	OTTHUMG00000032252	ENST00000253354.1:c.946C>T	20.37:g.31890183C>T	ENSP00000253354:p.Arg316Trp		31353844	NM_033197	A8K2H8|Q5QP43|Q6UWY1|Q6ZRU7|Q96HK6|Q9BQP8|Q9BWZ6|Q9H4V6	Missense_Mutation	SNP	ENST00000253354.1	37	CCDS13218.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.857344	0.51376	.	.	ENSG00000125999	ENST00000253354;ENST00000375378	T	0.08008	3.14	4.4	-7.77	0.01227	.	1.404350	0.04553	N	0.390301	T	0.17195	0.0413	M	0.65975	2.015	0.09310	N	1	D	0.76494	0.999	P	0.56434	0.798	T	0.42616	-0.9441	10	0.62326	D	0.03	-0.9242	9.0598	0.36427	0.3883:0.1939:0.4178:0.0	.	316	Q8TDL5	BPIB1_HUMAN	W	316;147	ENSP00000253354:R316W	ENSP00000253354:R316W	R	+	1	2	BPIFB1	31353844	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.780000	0.04654	-1.491000	0.01840	-0.502000	0.04539	CGG		0.582	BPIFB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106499.2	NM_033197	
MROH8	140699	broad.mit.edu	37	20	35740789	35740789	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr20:35740789C>A	ENST00000400441.3	-	21	2751	c.2752G>T	c.(2752-2754)Gtg>Ttg	p.V918L	MROH8_ENST00000217333.8_Missense_Mutation_p.V747L|MROH8_ENST00000441008.2_Missense_Mutation_p.V904L			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	0								p.V918L(1)									TTGGAGTACACTTCTTGGGGC	0.423																																					p.S918I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2753T	20						.						115.0	106.0	109.0					20																	35740789		1895	4121	6016	35174203	SO:0001583	missense	140699	exon20			AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.2752G>T	20.37:g.35740789C>A	ENSP00000383291:p.Val918Leu		35174203	NM_152503	Q5JYQ6	Missense_Mutation	SNP	ENST00000400441.3	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	16.74|16.74|16.74	3.206855|3.206855|3.206855	0.58343|0.58343|0.58343	.|.|.	.|.|.	ENSG00000101353|ENSG00000101353|ENSG00000101353	ENST00000343811|ENST00000417458|ENST00000441008;ENST00000400441;ENST00000217333	.|.|T;T;T	.|.|0.62364	.|.|4.31;4.6;0.03	5.57|5.57|5.57	5.57|5.57|5.57	0.84162|0.84162|0.84162	.|.|.	.|.|0.092777	.|.|0.47093	.|.|D	.|.|0.000250	T|T|T	0.71953|0.71953|0.71953	0.3401|0.3401|0.3401	M|M|M	0.61703|0.61703|0.61703	1.905|1.905|1.905	0.33885|0.33885|0.33885	D|D|D	0.636578|0.636578|0.636578	.|.|D;D	.|.|0.76494	.|.|0.999;0.999	.|.|D;D	.|.|0.78314	.|.|0.987;0.991	T|T|T	0.69540|0.69540|0.69540	-0.5118|-0.5118|-0.5118	5|5|10	.|.|0.02654	.|.|T	.|.|1	-2.2882|-2.2882|-2.2882	15.0479|15.0479|15.0479	0.71841|0.71841|0.71841	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|918;752	.|.|E7ETR9;Q9H579-2	.|.|.;.	N|I|L	944|545|904;918;747	.|.|ENSP00000392144:V904L;ENSP00000383291:V918L;ENSP00000217333:V747L	.|.|ENSP00000217333:V747L	K|S|V	-|-|-	3|2|1	2|0|0	C20orf132|C20orf132|C20orf132	35174203|35174203|35174203	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.990000|0.990000|0.990000	0.47175|0.47175|0.47175	0.750000|0.750000|0.750000	0.42670|0.42670|0.42670	3.697000|3.697000|3.697000	0.54764|0.54764|0.54764	2.615000|2.615000|2.615000	0.88500|0.88500|0.88500	0.511000|0.511000|0.511000	0.50034|0.50034|0.50034	AAG|AGT|GTG		0.423	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152503	
BPI	671	broad.mit.edu	37	20	36965562	36965562	+	Silent	SNP	C	C	T	rs145842777		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr20:36965562C>T	ENST00000262865.4	+	15	1529	c.1440C>T	c.(1438-1440)ttC>ttT	p.F480F		NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	480					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)	p.F480F(1)		kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				TCCTGCTGTTCGGTGCAGACG	0.542																																					p.F480F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1440T	20						.	C		0,4406		0,0,2203	129.0	118.0	121.0		1440	-7.8	0.0	20	dbSNP_134	121	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	BPI	NM_001725.2		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		480/488	36965562	4,13002	2203	4300	6503	36398976	SO:0001819	synonymous_variant	671	exon15			J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.1440C>T	20.37:g.36965562C>T			36398976	NM_001725	B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Silent	SNP	ENST00000262865.4	37	CCDS13303.1	.	.	.	.	.	.	.	.	.	.	C	3.452	-0.111742	0.06881	0.0	4.65E-4	ENSG00000101425	ENST00000417318	.	.	.	4.26	-7.8	0.01214	.	.	.	.	.	T	0.16811	0.0404	.	.	.	0.22366	N	0.999168	.	.	.	.	.	.	T	0.20405	-1.0276	4	.	.	.	-9.7201	2.825	0.05483	0.1145:0.1489:0.227:0.5096	.	.	.	.	L	306	.	.	S	+	2	0	BPI	36398976	0.033000	0.19621	0.009000	0.14445	0.063000	0.16089	-2.098000	0.01347	-1.741000	0.01344	-0.137000	0.14449	TCG		0.542	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2	NM_001725	
KCNB1	3745	broad.mit.edu	37	20	48098514	48098514	+	Silent	SNP	G	G	A	rs139960830		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr20:48098514G>A	ENST00000371741.4	-	1	670	c.504C>T	c.(502-504)tgC>tgT	p.C168C		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	168					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)	p.C168C(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	TCTTCTCTGCGCAGCACGTGT	0.592													g|||	1	0.000199681	0.0	0.0	5008	,	,		17973	0.0		0.0	False		,,,				2504	0.001				p.C168C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C504T	20						.	G		0,4406		0,0,2203	188.0	162.0	171.0		504	-0.1	0.6	20	dbSNP_134	171	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KCNB1	NM_004975.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		168/859	48098514	1,13005	2203	4300	6503	47531921	SO:0001819	synonymous_variant	3745	exon1			AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.504C>T	20.37:g.48098514G>A			47531921	NM_004975	Q14193	Silent	SNP	ENST00000371741.4	37	CCDS13418.1																																																																																				0.592	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	
ADNP	23394	broad.mit.edu	37	20	49508155	49508155	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr20:49508155delG	ENST00000396029.3	-	5	3663	c.3096delC	c.(3094-3096)tccfs	p.S1032fs	ADNP_ENST00000371602.4_Frame_Shift_Del_p.S1032fs|ADNP_ENST00000349014.3_Frame_Shift_Del_p.S1032fs|ADNP_ENST00000396032.3_Frame_Shift_Del_p.S1032fs	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	1032					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S1032S(1)|p.Y1033fs*48(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						CTTTTCCATAGGAACTATTCT	0.458																																					p.S1032fs												.	.	2	Deletion - Frameshift(1)|Substitution - coding silent(1)	large_intestine(2)	c.3096delC	20						.						142.0	137.0	139.0					20																	49508155		2203	4300	6503	48941562	SO:0001589	frameshift_variant	23394	exon5			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.3096delC	20.37:g.49508155delG	ENSP00000379346:p.Ser1032fs		48941562	NM_015339	E1P5Y2|O94881|Q5BKU2|Q9UG34	Frame_Shift_Del	DEL	ENST00000396029.3	37	CCDS13433.1																																																																																				0.458	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
APCDD1L	164284	broad.mit.edu	37	20	57036316	57036316	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr20:57036316G>A	ENST00000371149.3	-	4	1266	c.1036C>T	c.(1036-1038)Cgc>Tgc	p.R346C	APCDD1L_ENST00000439429.1_Missense_Mutation_p.R357C|APCDD1L_ENST00000491015.1_5'UTR	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	346						integral component of membrane (GO:0016021)		p.R346C(1)		large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			GTGCCGCCGCGGACCCTGGTG	0.652																																					p.R346C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1036T	20						.						32.0	32.0	32.0					20																	57036316		2203	4299	6502	56469722	SO:0001583	missense	164284	exon4			AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.1036C>T	20.37:g.57036316G>A	ENSP00000360191:p.Arg346Cys		56469722	NM_153360		Missense_Mutation	SNP	ENST00000371149.3	37	CCDS13467.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057125	0.36277	.	.	ENSG00000198768	ENST00000371149;ENST00000439429	T;T	0.19250	2.16;2.16	4.36	2.19	0.27852	.	1.527430	0.03698	N	0.248102	T	0.40791	0.1131	M	0.79926	2.475	0.09310	N	1	D;D	0.76494	0.999;0.998	P;P	0.56700	0.804;0.731	T	0.06075	-1.0847	10	0.56958	D	0.05	-6.0653	3.5121	0.07712	0.1036:0.1138:0.5328:0.2498	.	357;346	F5H6V6;Q8NCL9	.;APCDL_HUMAN	C	346;357	ENSP00000360191:R346C;ENSP00000413261:R357C	ENSP00000360191:R346C	R	-	1	0	APCDD1L	56469722	0.002000	0.14202	0.171000	0.22900	0.390000	0.30446	0.863000	0.27913	0.841000	0.35020	0.563000	0.77884	CGC		0.652	APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000079881.2	NM_153360	
NCAM2	4685	broad.mit.edu	37	21	22804561	22804561	+	Silent	SNP	G	G	A	rs377668299		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr21:22804561G>A	ENST00000400546.1	+	12	1863	c.1614G>A	c.(1612-1614)gcG>gcA	p.A538A	NCAM2_ENST00000284894.7_Silent_p.A396A	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	538	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A538A(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AAGAAGTAGCGTCAGAAATCT	0.433													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18129	0.0		0.0	False		,,,				2504	0.0				p.A538A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1614A	21						.	G		3,3733		0,3,1865	91.0	87.0	88.0		1614	-8.8	0.8	21		88	0,8196		0,0,4098	no	coding-synonymous	NCAM2	NM_004540.3		0,3,5963	AA,AG,GG		0.0,0.0803,0.0251		538/838	22804561	3,11929	1868	4098	5966	21726432	SO:0001819	synonymous_variant	4685	exon12				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1614G>A	21.37:g.22804561G>A			21726432	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Silent	SNP	ENST00000400546.1	37	CCDS42910.1																																																																																				0.433	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
BACE2	25825	broad.mit.edu	37	21	42609477	42609477	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr21:42609477G>A	ENST00000330333.6	+	3	902	c.439G>A	c.(439-441)Gtg>Atg	p.V147M	BACE2_ENST00000328735.6_Missense_Mutation_p.V147M|BACE2_ENST00000347667.5_Missense_Mutation_p.V147M|BACE2_ENST00000466122.1_3'UTR	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	147					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)	p.V147M(1)|p.V147L(1)		endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				TGACGTCACAGTGAAGTACAC	0.393																																					p.V147M												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G439A	21						.						79.0	62.0	68.0					21																	42609477		2203	4300	6503	41531347	SO:0001583	missense	25825	exon3			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.439G>A	21.37:g.42609477G>A	ENSP00000332979:p.Val147Met		41531347	NM_138991	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Missense_Mutation	SNP	ENST00000330333.6	37	CCDS13668.1	.	.	.	.	.	.	.	.	.	.	G	30	5.056037	0.93793	.	.	ENSG00000182240	ENST00000330333;ENST00000347667;ENST00000328735;ENST00000544566	T;T;T	0.60040	0.22;0.22;0.22	5.85	5.85	0.93711	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.000000	0.85682	D	0.000000	T	0.74688	0.3749	L	0.60845	1.875	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	T	0.75414	-0.3326	10	0.87932	D	0	.	19.1545	0.93504	0.0:0.0:1.0:0.0	.	147;147;147	Q9Y5Z0-3;Q9Y5Z0-2;Q9Y5Z0	.;.;BACE2_HUMAN	M	147;147;147;52	ENSP00000332979:V147M;ENSP00000327528:V147M;ENSP00000333854:V147M	ENSP00000333854:V147M	V	+	1	0	BACE2	41531347	1.000000	0.71417	0.926000	0.36857	0.887000	0.51463	8.856000	0.92245	2.773000	0.95371	0.585000	0.79938	GTG		0.393	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
ZBTB21	49854	broad.mit.edu	37	21	43411925	43411925	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr21:43411925G>A	ENST00000310826.5	-	3	2463	c.2280C>T	c.(2278-2280)ccC>ccT	p.P760P	ZBTB21_ENST00000398505.3_Silent_p.P559P|ZBTB21_ENST00000398499.1_Silent_p.P760P|ZBTB21_ENST00000465968.1_5'UTR|ZBTB21_ENST00000398511.3_Silent_p.P760P	NM_001098402.1	NP_001091872.1	Q9ULJ3	ZBT21_HUMAN	zinc finger and BTB domain containing 21	760					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)	p.P760P(2)									GCTTCAGCTCGGGCGAGAAAA	0.567																																					p.P559P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C1677T	21						.						144.0	159.0	154.0					21																	43411925		2203	4300	6503	42284994	SO:0001819	synonymous_variant	49854	exon4			AB033053	CCDS13678.1, CCDS42934.1	21q22.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000173276	ENSG00000173276		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13083	protein-coding gene	gene with protein product			"""zinc finger protein 295"""	ZNF295			Standard	NM_020727		Approved	KIAA1227	uc002yzy.4	Q9ULJ3	OTTHUMG00000086789	ENST00000310826.5:c.2280C>T	21.37:g.43411925G>A			42284994	NM_001098403	Q5R2W1|Q5R2W2|Q6P4R0	Silent	SNP	ENST00000310826.5	37	CCDS13678.1																																																																																				0.567	ZBTB21-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195308.1	NM_020727	
TMPRSS3	64699	broad.mit.edu	37	21	43795866	43795866	+	Missense_Mutation	SNP	G	G	C	rs565348874	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr21:43795866G>C	ENST00000291532.3	-	12	2261	c.1306C>G	c.(1306-1308)Cgt>Ggt	p.R436G	TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.R433G|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.R520G|TMPRSS3_ENST00000433957.2_Missense_Mutation_p.R435G	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	436	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)	p.R436G(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						GAGGTGACACGGGTGTACACC	0.622																																					p.R436G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1306G	21						.						108.0	102.0	104.0					21																	43795866		2203	4300	6503	42668935	SO:0001583	missense	64699	exon12			AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.1306C>G	21.37:g.43795866G>C	ENSP00000291532:p.Arg436Gly		42668935	NM_024022	D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	ENST00000291532.3	37	CCDS13686.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258147	0.59321	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399	T;D;D;T	0.84298	-0.06;-1.83;-1.83;-0.06	5.13	5.13	0.70059	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.92655	0.7666	M	0.88310	2.945	0.40349	D	0.979116	D;D;D	0.76494	0.999;0.995;0.999	D;D;D	0.70716	0.969;0.962;0.97	D	0.93785	0.7087	9	.	.	.	.	12.9159	0.58205	0.0:0.0:0.714:0.286	.	435;436;433	P57727-5;P57727;B7WPR2	.;TMPS3_HUMAN;.	G	436;435;433;520	ENSP00000291532:R436G;ENSP00000411013:R435G;ENSP00000381442:R433G;ENSP00000369762:R520G	.	R	-	1	0	TMPRSS3	42668935	1.000000	0.71417	0.944000	0.38274	0.606000	0.37113	4.654000	0.61469	2.395000	0.81488	0.650000	0.86243	CGT		0.622	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1		
AIRE	326	broad.mit.edu	37	21	45706601	45706601	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr21:45706601C>A	ENST00000291582.5	+	2	421	c.294C>A	c.(292-294)gaC>gaA	p.D98E		NM_000383.3	NP_000374.1	O43918	AIRE_HUMAN	autoimmune regulator	98	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				humoral immune response (GO:0006959)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|transcription regulatory region DNA binding (GO:0044212)|translation regulator activity (GO:0045182)|zinc ion binding (GO:0008270)	p.D98E(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(1)	14				Colorectal(79;0.0806)		CCATCCTGGACAGCTTCCCCA	0.642									Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy																												p.D98E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C294A	21						.						54.0	58.0	57.0					21																	45706601		2203	4300	6503	44531029	SO:0001583	missense	326	exon2	Familial Cancer Database	APECED	AB006684	CCDS13706.1	21q22.3	2014-09-17	2007-06-20		ENSG00000160224	ENSG00000160224		"""Zinc fingers, PHD-type"""	360	protein-coding gene	gene with protein product	"""autoimmune polyendocrinopathy candidiasis ectodermal dystrophy"""	607358	"""autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)"""	APECED		9398840	Standard	NM_000383		Approved	PGA1, APS1	uc002zei.3	O43918	OTTHUMG00000086921	ENST00000291582.5:c.294C>A	21.37:g.45706601C>A	ENSP00000291582:p.Asp98Glu		44531029	NM_000383	B2RP50|O43922|O43932|O75745	Missense_Mutation	SNP	ENST00000291582.5	37	CCDS13706.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.858929	0.51376	.	.	ENSG00000160224	ENST00000291582	D	0.93859	-3.3	4.65	3.76	0.43208	Sp100 (2);	0.241165	0.29508	N	0.011959	D	0.91994	0.7464	N	0.25647	0.755	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	D	0.87518	0.2444	10	0.12430	T	0.62	-22.7341	8.8798	0.35367	0.0:0.8934:0.0:0.1066	.	98	O43918	AIRE_HUMAN	E	98	ENSP00000291582:D98E	ENSP00000291582:D98E	D	+	3	2	AIRE	44531029	0.000000	0.05858	0.996000	0.52242	0.996000	0.88848	-0.371000	0.07513	1.076000	0.40961	0.591000	0.81541	GAC		0.642	AIRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195842.2		
LZTR1	8216	broad.mit.edu	37	22	21344765	21344765	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr22:21344765G>A	ENST00000215739.8	+	8	1101	c.742G>A	c.(742-744)Gga>Aga	p.G248R	LZTR1_ENST00000389355.3_Missense_Mutation_p.G229R|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	248					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G248R(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			TGGGCAAAGCGGAGCCAAAAT	0.562																																					p.G248R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G742A	22						.						107.0	101.0	103.0					22																	21344765		2203	4300	6503	19674765	SO:0001583	missense	8216	exon8			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.742G>A	22.37:g.21344765G>A	ENSP00000215739:p.Gly248Arg		19674765	NM_006767	Q14776|Q20WK0	Missense_Mutation	SNP	ENST00000215739.8	37	CCDS33606.1	.	.	.	.	.	.	.	.	.	.	G	33	5.252102	0.95336	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.70869	-0.52;-0.52	5.6	5.6	0.85130	Kelch-type beta propeller (1);	0.051728	0.85682	D	0.000000	D	0.85075	0.5614	M	0.81942	2.565	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.83275	0.989;0.996;0.966;0.954	D	0.86723	0.1943	10	0.87932	D	0	-16.5654	17.1017	0.86652	0.0:0.0:1.0:0.0	.	229;207;248;207	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	R	207;248;229	ENSP00000215739:G248R;ENSP00000374006:G229R	ENSP00000215739:G248R	G	+	1	0	LZTR1	19674765	1.000000	0.71417	0.988000	0.46212	0.924000	0.55760	9.785000	0.99042	2.632000	0.89209	0.655000	0.94253	GGA		0.562	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	
MN1	4330	broad.mit.edu	37	22	28192812	28192812	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr22:28192812G>A	ENST00000302326.4	-	1	4674	c.3720C>T	c.(3718-3720)gaC>gaT	p.D1240D		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	1240					intramembranous ossification (GO:0001957)			p.D1240D(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						TCTTGTCGTCGTCCGCGCTGT	0.597			T	ETV6	"""AML, meningioma"""																																p.D1240D			Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3720T	22						.						90.0	95.0	93.0					22																	28192812		2152	4248	6400	26522812	SO:0001819	synonymous_variant	4330	exon1			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.3720C>T	22.37:g.28192812G>A			26522812	NM_002430	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																				0.597	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
CDC42EP1	11135	broad.mit.edu	37	22	37964409	37964429	+	In_Frame_Del	DEL	CAGCGCCTGCTGCAAACCCCT	CAGCGCCTGCTGCAAACCCCT	-	rs13056859|rs13055845|rs77417880|rs62235033|rs62235034|rs187761157|rs66468174|rs200195385	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	CAGCGCCTGCTGCAAACCCCT	CAGCGCCTGCTGCAAACCCCT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr22:37964409_37964429delCAGCGCCTGCTGCAAACCCCT	ENST00000249014.4	+	3	1178_1198	c.758_778delCAGCGCCTGCTGCAAACCCCT	c.(757-780)ccagcgcctgctgcaaacccctca>cca	p.APAANPS254del		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	254	8 X 7 AA tandem repeats of [PT]-[AT]-A- [ENT]-[PT]-[PTS]-[AG].				positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.N258_A264delNPSAPAA(3)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					GCAAACCCCCCAGCGCCTGCTGCAAACCCCTCAGCACCTGC	0.665																																					p.253_260del												.	.	3	Deletion - In frame(3)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(1)	c.758_778del	22						.			868,3338		98,672,1333						1.5	0.0		dbSNP_130	10	4310,3696		1298,1714,991	no	coding	CDC42EP1	NM_152243.2		1396,2386,2324	A1A1,A1R,RR		46.1654,20.6372,42.4009				5178,7034				36294375	SO:0001651	inframe_deletion	11135	exon3			M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.758_778delCAGCGCCTGCTGCAAACCCCT	22.37:g.37964409_37964429delCAGCGCCTGCTGCAAACCCCT	ENSP00000249014:p.Ala254_Ser260del		36294355	NM_152243	A8K825|Q96GN1	In_Frame_Del	DEL	ENST00000249014.4	37	CCDS13949.1																																																																																				0.665	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318993.1	NM_152243	
TGOLN2	10618	broad.mit.edu	37	2	85549872	85549873	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:85549872_85549873insA	ENST00000409232.3	-	4	1378_1379	c.1317_1318insT	c.(1315-1320)tttcccfs	p.P440fs	TGOLN2_ENST00000282120.2_Intron|TGOLN2_ENST00000377386.3_Intron|TGOLN2_ENST00000409015.1_Frame_Shift_Ins_p.F453fs|TGOLN2_ENST00000398263.2_Intron			O43493	TGON2_HUMAN	trans-golgi network protein 2	445						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)		p.?(1)									GGACTTAGGGGAAAAAAGATCT	0.381																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	2						.																																			85403384	SO:0001589	frameshift_variant	10618	.			AF027515	CCDS46351.1, CCDS56126.1, CCDS56127.1	2p11.2	2012-06-25			ENSG00000152291	ENSG00000152291			15450	protein-coding gene	gene with protein product	"""trans-Golgi network protein (46, 48, 51kD isoforms)"""	603062				9422759, 21994457	Standard	NM_001206840		Approved	TGN51, TGN46, TGN48, TGN38, TTGN2	uc021vjw.1	O43493	OTTHUMG00000153017	ENST00000409232.3:c.1318dupT	2.37:g.85549878_85549878dupA	ENSP00000386443:p.Pro440fs		85403383	.	B2R686|B8ZZ88|D6W5K3|F8WBK2|O15282|O43492|O43499|O43500|O43501|Q53G68|Q53GV2|Q6MZV1|Q6ZTM7|Q8N6T8|Q92760|Q96QL2	Frame_Shift_Ins	INS	ENST00000409232.3	37	CCDS56126.1																																																																																				0.381	TGOLN2-006	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329045.2	NM_006464	
EPB41L5	57669	broad.mit.edu	37	2	120776703	120776703	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:120776703C>T	ENST00000263713.5	+	2	257	c.43C>T	c.(43-45)Cgt>Tgt	p.R15C	EPB41L5_ENST00000443902.2_Missense_Mutation_p.R15C|EPB41L5_ENST00000452780.1_Missense_Mutation_p.R15C|EPB41L5_ENST00000443124.1_Missense_Mutation_p.R15C|EPB41L5_ENST00000331393.4_Missense_Mutation_p.R15C	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	15					actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)		p.R15C(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						TCGGTCTATGCGTAAACATGC	0.463																																					p.R15C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C43T	2						.						238.0	231.0	233.0					2																	120776703		2203	4300	6503	120493173	SO:0001583	missense	57669	exon2			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.43C>T	2.37:g.120776703C>T	ENSP00000263713:p.Arg15Cys		120493173	NM_001184937	Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	ENST00000263713.5	37	CCDS2130.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723497	0.89298	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000331393;ENST00000443124;ENST00000452780	D;D;D;D;D	0.89552	-2.45;-2.53;-2.34;-2.34;-2.47	5.12	5.12	0.69794	.	0.073514	0.53938	D	0.000053	D	0.91516	0.7321	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.991;1.0	D	0.92635	0.6119	10	0.72032	D	0.01	.	18.9431	0.92611	0.0:1.0:0.0:0.0	.	15;15;15	Q9HCM4-4;Q9HCM4-2;Q9HCM4	.;.;E41L5_HUMAN	C	15	ENSP00000263713:R15C;ENSP00000393856:R15C;ENSP00000329687:R15C;ENSP00000393722:R15C;ENSP00000390439:R15C	ENSP00000263713:R15C	R	+	1	0	EPB41L5	120493173	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.319000	0.79040	2.552000	0.86080	0.650000	0.86243	CGT		0.463	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909	
LRP1B	53353	broad.mit.edu	37	2	141200172	141200172	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:141200172C>A	ENST00000389484.3	-	66	11286	c.10315G>T	c.(10315-10317)Gac>Tac	p.D3439Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3439	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.D3439Y(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGGAAATAGTCTGGAGAACAG	0.398										TSP Lung(27;0.18)																											p.D3439Y	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G10315T	2						.						114.0	113.0	113.0					2																	141200172		2203	4300	6503	140916642	SO:0001583	missense	53353	exon66			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10315G>T	2.37:g.141200172C>A	ENSP00000374135:p.Asp3439Tyr		140916642	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088344	0.76756	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95949	-3.86	5.47	5.47	0.80525	.	0.000000	0.85682	U	0.000000	D	0.96719	0.8929	M	0.62154	1.92	0.53688	D	0.999976	D	0.89917	1.0	D	0.69479	0.964	D	0.96716	0.9529	10	0.72032	D	0.01	.	12.6513	0.56764	0.0:0.9245:0.0:0.0755	.	3439	Q9NZR2	LRP1B_HUMAN	Y	3439;3377	ENSP00000374135:D3439Y	ENSP00000374135:D3439Y	D	-	1	0	LRP1B	140916642	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.092000	0.57707	2.551000	0.86045	0.650000	0.86243	GAC		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ACVR1C	130399	broad.mit.edu	37	2	158395160	158395160	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:158395160C>T	ENST00000243349.8	-	8	1641	c.1281G>A	c.(1279-1281)tcG>tcA	p.S427S	ACVR1C_ENST00000409680.3_Silent_p.S377S|ACVR1C_ENST00000348328.5_Silent_p.S270S|ACVR1C_ENST00000335450.7_Silent_p.S347S	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC									p.S427S(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						TTTCCTCTATCGAGGGATCTG	0.363																																					p.S377S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1131A	2						.						107.0	107.0	107.0					2																	158395160		2203	4300	6503	158103406	SO:0001819	synonymous_variant	130399	exon8			BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1281G>A	2.37:g.158395160C>T			158103406	NM_001111031		Silent	SNP	ENST00000243349.8	37	CCDS2205.1																																																																																				0.363	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259	
SCN2A	6326	broad.mit.edu	37	2	166152416	166152416	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:166152416G>A	ENST00000375437.2	+	2	373	c.83G>A	c.(82-84)cGc>cAc	p.R28H	SCN2A_ENST00000357398.3_Missense_Mutation_p.R28H|SCN2A_ENST00000283256.6_Missense_Mutation_p.R28H|SCN2A_ENST00000375427.2_Missense_Mutation_p.R28H	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	28					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R28H(2)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATTGAACAACGCATTGCAGAA	0.488																																					p.R28H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G83A	2						.						93.0	83.0	87.0					2																	166152416		2203	4300	6503	165860662	SO:0001583	missense	6326	exon1			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.83G>A	2.37:g.166152416G>A	ENSP00000364586:p.Arg28His		165860662	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815998	0.90790	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D;D	0.98105	-4.55;-4.72;-4.72;-4.72;-4.72	5.55	5.55	0.83447	.	1.781180	0.02680	N	0.109544	D	0.99211	0.9726	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.93598	0.6927	10	0.87932	D	0	.	19.5116	0.95144	0.0:0.0:1.0:0.0	.	28;28	Q99250-2;Q99250	.;SCN2A_HUMAN	H	28	ENSP00000406454:R28H;ENSP00000364586:R28H;ENSP00000349973:R28H;ENSP00000283256:R28H;ENSP00000364576:R28H	ENSP00000283256:R28H	R	+	2	0	SCN2A	165860662	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.619000	0.88677	0.655000	0.94253	CGC		0.488	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
LRP2	4036	broad.mit.edu	37	2	170068566	170068566	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:170068566G>A	ENST00000263816.3	-	37	6477	c.6192C>T	c.(6190-6192)ttC>ttT	p.F2064F		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2064					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.F2064F(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAACAACAATGAAAGAGTTAT	0.468																																					p.F2064F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6192T	2						.						147.0	157.0	153.0					2																	170068566		2203	4300	6503	169776812	SO:0001819	synonymous_variant	4036	exon37				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.6192C>T	2.37:g.170068566G>A			169776812	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	37	CCDS2232.1																																																																																				0.468	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TTN	7273	broad.mit.edu	37	2	179429942	179429942	+	Missense_Mutation	SNP	G	G	A	rs148598047		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:179429942G>A	ENST00000591111.1	-	276	76218	c.75994C>T	c.(75994-75996)Cct>Tct	p.P25332S	TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P18033S|TTN_ENST00000342175.6_Missense_Mutation_p.P18100S|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P26973S|TTN_ENST00000460472.2_Missense_Mutation_p.P17908S|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P24405S			Q8WZ42	TITIN_HUMAN	titin	25332					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P18100S(1)|p.P18033S(1)|p.P24403S(1)|p.P17908S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGAGGTCCAGGCTTTTCTAAA	0.433																																					p.S17907S												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C53721T	2						.						86.0	83.0	84.0					2																	179429942		1876	4112	5988	179138188	SO:0001583	missense	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.75994C>T	2.37:g.179429942G>A	ENSP00000465570:p.Pro25332Ser		179138188	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	14.51	2.556936	0.45590	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	5.82	5.82	0.92795	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.96880	0.8981	H	0.99182	4.46	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.999;0.996	D	0.98109	1.0419	9	0.87932	D	0	.	20.0937	0.97831	0.0:0.0:1.0:0.0	.	17908;18033;18100;25332	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	24405;17908;18100;18033;17906	ENSP00000343764:P24405S;ENSP00000434586:P17908S;ENSP00000340554:P18100S;ENSP00000352154:P18033S	ENSP00000340554:P18100S	P	-	1	0	TTN	179138188	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.762000	0.94881	0.484000	0.47621	CCT		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
MYT1L	23040	broad.mit.edu	37	2	1926216	1926216	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:1926216G>A	ENST00000399161.2	-	10	2072	c.1325C>T	c.(1324-1326)aCg>aTg	p.T442M	MYT1L_ENST00000428368.2_Missense_Mutation_p.T442M	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	442					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T442M(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TGCTCTTTCCGTTTCCAAAGC	0.547																																					p.T442M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1325T	2						.						157.0	154.0	155.0					2																	1926216		2024	4166	6190	1905223	SO:0001583	missense	23040	exon10			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1325C>T	2.37:g.1926216G>A	ENSP00000382114:p.Thr442Met		1905223	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	G	13.54	2.268321	0.40095	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.48522	0.81;0.81	5.91	5.91	0.95273	.	0.102926	0.64402	D	0.000002	T	0.50292	0.1607	N	0.24115	0.695	0.44937	D	0.997955	D;D	0.69078	0.996;0.997	P;P	0.56700	0.732;0.804	T	0.52873	-0.8517	10	0.87932	D	0	-36.2077	15.7394	0.77876	0.0:0.1358:0.8642:0.0	.	442;442	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	M	442;390;442	ENSP00000382114:T442M;ENSP00000396103:T442M	ENSP00000295067:T390M	T	-	2	0	MYT1L	1905223	1.000000	0.71417	0.382000	0.26119	0.004000	0.04260	6.434000	0.73408	2.801000	0.96364	0.655000	0.94253	ACG		0.547	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
TTN	7273	broad.mit.edu	37	2	179581904	179581904	+	Silent	SNP	G	G	T	rs372320172		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:179581904G>T	ENST00000591111.1	-	86	24830	c.24606C>A	c.(24604-24606)ggC>ggA	p.G8202G	TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.G8519G|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.G7275G			Q8WZ42	TITIN_HUMAN	titin	12386	Ig-like 64.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G7275G(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATCGCCTTTGCCTACTTTGA	0.478																																					p.G7275G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C21825A	2						.						65.0	66.0	66.0					2																	179581904		1920	4131	6051	179290149	SO:0001819	synonymous_variant	7273	exon85			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.24606C>A	2.37:g.179581904G>T			179290149	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.478	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NRXN1	9378	broad.mit.edu	37	2	50765425	50765425	+	Silent	SNP	G	G	A	rs200456688	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:50765425G>A	ENST00000406316.2	-	10	3585	c.2109C>T	c.(2107-2109)tcC>tcT	p.S703S	NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000406859.3_Silent_p.S703S|NRXN1_ENST00000402717.3_Silent_p.S695S|NRXN1_ENST00000405472.3_Silent_p.S695S|NRXN1_ENST00000404971.1_Silent_p.S743S|NRXN1_ENST00000401669.2_Silent_p.S703S	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	703	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.S744S(1)|p.S703S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AGCCTGTTCCGGAACAATCAC	0.463													G|||	2	0.000399361	0.0	0.0014	5008	,	,		19036	0.0		0.001	False		,,,				2504	0.0				p.S743S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2229T	2						.						149.0	148.0	148.0					2																	50765425		2012	4183	6195	50618929	SO:0001819	synonymous_variant	9378	exon11			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2109C>T	2.37:g.50765425G>A			50618929	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1																																																																																				0.463	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
VAMP8	8673	broad.mit.edu	37	2	85806196	85806196	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:85806196T>A	ENST00000263864.5	+	2	224	c.68T>A	c.(67-69)gTt>gAt	p.V23D	VAMP8_ENST00000432071.1_5'UTR|VAMP8_ENST00000409760.1_Missense_Mutation_p.V23D	NM_003761.4	NP_003752.2	Q9BV40	VAMP8_HUMAN	vesicle-associated membrane protein 8	23	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				autophagic vacuole fusion (GO:0000046)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of endocytosis (GO:0030100)|SNARE complex assembly (GO:0035493)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|secretory granule membrane (GO:0030667)|SNARE complex (GO:0031201)		p.V23D(1)		breast(1)|endometrium(2)|large_intestine(1)|stomach(2)	6						GTGGAGGGAGTTAAGAATATT	0.527																																					p.V23D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T68A	2						.						80.0	70.0	73.0					2																	85806196		2203	4300	6503	85659707	SO:0001583	missense	8673	exon2			AF053233	CCDS1979.1	2p12-p11.2	2013-02-13	2012-10-17		ENSG00000118640	ENSG00000118640		"""Vesicle-associated membrane proteins"""	12647	protein-coding gene	gene with protein product	"""endobrevin"""	603177				9878266, 9614193	Standard	NM_003761		Approved	EDB	uc002spt.4	Q9BV40	OTTHUMG00000130180	ENST00000263864.5:c.68T>A	2.37:g.85806196T>A	ENSP00000263864:p.Val23Asp		85659707	NM_003761	O60625|Q53SP9|Q6IB09	Missense_Mutation	SNP	ENST00000263864.5	37	CCDS1979.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.003916	0.93287	.	.	ENSG00000118640	ENST00000263864;ENST00000409760	T;T	0.60299	0.2;0.2	5.73	5.73	0.89815	Synaptobrevin (3);	0.000000	0.85682	D	0.000000	D	0.82664	0.5086	H	0.96269	3.795	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87562	0.2472	10	0.87932	D	0	-6.9046	12.4092	0.55457	0.0:0.0:0.0:1.0	.	23	Q9BV40	VAMP8_HUMAN	D	23	ENSP00000263864:V23D;ENSP00000387094:V23D	ENSP00000263864:V23D	V	+	2	0	VAMP8	85659707	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.925000	0.75829	2.186000	0.69663	0.533000	0.62120	GTT		0.527	VAMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252498.3	NM_003761	
SPEG	10290	broad.mit.edu	37	2	220337744	220337744	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr2:220337744G>A	ENST00000312358.7	+	16	4205	c.4073G>A	c.(4072-4074)cGg>cAg	p.R1358Q	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1358	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R1358Q(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CACATCTTCCGGGTCCTCAGC	0.672																																					p.R1358Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4073A	2						.						47.0	54.0	52.0					2																	220337744		2102	4230	6332	220045988	SO:0001583	missense	10290	exon16			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.4073G>A	2.37:g.220337744G>A	ENSP00000311684:p.Arg1358Gln		220045988	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461297	0.84317	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.58797	0.31	5.11	5.11	0.69529	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.36101	N	0.002781	T	0.78941	0.4363	M	0.87617	2.895	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.81784	-0.0774	10	0.51188	T	0.08	.	16.3445	0.83118	0.0:0.0:1.0:0.0	.	1358	Q15772	SPEG_HUMAN	Q	1358	ENSP00000311684:R1358Q	ENSP00000265327:R1358Q	R	+	2	0	SPEG	220045988	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.320000	0.96346	2.375000	0.81037	0.561000	0.74099	CGG		0.672	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
CCDC80	151887	broad.mit.edu	37	3	112357602	112357602	+	Missense_Mutation	SNP	G	G	A	rs139212823	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:112357602G>A	ENST00000206423.3	-	2	2104	c.1151C>T	c.(1150-1152)aCg>aTg	p.T384M	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.T384M	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	384	Thr-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)	p.T384M(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						GGGCCTCTGCGTGGTGGGAAA	0.607													G|||	3	0.000599042	0.0	0.0	5008	,	,		17198	0.003		0.0	False		,,,				2504	0.0				p.T384M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1151T	3						.						70.0	65.0	67.0					3																	112357602		2203	4300	6503	113840292	SO:0001583	missense	151887	exon2			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1151C>T	3.37:g.112357602G>A	ENSP00000206423:p.Thr384Met		113840292	NM_199511	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	CCDS2968.1	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	19.14	3.769596	0.69992	.	.	ENSG00000091986	ENST00000206423;ENST00000439685	T;T	0.51574	0.7;0.7	4.88	4.01	0.46588	.	0.051080	0.85682	D	0.000000	T	0.43590	0.1254	L	0.27053	0.805	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	P;P;P	0.62014	0.897;0.791;0.791	T	0.52403	-0.8580	10	0.62326	D	0.03	-10.5894	13.0207	0.58784	0.0777:0.0:0.9223:0.0	.	395;384;384	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	M	384	ENSP00000206423:T384M;ENSP00000411814:T384M	ENSP00000206423:T384M	T	-	2	0	CCDC80	113840292	1.000000	0.71417	0.821000	0.32701	0.789000	0.44602	3.532000	0.53553	1.289000	0.44618	0.555000	0.69702	ACG		0.607	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
FSTL1	11167	broad.mit.edu	37	3	120122109	120122109	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:120122109G>T	ENST00000295633.3	-	8	1030	c.674C>A	c.(673-675)tCt>tAt	p.S225Y	FSTL1_ENST00000424703.2_Missense_Mutation_p.S190Y	NM_007085.4	NP_009016.1	Q12841	FSTL1_HUMAN	follistatin-like 1	225	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				BMP signaling pathway (GO:0030509)|response to starvation (GO:0042594)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.S225Y(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(1)	20				GBM - Glioblastoma multiforme(114;0.189)		AGGGTTGAAAGATGGGTTGAG	0.443																																					p.S225Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C674A	3						.						103.0	104.0	103.0					3																	120122109		2203	4300	6503	121604799	SO:0001583	missense	11167	exon8			U06863	CCDS2998.1	3q13.33	2013-01-10			ENSG00000163430	ENSG00000163430		"""EF-hand domain containing"""	3972	protein-coding gene	gene with protein product		605547				7957230, 9786430	Standard	NM_007085		Approved	FRP, FSL1	uc003eds.3	Q12841	OTTHUMG00000159440	ENST00000295633.3:c.674C>A	3.37:g.120122109G>T	ENSP00000295633:p.Ser225Tyr		121604799	NM_007085	A8K523|B4DTT5|D3DN90|Q549Z0	Missense_Mutation	SNP	ENST00000295633.3	37	CCDS2998.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.824499	0.32237	.	.	ENSG00000163430	ENST00000295633;ENST00000539471;ENST00000424703	T;T	0.25912	2.42;1.77	6.16	5.27	0.74061	.	0.254649	0.46145	N	0.000318	T	0.18718	0.0449	N	0.19112	0.55	0.34899	D	0.746287	B;B	0.19583	0.037;0.017	B;B	0.14578	0.011;0.005	T	0.11867	-1.0570	10	0.49607	T	0.09	-7.9674	14.1802	0.65568	0.0:0.0:0.8504:0.1496	.	190;225	B4DTT5;Q12841	.;FSTL1_HUMAN	Y	225;168;190	ENSP00000295633:S225Y;ENSP00000394355:S190Y	ENSP00000295633:S225Y	S	-	2	0	FSTL1	121604799	0.995000	0.38212	0.961000	0.40146	0.999000	0.98932	3.203000	0.51075	1.578000	0.49821	0.650000	0.86243	TCT		0.443	FSTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355399.1	NM_007085	
MYLK	4638	broad.mit.edu	37	3	123411599	123411599	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:123411599C>A	ENST00000475616.1	-	16	3547	c.3548G>T	c.(3547-3549)tGc>tTc	p.C1183F	MYLK-AS2_ENST00000515464.1_RNA|MYLK-AS2_ENST00000510827.1_RNA|MYLK_ENST00000346322.5_Missense_Mutation_p.C1114F|MYLK_ENST00000354792.5_5'Flank|MYLK_ENST00000360772.3_Missense_Mutation_p.C1183F|MYLK_ENST00000359169.1_Missense_Mutation_p.C1183F|MYLK_ENST00000510775.1_5'UTR|MYLK_ENST00000360304.3_Missense_Mutation_p.C1183F			Q15746	MYLK_HUMAN	myosin light chain kinase	1183	Actin-binding (calcium/calmodulin- insensitive). {ECO:0000250}.|Ig-like C2-type 7.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.C1183F(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GGTGACTTGGCAGGAGCACTC	0.597																																					p.C1183F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3548T	3						.						96.0	71.0	79.0					3																	123411599		2203	4300	6503	124894289	SO:0001583	missense	4638	exon19			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.3548G>T	3.37:g.123411599C>A	ENSP00000418335:p.Cys1183Phe		124894289	NM_053025	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522564	0.85600	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	5.33	5.33	0.75918	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74168	0.3681	L	0.48362	1.52	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;0.999;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;0.997;1.0;0.999;1.0	T	0.76405	-0.2971	9	0.87932	D	0	.	16.1596	0.81693	0.0:1.0:0.0:0.0	.	1183;261;1114;1183;1114;1183	Q15746-6;Q15746-7;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	F	1183;1183;1183;1114;1183	ENSP00000354004:C1183F;ENSP00000353452:C1183F;ENSP00000352088:C1183F;ENSP00000320622:C1114F;ENSP00000418335:C1183F	ENSP00000320622:C1114F	C	-	2	0	MYLK	124894289	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.637000	0.74304	2.514000	0.84764	0.563000	0.77884	TGC		0.597	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
KALRN	8997	broad.mit.edu	37	3	124356081	124356081	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:124356081G>C	ENST00000291478.5	+	4	664	c.501G>C	c.(499-501)caG>caC	p.Q167H	KALRN_ENST00000393496.1_Intron|KALRN_ENST00000360013.3_Missense_Mutation_p.Q1864H|KALRN_ENST00000428018.2_Intron|KALRN_ENST00000459915.1_5'UTR	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1863	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q167H(1)|p.Q1864H(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CAGCCCGGCAGGCTTCCACTG	0.478																																					p.Q1864H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5592C	3						.						123.0	125.0	124.0					3																	124356081		2203	4300	6503	125838771	SO:0001583	missense	8997	exon37			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.501G>C	3.37:g.124356081G>C	ENSP00000291478:p.Gln167His		125838771	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000291478.5	37	CCDS3028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.31|15.31	2.796703|2.796703	0.50208|0.50208	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000360013;ENST00000291478|ENST00000354186	T;T|.	0.61392|.	0.11;0.11|.	5.09|5.09	4.2|4.2	0.49525|0.49525	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.64438|0.64438	0.2598|0.2598	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	D;D|.	0.67145|.	0.996;0.978|.	P;P|.	0.59546|.	0.859;0.598|.	T|T	0.62258|0.62258	-0.6892|-0.6892	10|5	0.46703|.	T|.	0.11|.	.|.	11.414|11.414	0.49941|0.49941	0.1421:0.0:0.8578:0.0|0.1421:0.0:0.8578:0.0	.|.	167;1863|.	C9JQ37;O60229|.	.;KALRN_HUMAN|.	H|T	1864;167|1833	ENSP00000353109:Q1864H;ENSP00000291478:Q167H|.	ENSP00000291478:Q167H|.	Q|R	+|+	3|2	2|0	KALRN|KALRN	125838771|125838771	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.548000|3.548000	0.53670|0.53670	2.653000|2.653000	0.90120|0.90120	0.655000|0.655000	0.94253|0.94253	CAG|AGG		0.478	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
KALRN	8997	broad.mit.edu	37	3	124418787	124418787	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:124418787G>A	ENST00000291478.5	+	23	2975	c.2812G>A	c.(2812-2814)Ggg>Agg	p.G938R	AC080008.1_ENST00000584173.1_RNA|KALRN_ENST00000360013.3_Missense_Mutation_p.G2635R|KALRN_ENST00000428018.2_Missense_Mutation_p.G906R	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2634					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G938R(1)|p.G2635R(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CCTTAGTCCCGGGTGTCCTTA	0.537																																					p.G2635R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7903A	3						.						174.0	155.0	162.0					3																	124418787		2203	4300	6503	125901477	SO:0001583	missense	8997	exon56			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.2812G>A	3.37:g.124418787G>A	ENSP00000291478:p.Gly938Arg		125901477	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000291478.5	37	CCDS3028.1	.	.	.	.	.	.	.	.	.	.	G	34	5.412774	0.96072	.	.	ENSG00000160145	ENST00000360013;ENST00000291478;ENST00000428018	T;T;T	0.62639	0.01;0.01;0.01	6.02	6.02	0.97574	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.81721	0.4882	M	0.80508	2.5	0.50813	D	0.999892	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.80991	-0.1135	10	0.52906	T	0.07	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	938;2634	C9JQ37;O60229	.;KALRN_HUMAN	R	2635;938;906	ENSP00000353109:G2635R;ENSP00000291478:G938R;ENSP00000402419:G906R	ENSP00000291478:G938R	G	+	1	0	KALRN	125901477	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	9.411000	0.97342	2.865000	0.98341	0.655000	0.94253	GGG		0.537	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
ZXDC	79364	broad.mit.edu	37	3	126160702	126160702	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:126160702C>T	ENST00000389709.3	-	8	2353	c.2300G>A	c.(2299-2301)gGg>gAg	p.G767E		NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	767					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G767E(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		CACGAGGCTCCCACACAACCA	0.567																																					p.G767E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2300A	3						.						57.0	60.0	59.0					3																	126160702		1980	4178	6158	127643392	SO:0001583	missense	79364	exon8			AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.2300G>A	3.37:g.126160702C>T	ENSP00000374359:p.Gly767Glu		127643392	NM_025112	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Missense_Mutation	SNP	ENST00000389709.3	37	CCDS43145.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.797768	0.31777	.	.	ENSG00000070476	ENST00000389709	T	0.09163	3.01	5.08	4.2	0.49525	.	0.186271	0.47455	D	0.000233	T	0.11965	0.0291	L	0.40543	1.245	0.80722	D	1	D	0.56968	0.978	P	0.47134	0.539	T	0.05007	-1.0912	10	0.40728	T	0.16	-12.1028	9.3609	0.38195	0.0:0.9004:0.0:0.0996	.	767	Q2QGD7	ZXDC_HUMAN	E	767	ENSP00000374359:G767E	ENSP00000374359:G767E	G	-	2	0	ZXDC	127643392	0.612000	0.27000	0.161000	0.22692	0.052000	0.14988	1.870000	0.39529	1.130000	0.42092	0.591000	0.81541	GGG		0.567	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370327.2	NM_025112	
IQCJ	654502	broad.mit.edu	37	3	158983173	158983173	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:158983173G>A	ENST00000451172.1	+	5	566	c.461G>A	c.(460-462)gGt>gAt	p.G154D	IQCJ-SCHIP1_ENST00000467442.1_Intron|IQCJ-SCHIP1_ENST00000485419.1_Intron|IQCJ-SCHIP1_ENST00000476809.1_Intron|IQCJ_ENST00000482126.1_Missense_Mutation_p.G127D	NM_001042705.2	NP_001036170.1	Q1A5X6	IQCJ_HUMAN	IQ motif containing J	154								p.G154D(1)		cervix(1)|endometrium(2)|large_intestine(2)|lung(10)	15			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			GAAAGACTTGGTTTTCTCACC	0.488																																					p.G154D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G461A	3						.						93.0	89.0	90.0					3																	158983173		1889	4130	6019	160465867	SO:0001583	missense	654502	exon5			DQ309553, DQ309554	CCDS46946.1, CCDS46947.1, CCDS56290.1	3q25.32	2011-03-24			ENSG00000214216	ENSG00000214216			32406	protein-coding gene	gene with protein product		611622				17045569	Standard	NM_001042705		Approved			Q1A5X6	OTTHUMG00000166440	ENST00000451172.1:c.461G>A	3.37:g.158983173G>A	ENSP00000402153:p.Gly154Asp		160465867	NM_001042705	B7ZMM2|B9EH97|Q1A5X5	Missense_Mutation	SNP	ENST00000451172.1	37	CCDS46946.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.738678	0.30774	.	.	ENSG00000214216	ENST00000451172;ENST00000482126	.	.	.	3.53	-0.887	0.10587	.	.	.	.	.	T	0.19366	0.0465	N	0.24115	0.695	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.12156	0.007;0.007	T	0.28839	-1.0031	8	0.87932	D	0	.	0.6457	0.00818	0.2563:0.1818:0.376:0.1858	.	127;154	B7ZMM2;Q1A5X6	.;IQCJ_HUMAN	D	154;127	.	ENSP00000402153:G154D	G	+	2	0	IQCJ	160465867	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.227000	0.09126	-0.193000	0.10415	0.655000	0.94253	GGT		0.488	IQCJ-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352395.1	NM_001042705.1	
SMC4	10051	broad.mit.edu	37	3	160129837	160129837	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:160129837A>G	ENST00000357388.3	+	6	1268	c.817A>G	c.(817-819)Aga>Gga	p.R273G	SMC4_ENST00000469762.1_Missense_Mutation_p.R248G|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_Missense_Mutation_p.R273G|SMC4_ENST00000470240.1_3'UTR|SMC4_ENST00000344722.5_Missense_Mutation_p.R273G|SMC4_ENST00000360111.2_Missense_Mutation_p.R273G	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	273					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.R273G(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CTTGTGTCGGAGAGTTGAAAT	0.343																																					p.R273G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A817G	3						.						76.0	71.0	73.0					3																	160129837		2203	4300	6503	161612531	SO:0001583	missense	10051	exon6			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.817A>G	3.37:g.160129837A>G	ENSP00000349961:p.Arg273Gly		161612531	NM_001002800	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.022594	0.75275	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000392788;ENST00000469762;ENST00000489573;ENST00000462787;ENST00000344722	T;T;T;T;T;T	0.75260	-0.91;-0.92;-0.91;3.24;-0.92;-0.91	5.28	4.09	0.47781	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.86573	0.5965	M	0.87180	2.865	0.80722	D	1	P;D;D	0.71674	0.928;0.997;0.998	P;D;D	0.80764	0.491;0.994;0.959	D	0.87075	0.2162	10	0.54805	T	0.06	-27.8409	12.4083	0.55453	0.8597:0.1403:0.0:0.0	.	273;248;273	Q9NTJ3-2;E9PD53;Q9NTJ3	.;.;SMC4_HUMAN	G	273;273;273;248;273;273;273	ENSP00000349961:R273G;ENSP00000353225:R273G;ENSP00000417964:R248G;ENSP00000420121:R273G;ENSP00000420734:R273G;ENSP00000341382:R273G	ENSP00000341382:R273G	R	+	1	2	SMC4	161612531	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	3.201000	0.51059	0.811000	0.34303	0.477000	0.44152	AGA		0.343	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
OTOL1	131149	broad.mit.edu	37	3	161214888	161214888	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:161214888T>A	ENST00000327928.4	+	1	293	c.293T>A	c.(292-294)tTt>tAt	p.F98Y		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	98						collagen trimer (GO:0005581)|extracellular region (GO:0005576)		p.F98Y(1)		central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						GCTGATTTCTTTTTGAATTGT	0.448																																					p.F98Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T293A	3						.						145.0	140.0	141.0					3																	161214888		1857	4103	5960	162697582	SO:0001583	missense	131149	exon1				CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.293T>A	3.37:g.161214888T>A	ENSP00000330808:p.Phe98Tyr		162697582	NM_001080440		Missense_Mutation	SNP	ENST00000327928.4	37	CCDS46948.1	.	.	.	.	.	.	.	.	.	.	T	10.44	1.349491	0.24426	.	.	ENSG00000182447	ENST00000327928	D	0.90676	-2.71	5.66	5.66	0.87406	.	0.420468	0.28273	N	0.015947	D	0.83078	0.5176	L	0.32530	0.975	0.24575	N	0.9939	B	0.29988	0.264	B	0.17979	0.02	T	0.68569	-0.5374	10	0.11485	T	0.65	.	13.8563	0.63529	0.0:0.0:0.0:1.0	.	98	A6NHN0	OTOL1_HUMAN	Y	98	ENSP00000330808:F98Y	ENSP00000330808:F98Y	F	+	2	0	OTOL1	162697582	1.000000	0.71417	0.141000	0.22245	0.107000	0.19398	2.340000	0.43974	2.160000	0.67779	0.528000	0.53228	TTT		0.448	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440	
KLHL6	89857	broad.mit.edu	37	3	183209864	183209864	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:183209864T>G	ENST00000341319.3	-	7	1752	c.1717A>C	c.(1717-1719)Atc>Ctc	p.I573L		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	573					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)			p.I573L(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			ACCGTGGCGATAACCTCGTTC	0.672																																					p.I573L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1717C	3						.						99.0	95.0	97.0					3																	183209864		2203	4300	6503	184692558	SO:0001583	missense	89857	exon7			AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1717A>C	3.37:g.183209864T>G	ENSP00000341342:p.Ile573Leu		184692558	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	T	21.7	4.190443	0.78789	.	.	ENSG00000172578	ENST00000341319	T	0.73152	-0.72	5.66	5.66	0.87406	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.48660	0.1512	N	0.02721	-0.515	0.58432	D	0.999994	B	0.20780	0.048	B	0.33960	0.173	T	0.50750	-0.8791	10	0.02654	T	1	.	15.8748	0.79154	0.0:0.0:0.0:1.0	.	573	Q8WZ60	KLHL6_HUMAN	L	573	ENSP00000341342:I573L	ENSP00000341342:I573L	I	-	1	0	KLHL6	184692558	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.841000	0.86834	2.158000	0.67659	0.402000	0.26972	ATC		0.672	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
MASP1	5648	broad.mit.edu	37	3	186953789	186953789	+	Intron	SNP	C	C	T	rs144963945	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:186953789C>T	ENST00000337774.5	-	10	1693				MASP1_ENST00000296280.6_Missense_Mutation_p.V624M|MASP1_ENST00000495249.1_5'UTR|MASP1_ENST00000392472.2_Missense_Mutation_p.V511M	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)						complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.V624M(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TGAGGCACCACGGGTAACTTG	0.557																																					p.V624M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1870A	3						.	C	,MET/VAL	2,4404	4.2+/-10.8	0,2,2201	110.0	92.0	98.0		,1870	4.4	0.8	3	dbSNP_134	98	0,8600		0,0,4300	no	intron,missense	MASP1	NM_001879.5,NM_139125.3	,21	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,probably-damaging	,624/729	186953789	2,13004	2203	4300	6503	188436483	SO:0001627	intron_variant	5648	exon11			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1303+5479G>A	3.37:g.186953789C>T			188436483	NM_139125	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	37	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.283933	0.59867	4.54E-4	0.0	ENSG00000127241	ENST00000296280;ENST00000392472	D;D	0.90563	-2.69;-2.69	6.17	4.38	0.52667	.	0.267876	0.37178	N	0.002216	D	0.93664	0.7976	M	0.71920	2.185	0.80722	D	1	D;D	0.76494	0.995;0.999	P;D	0.66351	0.9;0.943	D	0.92917	0.6352	10	0.52906	T	0.07	.	11.448	0.50136	0.0:0.8062:0.1266:0.0672	.	511;624	P48740-4;P48740-2	.;.	M	624;511	ENSP00000296280:V624M;ENSP00000376264:V511M	ENSP00000296280:V624M	V	-	1	0	MASP1	188436483	1.000000	0.71417	0.817000	0.32601	0.600000	0.36913	4.904000	0.63279	0.924000	0.37069	0.655000	0.94253	GTG		0.557	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
ITPR1	3708	broad.mit.edu	37	3	4744563	4744563	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:4744563A>G	ENST00000443694.2	+	33	4541	c.4541A>G	c.(4540-4542)tAc>tGc	p.Y1514C	ITPR1_ENST00000423119.2_Missense_Mutation_p.Y1520C|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.Y1529C|ITPR1_ENST00000302640.8_Missense_Mutation_p.Y1514C|ITPR1_ENST00000357086.4_Missense_Mutation_p.Y1520C|ITPR1_ENST00000456211.2_Missense_Mutation_p.Y1505C			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1529					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.Y1505C(1)		NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TTCAGGGTTTACCACTGCAAC	0.468																																					p.Y1520C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4559G	3						.						76.0	79.0	78.0					3																	4744563		1956	4157	6113	4719563	SO:0001583	missense	3708	exon36			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.4541A>G	3.37:g.4744563A>G	ENSP00000401671:p.Tyr1514Cys		4719563	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	A	19.11	3.764654	0.69878	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.70937	0.3281	L	0.43152	1.355	0.80722	D	1	D;D	0.71674	0.991;0.998	P;D	0.67382	0.784;0.951	T	0.70281	-0.4915	10	0.38643	T	0.18	.	15.0556	0.71910	1.0:0.0:0.0:0.0	.	1529;1520	Q14643;G5E9P1	ITPR1_HUMAN;.	C	1529;1514;1529;1520;1520;1505;1514	ENSP00000306253:Y1514C;ENSP00000346595:Y1529C;ENSP00000405934:Y1520C;ENSP00000349597:Y1520C;ENSP00000397885:Y1505C;ENSP00000401671:Y1514C	ENSP00000306253:Y1514C	Y	+	2	0	ITPR1	4719563	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	7.292000	0.78731	1.946000	0.56461	0.460000	0.39030	TAC		0.468	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
CAV3	859	broad.mit.edu	37	3	8787331	8787331	+	Silent	SNP	G	G	A	rs148846096	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:8787331G>A	ENST00000343849.2	+	2	311	c.234G>A	c.(232-234)acG>acA	p.T78T	CAV3_ENST00000472766.1_Intron|SSUH2_ENST00000478513.1_5'Flank|CAV3_ENST00000397368.2_Silent_p.T78T	NM_001234.4|NM_033337.2	NP_001225.1|NP_203123.1	P56539	CAV3_HUMAN	caveolin 3	78	Required for interaction with DAG1.		T -> M (in LQT9 and SIDS; dbSNP:rs72546668). {ECO:0000269|PubMed:17060380, ECO:0000269|PubMed:17275750}.		actin filament organization (GO:0007015)|cardiac muscle cell development (GO:0055013)|caveola assembly (GO:0070836)|cell differentiation (GO:0030154)|cell growth (GO:0016049)|cholesterol homeostasis (GO:0042632)|cytoplasmic microtubule organization (GO:0031122)|endocytosis (GO:0006897)|establishment of protein localization to plasma membrane (GO:0090002)|glucose homeostasis (GO:0042593)|heart trabecula formation (GO:0060347)|membrane raft organization (GO:0031579)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of cell size (GO:0045792)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sarcomere organization (GO:0060299)|nucleus localization (GO:0051647)|plasma membrane organization (GO:0007009)|plasma membrane repair (GO:0001778)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein localization (GO:0008104)|protein localization to plasma membrane (GO:0072659)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of calcium ion import (GO:0090279)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart contraction (GO:0008016)|regulation of heart rate (GO:0002027)|regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900825)|regulation of membrane potential (GO:0042391)|regulation of nerve growth factor receptor activity (GO:0051394)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase B signaling (GO:0051896)|regulation of signal transduction by receptor internalization (GO:0038009)|regulation of skeletal muscle contraction (GO:0014819)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|T-tubule organization (GO:0033292)|triglyceride metabolic process (GO:0006641)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|dystrophin-associated glycoprotein complex (GO:0016010)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|connexin binding (GO:0071253)|ion channel binding (GO:0044325)|potassium channel inhibitor activity (GO:0019870)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein complex scaffold (GO:0032947)|sodium channel regulator activity (GO:0017080)	p.T78T(1)		breast(1)|kidney(2)|large_intestine(4)|lung(3)|prostate(1)	11						TGTTGTCCACGCTGCTGGGCG	0.597													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17462	0.0		0.0	False		,,,				2504	0.0				p.T78T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G234A	3						.	G	,	3,4403	6.2+/-15.9	0,3,2200	104.0	79.0	88.0		234,234	-3.6	1.0	3	dbSNP_134	88	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CAV3	NM_001234.3,NM_033337.2	,	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	,	78/152,78/152	8787331	3,13003	2203	4300	6503	8762331	SO:0001819	synonymous_variant	859	exon2			AF043101	CCDS2569.1	3p25	2014-09-17			ENSG00000182533	ENSG00000182533			1529	protein-coding gene	gene with protein product	"""M-caveolin"""	601253				9536092, 9537420	Standard	NM_033337		Approved	VIP-21, LGMD1C, VIP21, LQT9	uc003brb.3	P56539	OTTHUMG00000090519	ENST00000343849.2:c.234G>A	3.37:g.8787331G>A			8762331	NM_001234	A8K777|Q3T1A4	Silent	SNP	ENST00000343849.2	37	CCDS2569.1																																																																																				0.597	CAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207008.2	NM_033337	
SCN5A	6331	broad.mit.edu	37	3	38616870	38616870	+	Missense_Mutation	SNP	C	C	T	rs199473596		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:38616870C>T	ENST00000333535.4	-	20	3733	c.3584G>A	c.(3583-3585)cGc>cAc	p.R1195H	SCN5A_ENST00000443581.1_Missense_Mutation_p.R1194H|SCN5A_ENST00000425664.1_Missense_Mutation_p.R1195H|SCN5A_ENST00000450102.2_Missense_Mutation_p.R1141H|SCN5A_ENST00000413689.1_Missense_Mutation_p.R1195H|SCN5A_ENST00000423572.2_Missense_Mutation_p.R1194H|SCN5A_ENST00000455624.2_Missense_Mutation_p.R1194H|SCN5A_ENST00000449557.2_Missense_Mutation_p.R1141H|SCN5A_ENST00000414099.2_Missense_Mutation_p.R1195H|SCN5A_ENST00000451551.2_Missense_Mutation_p.R1141H			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1195					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.R1195H(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GCAGGTCTTGCGCAACCGCCA	0.612																																					p.R1195H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3584A	3						.						36.0	39.0	38.0					3																	38616870		2203	4300	6503	38591874	SO:0001583	missense	6331	exon20			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.3584G>A	3.37:g.38616870C>T	ENSP00000328968:p.Arg1195His		38591874	NM_001099405	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.004889	0.93287	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.98105	-4.72;-4.72;-4.72;-4.72;-4.72;-4.72;-4.72;-4.72;-4.72;-4.72	4.31	4.31	0.51392	Sodium ion transport-associated (1);	0.105565	0.64402	D	0.000008	D	0.98934	0.9638	M	0.91717	3.235	0.50632	D	0.999885	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.995;0.918;0.979;0.988;0.999;0.979;0.95	D	0.99505	1.0954	10	0.87932	D	0	.	16.9506	0.86244	0.0:1.0:0.0:0.0	.	1141;1194;1195;1195;1195;1194;1195	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	H	1195;1194;1195;1141;1194;1195;1195;1194;1141;1141	ENSP00000398962:R1195H;ENSP00000398266:R1194H;ENSP00000410257:R1195H;ENSP00000388797:R1141H;ENSP00000397915:R1194H;ENSP00000416634:R1195H;ENSP00000328968:R1195H;ENSP00000399524:R1194H;ENSP00000403355:R1141H;ENSP00000413996:R1141H	ENSP00000328968:R1195H	R	-	2	0	SCN5A	38591874	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.413000	0.81919	0.655000	0.94253	CGC		0.612	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
SCN5A	6331	broad.mit.edu	37	3	38618163	38618163	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:38618163C>A	ENST00000333535.4	-	19	3649	c.3500G>T	c.(3499-3501)tGc>tTc	p.C1167F	SCN5A_ENST00000443581.1_Missense_Mutation_p.C1166F|SCN5A_ENST00000425664.1_Missense_Mutation_p.C1167F|SCN5A_ENST00000450102.2_Missense_Mutation_p.C1113F|SCN5A_ENST00000413689.1_Missense_Mutation_p.C1167F|SCN5A_ENST00000423572.2_Missense_Mutation_p.C1166F|SCN5A_ENST00000455624.2_Missense_Mutation_p.C1166F|SCN5A_ENST00000449557.2_Missense_Mutation_p.C1113F|SCN5A_ENST00000414099.2_Missense_Mutation_p.C1167F|SCN5A_ENST00000451551.2_Missense_Mutation_p.C1113F			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1167					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.C1167F(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TTCAGTGAAGCAGTCCTCTGG	0.632																																					p.C1167F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3500T	3						.						46.0	53.0	50.0					3																	38618163		2128	4241	6369	38593167	SO:0001583	missense	6331	exon19			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.3500G>T	3.37:g.38618163C>A	ENSP00000328968:p.Cys1167Phe		38593167	NM_001099405	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781109	0.70222	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81;-3.81;-3.81;-3.81;-3.81;-3.81;-3.81	4.47	4.47	0.54385	Sodium ion transport-associated (1);	0.044767	0.85682	D	0.000000	D	0.98009	0.9344	M	0.91612	3.225	0.58432	D	0.999997	D;P;P;P;D;P;P	0.89917	1.0;0.938;0.9;0.919;0.992;0.912;0.81	D;P;P;P;D;P;B	0.79108	0.992;0.637;0.813;0.703;0.937;0.845;0.312	D	0.98737	1.0715	10	0.87932	D	0	.	15.0494	0.71854	0.0:1.0:0.0:0.0	.	1113;1166;1167;1167;1167;1166;1167	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	F	1167;1166;1167;1113;1166;1167;1167;1166;1113;1113	ENSP00000398962:C1167F;ENSP00000398266:C1166F;ENSP00000410257:C1167F;ENSP00000388797:C1113F;ENSP00000397915:C1166F;ENSP00000416634:C1167F;ENSP00000328968:C1167F;ENSP00000399524:C1166F;ENSP00000403355:C1113F;ENSP00000413996:C1113F	ENSP00000328968:C1167F	C	-	2	0	SCN5A	38593167	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	7.590000	0.82653	2.496000	0.84212	0.655000	0.94253	TGC		0.632	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
NBEAL2	23218	broad.mit.edu	37	3	47030358	47030358	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:47030358C>T	ENST00000450053.3	+	3	346	c.167C>T	c.(166-168)cCg>cTg	p.P56L	NBEAL2_ENST00000383740.2_5'UTR|NBEAL2_ENST00000292309.5_Missense_Mutation_p.P56L	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	56					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.P56L(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GCAGAGGTCCCGCTGCTACCA	0.612																																					p.P56L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C167T	3						.						62.0	69.0	66.0					3																	47030358		2156	4263	6419	47005362	SO:0001583	missense	23218	exon3			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.167C>T	3.37:g.47030358C>T	ENSP00000415034:p.Pro56Leu		47005362	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.	.	.	.	.	.	.	.	.	.	C	18.20	3.571811	0.65765	.	.	ENSG00000160796	ENST00000292309;ENST00000450053;ENST00000296147	T;T	0.58210	0.35;0.36	4.07	4.07	0.47477	.	.	.	.	.	T	0.68155	0.2970	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.71689	-0.4517	9	0.72032	D	0.01	.	13.1287	0.59369	0.0:1.0:0.0:0.0	.	49;56	Q6ZNJ1-4;Q6ZNJ1	.;NBEL2_HUMAN	L	56;56;49	ENSP00000292309:P56L;ENSP00000415034:P56L	ENSP00000292309:P56L	P	+	2	0	NBEAL2	47005362	0.995000	0.38212	0.343000	0.25615	0.189000	0.23516	4.321000	0.59209	2.114000	0.64651	0.561000	0.74099	CCG		0.612	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
CADPS	8618	broad.mit.edu	37	3	62464048	62464048	+	Missense_Mutation	SNP	C	C	T	rs147087123		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:62464048C>T	ENST00000383710.4	-	23	3566	c.3217G>A	c.(3217-3219)Gcc>Acc	p.A1073T	CADPS_ENST00000283269.9_Missense_Mutation_p.A1034T|CADPS_ENST00000357948.3_Missense_Mutation_p.A994T	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	1073	Interaction with DRD2.|MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.A1034T(3)|p.A1073T(2)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GTCTGAAGGGCGTCAAGTTTC	0.483																																					p.A994T												.	.	5	Substitution - Missense(5)	large_intestine(3)|endometrium(2)	c.G2980A	3						.	C	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	126.0	117.0	120.0		3217,2980,3100	6.1	1.0	3	dbSNP_134	120	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	CADPS	NM_003716.3,NM_183393.2,NM_183394.2	58,58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	1073/1354,994/1275,1034/1315	62464048	1,13005	2203	4300	6503	62439088	SO:0001583	missense	8618	exon20			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.3217G>A	3.37:g.62464048C>T	ENSP00000373215:p.Ala1073Thr		62439088	NM_183393	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396577	0.83011	0.0	1.16E-4	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269	T;T;T	0.33216	1.42;1.42;1.42	6.06	6.06	0.98353	Munc13 homology 1 (1);	0.000000	0.85682	D	0.000000	T	0.61751	0.2372	M	0.80982	2.52	0.80722	D	1	D;D;D;D	0.89917	0.964;1.0;1.0;0.997	P;D;D;P	0.79108	0.556;0.992;0.99;0.778	T	0.62950	-0.6745	10	0.87932	D	0	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	994;1034;1073;1073	Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4	.;.;CAPS1_HUMAN;.	T	1073;1073;994;1034	ENSP00000373215:A1073T;ENSP00000350632:A994T;ENSP00000283269:A1034T	ENSP00000283269:A1034T	A	-	1	0	CADPS	62439088	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	GCC		0.483	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
ROBO1	6091	broad.mit.edu	37	3	78667090	78667090	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:78667090G>A	ENST00000464233.1	-	27	4090	c.3977C>T	c.(3976-3978)gCg>gTg	p.A1326V	ROBO1_ENST00000467549.1_Missense_Mutation_p.A1226V|ROBO1_ENST00000495273.1_Missense_Mutation_p.A1281V|ROBO1_ENST00000436010.2_Missense_Mutation_p.A1287V	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1326					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.A1326V(1)|p.A1303V(1)|p.A1281V(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CTCTTCTGGCGCATCCGTATC	0.557																																					p.A1326V												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C3977T	3						.						59.0	67.0	64.0					3																	78667090		2007	4165	6172	78749780	SO:0001583	missense	6091	exon27			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3977C>T	3.37:g.78667090G>A	ENSP00000420321:p.Ala1326Val		78749780	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	0.087	-1.173591	0.01646	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.58210	0.4;0.38;0.39;0.35	5.68	4.79	0.61399	.	0.432629	0.28382	N	0.015548	T	0.26991	0.0661	N	0.03608	-0.345	0.38703	D	0.953038	B;B;B;B;B	0.12630	0.003;0.002;0.0;0.006;0.001	B;B;B;B;B	0.11329	0.002;0.0;0.0;0.006;0.001	T	0.18209	-1.0344	9	.	.	.	.	11.8036	0.52141	0.1382:0.0:0.8618:0.0	.	1290;1326;1281;1226;1287	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	V	1287;1281;1326;1281;1226;1330	ENSP00000406043:A1287V;ENSP00000420321:A1326V;ENSP00000420637:A1281V;ENSP00000417992:A1226V	.	A	-	2	0	ROBO1	78749780	1.000000	0.71417	0.969000	0.41365	0.015000	0.08874	3.742000	0.55097	2.838000	0.97847	0.591000	0.81541	GCG		0.557	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
RTP2	344892	broad.mit.edu	37	3	187416388	187416388	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr3:187416388G>A	ENST00000358241.1	-	2	1004	c.576C>T	c.(574-576)tcC>tcT	p.S192S		NM_001004312.2	NP_001004312.2	Q5QGT7	RTP2_HUMAN	receptor (chemosensory) transporter protein 2	192					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)	p.S192S(2)		large_intestine(3)|lung(14)|skin(1)	18	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		AGTTGTAGCCGGATCCCGCCT	0.587																																					p.S192S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C576T	3						.						77.0	83.0	81.0					3																	187416388		2203	4300	6503	188899082	SO:0001819	synonymous_variant	344892	exon2			AY562236	CCDS33911.1	3q27.3	2014-02-20	2006-11-21		ENSG00000198471	ENSG00000198471		"""Receptor transporter proteins"""	32486	protein-coding gene	gene with protein product	"""receptor transporting protein 2"", ""zinc finger, 3CxxC-type 2"""	609138	"""receptor transporter protein 2"""			16271481, 15550249, 16720576	Standard	NM_001004312		Approved	MGC78665, Z3CXXC2	uc003fro.1	Q5QGT7	OTTHUMG00000156458	ENST00000358241.1:c.576C>T	3.37:g.187416388G>A			188899082	NM_001004312	Q6NVH4	Silent	SNP	ENST00000358241.1	37	CCDS33911.1																																																																																				0.587	RTP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344259.1	NM_001004312	
CENPE	1062	broad.mit.edu	37	4	104030085	104030085	+	Missense_Mutation	SNP	C	C	T	rs141321114	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:104030085C>T	ENST00000265148.3	-	48	7975	c.7886G>A	c.(7885-7887)cGg>cAg	p.R2629Q	CENPE_ENST00000380026.3_Missense_Mutation_p.R2508Q	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2629	Globular autoinhibitory domain. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.R2592Q(2)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTGTAAATTCCGTTCCTTGCA	0.383													C|||	4	0.000798722	0.0	0.0	5008	,	,		18000	0.0		0.001	False		,,,				2504	0.0031				p.R2629Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.G7886A	4						.	C	GLN/ARG	0,4406		0,0,2203	190.0	187.0	188.0		7886	-3.7	0.0	4	dbSNP_134	188	6,8594	5.0+/-18.6	0,6,4294	yes	missense	CENPE	NM_001813.2	43	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	probably-damaging	2629/2702	104030085	6,13000	2203	4300	6503	104249534	SO:0001583	missense	1062	exon48			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.7886G>A	4.37:g.104030085C>T	ENSP00000265148:p.Arg2629Gln		104249534	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.78	1.447334	0.25987	0.0	6.98E-4	ENSG00000138778	ENST00000265148;ENST00000380026	T;T	0.65732	-0.17;-0.17	5.19	-3.72	0.04411	.	.	.	.	.	T	0.35770	0.0943	N	0.14661	0.345	0.09310	N	1	B;B	0.16396	0.017;0.01	B;B	0.10450	0.005;0.002	T	0.15464	-1.0436	9	0.29301	T	0.29	.	4.1379	0.10179	0.2728:0.244:0.0:0.4832	.	2508;2629	Q02224-3;Q02224	.;CENPE_HUMAN	Q	2629;2508	ENSP00000265148:R2629Q;ENSP00000369365:R2508Q	ENSP00000265148:R2629Q	R	-	2	0	CENPE	104249534	0.000000	0.05858	0.001000	0.08648	0.492000	0.33523	-1.506000	0.02271	-0.398000	0.07679	-0.126000	0.14955	CGG		0.383	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
LEF1	51176	broad.mit.edu	37	4	108999470	108999470	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:108999470G>A	ENST00000265165.1	-	8	1568	c.914C>T	c.(913-915)gCt>gTt	p.A305V	LEF1_ENST00000503879.1_5'UTR|LEF1_ENST00000438313.2_Missense_Mutation_p.A277V|LEF1_ENST00000379951.2_Missense_Mutation_p.A277V|LEF1_ENST00000510624.1_Missense_Mutation_p.A209V	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1	305					alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A305V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		TAACATAAAAGCATTCAGAGG	0.438																																					p.A209V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C626T	4						.						251.0	253.0	252.0					4																	108999470		2203	4300	6503	109218919	SO:0001583	missense	51176	exon7				CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.914C>T	4.37:g.108999470G>A	ENSP00000265165:p.Ala305Val		109218919	NM_001166119	B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Missense_Mutation	SNP	ENST00000265165.1	37	CCDS3679.1	.	.	.	.	.	.	.	.	.	.	G	36	5.717218	0.96839	.	.	ENSG00000138795	ENST00000265165;ENST00000379951;ENST00000438313;ENST00000510624	D;D;D;D	0.98747	-5.11;-5.11;-5.11;-5.11	5.89	5.89	0.94794	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.99495	0.9820	H	0.96208	3.785	0.80722	D	1	D;D;D;D;D	0.89917	0.997;0.999;0.996;1.0;1.0	D;D;D;D;D	0.97110	0.983;0.996;0.98;0.999;1.0	D	0.98352	1.0544	10	0.87932	D	0	-8.9932	20.248	0.98401	0.0:0.0:1.0:0.0	.	209;162;277;277;305	E9PDK3;B4DZY5;Q9UJU2-6;Q9UJU2-5;Q9UJU2	.;.;.;.;LEF1_HUMAN	V	305;277;277;209	ENSP00000265165:A305V;ENSP00000369284:A277V;ENSP00000406176:A277V;ENSP00000422840:A209V	ENSP00000265165:A305V	A	-	2	0	LEF1	109218919	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.751000	0.98889	2.790000	0.95986	0.655000	0.94253	GCT		0.438	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254749.2		
QRFPR	84109	broad.mit.edu	37	4	122301740	122301740	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:122301740C>T	ENST00000394427.2	-	1	474	c.63G>A	c.(61-63)acG>acA	p.T21T	QRFPR_ENST00000334383.5_Silent_p.T21T	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	21					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)	p.T21T(1)		endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						ACTGCTCCCGCGTCAGGTTGT	0.682																																					p.T21T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G63A	4						.						16.0	19.0	18.0					4																	122301740		2203	4297	6500	122521190	SO:0001819	synonymous_variant	84109	exon1			AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.63G>A	4.37:g.122301740C>T			122521190	NM_198179		Silent	SNP	ENST00000394427.2	37	CCDS3719.1																																																																																				0.682	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256641.2	NM_198179	
HTT	3064	broad.mit.edu	37	4	3176515	3176515	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:3176515C>T	ENST00000355072.5	+	32	4379	c.4234C>T	c.(4234-4236)Cgt>Tgt	p.R1412C		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1412					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.R1412C(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CACAAAGAACCGTGCAGATAA	0.463																																					p.R1412C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4234T	4						.						125.0	116.0	119.0					4																	3176515		1966	4149	6115	3146313	SO:0001583	missense	3064	exon32			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.4234C>T	4.37:g.3176515C>T	ENSP00000347184:p.Arg1412Cys		3146313	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.495873	0.85069	.	.	ENSG00000197386	ENST00000355072	T	0.05855	3.38	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.24236	0.0587	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00164	-1.1968	10	0.87932	D	0	.	19.2953	0.94119	0.0:1.0:0.0:0.0	.	1412	P42858	HD_HUMAN	C	1412	ENSP00000347184:R1412C	ENSP00000347184:R1412C	R	+	1	0	HTT	3146313	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.792000	0.69052	2.557000	0.86248	0.555000	0.69702	CGT		0.463	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
PPP2R2C	5522	broad.mit.edu	37	4	6325190	6325190	+	Missense_Mutation	SNP	C	C	T	rs375066274		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:6325190C>T	ENST00000382599.4	-	9	1399	c.1183G>A	c.(1183-1185)Gtg>Atg	p.V395M	PPP2R2C_ENST00000335585.5_Missense_Mutation_p.V395M|PPP2R2C_ENST00000506140.1_Missense_Mutation_p.V388M|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.V378M|PPP2R2C_ENST00000507294.1_Missense_Mutation_p.V388M			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	395					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.V395M(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						TTGCCCCCCACGCACACGCGC	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		17855	0.0		0.0	False		,,,				2504	0.001				p.V395M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1183A	4						.	C	MET/VAL,MET/VAL,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	87.0	76.0	80.0		1183,1132,1162,1162	3.6	1.0	4		80	0,8600		0,0,4300	no	missense,missense,missense,missense	PPP2R2C	NM_181876.2,NM_001206996.1,NM_001206995.1,NM_001206994.1	21,21,21,21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign,benign	395/448,378/431,388/441,388/441	6325190	1,13005	2203	4300	6503	6376091	SO:0001583	missense	5522	exon9			AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.1183G>A	4.37:g.6325190C>T	ENSP00000372042:p.Val395Met		6376091	NM_020416	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	ENST00000382599.4	37		.	.	.	.	.	.	.	.	.	.	C	11.98	1.801264	0.31869	2.27E-4	0.0	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.30981	1.51;1.52;1.52;1.52;1.52	4.45	3.6	0.41247	WD40 repeat-like-containing domain (1);	0.262132	0.37906	N	0.001892	T	0.23289	0.0563	L	0.31294	0.92	0.39731	D	0.971605	B;B;B;B	0.23185	0.037;0.081;0.081;0.081	B;B;B;B	0.22601	0.025;0.04;0.024;0.04	T	0.05649	-1.0872	10	0.33940	T	0.23	-24.681	13.5959	0.61988	0.0:0.8434:0.1566:0.0	.	388;395;378;395	B7Z3Y1;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;2ABG_HUMAN;.;.	M	395;388;378;395;388	ENSP00000335083:V395M;ENSP00000423649:V388M;ENSP00000422374:V378M;ENSP00000372042:V395M;ENSP00000425247:V388M	ENSP00000335083:V395M	V	-	1	0	PPP2R2C	6376091	1.000000	0.71417	0.998000	0.56505	0.897000	0.52465	1.498000	0.35660	1.073000	0.40885	0.555000	0.69702	GTG		0.632	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
SLAIN2	57606	broad.mit.edu	37	4	48371911	48371911	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:48371911G>A	ENST00000264313.6	+	2	853	c.435G>A	c.(433-435)tcG>tcA	p.S145S	SLAIN2_ENST00000506375.1_3'UTR	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	145					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.S145S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						TGCAGAAATCGGTTAGTCCAT	0.348																																					p.S145S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G435A	4						.						147.0	140.0	142.0					4																	48371911		1833	4085	5918	48066668	SO:0001819	synonymous_variant	57606	exon2			BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.435G>A	4.37:g.48371911G>A			48066668	NM_020846	A8K4P1|Q8N5R3	Silent	SNP	ENST00000264313.6	37	CCDS47051.1																																																																																				0.348	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365807.4	NM_020846	
LNX1	84708	broad.mit.edu	37	4	54424125	54424125	+	Intron	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:54424125G>A	ENST00000263925.7	-	2	695				LNX1_ENST00000306888.2_Missense_Mutation_p.A3V|FIP1L1_ENST00000507166.1_Intron	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase						protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A3V(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CAACAGAAGCGCCTTCATTCT	0.537																																					p.A3V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8T	4						.						163.0	136.0	145.0					4																	54424125		2203	4300	6503	54118882	SO:0001627	intron_variant	84708	exon1			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.380+15664C>T	4.37:g.54424125G>A			54118882	NM_032622	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	ENST00000263925.7	37	CCDS47057.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442006	0.83993	.	.	ENSG00000072201	ENST00000306888	T	0.10099	2.91	5.76	4.91	0.64330	.	.	.	.	.	T	0.30262	0.0759	.	.	.	0.80722	D	1	D	0.76494	0.999	P	0.59288	0.855	T	0.09509	-1.0671	8	0.87932	D	0	.	16.3179	0.82935	0.0:0.0:0.8667:0.1333	.	3	Q8TBB1-2	.	V	3	ENSP00000302879:A3V	ENSP00000302879:A3V	A	-	2	0	LNX1	54118882	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	9.199000	0.95003	1.428000	0.47296	0.456000	0.33151	GCG		0.537	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2		
THAP9	79725	broad.mit.edu	37	4	83839144	83839144	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:83839144C>T	ENST00000302236.5	+	5	1830	c.1779C>T	c.(1777-1779)ttC>ttT	p.F593F	LIN54_ENST00000505905.1_Intron	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	593					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)	p.F593F(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				ATTATGTTTTCCCAAAGGTCA	0.338																																					p.F593F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1779T	4						.						37.0	36.0	36.0					4																	83839144		2203	4300	6503	84058168	SO:0001819	synonymous_variant	79725	exon5			AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.1779C>T	4.37:g.83839144C>T			84058168	NM_024672	B3KRE2|Q59AC9	Silent	SNP	ENST00000302236.5	37	CCDS3598.1																																																																																				0.338	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672	
PPM1K	152926	broad.mit.edu	37	4	89199469	89199469	+	Silent	SNP	T	T	C			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:89199469T>C	ENST00000608933.1	-	2	656	c.267A>G	c.(265-267)aaA>aaG	p.K89K	PPM1K_ENST00000506423.1_5'UTR|PPM1K_ENST00000295908.7_Silent_p.K89K|PPM1K_ENST00000508256.1_Intron|PPM1K_ENST00000315194.4_Silent_p.K89K|PPM1K_ENST00000514204.1_Silent_p.K89K	NM_152542.4	NP_689755.3	Q8N3J5	PPM1K_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1K	89					protein dephosphorylation (GO:0006470)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.K89K(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	13		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000192)		CCAAGCTGATTTTGGGAATTG	0.493																																					p.K89K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A267G	4						.						81.0	79.0	80.0					4																	89199469		2203	4300	6503	89418493	SO:0001819	synonymous_variant	152926	exon2			BC037552	CCDS3629.1	4q22.1	2012-04-17	2010-03-05		ENSG00000163644	ENSG00000163644	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	25415	protein-coding gene	gene with protein product	"""PP2C-type mitochondrial phosphoprotein phosphatase"", ""protein phosphatase 2C kappa"", ""branched-chain &#945;-ketoacid dehydrogenase phosphatase"""	611065	"""protein phosphatase 1K (PP2C domain containing)"""			22291014	Standard	NM_152542		Approved	DKFZp761G058, PP2Ckappa, hPTMP, PP2Cm, BDP	uc003hrm.5	Q8N3J5	OTTHUMG00000130952	ENST00000608933.1:c.267A>G	4.37:g.89199469T>C			89418493	NM_152542	B2RAZ1|Q05CT5|Q49AB5|Q4W5E6|Q56AN8|Q8IUZ7|Q8IXG7|Q8ND70|Q96NT4	Silent	SNP	ENST00000608933.1	37	CCDS3629.1																																																																																				0.493	PPM1K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253553.4	NM_152542	
UNC5C	8633	broad.mit.edu	37	4	96163598	96163598	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:96163598C>A	ENST00000453304.1	-	7	1438	c.1090G>T	c.(1090-1092)Gat>Tat	p.D364Y	UNC5C_ENST00000506749.1_Missense_Mutation_p.D364Y	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	364	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.D364Y(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		CAAAGCCCATCAGTGCAGTTC	0.512																																					p.D364Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1090T	4						.						63.0	54.0	57.0					4																	96163598		2203	4300	6503	96382621	SO:0001583	missense	8633	exon7			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1090G>T	4.37:g.96163598C>A	ENSP00000406022:p.Asp364Tyr		96382621	NM_003728	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.595529	0.86953	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.60424	0.19;0.19;0.19	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.76378	0.3979	M	0.69823	2.125	0.80722	D	1	P;D;D	0.89917	0.792;1.0;1.0	P;D;D	0.91635	0.542;0.999;0.999	T	0.78028	-0.2364	10	0.72032	D	0.01	.	19.0716	0.93140	0.0:1.0:0.0:0.0	.	364;364;364	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	Y	364;323;364;364	ENSP00000406022:D364Y;ENSP00000426924:D364Y;ENSP00000426153:D364Y	ENSP00000328673:D323Y	D	-	1	0	UNC5C	96382621	0.998000	0.40836	0.966000	0.40874	0.989000	0.77384	3.853000	0.55941	2.805000	0.96524	0.655000	0.94253	GAT		0.512	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
STPG2	285555	broad.mit.edu	37	4	98902376	98902376	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:98902376T>C	ENST00000295268.3	-	6	795	c.706A>G	c.(706-708)Aaa>Gaa	p.K236E		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	236								p.K236E(1)									GGAATATTTTTCAGTCCTGAT	0.398																																					p.K236E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A706G	4						.						177.0	176.0	176.0					4																	98902376		2203	4300	6503	99121399	SO:0001583	missense	285555	exon6			BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.706A>G	4.37:g.98902376T>C	ENSP00000295268:p.Lys236Glu		99121399	NM_174952		Missense_Mutation	SNP	ENST00000295268.3	37	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	T	16.16	3.044029	0.55110	.	.	ENSG00000163116	ENST00000295268	T	0.11712	2.75	5.58	3.08	0.35506	.	0.281705	0.33401	N	0.004955	T	0.18635	0.0447	M	0.63843	1.955	0.09310	N	1	D	0.59767	0.986	P	0.59595	0.86	T	0.11179	-1.0598	10	0.36615	T	0.2	-28.0934	2.7457	0.05267	0.1516:0.0793:0.1485:0.6206	.	236	Q8N412	CD037_HUMAN	E	236	ENSP00000295268:K236E	ENSP00000295268:K236E	K	-	1	0	C4orf37	99121399	0.739000	0.28196	0.015000	0.15790	0.965000	0.64279	0.899000	0.28417	0.369000	0.24510	0.460000	0.39030	AAA		0.398	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
TLL1	7092	broad.mit.edu	37	4	166915616	166915616	+	Missense_Mutation	SNP	G	G	A	rs537288580		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr4:166915616G>A	ENST00000061240.2	+	4	1092	c.445G>A	c.(445-447)Gct>Act	p.A149T	TLL1_ENST00000513213.1_Missense_Mutation_p.A149T|TLL1_ENST00000507499.1_Missense_Mutation_p.A149T	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	149	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A149T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TCCCAGAGCCGCTACATCAAG	0.418																																					p.A149T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G445A	4						.						75.0	73.0	74.0					4																	166915616		2203	4300	6503	167135066	SO:0001583	missense	7092	exon4			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.445G>A	4.37:g.166915616G>A	ENSP00000061240:p.Ala149Thr		167135066	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.350828	0.61183	.	.	ENSG00000038295	ENST00000061240;ENST00000507499;ENST00000513213;ENST00000506144	T;T;T;T	0.79749	0.23;0.13;0.12;-1.3	5.51	5.51	0.81932	Metallopeptidase, catalytic domain (1);	0.000000	0.85682	U	0.000000	D	0.83418	0.5250	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.987	T	0.83025	-0.0165	10	0.35671	T	0.21	.	19.4226	0.94727	0.0:0.0:1.0:0.0	.	149;149	E9PD25;O43897	.;TLL1_HUMAN	T	149;149;149;49	ENSP00000061240:A149T;ENSP00000426082:A149T;ENSP00000422937:A149T;ENSP00000423748:A49T	ENSP00000061240:A149T	A	+	1	0	TLL1	167135066	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	7.959000	0.87885	2.593000	0.87608	0.655000	0.94253	GCT		0.418	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
APC	324	broad.mit.edu	37	5	112173704	112173704	+	Nonsense_Mutation	SNP	C	C	T	rs587779783		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:112173704C>T	ENST00000457016.1	+	16	2793	c.2413C>T	c.(2413-2415)Cga>Tga	p.R805*	APC_ENST00000508376.2_Nonsense_Mutation_p.R805*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.R805*			P25054	APC_HUMAN	adenomatous polyposis coli	805	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R805*(10)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGACACCAATCGACATGATGA	0.373		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R787X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,0 	.	11	Substitution - Nonsense(10)|Unknown(1)	large_intestine(10)|skin(1)	c.C2359T	5	GRCh37	CM960067	APC	M		.						77.0	78.0	78.0					5																	112173704		2202	4300	6502	112201603	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2413C>T	5.37:g.112173704C>T	ENSP00000413133:p.Arg805*		112201603	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.853935	0.97030	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.16	4.36	0.52297	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-10.8016	14.7295	0.69372	0.4961:0.5038:0.0:0.0	.	.	.	.	X	805;787;805;805;805	.	ENSP00000257430:R805X	R	+	1	2	APC	112201603	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.615000	0.36922	0.896000	0.36366	-0.188000	0.12872	CGA		0.373	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
LVRN	206338	broad.mit.edu	37	5	115336188	115336188	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:115336188C>A	ENST00000357872.4	+	8	1698	c.1574C>A	c.(1573-1575)gCa>gAa	p.A525E	AQPEP_ENST00000395528.2_Missense_Mutation_p.A42E	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		525						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A525E(1)									TTTGTCAGTGCACTCAAGGTG	0.358																																					p.A525E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1574A	5						.						155.0	147.0	150.0					5																	115336188		2202	4300	6502	115364087	SO:0001583	missense	206338	exon8																														ENST00000357872.4:c.1574C>A	5.37:g.115336188C>A	ENSP00000350541:p.Ala525Glu		115364087	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	37	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912573	0.72983	.	.	ENSG00000172901	ENST00000395528;ENST00000357872;ENST00000379578	T;T	0.39997	1.05;1.05	5.72	4.8	0.61643	.	0.268165	0.32041	N	0.006664	T	0.65575	0.2704	M	0.80508	2.5	0.32081	N	0.593086	D	0.89917	1.0	D	0.73380	0.98	T	0.73157	-0.4071	10	0.87932	D	0	.	15.1096	0.72346	0.0:0.762:0.238:0.0	.	525	Q6Q4G3	AMPQ_HUMAN	E	42;525;514	ENSP00000378899:A42E;ENSP00000350541:A525E	ENSP00000350541:A525E	A	+	2	0	AC010282.1	115364087	1.000000	0.71417	0.570000	0.28473	0.931000	0.56810	3.013000	0.49582	2.857000	0.98124	0.650000	0.86243	GCA		0.358	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
FTMT	94033	broad.mit.edu	37	5	121187716	121187716	+	Missense_Mutation	SNP	C	C	T	rs372731129		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:121187716C>T	ENST00000321339.1	+	1	67	c.58C>T	c.(58-60)Cgc>Tgc	p.R20C		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	20					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)	p.R20C(1)|p.R20S(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GGCGTCTCTGCGCCCGGTGCG	0.736																																					p.R20C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C58T	5						.	T	CYS/ARG	0,4400		0,0,2200	18.0	21.0	20.0		58	-0.9	0.0	5		20	1,8593		0,1,4296	no	missense	FTMT	NM_177478.1	180	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	20/243	121187716	1,12993	2200	4297	6497	121215615	SO:0001583	missense	94033	exon1			BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.58C>T	5.37:g.121187716C>T	ENSP00000313691:p.Arg20Cys		121215615	NM_177478		Missense_Mutation	SNP	ENST00000321339.1	37	CCDS4128.1	.	.	.	.	.	.	.	.	.	.	c	12.76	2.034868	0.35893	0.0	1.16E-4	ENSG00000181867	ENST00000321339	T	0.67523	-0.27	2.95	-0.931	0.10438	.	.	.	.	.	T	0.49338	0.1551	L	0.29908	0.895	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.38329	-0.9666	9	0.56958	D	0.05	.	6.1415	0.20263	0.0:0.4786:0.0:0.5214	.	20	Q8N4E7	FTMT_HUMAN	C	20	ENSP00000313691:R20C	ENSP00000313691:R20C	R	+	1	0	FTMT	121215615	0.080000	0.21391	0.000000	0.03702	0.002000	0.02628	0.498000	0.22530	-0.257000	0.09459	-0.127000	0.14921	CGC		0.736	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
BRD8	10902	broad.mit.edu	37	5	137504996	137504996	+	Missense_Mutation	SNP	C	C	T	rs555229577		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:137504996C>T	ENST00000254900.5	-	8	928	c.557G>A	c.(556-558)cGc>cAc	p.R186H	BRD8_ENST00000230901.5_Missense_Mutation_p.R186H|BRD8_ENST00000402931.1_Missense_Mutation_p.R186H|BRD8_ENST00000455658.2_Missense_Mutation_p.R145H|BRD8_ENST00000411594.2_Missense_Mutation_p.R186H	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	186					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)	p.R186H(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TATAGGAGAGCGAACCATCAC	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		16896	0.0		0.0	False		,,,				2504	0.001				p.R186H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G557A	5						.						86.0	89.0	88.0					5																	137504996		2203	4300	6503	137532895	SO:0001583	missense	10902	exon8			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.557G>A	5.37:g.137504996C>T	ENSP00000254900:p.Arg186His		137532895	NM_006696	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	37	CCDS4198.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.0|25.0	4.593591|4.593591	0.86953|0.86953	.|.	.|.	ENSG00000112983|ENSG00000112983	ENST00000441656|ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000239899;ENST00000455658;ENST00000453824	.|T;T;T;T;T;T;T	.|0.36699	.|1.54;1.24;1.32;1.46;1.33;1.33;1.26	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	.|0.099848	.|0.64402	.|D	.|0.000001	T|T	0.51719|0.51719	0.1691|0.1691	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999999|0.999999	.|D;P;P;D;D;D;D;D	.|0.89917	.|1.0;0.835;0.888;0.999;0.999;1.0;0.999;1.0	.|D;B;P;D;D;D;D;D	.|0.85130	.|0.993;0.348;0.534;0.98;0.994;0.997;0.994;0.996	T|T	0.48186|0.48186	-0.9057|-0.9057	5|10	.|0.59425	.|D	.|0.04	-6.8566|-6.8566	19.6603|19.6603	0.95864|0.95864	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|145;170;145;186;186;46;186;186	.|F8W820;B4DN43;B4DEG9;A8K1N6;Q9H0E9-4;Q9H0E9-3;Q9H0E9-2;Q9H0E9	.|.;.;.;.;.;.;.;BRD8_HUMAN	T|H	177|186;181;181;186;186;186;46;145;74	.|ENSP00000254900:R186H;ENSP00000398067:R181H;ENSP00000398873:R181H;ENSP00000230901:R186H;ENSP00000384845:R186H;ENSP00000394330:R186H;ENSP00000408396:R145H	.|ENSP00000230901:R186H	A|R	-|-	1|2	0|0	BRD8|BRD8	137532895|137532895	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.220000|4.220000	0.58567|0.58567	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	GCT|CGC		0.458	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
EGR1	1958	broad.mit.edu	37	5	137803366	137803366	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:137803366G>T	ENST00000239938.4	+	2	1500	c.1228G>T	c.(1228-1230)Gaa>Taa	p.E410*		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	410					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.E410*(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CAGGAGCGATGAACGCAAGAG	0.567																																					p.E410X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1228T	5						.						115.0	113.0	113.0					5																	137803366		2203	4300	6503	137831265	SO:0001587	stop_gained	1958	exon2			M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.1228G>T	5.37:g.137803366G>T	ENSP00000239938:p.Glu410*		137831265	NM_001964		Nonsense_Mutation	SNP	ENST00000239938.4	37	CCDS4206.1	.	.	.	.	.	.	.	.	.	.	G	37	6.618986	0.97709	.	.	ENSG00000120738	ENST00000239938	.	.	.	4.2	4.2	0.49525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.5768	15.72	0.77700	0.0:0.0:1.0:0.0	.	.	.	.	X	410	.	ENSP00000239938:E410X	E	+	1	0	EGR1	137831265	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.657000	0.98554	2.177000	0.69029	0.563000	0.77884	GAA		0.567	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251274.1	NM_001964	
PCDHA2	56146	broad.mit.edu	37	5	140176624	140176624	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:140176624C>T	ENST00000526136.1	+	1	2075	c.2075C>T	c.(2074-2076)aCg>aTg	p.T692M	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.T692M|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.T692M	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	692					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T692M(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGAGGCTACGCTGGTGGAT	0.647																																					p.T692M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2075T	5						.						81.0	81.0	81.0					5																	140176624		2203	4300	6503	140156808	SO:0001583	missense	56146	exon1			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.2075C>T	5.37:g.140176624C>T	ENSP00000431748:p.Thr692Met		140156808	NM_018905	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	c	14.03	2.414616	0.42817	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.53206	0.69;0.63;0.66	3.96	2.14	0.27477	.	0.563798	0.13024	U	0.419845	T	0.35508	0.0934	N	0.25647	0.755	0.09310	N	1	P;B;P	0.45594	0.755;0.211;0.862	B;B;B	0.43360	0.299;0.048;0.417	T	0.13388	-1.0511	10	0.62326	D	0.03	.	7.3937	0.26923	0.0:0.7181:0.0:0.2819	.	692;692;692	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	M	692	ENSP00000430584:T692M;ENSP00000367372:T692M;ENSP00000431748:T692M	ENSP00000367372:T692M	T	+	2	0	PCDHA2	140156808	0.000000	0.05858	0.028000	0.17463	0.180000	0.23129	-0.458000	0.06737	0.282000	0.22254	0.580000	0.79431	ACG		0.647	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHAC1	56135	broad.mit.edu	37	5	140307759	140307759	+	Nonsense_Mutation	SNP	C	C	T	rs79095134		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:140307759C>T	ENST00000253807.2	+	1	1282	c.1282C>T	c.(1282-1284)Cga>Tga	p.R428*	PCDHA3_ENST00000522353.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHAC1_ENST00000409700.3_Nonsense_Mutation_p.R428*|PCDHA5_ENST00000529859.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	428	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R428*(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTTAGCACCCGAAGGACAAT	0.522																																					p.R428X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1282T	5						.						74.0	74.0	74.0					5																	140307759		2203	4300	6503	140287943	SO:0001587	stop_gained	56135	exon1			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1282C>T	5.37:g.140307759C>T	ENSP00000253807:p.Arg428*		140287943	NM_031882	Q9Y5F5|Q9Y5I5	Nonsense_Mutation	SNP	ENST00000253807.2	37	CCDS4241.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215592	0.79352	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	.	.	.	5.54	3.64	0.41730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3893	0.66968	0.2678:0.7322:0.0:0.0	.	.	.	.	X	428	.	ENSP00000253807:R428X	R	+	1	2	PCDHAC1	140287943	0.000000	0.05858	0.056000	0.19401	0.988000	0.76386	0.174000	0.16743	1.309000	0.44985	0.462000	0.41574	CGA		0.522	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
PCDHGB2	56103	broad.mit.edu	37	5	140741249	140741249	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:140741249C>T	ENST00000522605.1	+	1	1547	c.1547C>T	c.(1546-1548)gCg>gTg	p.A516V	PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	516	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A516V(2)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGTGTTCGCGCAGCGCGCC	0.667																																					p.A516V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1547T	5						.						33.0	37.0	35.0					5																	140741249		2012	4171	6183	140721433	SO:0001583	missense	56103	exon1			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1547C>T	5.37:g.140741249C>T	ENSP00000429018:p.Ala516Val		140721433	NM_018923	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	37	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	19.01	3.743442	0.69418	.	.	ENSG00000253910	ENST00000522605	T	0.01647	4.71	5.18	5.18	0.71444	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.07818	0.0196	L	0.42632	1.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.12426	-1.0548	9	0.87932	D	0	.	18.6559	0.91453	0.0:1.0:0.0:0.0	.	516;516	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	V	516	ENSP00000429018:A516V	ENSP00000429018:A516V	A	+	2	0	PCDHGB2	140721433	0.410000	0.25376	1.000000	0.80357	0.486000	0.33341	2.350000	0.44063	2.564000	0.86499	0.467000	0.42956	GCG		0.667	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
PCDHGB3	56102	broad.mit.edu	37	5	140751850	140751850	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:140751850G>A	ENST00000576222.1	+	1	2020	c.1889G>A	c.(1888-1890)cGt>cAt	p.R630H	PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	630	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCACGGCGCGTACCTTGGGC	0.667																																					p.R630H												.	.	0			c.G1889A	5						.						37.0	43.0	41.0					5																	140751850		2148	4257	6405	140732034	SO:0001583	missense	56102	exon1			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1889G>A	5.37:g.140751850G>A	ENSP00000461862:p.Arg630His		140732034	NM_018924	A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	CCDS58980.1																																																																																				0.667	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
PCDHGA10	56106	broad.mit.edu	37	5	140795035	140795035	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:140795035G>A	ENST00000398610.2	+	1	2293	c.2293G>A	c.(2293-2295)Gcg>Acg	p.A765T	PCDHGA1_ENST00000517417.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB7_ENST00000398594.2_5'Flank|PCDHGA9_ENST00000573521.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	765					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A765T(1)		breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTCTCACCGCGGACTCGCG	0.572																																					p.A765T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2293A	5						.						98.0	106.0	103.0					5																	140795035		2203	4300	6503	140775219	SO:0001583	missense	56106	exon1				CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.2293G>A	5.37:g.140795035G>A	ENSP00000381611:p.Ala765Thr		140775219	NM_032090	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	CCDS47292.1	.	.	.	.	.	.	.	.	.	.	g	0.234	-1.018729	0.02078	.	.	ENSG00000253846	ENST00000398610	T	0.47528	0.84	5.42	2.25	0.28309	.	.	.	.	.	T	0.26085	0.0636	L	0.37466	1.105	0.09310	N	1	B;B	0.29716	0.255;0.165	B;B	0.25884	0.064;0.029	T	0.16041	-1.0416	9	0.07990	T	0.79	.	0.2021	0.00146	0.2574:0.1586:0.2596:0.3244	.	765;765	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	T	765	ENSP00000381611:A765T	ENSP00000381611:A765T	A	+	1	0	PCDHGA10	140775219	0.000000	0.05858	0.044000	0.18714	0.343000	0.28985	-0.003000	0.12901	0.671000	0.31185	-0.140000	0.14226	GCG		0.572	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913	
CAMK2A	815	broad.mit.edu	37	5	149652711	149652711	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:149652711G>A	ENST00000348628.6	-	2	739	c.74C>T	c.(73-75)tCg>tTg	p.S25L	CAMK2A_ENST00000398376.3_Missense_Mutation_p.S25L	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha	25	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)	p.S25L(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCGCACCACCGAGAAGGCTCC	0.567																																					p.S25L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C74T	5						.						84.0	89.0	87.0					5																	149652711		2203	4300	6503	149632904	SO:0001583	missense	815	exon2			AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.74C>T	5.37:g.149652711G>A	ENSP00000261793:p.Ser25Leu		149632904	NM_015981	Q9UL21|Q9Y2H4|Q9Y352	Missense_Mutation	SNP	ENST00000348628.6	37	CCDS43386.1	.	.	.	.	.	.	.	.	.	.	G	36	5.609942	0.96637	.	.	ENSG00000070808	ENST00000348628;ENST00000398376;ENST00000510347	T;T;T	0.26957	1.7;1.7;1.7	5.94	5.94	0.96194	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	T	0.63486	0.2515	M	0.93106	3.38	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.71251	-0.4648	10	0.87932	D	0	.	19.1308	0.93406	0.0:0.0:1.0:0.0	.	25;25;25	Q9UQM7-2;Q9UQM7;A8K161	.;KCC2A_HUMAN;.	L	25	ENSP00000261793:S25L;ENSP00000381412:S25L;ENSP00000426607:S25L	ENSP00000261793:S25L	S	-	2	0	CAMK2A	149632904	1.000000	0.71417	0.975000	0.42487	0.995000	0.86356	9.370000	0.97159	2.816000	0.96949	0.563000	0.77884	TCG		0.567	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258869.2	NM_015981	
EBF1	1879	broad.mit.edu	37	5	158522658	158522658	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:158522658G>A	ENST00000313708.6	-	4	663	c.381C>T	c.(379-381)taC>taT	p.Y127Y	EBF1_ENST00000380654.4_Silent_p.Y127Y|EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000517373.1_Silent_p.Y127Y	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	127					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y127Y(1)	HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGAGGCGCACGTAGAAATCCT	0.478			T	HMGA2	lipoma																																p.Y127Y			Dom	yes		5	5q34	1879	early B-cell factor 1		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C381T	5						.						68.0	67.0	67.0					5																	158522658		2203	4300	6503	158455236	SO:0001819	synonymous_variant	1879	exon4			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.381C>T	5.37:g.158522658G>A			158455236	NM_024007	Q8IW11	Silent	SNP	ENST00000313708.6	37	CCDS4343.1																																																																																				0.478	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007	
IL6ST	3572	broad.mit.edu	37	5	55243379	55243379	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:55243379A>C	ENST00000381298.2	-	15	2191	c.1879T>G	c.(1879-1881)Tta>Gta	p.L627V	IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000381294.3_Missense_Mutation_p.L566V|IL6ST_ENST00000381287.4_3'UTR|IL6ST_ENST00000502326.3_Missense_Mutation_p.L627V|IL6ST_ENST00000336909.5_Missense_Mutation_p.L627V	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	627					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)	p.L627V(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				AGGAATGCTAAGCAAACAGGC	0.348			O		hepatocellular ca																																p.L566V			Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1696G	5						.						87.0	82.0	84.0					5																	55243379		2203	4300	6503	55279136	SO:0001583	missense	3572	exon14			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.1879T>G	5.37:g.55243379A>C	ENSP00000370698:p.Leu627Val		55279136	NM_001190981	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	ENST00000381298.2	37	CCDS3971.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.172346	0.38315	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294	T;T;T	0.41065	1.24;1.24;1.01	5.52	1.93	0.25924	.	0.150310	0.44902	D	0.000410	T	0.15176	0.0366	N	0.11201	0.11	0.80722	D	1	P;P;P	0.35411	0.5;0.5;0.5	B;B;B	0.32980	0.156;0.11;0.156	T	0.14868	-1.0457	10	0.05959	T	0.93	.	4.0542	0.09810	0.5216:0.1795:0.2989:0.0	.	627;566;627	Q17RA0;Q5FC04;P40189	.;.;IL6RB_HUMAN	V	627;627;566	ENSP00000370698:L627V;ENSP00000338799:L627V;ENSP00000370694:L566V	ENSP00000338799:L627V	L	-	1	2	IL6ST	55279136	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.681000	0.25320	0.923000	0.37045	0.374000	0.22700	TTA		0.348	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
ANKRD55	79722	broad.mit.edu	37	5	55422884	55422884	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:55422884G>A	ENST00000341048.4	-	8	813	c.662C>T	c.(661-663)cCg>cTg	p.P221L	ANKRD55_ENST00000505970.2_Intron|RNU6-299P_ENST00000517223.1_RNA|ANKRD55_ENST00000504958.2_Missense_Mutation_p.P178L	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	221								p.P221L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				GATTATGGACGGCCCCTGGTG	0.468																																					p.P221L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C662T	5						.						114.0	109.0	111.0					5																	55422884		2203	4300	6503	55458641	SO:0001583	missense	79722	exon8			AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.662C>T	5.37:g.55422884G>A	ENSP00000342295:p.Pro221Leu		55458641	NM_024669	B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	ENST00000341048.4	37	CCDS34161.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655031	0.67472	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000504958	T;T	0.53423	1.13;0.62	5.62	4.67	0.58626	.	0.207171	0.41823	D	0.000812	T	0.38931	0.1059	L	0.42686	1.345	0.37789	D	0.927308	D	0.56746	0.977	B	0.39876	0.312	T	0.41998	-0.9477	10	0.30854	T	0.27	.	15.36	0.74464	0.0:0.0:0.7702:0.2298	.	221	B3KVT8	.	L	221;221;178	ENSP00000342295:P221L;ENSP00000424230:P178L	ENSP00000342295:P221L	P	-	2	0	ANKRD55	55458641	1.000000	0.71417	0.802000	0.32245	0.793000	0.44817	5.077000	0.64419	2.656000	0.90262	0.563000	0.77884	CCG		0.468	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669	
APC	324	broad.mit.edu	37	5	112175752	112175752	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:112175752delT	ENST00000457016.1	+	16	4841	c.4461delT	c.(4459-4461)actfs	p.T1487fs	APC_ENST00000508376.2_Frame_Shift_Del_p.T1487fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.T1487fs			P25054	APC_HUMAN	adenomatous polyposis coli	1487	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.T1487fs*17(10)|p.L1488fs*19(7)|p.L1488fs*26(5)|p.L1488fs*18(1)|p.?(1)|p.K1454fs*3(1)|p.T1487fs*25(1)|p.T1487T(1)|p.K1192fs*3(1)|p.T1487fs*23(1)|p.L1488fs*20(1)|p.L1488fs*21(1)|p.L1488fs*23(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ATGCTGATACTTTATTACATT	0.443		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.T1469fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Complex - frameshift,+1 	.	32	Deletion - Frameshift(21)|Insertion - Frameshift(7)|Complex - frameshift(2)|Unknown(1)|Substitution - coding silent(1)	large_intestine(29)|thyroid(1)|soft_tissue(1)|skin(1)	c.4407delT	5						.						69.0	70.0	70.0					5																	112175752		2202	4300	6502	112203651	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4461delT	5.37:g.112175752delT	ENSP00000413133:p.Thr1487fs		112203651	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.443	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
CDHR2	54825	broad.mit.edu	37	5	175992684	175992684	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:175992684G>A	ENST00000510636.1	+	3	338	c.64G>A	c.(64-66)Gtg>Atg	p.V22M	CDHR2_ENST00000261944.5_Missense_Mutation_p.V22M|CDHR2_ENST00000506348.1_Missense_Mutation_p.V22M	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	22					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V22M(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						GGCAGCCAACGTGGCCCCGAA	0.602																																					p.V22M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G64A	5						.						109.0	76.0	87.0					5																	175992684		2203	4300	6503	175925290	SO:0001583	missense	54825	exon3			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.64G>A	5.37:g.175992684G>A	ENSP00000424565:p.Val22Met		175925290	NM_001171976	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	G	13.73	2.323277	0.41096	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.55588	0.51;0.51;0.51	4.8	-9.6	0.00553	Cadherin-like (1);	.	.	.	.	T	0.28830	0.0715	L	0.29908	0.895	0.09310	N	1	B	0.16396	0.017	B	0.11329	0.006	T	0.21724	-1.0237	9	0.49607	T	0.09	0.7284	1.5285	0.02530	0.463:0.1807:0.1242:0.232	.	22	Q9BYE9	CDHR2_HUMAN	M	22	ENSP00000424565:V22M;ENSP00000261944:V22M;ENSP00000421078:V22M	ENSP00000261944:V22M	V	+	1	0	CDHR2	175925290	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-3.828000	0.00356	-2.141000	0.00805	-0.219000	0.12488	GTG		0.602	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
GPRIN1	114787	broad.mit.edu	37	5	176026122	176026134	+	Frame_Shift_Del	DEL	CAAAGACCCAGGA	CAAAGACCCAGGA	-	rs3797464|rs200519605|rs386695335|rs550332435|rs142779818|rs371149640|rs199714570|rs373697082	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	CAAAGACCCAGGA	CAAAGACCCAGGA	CAAAGACCCAGGA	CAAAGACCCAGGA	CAAAGACCCAGGA	CAAAGACCCAGGA	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr5:176026122_176026134delCAAAGACCCAGGA	ENST00000303991.4	-	2	879_891	c.702_714delTCCTGGGTCTTTG	c.(700-714)gatcctgggtctttgfs	p.DPGSL234fs		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	234				Missing (in Ref. 4; CAD38868). {ECO:0000305}.	neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)		p.L238L(1)		NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCACCTTTCTCAAAGACCCAGGATCCTCCTTCC	0.488																																					p.234_238del												.	.	1	Substitution - coding silent(1)	lung(1)	c.702_714del	5						.			721,3495		76,569,1463						-0.3	0.0		dbSNP_107	106	1092,7070		103,886,3092	no	frameshift	GPRIN1	NM_052899.2		179,1455,4555	A1A1,A1R,RR		13.3791,17.1015,14.647				1813,10565				175958740	SO:0001589	frameshift_variant	114787	exon2			AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.702_714delTCCTGGGTCTTTG	5.37:g.176026122_176026134delCAAAGACCCAGGA	ENSP00000305839:p.Asp234fs		175958728	NM_052899	C9JM70|Q8ND74|Q96PZ4	Frame_Shift_Del	DEL	ENST00000303991.4	37	CCDS4405.1																																																																																				0.488	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899	
HLA-B	3106	broad.mit.edu	37	6	31324601	31324602	+	Frame_Shift_Ins	INS	-	-	G	rs41562914|rs41541416|rs9281379	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:31324601_31324602insG	ENST00000412585.2	-	2	234_235	c.206_207insC	c.(205-207)gagfs	p.E69fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	69	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.E69fs*30(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CCCGCGGCTCCTCTCTCGGACT	0.673									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.E69fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.207_208insC	6						.			1399,160,2559		395,63,546,25,47,983						0.1	0.1		dbSNP_130	35	1793,477,5714		469,110,745,86,195,2387	no	codingComplex	HLA-B	NM_005514.6		864,173,1291,111,242,3370	A1A1,A1A2,A1R,A2A2,A2R,RR		28.4319,37.8582,31.6394				3192,637,8273				31432581	SO:0001589	frameshift_variant	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.206_207insC	6.37:g.31324601_31324602insG	ENSP00000399168:p.Glu69fs		31432580	NM_005514	Q29764	Frame_Shift_Ins	INS	ENST00000412585.2	37	CCDS34394.1																																																																																				0.673	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
FYN	2534	broad.mit.edu	37	6	112041227	112041227	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:112041227C>A	ENST00000354650.3	-	4	634	c.28G>T	c.(28-30)Gaa>Taa	p.E10*	FYN_ENST00000229471.4_Nonsense_Mutation_p.E10*|FYN_ENST00000368682.3_Nonsense_Mutation_p.E10*|FYN_ENST00000356013.2_Nonsense_Mutation_p.E10*|FYN_ENST00000538466.1_Nonsense_Mutation_p.E10*|FYN_ENST00000368667.2_Nonsense_Mutation_p.E10*|FYN_ENST00000229470.5_Nonsense_Mutation_p.E10*|FYN_ENST00000368678.4_Nonsense_Mutation_p.E10*	NM_002037.5	NP_002028.1	P06241	FYN_HUMAN	FYN proto-oncogene, Src family tyrosine kinase	10					activated T cell proliferation (GO:0050798)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular response to peptide hormone stimulus (GO:0071375)|dendrite morphogenesis (GO:0048813)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|feeding behavior (GO:0007631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|leukocyte migration (GO:0050900)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein localization to nucleus (GO:1900182)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|glycoprotein binding (GO:0001948)|growth factor receptor binding (GO:0070851)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.E10*(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(17)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	30		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	TTTGTTGCTTCTTTATCCTTA	0.537																																					p.E10X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G28T	6						.						131.0	98.0	109.0					6																	112041227		2203	4300	6503	112147920	SO:0001587	stop_gained	2534	exon4			AK056699	CCDS5094.1, CCDS5095.1, CCDS5096.1	6q21	2014-06-25	2014-06-25		ENSG00000010810	ENSG00000010810		"""SH2 domain containing"""	4037	protein-coding gene	gene with protein product		137025	"""FYN oncogene related to SRC, FGR, YES"""			3526330	Standard	NM_002037		Approved	SYN, SLK, MGC45350	uc003pvh.3	P06241	OTTHUMG00000016305	ENST00000354650.3:c.28G>T	6.37:g.112041227C>A	ENSP00000346671:p.Glu10*		112147920	NM_002037	B5BU57|E1P557|H0UI48|Q16248|Q5R3A6|Q5R3A7|Q8N5D7	Nonsense_Mutation	SNP	ENST00000354650.3	37	CCDS5094.1	.	.	.	.	.	.	.	.	.	.	C	39	7.845158	0.98522	.	.	ENSG00000010810	ENST00000368682;ENST00000354650;ENST00000229471;ENST00000368667;ENST00000368678;ENST00000229470;ENST00000356013;ENST00000538466;ENST00000544792;ENST00000462856;ENST00000520518;ENST00000517419;ENST00000518295;ENST00000523238;ENST00000524310;ENST00000523574;ENST00000462598;ENST00000518630;ENST00000523570;ENST00000484067;ENST00000521062;ENST00000487824	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	19.919	0.97077	0.0:1.0:0.0:0.0	.	.	.	.	X	10	.	ENSP00000229470:E10X	E	-	1	0	FYN	112147920	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.714000	0.68422	2.707000	0.92482	0.655000	0.94253	GAA		0.537	FYN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043655.1		
HEY2	23493	broad.mit.edu	37	6	126080352	126080352	+	Missense_Mutation	SNP	G	G	A	rs3734638	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:126080352G>A	ENST00000368364.3	+	5	615	c.418G>A	c.(418-420)Gtg>Atg	p.V140M	HEY2_ENST00000368365.1_Missense_Mutation_p.V94M	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	140	Orange. {ECO:0000255|PROSITE- ProRule:PRU00380}.		V -> M (in dbSNP:rs3734638).		anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.V140M(1)		breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		CCTGAGCTCCGTGGAAGGCCT	0.597													G|||	6	0.00119808	0.0	0.0	5008	,	,		18737	0.006		0.0	False		,,,				2504	0.0				p.V140M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G418A	6						.						118.0	106.0	110.0					6																	126080352		2203	4300	6503	126122045	SO:0001583	missense	23493	exon5			AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.418G>A	6.37:g.126080352G>A	ENSP00000357348:p.Val140Met		126122045	NM_012259		Missense_Mutation	SNP	ENST00000368364.3	37	CCDS5131.1	7	0.003205128205128205	0	0.0	0	0.0	7	0.012237762237762238	0	0.0	G	20.4	3.978219	0.74360	.	.	ENSG00000135547	ENST00000368365;ENST00000368364	T;T	0.46451	0.87;0.87	5.54	5.54	0.83059	Orange subgroup (1);Orange (2);	0.083458	0.48286	D	0.000200	T	0.17365	0.0417	N	0.11341	0.13	0.80722	D	1	P	0.43519	0.809	B	0.40477	0.33	T	0.03364	-1.1044	10	0.28530	T	0.3	-25.4928	19.4671	0.94946	0.0:0.0:1.0:0.0	rs3734638;rs52789894;rs3734638	140	Q9UBP5	HEY2_HUMAN	M	94;140	ENSP00000357349:V94M;ENSP00000357348:V140M	ENSP00000357348:V140M	V	+	1	0	HEY2	126122045	1.000000	0.71417	0.996000	0.52242	0.925000	0.55904	5.656000	0.67988	2.606000	0.88127	0.561000	0.74099	GTG		0.597	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042077.1		
SYNE1	23345	broad.mit.edu	37	6	152688366	152688366	+	Missense_Mutation	SNP	G	G	A	rs548283137		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:152688366G>A	ENST00000367255.5	-	62	10560	c.9959C>T	c.(9958-9960)aCg>aTg	p.T3320M	SYNE1_ENST00000341594.5_Missense_Mutation_p.T3359M|SYNE1_ENST00000265368.4_Missense_Mutation_p.T3320M|SYNE1_ENST00000423061.1_Missense_Mutation_p.T3327M|SYNE1_ENST00000448038.1_Missense_Mutation_p.T3327M	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3320					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.T3320M(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAGCTTGAGCGTCCTGCTGTC	0.463										HNSCC(10;0.0054)			G|||	1	0.000199681	0.0	0.0	5008	,	,		19084	0.0		0.001	False		,,,				2504	0.0				p.T3327M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C9980T	6						.						179.0	167.0	171.0					6																	152688366		2203	4300	6503	152730059	SO:0001583	missense	23345	exon62			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.9959C>T	6.37:g.152688366G>A	ENSP00000356224:p.Thr3320Met		152730059	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.971|0.971	-0.700155|-0.700155	0.03279|0.03279	.|.	.|.	ENSG00000131018|ENSG00000131018	ENST00000454018|ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	.|T;T;T;T;T	.|0.52057	.|1.4;0.68;1.4;0.68;0.76	6.17|6.17	3.75|3.75	0.43078|0.43078	.|.	.|0.218384	.|0.41097	.|N	.|0.000955	T|T	0.03739|0.03739	0.0106|0.0106	N|N	0.00092|0.00092	-2.175|-2.175	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B	.|0.17268	.|0.003;0.003;0.021;0.003;0.005	.|B;B;B;B;B	.|0.06405	.|0.0;0.0;0.002;0.0;0.001	T|T	0.27331|0.27331	-1.0077|-1.0077	5|10	.|0.15066	.|T	.|0.55	.|.	11.1931|11.1931	0.48696|0.48696	0.8961:0.0:0.1039:0.0|0.8961:0.0:0.1039:0.0	.|.	.|3320;3320;437;3320;3327	.|B7ZBC3;Q8NF91;B7ZBC4;E7EQI5;Q8NF91-4	.|.;SYNE1_HUMAN;.;.;.	C|M	437|3320;3327;3320;3327;3359	.|ENSP00000356224:T3320M;ENSP00000396024:T3327M;ENSP00000265368:T3320M;ENSP00000390975:T3327M;ENSP00000341887:T3359M	.|ENSP00000265368:T3320M	R|T	-|-	1|2	0|0	SYNE1|SYNE1	152730059|152730059	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.414000|0.414000	0.31173|0.31173	7.145000|7.145000	0.77365|0.77365	0.570000|0.570000	0.29347|0.29347	-0.982000|-0.982000	0.02568|0.02568	CGC|ACG		0.463	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
DUSP22	56940	broad.mit.edu	37	6	348181	348181	+	Silent	SNP	C	C	T	rs539737732		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:348181C>T	ENST00000344450.5	+	6	785	c.342C>T	c.(340-342)gcC>gcT	p.A114A	DUSP22_ENST00000603453.1_Silent_p.A11A|DUSP22_ENST00000605315.1_Silent_p.A11A|DUSP22_ENST00000604971.1_Silent_p.A11A|DUSP22_ENST00000605863.1_Silent_p.A11A|DUSP22_ENST00000605035.1_Silent_p.A11A|DUSP22_ENST00000419235.2_Silent_p.A114A	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	114	Tyrosine-protein phosphatase.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.A114A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		GGGAGGATGCCCTGCACACCG	0.597																																					p.A114A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C342T	6						.						174.0	156.0	162.0					6																	348181		2203	4300	6503	293181	SO:0001819	synonymous_variant	56940	exon6			AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.342C>T	6.37:g.348181C>T			293181	NM_020185	B4DK56|Q59GW2|Q5VWR2|Q96AR1	Silent	SNP	ENST00000344450.5	37	CCDS4468.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.741091	0.30865	.	.	ENSG00000112679	ENST00000419235	.	.	.	5.82	3.87	0.44632	.	.	.	.	.	T	0.38878	0.1057	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39396	-0.9616	4	.	.	.	.	4.8596	0.13577	0.2772:0.5403:0.0:0.1825	.	.	.	.	S	52	.	.	P	+	1	0	DUSP22	293181	0.307000	0.24500	1.000000	0.80357	0.971000	0.66376	-0.203000	0.09438	1.464000	0.47987	0.655000	0.94253	CCT		0.597	DUSP22-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000039621.1	NM_020185	
HUS1B	135458	broad.mit.edu	37	6	656638	656638	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:656638G>A	ENST00000380907.2	-	1	325	c.307C>T	c.(307-309)Cag>Tag	p.Q103*	EXOC2_ENST00000230449.4_Intron|EXOC2_ENST00000448181.3_Intron	NM_148959.3	NP_683762.2	Q8NHY5	HUS1B_HUMAN	HUS1 checkpoint homolog b (S. pombe)	103					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)	checkpoint clamp complex (GO:0030896)|nucleolus (GO:0005730)		p.Q103*(1)		endometrium(3)|large_intestine(1)|lung(7)	11	Ovarian(93;0.0733)	Breast(5;0.00139)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.041)|BRCA - Breast invasive adenocarcinoma(62;0.0965)		TGGGTCAGCTGCAGCTTCAGG	0.701																																					p.Q103X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C307T	6						.						14.0	17.0	16.0					6																	656638		2189	4286	6475	601638	SO:0001587	stop_gained	135458	exon1			AF508547	CCDS4470.1	6p25.3	2008-08-08	2001-11-28		ENSG00000188996	ENSG00000188996			16485	protein-coding gene	gene with protein product		609713	"""HUS1 (S. pombe) checkpoint homolog b"""			11944979	Standard	NM_148959		Approved		uc003mtg.3	Q8NHY5	OTTHUMG00000090059	ENST00000380907.2:c.307C>T	6.37:g.656638G>A	ENSP00000370293:p.Gln103*		601638	NM_148959	Q5T4Z2	Nonsense_Mutation	SNP	ENST00000380907.2	37	CCDS4470.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062800	0.55432	.	.	ENSG00000188996	ENST00000380907	.	.	.	3.5	-1.14	0.09741	.	0.070080	0.53938	U	0.000051	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4907	0.38958	0.0:0.0:0.33:0.67	.	.	.	.	X	103	.	ENSP00000370293:Q103X	Q	-	1	0	HUS1B	601638	1.000000	0.71417	0.004000	0.12327	0.040000	0.13550	3.282000	0.51693	-0.078000	0.12730	0.491000	0.48974	CAG		0.701	HUS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205617.2	NM_148959	
HLA-B	3106	broad.mit.edu	37	6	31324604	31324604	+	Frame_Shift_Del	DEL	T	T	-	rs9266179|rs200186034	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:31324604delT	ENST00000412585.2	-	2	232	c.204delA	c.(202-204)agafs	p.R68fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	68	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.E69fs*8(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						GCGGCTCCTCTCTCGGACTCG	0.677									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.R68fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.204delA	6						.			1993,2105		740,513,796	33.0	33.0	33.0			-6.4	0.0	6	dbSNP_118	34	3347,4625		1272,803,1911	no	frameshift	HLA-B	NM_005514.6		2012,1316,2707	A1A1,A1R,RR		41.9844,48.6335,44.2419			31324604	5340,6730	2015	3950	5965	31432583	SO:0001589	frameshift_variant	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.204delA	6.37:g.31324604delT	ENSP00000399168:p.Arg68fs		31432583	NM_005514	Q29764	Frame_Shift_Del	DEL	ENST00000412585.2	37	CCDS34394.1																																																																																				0.677	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
SKIV2L	6499	broad.mit.edu	37	6	31932021	31932021	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:31932021T>A	ENST00000375394.2	+	17	1986	c.1873T>A	c.(1873-1875)Tca>Aca	p.S625T	SKIV2L_ENST00000544581.1_Missense_Mutation_p.S432T	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	625	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.S625T(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CCTGCACATGTCAGAGCTCCT	0.597																																					p.S625T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1873A	6						.						106.0	77.0	88.0					6																	31932021		1510	2709	4219	32040000	SO:0001583	missense	6499	exon17				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1873T>A	6.37:g.31932021T>A	ENSP00000364543:p.Ser625Thr		32040000	NM_006929	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.293857	0.40594	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.42131	0.98;0.98	5.95	4.78	0.61160	Helicase, C-terminal (2);	0.242150	0.37178	N	0.002211	T	0.10766	0.0263	L	0.28649	0.875	0.32512	N	0.537461	B	0.27823	0.19	B	0.16722	0.016	T	0.10019	-1.0648	10	0.40728	T	0.16	-12.3571	2.9027	0.05711	0.1456:0.0762:0.1524:0.6259	.	625	Q15477	SKIV2_HUMAN	T	625;467;432	ENSP00000364543:S625T;ENSP00000442645:S432T	ENSP00000364543:S625T	S	+	1	0	SKIV2L	32040000	0.994000	0.37717	0.976000	0.42696	0.988000	0.76386	0.545000	0.23268	1.053000	0.40415	0.533000	0.62120	TCA		0.597	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
PPARD	5467	broad.mit.edu	37	6	35389614	35389614	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:35389614G>A	ENST00000311565.4	+	6	652	c.303G>A	c.(301-303)acG>acA	p.T101T	PPARD_ENST00000360694.3_Silent_p.T101T|PPARD_ENST00000540939.1_5'UTR|PPARD_ENST00000337400.2_Silent_p.T101T|PPARD_ENST00000418635.2_Intron|PPARD_ENST00000448077.2_Silent_p.T62T|PPARD_ENST00000444397.1_Silent_p.T101T	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	101					adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.T101T(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	TCCGTCGTACGATCCGCATGA	0.557																																					p.T101T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G303A	6						.						95.0	83.0	87.0					6																	35389614		2203	4300	6503	35497592	SO:0001819	synonymous_variant	5467	exon6			L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.303G>A	6.37:g.35389614G>A			35497592	NM_001171818	A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Silent	SNP	ENST00000311565.4	37	CCDS4803.1																																																																																				0.557	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040288.1	NM_006238	
MDGA1	266727	broad.mit.edu	37	6	37619824	37619824	+	Silent	SNP	G	G	A	rs560720783		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:37619824G>A	ENST00000434837.3	-	7	2453	c.1275C>T	c.(1273-1275)ccC>ccT	p.P425P	MDGA1_ENST00000297153.7_Silent_p.P425P|MDGA1_ENST00000505425.1_Silent_p.P425P	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	425	Ig-like 4.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)		p.P425P(1)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						CGCTGAGGTCGGGCACGGGTG	0.617													g|||	1	0.000199681	0.0	0.0014	5008	,	,		19663	0.0		0.0	False		,,,				2504	0.0				p.P425P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1275T	6						.						24.0	25.0	25.0					6																	37619824		2046	4178	6224	37727802	SO:0001819	synonymous_variant	266727	exon7			AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.1275C>T	6.37:g.37619824G>A			37727802	NM_153487	A6NHG0|Q8NBE3	Silent	SNP	ENST00000434837.3	37	CCDS47417.1																																																																																				0.617	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3		
EYS	346007	broad.mit.edu	37	6	66205165	66205165	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:66205165C>A	ENST00000370621.3	-	4	665	c.139G>T	c.(139-141)Gaa>Taa	p.E47*	EYS_ENST00000342421.5_Nonsense_Mutation_p.E47*|EYS_ENST00000503581.1_Nonsense_Mutation_p.E47*|EYS_ENST00000370616.2_Nonsense_Mutation_p.E47*|EYS_ENST00000393380.2_Nonsense_Mutation_p.E47*|EYS_ENST00000370618.3_Nonsense_Mutation_p.E47*			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	47					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.E47*(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CAGATGTTTTCTGTTAGTGTC	0.398																																					p.E47X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G139T	6						.						109.0	109.0	109.0					6																	66205165		2203	4300	6503	66261886	SO:0001587	stop_gained	346007	exon3				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.139G>T	6.37:g.66205165C>A	ENSP00000359655:p.Glu47*		66261886	NM_198283	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Nonsense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	C	39	7.903281	0.98554	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	.	.	.	5.13	4.26	0.50523	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	10.7447	0.46172	0.0:0.9104:0.0:0.0896	.	.	.	.	X	47	.	ENSP00000341818:E47X	E	-	1	0	EYS	66261886	0.085000	0.21516	0.012000	0.15200	0.922000	0.55478	0.811000	0.27198	1.273000	0.44346	0.591000	0.81541	GAA		0.398	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
COL19A1	1310	broad.mit.edu	37	6	70866060	70866060	+	Silent	SNP	A	A	G			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:70866060A>G	ENST00000322773.4	+	32	2223	c.2121A>G	c.(2119-2121)aaA>aaG	p.K707K	COL19A1_ENST00000393344.1_Silent_p.K329K	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	707	Triple-helical region 4 (COL4).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.K707K(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CAGGGCTGAAAAGCAACAAAG	0.483																																					p.K707K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2121G	6						.						115.0	98.0	104.0					6																	70866060		2203	4300	6503	70922781	SO:0001819	synonymous_variant	1310	exon32				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2121A>G	6.37:g.70866060A>G			70922781	NM_001858	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Silent	SNP	ENST00000322773.4	37	CCDS4970.1																																																																																				0.483	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
FAM135A	57579	broad.mit.edu	37	6	71186932	71186932	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:71186932G>A	ENST00000418814.2	+	8	1053	c.439G>A	c.(439-441)Ggc>Agc	p.G147S	FAM135A_ENST00000505769.1_Missense_Mutation_p.G147S|FAM135A_ENST00000370479.3_Missense_Mutation_p.G104S|FAM135A_ENST00000361499.3_Missense_Mutation_p.G147S|FAM135A_ENST00000457062.2_Missense_Mutation_p.G104S|FAM135A_ENST00000505868.1_Missense_Mutation_p.G147S	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	147								p.G104S(1)		breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						CCCCCATAGAGGCCTTCATCA	0.408																																					p.G147S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G439A	6						.						181.0	159.0	166.0					6																	71186932		2203	4300	6503	71243653	SO:0001583	missense	57579	exon6			AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.439G>A	6.37:g.71186932G>A	ENSP00000410768:p.Gly147Ser		71243653	NM_001162529	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	ENST00000418814.2	37	CCDS55028.1	.	.	.	.	.	.	.	.	.	.	G	35	5.501905	0.96371	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000505769;ENST00000515323;ENST00000457062;ENST00000361499;ENST00000505868	T;T;T;T;T;T;T	0.77229	-1.08;0.55;-1.08;-1.08;0.55;-1.08;-1.08	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.86301	0.5900	M	0.71581	2.175	0.58432	D	0.999992	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.86384	0.1731	10	0.59425	D	0.04	.	19.5208	0.95184	0.0:0.0:1.0:0.0	.	147;147;147;104	D6RC17;Q9P2D6;Q9P2D6-2;Q9P2D6-3	.;F135A_HUMAN;.;.	S	147;104;147;147;104;147;147	ENSP00000410768:G147S;ENSP00000359510:G104S;ENSP00000423785:G147S;ENSP00000422406:G147S;ENSP00000409201:G104S;ENSP00000354913:G147S;ENSP00000423307:G147S	ENSP00000354913:G147S	G	+	1	0	FAM135A	71243653	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.837000	0.99465	2.625000	0.88918	0.460000	0.39030	GGC		0.408	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	NM_020819	
SLC17A5	26503	broad.mit.edu	37	6	74304857	74304857	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:74304857G>A	ENST00000355773.5	-	11	1699	c.1431C>T	c.(1429-1431)ttC>ttT	p.F477F		NM_012434.4	NP_036566.1	Q9NRA2	S17A5_HUMAN	solute carrier family 17 (acidic sugar transporter), member 5	477					amino acid transport (GO:0006865)|anion transport (GO:0006820)|ion transport (GO:0006811)|proton transport (GO:0015992)|sialic acid transport (GO:0015739)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	sialic acid transmembrane transporter activity (GO:0015136)|sugar:proton symporter activity (GO:0005351)	p.F477F(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CACCTTTGGCGAATAGTGTAA	0.363																																					p.F477F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1431T	6						.						152.0	147.0	149.0					6																	74304857		2203	4300	6503	74361578	SO:0001819	synonymous_variant	26503	exon11			AJ387747	CCDS4981.1	6q13	2013-07-18	2013-07-18		ENSG00000119899	ENSG00000119899		"""Solute carriers"""	10933	protein-coding gene	gene with protein product		604322	"""sialic acid storage disease"", ""solute carrier family 17 (anion/sugar transporter), member 5"""	SIASD		10581036, 8198127	Standard	NM_012434		Approved	AST, SD, ISSD, NSD, SIALIN, SLD	uc003phn.4	Q9NRA2	OTTHUMG00000015039	ENST00000355773.5:c.1431C>T	6.37:g.74304857G>A			74361578	NM_012434	Q5SZ76|Q8NBR5|Q9UGH0	Silent	SNP	ENST00000355773.5	37	CCDS4981.1																																																																																				0.363	SLC17A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041228.1		
COL12A1	1303	broad.mit.edu	37	6	75901939	75901939	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:75901939C>A	ENST00000322507.8	-	4	632	c.323G>T	c.(322-324)gGa>gTa	p.G108V	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.G108V|COL12A1_ENST00000483888.2_Missense_Mutation_p.G108V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	108	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.G108V(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGTTAGTTGTCCTATAACTGG	0.289																																					p.G108V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G323T	6						.						88.0	71.0	76.0					6																	75901939		1817	4064	5881	75958659	SO:0001583	missense	1303	exon4			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.323G>T	6.37:g.75901939C>A	ENSP00000325146:p.Gly108Val		75958659	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320818	0.81469	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.04156	3.69;3.69;3.69	6.06	6.06	0.98353	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.16599	0.0399	M	0.73319	2.225	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00253	-1.1875	10	0.51188	T	0.08	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	108	Q99715	COCA1_HUMAN	V	108	ENSP00000325146:G108V;ENSP00000412864:G108V;ENSP00000421216:G108V	ENSP00000325146:G108V	G	-	2	0	COL12A1	75958659	1.000000	0.71417	0.998000	0.56505	0.794000	0.44872	7.118000	0.77137	2.880000	0.98712	0.650000	0.86243	GGA		0.289	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
SYNE1	23345	broad.mit.edu	37	6	152777044	152777044	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr6:152777044C>A	ENST00000367255.5	-	23	3305	c.2704G>T	c.(2704-2706)Gca>Tca	p.A902S	SYNE1_ENST00000341594.5_Missense_Mutation_p.C953F|SYNE1_ENST00000265368.4_Missense_Mutation_p.A902S|SYNE1_ENST00000423061.1_Missense_Mutation_p.A909S|SYNE1_ENST00000367253.4_Missense_Mutation_p.A902S|SYNE1_ENST00000367248.3_Missense_Mutation_p.A892S|SYNE1_ENST00000448038.1_Missense_Mutation_p.A909S|SYNE1_ENST00000495090.2_Missense_Mutation_p.A469S|SYNE1_ENST00000413186.2_Missense_Mutation_p.A902S	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	902					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.A902S(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGAATATCTGCAATCTGTCTT	0.423										HNSCC(10;0.0054)																											p.A909S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2725T	6						.						157.0	134.0	142.0					6																	152777044		2203	4300	6503	152818737	SO:0001583	missense	23345	exon23			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.2704G>T	6.37:g.152777044C>A	ENSP00000356224:p.Ala902Ser		152818737	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.67|12.67	2.006290|2.006290	0.35415|0.35415	.|.	.|.	ENSG00000131018|ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000495090|ENST00000341594	T;T;T;T;T;T;T;T|T	0.34072|0.46451	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38|0.87	5.49|5.49	3.67|3.67	0.42095|0.42095	.|.	0.341646|.	0.24899|.	N|.	0.034711|.	T|T	0.29355|0.29355	0.0731|0.0731	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	B;B;B;B;B;B;B|.	0.33940|.	0.055;0.323;0.433;0.231;0.348;0.323;0.066|.	B;B;B;B;B;B;B|.	0.36244|.	0.022;0.079;0.167;0.22;0.22;0.079;0.044|.	T|T	0.23119|0.23119	-1.0197|-1.0197	10|7	0.15952|0.56958	T|D	0.53|0.05	.|.	3.6838|3.6838	0.08320|0.08320	0.1759:0.545:0.0:0.279|0.1759:0.545:0.0:0.279	.|.	885;902;469;892;902;902;909|.	B3W695;Q8NF91;F5H422;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4|.	.;SYNE1_HUMAN;.;.;.;.;.|.	S|F	902;909;902;909;902;892;902;469|953	ENSP00000356224:A902S;ENSP00000396024:A909S;ENSP00000265368:A902S;ENSP00000390975:A909S;ENSP00000356222:A902S;ENSP00000356217:A892S;ENSP00000414510:A902S;ENSP00000438508:A469S|ENSP00000341887:C953F	ENSP00000265368:A902S|ENSP00000341887:C953F	A|C	-|-	1|2	0|0	SYNE1|SYNE1	152818737|152818737	0.958000|0.958000	0.32768|0.32768	0.985000|0.985000	0.45067|0.45067	0.884000|0.884000	0.51177|0.51177	1.318000|1.318000	0.33643|0.33643	0.641000|0.641000	0.30601|0.30601	-0.150000|-0.150000	0.13652|0.13652	GCA|TGC		0.423	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
GPER1	2852	broad.mit.edu	37	7	1132186	1132186	+	Silent	SNP	G	G	A	rs369986460		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:1132186G>A	ENST00000297469.3	+	2	1513	c.822G>A	c.(820-822)ccG>ccA	p.P274P	GPER1_ENST00000397092.1_Silent_p.P274P|GPER1_ENST00000401670.1_Silent_p.P274P|GPER1_ENST00000397088.3_Silent_p.P274P|C7orf50_ENST00000397100.2_Intron|C7orf50_ENST00000357429.6_Intron|C7orf50_ENST00000397098.3_Intron|C7orf50_ENST00000488073.1_Intron	NM_001505.2	NP_001496.1	Q99527	GPER1_HUMAN	G protein-coupled estrogen receptor 1	274					apoptotic chromosome condensation (GO:0030263)|cell cycle (GO:0007049)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucose stimulus (GO:0071333)|cellular response to mineralocorticoid stimulus (GO:0071389)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytosolic calcium ion homeostasis (GO:0051480)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA metabolic process (GO:0051053)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte activation (GO:0002695)|negative regulation of lipid biosynthetic process (GO:0051055)|neuronal action potential (GO:0019228)|nuclear fragmentation involved in apoptotic nuclear change (GO:0030264)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of gene expression (GO:0010628)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of insulin secretion (GO:0032024)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vasodilation (GO:0045909)|steroid hormone mediated signaling pathway (GO:0043401)	axon (GO:0030424)|axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine head (GO:0044327)|dendritic spine membrane (GO:0032591)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|keratin filament (GO:0045095)|mitochondrial membrane (GO:0031966)|neuronal postsynaptic density (GO:0097481)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	chromatin binding (GO:0003682)|estrogen receptor activity (GO:0030284)|G-protein coupled receptor activity (GO:0004930)|mineralocorticoid receptor activity (GO:0017082)|steroid binding (GO:0005496)	p.P274P(1)									GCTGGCTGCCGGAGAACGTCT	0.697																																					p.P274P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G822A	7						.		,,,,,	1,4405	2.1+/-5.4	0,1,2202	57.0	58.0	58.0		822,822,,,822,	-10.9	0.9	7		58	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous,intron,intron,coding-synonymous,intron	GPER,C7orf50	NM_001039966.1,NM_001098201.1,NM_001134395.1,NM_001134396.1,NM_001505.2,NM_032350.5	,,,,,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,,,,,	274/376,274/376,,,274/376,	1132186	1,13003	2203	4299	6502	1098712	SO:0001819	synonymous_variant	2852	exon2			U63917	CCDS5322.1	7p22	2013-08-14	2007-07-03	2013-08-14	ENSG00000164850	ENSG00000164850			4485	protein-coding gene	gene with protein product		601805	"""G protein-coupled receptor 30"""	CMKRL2, GPR30, GPER		9479505, 17655271	Standard	NM_001098201		Approved	FEG-1, GPCR-Br, LERGU, LERGU2, DRY12, LyGPR, CEPR	uc003skb.2	Q99527	OTTHUMG00000023680	ENST00000297469.3:c.822G>A	7.37:g.1132186G>A			1098712	NM_001505	A8K6C5|B5BUJ1|O00143|O43494|Q13631|Q6FHL1|Q96F42|Q99981	Silent	SNP	ENST00000297469.3	37	CCDS5322.1																																																																																				0.697	GPER1-030	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060001.1	NM_001039966	
PRSS1	5644	broad.mit.edu	37	7	142459877	142459877	+	Splice_Site	SNP	C	C	T	rs147765409		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:142459877C>T	ENST00000311737.7	+	3	459	c.453C>T	c.(451-453)ggC>ggT	p.G151G	PRSS1_ENST00000486171.1_Splice_Site_p.G165G	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	151	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.G151G(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	CGAGCTCTGGCGGTGAGTGGG	0.567																																					p.G151G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C453T	7						.						62.0	64.0	63.0					7																	142459877		2203	4300	6503	142139451	SO:0001630	splice_region_variant	5644	exon3			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.454+1C>T	7.37:g.142459877C>T			142139451	NM_002769	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	ENST00000311737.7	37	CCDS5872.1																																																																																				0.567	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		Silent
ACTB	60	broad.mit.edu	37	7	5567393	5567393	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:5567393G>A	ENST00000331789.5	-	6	1305	c.1114C>T	c.(1114-1116)Cgc>Tgc	p.R372C	ACTB_ENST00000464611.1_5'UTR|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	372					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)	p.R372C(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		AAGCATTTGCGGTGGACGATG	0.527																																					p.R372C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1114T	7						.						125.0	130.0	128.0					7																	5567393		2203	4300	6503	5533919	SO:0001583	missense	60	exon6			M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.1114C>T	7.37:g.5567393G>A	ENSP00000349960:p.Arg372Cys		5533919	NM_001101	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000331789.5	37	CCDS5341.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.372339	0.24857	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000320713	D	0.95238	-3.65	5.66	3.82	0.43975	.	0.000000	0.64402	D	0.000012	D	0.95459	0.8525	H	0.95224	3.64	0.52099	D	0.99994	B	0.13145	0.007	B	0.16722	0.016	D	0.94307	0.7542	10	0.87932	D	0	.	10.4527	0.44531	0.0705:0.0:0.7973:0.1322	.	372	P60709	ACTB_HUMAN	C	372;348;344;291	ENSP00000349960:R372C	ENSP00000440549:R291C	R	-	1	0	ACTB	5533919	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.214000	0.65236	1.393000	0.46605	0.650000	0.86243	CGC		0.527	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101	
OCM	654231	broad.mit.edu	37	7	5920536	5920536	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:5920536G>A	ENST00000242104.5	+	1	108	c.16G>A	c.(16-18)Gtg>Atg	p.V6M	OCM_ENST00000416608.1_Missense_Mutation_p.V6M	NM_001097622.1	NP_001091091.1	P0CE72	ONCO_HUMAN	oncomodulin	6							calcium ion binding (GO:0005509)	p.V6M(1)		endometrium(1)|large_intestine(3)|lung(2)	6		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0978)|OV - Ovarian serous cystadenocarcinoma(56;2.11e-14)		CATCACGGACGTGCTCAGTGC	0.547																																					p.V6M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G16A	7						.						119.0	106.0	110.0					7																	5920536		2203	4300	6503	5887062	SO:0001583	missense	654231	exon1			BC069468	CCDS43548.1	7p22.1	2013-01-10						"""EF-hand domain containing"""	8105	protein-coding gene	gene with protein product	"""oncomodulin 1"""	164795				1559707, 8354278	Standard	NM_001097622		Approved	OCM1	uc003spe.4	P0CE72		ENST00000242104.5:c.16G>A	7.37:g.5920536G>A	ENSP00000242104:p.Val6Met		5887062	NM_001097622	B9EJH7|P32930|Q6ISI5|Q75MW0	Missense_Mutation	SNP	ENST00000242104.5	37	CCDS43548.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.704503	0.30232	.	.	ENSG00000122543	ENST00000416608;ENST00000242104	T;T	0.79033	-1.23;-1.23	4.17	0.948	0.19561	.	0.312314	0.30483	N	0.009524	T	0.62380	0.2423	L	0.39898	1.24	0.27934	N	0.937757	B	0.06786	0.001	B	0.04013	0.001	T	0.51092	-0.8749	10	0.45353	T	0.12	-12.5608	3.1946	0.06629	0.1052:0.2211:0.512:0.1618	.	6	P0CE72	ONCO_HUMAN	M	6	ENSP00000401365:V6M;ENSP00000242104:V6M	ENSP00000242104:V6M	V	+	1	0	OCM	5887062	0.009000	0.17119	0.429000	0.26710	0.944000	0.59088	-0.128000	0.10531	-0.069000	0.12931	0.502000	0.49764	GTG		0.547	OCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340372.1	NM_001097622	
INHBA	3624	broad.mit.edu	37	7	41729481	41729481	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:41729481A>G	ENST00000242208.4	-	3	1294	c.1048T>C	c.(1048-1050)Tgc>Cgc	p.C350R	INHBA_ENST00000464515.1_5'UTR|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000442711.1_Missense_Mutation_p.C350R	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	350					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)	p.C350R(1)		biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						TCACCCTCGCAGTAGTTGGCA	0.537										TSP Lung(11;0.080)																											p.C350R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1048C	7						.						105.0	100.0	102.0					7																	41729481		2203	4300	6503	41696006	SO:0001583	missense	3624	exon3				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.1048T>C	7.37:g.41729481A>G	ENSP00000242208:p.Cys350Arg		41696006	NM_002192	Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	17.20	3.329791	0.60743	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	D;D	0.98105	-4.72;-4.72	5.97	5.97	0.96955	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99312	0.9759	H	0.98388	4.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98570	1.0645	10	0.87932	D	0	-15.8771	16.4383	0.83889	1.0:0.0:0.0:0.0	.	350	P08476	INHBA_HUMAN	R	350	ENSP00000242208:C350R;ENSP00000397197:C350R	ENSP00000242208:C350R	C	-	1	0	INHBA	41696006	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.257000	0.95545	2.287000	0.76781	0.482000	0.46254	TGC		0.537	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
PCLO	27445	broad.mit.edu	37	7	82586018	82586018	+	Silent	SNP	T	T	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:82586018T>A	ENST00000333891.9	-	5	4588	c.4251A>T	c.(4249-4251)ctA>ctT	p.L1417L	PCLO_ENST00000423517.2_Silent_p.L1417L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.L1417L(2)|p.L1348L(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCAAAATAGATAGGACTGTAC	0.408																																					p.L1417L												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.A4251T	7						.						113.0	105.0	107.0					7																	82586018		1830	4085	5915	82423954	SO:0001819	synonymous_variant	27445	exon5			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.4251A>T	7.37:g.82586018T>A			82423954	NM_033026		Silent	SNP	ENST00000333891.9	37	CCDS47630.1																																																																																				0.408	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
COL1A2	1278	broad.mit.edu	37	7	94052317	94052317	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:94052317C>A	ENST00000297268.6	+	40	2923	c.2452C>A	c.(2452-2454)Ctt>Att	p.L818I		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	818			Missing (in OI2). {ECO:0000269|PubMed:1339453}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)	p.L818I(1)	COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GAAAGAAGGGCTTCGTGGTCC	0.562										HNSCC(75;0.22)																											p.L818I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2452A	7						.						163.0	156.0	159.0					7																	94052317		2203	4300	6503	93890253	SO:0001583	missense	1278	exon40			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2452C>A	7.37:g.94052317C>A	ENSP00000297268:p.Leu818Ile		93890253	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.561902	0.45590	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93659	-3.26	5.08	0.294	0.15747	.	0.265381	0.37809	N	0.001924	D	0.86760	0.6010	L	0.28054	0.825	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.75900	-0.3154	10	0.52906	T	0.07	.	11.5836	0.50906	0.5594:0.3326:0.108:0.0	.	818	P08123	CO1A2_HUMAN	I	818;819	ENSP00000297268:L818I	ENSP00000297268:L818I	L	+	1	0	COL1A2	93890253	0.000000	0.05858	0.027000	0.17364	0.933000	0.57130	0.090000	0.15025	-0.173000	0.10761	-0.309000	0.09137	CTT		0.562	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
NPTX2	4885	broad.mit.edu	37	7	98254457	98254457	+	Silent	SNP	C	C	T	rs369073829	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:98254457C>T	ENST00000265634.3	+	3	1032	c.867C>T	c.(865-867)atC>atT	p.I289I		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	289	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.I289I(2)		breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			ACAACCCCATCGAGCTGCTCA	0.662													C|||	2	0.000399361	0.0008	0.0	5008	,	,		14279	0.0		0.001	False		,,,				2504	0.0				p.I289I												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C867T	7						.	C		1,4405	2.1+/-5.4	0,1,2202	72.0	60.0	64.0		867	-5.3	0.9	7		64	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous	NPTX2	NM_002523.2		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		289/432	98254457	3,13003	2203	4300	6503	98092393	SO:0001819	synonymous_variant	4885	exon3				CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.867C>T	7.37:g.98254457C>T			98092393	NM_002523	A4D267|Q86XV7|Q96G70	Silent	SNP	ENST00000265634.3	37	CCDS5657.1																																																																																				0.662	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
ZKSCAN5	23660	broad.mit.edu	37	7	99103921	99103921	+	Missense_Mutation	SNP	C	C	T	rs115127995		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:99103921C>T	ENST00000394170.2	+	2	505	c.254C>T	c.(253-255)aCg>aTg	p.T85M	ZKSCAN5_ENST00000326775.5_Missense_Mutation_p.T85M|ZKSCAN5_ENST00000451158.1_Missense_Mutation_p.T85M	NM_014569.3	NP_055384.1	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	85	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T85M(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	21	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GAGCTGCACACGAAGGAGCAG	0.612																																					p.T85M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C254T	7						.						71.0	74.0	73.0					7																	99103921		2203	4300	6503	98941857	SO:0001583	missense	23660	exon2			AF170025	CCDS5667.1	7q22	2013-01-09	2007-02-20	2007-02-20	ENSG00000196652	ENSG00000196652		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12867	protein-coding gene	gene with protein product		611272	"""zinc finger protein homologous to Zfp95 in mouse"", ""zinc finger protein 95 homolog (mouse)"""	ZFP95		10585779	Standard	NM_014569		Approved	ZNF914, ZSCAN37	uc003uqv.3	Q9Y2L8	OTTHUMG00000156749	ENST00000394170.2:c.254C>T	7.37:g.99103921C>T	ENSP00000377725:p.Thr85Met		98941857	NM_145102	A4D280|D6W5S9	De_novo_Start_OutOfFrame	SNP	ENST00000394170.2	37	CCDS5667.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358094	0.82243	.	.	ENSG00000196652	ENST00000537357;ENST00000326775;ENST00000451158;ENST00000394170;ENST00000439985	T;T;T	0.12039	2.72;2.72;2.72	4.93	4.93	0.64822	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.122950	0.36932	N	0.002325	T	0.42426	0.1202	M	0.88450	2.955	0.39382	D	0.966271	D;D	0.89917	1.0;1.0	D;D	0.69824	0.966;0.966	T	0.50533	-0.8817	10	0.87932	D	0	.	13.8578	0.63540	0.0:1.0:0.0:0.0	.	85;85	Q8N718;Q9Y2L8	.;ZKSC5_HUMAN	M	85;85;85;85;33	ENSP00000322872:T85M;ENSP00000392104:T85M;ENSP00000377725:T85M	ENSP00000322872:T85M	T	+	2	0	ZKSCAN5	98941857	0.998000	0.40836	1.000000	0.80357	0.820000	0.46376	2.993000	0.49425	2.735000	0.93741	0.561000	0.74099	ACG		0.612	ZKSCAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345597.1	NM_014569	
ZKSCAN5	23660	broad.mit.edu	37	7	99128905	99128905	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:99128905T>C	ENST00000394170.2	+	7	1804	c.1553T>C	c.(1552-1554)aTg>aCg	p.M518T	ZKSCAN5_ENST00000326775.5_Missense_Mutation_p.M518T|ZKSCAN5_ENST00000451158.1_Missense_Mutation_p.M518T	NM_014569.3	NP_055384.1	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	518					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.M518T(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	21	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GGAATTCCCATGAAAGAGATA	0.408																																					p.M518T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1553C	7						.						100.0	103.0	102.0					7																	99128905		2203	4300	6503	98966841	SO:0001583	missense	23660	exon7			AF170025	CCDS5667.1	7q22	2013-01-09	2007-02-20	2007-02-20	ENSG00000196652	ENSG00000196652		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12867	protein-coding gene	gene with protein product		611272	"""zinc finger protein homologous to Zfp95 in mouse"", ""zinc finger protein 95 homolog (mouse)"""	ZFP95		10585779	Standard	NM_014569		Approved	ZNF914, ZSCAN37	uc003uqv.3	Q9Y2L8	OTTHUMG00000156749	ENST00000394170.2:c.1553T>C	7.37:g.99128905T>C	ENSP00000377725:p.Met518Thr		98966841	NM_145102	A4D280|D6W5S9	Missense_Mutation	SNP	ENST00000394170.2	37	CCDS5667.1	.	.	.	.	.	.	.	.	.	.	T	2.078	-0.411505	0.04799	.	.	ENSG00000196652	ENST00000537357;ENST00000326775;ENST00000451158;ENST00000394170	T;T;T	0.07021	3.23;3.23;3.23	5.06	1.41	0.22369	.	0.280453	0.32081	N	0.006616	T	0.02649	0.0080	N	0.08118	0	0.26507	N	0.974661	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.44636	-0.9315	10	0.02654	T	1	.	3.8101	0.08793	0.0:0.1908:0.1879:0.6214	.	518;518	Q8N718;Q9Y2L8	.;ZKSC5_HUMAN	T	518	ENSP00000322872:M518T;ENSP00000392104:M518T;ENSP00000377725:M518T	ENSP00000322872:M518T	M	+	2	0	ZKSCAN5	98966841	0.190000	0.23276	0.898000	0.35279	0.787000	0.44495	1.030000	0.30153	0.474000	0.27392	0.383000	0.25322	ATG		0.408	ZKSCAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345597.1	NM_014569	
CNTNAP2	26047	broad.mit.edu	37	7	146471367	146471367	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr7:146471367A>T	ENST00000361727.3	+	2	618	c.102A>T	c.(100-102)aaA>aaT	p.K34N		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	34					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.K34N(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TTTCAGAAAAATGTGATGAGC	0.428										HNSCC(39;0.1)																											p.K34N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A102T	7						.						57.0	56.0	56.0					7																	146471367		2203	4300	6503	146102300	SO:0001583	missense	26047	exon2			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.102A>T	7.37:g.146471367A>T	ENSP00000354778:p.Lys34Asn		146102300	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	A	8.307	0.821156	0.16678	.	.	ENSG00000174469	ENST00000361727	D	0.88741	-2.42	5.74	2.16	0.27623	Coagulation factor 5/8 C-terminal type domain (1);	0.000000	0.52532	D	0.000061	T	0.72732	0.3497	N	0.12182	0.205	0.80722	D	1	B	0.18610	0.029	B	0.12837	0.008	T	0.60571	-0.7237	10	0.06365	T	0.9	.	7.8762	0.29595	0.7571:0.0:0.2429:0.0	.	34	Q9UHC6	CNTP2_HUMAN	N	34	ENSP00000354778:K34N	ENSP00000354778:K34N	K	+	3	2	CNTNAP2	146102300	1.000000	0.71417	1.000000	0.80357	0.656000	0.38851	1.985000	0.40668	0.455000	0.26910	-0.263000	0.10527	AAA		0.428	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
TMEM74	157753	broad.mit.edu	37	8	109796640	109796640	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr8:109796640G>A	ENST00000297459.3	-	2	866	c.688C>T	c.(688-690)Cgc>Tgc	p.R230C	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	230					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.R230C(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			ATCACACAGCGGTCCAGGTGA	0.622																																					p.R230C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C688T	8						.						59.0	57.0	58.0					8																	109796640		2203	4300	6503	109865816	SO:0001583	missense	157753	exon2			AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.688C>T	8.37:g.109796640G>A	ENSP00000297459:p.Arg230Cys		109865816	NM_153015		Missense_Mutation	SNP	ENST00000297459.3	37	CCDS6310.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308883	0.60305	.	.	ENSG00000164841	ENST00000297459	T	0.17213	2.29	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.38532	0.1044	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.05451	-1.0884	10	0.87932	D	0	-16.2628	13.0476	0.58935	0.0:0.0:0.7246:0.2754	.	230	Q96NL1	TMM74_HUMAN	C	230	ENSP00000297459:R230C	ENSP00000297459:R230C	R	-	1	0	TMEM74	109865816	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	3.999000	0.57031	2.821000	0.97095	0.650000	0.86243	CGC		0.622	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380755.1	NM_153015	
TRPS1	7227	broad.mit.edu	37	8	116427000	116427000	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr8:116427000G>T	ENST00000220888.5	-	6	3256	c.3097C>A	c.(3097-3099)Caa>Aaa	p.Q1033K	TRPS1_ENST00000519076.1_Missense_Mutation_p.Q787K|TRPS1_ENST00000395715.3_Missense_Mutation_p.Q1046K|TRPS1_ENST00000520276.1_Missense_Mutation_p.Q1037K			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1033	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.Q1033K(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TGCAAAGGTTGCATCCTTTTG	0.453									Langer-Giedion syndrome																												p.Q1046K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3136A	8						.						143.0	135.0	138.0					8																	116427000		1904	4121	6025	116496176	SO:0001583	missense	7227	exon7	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3097C>A	8.37:g.116427000G>T	ENSP00000220888:p.Gln1033Lys		116496176	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.05|15.05	2.719616|2.719616	0.48728|0.48728	.|.	.|.	ENSG00000104447|ENSG00000104447	ENST00000518018|ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	.|D;D;D;D	.|0.98381	.|-4.9;-4.88;-4.87;-4.88	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.061993	.|0.64402	.|D	.|0.000002	D|D	0.95236|0.95236	0.8455|0.8455	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.26547	.|0.152;0.094;0.152	.|B;B;B	.|0.21708	.|0.036;0.016;0.036	D|D	0.92307|0.92307	0.5854|0.5854	5|10	.|0.59425	.|D	.|0.04	.|.	19.6491|19.6491	0.95794|0.95794	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1037;1033;1046	.|Q9UHF7-3;Q9UHF7;Q9UHF7-2	.|.;TRPS1_HUMAN;.	E|K	157|1046;1033;787;1037	.|ENSP00000379065:Q1046K;ENSP00000220888:Q1033K;ENSP00000428910:Q787K;ENSP00000428680:Q1037K	.|ENSP00000220888:Q1033K	A|Q	-|-	2|1	0|0	TRPS1|TRPS1	116496176|116496176	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.464000|7.464000	0.80887|0.80887	2.638000|2.638000	0.89438|0.89438	0.655000|0.655000	0.94253|0.94253	GCA|CAA		0.453	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
FAM135B	51059	broad.mit.edu	37	8	139164067	139164067	+	Missense_Mutation	SNP	C	C	T	rs143605493	byFrequency	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr8:139164067C>T	ENST00000395297.1	-	13	2821	c.2651G>A	c.(2650-2652)cGc>cAc	p.R884H		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	884								p.R884H(4)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGCTATGACGCGTGGTATTTT	0.463										HNSCC(54;0.14)			C|||	3	0.000599042	0.0008	0.0014	5008	,	,		20098	0.001		0.0	False		,,,				2504	0.0				p.R884H												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G2651A	8						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	118.0	110.0	112.0		2651	-0.4	0.0	8	dbSNP_134	112	0,8600		0,0,4300	yes	missense	FAM135B	NM_015912.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	884/1407	139164067	1,13005	2203	4300	6503	139233249	SO:0001583	missense	51059	exon13			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.2651G>A	8.37:g.139164067C>T	ENSP00000378710:p.Arg884His		139233249	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	9.093	1.002180	0.19121	2.27E-4	0.0	ENSG00000147724	ENST00000395297	T	0.13538	2.58	5.33	-0.4	0.12411	.	1.043410	0.07411	N	0.892363	T	0.07683	0.0193	N	0.17082	0.46	0.09310	N	1	B;B;B	0.17465	0.022;0.002;0.001	B;B;B	0.09377	0.004;0.003;0.001	T	0.40924	-0.9537	10	0.29301	T	0.29	0.2605	5.4294	0.16444	0.0:0.4851:0.1443:0.3706	.	884;884;884	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	H	884	ENSP00000378710:R884H	ENSP00000276737:R884H	R	-	2	0	FAM135B	139233249	0.000000	0.05858	0.003000	0.11579	0.011000	0.07611	-1.754000	0.01816	-0.014000	0.14175	0.655000	0.94253	CGC		0.463	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
MYOM2	9172	broad.mit.edu	37	8	2054108	2054108	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr8:2054108C>T	ENST00000262113.4	+	22	2952	c.2811C>T	c.(2809-2811)gaC>gaT	p.D937D	MYOM2_ENST00000523438.1_Silent_p.D362D	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	937	Ig-like C2-type 3.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.D937D(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AAATGACAGACGCGTCTCAGT	0.478																																					p.D937D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2811T	8						.						144.0	136.0	139.0					8																	2054108		2203	4300	6503	2041515	SO:0001819	synonymous_variant	9172	exon22				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2811C>T	8.37:g.2054108C>T			2041515	NM_003970	Q7Z3Y2	Silent	SNP	ENST00000262113.4	37	CCDS5957.1																																																																																				0.478	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
CSMD1	64478	broad.mit.edu	37	8	3351198	3351198	+	Silent	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr8:3351198G>T	ENST00000520002.1	-	12	1953	c.1398C>A	c.(1396-1398)acC>acA	p.T466T	CSMD1_ENST00000542608.1_Silent_p.T465T|CSMD1_ENST00000537824.1_Silent_p.T465T|CSMD1_ENST00000602723.1_Silent_p.T466T|CSMD1_ENST00000400186.3_Silent_p.T466T|CSMD1_ENST00000602557.1_Silent_p.T466T|CSMD1_ENST00000539096.1_Silent_p.T465T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	466	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.T465T(1)|p.T194T(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CAACCGTCAGGGTGTCATAGC	0.493																																					p.T465T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1395A	8						.						82.0	88.0	86.0					8																	3351198		2183	4298	6481	3338606	SO:0001819	synonymous_variant	64478	exon11					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1398C>A	8.37:g.3351198G>T			3338606	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37																																																																																					0.493	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
PNMA2	10687	broad.mit.edu	37	8	26365422	26365422	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr8:26365422C>T	ENST00000522362.2	-	3	1744	c.850G>A	c.(850-852)Gcc>Acc	p.A284T	PNMA2_ENST00000522764.1_5'Flank	NM_007257.5	NP_009188.1	Q9UL42	PNMA2_HUMAN	paraneoplastic Ma antigen 2	284					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)		p.A284T(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)	11		all_cancers(63;0.109)|Ovarian(32;2.61e-05)|all_epithelial(46;0.105)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0196)|Epithelial(17;3.13e-11)|Colorectal(74;0.123)		cgagggatggcgcgtttctcc	0.592																																					p.A284T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G850A	8						.						48.0	47.0	48.0					8																	26365422		2203	4300	6503	26421339	SO:0001583	missense	10687	exon3				CCDS34868.1	8p21.1	2012-02-09	2012-02-09		ENSG00000240694	ENSG00000240694		"""Paraneoplastic Ma antigens"""	9159	protein-coding gene	gene with protein product		603970	"""paraneoplastic antigen MA2"""			10362822	Standard	NM_007257		Approved	MA2, RGAG2	uc003xez.2	Q9UL42	OTTHUMG00000163816	ENST00000522362.2:c.850G>A	8.37:g.26365422C>T	ENSP00000429344:p.Ala284Thr		26421339	NM_007257	B3KNY9|O94959|O95145|Q49A18|Q9UL43	Missense_Mutation	SNP	ENST00000522362.2	37	CCDS34868.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.158264	0.57368	.	.	ENSG00000240694	ENST00000522362	T	0.13778	2.56	4.32	4.32	0.51571	.	.	.	.	.	T	0.34571	0.0902	M	0.70595	2.14	0.34348	D	0.689526	D	0.89917	1.0	D	0.87578	0.998	T	0.37079	-0.9721	9	0.45353	T	0.12	-2.1094	12.6235	0.56616	0.0:1.0:0.0:0.0	.	284	Q9UL42	PNMA2_HUMAN	T	284	ENSP00000429344:A284T	ENSP00000429344:A284T	A	-	1	0	PNMA2	26421339	0.973000	0.33851	0.958000	0.39756	0.181000	0.23173	2.922000	0.48860	2.697000	0.92050	0.655000	0.94253	GCC		0.592	PNMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375709.2	NM_007257	
UNC5D	137970	broad.mit.edu	37	8	35406878	35406878	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr8:35406878G>T	ENST00000404895.2	+	2	500	c.172G>T	c.(172-174)Gag>Tag	p.E58*	UNC5D_ENST00000416672.1_Nonsense_Mutation_p.E58*|UNC5D_ENST00000287272.2_Nonsense_Mutation_p.E58*|UNC5D_ENST00000453357.2_Nonsense_Mutation_p.E53*|UNC5D_ENST00000420357.1_Nonsense_Mutation_p.E58*	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	58	Ig-like.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.E53*(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TCATTTCATAGAGGAGCCAGA	0.483																																					p.E58X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G172T	8						.						67.0	63.0	64.0					8																	35406878		2203	4300	6503	35526420	SO:0001587	stop_gained	137970	exon2			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.172G>T	8.37:g.35406878G>T	ENSP00000385143:p.Glu58*		35526420	NM_080872	Q8WYP7	Nonsense_Mutation	SNP	ENST00000404895.2	37	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	G	37	6.319960	0.97471	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357	.	.	.	5.97	5.08	0.68730	.	0.112191	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-21.7533	10.7812	0.46379	0.0783:0.2003:0.7214:0.0	.	.	.	.	X	58;58;58;58;53	.	ENSP00000287272:E58X	E	+	1	0	UNC5D	35526420	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.438000	0.44837	2.833000	0.97629	0.585000	0.79938	GAG		0.483	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		
SMIM19	114926	broad.mit.edu	37	8	42401705	42401705	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr8:42401705G>T	ENST00000438528.3	+	2	139	c.90G>T	c.(88-90)ttG>ttT	p.L30F	SMIM19_ENST00000416469.2_Missense_Mutation_p.L30F|SMIM19_ENST00000417410.2_Missense_Mutation_p.L30F|SMIM19_ENST00000529505.1_3'UTR|SMIM19_ENST00000414154.2_Missense_Mutation_p.L30F|SMIM19_ENST00000490331.2_Missense_Mutation_p.L30F	NM_001135676.1	NP_001129148.1	Q96E16	SMI19_HUMAN	small integral membrane protein 19	30						integral component of membrane (GO:0016021)		p.L23F(1)									ATGTTTACTTGATAGTTATCC	0.408																																					p.L30F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G90T	8						.						231.0	200.0	210.0					8																	42401705		2203	4300	6503	42520862	SO:0001583	missense	114926	exon2			BC013035	CCDS6133.2	8p11.21	2013-03-08	2013-03-08	2013-03-08	ENSG00000176209	ENSG00000176209			25166	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 40"""	C8orf40		12477932	Standard	NM_001135674		Approved		uc011lcv.2	Q96E16	OTTHUMG00000157060	ENST00000438528.3:c.90G>T	8.37:g.42401705G>T	ENSP00000391549:p.Leu30Phe		42520862	NM_001135675	B2R4S6|D3DSY4	Missense_Mutation	SNP	ENST00000438528.3	37	CCDS6133.2	.	.	.	.	.	.	.	.	.	.	G	27.5	4.837999	0.91117	.	.	ENSG00000176209	ENST00000438528;ENST00000417410;ENST00000414154;ENST00000416469;ENST00000490331	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.68100	0.2964	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.69394	-0.5157	9	0.62326	D	0.03	.	17.354	0.87330	0.0:0.0:1.0:0.0	.	30	Q96E16	CH040_HUMAN	F	30	.	ENSP00000408997:L30F	L	+	3	2	C8orf40	42520862	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.464000	0.60134	2.707000	0.92482	0.591000	0.81541	TTG		0.408	SMIM19-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347309.2	NM_138436	
DCAF4L2	138009	broad.mit.edu	37	8	88885682	88885682	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr8:88885682C>T	ENST00000319675.3	-	1	614	c.518G>A	c.(517-519)cGg>cAg	p.R173Q		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	173								p.R173Q(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						CATGCCAGGCCGACGCATTCC	0.572																																					p.R173Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G518A	8						.						119.0	111.0	114.0					8																	88885682		2203	4300	6503	88954798	SO:0001583	missense	138009	exon1			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.518G>A	8.37:g.88885682C>T	ENSP00000316496:p.Arg173Gln		88954798	NM_152418		Missense_Mutation	SNP	ENST00000319675.3	37	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	C	1.600	-0.526864	0.04141	.	.	ENSG00000176566	ENST00000319675	T	0.60424	0.19	1.39	-0.755	0.11061	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.667620	0.16730	N	0.201866	T	0.27098	0.0664	N	0.10837	0.055	0.09310	N	1	B	0.17465	0.022	B	0.09377	0.004	T	0.13575	-1.0504	10	0.12766	T	0.61	.	3.8137	0.08806	0.0:0.4729:0.0:0.5271	.	173	Q8NA75	DC4L2_HUMAN	Q	173	ENSP00000316496:R173Q	ENSP00000316496:R173Q	R	-	2	0	DCAF4L2	88954798	1.000000	0.71417	0.010000	0.14722	0.008000	0.06430	0.806000	0.27126	-0.066000	0.12998	0.467000	0.42956	CGG		0.572	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
EPPK1	83481	broad.mit.edu	37	8	144940981	144940981	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr8:144940981G>A	ENST00000525985.1	-	2	6512	c.6441C>T	c.(6439-6441)acC>acT	p.T2147T				P58107	EPIPL_HUMAN	epiplakin 1	2147						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.T2147T(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTGCCCGTCTGGTGTGTGTTC	0.507																																					p.T2147T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C6441T	8						.						215.0	222.0	220.0					8																	144940981		2081	4209	6290	145012969	SO:0001819	synonymous_variant	83481	exon1			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6441C>T	8.37:g.144940981G>A			145012969	NM_031308	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																					0.507	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
ACTL7B	10880	broad.mit.edu	37	9	111617150	111617150	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr9:111617150C>T	ENST00000374667.3	-	1	2089	c.1061G>A	c.(1060-1062)cGc>cAc	p.R354H		NM_006686.3	NP_006677.1	Q9Y614	ACL7B_HUMAN	actin-like 7B	354						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of cytoskeleton (GO:0005200)	p.R354H(2)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						CCTCTGGAAGCGCTCGGGGAA	0.677																																					p.R354H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1061A	9						.						30.0	36.0	34.0					9																	111617150		2202	4299	6501	110656971	SO:0001583	missense	10880	exon1			BC033789	CCDS6771.1	9q31	2009-05-15			ENSG00000148156	ENSG00000148156			162	protein-coding gene	gene with protein product		604304				10373328, 12907721	Standard	NM_006686		Approved	Tact1	uc004bdi.3	Q9Y614	OTTHUMG00000020462	ENST00000374667.3:c.1061G>A	9.37:g.111617150C>T	ENSP00000363799:p.Arg354His		110656971	NM_006686	B2R9Q2|Q5JSV1	Missense_Mutation	SNP	ENST00000374667.3	37	CCDS6771.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.740686	0.89573	.	.	ENSG00000148156	ENST00000374667	D	0.99353	-5.77	5.24	5.24	0.73138	.	0.000000	0.39834	N	0.001248	D	0.99597	0.9854	H	0.95745	3.715	0.51482	D	0.999925	D	0.89917	1.0	D	0.91635	0.999	D	0.97842	1.0269	10	0.87932	D	0	.	16.3291	0.83001	0.0:1.0:0.0:0.0	.	354	Q9Y614	ACL7B_HUMAN	H	354	ENSP00000363799:R354H	ENSP00000363799:R354H	R	-	2	0	ACTL7B	110656971	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.961000	0.63681	2.449000	0.82847	0.561000	0.74099	CGC		0.677	ACTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053571.1	NM_006686	
VAV2	7410	broad.mit.edu	37	9	136633570	136633570	+	Silent	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr9:136633570G>A	ENST00000371850.3	-	29	2614	c.2583C>T	c.(2581-2583)aaC>aaT	p.N861N	VAV2_ENST00000406606.3_Silent_p.N822N|VAV2_ENST00000371851.1_Silent_p.N851N	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	861	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N822N(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		TCACCCGTCCGTTGGTCTCGC	0.667																																					p.N861N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2583T	9						.						71.0	69.0	70.0					9																	136633570		2203	4300	6503	135623391	SO:0001819	synonymous_variant	7410	exon29				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.2583C>T	9.37:g.136633570G>A			135623391	NM_001134398	A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Silent	SNP	ENST00000371850.3	37	CCDS48053.1																																																																																				0.667	VAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054939.1		
FREM1	158326	broad.mit.edu	37	9	14801800	14801800	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr9:14801800C>A	ENST00000380880.3	-	20	4327	c.3544G>T	c.(3544-3546)Gcc>Tcc	p.A1182S	FREM1_ENST00000422223.2_Missense_Mutation_p.A1182S|FREM1_ENST00000380881.4_Missense_Mutation_p.A1183S			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1182					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.A1183S(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		AACAGCAGGGCATCCTGGGGA	0.517																																					p.A1182S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3544T	9						.						158.0	154.0	155.0					9																	14801800		2046	4219	6265	14791800	SO:0001583	missense	158326	exon21			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.3544G>T	9.37:g.14801800C>A	ENSP00000370262:p.Ala1182Ser		14791800	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.847191	0.00568	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.28895	1.59;1.59;1.59	5.51	-0.631	0.11526	.	1.318910	0.04475	N	0.376830	T	0.09158	0.0226	N	0.00873	-1.125	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23226	-1.0194	10	0.11182	T	0.66	0.7752	5.4977	0.16811	0.3398:0.236:0.4242:0.0	.	1182	Q5H8C1	FREM1_HUMAN	S	1183;1182;1182	ENSP00000370263:A1183S;ENSP00000412940:A1182S;ENSP00000370262:A1182S	ENSP00000370257:A1185S	A	-	1	0	FREM1	14791800	0.000000	0.05858	0.003000	0.11579	0.008000	0.06430	-0.086000	0.11233	-0.430000	0.07318	-0.976000	0.02587	GCC		0.517	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
FREM1	158326	broad.mit.edu	37	9	14806686	14806686	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr9:14806686C>A	ENST00000380880.3	-	18	4030	c.3247G>T	c.(3247-3249)Gaa>Taa	p.E1083*	FREM1_ENST00000422223.2_Nonsense_Mutation_p.E1083*|FREM1_ENST00000380881.4_Nonsense_Mutation_p.E1084*			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1083					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.E1084*(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TTGCTTTTTTCAAAACCCACA	0.443																																					p.E1083X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G3247T	9						.						47.0	46.0	46.0					9																	14806686		1913	4135	6048	14796686	SO:0001587	stop_gained	158326	exon19			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.3247G>T	9.37:g.14806686C>A	ENSP00000370262:p.Glu1083*		14796686	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Nonsense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	C	49	15.485575	0.99835	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-22.6789	20.2182	0.98305	0.0:1.0:0.0:0.0	.	.	.	.	X	1084;1083;1083	.	ENSP00000370257:E1086X	E	-	1	0	FREM1	14796686	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.398000	0.79919	2.785000	0.95823	0.655000	0.94253	GAA		0.443	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
TAF1L	138474	broad.mit.edu	37	9	32630914	32630914	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr9:32630914A>T	ENST00000242310.4	-	1	4753	c.4664T>A	c.(4663-4665)tTt>tAt	p.F1555Y	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1555	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.F1555Y(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		ATCTGGAACAAACTTCTTATT	0.393																																					p.F1555Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4664A	9						.						119.0	116.0	117.0					9																	32630914		2203	4300	6503	32620914	SO:0001583	missense	138474	exon1			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.4664T>A	9.37:g.32630914A>T	ENSP00000418379:p.Phe1555Tyr		32620914	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	A	13.93	2.384630	0.42308	.	.	ENSG00000122728	ENST00000242310	T	0.29397	1.57	0.489	0.489	0.16854	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.13798	0.0334	N	0.20530	0.585	0.42626	D	0.993363	B	0.31383	0.321	B	0.35114	0.196	T	0.18555	-1.0333	10	0.02654	T	1	.	5.2121	0.15322	0.9999:0.0:1.0E-4:0.0	.	1555	Q8IZX4	TAF1L_HUMAN	Y	1555	ENSP00000418379:F1555Y	ENSP00000418379:F1555Y	F	-	2	0	TAF1L	32620914	1.000000	0.71417	0.989000	0.46669	0.862000	0.49288	3.944000	0.56629	0.431000	0.26258	0.172000	0.16884	TTT		0.393	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
SPATA31E1	286234	broad.mit.edu	37	9	90501412	90501412	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr9:90501412C>T	ENST00000325643.5	+	4	2076	c.2010C>T	c.(2008-2010)gaC>gaT	p.D670D		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	670					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.D670D(1)									AGGCAGAAGACACGCAGCAGG	0.617																																					p.D670D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2010T	9						.						41.0	51.0	48.0					9																	90501412		2203	4299	6502	89691232	SO:0001819	synonymous_variant	286234	exon4			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2010C>T	9.37:g.90501412C>T			89691232	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	ENST00000325643.5	37	CCDS6676.1																																																																																				0.617	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
CCDC180	100499483	broad.mit.edu	37	9	100080840	100080840	+	Missense_Mutation	SNP	G	G	A	rs368120179		TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr9:100080840G>A	ENST00000357054.1	+	24	2539	c.1604G>A	c.(1603-1605)cGg>cAg	p.R535Q	CCDC180_ENST00000529487.1_Missense_Mutation_p.R396Q|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000411667.2_Missense_Mutation_p.R393Q|CCDC180_ENST00000375202.2_Missense_Mutation_p.R396Q|CCDC180_ENST00000395220.1_Intron			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	535						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R535Q(1)									CAGCAAAGGCGGCTGAAGCAT	0.602																																					p.R396Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1187A	9						.	G	GLN/ARG	0,4406		0,0,2203	78.0	63.0	68.0		1187	4.6	0.3	9		68	1,8599		0,1,4299	no	missense	C9orf174	NM_020893.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	396/1702	100080840	1,13005	2203	4300	6503	99120661	SO:0001583	missense	57653	exon10			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1604G>A	9.37:g.100080840G>A	ENSP00000349562:p.Arg535Gln		99120661	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	37		.	.	.	.	.	.	.	.	.	.	G	17.16	3.319471	0.60524	0.0	1.16E-4	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	4.61	4.61	0.57282	.	0.229630	0.36409	N	0.002610	T	0.53658	0.1810	M	0.74258	2.255	0.18873	N	0.999987	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	P;D;D;D	0.87578	0.836;0.998;0.998;0.998	T	0.44952	-0.9294	10	0.46703	T	0.11	-25.4457	13.1516	0.59492	0.0:0.0:1.0:0.0	.	393;535;396;535	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	Q	535;396;393;419;396	ENSP00000349562:R535Q;ENSP00000364348:R396Q;ENSP00000414000:R393Q;ENSP00000434727:R396Q	ENSP00000349562:R535Q	R	+	2	0	C9orf174	99120661	0.860000	0.29831	0.335000	0.25508	0.014000	0.08584	3.458000	0.53014	2.548000	0.85928	0.563000	0.77884	CGG		0.602	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
OLFM1	10439	broad.mit.edu	37	9	138011798	138011798	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chr9:138011798C>T	ENST00000371793.3	+	6	1483	c.1232C>T	c.(1231-1233)aCg>aTg	p.T411M	OLFM1_ENST00000371796.3_Missense_Mutation_p.T384M|OLFM1_ENST00000252854.4_Missense_Mutation_p.T393M	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	411	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)	p.T393M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		ATCTGCGGCACGCTGTACGTC	0.592																																					p.T393M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1178T	9						.						94.0	80.0	85.0					9																	138011798		2203	4299	6502	137151619	SO:0001583	missense	10439	exon6			AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.1232C>T	9.37:g.138011798C>T	ENSP00000360858:p.Thr411Met		137151619	NM_014279	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Missense_Mutation	SNP	ENST00000371793.3	37		.	.	.	.	.	.	.	.	.	.	C	15.85	2.953794	0.53293	.	.	ENSG00000130558	ENST00000252854;ENST00000371796;ENST00000371793	D;D;D	0.90620	-2.7;-2.7;-2.7	4.7	4.7	0.59300	Olfactomedin-like (3);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	D	0.95903	0.8666	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96807	0.9594	10	0.87932	D	0	.	17.6361	0.88122	0.0:1.0:0.0:0.0	.	411;393	Q99784;Q6IMJ8	NOE1_HUMAN;.	M	393;384;411	ENSP00000252854:T393M;ENSP00000360861:T384M;ENSP00000360858:T411M	ENSP00000252854:T393M	T	+	2	0	OLFM1	137151619	1.000000	0.71417	0.988000	0.46212	0.359000	0.29487	5.705000	0.68355	2.166000	0.68216	0.491000	0.48974	ACG		0.592	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	NM_014279	
LHFPL1	340596	broad.mit.edu	37	X	111914502	111914502	+	Silent	SNP	C	C	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chrX:111914502C>A	ENST00000371968.3	-	2	356	c.117G>T	c.(115-117)ggG>ggT	p.G39G	LHFPL1_ENST00000536453.1_Silent_p.G39G|LHFPL1_ENST00000478229.1_Intron	NM_178175.3	NP_835469.1	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1	39						integral component of membrane (GO:0016021)		p.G39G(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)	13						ACACTGGCTTCCCCATCTGGG	0.552																																					p.G39G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G117T	X						.						161.0	149.0	153.0					X																	111914502		2203	4300	6503	111801158	SO:0001819	synonymous_variant	340596	exon2			AY217350	CCDS14562.1	Xq23	2008-02-05			ENSG00000182508	ENSG00000182508			6587	protein-coding gene	gene with protein product		300566				10329012	Standard	NM_178175		Approved		uc004epq.3	Q86WI0	OTTHUMG00000022214	ENST00000371968.3:c.117G>T	X.37:g.111914502C>A			111801158	NM_178175	A8K1N1|Q496M9|Q496N0|Q6UXU2	Silent	SNP	ENST00000371968.3	37	CCDS14562.1																																																																																				0.552	LHFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057947.1	NM_178175	
ASMTL	8623	broad.mit.edu	37	X	1561193	1561193	+	Silent	SNP	C	C	T			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chrX:1561193C>T	ENST00000381317.3	-	2	143	c.111G>A	c.(109-111)gtG>gtA	p.V37V	ASMTL_ENST00000416733.2_5'UTR|ASMTL_ENST00000381333.4_Silent_p.V37V|ASMTL_ENST00000534940.1_5'UTR	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	37	MAF-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)	p.V37V(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGGAGGGGACCACCTCAAACC	0.527																																					p.V37V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G111A	X						.						90.0	96.0	94.0					X																	1561193		1906	4108	6014	1521193	SO:0001819	synonymous_variant	8623	exon2			Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.111G>A	X.37:g.1561193C>T			1521193	NM_004192	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Silent	SNP	ENST00000381317.3	37	CCDS43917.1																																																																																				0.527	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1	NM_004192	
MAGEE1	57692	broad.mit.edu	37	X	75649461	75649461	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chrX:75649461G>A	ENST00000361470.2	+	1	1416	c.1138G>A	c.(1138-1140)Gtg>Atg	p.V380M		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	380	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.V380M(4)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						GGACACCTCCGTGCCGCCCAC	0.677																																					p.V380M												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G1138A	X						.						41.0	28.0	32.0					X																	75649461		2203	4299	6502	75565865	SO:0001583	missense	57692	exon1			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.1138G>A	X.37:g.75649461G>A	ENSP00000354912:p.Val380Met		75565865	NM_020932	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	ENST00000361470.2	37	CCDS14433.1	.	.	.	.	.	.	.	.	.	.	G	8.531	0.870987	0.17322	.	.	ENSG00000198934	ENST00000361470	T	0.09630	2.96	2.13	-3.34	0.04943	.	.	.	.	.	T	0.04861	0.0131	N	0.14661	0.345	0.09310	N	1	B	0.17667	0.023	B	0.04013	0.001	T	0.36335	-0.9752	9	0.49607	T	0.09	.	2.426	0.04460	0.1301:0.2731:0.4355:0.1613	.	380	Q9HCI5	MAGE1_HUMAN	M	380	ENSP00000354912:V380M	ENSP00000354912:V380M	V	+	1	0	MAGEE1	75565865	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.085000	0.03390	-1.119000	0.02958	0.506000	0.49869	GTG		0.677	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932	
GLUD2	2747	broad.mit.edu	37	X	120181909	120181909	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-3994-01A-01W-1073-09	TCGA-AA-3994-10A-01W-1073-09	g.chrX:120181909G>A	ENST00000328078.1	+	1	448	c.371G>A	c.(370-372)cGc>cAc	p.R124H		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	124					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.R124H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CCCATCCGGCGCGACGACGGC	0.637																																					p.R124H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G371A	X						.						58.0	45.0	49.0					X																	120181909		2202	4277	6479	120009590	SO:0001583	missense	2747	exon1			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.371G>A	X.37:g.120181909G>A	ENSP00000327589:p.Arg124His		120009590	NM_012084	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271993	0.59649	.	.	ENSG00000182890	ENST00000328078	D	0.96802	-4.13	1.68	0.479	0.16796	Glutamate/phenylalanine/leucine/valine dehydrogenase, dimerisation domain (1);	0.054671	0.64402	D	0.000002	D	0.97999	0.9341	H	0.95645	3.7	0.51482	D	0.999924	D	0.89917	1.0	D	0.67900	0.954	D	0.96305	0.9224	10	0.87932	D	0	-19.7725	6.6366	0.22887	0.0:0.0:0.6238:0.3762	.	124	P49448	DHE4_HUMAN	H	124	ENSP00000327589:R124H	ENSP00000327589:R124H	R	+	2	0	GLUD2	120009590	1.000000	0.71417	0.003000	0.11579	0.018000	0.09664	4.471000	0.60182	0.047000	0.15862	0.472000	0.43445	CGC		0.637	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
