#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ENTPD6	955	hgsc.bcm.edu	37	20	25197303	25197304	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:25197303_25197304insG	ENST00000376652.4	+	8	892_893	c.729_730insG	c.(730-732)gggfs	p.G244fs	ENTPD6_ENST00000433259.2_Frame_Shift_Ins_p.G244fs|ENTPD6_ENST00000360031.2_Frame_Shift_Ins_p.G243fs|ENTPD6_ENST00000354989.5_Frame_Shift_Ins_p.G227fs|Y_RNA_ENST00000365544.1_RNA			O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6 (putative)	244					response to calcium ion (GO:0051592)|response to magnesium ion (GO:0032026)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	guanosine-5'-triphosphate,3'-diphosphate diphosphatase activity (GO:0008894)|nucleoside-triphosphatase activity (GO:0017111)|uridine-diphosphatase activity (GO:0045134)	p.S245fs*40(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|prostate(1)|skin(1)	27						AAACTCCAGGAGGGAGCAGCGT	0.584																																					p.G243fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.729_730insG	20						.																																			25145304	SO:0001589	frameshift_variant	955	exon8			AF039916	CCDS13170.1, CCDS46586.1	20p11.21	2010-06-24	2010-06-24		ENSG00000197586	ENSG00000197586			3368	protein-coding gene	gene with protein product		603160	"""interleukin 6 signal transducer-2"""	CD39L2, IL6ST2		9676430	Standard	NM_001247		Approved	NTPDase-6, dJ738P15.3	uc002wuj.2	O75354	OTTHUMG00000032116	ENST00000376652.4:c.732dupG	20.37:g.25197306_25197306dupG	ENSP00000365840:p.Gly244fs		25145303	NM_001247	A6NCX6|D3DW49|Q5QPJ2|Q5QPJ5|Q7Z5B5|Q8N3H3|Q8TAS7|Q9UJD1	Frame_Shift_Ins	INS	ENST00000376652.4	37	CCDS13170.1																																																																																				0.584	ENTPD6-020	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078414.2		
RPRD1B	58490	hgsc.bcm.edu	37	20	36687879	36687880	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:36687879_36687880insC	ENST00000373433.4	+	5	1014_1015	c.612_613insC	c.(613-615)cccfs	p.P205fs		NM_021215.3	NP_067038.1	Q9NQG5	RPR1B_HUMAN	regulation of nuclear pre-mRNA domain containing 1B	205					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle process (GO:0010564)|transcription, DNA-templated (GO:0006351)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)	p.Q206fs*19(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)	12						TTGCTTCTCTGCCCCAGGAAGT	0.441																																					p.L204fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.612_613insC	20						.																																			36121294	SO:0001589	frameshift_variant	58490	exon5			AL109823	CCDS13301.1	20q11.21-q12	2012-02-09	2008-08-15	2008-07-28	ENSG00000101413	ENSG00000101413			16209	protein-coding gene	gene with protein product		614694	"""chromosome 20 open reading frame 77"""	C20orf77		22231121	Standard	NM_021215		Approved	dJ1057B20.2, DKFZp434P0735, CREPT, FLJ44520, NET60	uc002xho.4	Q9NQG5	OTTHUMG00000032434	ENST00000373433.4:c.616dupC	20.37:g.36687883_36687883dupC	ENSP00000362532:p.Pro205fs		36121293	NM_021215	Q1WDE7|Q6PKF4	Frame_Shift_Ins	INS	ENST00000373433.4	37	CCDS13301.1																																																																																				0.441	RPRD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079142.2	NM_021215	
CABIN1	23523	hgsc.bcm.edu	37	22	24494130	24494131	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr22:24494130_24494131insC	ENST00000398319.2	+	26	4477_4478	c.4092_4093insC	c.(4093-4095)cccfs	p.P1365fs	CABIN1_ENST00000405822.2_Intron|CABIN1_ENST00000263119.5_Frame_Shift_Ins_p.P1365fs	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1365					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.H1366fs*22(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AATGTAAAAAACCCCACCAGCA	0.614																																					p.K1364fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.4092_4093insC	22						.																																			22824131	SO:0001589	frameshift_variant	23523	exon26			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.4096dupC	22.37:g.24494134_24494134dupC	ENSP00000381364:p.Pro1365fs		22824130	NM_012295	G5E9F3|Q6PHY0|Q9Y460	Frame_Shift_Ins	INS	ENST00000398319.2	37	CCDS13823.1																																																																																				0.614	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
ZHX2	22882	hgsc.bcm.edu	37	8	123963963	123963964	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:123963963_123963964insA	ENST00000314393.4	+	3	1048_1049	c.213_214insA	c.(214-216)aaafs	p.K72fs		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	72					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.L74fs*6(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			AAAGCCAGTCCAAAAAACTCCA	0.49																																					p.S71fs	Esophageal Squamous(94;1056 1388 11767 13799 49639)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.213_214insA	8						.																																			124033145	SO:0001589	frameshift_variant	22882	exon3			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.219dupA	8.37:g.123963969_123963969dupA	ENSP00000314709:p.Lys72fs		124033144	NM_014943		Frame_Shift_Ins	INS	ENST00000314393.4	37	CCDS6336.1																																																																																				0.490	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
KCTD9	54793	hgsc.bcm.edu	37	8	25296814	25296815	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:25296814_25296815insT	ENST00000221200.4	-	6	699_700	c.479_480insA	c.(478-480)aatfs	p.N160fs	KCTD9_ENST00000518067.1_5'Flank	NM_017634.3	NP_060104.2	Q7L273	KCTD9_HUMAN	potassium channel tetramerization domain containing 9	160	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein homooligomerization (GO:0051260)			p.N160fs*2(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)	12		all_cancers(63;0.0164)|Ovarian(32;0.000878)|all_epithelial(46;0.00542)|Breast(100;0.0164)|Hepatocellular(4;0.114)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Epithelial(17;2.39e-12)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0438)		TAATGCCATCATTTACAATGAG	0.327																																					p.N160fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.480_481insA	8						.																																			25352732	SO:0001589	frameshift_variant	54793	exon6			BC021216	CCDS6048.1	8p21.1	2013-06-20	2013-06-20		ENSG00000104756	ENSG00000104756		"""BTB/POZ domain containing"""	22401	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 9"""			11483580	Standard	NM_017634		Approved	FLJ20038, BTBD27	uc003xeo.3	Q7L273	OTTHUMG00000099428	ENST00000221200.4:c.480dupA	8.37:g.25296817_25296817dupT	ENSP00000221200:p.Asn160fs		25352731	NM_017634	Q6NUM8|Q9NXV4	Frame_Shift_Ins	INS	ENST00000221200.4	37	CCDS6048.1																																																																																				0.327	KCTD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216890.1	NM_017634	
IL27RA	9466	hgsc.bcm.edu	37	19	14157253	14157254	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:14157253_14157254insC	ENST00000263379.2	+	8	1089_1090	c.964_965insC	c.(964-966)gccfs	p.A322fs		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	322	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)	p.R324fs*2(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						TTCAGCCTCTGCCCCCCGTAGC	0.629																																					p.A322fs	Colon(164;1849 1896 4443 37792 47834)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.964_965insC	19						.																																			14018254	SO:0001589	frameshift_variant	9466	exon8			AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.970dupC	19.37:g.14157259_14157259dupC	ENSP00000263379:p.Ala322fs		14018253	NM_004843	A0N0L1|O60624	Frame_Shift_Ins	INS	ENST00000263379.2	37	CCDS12303.1																																																																																				0.629	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1	NM_004843	
ZNF559	84527	hgsc.bcm.edu	37	19	9451823	9451824	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:9451823_9451824insT	ENST00000393883.2	+	5	854_855	c.206_207insT	c.(205-210)aattttfs	p.NF69fs	ZNF559_ENST00000586255.1_Frame_Shift_Ins_p.NF97fs|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000538743.1_5'UTR|ZNF559_ENST00000317221.7_Frame_Shift_Ins_p.NF69fs|ZNF559_ENST00000603380.1_Frame_Shift_Ins_p.NF69fs|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000592504.1_Frame_Shift_Ins_p.NF69fs|ZNF559_ENST00000585352.1_Frame_Shift_Ins_p.NF69fs|ZNF177_ENST00000446085.4_Intron|ZNF559_ENST00000587557.1_Frame_Shift_Ins_p.NF133fs|ZNF177_ENST00000602856.1_Intron|ZNF559_ENST00000592896.1_Frame_Shift_Ins_p.NF97fs	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	69	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L71fs*22(1)		endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						CCTCAGCAGAATTTTTTGCAGG	0.317																																					p.N69fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.206_207insT	19						.		,,,,,,,,,	0,4264		0,0,2132					,,,,,,,,,	0.4	0.0			105	1,8253		0,1,4126	no	frameshift,intron,frameshift,frameshift,frameshift,frameshift,frameshift,frameshift,frameshift,intron	ZNF559,ZNF559-ZNF177	NM_032497.2,NM_001202425.1,NM_001202412.1,NM_001202411.1,NM_001202410.1,NM_001202409.1,NM_001202408.1,NM_001202407.1,NM_001202406.1,NM_001172650.2	,,,,,,,,,	0,1,6258	A1A1,A1R,RR		0.0121,0.0,0.0080	,,,,,,,,,	,,,,,,,,,		1,12517				9312824	SO:0001589	frameshift_variant	84527	exon5			AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.212dupT	19.37:g.9451829_9451829dupT	ENSP00000377461:p.Asn69fs		9312823	NM_032497	K7EMG6	Frame_Shift_Ins	INS	ENST00000393883.2	37	CCDS12211.1																																																																																				0.317	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
TNNT2	7139	hgsc.bcm.edu	37	1	201334748	201334749	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:201334748_201334749insCT	ENST00000509001.1	-	8	539_540	c.253_254insAG	c.(253-255)gtgfs	p.V85fs	TNNT2_ENST00000458432.2_Frame_Shift_Ins_p.V97fs|TNNT2_ENST00000367318.5_Frame_Shift_Ins_p.V85fs|TNNT2_ENST00000421663.2_Frame_Shift_Ins_p.V87fs|TNNT2_ENST00000367317.4_Frame_Shift_Ins_p.V85fs|TNNT2_ENST00000460780.1_5'Flank|TNNT2_ENST00000367320.2_Frame_Shift_Ins_p.V94fs|TNNT2_ENST00000236918.7_Frame_Shift_Ins_p.V90fs|TNNT2_ENST00000360372.4_Frame_Shift_Ins_p.V80fs|TNNT2_ENST00000367322.1_Frame_Shift_Ins_p.V85fs|TNNT2_ENST00000367315.2_Frame_Shift_Ins_p.V85fs	NM_001276347.1	NP_001263276.1	P45379	TNNT2_HUMAN	troponin T type 2 (cardiac)	95					ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|positive regulation of ATPase activity (GO:0032781)|regulation of heart contraction (GO:0008016)|regulation of muscle contraction (GO:0006937)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle thin filament (GO:0005865)|troponin complex (GO:0005861)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)	p.V85fs*16(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(9)	20						ATCAAAGTCCACTCTCTCTCCA	0.569																																					p.V85fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.254_255insAG	1	GRCh37	CM044947	TNNT2	M		.																																			199601372	SO:0001589	frameshift_variant	7139	exon8			X74819	CCDS30968.1, CCDS30969.1, CCDS60390.1, CCDS73002.1, CCDS73003.1	1q32	2014-09-17	2005-09-12		ENSG00000118194	ENSG00000118194			11949	protein-coding gene	gene with protein product		191045	"""troponin T2, cardiac"", ""cardiomyopathy, hypertrophic 2"", ""cardiomyopathy, dilated 1D (autosomal dominant)"""	CMH2, CMD1D		8088824, 8205619, 9482583	Standard	NM_001001430		Approved	CMPD2	uc001gwf.4	P45379	OTTHUMG00000035733	ENST00000509001.1:c.252_253dupAG	1.37:g.201334755_201334756dupCT	ENSP00000422031:p.Val85fs		199601371	NM_001001430	A2TDB9|A8K3K6|O60214|Q99596|Q99597|Q9BUF6|Q9UM96	Frame_Shift_Ins	INS	ENST00000509001.1	37	CCDS30969.1																																																																																				0.569	TNNT2-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360358.1	NM_000364	
PRKAA2	5563	hgsc.bcm.edu	37	1	57173340	57173341	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:57173340_57173341insT	ENST00000371244.4	+	9	1679_1680	c.1613_1614insT	c.(1612-1617)gattttfs	p.DF538fs		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	538					autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.E541fs*1(2)		breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	CACACCATGGATTTTTTTGAAA	0.421																																					p.D538fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.1613_1614insT	1						.																																			56945929	SO:0001589	frameshift_variant	5563	exon9			BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.1620dupT	1.37:g.57173347_57173347dupT	ENSP00000360290:p.Asp538fs		56945928	NM_006252	Q9H1E8|Q9UD43	Frame_Shift_Ins	INS	ENST00000371244.4	37	CCDS605.1																																																																																				0.421	PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022753.2	NM_006252	
SLC44A3	126969	hgsc.bcm.edu	37	1	95357931	95357932	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:95357931_95357932insT	ENST00000271227.6	+	14	1817_1818	c.1715_1716insT	c.(1714-1719)gcttttfs	p.AF572fs	SLC44A3_ENST00000527077.1_Frame_Shift_Ins_p.AF504fs|SLC44A3_ENST00000529450.1_Frame_Shift_Ins_p.AF539fs|SLC44A3_ENST00000446120.2_Frame_Shift_Ins_p.AF536fs|SLC44A3_ENST00000467909.1_Frame_Shift_Ins_p.AF524fs|SLC44A3_ENST00000532427.1_Frame_Shift_Ins_p.AF492fs	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	572					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F526fs*4(1)|p.A575fs*7(1)|p.A527fs*7(1)|p.F574fs*4(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	TTATTGGTAGCTTTTTTTGCCT	0.426																																					p.A524fs												.	.	4	Deletion - Frameshift(2)|Insertion - Frameshift(2)	large_intestine(4)	c.1571_1572insT	1						.																																			95130520	SO:0001589	frameshift_variant	126969	exon13			BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1722dupT	1.37:g.95357938_95357938dupT	ENSP00000271227:p.Ala572fs		95130519	NM_152369	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Frame_Shift_Ins	INS	ENST00000271227.6	37	CCDS44176.1																																																																																				0.426	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
MED23	9439	hgsc.bcm.edu	37	6	131919845	131919846	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:131919845_131919846insT	ENST00000368068.3	-	19	2455_2456	c.2276_2277insA	c.(2275-2277)aatfs	p.N759fs	MED23_ENST00000545957.1_Frame_Shift_Ins_p.N400fs|MED23_ENST00000368060.3_Frame_Shift_Ins_p.N759fs|MED23_ENST00000479213.1_5'Flank|MED23_ENST00000368053.4_Frame_Shift_Ins_p.N765fs|MED23_ENST00000540546.1_Frame_Shift_Ins_p.N765fs|MED23_ENST00000368058.1_Frame_Shift_Ins_p.N765fs|MED23_ENST00000403834.3_Frame_Shift_Ins_p.N765fs|MED23_ENST00000354577.4_Frame_Shift_Ins_p.N765fs	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	759					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)	p.N759fs*7(1)|p.N765fs*7(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		CCTCCTCCACATTTTTTTTCAG	0.381																																					p.N759fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.2277_2278insA	6						.																																			131961539	SO:0001589	frameshift_variant	9439	exon19			AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.2277dupA	6.37:g.131919853_131919853dupT	ENSP00000357047:p.Asn759fs		131961538	NM_004830	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Frame_Shift_Ins	INS	ENST00000368068.3	37	CCDS5147.1																																																																																				0.381	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1		
C6orf211	79624	hgsc.bcm.edu	37	6	151785735	151785736	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:151785735_151785736insT	ENST00000367294.3	+	4	799_800	c.540_541insT	c.(541-543)tttfs	p.F181fs	C6orf211_ENST00000545879.1_Frame_Shift_Ins_p.F62fs	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	181								p.K183fs*1(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		TGAAAGATGAGTTTTTTAAACT	0.302																																					p.E180fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.540_541insT	6						.			0,4262		0,0,2131						-0.6	0.1			60	1,8249		0,1,4124	no	frameshift	C6orf211	NM_024573.1		0,1,6255	A1A1,A1R,RR		0.0121,0.0,0.0080				1,12511				151827429	SO:0001589	frameshift_variant	79624	exon4			AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.546dupT	6.37:g.151785741_151785741dupT	ENSP00000356263:p.Phe181fs		151827428	NM_024573	Q96FC6|Q9UFY5	Frame_Shift_Ins	INS	ENST00000367294.3	37	CCDS5233.1																																																																																				0.302	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042724.1	NM_024573	
TPMT	7172	hgsc.bcm.edu	37	6	18143892	18143893	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:18143892_18143893insA	ENST00000309983.4	-	4	385_386	c.300_301insT	c.(298-303)tttacafs	p.T101fs		NM_000367.2	NP_000358.1	P51580	TPMT_HUMAN	thiopurine S-methyltransferase	101					methylation (GO:0032259)|nucleobase-containing compound metabolic process (GO:0006139)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	thiopurine S-methyltransferase activity (GO:0008119)	p.T101fs*22(1)		large_intestine(2)|lung(1)	3	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.146)	all cancers(50;0.06)|Epithelial(50;0.0654)		Azathioprine(DB00993)|Bendroflumethiazide(DB00436)|Cefazolin(DB01327)|Mercaptopurine(DB01033)|Olsalazine(DB01250)|Trichlormethiazide(DB01021)	TTCTGCTCTGTAAAAAATTCTT	0.351																																					p.T101fs	Colon(190;1381 2791 16728 32493)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.301_302insT	6						.																																			18251872	SO:0001589	frameshift_variant	7172	exon4				CCDS4543.1	6p22.3	2014-09-17			ENSG00000137364	ENSG00000137364	2.1.1.67		12014	protein-coding gene	gene with protein product		187680				8316220	Standard	NM_000367		Approved		uc003ncm.3	P51580	OTTHUMG00000014317	ENST00000309983.4:c.301dupT	6.37:g.18143898_18143898dupA	ENSP00000312304:p.Thr101fs		18251871	NM_000367	O14806|O15423|O15424|O15425|O15426|O15515|O15548|O43213|Q5VUK6|Q9UBE6|Q9UBT8|Q9UE62	Frame_Shift_Ins	INS	ENST00000309983.4	37	CCDS4543.1																																																																																				0.351	TPMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039960.1		
TAP1	6890	hgsc.bcm.edu	37	6	32815331	32815332	+	Frame_Shift_Ins	INS	-	-	C	rs139871208		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:32815331_32815332insC	ENST00000354258.4	-	9	2202_2203	c.2041_2042insG	c.(2041-2043)gccfs	p.A681fs	PSMB9_ENST00000395330.1_Intron|TAP1_ENST00000425148.2_Frame_Shift_Ins_p.A420fs|PSMB8_ENST00000374881.2_5'Flank|TAPSAR1_ENST00000453426.1_lincRNA	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	681	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)	p.A681fs*3(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	GAAACTATGGGCCCCAGACTTT	0.495																																					p.A681fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2042_2043insG	6						.																																			32923310	SO:0001589	frameshift_variant	6890	exon9				CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.2042dupG	6.37:g.32815335_32815335dupC	ENSP00000346206:p.Ala681fs		32923309	NM_000593	Q16149|Q96CP4	Frame_Shift_Ins	INS	ENST00000354258.4	37	CCDS4758.1																																																																																				0.495	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	NM_000593	
PHF3	23469	hgsc.bcm.edu	37	6	64421675	64421676	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:64421675_64421676insT	ENST00000262043.3	+	16	4531_4532	c.4191_4192insT	c.(4192-4194)tttfs	p.F1398fs	PHF3_ENST00000393387.1_Frame_Shift_Ins_p.F1398fs			Q92576	PHF3_HUMAN	PHD finger protein 3	1398					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.N1400fs*1(1)		breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AAGAAAATGACTTTTTTAATTC	0.371																																					p.D1397fs	GBM(135;136 1820 29512 34071 46235)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.4191_4192insT	6						.																																			64479635	SO:0001589	frameshift_variant	23469	exon15			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.4197dupT	6.37:g.64421681_64421681dupT	ENSP00000262043:p.Phe1398fs		64479634	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Frame_Shift_Ins	INS	ENST00000262043.3	37	CCDS4966.1																																																																																				0.371	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
HTR1E	3354	hgsc.bcm.edu	37	6	87725846	87725847	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:87725846_87725847insC	ENST00000305344.5	+	2	1497_1498	c.794_795insC	c.(793-798)atccccfs	p.IP265fs		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	265					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.F268fs*4(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	TCCATCAGGATCCCCCCCTTCG	0.51																																					p.I265fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.794_795insC	6						.																																			87782566	SO:0001589	frameshift_variant	3354	exon2				CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.801dupC	6.37:g.87725853_87725853dupC	ENSP00000307766:p.Ile265fs		87782565	NM_000865	E1P503|Q9P1Y1	Frame_Shift_Ins	INS	ENST00000305344.5	37	CCDS5006.1																																																																																				0.510	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865	
TMEM135	65084	hgsc.bcm.edu	37	11	86778818	86778819	+	Frame_Shift_Ins	INS	-	-	A	rs140469091		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:86778818_86778819insA	ENST00000305494.5	+	2	263_264	c.224_225insA	c.(223-228)ctaactfs	p.T76fs	TMEM135_ENST00000340353.7_Frame_Shift_Ins_p.T76fs|TMEM135_ENST00000355734.4_Frame_Shift_Ins_p.T76fs|TMEM135_ENST00000532959.1_Intron|TMEM135_ENST00000535167.1_5'UTR	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	76					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)		p.T76fs*3(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GCTTCATTTCTAACTGCTAATG	0.361																																					p.L75fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.224_225insA	11						.																																			86456467	SO:0001589	frameshift_variant	65084	exon2			BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.226dupA	11.37:g.86778820_86778820dupA	ENSP00000306344:p.Thr76fs		86456466	NM_001168724	Q6AW91|Q8ND01|Q9H6M3	Frame_Shift_Ins	INS	ENST00000305494.5	37	CCDS8280.1																																																																																				0.361	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918	
EVI2A	2123	hgsc.bcm.edu	37	17	29645964	29645965	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:29645964_29645965insA	ENST00000462804.2	-	2	466_467	c.67_68insT	c.(67-69)tctfs	p.S23fs	NF1_ENST00000358273.4_Intron|NF1_ENST00000581113.2_Intron|EVI2A_ENST00000247270.3_Frame_Shift_Ins_p.S46fs|CTD-2370N5.3_ENST00000578584.1_5'Flank|EVI2A_ENST00000461237.1_Frame_Shift_Ins_p.S23fs|NF1_ENST00000356175.3_Intron	NM_014210.3	NP_055025.2	P22794	EVI2A_HUMAN	ecotropic viral integration site 2A	23					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.0?(8)|p.?(3)|p.S46fs*16(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;5.94e-13)|Epithelial(4;7.98e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.4e-12)|GBM - Glioblastoma multiforme(4;0.18)		AGGAGACAAAGAAAAAACTGTT	0.416																																					p.S46fs												.	.	12	Whole gene deletion(8)|Unknown(3)|Insertion - Frameshift(1)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|large_intestine(1)|central_nervous_system(1)	c.137_138insT	17						.																																			26670091	SO:0001589	frameshift_variant	2123	exon3			M55267	CCDS32608.1, CCDS42293.1	17q11.2	2008-07-18			ENSG00000126860	ENSG00000126860			3499	protein-coding gene	gene with protein product		158380		EVI2		2117566	Standard	NM_014210		Approved	EVDA	uc002hgm.3	P22794	OTTHUMG00000159306	ENST00000462804.2:c.68dupT	17.37:g.29645970_29645970dupA	ENSP00000420557:p.Ser23fs		26670090	NM_001003927	B2R5X2|B4DHX8	Frame_Shift_Ins	INS	ENST00000462804.2	37	CCDS42293.1																																																																																				0.416	EVI2A-001	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354491.3	NM_014210	
MTMR4	9110	hgsc.bcm.edu	37	17	56590245	56590246	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:56590245_56590246insG	ENST00000323456.5	-	3	184_185	c.60_61insC	c.(58-63)cccaagfs	p.K21fs	MTMR4_ENST00000579925.1_Frame_Shift_Ins_p.K21fs	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	21					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.K21fs*20(1)		breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ACTAGTTCCTTGGGGGGGAACA	0.569																																					p.K21fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.61_62insC	17						.																																			53945245	SO:0001589	frameshift_variant	9110	exon3			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.61dupC	17.37:g.56590252_56590252dupG	ENSP00000325285:p.Lys21fs		53945244	NM_004687	D3DTZ6|Q8IV27|Q9Y4D5	Frame_Shift_Ins	INS	ENST00000323456.5	37	CCDS11608.1																																																																																				0.569	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687	
MYH11	4629	hgsc.bcm.edu	37	16	15802686	15802687	+	Intron	INS	-	-	G	rs111588143	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:15802686_15802687insG	ENST00000300036.5	-	41	5896				MYH11_ENST00000452625.2_Frame_Shift_Ins_p.P1940fs|NDE1_ENST00000396355.1_Intron|NDE1_ENST00000396354.1_Intron|MYH11_ENST00000396324.3_Intron|MYH11_ENST00000576790.2_Frame_Shift_Ins_p.P1933fs|NDE1_ENST00000342673.5_Intron|MYH11_ENST00000573908.1_Intron	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle						axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						AAGTTTCCTGTGGGGGGGGCCC	0.495			T	CBFB	AML																																p.P1940fs			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	.	0			c.5820_5821insC	16						.		,,,,,	37,4227		0,37,2095					,,,,,	1.7	1.0			33	57,8197		0,57,4070	no	frameshift,intron,intron,intron,intron,frameshift	MYH11,NDE1	NM_022844.2,NM_017668.2,NM_002474.2,NM_001143979.1,NM_001040114.1,NM_001040113.1	,,,,,	0,94,6165	A1A1,A1R,RR		0.6906,0.8677,0.7509	,,,,,	,,,,,		94,12424				15710188	SO:0001627	intron_variant	4629	exon42			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5787-4706->C	16.37:g.15802694_15802694dupG			15710187	NM_001040113	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Frame_Shift_Ins	INS	ENST00000300036.5	37	CCDS10565.1																																																																																				0.495	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
COLEC12	81035	hgsc.bcm.edu	37	18	346827	346828	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr18:346827_346828insA	ENST00000400256.3	-	5	1001_1002	c.794_795insT	c.(793-795)ttgfs	p.L265fs		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	265					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)	p.L265fs*60(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CCAGCGTCTGCAAGCTCTGCAC	0.505																																					p.L265fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.795_796insT	18						.																																			336828	SO:0001589	frameshift_variant	81035	exon5			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.795dupT	18.37:g.346829_346829dupA	ENSP00000383115:p.Leu265fs		336827	NM_130386	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Frame_Shift_Ins	INS	ENST00000400256.3	37	CCDS32782.1																																																																																				0.505	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
KIAA1468	57614	hgsc.bcm.edu	37	18	59925895	59925896	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr18:59925895_59925896insA	ENST00000398130.2	+	15	2420_2421	c.2188_2189insA	c.(2188-2190)gaafs	p.E730fs	KIAA1468_ENST00000256858.6_Frame_Shift_Ins_p.E730fs	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	730								p.L732fs*11(1)		autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				GAACAAGATTGAAAAACTTCTC	0.356																																					p.E730fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2188_2189insA	18						.																																			58076876	SO:0001589	frameshift_variant	57614	exon15			BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.2193dupA	18.37:g.59925900_59925900dupA	ENSP00000381198:p.Glu730fs		58076875	NM_020854		Frame_Shift_Ins	INS	ENST00000398130.2	37	CCDS11979.2																																																																																				0.356	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	
OSBPL11	114885	hgsc.bcm.edu	37	3	125298726	125298727	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:125298726_125298727insC	ENST00000296220.5	-	3	680_681	c.391_392insG	c.(391-393)gaafs	p.E131fs		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	131	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)	p.E131fs*4(1)		NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						TTTATATTGTTCCCCACTGGCA	0.396																																					p.E131fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.392_393insG	3						.																																			126781417	SO:0001589	frameshift_variant	114885	exon3			AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.392dupG	3.37:g.125298730_125298730dupC	ENSP00000296220:p.Glu131fs		126781416	NM_022776	A8K9I7	Frame_Shift_Ins	INS	ENST00000296220.5	37	CCDS3033.1																																																																																				0.396	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
SCAF11	9169	hgsc.bcm.edu	37	12	46320481	46320482	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:46320481_46320482insT	ENST00000369367.3	-	11	3235_3236	c.3002_3003insA	c.(3001-3003)aatfs	p.N1001fs	SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000465950.1_Frame_Shift_Ins_p.N686fs|SCAF11_ENST00000549162.1_Frame_Shift_Ins_p.N809fs|SCAF11_ENST00000419565.2_Frame_Shift_Ins_p.N1001fs	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	1001					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.N1001fs*2(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GATGGATGTCATTTTTTTCTTT	0.386																																					p.N1001fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3003_3004insA	12						.																																			44606749	SO:0001589	frameshift_variant	9169	exon11			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.3003dupA	12.37:g.46320488_46320488dupT	ENSP00000358374:p.Asn1001fs		44606748	NM_004719	A6NEU9|A6NLW5|Q8IW59	Frame_Shift_Ins	INS	ENST00000369367.3	37	CCDS8748.2																																																																																				0.386	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
NDUFA12	55967	hgsc.bcm.edu	37	12	95397373	95397374	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:95397373_95397374insA	ENST00000327772.2	-	1	172_173	c.83_84insT	c.(82-84)ttcfs	p.F28fs	NDUFA12_ENST00000547986.1_Frame_Shift_Ins_p.F28fs|NDUFA12_ENST00000547157.1_Frame_Shift_Ins_p.F28fs	NM_018838.4	NP_061326.1	Q9UI09	NDUAC_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12	28					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.R29fs*4(1)|p.F28F(1)		endometrium(1)|large_intestine(2)|lung(3)	6						CCGCCTACCTGAAAAAAACCCG	0.614																																					p.F28fs												.	.	2	Substitution - coding silent(1)|Insertion - Frameshift(1)	large_intestine(1)|lung(1)	c.84_85insT	12						.																																			93921505	SO:0001589	frameshift_variant	55967	exon1			BC005936	CCDS9050.1, CCDS58263.1	12q22	2011-07-04			ENSG00000184752	ENSG00000184752		"""Mitochondrial respiratory chain complex / Complex I"""	23987	protein-coding gene	gene with protein product	"""complex I B17.2 subunit"""	614530				10830904, 9827566	Standard	NM_018838		Approved	DAP13, B17.2	uc001tdl.4	Q9UI09		ENST00000327772.2:c.84dupT	12.37:g.95397380_95397380dupA	ENSP00000330737:p.Phe28fs		93921504	NM_018838	F8VQS7|Q53XX0|Q9BRV6	Frame_Shift_Ins	INS	ENST00000327772.2	37	CCDS9050.1																																																																																				0.614	NDUFA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407245.2	NM_018838	
SCML2	10389	hgsc.bcm.edu	37	X	18260581	18260582	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:18260581_18260582insG	ENST00000251900.4	-	14	2110_2111	c.1951_1952insC	c.(1951-1953)ctcfs	p.L651fs	SCML2_ENST00000491988.1_5'Flank|SCML2_ENST00000398048.3_Intron	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	651	SAM.				anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L651fs*9(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					GAGGTCGGCGAGGGGGCCTGAT	0.475																																					p.L651fs	Esophageal Squamous(100;1252 1965 19021 35517)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1952_1953insC	X						.																																			18170503	SO:0001589	frameshift_variant	10389	exon14			Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1952dupC	X.37:g.18260586_18260586dupG	ENSP00000251900:p.Leu651fs		18170502	NM_006089	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Frame_Shift_Ins	INS	ENST00000251900.4	37	CCDS14185.1																																																																																				0.475	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089	
AMER1	139285	hgsc.bcm.edu	37	X	63412058	63412059	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:63412058_63412059insC	ENST00000330258.3	-	2	1380_1381	c.1108_1109insG	c.(1108-1110)gagfs	p.E370fs	AMER1_ENST00000374869.3_Frame_Shift_Ins_p.E370fs|AMER1_ENST00000403336.1_Frame_Shift_Ins_p.E370fs	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	370	Glu-rich.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)|p.E370fs*8(2)									GGCCATCTCCTCCCCACCTCCT	0.54																																					p.E370fs												.	.	69	Whole gene deletion(67)|Insertion - Frameshift(2)	kidney(65)|large_intestine(3)|ovary(1)	c.1109_1110insG	X						.																																			63328784	SO:0001589	frameshift_variant	139285	exon2			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1109dupG	X.37:g.63412062_63412062dupC	ENSP00000329117:p.Glu370fs		63328783	NM_152424	A2IB86|Q8N885	Frame_Shift_Ins	INS	ENST00000330258.3	37	CCDS14377.2																																																																																				0.540	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
EVC2	132884	hgsc.bcm.edu	37	4	5620303	5620304	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:5620303_5620304insG	ENST00000344408.5	-	15	2660_2661	c.2607_2608insC	c.(2605-2610)cccaagfs	p.K870fs	EVC2_ENST00000344938.1_Frame_Shift_Ins_p.K870fs|EVC2_ENST00000310917.2_Frame_Shift_Ins_p.K790fs	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	870					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.K870fs*31(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						GCCCGGATCTTGGGGAGGGCCA	0.604																																					p.K870fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2608_2609insC	4						.																																			5671205	SO:0001589	frameshift_variant	132884	exon15			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2608dupC	4.37:g.5620307_5620307dupG	ENSP00000342144:p.Lys870fs		5671204	NM_147127	Q86YT3|Q86YT4|Q8NG49	Frame_Shift_Ins	INS	ENST00000344408.5	37	CCDS3382.2																																																																																				0.604	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
PDE6B	5158	hgsc.bcm.edu	37	4	656338	656339	+	In_Frame_Ins	INS	-	-	TCC			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:656338_656339insTCC	ENST00000496514.1	+	14	1784_1785	c.1763_1764insTCC	c.(1762-1767)ttcgcc>ttTCCcgcc	p.588_589FA>FPA	RP11-1191J2.5_ENST00000609172.1_RNA|PDE6B_ENST00000255622.6_In_Frame_Ins_p.588_589FA>FPA|PDE6B_ENST00000429163.2_In_Frame_Ins_p.309_310FA>FPA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	588					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.F588_A589insP(1)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CTGGAGGCCTTCGCCATGGTGA	0.609																																					p.F309delinsFP	GBM(71;463 1194 9848 25922 46834)											.	.	1	Insertion - In frame(1)	large_intestine(1)	c.926_927insTCC	4						.																																			646339	SO:0001652	inframe_insertion	5158	exon12			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	Exception_encountered	4.37:g.656338_656339insTCC	ENSP00000420295:p.Phe588_Ala589insPro		646338	NM_001145292	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	In_Frame_Ins	INS	ENST00000496514.1	37	CCDS33932.1																																																																																				0.609	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
MBD5	55777	hgsc.bcm.edu	37	2	149247244	149247245	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:149247244_149247245insC	ENST00000407073.1	+	12	4341_4342	c.3344_3345insC	c.(3343-3348)agccccfs	p.SP1115fs	MBD5_ENST00000404807.1_Frame_Shift_Ins_p.SP1348fs	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1115					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.I1117fs*16(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		ACTCAGATCAGCCCCATTCCAG	0.5																																					p.S1115fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3344_3345insC	2						.																																			148963715	SO:0001589	frameshift_variant	55777	exon12			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3348dupC	2.37:g.149247248_149247248dupC	ENSP00000386049:p.Ser1115fs		148963714	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Frame_Shift_Ins	INS	ENST00000407073.1	37	CCDS33302.1																																																																																				0.500	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
UBR3	130507	hgsc.bcm.edu	37	2	170917929	170917930	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:170917929_170917930insG	ENST00000272793.5	+	35	5045_5046	c.4995_4996insG	c.(4996-4998)gggfs	p.G1666fs	UBR3_ENST00000418381.1_Frame_Shift_Ins_p.G1666fs|UBR3_ENST00000392631.1_Frame_Shift_Ins_p.G487fs			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1666					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E520fs*5(1)|p.E1667fs*5(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						ACCACCTTTTTGGGGAAGATTT	0.431																																					p.F1665fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.4995_4996insG	2						.																																			170626176	SO:0001589	frameshift_variant	130507	exon35			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.4999dupG	2.37:g.170917933_170917933dupG	ENSP00000272793:p.Gly1666fs		170626175	NM_172070	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Frame_Shift_Ins	INS	ENST00000272793.5	37																																																																																					0.431	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070	
MAN1B1	11253	hgsc.bcm.edu	37	9	139995547	139995548	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:139995547_139995548insG	ENST00000371589.4	+	7	1080_1081	c.1007_1008insG	c.(1006-1011)ctggggfs	p.LG336fs	MAN1B1_ENST00000474902.1_Frame_Shift_Ins_p.LG39fs	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	336					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		ATCCGCATCCTGGGGGGGCTCC	0.54																																					p.L336fs												.	.	0			c.1007_1008insG	9						.																																			139115369	SO:0001589	frameshift_variant	11253	exon7			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1014dupG	9.37:g.139995554_139995554dupG	ENSP00000360645:p.Leu336fs		139115368	NM_016219	Q5VSG3|Q9BRS9|Q9Y5K7	Frame_Shift_Ins	INS	ENST00000371589.4	37	CCDS7029.1																																																																																				0.540	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055294.2	NM_016219	
KIAA0020	9933	hgsc.bcm.edu	37	9	2824764	2824765	+	Frame_Shift_Ins	INS	-	-	GT	rs143370878	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:2824764_2824765insGT	ENST00000397885.2	-	11	1292_1293	c.1086_1087insAC	c.(1084-1089)cacgatfs	p.D363fs		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	363	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.H362H(1)|p.D363fs*21(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		CTGGCGCCATCGTGTGTGTGTG	0.52																																					p.D363fs												.	.	2	Substitution - coding silent(1)|Insertion - Frameshift(1)	large_intestine(2)	c.1087_1088insAC	9						.																																			2814765	SO:0001589	frameshift_variant	9933	exon11			AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1085_1086dupAC	9.37:g.2824773_2824774dupGT	ENSP00000380982:p.Asp363fs		2814764	NM_014878	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Frame_Shift_Ins	INS	ENST00000397885.2	37	CCDS6448.2																																																																																				0.520	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051529.3	NM_014878	
CHMP5	51510	hgsc.bcm.edu	37	9	33278213	33278214	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:33278213_33278214insA	ENST00000223500.8	+	7	736_737	c.599_600insA	c.(598-603)acaaaafs	p.TK200fs	CHMP5_ENST00000419016.2_Intron|CHMP5_ENST00000487080.1_3'UTR	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5	200					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.N202fs*9(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			CCCACTGATACAAAAAACAAGG	0.396																																					p.T200fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.599_600insA	9						.																																			33268214	SO:0001589	frameshift_variant	51510	exon7			AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765	ENST00000223500.8:c.605dupA	9.37:g.33278219_33278219dupA	ENSP00000223500:p.Thr200fs		33268213	NM_016410	B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Frame_Shift_Ins	INS	ENST00000223500.8	37	CCDS6537.1																																																																																				0.396	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052040.3	NM_016410	
ADRA2A	150	hgsc.bcm.edu	37	10	112838962	112838963	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:112838962_112838963insC	ENST00000280155.2	+	1	2173_2174	c.1208_1209insC	c.(1207-1212)ttccccfs	p.FP403fs		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	388					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)	p.F390fs*>62(1)		breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GTGTGCTGGTTCCCCTTCTTCT	0.629																																					p.F403fs	Esophageal Squamous(173;605 2658 7278 49362)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1208_1209insC	10						.																																			112828953	SO:0001589	frameshift_variant	150	exon1			AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.1212dupC	10.37:g.112838966_112838966dupC	ENSP00000280155:p.Phe403fs		112828952	NM_000681	B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Frame_Shift_Ins	INS	ENST00000280155.2	37	CCDS7569.2																																																																																				0.629	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050372.2	NM_000681	
MASTL	84930	hgsc.bcm.edu	37	10	27459055	27459056	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:27459055_27459056insA	ENST00000375940.4	+	8	1224_1225	c.1167_1168insA	c.(1168-1170)aaafs	p.K390fs	MASTL_ENST00000375946.4_Frame_Shift_Ins_p.K390fs|MASTL_ENST00000477034.1_3'UTR|MASTL_ENST00000342386.6_Frame_Shift_Ins_p.K390fs			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	390	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)	p.C392fs*17(2)		breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TAAACCTTGCTAAAAAATGCTT	0.416																																					p.A389fs												.	.	2	Insertion - Frameshift(2)	large_intestine(1)|stomach(1)	c.1167_1168insA	10						.																																			27499062	SO:0001589	frameshift_variant	84930	exon8			BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.1173dupA	10.37:g.27459061_27459061dupA	ENSP00000365107:p.Lys390fs		27499061	NM_032844	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Frame_Shift_Ins	INS	ENST00000375940.4	37	CCDS53502.1																																																																																				0.416	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047320.1	NM_032844	
SLC16A9	220963	hgsc.bcm.edu	37	10	61432545	61432546	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:61432545_61432546insA	ENST00000395348.3	-	3	958_959	c.322_323insT	c.(322-324)tccfs	p.S108fs	SLC16A9_ENST00000395347.1_Frame_Shift_Ins_p.S108fs	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	108					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.S108fs*26(1)		kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						AATGCCATAGGAAAAAAACAGA	0.426																																					p.S108fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.323_324insT	10						.																																			61102552	SO:0001589	frameshift_variant	220963	exon3			AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.323dupT	10.37:g.61432552_61432552dupA	ENSP00000378757:p.Ser108fs		61102551	NM_194298	Q6ZMI2|Q9UFH8	Frame_Shift_Ins	INS	ENST00000395348.3	37	CCDS7256.1																																																																																				0.426	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048174.2	NM_194298	
APC	324	hgsc.bcm.edu	37	5	112151228	112151229	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:112151228_112151229insT	ENST00000457016.1	+	9	1251_1252	c.871_872insT	c.(871-873)gttfs	p.V291fs	APC_ENST00000508376.2_Frame_Shift_Ins_p.V291fs|APC_ENST00000257430.4_Frame_Shift_Ins_p.V291fs			P25054	APC_HUMAN	adenomatous polyposis coli	291	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.V291F(1)|p.L292fs*4(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AACAGCCAGTGTTTTGAGTTCT	0.396		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.V291fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(2)	c.871_872insT	5						.																																			112179128	SO:0001589	frameshift_variant	324	exon9	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.875dupT	5.37:g.112151232_112151232dupT	ENSP00000413133:p.Val291fs		112179127	NM_000038	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Ins	INS	ENST00000457016.1	37	CCDS4107.1																																																																																				0.396	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	hgsc.bcm.edu	37	5	112175969	112175970	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:112175969_112175970insA	ENST00000457016.1	+	16	5058_5059	c.4678_4679insA	c.(4678-4680)gaafs	p.E1560fs	APC_ENST00000508376.2_Frame_Shift_Ins_p.E1560fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Ins_p.E1560fs			P25054	APC_HUMAN	adenomatous polyposis coli	1560	Asp/Glu-rich (acidic).|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.D1562fs*5(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TATTGATTCTGAAAAGGACCTA	0.342		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1560fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	3	Unknown(1)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	large_intestine(1)|soft_tissue(1)|skin(1)	c.4678_4679insA	5						.																																			112203869	SO:0001589	frameshift_variant	324	exon16	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4682dupA	5.37:g.112175973_112175973dupA	ENSP00000413133:p.Glu1560fs		112203868	NM_000038	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Ins	INS	ENST00000457016.1	37	CCDS4107.1																																																																																				0.342	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SLC9A3	6550	hgsc.bcm.edu	37	5	475754	475755	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:475754_475755insG	ENST00000264938.3	-	15	2181_2182	c.2172_2173insC	c.(2170-2175)cccaacfs	p.N725fs	SLC9A3_ENST00000514375.1_Frame_Shift_Ins_p.N716fs|CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.5_ENST00000510604.1_5'Flank|CTD-2228K2.5_ENST00000342584.3_5'Flank|CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.5_ENST00000510714.1_5'Flank	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	725					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)	p.N725fs*3(1)		NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TCATCATAGTTGGGGGGCTCCT	0.624																																					p.N725fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.2173_2174insC	5						.																																			528755	SO:0001589	frameshift_variant	6550	exon15				CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2173dupC	5.37:g.475760_475760dupG	ENSP00000264938:p.Asn725fs		528754	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Frame_Shift_Ins	INS	ENST00000264938.3	37	CCDS3855.1																																																																																				0.624	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
CLCA3P	9629	hgsc.bcm.edu	37	1	87108245	87108246	+	RNA	INS	-	-	A	rs146125126		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:87108245_87108246insA	ENST00000456587.1	-	0	294				CLCA3P_ENST00000466454.1_RNA														p.T254fs*4(1)									ATTTTGTACTGAAAAAACACAC	0.332																																					.												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	.	1						.																																			86880834			9629	.																															1.37:g.87108251_87108251dupA			86880833	.		Frame_Shift_Ins	INS	ENST00000456587.1	37																																																																																					0.332	RP4-651E10.4-001	KNOWN	non_canonical_TEC|basic	antisense	antisense	OTTHUMT00000028263.1		
BTN2A3P	54718	hgsc.bcm.edu	37	6	26431305	26431306	+	RNA	INS	-	-	TC			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	-	-	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:26431305_26431306insTC	ENST00000466808.2	+	0	1447							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.E412fs*24(1)									CTTAAGTGGATTCTCTCTCTGG	0.51																																					.												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	.	6						.																																			26539285			54718	.			AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26431312_26431313dupTC			26539284	.	A6NEF4	Frame_Shift_Ins	INS	ENST00000466808.2	37																																																																																					0.510	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000040118.4	NR_027795	
KCND2	3751	hgsc.bcm.edu	37	7	119914855	119914855	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:119914855G>A	ENST00000331113.4	+	1	1134	c.169G>A	c.(169-171)Gac>Aac	p.D57N		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	57					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.D57N(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GACGTGGCAGGACACCCTGGA	0.562																																					p.D57N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G169A	7						.						126.0	132.0	130.0					7																	119914855		2203	4300	6503	119702091	SO:0001583	missense	3751	exon1			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.169G>A	7.37:g.119914855G>A	ENSP00000333496:p.Asp57Asn		119702091	NM_012281	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	37	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	G	5.209	0.224153	0.09863	.	.	ENSG00000184408	ENST00000331113	T	0.44083	0.93	5.51	5.51	0.81932	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.127808	0.51477	D	0.000092	T	0.20861	0.0502	N	0.04203	-0.255	0.45806	D	0.998687	B	0.02656	0.0	B	0.04013	0.001	T	0.13548	-1.0505	9	.	.	.	.	12.7251	0.57166	0.0749:0.0:0.9251:0.0	.	57	Q9NZV8	KCND2_HUMAN	N	57	ENSP00000333496:D57N	.	D	+	1	0	KCND2	119702091	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.653000	0.54446	2.603000	0.88011	0.655000	0.94253	GAC		0.562	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281	
NRF1	4899	hgsc.bcm.edu	37	7	129297323	129297323	+	Silent	SNP	G	G	A	rs143882672	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:129297323G>A	ENST00000393232.1	+	2	249	c.132G>A	c.(130-132)tcG>tcA	p.S44S	NRF1_ENST00000539636.1_5'UTR|NRF1_ENST00000223190.4_Silent_p.S44S|NRF1_ENST00000393230.2_Silent_p.S44S|NRF1_ENST00000311967.2_Silent_p.S44S|NRF1_ENST00000353868.4_Silent_p.S44S|NRF1_ENST00000393231.3_Silent_p.S44S	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	44	Asp/Glu-rich (acidic).|Dimerization.				cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.S44S(1)		breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						ATGAAGACTCGCCTTCTTCTC	0.517													G|||	3	0.000599042	0.0015	0.0	5008	,	,		17028	0.0		0.0	False		,,,				2504	0.001				p.S44S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G132A	7						.	G	,	9,4397	14.3+/-33.2	0,9,2194	138.0	116.0	123.0		132,132	-8.3	0.8	7	dbSNP_134	123	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	NRF1	NM_001040110.1,NM_005011.3	,	0,9,6494	AA,AG,GG		0.0,0.2043,0.0692	,	44/504,44/504	129297323	9,12997	2203	4300	6503	129084559	SO:0001819	synonymous_variant	4899	exon2			L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.132G>A	7.37:g.129297323G>A			129084559	NM_005011	A8K4C6|B4DDV6|Q15305|Q96AN2	Silent	SNP	ENST00000393232.1	37	CCDS5813.2																																																																																				0.517	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289813.1	NM_001040110	
SLC13A4	26266	hgsc.bcm.edu	37	7	135378907	135378907	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:135378907A>G	ENST00000354042.4	-	10	1785	c.1096T>C	c.(1096-1098)Tat>Cat	p.Y366H		NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	366					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)	p.Y366H(1)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						AGTTTTTCATATTCTTCTTGG	0.448																																					p.Y366H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1096C	7						.						297.0	266.0	276.0					7																	135378907		2203	4300	6503	135029447	SO:0001583	missense	26266	exon10			AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1096T>C	7.37:g.135378907A>G	ENSP00000297282:p.Tyr366His		135029447	NM_012450	A4D1Q4|Q8N631	Missense_Mutation	SNP	ENST00000354042.4	37	CCDS5840.1	.	.	.	.	.	.	.	.	.	.	A	17.59	3.427457	0.62733	.	.	ENSG00000164707	ENST00000354042	T	0.02472	4.28	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.11580	0.0282	L	0.60957	1.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.07366	-1.0776	10	0.33141	T	0.24	-8.1799	13.5883	0.61944	1.0:0.0:0.0:0.0	.	235;366	Q59HF0;Q9UKG4	.;S13A4_HUMAN	H	366	ENSP00000297282:Y366H	ENSP00000297282:Y366H	Y	-	1	0	SLC13A4	135029447	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	8.651000	0.91078	2.090000	0.63153	0.460000	0.39030	TAT		0.448	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1	NM_012450	
ZC3HAV1	56829	hgsc.bcm.edu	37	7	138732496	138732496	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:138732496A>G	ENST00000242351.5	-	13	2869	c.2553T>C	c.(2551-2553)acT>acC	p.T851T	ZC3HAV1_ENST00000464606.1_Silent_p.T973T	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	851	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.		T -> I (in dbSNP:rs3735007). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005}.		defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.T851T(1)		cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						TATTTCCTTCAGTAAACTTTC	0.428																																					p.T851T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2553C	7						.						138.0	138.0	138.0					7																	138732496		2203	4300	6503	138383036	SO:0001819	synonymous_variant	56829	exon13			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.2553T>C	7.37:g.138732496A>G			138383036	NM_020119	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Silent	SNP	ENST00000242351.5	37	CCDS5851.1																																																																																				0.428	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
TAS2R5	54429	hgsc.bcm.edu	37	7	141490671	141490671	+	Silent	SNP	A	A	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:141490671A>T	ENST00000247883.4	+	1	655	c.510A>T	c.(508-510)gcA>gcT	p.A170A		NM_018980.2	NP_061853.1	Q9NYW4	TA2R5_HUMAN	taste receptor, type 2, member 5	170					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.A170A(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9	Melanoma(164;0.0171)					ACCTGTATGCATTTCAGCTCA	0.413																																					p.A170A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A510T	7						.						147.0	119.0	129.0					7																	141490671		2203	4300	6503	141137140	SO:0001819	synonymous_variant	54429	exon1			AF227132	CCDS5869.1	7q31.3-q32	2012-08-22			ENSG00000127366	ENSG00000127366		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14912	protein-coding gene	gene with protein product		605062					Standard	NM_018980		Approved	T2R5	uc003vwr.1	Q9NYW4	OTTHUMG00000157632	ENST00000247883.4:c.510A>T	7.37:g.141490671A>T			141137140	NM_018980	Q645W0|Q75MV7	Silent	SNP	ENST00000247883.4	37	CCDS5869.1																																																																																				0.413	TAS2R5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349283.1		
ZNF425	155054	hgsc.bcm.edu	37	7	148801216	148801216	+	Missense_Mutation	SNP	C	C	T	rs538143174		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:148801216C>T	ENST00000378061.2	-	4	1879	c.1747G>A	c.(1747-1749)Gcg>Acg	p.A583T		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	583					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A583T(1)		breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TCACCGCACGCGAAGGGCTTC	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		18759	0.0		0.0	False		,,,				2504	0.001				p.A583T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1747A	7						.						78.0	65.0	69.0					7																	148801216		2203	4300	6503	148432149	SO:0001583	missense	155054	exon4			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.1747G>A	7.37:g.148801216C>T	ENSP00000367300:p.Ala583Thr		148432149	NM_001001661	B3KPM1|Q08AG3	Missense_Mutation	SNP	ENST00000378061.2	37	CCDS34773.1	.	.	.	.	.	.	.	.	.	.	C	10.10	1.256562	0.22965	.	.	ENSG00000204947	ENST00000378061	T	0.08008	3.14	3.11	-3.45	0.04781	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04543	0.0124	N	0.17723	0.515	0.09310	N	1	B	0.13594	0.008	B	0.04013	0.001	T	0.40289	-0.9571	9	0.45353	T	0.12	.	4.7052	0.12846	0.1409:0.2053:0.5453:0.1084	.	583	Q6IV72	ZN425_HUMAN	T	583	ENSP00000367300:A583T	ENSP00000367300:A583T	A	-	1	0	ZNF425	148432149	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-4.646000	0.00204	-0.520000	0.06435	-0.844000	0.03045	GCG		0.597	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352726.1	XM_088140	
GALNT11	63917	hgsc.bcm.edu	37	7	151818641	151818641	+	Missense_Mutation	SNP	G	G	A	rs371120745		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:151818641G>A	ENST00000434507.1	+	14	2143	c.1706G>A	c.(1705-1707)cGg>cAg	p.R569Q	RP5-981O7.2_ENST00000424630.1_RNA|GALNT11_ENST00000320311.2_Missense_Mutation_p.R569Q|GALNT11_ENST00000430044.2_Missense_Mutation_p.R569Q|GALNT11_ENST00000452146.2_Missense_Mutation_p.R488Q			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	569	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R569Q(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		AAAAACAATCGGCTATACCAG	0.478																																					p.R569Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1706A	7						.	G	GLN/ARG	0,4406		0,0,2203	88.0	81.0	83.0		1706	5.1	1.0	7		83	1,8599	1.2+/-3.3	0,1,4299	no	missense	GALNT11	NM_022087.2	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	569/609	151818641	1,13005	2203	4300	6503	151449574	SO:0001583	missense	63917	exon12			AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.1706G>A	7.37:g.151818641G>A	ENSP00000416787:p.Arg569Gln		151449574	NM_022087	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Missense_Mutation	SNP	ENST00000434507.1	37	CCDS5930.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.985691	0.53934	0.0	1.16E-4	ENSG00000178234	ENST00000430044;ENST00000452146;ENST00000443352;ENST00000434507;ENST00000320311	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.08	5.08	0.68730	Ricin B-related lectin (1);Ricin B lectin (3);	0.433616	0.23718	N	0.045260	T	0.20170	0.0485	L	0.31420	0.93	0.80722	D	1	B;B	0.18863	0.031;0.008	B;B	0.17433	0.018;0.012	T	0.06534	-1.0821	10	0.09084	T	0.74	.	18.4665	0.90757	0.0:0.0:1.0:0.0	.	488;569	B7Z5G5;Q8NCW6	.;GLT11_HUMAN	Q	569;488;569;569;569	ENSP00000395122:R569Q;ENSP00000393399:R488Q;ENSP00000416787:R569Q;ENSP00000315835:R569Q	ENSP00000315835:R569Q	R	+	2	0	GALNT11	151449574	1.000000	0.71417	0.983000	0.44433	0.624000	0.37722	9.692000	0.98682	2.340000	0.79590	0.561000	0.74099	CGG		0.478	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348184.1	NM_022087	
BRAT1	221927	hgsc.bcm.edu	37	7	2586968	2586968	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:2586968T>C	ENST00000340611.4	-	3	528	c.272A>G	c.(271-273)cAg>cGg	p.Q91R		NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	91					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)		p.Q91R(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						CTGAAGATACTGGAAGCAGTT	0.607																																					p.Q91R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A272G	7						.						70.0	64.0	66.0					7																	2586968		2203	4300	6503	2553494	SO:0001583	missense	221927	exon3			BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.272A>G	7.37:g.2586968T>C	ENSP00000339637:p.Gln91Arg		2553494	NM_152743	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	ENST00000340611.4	37	CCDS5334.1	.	.	.	.	.	.	.	.	.	.	T	14.09	2.431450	0.43122	.	.	ENSG00000106009	ENST00000340611	D	0.82711	-1.64	5.01	3.82	0.43975	Armadillo-type fold (1);	0.602490	0.17046	N	0.189103	T	0.80660	0.4665	M	0.65975	2.015	0.21604	N	0.999627	P;P	0.46142	0.873;0.608	B;B	0.42361	0.385;0.156	T	0.71265	-0.4644	10	0.49607	T	0.09	-3.8635	8.5528	0.33462	0.307:0.0:0.0:0.693	.	91;91	Q6PJG6-2;Q6PJG6	.;BRAT1_HUMAN	R	91	ENSP00000339637:Q91R	ENSP00000339637:Q91R	Q	-	2	0	BRAT1	2553494	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	1.805000	0.38883	0.723000	0.32274	0.528000	0.53228	CAG		0.607	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239305.2	NM_152743	
BZW2	28969	hgsc.bcm.edu	37	7	16734594	16734594	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:16734594C>T	ENST00000433922.2	+	8	965	c.787C>T	c.(787-789)Cag>Tag	p.Q263*	BZW2_ENST00000405202.1_Nonsense_Mutation_p.Q187*|BZW2_ENST00000258761.3_Nonsense_Mutation_p.Q263*|BZW2_ENST00000432311.1_Intron|BZW2_ENST00000407633.1_Nonsense_Mutation_p.Q69*|AC073333.8_ENST00000418907.1_RNA|BZW2_ENST00000452975.2_3'UTR	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	263	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		GAAGGAGCTCCAGGAGCGTCT	0.522																																					p.Q263X												.	.	0			c.C787T	7						.						59.0	56.0	57.0					7																	16734594		2203	4300	6503	16701119	SO:0001587	stop_gained	28969	exon8			AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.787C>T	7.37:g.16734594C>T	ENSP00000397249:p.Gln263*		16701119	NM_014038	A4D123|Q3B779|Q96JW5|Q9H3F7	Nonsense_Mutation	SNP	ENST00000433922.2	37	CCDS5362.1	.	.	.	.	.	.	.	.	.	.	C	37	6.534013	0.97641	.	.	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000405202;ENST00000446596;ENST00000407633	.	.	.	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	-17.402	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	263;263;263;187;263;69	.	ENSP00000258761:Q263X	Q	+	1	0	BZW2	16701119	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.950000	0.70265	2.941000	0.99782	0.655000	0.94253	CAG		0.522	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253256.2	NM_014038	
BZW2	28969	hgsc.bcm.edu	37	7	16736652	16736652	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:16736652A>C	ENST00000433922.2	+	9	1113	c.935A>C	c.(934-936)gAa>gCa	p.E312A	BZW2_ENST00000405202.1_Missense_Mutation_p.E236A|BZW2_ENST00000258761.3_Missense_Mutation_p.E312A|BZW2_ENST00000432311.1_3'UTR|BZW2_ENST00000407633.1_Missense_Mutation_p.E118A|AC073333.8_ENST00000418907.1_RNA|BZW2_ENST00000452975.2_3'UTR	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	312	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)		p.E312A(1)		cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		AAGAAGGAAGAACTTGTTGCA	0.443																																					p.E312A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A935C	7						.						105.0	99.0	101.0					7																	16736652		2203	4300	6503	16703177	SO:0001583	missense	28969	exon9			AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.935A>C	7.37:g.16736652A>C	ENSP00000397249:p.Glu312Ala		16703177	NM_014038	A4D123|Q3B779|Q96JW5|Q9H3F7	Missense_Mutation	SNP	ENST00000433922.2	37	CCDS5362.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.007343	0.93287	.	.	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000405202;ENST00000407633	T;T;T;D;D	0.86694	-1.26;-1.16;-1.16;-2.16;-2.15	5.89	5.89	0.94794	eIF4-gamma/eIF5/eIF2-epsilon (1);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.64402	D	0.000001	D	0.92606	0.7651	M	0.72894	2.215	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.68192	0.956;0.956	D	0.92714	0.6185	10	0.52906	T	0.07	-5.8611	16.3083	0.82859	1.0:0.0:0.0:0.0	.	312;312	E7ETZ4;Q9Y6E2	.;BZW2_HUMAN	A	312;312;312;236;118	ENSP00000403481:E312A;ENSP00000258761:E312A;ENSP00000397249:E312A;ENSP00000385577:E236A;ENSP00000384617:E118A	ENSP00000258761:E312A	E	+	2	0	BZW2	16703177	1.000000	0.71417	0.993000	0.49108	0.957000	0.61999	9.339000	0.96797	2.250000	0.74265	0.455000	0.32223	GAA		0.443	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253256.2	NM_014038	
MACC1	346389	hgsc.bcm.edu	37	7	20198745	20198745	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:20198745A>G	ENST00000400331.5	-	5	1547	c.1239T>C	c.(1237-1239)tcT>tcC	p.S413S	MACC1_ENST00000332878.4_Silent_p.S413S|MACC1_ENST00000589011.1_Silent_p.S413S	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	413					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S413S(1)		endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						ACACAACTGGAGATATGTTTT	0.358																																					p.S413S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1239C	7						.						49.0	47.0	48.0					7																	20198745		2203	4300	6503	20165270	SO:0001819	synonymous_variant	346389	exon5				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.1239T>C	7.37:g.20198745A>G			20165270	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Silent	SNP	ENST00000400331.5	37	CCDS5369.1																																																																																				0.358	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
PSMA2	5683	hgsc.bcm.edu	37	7	42957378	42957378	+	Splice_Site	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:42957378T>C	ENST00000223321.4	-	7	651	c.587A>G	c.(586-588)aAg>aGg	p.K196R	PSMA2_ENST00000442788.1_Splice_Site_p.K196R|PSMA2_ENST00000445517.1_Splice_Site_p.K126R	NM_002787.4	NP_002778.1	P25787	PSA2_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 2	196					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to virus (GO:0009615)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)	p.K196R(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)	10						TGAGCTAACCTTTAGGGTTAA	0.303																																					p.K196R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A587G	7						.						81.0	85.0	83.0					7																	42957378		2203	4300	6503	42923903	SO:0001630	splice_region_variant	5683	exon7			D00760	CCDS5467.1	7p13	2005-10-11			ENSG00000106588	ENSG00000106588		"""Proteasome (prosome, macropain) subunits"""	9531	protein-coding gene	gene with protein product		176842				2025653, 1888762	Standard	NM_002787		Approved	MU, HC3, PMSA2	uc003thy.3	P25787	OTTHUMG00000023916	ENST00000223321.4:c.588+1A>G	7.37:g.42957378T>C			42923903	NM_002787	Q6ICS6|Q9BU45	Missense_Mutation	SNP	ENST00000223321.4	37	CCDS5467.1	.	.	.	.	.	.	.	.	.	.	T	18.71	3.682400	0.68157	.	.	ENSG00000106588	ENST00000223321;ENST00000445517	T;T	0.23147	1.92;1.92	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	L	0.41492	1.28	0.80722	D	1	B	0.10296	0.003	B	0.21151	0.033	T	0.02560	-1.1141	10	0.30854	T	0.27	.	16.5582	0.84512	0.0:0.0:0.0:1.0	.	196	P25787	PSA2_HUMAN	R	196;126	ENSP00000223321:K196R;ENSP00000404858:K126R	ENSP00000223321:K196R	K	-	2	0	PSMA2	42923903	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.040000	0.89188	2.308000	0.77769	0.533000	0.62120	AAG		0.303	PSMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250816.1	NM_002787	Missense_Mutation
EGFR	1956	hgsc.bcm.edu	37	7	55223620	55223620	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:55223620C>T	ENST00000275493.2	+	8	1164	c.987C>T	c.(985-987)tgC>tgT	p.C329C	EGFR_ENST00000442591.1_Silent_p.C329C|EGFR_ENST00000342916.3_Silent_p.C329C|EGFR_ENST00000455089.1_Silent_p.C284C|EGFR_ENST00000454757.2_Silent_p.C276C|EGFR_ENST00000344576.2_Silent_p.C329C|EGFR_ENST00000420316.2_Silent_p.C329C	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	329					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.C329C(2)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GTAAGAAGTGCGAAGGGCCTT	0.602		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.C329C		yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C987T	7						.						37.0	35.0	36.0					7																	55223620		2203	4300	6503	55191114	SO:0001819	synonymous_variant	1956	exon8	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.987C>T	7.37:g.55223620C>T			55191114	NM_201282	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	ENST00000275493.2	37	CCDS5514.1																																																																																				0.602	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
KCTD7	154881	hgsc.bcm.edu	37	7	66103262	66103262	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:66103262T>A	ENST00000275532.3	+	3	521	c.337T>A	c.(337-339)Tca>Aca	p.S113T	KCTD7_ENST00000443322.1_Missense_Mutation_p.S113T	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	113	BTB.				cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.S113T(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						TTTCCTGCGCTCAGGGGACCT	0.572																																					p.S113T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T337A	7						.						104.0	97.0	99.0					7																	66103262		2203	4300	6503	65740697	SO:0001583	missense	154881	exon3			AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.337T>A	7.37:g.66103262T>A	ENSP00000275532:p.Ser113Thr		65740697	NM_001167961	A4D2M4|Q8IVR0	Missense_Mutation	SNP	ENST00000275532.3	37	CCDS5534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	19.79|19.79	3.892100|3.892100	0.72524|0.72524	.|.	.|.	ENSG00000243335|ENSG00000243335	ENST00000449064|ENST00000275532;ENST00000443322	.|T;T	.|0.75154	.|-0.91;-0.91	5.61|5.61	5.61|5.61	0.85477|0.85477	.|BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.216830|.	0.23581|.	N|.	0.046646|.	T|T	0.56790|0.56790	0.2009|0.2009	N|N	0.13299|0.13299	0.325|0.325	0.80722|0.80722	D|D	1|1	.|B	.|0.21688	.|0.059	.|B	.|0.27608	.|0.081	T|T	0.54351|0.54351	-0.8307|-0.8307	7|9	0.87932|0.05436	D|T	0|0.98	.|.	15.0016|15.0016	0.71476|0.71476	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|113	.|Q96MP8	.|KCTD7_HUMAN	H|T	56|113	.|ENSP00000275532:S113T;ENSP00000411624:S113T	ENSP00000388463:L56H|ENSP00000275532:S113T	L|S	+|+	2|1	0|0	KCTD7|KCTD7	65740697|65740697	0.999000|0.999000	0.42202|0.42202	0.999000|0.999000	0.59377|0.59377	0.952000|0.952000	0.60782|0.60782	4.775000|4.775000	0.62346|0.62346	2.146000|2.146000	0.66826|0.66826	0.459000|0.459000	0.35465|0.35465	CTC|TCA		0.572	KCTD7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251733.2	NM_153033	
BAZ1B	9031	hgsc.bcm.edu	37	7	72892508	72892508	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:72892508A>G	ENST00000339594.4	-	7	1621	c.1283T>C	c.(1282-1284)cTg>cCg	p.L428P	BAZ1B_ENST00000404251.1_Missense_Mutation_p.L428P	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	428	Lys-rich.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)	p.L428P(1)		NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				AGGAGTCTTCAGTCCTTTTTT	0.483																																					p.L428P	Esophageal Squamous(112;1167 1561 21085 43672 48228)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1283C	7						.						134.0	123.0	127.0					7																	72892508		2203	4300	6503	72530444	SO:0001583	missense	9031	exon7			AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.1283T>C	7.37:g.72892508A>G	ENSP00000342434:p.Leu428Pro		72530444	NM_032408	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	ENST00000339594.4	37	CCDS5549.1	.	.	.	.	.	.	.	.	.	.	A	7.546	0.661724	0.14645	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.57595	0.39;0.39	5.83	4.69	0.59074	.	0.313649	0.30630	N	0.009216	T	0.33177	0.0854	N	0.14661	0.345	0.19945	N	0.999945	B	0.02656	0.0	B	0.04013	0.001	T	0.12344	-1.0551	10	0.29301	T	0.29	-6.186	10.5895	0.45302	0.9252:0.0:0.0748:0.0	.	428	Q9UIG0	BAZ1B_HUMAN	P	428	ENSP00000342434:L428P;ENSP00000385442:L428P	ENSP00000342434:L428P	L	-	2	0	BAZ1B	72530444	0.996000	0.38824	0.165000	0.22776	0.973000	0.67179	4.103000	0.57783	2.229000	0.72834	0.482000	0.46254	CTG		0.483	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252123.4	NM_032408	
MAGI2	9863	hgsc.bcm.edu	37	7	77885784	77885784	+	Missense_Mutation	SNP	C	C	T	rs370977895		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:77885784C>T	ENST00000354212.4	-	10	1776	c.1523G>A	c.(1522-1524)cGt>cAt	p.R508H	MAGI2_ENST00000522391.1_Missense_Mutation_p.R508H|MAGI2_ENST00000419488.1_Missense_Mutation_p.R508H|MAGI2_ENST00000535697.1_Missense_Mutation_p.R345H|MAGI2_ENST00000536571.1_Missense_Mutation_p.R340H	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	508	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.R508H(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				AGGGTAGCCACGACACAACAC	0.473													C|||	1	0.000199681	0.0	0.0	5008	,	,		20089	0.0		0.0	False		,,,				2504	0.001				p.R508H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1523A	7						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	72.0	61.0	65.0		1523	5.8	1.0	7		65	0,8600		0,0,4300	no	missense	MAGI2	NM_012301.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	508/1456	77885784	1,13005	2203	4300	6503	77723720	SO:0001583	missense	9863	exon10			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1523G>A	7.37:g.77885784C>T	ENSP00000346151:p.Arg508His		77723720	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.839348	0.91117	2.27E-4	0.0	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34	5.85	5.85	0.93711	PDZ/DHR/GLGF (2);	0.000000	0.37437	U	0.002084	T	0.79246	0.4413	M	0.89658	3.05	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.91635	0.999;0.999;0.994;0.994;0.999;0.983	T	0.82661	-0.0347	10	0.87932	D	0	.	19.1433	0.93455	0.0:1.0:0.0:0.0	.	345;340;508;508;508;508	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	H	508;508;508;508;340;345	ENSP00000405766:R508H;ENSP00000346151:R508H;ENSP00000428389:R508H;ENSP00000441584:R340H;ENSP00000441603:R345H	ENSP00000346151:R508H	R	-	2	0	MAGI2	77723720	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.783000	0.85696	2.770000	0.95276	0.555000	0.69702	CGT		0.473	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
KRIT1	889	hgsc.bcm.edu	37	7	91864126	91864126	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:91864126C>G	ENST00000340022.2	-	9	1859	c.841G>C	c.(841-843)Gac>Cac	p.D281H	KRIT1_ENST00000394505.2_Missense_Mutation_p.D281H|KRIT1_ENST00000412043.2_Missense_Mutation_p.D281H|KRIT1_ENST00000394507.1_Missense_Mutation_p.D281H|KRIT1_ENST00000394503.2_Missense_Mutation_p.D281H	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	281					angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)	p.D281H(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CAGTACTTGTCTTCTGTGACA	0.323																																					p.D281H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G841C	7						.						152.0	138.0	143.0					7																	91864126		2203	4300	6503	91702062	SO:0001583	missense	889	exon9			AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.841G>C	7.37:g.91864126C>G	ENSP00000344668:p.Asp281His		91702062	NM_194455	A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Missense_Mutation	SNP	ENST00000340022.2	37	CCDS5624.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804959	0.70682	.	.	ENSG00000001631	ENST00000394507;ENST00000340022;ENST00000412043;ENST00000394505;ENST00000394503;ENST00000415227;ENST00000445516	T;T;T;T;T;T	0.73152	0.78;0.78;0.78;0.78;-0.72;0.74	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.76702	0.4024	L	0.53561	1.675	0.80722	D	1	D;P;D	0.57899	0.981;0.855;0.981	P;P;P	0.57371	0.819;0.533;0.819	T	0.78247	-0.2278	10	0.54805	T	0.06	.	13.4832	0.61348	0.0:0.9218:0.0:0.0782	.	281;281;281	A4D1F7;A6NNU0;O00522	.;.;KRIT1_HUMAN	H	281;281;281;281;281;281;43	ENSP00000378015:D281H;ENSP00000344668:D281H;ENSP00000410909:D281H;ENSP00000378013:D281H;ENSP00000378011:D281H;ENSP00000404084:D43H	ENSP00000344668:D281H	D	-	1	0	KRIT1	91702062	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.768000	0.68858	2.256000	0.74724	0.467000	0.42956	GAC		0.323	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253910.1		
SAMD9	54809	hgsc.bcm.edu	37	7	92731908	92731908	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:92731908T>G	ENST00000379958.2	-	3	3772	c.3503A>C	c.(3502-3504)cAg>cCg	p.Q1168P		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1168						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.Q1168P(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TTCACTTTGCTGTTGAGATTC	0.378																																					p.Q1168P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3503C	7						.						210.0	213.0	212.0					7																	92731908		2203	4300	6503	92569844	SO:0001583	missense	54809	exon2			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.3503A>C	7.37:g.92731908T>G	ENSP00000369292:p.Gln1168Pro		92569844	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	T	9.604	1.129360	0.21041	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.24350	1.86;2.67	4.54	-0.505	0.11993	.	0.664710	0.13586	N	0.377014	T	0.19846	0.0477	L	0.43152	1.355	0.25523	N	0.987342	P	0.50943	0.94	B	0.41571	0.36	T	0.12604	-1.0541	10	0.66056	D	0.02	0.0431	8.0847	0.30765	0.0:0.3871:0.0:0.6129	.	1168	Q5K651	SAMD9_HUMAN	P	1168	ENSP00000369292:Q1168P;ENSP00000414529:Q1168P	ENSP00000369292:Q1168P	Q	-	2	0	SAMD9	92569844	0.000000	0.05858	0.985000	0.45067	0.141000	0.21300	0.029000	0.13666	-0.245000	0.09625	0.418000	0.28097	CAG		0.378	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
TRRAP	8295	hgsc.bcm.edu	37	7	98527741	98527741	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:98527741A>G	ENST00000359863.4	+	24	3514	c.3305A>G	c.(3304-3306)tAt>tGt	p.Y1102C	TRRAP_ENST00000446306.3_Missense_Mutation_p.Y1101C|TRRAP_ENST00000355540.3_Missense_Mutation_p.Y1102C	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1102					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.Y1102C(2)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TGTATGGCATATGAAGAAAAG	0.473																																					p.Y1102C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A3305G	7						.						125.0	123.0	124.0					7																	98527741		2203	4300	6503	98365677	SO:0001583	missense	8295	exon24			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.3305A>G	7.37:g.98527741A>G	ENSP00000352925:p.Tyr1102Cys		98365677	NM_003496	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	37	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.9|20.9	4.059579|4.059579	0.76074|0.76074	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|T;T	.|0.64991	.|-0.13;-0.13	5.38|5.38	5.38|5.38	0.77491|0.77491	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.63581|0.63581	0.2523|0.2523	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.62365	.|0.991;0.975;0.987	.|P;P;P	.|0.58391	.|0.838;0.555;0.758	T|T	0.64206|0.64206	-0.6462|-0.6462	5|10	.|0.38643	.|T	.|0.18	.|.	15.6703|15.6703	0.77267|0.77267	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1102;816;1102	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	V|C	817|1102;1102;1100	.|ENSP00000352925:Y1102C;ENSP00000347733:Y1102C	.|ENSP00000347733:Y1102C	M|Y	+|+	1|2	0|0	TRRAP|TRRAP	98365677|98365677	1.000000|1.000000	0.71417|0.71417	0.858000|0.858000	0.33744|0.33744	0.997000|0.997000	0.91878|0.91878	8.784000|8.784000	0.91818|0.91818	2.165000|2.165000	0.68154|0.68154	0.482000|0.482000	0.46254|0.46254	ATG|TAT		0.473	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
MEPCE	56257	hgsc.bcm.edu	37	7	100030692	100030692	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:100030692C>T	ENST00000310512.2	+	2	2210	c.1822C>T	c.(1822-1824)Cgc>Tgc	p.R608C	PPP1R35_ENST00000476185.1_5'Flank|RP11-758P17.2_ENST00000492523.1_RNA|MEPCE_ENST00000414441.1_Missense_Mutation_p.R139C	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	608	Bin3-type SAM. {ECO:0000255|PROSITE- ProRule:PRU00848}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.R608C(3)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCGGCACCTACGCCCTGGGGG	0.577																																					p.R139C												.	.	3	Substitution - Missense(3)	liver(2)|large_intestine(1)	c.C415T	7						.						77.0	73.0	74.0					7																	100030692		2203	4300	6503	99868628	SO:0001583	missense	56257	exon3			AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.1822C>T	7.37:g.100030692C>T	ENSP00000308546:p.Arg608Cys		99868628	NM_001194991	B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	ENST00000310512.2	37	CCDS5693.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278493	0.59758	.	.	ENSG00000146834	ENST00000414441;ENST00000425355;ENST00000310512	T;T	0.51325	0.71;0.74	5.37	5.37	0.77165	Bin3-type S-adenosyl-L-methionine binding domain (1);Bicoid-interacting 3 (1);	0.142658	0.47455	D	0.000223	T	0.57858	0.2082	M	0.84433	2.695	0.39669	D	0.970721	D	0.60575	0.988	P	0.47206	0.541	T	0.68530	-0.5384	10	0.87932	D	0	-27.7048	11.982	0.53125	0.1732:0.8268:0.0:0.0	.	608	Q7L2J0	MEPCE_HUMAN	C	139;139;608	ENSP00000400875:R139C;ENSP00000308546:R608C	ENSP00000308546:R608C	R	+	1	0	MEPCE	99868628	0.063000	0.20901	0.774000	0.31636	0.647000	0.38526	1.998000	0.40796	2.670000	0.90874	0.462000	0.41574	CGC		0.577	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339135.1		
HTR5A	3361	hgsc.bcm.edu	37	7	154862834	154862834	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr7:154862834C>T	ENST00000287907.2	+	1	801	c.225C>T	c.(223-225)ccC>ccT	p.P75P	HTR5A-AS1_ENST00000493904.1_5'UTR|HTR5A-AS1_ENST00000543018.1_Nonsense_Mutation_p.W60*|HTR5A-AS1_ENST00000395731.2_Nonsense_Mutation_p.W60*	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	75					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)	p.P75P(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	ACCGCGTGCCCCACAACCTGG	0.667																																					p.P75P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C225T	7						.						82.0	58.0	66.0					7																	154862834		2203	4300	6503	154493767	SO:0001819	synonymous_variant	3361	exon1				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.225C>T	7.37:g.154862834C>T			154493767	NM_024012	Q2M2D2	Silent	SNP	ENST00000287907.2	37	CCDS5936.1	.	.	.	.	.	.	.	.	.	.	C	36	5.758778	0.96898	.	.	ENSG00000220575	ENST00000395731;ENST00000543018	.	.	.	4.52	-4.24	0.03777	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	8.989	0.36012	0.2688:0.5251:0.2061:0.0	.	.	.	.	X	60	.	ENSP00000379080:W60X	W	-	3	0	AC093726.4	154493767	0.594000	0.26849	0.969000	0.41365	0.963000	0.63663	-0.125000	0.10579	-0.563000	0.06078	-1.097000	0.02148	TGG		0.667	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012	
CSRP2BP	57325	hgsc.bcm.edu	37	20	18168020	18168020	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:18168020T>C	ENST00000435364.3	+	10	2607	c.2266T>C	c.(2266-2268)Tat>Cat	p.Y756H	CSRP2BP_ENST00000377681.3_Missense_Mutation_p.Y755H|CSRP2BP_ENST00000489634.2_Missense_Mutation_p.Y628H	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	756	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)	p.Y756H(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						GACTGAAGAATATGTATTAGA	0.448																																					p.Y756H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2266C	20						.						91.0	94.0	93.0					20																	18168020		2203	4300	6503	18116020	SO:0001583	missense	57325	exon10			AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.2266T>C	20.37:g.18168020T>C	ENSP00000392318:p.Tyr756His		18116020	NM_020536	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.170254	0.57584	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.87	4.78	0.61160	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.23926	0.0579	N	0.08118	0	0.80722	D	1	B;B	0.31680	0.335;0.226	B;B	0.28305	0.088;0.059	T	0.10497	-1.0627	10	0.87932	D	0	-7.497	11.9033	0.52697	0.0:0.0678:0.0:0.9322	.	628;756	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	H	756;755;756;628	ENSP00000278816:Y756H;ENSP00000366909:Y755H;ENSP00000392318:Y756H;ENSP00000425909:Y628H	ENSP00000278816:Y756H	Y	+	1	0	CSRP2BP	18116020	1.000000	0.71417	0.911000	0.35937	0.983000	0.72400	7.948000	0.87774	1.057000	0.40506	0.482000	0.46254	TAT		0.448	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
FOXS1	2307	hgsc.bcm.edu	37	20	30432767	30432767	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:30432767T>C	ENST00000375978.3	-	1	653	c.579A>G	c.(577-579)aaA>aaG	p.K193K		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	193					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K193K(1)		kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						TGGAAATCTCTTTGGGCTCCA	0.632																																					p.K193K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A579G	20						.						54.0	50.0	52.0					20																	30432767		2203	4300	6503	29896428	SO:0001819	synonymous_variant	2307	exon1			AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.579A>G	20.37:g.30432767T>C			29896428	NM_004118	Q96D28	Silent	SNP	ENST00000375978.3	37	CCDS13192.1																																																																																				0.632	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078560.2	NM_004118	
GSS	2937	hgsc.bcm.edu	37	20	33517312	33517312	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:33517312A>G	ENST00000216951.2	-	12	1291	c.1193T>C	c.(1192-1194)aTg>aCg	p.M398T	GSS_ENST00000541098.1_Missense_Mutation_p.M270T|GSS_ENST00000451957.2_Missense_Mutation_p.M287T	NM_000178.2	NP_000169.1	P48637	GSHB_HUMAN	glutathione synthetase	398					aging (GO:0007568)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|nervous system development (GO:0007399)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to nutrient levels (GO:0031667)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|glutathione binding (GO:0043295)|glutathione synthase activity (GO:0004363)|glycine binding (GO:0016594)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.M398T(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(18;0.035)		Acetylcysteine(DB06151)|Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	GATCTTCTCCATGAGGATGTA	0.547																																					p.M398T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1193C	20						.						264.0	236.0	246.0					20																	33517312		2203	4300	6503	32980973	SO:0001583	missense	2937	exon12				CCDS13245.1	20q11.2	1996-06-18			ENSG00000100983	ENSG00000100983	6.3.2.3		4624	protein-coding gene	gene with protein product		601002				8825653	Standard	NM_000178		Approved		uc002xbg.3	P48637	OTTHUMG00000032315	ENST00000216951.2:c.1193T>C	20.37:g.33517312A>G	ENSP00000216951:p.Met398Thr		32980973	NM_000178	B2R697|B6F210|E1P5P9|Q4TTD9	Missense_Mutation	SNP	ENST00000216951.2	37	CCDS13245.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293883	0.81025	.	.	ENSG00000100983	ENST00000216951;ENST00000541098;ENST00000451957	D;D;D	0.94457	-3.43;-3.43;-3.43	5.27	5.27	0.74061	ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.98147	0.9388	H	0.96269	3.795	0.80722	D	1	D;D	0.76494	0.999;0.971	D;D	0.91635	0.999;0.993	D	0.99552	1.0966	10	0.87932	D	0	-21.9612	15.179	0.72938	1.0:0.0:0.0:0.0	.	287;398	B6F210;P48637	.;GSHB_HUMAN	T	398;270;287	ENSP00000216951:M398T;ENSP00000439744:M270T;ENSP00000407517:M287T	ENSP00000216951:M398T	M	-	2	0	GSS	32980973	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.023000	0.93683	1.991000	0.58162	0.402000	0.26972	ATG		0.547	GSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078821.2		
ATRN	8455	hgsc.bcm.edu	37	20	3543971	3543971	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:3543971G>A	ENST00000262919.5	+	10	1815	c.1747G>A	c.(1747-1749)Gcc>Acc	p.A583T	ATRN_ENST00000446916.2_Missense_Mutation_p.A583T	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	583					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.A583T(2)		breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						GAGCCATGGCGCCAAATGCTT	0.433																																					p.A583T												.	.	2	Substitution - Missense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.G1747A	20						.						180.0	148.0	159.0					20																	3543971		2203	4300	6503	3491971	SO:0001583	missense	8455	exon10			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.1747G>A	20.37:g.3543971G>A	ENSP00000262919:p.Ala583Thr		3491971	NM_139322	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	ENST00000262919.5	37	CCDS13053.1	.	.	.	.	.	.	.	.	.	.	G	32	5.125600	0.94429	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.06608	3.28;3.34	5.32	5.32	0.75619	Kelch-type beta propeller (1);	0.217572	0.47852	D	0.000214	T	0.25901	0.0631	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.957;0.998	T	0.00090	-1.2086	10	0.46703	T	0.11	-15.7622	18.7896	0.91968	0.0:0.0:1.0:0.0	.	583;583	O75882;O75882-2	ATRN_HUMAN;.	T	583;583;509	ENSP00000262919:A583T;ENSP00000416587:A583T	ENSP00000262919:A583T	A	+	1	0	ATRN	3491971	1.000000	0.71417	0.968000	0.41197	0.962000	0.63368	9.590000	0.98238	2.777000	0.95525	0.591000	0.81541	GCC		0.433	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321	
EDEM2	55741	hgsc.bcm.edu	37	20	33722565	33722565	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:33722565C>T	ENST00000374492.3	-	6	783	c.678G>A	c.(676-678)tgG>tgA	p.W226*	EDEM2_ENST00000540582.1_Nonsense_Mutation_p.W185*|EDEM2_ENST00000541621.1_5'UTR|EDEM2_ENST00000374491.3_Nonsense_Mutation_p.W189*|EDEM2_ENST00000542871.1_Intron	NM_018217.2	NP_060687.2	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like 2	226					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.W226*(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	22			BRCA - Breast invasive adenocarcinoma(18;0.00936)			ACCGGCTCTCCCAGAGGCGCA	0.567																																					p.W226X	Esophageal Squamous(51;906 1021 24535 36410 39145)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G678A	20						.						79.0	73.0	75.0					20																	33722565		2203	4300	6503	33186226	SO:0001587	stop_gained	55741	exon6			AK001645	CCDS13247.1, CCDS46592.1	20q11.22	2006-03-31	2006-03-31	2006-03-31	ENSG00000088298	ENSG00000088298			15877	protein-coding gene	gene with protein product		610302	"""chromosome 20 open reading frame 31"""	C20orf49, C20orf31		15537790, 15579471	Standard	NM_018217		Approved	FLJ10783, bA4204.1	uc002xbo.2	Q9BV94	OTTHUMG00000032322	ENST00000374492.3:c.678G>A	20.37:g.33722565C>T	ENSP00000363616:p.Trp226*		33186226	NM_018217	B4DTG9|Q6GU33|Q6IA89|Q6UWZ4|Q9H4U0|Q9H886|Q9NTL9|Q9NVE6	Nonsense_Mutation	SNP	ENST00000374492.3	37	CCDS13247.1	.	.	.	.	.	.	.	.	.	.	C	44	10.886283	0.99483	.	.	ENSG00000088298	ENST00000374491;ENST00000374492;ENST00000540582	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.4425	20.5827	0.99408	0.0:1.0:0.0:0.0	.	.	.	.	X	189;226;185	.	ENSP00000363615:W189X	W	-	3	0	EDEM2	33186226	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.583000	0.82559	2.941000	0.99782	0.655000	0.94253	TGG		0.567	EDEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078842.2	NM_018217	
SDC4	6385	hgsc.bcm.edu	37	20	43961686	43961686	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:43961686C>T	ENST00000372733.3	-	3	262	c.223G>A	c.(223-225)Ggc>Agc	p.G75S	SDC4_ENST00000537976.1_Missense_Mutation_p.G3S	NM_002999.3	NP_002990.2	P31431	SDC4_HUMAN	syndecan 4	75					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stress fiber assembly (GO:0051496)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|costamere (GO:0043034)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)	p.G75S(1)	SDC4/ROS1(7)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)	5		Myeloproliferative disorder(115;0.0122)				ACTTCAGGGCCGATCATGGAG	0.502			T	ROS1	NSCLC																																p.G75S			Dom	yes		20	20q12	6385	syndecan 4		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G223A	20						.						190.0	153.0	166.0					20																	43961686		2203	4300	6503	43395100	SO:0001583	missense	6385	exon3			X67016, D13292	CCDS13350.1	20q12	2010-03-25	2007-02-15		ENSG00000124145	ENSG00000124145		"""Proteoglycans / Cell Surface : Syndecans"""	10661	protein-coding gene	gene with protein product	"""syndecan proteoglycan 4"""	600017	"""syndecan 4 (amphiglycan, ryudocan)"""			7916598, 1500433	Standard	NM_002999		Approved	SYND4, amphiglycan, ryudocan	uc002xnu.3	P31431	OTTHUMG00000033083	ENST00000372733.3:c.223G>A	20.37:g.43961686C>T	ENSP00000361818:p.Gly75Ser		43395100	NM_002999	O00773|Q16833|Q53FN9|Q6FGN3	Missense_Mutation	SNP	ENST00000372733.3	37	CCDS13350.1	.	.	.	.	.	.	.	.	.	.	C	4.584	0.108448	0.08780	.	.	ENSG00000124145	ENST00000372733;ENST00000537976	T	0.28454	1.61	4.54	-0.584	0.11702	.	1.059890	0.07199	N	0.857118	T	0.14787	0.0357	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28744	-1.0034	10	0.09338	T	0.73	-3.9872	1.2624	0.02004	0.3279:0.2969:0.0869:0.2883	.	75	P31431	SDC4_HUMAN	S	75;3	ENSP00000361818:G75S	ENSP00000361818:G75S	G	-	1	0	SDC4	43395100	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.883000	0.04170	-0.516000	0.06470	-2.811000	0.00111	GGC		0.502	SDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080515.1	NM_002999	
ZSWIM3	140831	hgsc.bcm.edu	37	20	44506392	44506392	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:44506392A>G	ENST00000255152.2	+	2	1404	c.1195A>G	c.(1195-1197)Acc>Gcc	p.T399A	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.T393A	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	399							zinc ion binding (GO:0008270)	p.T399A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				AGACATTGTCACCAGCAAGGT	0.507																																					p.T399A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1195G	20						.						92.0	71.0	78.0					20																	44506392		2203	4300	6503	43939799	SO:0001583	missense	140831	exon2			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1195A>G	20.37:g.44506392A>G	ENSP00000255152:p.Thr399Ala		43939799	NM_080752	Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	37	CCDS13381.1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.446954	0.63178	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.26223	1.78;1.75	5.41	5.41	0.78517	.	0.133602	0.46758	D	0.000279	T	0.39600	0.1084	L	0.34521	1.04	0.41316	D	0.987144	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.10847	-1.0612	10	0.36615	T	0.2	-27.2632	15.2707	0.73699	1.0:0.0:0.0:0.0	.	393;399	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	A	399;393	ENSP00000255152:T399A;ENSP00000406313:T393A	ENSP00000255152:T399A	T	+	1	0	ZSWIM3	43939799	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.137000	0.58010	2.281000	0.76405	0.533000	0.62120	ACC		0.507	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752	
ARFGEF2	10564	hgsc.bcm.edu	37	20	47621658	47621658	+	Silent	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:47621658A>C	ENST00000371917.4	+	26	3484	c.3484A>C	c.(3484-3486)Agg>Cgg	p.R1162R		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1162					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)	p.R1162R(1)		breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TGACTCATTAAGGCAACTCTC	0.403																																					p.R1162R	Esophageal Squamous(176;1738 1974 26285 33069 35354)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3484C	20						.						224.0	216.0	219.0					20																	47621658		2203	4300	6503	47055065	SO:0001819	synonymous_variant	10564	exon26			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.3484A>C	20.37:g.47621658A>C			47055065	NM_006420	Q5TFT9|Q9NTS1	Silent	SNP	ENST00000371917.4	37	CCDS13411.1																																																																																				0.403	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
CYP24A1	1591	hgsc.bcm.edu	37	20	52786160	52786160	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:52786160T>C	ENST00000216862.3	-	4	1004	c.611A>G	c.(610-612)tAc>tGc	p.Y204C	CYP24A1_ENST00000395954.3_Missense_Mutation_p.Y62C|CYP24A1_ENST00000395955.3_Missense_Mutation_p.Y204C	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	204					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)	p.Y204C(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	CAGTTCGCTGTACAAGTCTTC	0.418																																					p.Y204C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A611G	20						.						146.0	119.0	128.0					20																	52786160		2203	4300	6503	52219567	SO:0001583	missense	1591	exon4			U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.611A>G	20.37:g.52786160T>C	ENSP00000216862:p.Tyr204Cys		52219567	NM_000782	Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	ENST00000216862.3	37	CCDS33491.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.019617	0.75275	.	.	ENSG00000019186	ENST00000216862;ENST00000395955;ENST00000395954	T;T;T	0.68765	-0.35;-0.35;-0.35	5.63	5.63	0.86233	.	0.060989	0.64402	D	0.000002	T	0.79505	0.4457	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.80634	-0.1295	10	0.54805	T	0.06	0.9152	13.2161	0.59861	0.0:0.0:0.0:1.0	.	204;204;62	Q32ML3;Q07973;Q5I2W7	.;CP24A_HUMAN;.	C	204;204;62	ENSP00000216862:Y204C;ENSP00000379285:Y204C;ENSP00000379284:Y62C	ENSP00000216862:Y204C	Y	-	2	0	CYP24A1	52219567	1.000000	0.71417	0.832000	0.32986	0.955000	0.61496	7.651000	0.83577	2.148000	0.66965	0.460000	0.39030	TAC		0.418	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079769.2		
RAE1	8480	hgsc.bcm.edu	37	20	55948793	55948793	+	Splice_Site	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr20:55948793C>T	ENST00000395841.2	+	10	1244	c.824C>T	c.(823-825)gCg>gTg	p.A275V	RAE1_ENST00000371242.2_Splice_Site_p.A275V|RAE1_ENST00000527947.1_Splice_Site_p.A275V|RAE1_ENST00000395840.2_Splice_Site_p.A275V	NM_003610.3	NP_003601.1	P78406	RAE1L_HUMAN	ribonucleic acid export 1	275					carbohydrate metabolic process (GO:0005975)|cellular response to organic cyclic compound (GO:0071407)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|RNA binding (GO:0003723)	p.A275V(2)		breast(1)|endometrium(5)|large_intestine(4)|lung(6)|prostate(3)|skin(2)	21	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)			GACATTTATGCGGTACGTTTT	0.423																																					p.A275V												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C824T	20						.						201.0	190.0	193.0					20																	55948793		2203	4300	6503	55382200	SO:0001630	splice_region_variant	8480	exon10			U84720	CCDS13458.1	20q13.31	2013-08-28	2013-08-28		ENSG00000101146	ENSG00000101146		"""WD repeat domain containing"""	9828	protein-coding gene	gene with protein product		603343	"""RAE1 (RNA export 1, S.pombe) homolog"", ""RAE1 RNA export 1 homolog (S. pombe)"""			9370289, 9256445	Standard	XM_005260582		Approved	Mnrp41	uc002xyi.3	P78406	OTTHUMG00000032819	ENST00000395841.2:c.825+1C>T	20.37:g.55948793C>T			55382200	NM_003610	A8K882|O15306|Q3SYL7|Q5TCH8|Q6V708|Q9H100|Q9NQM6	Missense_Mutation	SNP	ENST00000395841.2	37	CCDS13458.1	.	.	.	.	.	.	.	.	.	.	C	18.52	3.642695	0.67244	.	.	ENSG00000101146	ENST00000395841;ENST00000371242;ENST00000527947;ENST00000395840	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.75	3.83	0.44106	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.66096	0.2755	M	0.81341	2.54	0.80722	D	1	P;D;D	0.59357	0.835;0.985;0.985	B;B;B	0.39706	0.048;0.307;0.307	T	0.71192	-0.4665	10	0.62326	D	0.03	-15.7125	12.6177	0.56586	0.0:0.8659:0.0:0.1341	.	275;275;275	E9PQ57;A8K882;P78406	.;.;RAE1L_HUMAN	V	275	ENSP00000379182:A275V;ENSP00000360286:A275V;ENSP00000432609:A275V;ENSP00000379181:A275V	ENSP00000360286:A275V	A	+	2	0	RAE1	55382200	1.000000	0.71417	0.934000	0.37439	0.198000	0.23893	5.435000	0.66532	0.792000	0.33850	0.655000	0.94253	GCG		0.423	RAE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079842.2		Missense_Mutation
AP1G2	8906	hgsc.bcm.edu	37	14	24035527	24035527	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:24035527T>C	ENST00000308724.5	-	3	1186	c.431A>G	c.(430-432)gAg>gGg	p.E144G	RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000556277.1_5'UTR|AP1G2_ENST00000397120.3_Missense_Mutation_p.E144G	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	144					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)	p.E144G(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		GAGCAGTTTCTCCACCTCTGG	0.607																																					p.E144G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A431G	14						.						67.0	65.0	66.0					14																	24035527		2203	4300	6503	23105367	SO:0001583	missense	8906	exon4			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.431A>G	14.37:g.24035527T>C	ENSP00000312442:p.Glu144Gly		23105367	NM_003917	D3DS51|O75504	Missense_Mutation	SNP	ENST00000308724.5	37	CCDS9602.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.483790	0.84854	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000557189	T;T;T	0.27720	1.65;1.65;1.65	5.01	5.01	0.66863	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.050770	0.85682	D	0.000000	T	0.52041	0.1710	M	0.84585	2.705	0.80722	D	1	P;P	0.43542	0.756;0.81	P;P	0.52672	0.46;0.706	T	0.59506	-0.7442	10	0.87932	D	0	-18.0904	12.7212	0.57144	0.0:0.0:0.0:1.0	.	144;144	G3V532;O75843	.;AP1G2_HUMAN	G	144	ENSP00000312442:E144G;ENSP00000380309:E144G;ENSP00000452153:E144G	ENSP00000312442:E144G	E	-	2	0	AP1G2	23105367	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.162000	0.77515	2.098000	0.63641	0.459000	0.35465	GAG		0.607	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917	
TM9SF1	10548	hgsc.bcm.edu	37	14	24661503	24661503	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:24661503A>G	ENST00000261789.4	-	4	1385	c.1027T>C	c.(1027-1029)Tca>Cca	p.S343P	TM9SF1_ENST00000524835.1_Missense_Mutation_p.S256P|TM9SF1_ENST00000556387.1_Missense_Mutation_p.S552P|TM9SF1_ENST00000530611.1_Missense_Mutation_p.S552P|RP11-468E2.2_ENST00000561419.1_5'Flank|TM9SF1_ENST00000396854.4_Missense_Mutation_p.S343P|TM9SF1_ENST00000528669.1_Missense_Mutation_p.S343P	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	343					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.S343P(1)		NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		ATGGCTGCTGAGTTAATGGCC	0.557																																					p.S343P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1027C	14						.						114.0	97.0	103.0					14																	24661503		2203	4300	6503	23731343	SO:0001583	missense	10548	exon4			U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.1027T>C	14.37:g.24661503A>G	ENSP00000261789:p.Ser343Pro		23731343	NM_001014842	D3DS65|Q86SZ6|Q96FI8	Missense_Mutation	SNP	ENST00000261789.4	37	CCDS9617.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.539862	0.85917	.	.	ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000254692	ENST00000261789;ENST00000528669;ENST00000556387;ENST00000524835;ENST00000396854;ENST00000530611	T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84	5.31	5.31	0.75309	.	0.131674	0.52532	D	0.000065	T	0.70263	0.3204	M	0.86028	2.79	0.58432	D	0.999998	D;D;D	0.76494	0.999;0.997;0.969	D;D;P	0.70227	0.968;0.953;0.88	T	0.75811	-0.3186	10	0.87932	D	0	-6.4479	13.2674	0.60141	1.0:0.0:0.0:0.0	.	343;343;343	E9PJM1;Q86SZ6;O15321	.;.;TM9S1_HUMAN	P	343;343;552;256;343;552	ENSP00000261789:S343P;ENSP00000432997:S343P;ENSP00000451949:S552P;ENSP00000434387:S256P;ENSP00000380063:S343P;ENSP00000433967:S552P	ENSP00000433967:S552P	S	-	1	0	TM9SF1;RP11-468E2.1	23731343	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.164000	0.89661	2.243000	0.73865	0.533000	0.62120	TCA		0.557	TM9SF1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073136.2	NM_006405	
CHMP4A	29082	hgsc.bcm.edu	37	14	24680707	24680707	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:24680707C>T	ENST00000609024.1	-	3	321	c.273G>A	c.(271-273)gaG>gaA	p.E91E	AL136419.6_ENST00000565988.1_RNA|CHMP4A_ENST00000542700.2_5'UTR|TM9SF1_ENST00000556387.1_Silent_p.E91E|CHMP4A_ENST00000530996.1_5'UTR|TM9SF1_ENST00000530611.1_Silent_p.E91E|MDP1_ENST00000532557.1_5'Flank|NEDD8-MDP1_ENST00000604306.1_5'Flank|CHMP4A_ENST00000347519.6_Silent_p.E134E			Q9BY43	CHM4A_HUMAN	charged multivesicular body protein 4A	91	Interaction with phosphoinosides.|Intramolecular interaction with C- terminus. {ECO:0000250}.				endosomal transport (GO:0016197)|membrane budding (GO:0006900)|membrane organization (GO:0061024)|membrane tubulation (GO:0097320)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)	p.E134E(1)		NS(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)	9				GBM - Glioblastoma multiforme(265;0.0181)		TCTCAATGGCCTCACGCTGAA	0.547																																					p.E134E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G402A	14						.						123.0	106.0	112.0					14																	24680707		2203	4300	6503	23750547	SO:0001819	synonymous_variant	29082	exon3			AF212243	CCDS9619.1	14q12	2012-10-04	2011-09-21	2005-04-04	ENSG00000254505	ENSG00000254505		"""Charged multivesicular body proteins"""	20274	protein-coding gene	gene with protein product		610051	"""chromosome 14 open reading frame 123"", ""chromatin modifying protein 4A"""	C14orf123			Standard	NM_014169		Approved	HSPC134, VPS32A		Q9BY43	OTTHUMG00000167036	ENST00000609024.1:c.273G>A	14.37:g.24680707C>T			23750547	NM_014169	Q14D22|Q32Q79|Q86SZ8|Q96QJ9|Q9P026	Silent	SNP	ENST00000609024.1	37		.	.	.	.	.	.	.	.	.	.	C	13.44	2.237640	0.39598	.	.	ENSG00000254505	ENST00000548308	.	.	.	4.59	0.106	0.14540	.	.	.	.	.	T	0.54127	0.1839	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43556	-0.9384	4	.	.	.	-8.2768	7.8485	0.29440	0.0:0.2791:0.0:0.7209	.	.	.	.	S	111	.	.	G	-	1	0	AL096870.1	23750547	0.983000	0.35010	0.997000	0.53966	0.997000	0.91878	0.153000	0.16323	-0.122000	0.11766	0.561000	0.74099	GGC		0.547	CHMP4A-012	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471846.1	NM_014169	
ADCY4	196883	hgsc.bcm.edu	37	14	24787659	24787659	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:24787659A>G	ENST00000310677.4	-	26	3310	c.3197T>C	c.(3196-3198)tTg>tCg	p.L1066S	ADCY4_ENST00000418030.2_Missense_Mutation_p.L1066S|ADCY4_ENST00000554068.2_Missense_Mutation_p.L1066S	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	1066					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)	p.L1066S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		AGTTCGTGTCAAGTCTGTGTT	0.547																																					p.L1066S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3197C	14						.						155.0	140.0	145.0					14																	24787659		2203	4300	6503	23857499	SO:0001583	missense	196883	exon26			AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.3197T>C	14.37:g.24787659A>G	ENSP00000312126:p.Leu1066Ser		23857499	NM_001198592	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	ENST00000310677.4	37	CCDS9627.1	.	.	.	.	.	.	.	.	.	.	A	13.59	2.282940	0.40394	.	.	ENSG00000129467	ENST00000310677;ENST00000554068;ENST00000418030	T;T;T	0.76316	-1.01;-1.01;-1.01	5.52	5.52	0.82312	.	0.000000	0.37906	N	0.001890	T	0.59321	0.2185	N	0.16130	0.375	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.56105	-0.8034	10	0.06891	T	0.86	.	13.5937	0.61975	1.0:0.0:0.0:0.0	.	1066	Q8NFM4	ADCY4_HUMAN	S	1066	ENSP00000312126:L1066S;ENSP00000452250:L1066S;ENSP00000393177:L1066S	ENSP00000312126:L1066S	L	-	2	0	ADCY4	23857499	0.999000	0.42202	0.998000	0.56505	0.987000	0.75469	4.837000	0.62796	2.075000	0.62263	0.533000	0.62120	TTG		0.547	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
AKAP6	9472	hgsc.bcm.edu	37	14	33290898	33290898	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:33290898T>C	ENST00000280979.4	+	13	4049	c.3879T>C	c.(3877-3879)aaT>aaC	p.N1293N	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1293					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.N1293N(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GCCTCCACAATGTTGAACTCT	0.443																																					p.N1293N	Melanoma(49;821 1200 7288 13647 42351)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3879C	14						.						59.0	51.0	54.0					14																	33290898		2203	4300	6503	32360649	SO:0001819	synonymous_variant	9472	exon13			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.3879T>C	14.37:g.33290898T>C			32360649	NM_004274	A7E242|A7E2D4|O15028	Silent	SNP	ENST00000280979.4	37	CCDS9644.1																																																																																				0.443	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
PPP2R3C	55012	hgsc.bcm.edu	37	14	35585818	35585818	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:35585818T>C	ENST00000261475.5	-	2	537	c.184A>G	c.(184-186)Agg>Ggg	p.R62G	PPP2R3C_ENST00000555644.1_Missense_Mutation_p.R62G	NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	62					activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R62G(1)		central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		CTACTTACCCTATAATAAAAC	0.348																																					p.R62G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A184G	14						.						76.0	77.0	77.0					14																	35585818		2202	4300	6502	34655569	SO:0001583	missense	55012	exon2			AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.184A>G	14.37:g.35585818T>C	ENSP00000261475:p.Arg62Gly		34655569	NM_017917	B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Missense_Mutation	SNP	ENST00000261475.5	37	CCDS9654.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.585122	0.86748	.	.	ENSG00000092020	ENST00000261475;ENST00000554361;ENST00000555644;ENST00000557278	T	0.49139	0.79	5.29	5.29	0.74685	.	0.086880	0.85682	D	0.000000	T	0.43211	0.1237	L	0.36672	1.1	0.80722	D	1	P;P;B	0.45715	0.728;0.865;0.218	B;B;B	0.42827	0.366;0.399;0.158	T	0.43605	-0.9381	10	0.54805	T	0.06	-5.7116	15.5183	0.75842	0.0:0.0:0.0:1.0	.	62;62;62	G3V2K1;Q86US5;Q969Q6	.;.;P2R3C_HUMAN	G	62	ENSP00000450716:R62G	ENSP00000261475:R62G	R	-	1	2	PPP2R3C	34655569	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	6.733000	0.74796	2.117000	0.64856	0.459000	0.35465	AGG		0.348	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276687.1	NM_017917	
SOS2	6655	hgsc.bcm.edu	37	14	50585242	50585242	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:50585242T>C	ENST00000216373.5	-	23	4093	c.3819A>G	c.(3817-3819)cgA>cgG	p.R1273R	SOS2_ENST00000543680.1_Silent_p.R1240R|VCPKMT_ENST00000395860.2_5'Flank|VCPKMT_ENST00000395859.2_5'Flank	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	1273					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1273R(2)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					GCACATAGCATCGACGCGGTA	0.517																																					p.R1273R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A3819G	14						.						146.0	120.0	129.0					14																	50585242		2203	4300	6503	49654992	SO:0001819	synonymous_variant	6655	exon23			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.3819A>G	14.37:g.50585242T>C			49654992	NM_006939	B7ZKT6|D3DSB4|Q15503|Q17RN1	Silent	SNP	ENST00000216373.5	37	CCDS9697.1																																																																																				0.517	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
SOS2	6655	hgsc.bcm.edu	37	14	50585466	50585466	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:50585466G>A	ENST00000216373.5	-	23	3869	c.3595C>T	c.(3595-3597)Cct>Tct	p.P1199S	SOS2_ENST00000543680.1_Missense_Mutation_p.P1166S|VCPKMT_ENST00000395860.2_5'Flank|VCPKMT_ENST00000395859.2_5'Flank	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	1199					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P1199S(2)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					CTATGCAGAGGCCCATCAAAT	0.507																																					p.P1199S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3595T	14						.						92.0	96.0	95.0					14																	50585466		2203	4300	6503	49655216	SO:0001583	missense	6655	exon23			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.3595C>T	14.37:g.50585466G>A	ENSP00000216373:p.Pro1199Ser		49655216	NM_006939	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	37	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.906160	0.52333	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.80033	-1.33;-1.18	5.01	4.12	0.48240	.	0.105428	0.64402	N	0.000003	T	0.76737	0.4029	M	0.63843	1.955	0.58432	D	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.71066	-0.4700	10	0.27082	T	0.32	.	13.4115	0.60946	0.0765:0.0:0.9235:0.0	.	1166;1199	B7ZKT6;Q07890	.;SOS2_HUMAN	S	1199;1166	ENSP00000216373:P1199S;ENSP00000445328:P1166S	ENSP00000216373:P1199S	P	-	1	0	SOS2	49655216	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.679000	0.61649	1.096000	0.41439	0.563000	0.77884	CCT		0.507	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
MTHFD1	4522	hgsc.bcm.edu	37	14	64908850	64908850	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:64908850G>A	ENST00000545908.1	+	20	2360	c.2131G>A	c.(2131-2133)Gca>Aca	p.A711T	MTHFD1_ENST00000216605.8_Missense_Mutation_p.A655T|CTD-2555O16.2_ENST00000556640.1_RNA|CTD-2555O16.4_ENST00000609125.1_RNA			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	655	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)	p.A655T(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	AGACCGGATCGCACTCAAGCT	0.488																																					p.A655T	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1963A	14						.						125.0	110.0	115.0					14																	64908850		2203	4300	6503	63978603	SO:0001583	missense	4522	exon20			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.2131G>A	14.37:g.64908850G>A	ENSP00000438588:p.Ala711Thr		63978603	NM_005956	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000545908.1	37		.	.	.	.	.	.	.	.	.	.	G	24.9	4.581053	0.86748	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605	T;T;T	0.35973	1.28;1.28;1.28	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.79149	0.4397	H	0.99404	4.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.956	D	0.87546	0.2462	10	0.87932	D	0	-20.9467	20.5827	0.99408	0.0:0.0:1.0:0.0	.	711;655	F5H2F4;G3V2B8	.;.	T	711;655;711	ENSP00000438588:A711T;ENSP00000450560:A655T;ENSP00000216605:A711T	ENSP00000216605:A655T	A	+	1	0	MTHFD1	63978603	1.000000	0.71417	0.983000	0.44433	0.151000	0.21798	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GCA		0.488	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1		
SIPA1L1	26037	hgsc.bcm.edu	37	14	72055626	72055626	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:72055626C>T	ENST00000555818.1	+	2	1385	c.1037C>T	c.(1036-1038)gCa>gTa	p.A346V	SIPA1L1_ENST00000358550.2_Missense_Mutation_p.A346V|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.A346V	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	346					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)	p.A346V(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		TTGAATGAGGCAATTATGAAC	0.463																																					p.A346V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1037T	14						.						71.0	75.0	74.0					14																	72055626		2203	4300	6503	71125379	SO:0001583	missense	26037	exon2			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.1037C>T	14.37:g.72055626C>T	ENSP00000450832:p.Ala346Val		71125379	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	37	CCDS9807.1	.	.	.	.	.	.	.	.	.	.	C	4.568	0.105432	0.08780	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	T;T;T	0.78707	-1.2;-1.19;-1.2	6.07	6.07	0.98685	.	0.158249	0.64402	D	0.000020	T	0.58736	0.2143	N	0.05467	-0.045	0.80722	D	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.16289	0.003;0.015;0.005	T	0.54997	-0.8209	10	0.32370	T	0.25	-24.661	10.8974	0.47031	0.0:0.8615:0.0:0.1385	.	346;346;346	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	V	346	ENSP00000370630:A346V;ENSP00000450832:A346V;ENSP00000351352:A346V	ENSP00000351352:A346V	A	+	2	0	SIPA1L1	71125379	0.852000	0.29690	0.970000	0.41538	0.018000	0.09664	1.690000	0.37711	2.885000	0.99019	0.655000	0.94253	GCA		0.463	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
DCAF4	26094	hgsc.bcm.edu	37	14	73418582	73418582	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:73418582C>T	ENST00000358377.2	+	9	1025	c.805C>T	c.(805-807)Cca>Tca	p.P269S	DCAF4_ENST00000553457.1_Missense_Mutation_p.P169S|DCAF4_ENST00000555042.1_Missense_Mutation_p.P269S|DCAF4_ENST00000509153.1_Missense_Mutation_p.P208S|DCAF4_ENST00000353777.3_Intron|DCAF4_ENST00000394234.2_Missense_Mutation_p.P169S	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	269					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)		p.P269S(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						CAATAGTCACCCAGGTACAGG	0.552																																					p.P208S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C622T	14						.						145.0	134.0	137.0					14																	73418582		2203	4300	6503	72488335	SO:0001583	missense	26094	exon7			BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.805C>T	14.37:g.73418582C>T	ENSP00000351147:p.Pro269Ser		72488335	NM_181341	B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Missense_Mutation	SNP	ENST00000358377.2	37	CCDS9809.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826810	0.50739	.	.	ENSG00000119599	ENST00000358377;ENST00000394234;ENST00000509153;ENST00000555042;ENST00000553457	T;T;T;T;T	0.63096	0.35;-0.02;0.41;0.01;1.1	5.7	3.86	0.44501	.	0.267048	0.44483	N	0.000453	T	0.48857	0.1523	L	0.46157	1.445	0.31278	N	0.690981	B;B;B;B;B	0.25809	0.021;0.047;0.135;0.078;0.047	B;B;B;B;B	0.26416	0.012;0.025;0.069;0.039;0.011	T	0.47394	-0.9121	10	0.20519	T	0.43	.	5.7236	0.18000	0.1441:0.6434:0.1389:0.0736	.	208;247;269;269;269	B4DUT6;B4DN30;Q8WV16-2;G3V522;Q8WV16	.;.;.;.;DCAF4_HUMAN	S	269;169;208;269;169	ENSP00000351147:P269S;ENSP00000377781:P169S;ENSP00000426178:P208S;ENSP00000452131:P269S;ENSP00000451186:P169S	ENSP00000351147:P269S	P	+	1	0	DCAF4	72488335	0.990000	0.36364	0.714000	0.30535	0.830000	0.47004	2.822000	0.48073	0.752000	0.32923	0.462000	0.41574	CCA		0.552	DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361058.1	NM_015604	
HEATR4	399671	hgsc.bcm.edu	37	14	73989306	73989306	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:73989306T>C	ENST00000553558.1	-	3	872	c.551A>G	c.(550-552)aAc>aGc	p.N184S	HEATR4_ENST00000560393.1_Missense_Mutation_p.N137S|RP3-414A15.2_ENST00000555972.2_RNA|RP3-414A15.11_ENST00000553394.1_RNA|HEATR4_ENST00000334988.2_Missense_Mutation_p.N184S	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	184								p.N137S(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TTCCTCCAGGTTCACATCTAG	0.602																																					p.N137S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A410G	14						.						46.0	44.0	45.0					14																	73989306		2203	4300	6503	73059059	SO:0001583	missense	399671	exon2			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.551A>G	14.37:g.73989306T>C	ENSP00000450444:p.Asn184Ser		73059059	NM_203309	B7Z7V9|E9KL41	Missense_Mutation	SNP	ENST00000553558.1	37	CCDS9815.2	.	.	.	.	.	.	.	.	.	.	T	6.788	0.514432	0.12944	.	.	ENSG00000187105	ENST00000553558;ENST00000334988;ENST00000556455	T	0.40756	1.02	5.32	-1.38	0.09027	.	1.213540	0.05528	N	0.563451	T	0.22166	0.0534	N	0.14661	0.345	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.16394	-1.0404	10	0.25751	T	0.34	-0.2904	3.0769	0.06249	0.3304:0.2777:0.0:0.3919	.	184	Q86WZ0	HEAT4_HUMAN	S	184;137;184	ENSP00000450444:N184S	ENSP00000335447:N137S	N	-	2	0	HEATR4	73059059	0.001000	0.12720	0.006000	0.13384	0.360000	0.29518	-0.539000	0.06113	-0.113000	0.11958	0.533000	0.62120	AAC		0.602	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309	
NRXN3	9369	hgsc.bcm.edu	37	14	80164266	80164266	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:80164266A>G	ENST00000557594.1	+	4	1848	c.895A>G	c.(895-897)Aca>Gca	p.T299A	NRXN3_ENST00000335750.5_Missense_Mutation_p.T931A|NRXN3_ENST00000554719.1_Missense_Mutation_p.T931A|RP11-242P2.1_ENST00000553322.1_RNA|NRXN3_ENST00000556003.1_Intron|NRXN3_ENST00000281127.7_Missense_Mutation_p.T299A|NRXN3_ENST00000428277.2_Missense_Mutation_p.T329A	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	299					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.T329A(1)|p.T931A(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GAATCGCTCTACAGCCAGCAT	0.423																																					p.T299A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A895G	14						.						94.0	77.0	83.0					14																	80164266		2203	4300	6503	79234019	SO:0001583	missense	9369	exon4			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.895A>G	14.37:g.80164266A>G	ENSP00000451672:p.Thr299Ala		79234019	NM_138970	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	ENST00000557594.1	37		.	.	.	.	.	.	.	.	.	.	A	5.825	0.336520	0.11013	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	T;T;T;T;T	0.66280	-0.2;-0.2;1.35;1.51;1.3	5.82	5.82	0.92795	.	0.370645	0.27861	N	0.017550	T	0.46171	0.1379	N	0.19112	0.55	0.36243	D	0.853421	B;B;B;B	0.24186	0.099;0.024;0.002;0.008	B;B;B;B	0.31869	0.137;0.037;0.011;0.013	T	0.51803	-0.8659	9	.	.	.	.	8.1675	0.31235	0.7288:0.1462:0.0:0.1251	.	329;299;299;931	Q9HDB5-4;Q9HDB5-2;Q9HDB5;Q9Y4C0-3	.;.;NRX3B_HUMAN;.	A	1304;1323;931;931;299;299;329	ENSP00000451648:T931A;ENSP00000338349:T931A;ENSP00000451672:T299A;ENSP00000281127:T299A;ENSP00000394426:T329A	.	T	+	1	0	NRXN3	79234019	0.985000	0.35326	0.373000	0.26003	0.508000	0.34012	2.790000	0.47821	2.222000	0.72286	0.455000	0.32223	ACA		0.423	NRXN3-004	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000413790.1	NM_001105250	
STON2	85439	hgsc.bcm.edu	37	14	81862320	81862320	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:81862320C>T	ENST00000267540.2	-	2	491	c.291G>A	c.(289-291)tcG>tcA	p.S97S	STON2_ENST00000555447.1_Silent_p.S97S	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	97					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)		p.S97S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		TGCTGATGGCCGAGGCCAGGT	0.592																																					p.S97S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G291A	14						.						89.0	92.0	91.0					14																	81862320		2203	4300	6503	80932073	SO:0001819	synonymous_variant	85439	exon2			AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.291G>A	14.37:g.81862320C>T			80932073	NM_033104	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Silent	SNP	ENST00000267540.2	37	CCDS9875.1																																																																																				0.592	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413317.1	NM_033104	
GPR65	8477	hgsc.bcm.edu	37	14	88478016	88478016	+	Silent	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:88478016G>T	ENST00000267549.3	+	2	1383	c.825G>T	c.(823-825)acG>acT	p.T275T	RP11-300J18.2_ENST00000554433.1_RNA	NM_003608.3	NP_003599.2	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	275					actin cytoskeleton reorganization (GO:0031532)|activation of Rho GTPase activity (GO:0032862)|apoptotic process (GO:0006915)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of stress fiber assembly (GO:0051496)|response to acidic pH (GO:0010447)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T275T(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)	16						ATAGAATCACGGTTGCATTAA	0.368																																					p.T275T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G825T	14						.						117.0	108.0	111.0					14																	88478016		2203	4300	6503	87547769	SO:0001819	synonymous_variant	8477	exon2			U95218	CCDS9879.1	14q31-q32.1	2012-08-21			ENSG00000140030	ENSG00000140030		"""GPCR / Class A : Orphans"""	4517	protein-coding gene	gene with protein product		604620				9655242	Standard	NM_003608		Approved	hTDAG8, TDAG8	uc001xvv.3	Q8IYL9	OTTHUMG00000028648	ENST00000267549.3:c.825G>T	14.37:g.88478016G>T			87547769	NM_003608	O75819	Silent	SNP	ENST00000267549.3	37	CCDS9879.1																																																																																				0.368	GPR65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071564.4		
TTC8	123016	hgsc.bcm.edu	37	14	89337995	89337995	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr14:89337995A>G	ENST00000345383.5	+	11	1206	c.1122A>G	c.(1120-1122)gaA>gaG	p.E374E	TTC8_ENST00000380656.2_Silent_p.E384E|TTC8_ENST00000338104.6_Silent_p.E400E|TTC8_ENST00000536576.1_Silent_p.E145E|TTC8_ENST00000354441.6_Silent_p.E119E|TTC8_ENST00000358622.5_Silent_p.E186E|TTC8_ENST00000346301.4_Silent_p.E344E	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	410					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)	p.E384E(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						CCTCATTTGAACGTGCCCTTT	0.448																																					p.E374E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1122G	14						.						142.0	130.0	134.0					14																	89337995		2203	4300	6503	88407748	SO:0001819	synonymous_variant	123016	exon11			AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.1122A>G	14.37:g.89337995A>G			88407748	NM_198309	A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Silent	SNP	ENST00000345383.5	37	CCDS9885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.784|9.784	1.176152|1.176152	0.21704|0.21704	.|.	.|.	ENSG00000165533|ENSG00000165533	ENST00000554686|ENST00000557580	.|.	.|.	.|.	5.73|5.73	3.32|3.32	0.38043|0.38043	.|.	.|.	.|.	.|.	.|.	T|T	0.60599|0.60599	0.2281|0.2281	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.54649|0.54649	-0.8262|-0.8262	4|4	.|.	.|.	.|.	-25.1091|-25.1091	10.1159|10.1159	0.42589|0.42589	0.8631:0.0:0.1369:0.0|0.8631:0.0:0.1369:0.0	.|.	.|.	.|.	.|.	S|A	334|173	.|.	.|.	N|T	+|+	2|1	0|0	TTC8|TTC8	88407748|88407748	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.540000|1.540000	0.36115|0.36115	0.423000|0.423000	0.26033|0.26033	0.454000|0.454000	0.30748|0.30748	AAC|ACG		0.448	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1	NM_144596	
SPECC1L	23384	hgsc.bcm.edu	37	22	24765247	24765247	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr22:24765247G>A	ENST00000314328.9	+	14	3331	c.3046G>A	c.(3046-3048)Gcc>Acc	p.A1016T	SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|SPECC1L_ENST00000541492.1_Missense_Mutation_p.A1016T|SPECC1L_ENST00000437398.1_Missense_Mutation_p.A1016T	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	1016	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)		p.A1016T(1)		breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						AAAGAGGAACGCCTTGCTGAA	0.408																																					p.A1016T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3046A	22						.						128.0	111.0	117.0					22																	24765247		2203	4300	6503	23095247	SO:0001583	missense	23384	exon13			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.3046G>A	22.37:g.24765247G>A	ENSP00000325785:p.Ala1016Thr		23095247	NM_001145468	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	ENST00000314328.9	37	CCDS33619.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.369609|5.369609	0.95900|0.95900	.|.	.|.	ENSG00000100014|ENSG00000258555	ENST00000437398;ENST00000314328;ENST00000541492|ENST00000493440	D;D;T|.	0.95447|.	-3.71;-3.71;0.14|.	5.56|5.56	5.56|5.56	0.83823|0.83823	Calponin homology domain (5);|.	0.056155|.	0.64402|.	N|.	0.000001|.	T|T	0.75982|0.75982	0.3924|0.3924	M|M	0.73372|0.73372	2.23|2.23	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.74893|0.74893	-0.3509|-0.3509	10|5	0.87932|.	D|.	0|.	-15.4823|-15.4823	18.5081|18.5081	0.90905|0.90905	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1016;1016|.	F5H1H6;Q69YQ0|.	.;CYTSA_HUMAN|.	T|H	1016|30	ENSP00000393363:A1016T;ENSP00000325785:A1016T;ENSP00000439633:A1016T|.	ENSP00000325785:A1016T|.	A|R	+|+	1|2	0|0	SPECC1L|KB-1896H10.1	23095247|23095247	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.995000|0.995000	0.86356|0.86356	9.071000|9.071000	0.93980|0.93980	2.607000|2.607000	0.88179|0.88179	0.563000|0.563000	0.77884|0.77884	GCC|CGC		0.408	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
CRYBB3	1417	hgsc.bcm.edu	37	22	25598687	25598687	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr22:25598687T>G	ENST00000215855.2	+	3	202	c.122T>G	c.(121-123)cTc>cGc	p.L41R	CRYBB3_ENST00000404334.1_Missense_Mutation_p.L41R	NM_004076.3	NP_004067.1	P26998	CRBB3_HUMAN	crystallin, beta B3	41	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(2)|lung(2)|prostate(1)	5						CGCTGCGAGCTCTCGGCCGAG	0.607											OREG0026423	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L41R												.	.	0			c.T122G	22						.						71.0	67.0	68.0					22																	25598687		2203	4300	6503	23928687	SO:0001583	missense	1417	exon3				CCDS13830.1	22q11.23	2008-06-10			ENSG00000100053	ENSG00000100053			2400	protein-coding gene	gene with protein product		123630		CRYB3		8999933	Standard	NM_004076		Approved		uc003abo.2	P26998	OTTHUMG00000150869	ENST00000215855.2:c.122T>G	22.37:g.25598687T>G	ENSP00000215855:p.Leu41Arg	780	23928687	NM_004076	Q3B7S9|Q3T1B7|Q6ISK6|Q92965|Q9UH09	Missense_Mutation	SNP	ENST00000215855.2	37	CCDS13830.1	.	.	.	.	.	.	.	.	.	.	T	17.14	3.312839	0.60414	.	.	ENSG00000100053	ENST00000215855;ENST00000404334	T;T	0.79454	-1.27;-1.27	4.45	4.45	0.53987	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.145296	0.47455	D	0.000236	D	0.89252	0.6662	M	0.91510	3.215	0.54753	D	0.999983	D	0.57571	0.98	D	0.69479	0.964	D	0.91203	0.4993	10	0.72032	D	0.01	.	12.5402	0.56165	0.0:0.0:0.0:1.0	.	41	P26998	CRBB3_HUMAN	R	41	ENSP00000215855:L41R;ENSP00000386123:L41R	ENSP00000215855:L41R	L	+	2	0	CRYBB3	23928687	1.000000	0.71417	0.996000	0.52242	0.304000	0.27724	5.838000	0.69388	1.647000	0.50633	0.454000	0.30748	CTC		0.607	CRYBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320352.1	NM_004076	
ADRBK2	157	hgsc.bcm.edu	37	22	26086189	26086189	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr22:26086189G>A	ENST00000324198.6	+	12	1183	c.991G>A	c.(991-993)Gca>Aca	p.A331T		NM_005160.3	NP_005151.2	P35626	ARBK2_HUMAN	adrenergic, beta, receptor kinase 2	331	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				receptor internalization (GO:0031623)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)		ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)	p.A331T(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|skin(3)|stomach(2)	32					Adenosine triphosphate(DB00171)	ACATGGACACGCAAGAATATC	0.413																																					p.A331T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G991A	22						.						126.0	115.0	119.0					22																	26086189		2203	4300	6503	24416189	SO:0001583	missense	157	exon12			X69117	CCDS13832.1	22q11	2013-01-10			ENSG00000100077	ENSG00000100077		"""Pleckstrin homology (PH) domain containing"""	290	protein-coding gene	gene with protein product		109636				7695743	Standard	NM_005160		Approved	GRK3, BARK2	uc003abx.4	P35626	OTTHUMG00000150280	ENST00000324198.6:c.991G>A	22.37:g.26086189G>A	ENSP00000317578:p.Ala331Thr		24416189	NM_005160	Q9UGW9	Missense_Mutation	SNP	ENST00000324198.6	37	CCDS13832.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082989	0.36758	.	.	ENSG00000100077	ENST00000324198;ENST00000545323	T	0.26223	1.75	4.49	4.49	0.54785	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.066369	0.64402	D	0.000012	T	0.26774	0.0655	L	0.42529	1.33	0.33464	D	0.585318	B;B	0.21381	0.012;0.055	B;B	0.26202	0.01;0.067	T	0.36163	-0.9759	10	0.56958	D	0.05	-17.4726	16.7419	0.85461	0.0:0.0:1.0:0.0	.	331;331	A8K869;P35626	.;ARBK2_HUMAN	T	331	ENSP00000317578:A331T	ENSP00000317578:A331T	A	+	1	0	ADRBK2	24416189	1.000000	0.71417	0.169000	0.22859	0.058000	0.15608	9.003000	0.93577	2.485000	0.83878	0.655000	0.94253	GCA		0.413	ADRBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317296.4	NM_005160	
SMTN	6525	hgsc.bcm.edu	37	22	31491409	31491409	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr22:31491409A>G	ENST00000347557.2	+	12	1971	c.1753A>G	c.(1753-1755)Act>Gct	p.T585A	SMTN_ENST00000404574.1_Missense_Mutation_p.T184A|SMTN_ENST00000333137.7_Missense_Mutation_p.T585A|SMTN_ENST00000358743.1_Missense_Mutation_p.T585A	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	585					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)	p.T585A(1)|p.T608A(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						GGAGCTGATGACTATTGAGGA	0.602																																					p.T585A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1753G	22						.						76.0	74.0	75.0					22																	31491409		2203	4300	6503	29821409	SO:0001583	missense	6525	exon12			AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.1753A>G	22.37:g.31491409A>G	ENSP00000328635:p.Thr585Ala		29821409	NM_006932	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	ENST00000347557.2	37	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.500134	0.01001	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496;ENST00000455608;ENST00000404574;ENST00000403419	T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15	4.98	0.602	0.17535	.	0.415512	0.17892	N	0.158474	T	0.07954	0.0199	N	0.00436	-1.5	0.21579	N	0.99963	B;B;B;B;B;B;B;B	0.21225	0.0;0.0;0.0;0.053;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.23574	0.003;0.005;0.0;0.047;0.003;0.002;0.003;0.001	T	0.41770	-0.9490	10	0.02654	T	1	-5.7204	8.0021	0.30304	0.4626:0.0:0.5374:0.0	.	641;670;41;184;608;585;585;585	E7ETT8;B4E229;B5MBZ4;B5MCI0;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;.;.;SMTN_HUMAN;.	A	585;585;585;583;608;62;184;41	ENSP00000351593:T585A;ENSP00000328635:T585A;ENSP00000329532:T585A;ENSP00000392329:T62A;ENSP00000383919:T184A	ENSP00000329393:T583A	T	+	1	0	SMTN	29821409	0.992000	0.36948	0.994000	0.49952	0.179000	0.23085	2.685000	0.46959	0.381000	0.24851	-0.366000	0.07423	ACT		0.602	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270	
CELSR1	9620	hgsc.bcm.edu	37	22	46835148	46835148	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr22:46835148C>T	ENST00000262738.3	-	3	4343	c.4344G>A	c.(4342-4344)ccG>ccA	p.P1448P		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1448	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)	p.P1448P(1)		breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		AGGACTGGGGCGGGAAGCTCC	0.652																																					p.P1448P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4344A	22						.						109.0	89.0	96.0					22																	46835148		2203	4300	6503	45213812	SO:0001819	synonymous_variant	9620	exon3			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4344G>A	22.37:g.46835148C>T			45213812	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	37	CCDS14076.1																																																																																				0.652	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
CERK	64781	hgsc.bcm.edu	37	22	47089396	47089396	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr22:47089396A>C	ENST00000216264.8	-	10	1166	c.1054T>G	c.(1054-1056)Ttt>Gtt	p.F352V	CERK_ENST00000471929.1_5'UTR|CERK_ENST00000541677.1_Missense_Mutation_p.F154V	NM_022766.5	NP_073603.2	Q8TCT0	CERK1_HUMAN	ceramide kinase	352					ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lipid phosphorylation (GO:0046834)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)	p.F352V(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	20		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CTGCAAACAAAGCATCTGAAA	0.428																																					p.F352V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1054G	22						.						149.0	129.0	136.0					22																	47089396		2203	4300	6503	45468060	SO:0001583	missense	64781	exon10			AB079066	CCDS14077.1	22q13.31	2008-06-10			ENSG00000100422	ENSG00000100422			19256	protein-coding gene	gene with protein product		610307				11956206, 11258795	Standard	NM_022766		Approved	hCERK, FLJ23239, dA59H18.3, DKFZp434E0211, FLJ21430, KIAA1646, LK4, dA59H18.2	uc003bia.3	Q8TCT0	OTTHUMG00000150395	ENST00000216264.8:c.1054T>G	22.37:g.47089396A>C	ENSP00000216264:p.Phe352Val		45468060	NM_022766	A0JNT4|A8K611|Q6NX59|Q9BYB3|Q9UGE5	Missense_Mutation	SNP	ENST00000216264.8	37	CCDS14077.1	.	.	.	.	.	.	.	.	.	.	a	5.778	0.327987	0.10956	.	.	ENSG00000100422	ENST00000216264;ENST00000541677	T;T	0.39997	1.05;1.05	5.2	5.2	0.72013	.	0.793255	0.12362	N	0.475529	T	0.41050	0.1142	L	0.53249	1.67	0.38737	D	0.953791	B	0.06786	0.001	B	0.12156	0.007	T	0.25187	-1.0139	10	0.26408	T	0.33	-16.6905	13.9007	0.63802	1.0:0.0:0.0:0.0	.	352	Q8TCT0	CERK1_HUMAN	V	352;154	ENSP00000216264:F352V;ENSP00000438659:F154V	ENSP00000216264:F352V	F	-	1	0	CERK	45468060	0.977000	0.34250	0.907000	0.35723	0.062000	0.15995	2.148000	0.42235	1.943000	0.56356	0.528000	0.53228	TTT		0.428	CERK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317924.2	NM_022766	
SLC44A2	57153	hgsc.bcm.edu	37	19	10741976	10741976	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:10741976G>A	ENST00000335757.5	+	6	732	c.356G>A	c.(355-357)cGc>cAc	p.R119H	SLC44A2_ENST00000407327.4_Missense_Mutation_p.R117H|SLC44A2_ENST00000586078.1_Missense_Mutation_p.R119H			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	119					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)	p.R119H(1)		NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	TGCCCCGACCGCTACCTCACG	0.537																																					p.R119H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G356A	19						.						115.0	114.0	114.0					19																	10741976		2203	4300	6503	10602976	SO:0001583	missense	57153	exon6			AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.356G>A	19.37:g.10741976G>A	ENSP00000336888:p.Arg119His		10602976	NM_020428	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	ENST00000335757.5	37	CCDS12245.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010454	0.75046	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.19669	2.13;2.13	4.71	4.71	0.59529	.	0.122956	0.50627	D	0.000115	T	0.37320	0.0999	M	0.82323	2.585	0.30423	N	0.77792	D;D	0.56968	0.962;0.978	P;P	0.52710	0.586;0.707	T	0.44952	-0.9294	10	0.42905	T	0.14	.	10.2731	0.43493	0.0922:0.0:0.9078:0.0	.	119;117	Q8IWA5;Q8IWA5-3	CTL2_HUMAN;.	H	117;119;119	ENSP00000385135:R117H;ENSP00000336888:R119H	ENSP00000336888:R119H	R	+	2	0	SLC44A2	10602976	0.835000	0.29415	1.000000	0.80357	0.749000	0.42624	3.319000	0.51983	2.476000	0.83614	0.456000	0.33151	CGC		0.537	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		
CARM1	10498	hgsc.bcm.edu	37	19	11015663	11015663	+	Missense_Mutation	SNP	G	G	C	rs373397887		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:11015663G>C	ENST00000327064.4	+	2	447	c.257G>C	c.(256-258)cGa>cCa	p.R86P	CARM1_ENST00000344150.4_Missense_Mutation_p.R86P	NM_199141.1	NP_954592.1	Q86X55	CARM1_HUMAN	coactivator-associated arginine methyltransferase 1	86					cellular lipid metabolic process (GO:0044255)|endochondral bone morphogenesis (GO:0060350)|histone H3-R17 methylation (GO:0034971)|histone H3-R2 methylation (GO:0034970)|histone methylation (GO:0016571)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of protein binding (GO:0032091)|pathogenesis (GO:0009405)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-R17 specific) (GO:0035642)|histone-arginine N-methyltransferase activity (GO:0008469)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|lysine-acetylated histone binding (GO:0070577)|protein methyltransferase activity (GO:0008276)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.R86P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	13						TCAGTGTCCCGAGAGACAGAG	0.582																																					p.R86P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G257C	19						.						261.0	191.0	214.0					19																	11015663		2203	4300	6503	10876663	SO:0001583	missense	10498	exon2			AF055027	CCDS12250.1	19p13.2	2010-10-11			ENSG00000142453	ENSG00000142453		"""Protein arginine methyltransferases"""	23393	protein-coding gene	gene with protein product		603934				10381882, 11724789	Standard	NM_199141		Approved	PRMT4	uc002mpz.3	Q86X55		ENST00000327064.4:c.257G>C	19.37:g.11015663G>C	ENSP00000325690:p.Arg86Pro		10876663	NM_199141	A6NN38	Missense_Mutation	SNP	ENST00000327064.4	37	CCDS12250.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678261	0.47886	.	.	ENSG00000142453	ENST00000327064;ENST00000344150	T;T	0.28069	1.64;1.63	5.31	5.31	0.75309	Histone-arginine methyltransferase CARM1, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.21186	0.0510	N	0.24115	0.695	0.54753	D	0.999984	B	0.10296	0.003	B	0.15052	0.012	T	0.04481	-1.0948	10	0.30854	T	0.27	-0.7739	11.9395	0.52892	0.0849:0.0:0.9151:0.0	.	86	Q86X55	CARM1_HUMAN	P	86	ENSP00000325690:R86P;ENSP00000340934:R86P	ENSP00000325690:R86P	R	+	2	0	CARM1	10876663	1.000000	0.71417	0.960000	0.40013	0.780000	0.44128	5.027000	0.64109	2.478000	0.83669	0.561000	0.74099	CGA		0.582	CARM1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452625.1	XM_032719	
NOTCH3	4854	hgsc.bcm.edu	37	19	15290228	15290228	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:15290228G>A	ENST00000263388.2	-	21	3482	c.3407C>T	c.(3406-3408)tCa>tTa	p.S1136L		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1136	EGF-like 29; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.S1136L(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GTCAATGCATGAACCCCCGTG	0.607																																					p.S1136L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3407T	19						.						105.0	92.0	97.0					19																	15290228		2203	4300	6503	15151228	SO:0001583	missense	4854	exon21			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3407C>T	19.37:g.15290228G>A	ENSP00000263388:p.Ser1136Leu		15151228	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.688147	0.48097	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.88586	-2.4	4.3	3.26	0.37387	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.85353	0.5677	L	0.53561	1.675	0.38819	D	0.955589	B;B	0.16396	0.017;0.011	B;B	0.24006	0.043;0.05	T	0.81693	-0.0817	9	0.72032	D	0.01	.	8.3384	0.32228	0.1312:0.0:0.8688:0.0	.	1087;1136	Q59FL3;Q9UM47	.;NOTC3_HUMAN	L	1136;1086	ENSP00000263388:S1136L	ENSP00000263388:S1136L	S	-	2	0	NOTCH3	15151228	1.000000	0.71417	0.997000	0.53966	0.874000	0.50279	4.507000	0.60434	0.710000	0.31997	0.561000	0.74099	TCA		0.607	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
CYP4F2	8529	hgsc.bcm.edu	37	19	16006322	16006322	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:16006322C>T	ENST00000221700.6	-	3	432	c.337G>A	c.(337-339)Gcc>Acc	p.A113T	CYP4F2_ENST00000011989.7_Intron	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2									p.A113T(1)		NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GTACCTGAGGCGTTGATGACA	0.612																																					p.A113T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G337A	19						.						122.0	131.0	128.0					19																	16006322		2203	4300	6503	15867322	SO:0001583	missense	8529	exon3			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.337G>A	19.37:g.16006322C>T	ENSP00000221700:p.Ala113Thr		15867322	NM_001082		Missense_Mutation	SNP	ENST00000221700.6	37	CCDS12336.1	.	.	.	.	.	.	.	.	.	.	c	15.24	2.775922	0.49786	.	.	ENSG00000186115	ENST00000221700	T	0.78246	-1.16	3.13	2.07	0.26955	.	0.000000	0.64402	U	0.000006	T	0.64702	0.2622	N	0.17800	0.525	0.80722	D	1	P	0.34977	0.478	B	0.41723	0.365	T	0.57341	-0.7828	10	0.33141	T	0.24	.	8.2506	0.31715	0.0:0.874:0.0:0.126	.	113	P78329	CP4F2_HUMAN	T	113	ENSP00000221700:A113T	ENSP00000221700:A113T	A	-	1	0	CYP4F2	15867322	0.933000	0.31639	0.550000	0.28217	0.586000	0.36452	1.875000	0.39578	0.631000	0.30412	0.305000	0.20034	GCC		0.612	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082	
SLC25A42	284439	hgsc.bcm.edu	37	19	19206947	19206947	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:19206947T>C	ENST00000318596.7	+	2	165	c.14T>C	c.(13-15)gTg>gCg	p.V5A		NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	5					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)	p.V5A(1)		cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			GGTAATGGTGTGAAGGAAGGC	0.597																																					p.V5A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T14C	19						.						187.0	148.0	161.0					19																	19206947		2203	4300	6503	19067947	SO:0001583	missense	284439	exon2				CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.14T>C	19.37:g.19206947T>C	ENSP00000326693:p.Val5Ala		19067947	NM_178526	D2T2J5|O14553|O43378	Missense_Mutation	SNP	ENST00000318596.7	37	CCDS32966.1	.	.	.	.	.	.	.	.	.	.	T	14.53	2.562162	0.45590	.	.	ENSG00000181035	ENST00000318596	T	0.80214	-1.35	3.72	3.72	0.42706	.	0.624246	0.14147	N	0.338276	T	0.69593	0.3128	L	0.29908	0.895	0.32846	D	0.506056	B;B	0.29037	0.231;0.018	B;B	0.27608	0.081;0.016	T	0.73154	-0.4072	10	0.38643	T	0.18	-0.3678	10.715	0.46006	0.0:0.0:0.0:1.0	.	57;5	B7Z8R5;Q86VD7	.;S2542_HUMAN	A	5	ENSP00000326693:V5A	ENSP00000326693:V5A	V	+	2	0	SLC25A42	19067947	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	3.399000	0.52586	1.711000	0.51337	0.379000	0.24179	GTG		0.597	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465931.1	NM_178526	
SBSN	374897	hgsc.bcm.edu	37	19	36015774	36015774	+	Missense_Mutation	SNP	G	G	A	rs199891331		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:36015774G>A	ENST00000452271.2	-	2	1719	c.1691C>T	c.(1690-1692)cCg>cTg	p.P564L	SBSN_ENST00000518157.1_Missense_Mutation_p.P221L	NM_001166034.1	NP_001159506.1	Q6UWP8	SBSN_HUMAN	suprabasin	564						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.P221L(1)		large_intestine(5)|lung(6)|ovary(1)|prostate(2)	14	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			AGAGGCTAACGGCGTGGTTGT	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		17744	0.0		0.0	False		,,,				2504	0.001				p.P564L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1691T	19						.						103.0	96.0	98.0					19																	36015774		2203	4300	6503	40707614	SO:0001583	missense	374897	exon2			AY358701	CCDS12464.1, CCDS54253.1	19q13.13	2008-02-05							24950	protein-coding gene	gene with protein product		609969				12228223	Standard	NM_198538		Approved	UNQ698, HLAR698	uc002oad.2	Q6UWP8		ENST00000452271.2:c.1691C>T	19.37:g.36015774G>A	ENSP00000430242:p.Pro564Leu		40707614	NM_001166034	A8K5J0|E9PBV3	Missense_Mutation	SNP	ENST00000452271.2	37	CCDS54253.1	.	.	.	.	.	.	.	.	.	.	G	9.457	1.092144	0.20471	.	.	ENSG00000189001	ENST00000452271;ENST00000518157	T;T	0.54279	0.58;0.74	3.21	3.21	0.36854	.	0.953961	0.08479	U	0.939820	T	0.35595	0.0937	N	0.19112	0.55	0.09310	N	1	B;B	0.33022	0.21;0.394	B;B	0.23018	0.043;0.042	T	0.18209	-1.0344	10	0.52906	T	0.07	.	10.12	0.42614	0.0:0.0:1.0:0.0	.	221;564	Q6UWP8;E9PBV3	SBSN_HUMAN;.	L	564;221	ENSP00000430242:P564L;ENSP00000428771:P221L	ENSP00000430242:P564L	P	-	2	0	SBSN	40707614	0.026000	0.19158	0.002000	0.10522	0.070000	0.16714	2.420000	0.44679	1.797000	0.52628	0.478000	0.44815	CCG		0.607	SBSN-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109463.3	NM_198538	
ATP4A	495	hgsc.bcm.edu	37	19	36047846	36047846	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:36047846G>T	ENST00000262623.3	-	12	1866	c.1838C>A	c.(1837-1839)gCt>gAt	p.A613D		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	613					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.A613V(1)|p.A613D(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	CTTGAGCACAGCATCAGGGAC	0.572																																					p.A613D												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C1838A	19						.						59.0	56.0	57.0					19																	36047846		2203	4300	6503	40739686	SO:0001583	missense	495	exon12				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.1838C>A	19.37:g.36047846G>T	ENSP00000262623:p.Ala613Asp		40739686	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.955835	0.92726	.	.	ENSG00000105675	ENST00000262623	D	0.97256	-4.31	4.93	4.93	0.64822	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.64402	D	0.000006	D	0.98985	0.9654	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99232	1.0882	10	0.87932	D	0	.	15.671	0.77274	0.0:0.0:1.0:0.0	.	613	P20648	ATP4A_HUMAN	D	613	ENSP00000262623:A613D	ENSP00000262623:A613D	A	-	2	0	ATP4A	40739686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.623000	0.98386	2.562000	0.86427	0.591000	0.81541	GCT		0.572	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
STAP2	55620	hgsc.bcm.edu	37	19	4324147	4324147	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:4324147G>A	ENST00000594605.1	-	13	1318	c.1195C>T	c.(1195-1197)Cgg>Tgg	p.R399W	STAP2_ENST00000600324.1_Missense_Mutation_p.R445W|STAP2_ENST00000597593.1_5'Flank	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	399						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.R445W(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCAGTGCCCGCCTCTTCTCC	0.607																																					p.R399W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1195T	19						.						45.0	39.0	41.0					19																	4324147		2048	3888	5936	4275147	SO:0001583	missense	55620	exon13			AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.1195C>T	19.37:g.4324147G>A	ENSP00000471052:p.Arg399Trp		4275147	NM_001013841	A6NKK3|Q9NXI2	Missense_Mutation	SNP	ENST00000594605.1	37	CCDS45926.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.266816	0.40095	.	.	ENSG00000178078	ENST00000314714;ENST00000424810	.	.	.	4.62	2.29	0.28610	.	0.000000	0.53938	U	0.000060	T	0.59878	0.2226	L	0.60455	1.87	0.29757	N	0.835885	D;D	0.89917	1.0;1.0	P;D	0.87578	0.872;0.998	T	0.56667	-0.7941	9	0.87932	D	0	-11.1162	8.7003	0.34320	0.0:0.0:0.4652:0.5348	.	445;399	Q9UGK3-2;Q9UGK3	.;STAP2_HUMAN	W	445;399	.	ENSP00000317912:R445W	R	-	1	2	STAP2	4275147	0.142000	0.22610	0.839000	0.33178	0.077000	0.17291	0.568000	0.23623	0.893000	0.36288	0.444000	0.29173	CGG		0.607	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458114.2	NM_001013841	
ZNF527	84503	hgsc.bcm.edu	37	19	37880187	37880187	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:37880187A>C	ENST00000436120.2	+	5	1343	c.1236A>C	c.(1234-1236)aaA>aaC	p.K412N	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	412					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K412N(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTGGAGAGAAACCCTATGAAT	0.408																																					p.K412N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1236C	19						.						56.0	60.0	59.0					19																	37880187		2201	4300	6501	42572027	SO:0001583	missense	84503	exon5			AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	ENST00000436120.2:c.1236A>C	19.37:g.37880187A>C	ENSP00000390179:p.Lys412Asn		42572027	NM_032453	B4DVL5	Missense_Mutation	SNP	ENST00000436120.2	37	CCDS42559.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.802021	0.50315	.	.	ENSG00000189164	ENST00000356178;ENST00000317566;ENST00000436120	.	.	.	3.57	3.57	0.40892	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36555	N	0.002538	T	0.67449	0.2894	M	0.84773	2.715	0.80722	D	1	P;P	0.51537	0.946;0.934	P;P	0.52793	0.709;0.585	T	0.71220	-0.4657	9	0.72032	D	0.01	.	6.8898	0.24222	0.887:0.0:0.113:0.0	.	412;380	Q8NB42;Q8NB42-2	ZN527_HUMAN;.	N	412;380;360	.	ENSP00000325231:K380N	K	+	3	2	ZNF527	42572027	0.895000	0.30542	1.000000	0.80357	0.930000	0.56654	0.163000	0.16520	1.511000	0.48818	0.533000	0.62120	AAA		0.408	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458434.1	NM_032453	
PRX	57716	hgsc.bcm.edu	37	19	40903809	40903809	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:40903809G>A	ENST00000324001.7	-	7	720	c.450C>T	c.(448-450)gaC>gaT	p.D150D	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	150	Arg/Lys-rich (basic).				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.D150D(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CAGGGGCCAGGTCAGCGGGGA	0.642																																					p.D150D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C450T	19						.						19.0	23.0	22.0					19																	40903809		2202	4299	6501	45595649	SO:0001819	synonymous_variant	57716	exon7			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.450C>T	19.37:g.40903809G>A			45595649	NM_181882	Q9BXL9|Q9HCF2	Silent	SNP	ENST00000324001.7	37	CCDS33028.1																																																																																				0.642	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956	
HNRNPUL1	11100	hgsc.bcm.edu	37	19	41800572	41800572	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:41800572G>A	ENST00000392006.3	+	10	1672	c.1499G>A	c.(1498-1500)cGc>cAc	p.R500H	HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.R400H|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.R400H|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.R411H|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.R500H|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.R400H|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.R386H	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	500	Necessary for interaction with BRD7 and transcriptional activation.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R500H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						CGCAAGAAACGCAACTATATC	0.567																																					p.R400H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1199A	19						.						85.0	84.0	84.0					19																	41800572		2203	4300	6503	46492412	SO:0001583	missense	11100	exon10			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1499G>A	19.37:g.41800572G>A	ENSP00000375863:p.Arg500His		46492412	NM_144732	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	37	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.657829	0.88154	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.45	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.70527	0.3234	M	0.85197	2.74	0.51482	D	0.999922	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D	0.97110	0.995;1.0;0.999;0.996;0.991;0.991	T	0.75599	-0.3262	10	0.59425	D	0.04	-9.3212	13.375	0.60732	0.0765:0.0:0.9235:0.0	.	411;400;500;386;500;400	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;HNRL1_HUMAN;.	H	400;500;386;411	ENSP00000340857:R400H;ENSP00000375863:R500H;ENSP00000367460:R386H;ENSP00000263367:R411H	ENSP00000263367:R411H	R	+	2	0	HNRNPUL1	46492412	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.746000	0.85057	1.534000	0.49203	0.650000	0.86243	CGC		0.567	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
HNRNPUL1	11100	hgsc.bcm.edu	37	19	41809916	41809916	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:41809916G>A	ENST00000392006.3	+	13	2185	c.2012G>A	c.(2011-2013)cGc>cAc	p.R671H	HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.R571H|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.R571H|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.R582H|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.R671H|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.R571H|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.R557H	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	671	Asn-rich.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R671H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						AGCCAGAACCGCTGGGGTAAC	0.572																																					p.R571H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1712A	19						.						100.0	102.0	101.0					19																	41809916		2203	4300	6503	46501756	SO:0001583	missense	11100	exon13			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.2012G>A	19.37:g.41809916G>A	ENSP00000375863:p.Arg671His		46501756	NM_144732	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	37	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.302697	0.81136	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.84515	0.5489	N	0.24115	0.695	0.49051	D	0.999743	D;D;D;D;D;D;D	0.89917	0.996;0.998;0.999;1.0;0.999;0.998;0.999	P;P;P;D;P;P;P	0.77004	0.586;0.725;0.901;0.989;0.901;0.799;0.858	T	0.81439	-0.0932	10	0.21540	T	0.41	-11.9835	17.3577	0.87341	0.0:0.0:1.0:0.0	.	582;571;671;195;557;671;571	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-5;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;.;HNRL1_HUMAN;.	H	571;671;557;582	ENSP00000340857:R571H;ENSP00000375863:R671H;ENSP00000367460:R557H;ENSP00000263367:R582H	ENSP00000263367:R582H	R	+	2	0	HNRNPUL1	46501756	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.119000	0.71590	2.649000	0.89929	0.555000	0.69702	CGC		0.572	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
XRCC1	7515	hgsc.bcm.edu	37	19	44047604	44047604	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:44047604A>G	ENST00000262887.5	-	17	2389	c.1842T>C	c.(1840-1842)agT>agC	p.S614S	XRCC1_ENST00000543982.1_Silent_p.S583S			P18887	XRCC1_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 1	614	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				base-excision repair (GO:0006284)|DNA repair (GO:0006281)|hippocampus development (GO:0021766)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to organic substance (GO:0010033)|single strand break repair (GO:0000012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)	p.S614S(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Prostate(69;0.0153)				TCTCATTGCAACTGTAGATCC	0.552								Other BER factors																													p.S614S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1842C	19						.						145.0	131.0	136.0					19																	44047604		2203	4300	6503	48739444	SO:0001819	synonymous_variant	7515	exon17			M36089	CCDS12624.1	19q13.2	2014-09-17				ENSG00000073050			12828	protein-coding gene	gene with protein product		194360		RCC		2247054	Standard	NM_006297		Approved		uc002owt.2	P18887		ENST00000262887.5:c.1842T>C	19.37:g.44047604A>G			48739444	NM_006297	Q6IBS4|Q9HCB1	Silent	SNP	ENST00000262887.5	37	CCDS12624.1																																																																																				0.552	XRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463194.1	NM_006297	
PLAUR	5329	hgsc.bcm.edu	37	19	44153053	44153053	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:44153053G>A	ENST00000340093.3	-	7	1226	c.997C>T	c.(997-999)Ctc>Ttc	p.L333F	PLAUR_ENST00000601723.1_Missense_Mutation_p.L284F|PLAUR_ENST00000221264.4_Missense_Mutation_p.L288F|PLAUR_ENST00000339082.3_Intron	NM_002659.3	NP_002650.1	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor	333					attachment of GPI anchor to protein (GO:0016255)|blood coagulation (GO:0007596)|C-terminal protein lipidation (GO:0006501)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|chemotaxis (GO:0006935)|fibrinolysis (GO:0042730)|post-translational protein modification (GO:0043687)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|urokinase plasminogen activator signaling pathway (GO:0038195)	anchored component of membrane (GO:0031225)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)|urokinase plasminogen activator receptor activity (GO:0030377)	p.L333F(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|urinary_tract(3)	20		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	TAGGTCCAGAGGAGAGTGCCT	0.627																																					p.L288F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C862T	19						.						81.0	74.0	77.0					19																	44153053		2203	4300	6503	48844893	SO:0001583	missense	5329	exon6				CCDS12628.1, CCDS33041.1, CCDS33042.1, CCDS74386.1	19q13	2012-03-15			ENSG00000011422	ENSG00000011422		"""CD molecules"""	9053	protein-coding gene	gene with protein product	"""urokinase-type plasminogen activator (uPA) receptor"", ""urokinase plasminogen activator surface receptor"""	173391					Standard	NM_002659		Approved	URKR, UPAR, CD87	uc002oxf.2	Q03405		ENST00000340093.3:c.997C>T	19.37:g.44153053G>A	ENSP00000339328:p.Leu333Phe		48844893	NM_001005377	A8K409|Q12876|Q15845|Q16887|Q6IB52|Q9BWT0|Q9NYC8|Q9UD69|Q9UEA6|Q9UM92|Q9UMV0	Missense_Mutation	SNP	ENST00000340093.3	37	CCDS12628.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997953	0.54147	.	.	ENSG00000011422	ENST00000340093;ENST00000221264	T;T	0.16457	2.34;2.35	3.84	0.465	0.16711	.	0.211187	0.22087	N	0.064801	T	0.14013	0.0339	M	0.64997	1.995	0.39144	D	0.962096	P;P	0.44816	0.844;0.759	B;B	0.39152	0.292;0.153	T	0.08411	-1.0723	10	0.87932	D	0	-12.837	3.0852	0.06276	0.2308:0.0:0.5565:0.2127	.	288;333	Q03405-3;Q03405	.;UPAR_HUMAN	F	333;288	ENSP00000339328:L333F;ENSP00000221264:L288F	ENSP00000221264:L288F	L	-	1	0	PLAUR	48844893	1.000000	0.71417	0.978000	0.43139	0.851000	0.48451	1.498000	0.35660	0.203000	0.20529	0.313000	0.20887	CTC		0.627	PLAUR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463571.1	NM_002659	
OPA3	80207	hgsc.bcm.edu	37	19	46087997	46087997	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:46087997G>A	ENST00000263275.4	-	1	80	c.26C>T	c.(25-27)gCg>gTg	p.A9V	OPA3_ENST00000323060.3_Missense_Mutation_p.A9V|OPA3_ENST00000544371.1_Intron	NM_025136.3	NP_079412.1	Q9H6K4	OPA3_HUMAN	optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia)	9					growth (GO:0040007)|mitochondrion morphogenesis (GO:0070584)|neuromuscular process (GO:0050905)|regulation of lipid metabolic process (GO:0019216)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	mitochondrion (GO:0005739)		p.A9V(1)		cervix(1)|large_intestine(1)|lung(2)	4		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00778)|GBM - Glioblastoma multiforme(486;0.0976)|Epithelial(262;0.242)		TAGCAGCTTCGCCATAGGGAA	0.627																																					p.A9V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C26T	19						.						56.0	55.0	56.0					19																	46087997		2203	4300	6503	50779837	SO:0001583	missense	80207	exon1			AK025840	CCDS12668.1, CCDS33052.1	19q13.2-q13.3	2014-01-28				ENSG00000125741			8142	protein-coding gene	gene with protein product		606580				9097959, 11668429	Standard	NM_001017989		Approved	FLJ22187, MGA3	uc002pcj.4	Q9H6K4		ENST00000263275.4:c.26C>T	19.37:g.46087997G>A	ENSP00000263275:p.Ala9Val		50779837	NM_025136	Q6P384|Q8N784	Missense_Mutation	SNP	ENST00000263275.4	37	CCDS12668.1	.	.	.	.	.	.	.	.	.	.	G	36	5.839274	0.97009	.	.	ENSG00000125741	ENST00000323060;ENST00000263275	D;D	0.82433	-1.61;-1.61	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.88811	0.6538	L	0.56396	1.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.84160	0.0428	10	0.16420	T	0.52	-5.8305	17.8364	0.88699	0.0:0.0:1.0:0.0	.	9;9	Q9H6K4;Q9H6K4-2	OPA3_HUMAN;.	V	9	ENSP00000319817:A9V;ENSP00000263275:A9V	ENSP00000263275:A9V	A	-	2	0	OPA3	50779837	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.913000	0.75759	2.884000	0.98904	0.655000	0.94253	GCG		0.627	OPA3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459601.1		
KDELR1	10945	hgsc.bcm.edu	37	19	48892939	48892939	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:48892939C>T	ENST00000330720.2	-	3	416	c.222G>A	c.(220-222)acG>acA	p.T74T	KDELR1_ENST00000597017.1_Silent_p.T12T	NM_006801.2	NP_006792.1	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1	74					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	KDEL sequence binding (GO:0005046)	p.T74T(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|pancreas(1)|urinary_tract(1)	11		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		TCAACCAGACCGTGGTGAAGG	0.552																																					p.T74T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G222A	19						.						144.0	109.0	121.0					19																	48892939		2203	4300	6503	53584751	SO:0001819	synonymous_variant	10945	exon3			X55885	CCDS12718.1	19q13.3	2008-05-02				ENSG00000105438			6304	protein-coding gene	gene with protein product		131235				2172835	Standard	NM_006801		Approved	ERD2.1, ERD2, HDEL	uc002pjb.1	P24390		ENST00000330720.2:c.222G>A	19.37:g.48892939C>T			53584751	NM_006801	B2R6N4|Q54A39|Q8NBW7	Silent	SNP	ENST00000330720.2	37	CCDS12718.1																																																																																				0.552	KDELR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465708.1		
ZNF649	65251	hgsc.bcm.edu	37	19	52394555	52394555	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:52394555A>G	ENST00000354957.3	-	5	1118	c.834T>C	c.(832-834)acT>acC	p.T278T	CTC-429C10.2_ENST00000600329.1_RNA|ZNF649_ENST00000600738.1_Silent_p.T250T	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	278					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T278T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		TTTGATGTTCAGTAAGCTCAG	0.483																																					p.T278T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T834C	19						.						100.0	102.0	101.0					19																	52394555		2203	4300	6503	57086367	SO:0001819	synonymous_variant	65251	exon5			BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.834T>C	19.37:g.52394555A>G			57086367	NM_023074	A8MYJ5|B2RDC4|Q9H9N2	Silent	SNP	ENST00000354957.3	37	CCDS12843.1																																																																																				0.483	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461097.1	NM_023074	
ZNF613	79898	hgsc.bcm.edu	37	19	52448394	52448394	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:52448394C>T	ENST00000293471.6	+	6	1937	c.1258C>T	c.(1258-1260)Cgt>Tgt	p.R420C	ZNF613_ENST00000601794.1_3'UTR|ZNF613_ENST00000391794.4_Missense_Mutation_p.R384C	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	420					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R420C(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		TATTCATCGACGTACTCACAC	0.408																																					p.R384C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1150T	19						.						73.0	70.0	71.0					19																	52448394		2203	4300	6503	57140206	SO:0001583	missense	79898	exon6			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1258C>T	19.37:g.52448394C>T	ENSP00000293471:p.Arg420Cys		57140206	NM_024840	Q96SS9	Missense_Mutation	SNP	ENST00000293471.6	37	CCDS33089.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.278271	0.40294	.	.	ENSG00000176024	ENST00000293471;ENST00000391794;ENST00000535279	T;T	0.02472	4.28;4.28	3.36	0.942	0.19525	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33591	N	0.004743	T	0.15003	0.0362	M	0.88570	2.965	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01245	-1.1407	10	0.87932	D	0	.	10.0636	0.42290	0.434:0.5659:0.0:0.0	.	420	Q6PF04	ZN613_HUMAN	C	420;384;94	ENSP00000293471:R420C;ENSP00000375671:R384C	ENSP00000293471:R420C	R	+	1	0	ZNF613	57140206	0.000000	0.05858	0.199000	0.23439	0.850000	0.48378	-0.439000	0.06897	0.742000	0.32697	0.655000	0.94253	CGT		0.408	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461104.2	NM_024840	
PPP2R1A	5518	hgsc.bcm.edu	37	19	52714602	52714602	+	Silent	SNP	G	G	A	rs11537700		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:52714602G>A	ENST00000322088.6	+	4	418	c.360G>A	c.(358-360)tcG>tcA	p.S120S	PPP2R1A_ENST00000444322.2_Silent_p.S65S|PPP2R1A_ENST00000462990.1_5'UTR|PPP2R1A_ENST00000473455.2_3'UTR	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	120	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.|SV40 small T antigen binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.S120S(1)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		ACGAGCACTCGCCCTCTGACC	0.662			Mis		clear cell ovarian carcinoma								G|||	1	0.000199681	0.0	0.0	5008	,	,		17565	0.0		0.001	False		,,,				2504	0.0				p.S120S			Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G360A	19						.						59.0	62.0	61.0					19																	52714602		2203	4300	6503	57406414	SO:0001819	synonymous_variant	5518	exon4				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.360G>A	19.37:g.52714602G>A			57406414	NM_014225	Q13773|Q6ICQ3|Q96DH3	Silent	SNP	ENST00000322088.6	37	CCDS12849.1																																																																																				0.662	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
NLRP9	338321	hgsc.bcm.edu	37	19	56244483	56244483	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:56244483T>C	ENST00000332836.2	-	2	741	c.714A>G	c.(712-714)caA>caG	p.Q238Q		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	238	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.Q238Q(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CAGCCTTAAGTTGTAAGTTAA	0.453																																					p.Q238Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A714G	19						.						39.0	40.0	40.0					19																	56244483		2203	4300	6503	60936295	SO:0001819	synonymous_variant	338321	exon2			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.714A>G	19.37:g.56244483T>C			60936295	NM_176820	B2RN12|Q86W27	Silent	SNP	ENST00000332836.2	37	CCDS12934.1																																																																																				0.453	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
ZNF470	388566	hgsc.bcm.edu	37	19	57089801	57089801	+	Missense_Mutation	SNP	G	G	C	rs149831867		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:57089801G>C	ENST00000330619.8	+	6	2690	c.2004G>C	c.(2002-2004)aaG>aaC	p.K668N	ZNF470_ENST00000391709.3_Missense_Mutation_p.K668N|ZNF470_ENST00000601902.1_Intron	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	668					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K668N(1)		endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		CTCTACATAAGAGAATTCATA	0.438																																					p.K668N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2004C	19						.	G	ASN/LYS	0,4406		0,0,2203	89.0	86.0	87.0		2004	0.8	0.1	19	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF470	NM_001001668.3	94	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	benign	668/718	57089801	1,13005	2203	4300	6503	61781613	SO:0001583	missense	388566	exon6			AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.2004G>C	19.37:g.57089801G>C	ENSP00000333223:p.Lys668Asn		61781613	NM_001001668	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	ENST00000330619.8	37	CCDS33122.1	.	.	.	.	.	.	.	.	.	.	G	10.10	1.256964	0.22965	0.0	1.16E-4	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.07567	3.18;3.18	4.07	0.79	0.18613	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08935	0.0221	L	0.43554	1.36	0.19575	N	0.999962	B	0.22909	0.077	B	0.28139	0.086	T	0.32745	-0.9895	9	0.87932	D	0	.	8.2786	0.31887	0.2719:0.0:0.7281:0.0	.	668	Q6ECI4	ZN470_HUMAN	N	668	ENSP00000375590:K668N;ENSP00000333223:K668N	ENSP00000333223:K668N	K	+	3	2	ZNF470	61781613	0.000000	0.05858	0.074000	0.20217	0.435000	0.31806	-0.339000	0.07832	0.072000	0.16694	-0.254000	0.11334	AAG		0.438	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459707.2	NM_001001668	
KLK2	3817	hgsc.bcm.edu	37	19	51378099	51378099	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:51378099C>A	ENST00000325321.3	+	2	394	c.169C>A	c.(169-171)Ccc>Acc	p.P57T	AC037199.1_ENST00000594218.1_5'Flank|KLK2_ENST00000358049.4_Missense_Mutation_p.P57T|KLK2_ENST00000597509.1_3'UTR|KLK2_ENST00000391810.2_Intron			P20151	KLK2_HUMAN	kallikrein-related peptidase 2	57	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)	p.P57T(2)|p.P57S(1)	KLK2/ETV1(3)|KLK2/ETV4(2)	large_intestine(3)|lung(6)|ovary(1)|skin(1)	11		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.00871)		CCTGGTGCACCCCCAGTGGGT	0.587			T	ETV4	prostate																																p.P57T			Dom	yes		19	19q13.41	3817	kallikrein-related peptidase 2		E	KLK2,skin,NS,Substitution - Missense,0	.	3	Substitution - Missense(3)	large_intestine(2)|skin(1)	c.C169A	19						.						69.0	57.0	61.0					19																	51378099		2203	4300	6503	56069911	SO:0001583	missense	3817	exon2			M18157	CCDS12808.1, CCDS42597.1, CCDS58675.1	19q13.33	2008-02-05	2006-10-27				3.4.21.35	"""Kallikreins"""	6363	protein-coding gene	gene with protein product		147960	"""kallikrein 2, prostatic"""			2468530, 16800724, 16800723	Standard	NM_005551		Approved		uc002ptv.3	P20151		ENST00000325321.3:c.169C>A	19.37:g.51378099C>A	ENSP00000313581:p.Pro57Thr		56069911	NM_001002231	B4DU93|B4DUB0|F5H8L3|Q15946|Q9UJZ9	Missense_Mutation	SNP	ENST00000325321.3	37	CCDS12808.1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.416849	0.42918	.	.	ENSG00000167751	ENST00000325321;ENST00000358049	T;T	0.07908	3.15;3.15	2.62	1.5	0.22942	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.20455	0.0492	L	0.58925	1.835	0.09310	N	0.999996	D;D	0.69078	0.997;0.995	D;P	0.66351	0.943;0.878	T	0.05419	-1.0886	9	0.62326	D	0.03	.	9.3247	0.37986	0.0:0.7756:0.2244:0.0	.	57;57	P20151-2;P20151	.;KLK2_HUMAN	T	57	ENSP00000313581:P57T;ENSP00000350748:P57T	ENSP00000313581:P57T	P	+	1	0	KLK2	56069911	0.043000	0.20138	0.006000	0.13384	0.957000	0.61999	2.250000	0.43178	0.352000	0.24053	0.442000	0.29010	CCC		0.587	KLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464438.3	NM_005551.3	
USP29	57663	hgsc.bcm.edu	37	19	57641534	57641534	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr19:57641534G>A	ENST00000254181.4	+	4	1945	c.1491G>A	c.(1489-1491)agG>agA	p.R497R	USP29_ENST00000598197.1_Silent_p.R497R	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	497	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.R497R(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTGTTGCAAGGCATACATTTA	0.378																																					p.R497R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1491A	19						.						106.0	109.0	108.0					19																	57641534		2203	4300	6503	62333346	SO:0001819	synonymous_variant	57663	exon4				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1491G>A	19.37:g.57641534G>A			62333346	NM_020903		Silent	SNP	ENST00000254181.4	37	CCDS33124.1																																																																																				0.378	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
CSMD3	114788	hgsc.bcm.edu	37	8	113649131	113649131	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:113649131C>T	ENST00000297405.5	-	22	3874	c.3630G>A	c.(3628-3630)tcG>tcA	p.S1210S	CSMD3_ENST00000343508.3_Silent_p.S1170S|CSMD3_ENST00000352409.3_Silent_p.S1210S|CSMD3_ENST00000455883.2_Silent_p.S1106S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1210	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1210S(2)|p.S1170S(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTCGATAACCCGAAGAGCATG	0.507										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S1210S												.	.	3	Substitution - coding silent(3)	lung(2)|large_intestine(1)	c.G3630A	8						.						225.0	171.0	189.0					8																	113649131		2203	4300	6503	113718307	SO:0001819	synonymous_variant	114788	exon22			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3630G>A	8.37:g.113649131C>T			113718307	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																				0.507	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
EXT1	2131	hgsc.bcm.edu	37	8	119123044	119123044	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:119123044G>A	ENST00000378204.2	-	1	1048	c.242C>T	c.(241-243)tCc>tTc	p.S81F		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	81					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)	p.S81F(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			CTGCCGGGGGGAAATGTGCAC	0.562			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																												p.S81F		yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C242T	8						.						59.0	60.0	60.0					8																	119123044		2203	4300	6503	119192225	SO:0001583	missense	2131	exon1	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.242C>T	8.37:g.119123044G>A	ENSP00000367446:p.Ser81Phe		119192225	NM_000127	B2R7V2|Q9BVI9	Missense_Mutation	SNP	ENST00000378204.2	37	CCDS6324.1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.715915	0.68844	.	.	ENSG00000182197	ENST00000378204	D	0.96491	-4.03	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000002	D	0.96546	0.8873	M	0.65975	2.015	0.80722	D	1	P	0.46395	0.877	P	0.52159	0.691	D	0.95025	0.8164	10	0.10111	T	0.7	-1.634	19.1676	0.93563	0.0:0.0:1.0:0.0	.	81	Q16394	EXT1_HUMAN	F	81	ENSP00000367446:S81F	ENSP00000367446:S81F	S	-	2	0	EXT1	119192225	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	7.789000	0.85783	2.616000	0.88540	0.462000	0.41574	TCC		0.562	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
COL14A1	7373	hgsc.bcm.edu	37	8	121220533	121220533	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:121220533T>C	ENST00000297848.3	+	11	1524	c.1254T>C	c.(1252-1254)taT>taC	p.Y418Y	COL14A1_ENST00000309791.4_Silent_p.Y418Y|COL14A1_ENST00000247781.3_Silent_p.Y323Y|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000537875.1_Silent_p.Y418Y	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.Y418Y(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TAACTGAATATCAGATAGCAG	0.388																																					p.Y418Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1254C	8						.						102.0	91.0	95.0					8																	121220533		2203	4300	6503	121289714	SO:0001819	synonymous_variant	7373	exon11				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1254T>C	8.37:g.121220533T>C			121289714	NM_021110		Silent	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	T	9.049	0.991585	0.18966	.	.	ENSG00000187955	ENST00000523142	.	.	.	5.25	0.335	0.15953	.	.	.	.	.	T	0.55545	0.1927	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48234	-0.9053	4	.	.	.	.	8.901	0.35495	0.0:0.591:0.0:0.409	.	.	.	.	P	175	.	.	S	+	1	0	COL14A1	121289714	0.998000	0.40836	0.996000	0.52242	0.958000	0.62258	0.507000	0.22675	0.095000	0.17434	0.459000	0.35465	TCA		0.388	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
ANXA13	312	hgsc.bcm.edu	37	8	124707940	124707940	+	Missense_Mutation	SNP	C	C	A	rs368146229		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:124707940C>A	ENST00000419625.1	-	5	451	c.379G>T	c.(379-381)Gcc>Tcc	p.A127S	ANXA13_ENST00000262219.6_Missense_Mutation_p.A168S	NM_004306.2	NP_004297.2	P27216	ANX13_HUMAN	annexin A13	127					cell differentiation (GO:0030154)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|exocytic vesicle (GO:0070382)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylglycerol binding (GO:1901611)|phosphatidylserine binding (GO:0001786)	p.A168S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	25	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			CTTTGGTAGGCCTCTTTAATG	0.383																																					p.A127S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G379T	8						.						129.0	137.0	134.0					8																	124707940		2203	4300	6503	124777121	SO:0001583	missense	312	exon5			Z11502	CCDS34939.1, CCDS47917.1	8q24.13	2005-11-09			ENSG00000104537	ENSG00000104537		"""Annexins"""	536	protein-coding gene	gene with protein product		602573		ANX13		9503022	Standard	NM_004306		Approved		uc003yqt.3	P27216	OTTHUMG00000164987	ENST00000419625.1:c.379G>T	8.37:g.124707940C>A	ENSP00000390809:p.Ala127Ser		124777121	NM_004306	Q9BQR5	Missense_Mutation	SNP	ENST00000419625.1	37	CCDS47917.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.991999	0.35131	.	.	ENSG00000104537	ENST00000262219;ENST00000419625;ENST00000520519	T;T;T	0.04119	3.7;3.7;3.7	5.7	5.7	0.88788	Annexin repeat, conserved site (1);	0.370264	0.33438	N	0.004919	T	0.10981	0.0268	M	0.82517	2.595	0.36691	D	0.87956	B;P	0.38473	0.394;0.633	B;B	0.33196	0.119;0.159	T	0.05683	-1.0870	10	0.54805	T	0.06	.	18.6092	0.91277	0.0:1.0:0.0:0.0	.	127;168	P27216;P27216-2	ANX13_HUMAN;.	S	168;127;98	ENSP00000262219:A168S;ENSP00000390809:A127S;ENSP00000429358:A98S	ENSP00000262219:A168S	A	-	1	0	ANXA13	124777121	0.995000	0.38212	0.998000	0.56505	0.322000	0.28314	3.748000	0.55142	2.711000	0.92665	0.561000	0.74099	GCC		0.383	ANXA13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381308.1	NM_004306	
WISP1	8840	hgsc.bcm.edu	37	8	134237748	134237748	+	Silent	SNP	C	C	T	rs201767438	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:134237748C>T	ENST00000250160.6	+	4	832	c.726C>T	c.(724-726)aaC>aaT	p.N242N	WISP1_ENST00000517423.1_Intron|WISP1_ENST00000377863.2_Silent_p.N70N|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Silent_p.N155N	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	242	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)		p.N242N(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CCAATGTTAACGCCCAGTGCT	0.597													C|||	2	0.000399361	0.0008	0.0	5008	,	,		16741	0.001		0.0	False		,,,				2504	0.0				p.N155N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C465T	8						.						56.0	58.0	57.0					8																	134237748		2203	4300	6503	134306930	SO:0001819	synonymous_variant	8840	exon3			AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.726C>T	8.37:g.134237748C>T			134306930	NM_080838	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Silent	SNP	ENST00000250160.6	37	CCDS6371.1																																																																																				0.597	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378794.2	NM_003882	
ANGPT2	285	hgsc.bcm.edu	37	8	6385146	6385146	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:6385146A>C	ENST00000325203.5	-	3	970	c.496T>G	c.(496-498)Tcg>Gcg	p.S166A	ANGPT2_ENST00000338312.6_Missense_Mutation_p.S114A|ANGPT2_ENST00000523120.1_Missense_Mutation_p.S166A|ANGPT2_ENST00000415216.1_Missense_Mutation_p.S166A|MCPH1_ENST00000344683.5_Intron			O15123	ANGP2_HUMAN	angiopoietin 2	166					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to growth factor stimulus (GO:0071363)|germ cell development (GO:0007281)|glomerulus vasculature development (GO:0072012)|leukocyte migration (GO:0050900)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of positive chemotaxis (GO:0050928)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|Tie signaling pathway (GO:0048014)	cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)	p.S166A(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(245;0.0663)		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)		TTGTTTGTCGAGAGGGAGTGT	0.303																																					p.S114A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T340G	8						.						158.0	146.0	150.0					8																	6385146		2203	4300	6503	6372554	SO:0001583	missense	285	exon2			AF004327	CCDS5958.1, CCDS47761.1	8p23	2013-02-06			ENSG00000091879	ENSG00000091879		"""Fibrinogen C domain containing"""	485	protein-coding gene	gene with protein product		601922				9545648	Standard	NM_001147		Approved	Ang2	uc003wqj.4	O15123	OTTHUMG00000090365	ENST00000325203.5:c.496T>G	8.37:g.6385146A>C	ENSP00000314897:p.Ser166Ala		6372554	NM_001118888	A0AV38|A8K205|B7ZLM7|Q9NRR7|Q9P2Y7	Missense_Mutation	SNP	ENST00000325203.5	37	CCDS5958.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.243257	0.79912	.	.	ENSG00000091879	ENST00000325203;ENST00000415216;ENST00000338312;ENST00000523120	T;T;D;T	0.81908	0.57;0.57;-1.55;1.25	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.89753	0.6806	M	0.77313	2.365	0.51233	D	0.999912	D;D;D;D	0.69078	0.997;0.995;0.997;0.989	D;D;D;P	0.66847	0.947;0.935;0.947;0.849	D	0.89314	0.3635	10	0.38643	T	0.18	.	13.4604	0.61223	1.0:0.0:0.0:0.0	.	114;166;166;166	O15123-2;E7EVQ3;O15123-3;O15123	.;.;.;ANGP2_HUMAN	A	166;166;114;166	ENSP00000314897:S166A;ENSP00000400782:S166A;ENSP00000343517:S114A;ENSP00000428023:S166A	ENSP00000314897:S166A	S	-	1	0	ANGPT2	6372554	1.000000	0.71417	0.357000	0.25798	0.881000	0.50899	8.567000	0.90737	2.068000	0.61886	0.533000	0.62120	TCG		0.303	ANGPT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206737.1	NM_001147	
AGPAT5	55326	hgsc.bcm.edu	37	8	6588343	6588343	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:6588343C>T	ENST00000285518.6	+	3	713	c.401C>T	c.(400-402)gCt>gTt	p.A134V		NM_018361.3	NP_060831.2	Q9NUQ2	PLCE_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 5	134					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.A134V(1)	AGPAT5/MCPH1(2)	endometrium(2)|kidney(2)|large_intestine(4)|lung(3)	11			STAD - Stomach adenocarcinoma(24;0.0578)	READ - Rectum adenocarcinoma(644;0.156)|COAD - Colon adenocarcinoma(149;0.191)		TGTTACTTTGCTCAGGTAACT	0.403																																					p.A134V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C401T	8						.						278.0	240.0	253.0					8																	6588343		2203	4300	6503	6575751	SO:0001583	missense	55326	exon3			AF375789	CCDS34796.1	8p23.1	2013-02-05	2013-02-05		ENSG00000155189	ENSG00000155189	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20886	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, epsilon"""	614796	"""1-acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, epsilon)"""				Standard	NM_018361		Approved	FLJ11210, LPAAT-e, LPAAT-epsilon	uc003wqo.3	Q9NUQ2	OTTHUMG00000163656	ENST00000285518.6:c.401C>T	8.37:g.6588343C>T	ENSP00000285518:p.Ala134Val		6575751	NM_018361	Q8IZ47|Q9BQG4	Missense_Mutation	SNP	ENST00000285518.6	37	CCDS34796.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172678	0.38413	.	.	ENSG00000155189	ENST00000285518	D	0.97279	-4.32	5.82	4.93	0.64822	Phospholipid/glycerol acyltransferase (2);	0.209202	0.52532	D	0.000076	D	0.94308	0.8171	L	0.41824	1.3	0.41134	D	0.985904	B	0.11235	0.004	B	0.18871	0.023	D	0.91523	0.5236	10	0.26408	T	0.33	-1.7524	14.5071	0.67761	0.0:0.8522:0.1478:0.0	.	134	Q9NUQ2	PLCE_HUMAN	V	134	ENSP00000285518:A134V	ENSP00000285518:A134V	A	+	2	0	AGPAT5	6575751	1.000000	0.71417	0.996000	0.52242	0.229000	0.25112	5.560000	0.67332	1.430000	0.47334	0.557000	0.71058	GCT		0.403	AGPAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374684.1	NM_018361	
KAT6A	7994	hgsc.bcm.edu	37	8	41790016	41790016	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:41790016C>T	ENST00000396930.3	-	18	6265	c.5722G>A	c.(5722-5724)Gcc>Acc	p.A1908T	KAT6A_ENST00000406337.1_Missense_Mutation_p.A1908T|KAT6A_ENST00000265713.2_Missense_Mutation_p.A1908T	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1908	Met-rich.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A1908T(1)									ACATTATAGGCGGGAGTAGGC	0.517																																					p.A1908T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5722A	8						.						130.0	114.0	119.0					8																	41790016		2203	4300	6503	41909173	SO:0001583	missense	7994	exon18			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.5722G>A	8.37:g.41790016C>T	ENSP00000380136:p.Ala1908Thr		41909173	NM_001099413	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	C	3.945	-0.013403	0.07727	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.64803	-0.12;-0.12;-0.12	5.93	1.74	0.24563	.	0.225165	0.39083	N	0.001477	T	0.45617	0.1351	L	0.32530	0.975	0.41402	D	0.987686	B	0.09022	0.002	B	0.04013	0.001	T	0.25882	-1.0119	10	0.38643	T	0.18	-9.0206	7.5103	0.27569	0.0:0.5391:0.2467:0.2142	.	1908	Q92794	KAT6A_HUMAN	T	1908	ENSP00000265713:A1908T;ENSP00000385888:A1908T;ENSP00000380136:A1908T	ENSP00000265713:A1908T	A	-	1	0	KAT6A	41909173	0.434000	0.25570	0.396000	0.26296	0.591000	0.36615	0.782000	0.26788	0.335000	0.23614	-0.710000	0.03640	GCC		0.517	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
KAT6A	7994	hgsc.bcm.edu	37	8	41791311	41791311	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:41791311G>A	ENST00000396930.3	-	18	4970	c.4427C>T	c.(4426-4428)gCg>gTg	p.A1476V	KAT6A_ENST00000406337.1_Missense_Mutation_p.A1476V|KAT6A_ENST00000265713.2_Missense_Mutation_p.A1476V	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1476					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A1476V(1)									ATGTTCTGACGCATGACAGTC	0.562																																					p.A1476V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4427T	8						.						141.0	111.0	122.0					8																	41791311		2203	4300	6503	41910468	SO:0001583	missense	7994	exon18			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.4427C>T	8.37:g.41791311G>A	ENSP00000380136:p.Ala1476Val		41910468	NM_001099413	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.183746	0.57800	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.61274	0.12;0.12;0.12	6.06	6.06	0.98353	.	0.141095	0.49916	D	0.000123	T	0.57125	0.2032	N	0.19112	0.55	0.47065	D	0.999305	D	0.71674	0.998	P	0.58620	0.842	T	0.46345	-0.9198	10	0.06236	T	0.91	-11.4023	20.6243	0.99512	0.0:0.0:1.0:0.0	.	1476	Q92794	KAT6A_HUMAN	V	1476	ENSP00000265713:A1476V;ENSP00000385888:A1476V;ENSP00000380136:A1476V	ENSP00000265713:A1476V	A	-	2	0	KAT6A	41910468	1.000000	0.71417	0.191000	0.23289	0.653000	0.38743	7.323000	0.79105	2.879000	0.98667	0.650000	0.86243	GCG		0.562	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
TOX	9760	hgsc.bcm.edu	37	8	59728240	59728240	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:59728240T>C	ENST00000361421.1	-	7	1269	c.1049A>G	c.(1048-1050)cAg>cGg	p.Q350R	RNU4-50P_ENST00000364361.1_RNA	NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	350						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q350R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				ATTGATCAGCTGAGGAGGTTG	0.507																																					p.Q350R	Pancreas(161;610 1969 17913 21374 22725)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1049G	8						.						94.0	95.0	95.0					8																	59728240		2203	4300	6503	59890794	SO:0001583	missense	9760	exon7				CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.1049A>G	8.37:g.59728240T>C	ENSP00000354842:p.Gln350Arg		59890794	NM_014729	Q96AV5	Missense_Mutation	SNP	ENST00000361421.1	37	CCDS34897.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.554766	0.86231	.	.	ENSG00000198846	ENST00000361421;ENST00000456290	T	0.14266	2.52	6.07	6.07	0.98685	.	0.276133	0.35970	N	0.002878	T	0.12646	0.0307	N	0.19112	0.55	0.80722	D	1	P	0.47409	0.895	P	0.44518	0.452	T	0.12553	-1.0543	9	.	.	.	.	16.6288	0.85011	0.0:0.0:0.0:1.0	.	350	O94900	TOX_HUMAN	R	350;108	ENSP00000354842:Q350R	.	Q	-	2	0	TOX	59890794	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.489000	0.66875	2.326000	0.78906	0.533000	0.62120	CAG		0.507	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
STAU2	27067	hgsc.bcm.edu	37	8	74601035	74601035	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:74601035T>C	ENST00000521419.1	-	4	320	c.14A>G	c.(13-15)cAg>cGg	p.Q5R	RP11-463D19.2_ENST00000358757.5_3'UTR|STAU2_ENST00000523558.1_Intron|STAU2_ENST00000521451.1_Intron|STAU2_ENST00000519961.1_Missense_Mutation_p.Q43R|STAU2_ENST00000522962.1_5'UTR|STAU2_ENST00000521727.1_Missense_Mutation_p.Q23R|STAU2_ENST00000522509.1_Missense_Mutation_p.Q11R|STAU2_ENST00000524300.1_Missense_Mutation_p.Q43R|STAU2_ENST00000521210.1_Intron|RP11-463D19.1_ENST00000533978.1_lincRNA|STAU2_ENST00000355780.5_Missense_Mutation_p.Q11R|STAU2_ENST00000517542.1_Missense_Mutation_p.Q5R|STAU2_ENST00000524104.1_Missense_Mutation_p.Q11R|STAU2_ENST00000522695.1_Missense_Mutation_p.Q11R			Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	43					transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.Q11R(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			AAGACTCAGCTGCACTGAGAA	0.393																																					p.Q11R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A32G	8						.						128.0	122.0	124.0					8																	74601035		2203	4300	6503	74763589	SO:0001583	missense	27067	exon3			Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521419.1:c.14A>G	8.37:g.74601035T>C	ENSP00000428681:p.Gln5Arg		74763589	NM_001164384	B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Missense_Mutation	SNP	ENST00000521419.1	37		.	.	.	.	.	.	.	.	.	.	T	16.87	3.242062	0.58995	.	.	ENSG00000040341	ENST00000522695;ENST00000524300;ENST00000355780;ENST00000519961;ENST00000521727;ENST00000522509;ENST00000517542;ENST00000521447;ENST00000524104;ENST00000521419;ENST00000521736	T;T;T;T;T;T;T;T	0.76578	1.5;-1.03;1.5;-1.03;1.5;1.5;1.5;0.98	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.79690	0.4489	N	0.26042	0.785	0.58432	D	0.999999	P;P;D;D;D;D;B	0.67145	0.956;0.956;0.996;0.974;0.992;0.982;0.211	P;P;P;P;P;P;B	0.62885	0.549;0.549;0.895;0.736;0.908;0.715;0.147	T	0.77986	-0.2381	10	0.30078	T	0.28	-23.4009	16.3648	0.83312	0.0:0.0:0.0:1.0	.	23;11;5;11;43;11;43	E7EPX0;A8K276;E5RGT3;F8VPI7;E7EVJ4;E9PH62;E9PF26	.;.;.;.;.;.;.	R	11;43;11;43;23;11;5;11;11;5;11	ENSP00000428456:Q11R;ENSP00000428756:Q43R;ENSP00000348026:Q11R;ENSP00000430907:Q43R;ENSP00000429973:Q23R;ENSP00000427977:Q11R;ENSP00000431111:Q5R;ENSP00000428829:Q11R	ENSP00000348026:Q11R	Q	-	2	0	STAU2	74763589	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.953000	0.70290	2.323000	0.78572	0.524000	0.50904	CAG		0.393	STAU2-013	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000379012.2	NM_001164380	
PEX2	5828	hgsc.bcm.edu	37	8	77896062	77896062	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:77896062T>G	ENST00000419564.2	-	4	817	c.353A>C	c.(352-354)gAa>gCa	p.E118A	PEX2_ENST00000357039.4_Missense_Mutation_p.E118A|PEX2_ENST00000520103.1_Missense_Mutation_p.E118A|PEX2_ENST00000522527.1_Missense_Mutation_p.E118A	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	118					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)	p.E118A(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						ATAGCATCGTTCTTCTAACCA	0.378																																					p.E118A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A353C	8						.						79.0	74.0	75.0					8																	77896062		2203	4300	6503	78058617	SO:0001583	missense	5828	exon4			M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.353A>C	8.37:g.77896062T>G	ENSP00000400984:p.Glu118Ala		78058617	NM_000318	Q567S6|Q9BW41	Missense_Mutation	SNP	ENST00000419564.2	37	CCDS6221.1	.	.	.	.	.	.	.	.	.	.	T	18.44	3.625238	0.66901	.	.	ENSG00000164751	ENST00000357039;ENST00000419564;ENST00000520103;ENST00000522527;ENST00000518986	D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74	5.19	5.19	0.71726	Pex, N-terminal (1);	0.050058	0.85682	D	0.000000	D	0.84647	0.5518	L	0.48877	1.53	0.80722	D	1	D	0.52996	0.957	P	0.57324	0.818	T	0.80955	-0.1151	10	0.13853	T	0.58	-21.0148	15.2556	0.73582	0.0:0.0:0.0:1.0	.	118	P28328	PEX2_HUMAN	A	118	ENSP00000349543:E118A;ENSP00000400984:E118A;ENSP00000428590:E118A;ENSP00000428638:E118A;ENSP00000429304:E118A	ENSP00000349543:E118A	E	-	2	0	PEX2	78058617	1.000000	0.71417	0.921000	0.36526	0.951000	0.60555	7.297000	0.78799	2.185000	0.69588	0.456000	0.33151	GAA		0.378	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379122.1	NM_000318	
COL22A1	169044	hgsc.bcm.edu	37	8	139611016	139611016	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr8:139611016A>G	ENST00000303045.6	-	61	4757	c.4311T>C	c.(4309-4311)aaT>aaC	p.N1437N	COL22A1_ENST00000341807.4_5'UTR|COL22A1_ENST00000435777.1_Silent_p.N1417N	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1437	Collagen-like 14.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.N1437N(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CAACTGGTCCATTCTCCCCAG	0.622										HNSCC(7;0.00092)																											p.N1437N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T4311C	8						.						66.0	68.0	67.0					8																	139611016		2203	4300	6503	139680198	SO:0001819	synonymous_variant	169044	exon61			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4311T>C	8.37:g.139611016A>G			139680198	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																				0.622	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
UTY	7404	hgsc.bcm.edu	37	Y	15447546	15447546	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrY:15447546T>C	ENST00000331397.4	-	16	3447	c.2440A>G	c.(2440-2442)Aaa>Gaa	p.K814E	UTY_ENST00000537580.1_Missense_Mutation_p.K735E|UTY_ENST00000329134.5_Missense_Mutation_p.K814E|UTY_ENST00000545955.1_Missense_Mutation_p.K889E|UTY_ENST00000362096.4_Missense_Mutation_p.K814E|UTY_ENST00000538878.1_Missense_Mutation_p.K781E|UTY_ENST00000382896.4_Missense_Mutation_p.K859E|UTY_ENST00000540140.1_Missense_Mutation_p.K811E	NM_001258267.1|NM_007125.4	NP_001245196.1|NP_009056.3	O14607	UTY_HUMAN	ubiquitously transcribed tetratricopeptide repeat containing, Y-linked	814					regulation of gene expression (GO:0010468)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)			kidney(1)|lung(6)	7						AGGTCTACTTTTGTAGAGCTC	0.458																																					p.K814E	Colon(103;1740 2135 40732 45171)											.	.	0			c.A2440G	Y						.						85.0	80.0	81.0					Y																	15447546		615	1944	2559	13956940	SO:0001583	missense	7404	exon16			AF000994	CCDS14783.1, CCDS14784.1, CCDS14785.1, CCDS59184.1, CCDS76073.1, CCDS76074.1, CCDS76075.1, CCDS76076.1, CCDS76077.1, CCDS76078.1, CCDS76079.1	Yq11.221	2013-11-04	2012-11-15		ENSG00000183878	ENSG00000183878		"""Tetratricopeptide (TTC) repeat domain containing"""	12638	protein-coding gene	gene with protein product		400009	"""ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome"", ""ubiquitously transcribed tetratricopeptide repeat gene, Y-linked"""			8944031, 9499428	Standard	NM_182659		Approved	KDM6AL	uc022ckf.2	O14607	OTTHUMG00000036319	ENST00000331397.4:c.2440A>G	Y.37:g.15447546T>C	ENSP00000328939:p.Lys814Glu		13956940	NM_007125	A8K9Z3|E1U199|E1U1A0|F5H4V7|F8W8R7|O14608	Missense_Mutation	SNP	ENST00000331397.4	37	CCDS14783.1																																																																																				0.458	UTY-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088394.1	NM_182660	
KDM5D	8284	hgsc.bcm.edu	37	Y	21869540	21869540	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrY:21869540T>C	ENST00000317961.4	-	24	3763	c.3492A>G	c.(3490-3492)ccA>ccG	p.P1164P	KDM5D_ENST00000382806.2_Silent_p.P1107P|KDM5D_ENST00000541639.1_Silent_p.P1195P	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	1164					histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.P1164P(2)		kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	CCATGAGGGATGGTGCCAGTG	0.577																																					p.P1164P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A3492G	Y						.						103.0	127.0	121.0					Y																	21869540		601	1941	2542	20328928	SO:0001819	synonymous_variant	8284	exon24			U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.3492A>G	Y.37:g.21869540T>C			20328928	NM_004653	A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Silent	SNP	ENST00000317961.4	37	CCDS14794.1																																																																																				0.577	KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088790.1	NM_004653	
UBE4B	10277	hgsc.bcm.edu	37	1	10221310	10221310	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:10221310T>C	ENST00000253251.8	+	22	3616	c.2777T>C	c.(2776-2778)aTg>aCg	p.M926T	UBE4B_ENST00000377157.3_Missense_Mutation_p.M810T|UBE4B_ENST00000343090.6_Missense_Mutation_p.M1055T|RNU6-828P_ENST00000364876.1_RNA					ubiquitination factor E4B									p.M926T(1)		NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CAGGAAGAGATGAAGAACAAA	0.507																																					p.M1055T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3164C	1						.						96.0	87.0	90.0					1																	10221310		2203	4300	6503	10143897	SO:0001583	missense	10277	exon23			AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.2777T>C	1.37:g.10221310T>C	ENSP00000253251:p.Met926Thr		10143897	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	37	CCDS110.1	.	.	.	.	.	.	.	.	.	.	T	18.21	3.573761	0.65765	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.42513	0.97;0.97;0.97	5.39	5.39	0.77823	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.52058	0.1711	M	0.73372	2.23	0.80722	D	1	P;B	0.44521	0.837;0.358	P;B	0.47603	0.551;0.124	T	0.54603	-0.8269	10	0.45353	T	0.12	-22.6307	15.4417	0.75187	0.0:0.0:0.0:1.0	.	1055;926	O95155;O95155-2	UBE4B_HUMAN;.	T	926;810;1055	ENSP00000253251:M926T;ENSP00000366362:M810T;ENSP00000343001:M1055T	ENSP00000253251:M926T	M	+	2	0	UBE4B	10143897	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.033000	0.88852	2.049000	0.60858	0.455000	0.32223	ATG		0.507	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
HIAT1	64645	hgsc.bcm.edu	37	1	100515510	100515510	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:100515510A>G	ENST00000370152.3	+	2	266	c.130A>G	c.(130-132)Atc>Gtc	p.I44V		NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	44					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.I44V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		AGTTATCGTCATCTTTTTGGA	0.323																																					p.I44V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A130G	1						.						141.0	137.0	138.0					1																	100515510		2203	4300	6503	100288098	SO:0001583	missense	64645	exon2			AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.130A>G	1.37:g.100515510A>G	ENSP00000359171:p.Ile44Val		100288098	NM_033055	Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Missense_Mutation	SNP	ENST00000370152.3	37	CCDS763.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.350590	0.82132	.	.	ENSG00000156875	ENST00000370152	T	0.57107	0.42	5.63	5.63	0.86233	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.52709	0.1751	M	0.77313	2.365	0.80722	D	1	P	0.46706	0.883	P	0.50617	0.646	T	0.53627	-0.8412	10	0.17369	T	0.5	-3.9832	16.1251	0.81386	1.0:0.0:0.0:0.0	.	44	Q96MC6	HIAT1_HUMAN	V	44	ENSP00000359171:I44V	ENSP00000359171:I44V	I	+	1	0	HIAT1	100288098	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.146000	0.94640	2.261000	0.74972	0.528000	0.53228	ATC		0.323	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029657.1	NM_033055	
SLC25A24	29957	hgsc.bcm.edu	37	1	108679348	108679348	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:108679348A>G	ENST00000565488.1	-	10	1580	c.1361T>C	c.(1360-1362)gTg>gCg	p.V454A	SLC25A24_ENST00000370041.4_Missense_Mutation_p.V435A	NM_013386.4	NP_037518.3	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24	454					ATP transport (GO:0015867)|cellular response to calcium ion (GO:0071277)|cellular response to oxidative stress (GO:0034599)|mitochondrial transport (GO:0006839)|regulation of cell death (GO:0010941)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP transmembrane transporter activity (GO:0005347)|calcium ion binding (GO:0005509)	p.V435A(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		AGCAGGGAGCACCTTCATGAA	0.418																																					p.V454A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1361C	1						.						136.0	137.0	137.0					1																	108679348		2203	4300	6503	108480871	SO:0001583	missense	29957	exon10			AJ619961	CCDS786.1, CCDS41361.1	1p13.2	2013-05-22			ENSG00000085491	ENSG00000085491		"""Solute carriers"", ""EF-hand domain containing"""	20662	protein-coding gene	gene with protein product		608744				15123600	Standard	NM_013386		Approved	DKFZp586G0123, APC1	uc001dvn.5	Q6NUK1	OTTHUMG00000011013	ENST00000565488.1:c.1361T>C	1.37:g.108679348A>G	ENSP00000457733:p.Val454Ala		108480871	NM_013386	B7ZAI9|Q5T331|Q5T485|Q6PJJ9|Q705K4|Q9P129	Missense_Mutation	SNP	ENST00000565488.1	37	CCDS41361.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.469617	0.84533	.	.	ENSG00000085491	ENST00000264128;ENST00000370041	T	0.78246	-1.16	5.55	4.41	0.53225	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.74137	0.3677	M	0.62016	1.91	0.80722	D	1	P;B	0.45283	0.855;0.143	P;B	0.51453	0.67;0.163	T	0.76490	-0.2940	10	0.54805	T	0.06	-23.3001	11.3122	0.49370	0.8637:0.0:0.0:0.1362	.	454;435	Q6NUK1;Q6NUK1-2	SCMC1_HUMAN;.	A	454;435	ENSP00000359058:V435A	ENSP00000264128:V454A	V	-	2	0	SLC25A24	108480871	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.284000	0.78650	1.089000	0.41292	0.533000	0.62120	GTG		0.418	SLC25A24-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030280.2	NM_013386	
OVGP1	5016	hgsc.bcm.edu	37	1	111966304	111966304	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:111966304G>A	ENST00000369732.3	-	5	399	c.344C>T	c.(343-345)gCc>gTc	p.A115V	OVGP1_ENST00000540696.1_Missense_Mutation_p.A55V|OVGP1_ENST00000481495.1_5'Flank	NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	115					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)	p.A115V(1)|p.A179V(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		TTCACGGTTGGCAAATGTGGA	0.453																																					p.A115V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C344T	1						.						126.0	109.0	115.0					1																	111966304		2203	4300	6503	111767827	SO:0001583	missense	5016	exon5			U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.344C>T	1.37:g.111966304G>A	ENSP00000358747:p.Ala115Val		111767827	NM_002557	A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	ENST00000369732.3	37	CCDS834.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668657	0.47677	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000540696	T;T	0.06687	3.27;3.27	4.54	-1.84	0.07809	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	1.232380	0.05723	N	0.598105	T	0.05318	0.0141	L	0.58101	1.795	0.09310	N	1	B;B;D	0.54601	0.261;0.261;0.967	B;B;P	0.52454	0.324;0.324;0.699	T	0.21042	-1.0257	10	0.41790	T	0.15	-0.0894	3.1638	0.06529	0.0968:0.134:0.2381:0.5311	.	115;115;179	B2RA77;Q12889;Q59HH5	.;OVGP1_HUMAN;.	V	115;179;55	ENSP00000358747:A115V;ENSP00000438449:A55V	ENSP00000358743:A179V	A	-	2	0	OVGP1	111767827	0.000000	0.05858	0.001000	0.08648	0.031000	0.12232	-0.384000	0.07389	-0.087000	0.12528	0.591000	0.81541	GCC		0.453	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557	
PTGFRN	5738	hgsc.bcm.edu	37	1	117504011	117504011	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:117504011C>T	ENST00000393203.2	+	5	1507	c.1360C>T	c.(1360-1362)Cgc>Tgc	p.R454C	RNA5SP55_ENST00000516701.1_RNA	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	454	Ig-like C2-type 4.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.R454C(2)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		GATGAACCGGCGCAGCGACAA	0.597																																					p.R454C												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C1360T	1						.						115.0	89.0	98.0					1																	117504011		2203	4300	6503	117305534	SO:0001583	missense	5738	exon5			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.1360C>T	1.37:g.117504011C>T	ENSP00000376899:p.Arg454Cys		117305534	NM_020440	Q5VVU9|Q8N2K6	Missense_Mutation	SNP	ENST00000393203.2	37	CCDS890.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.116678	0.56505	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.03860	3.78	5.35	5.35	0.76521	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.210695	0.41500	D	0.000875	T	0.10809	0.0264	L	0.54323	1.7	0.48040	D	0.999572	D	0.89917	1.0	D	0.67231	0.95	T	0.01648	-1.1304	10	0.54805	T	0.06	-23.1339	16.5508	0.84472	0.0:1.0:0.0:0.0	.	454	Q9P2B2	FPRP_HUMAN	C	454;313	ENSP00000376899:R454C	ENSP00000376899:R454C	R	+	1	0	PTGFRN	117305534	0.998000	0.40836	0.990000	0.47175	0.454000	0.32378	2.770000	0.47662	2.514000	0.84764	0.305000	0.20034	CGC		0.597	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033271.1	NM_020440	
VPS13D	55187	hgsc.bcm.edu	37	1	12569045	12569045	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:12569045C>T	ENST00000358136.3	+	70	13264	c.13134C>T	c.(13132-13134)agC>agT	p.S4378S	SNORA59A_ENST00000459326.1_RNA|VPS13D_ENST00000471923.1_Silent_p.S34S|VPS13D_ENST00000356315.4_Silent_p.S4353S|VPS13D_ENST00000543710.1_Silent_p.S182S|VPS13D_ENST00000496628.1_3'UTR|VPS13D_ENST00000543766.1_Silent_p.S376S	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)									p.S4378S(1)		NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TAAGACTCAGCGAAAACCGAG	0.537																																					p.S4353S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C13059T	1						.						108.0	114.0	112.0					1																	12569045		2203	4300	6503	12491632	SO:0001819	synonymous_variant	55187	exon69			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.13134C>T	1.37:g.12569045C>T			12491632	NM_018156		Silent	SNP	ENST00000358136.3	37	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	C	0.073	-1.197744	0.01594	.	.	ENSG00000048707	ENST00000011700	.	.	.	5.42	-1.25	0.09405	.	.	.	.	.	T	0.53206	0.1782	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43540	-0.9385	4	.	.	.	.	7.6961	0.28596	0.0:0.3171:0.1081:0.5749	.	.	.	.	V	3200	.	.	A	+	2	0	VPS13D	12491632	0.374000	0.25081	0.016000	0.15963	0.018000	0.09664	0.043000	0.13971	-0.502000	0.06596	-1.910000	0.00522	GCG		0.537	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
NOTCH2	4853	hgsc.bcm.edu	37	1	120483245	120483245	+	Missense_Mutation	SNP	G	G	A	rs61755044		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:120483245G>A	ENST00000256646.2	-	19	3335	c.3116C>T	c.(3115-3117)aCg>aTg	p.T1039M		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1039	EGF-like 27; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.T1039M(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATCAACACACGTTCCCTCATT	0.522			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome				G|||	1	0.000199681	0.0	0.0	5008	,	,		19568	0.001		0.0	False		,,,				2504	0.0				p.T1039M			Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3116T	1						.						183.0	164.0	171.0					1																	120483245		2203	4300	6503	120284768	SO:0001583	missense	4853	exon19	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.3116C>T	1.37:g.120483245G>A	ENSP00000256646:p.Thr1039Met		120284768	NM_024408	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	16.27	3.075781	0.55646	.	.	ENSG00000134250	ENST00000256646	D	0.99445	-5.91	5.6	1.4	0.22301	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.903371	0.09058	U	0.854689	D	0.99029	0.9668	M	0.91140	3.18	0.19300	N	0.999979	P;B	0.47106	0.89;0.355	P;B	0.52066	0.689;0.064	D	0.98492	1.0610	10	0.62326	D	0.03	.	8.8305	0.35080	0.148:0.1212:0.7308:0.0	rs61755044	1039;1039	Q6IQ50;Q04721	.;NOTC2_HUMAN	M	1039	ENSP00000256646:T1039M	ENSP00000256646:T1039M	T	-	2	0	NOTCH2	120284768	0.037000	0.19845	0.001000	0.08648	0.975000	0.68041	1.594000	0.36697	-0.024000	0.13941	0.563000	0.77884	ACG		0.522	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
ARNT	405	hgsc.bcm.edu	37	1	150795820	150795820	+	Splice_Site	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:150795820A>G	ENST00000358595.5	-	14	1444	c.1244T>C	c.(1243-1245)gTa>gCa	p.V415A	ARNT_ENST00000505755.1_Splice_Site_p.V400A|ARNT_ENST00000515192.1_Splice_Site_p.V401A|ARNT_ENST00000354396.2_Splice_Site_p.V415A	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	415	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.V415A(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			TAATTTCACTACCTGAAAAAG	0.363			T	ETV6	AML																																p.V400A			Dom	yes		1	1q21	405	aryl hydrocarbon receptor nuclear translocator		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1199C	1						.						106.0	107.0	107.0					1																	150795820		2203	4300	6503	149062444	SO:0001630	splice_region_variant	405	exon13			AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.1243-1T>C	1.37:g.150795820A>G			149062444	NM_001197325	B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Missense_Mutation	SNP	ENST00000358595.5	37	CCDS970.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.161199	0.78226	.	.	ENSG00000143437	ENST00000358595;ENST00000354396;ENST00000515192;ENST00000394700;ENST00000505755	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.84	5.84	0.93424	PAS fold-3 (1);PAS (3);	0.453085	0.24978	N	0.034088	T	0.26955	0.0660	L	0.37897	1.145	0.80722	D	1	B;P;B;B;P;B	0.38767	0.397;0.646;0.205;0.416;0.599;0.397	P;P;P;P;P;P	0.59889	0.549;0.768;0.632;0.823;0.865;0.692	T	0.02574	-1.1139	10	0.46703	T	0.11	.	16.2055	0.82126	1.0:0.0:0.0:0.0	.	399;400;415;401;400;415	B4E3L5;A8K6P0;F8WAP6;P27540-3;P27540-2;P27540	.;.;.;.;.;ARNT_HUMAN	A	415;415;401;399;400	ENSP00000351407:V415A;ENSP00000346372:V415A;ENSP00000423851:V401A;ENSP00000427571:V400A	ENSP00000346372:V415A	V	-	2	0	ARNT	149062444	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.476000	0.81055	2.226000	0.72624	0.482000	0.46254	GTA		0.363	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084741.2		Missense_Mutation
ADAM15	8751	hgsc.bcm.edu	37	1	155026403	155026403	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:155026403G>A	ENST00000356955.2	+	4	382	c.281G>A	c.(280-282)cGc>cAc	p.R94H	ADAM15_ENST00000447332.3_Missense_Mutation_p.R78H|ADAM15_ENST00000271836.6_Missense_Mutation_p.R94H|ADAM15_ENST00000355956.2_Missense_Mutation_p.R94H|ADAM15_ENST00000531455.1_Missense_Mutation_p.R104H|ADAM15_ENST00000368412.3_Missense_Mutation_p.R94H|ADAM15_ENST00000449910.2_Missense_Mutation_p.R94H|ADAM15_ENST00000368410.2_Intron|ADAM15_ENST00000359280.4_Missense_Mutation_p.R94H|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000360674.4_Missense_Mutation_p.R94H|ADAM15_ENST00000368413.1_Intron	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	94					angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.R94H(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GTCCCAGGCCGCCCAACCCTG	0.567																																					p.R94H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G281A	1						.						69.0	69.0	69.0					1																	155026403		2203	4300	6503	153293027	SO:0001583	missense	8751	exon4			U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.281G>A	1.37:g.155026403G>A	ENSP00000349436:p.Arg94His		153293027	NM_207195	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Missense_Mutation	SNP	ENST00000356955.2	37	CCDS1087.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.865498	0.32977	.	.	ENSG00000143537	ENST00000356955;ENST00000449910;ENST00000359280;ENST00000360674;ENST00000368412;ENST00000355956;ENST00000271836;ENST00000531455	T;T;T;T;T;T;T;T	0.05855	3.38;3.38;3.38;3.38;3.38;3.38;3.38;3.38	4.66	-2.4	0.06583	Peptidase M12B, propeptide (1);	0.685919	0.12816	N	0.436793	T	0.01695	0.0054	L	0.39245	1.2	0.80722	D	1	B;B;B;B;B;B;B;B;B;B	0.18013	0.021;0.021;0.021;0.02;0.02;0.017;0.017;0.009;0.02;0.025	B;B;B;B;B;B;B;B;B;B	0.18263	0.021;0.014;0.021;0.013;0.013;0.008;0.008;0.008;0.018;0.021	T	0.41998	-0.9477	10	0.38643	T	0.18	.	5.2584	0.15559	0.4701:0.1593:0.3706:0.0	.	104;111;78;94;94;94;94;94;94;94	E9PN65;B7Z390;B4DMH8;Q13444-10;Q13444-2;Q13444-4;Q13444-5;Q13444-3;Q13444-9;Q13444	.;.;.;.;.;.;.;.;.;ADA15_HUMAN	H	94;94;94;94;94;94;94;104	ENSP00000349436:R94H;ENSP00000403843:R94H;ENSP00000352226:R94H;ENSP00000353892:R94H;ENSP00000357397:R94H;ENSP00000348227:R94H;ENSP00000271836:R94H;ENSP00000432927:R104H	ENSP00000271836:R94H	R	+	2	0	ADAM15	153293027	0.028000	0.19301	0.937000	0.37676	0.660000	0.38997	0.510000	0.22723	-0.258000	0.09446	0.561000	0.74099	CGC		0.567	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387168.1	NM_003815	
EPHA2	1969	hgsc.bcm.edu	37	1	16461660	16461660	+	Missense_Mutation	SNP	G	G	A	rs370741075		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:16461660G>A	ENST00000358432.5	-	7	1607	c.1453C>T	c.(1453-1455)Cgc>Tgc	p.R485C		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	485	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R485C(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	TCGGTGCGGCGCACATTGTAG	0.701																																					p.R485C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1453T	1						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	117.0	110.0	112.0		1453	5.4	1.0	1		112	0,8600		0,0,4300	no	missense	EPHA2	NM_004431.3	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	485/977	16461660	1,13005	2203	4300	6503	16334247	SO:0001583	missense	1969	exon7			BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.1453C>T	1.37:g.16461660G>A	ENSP00000351209:p.Arg485Cys		16334247	NM_004431	B5A968|Q8N3Z2	Missense_Mutation	SNP	ENST00000358432.5	37	CCDS169.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691014	0.88735	2.27E-4	0.0	ENSG00000142627	ENST00000358432	T	0.57436	0.4	5.4	5.4	0.78164	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.241975	0.29638	N	0.011584	T	0.45418	0.1341	L	0.39898	1.24	0.58432	D	0.999999	D	0.55385	0.971	B	0.39771	0.309	T	0.51309	-0.8722	10	0.54805	T	0.06	.	16.672	0.85269	0.0:0.0:1.0:0.0	.	485	P29317	EPHA2_HUMAN	C	485	ENSP00000351209:R485C	ENSP00000351209:R485C	R	-	1	0	EPHA2	16334247	0.939000	0.31865	1.000000	0.80357	0.904000	0.53231	2.932000	0.48940	2.539000	0.85634	0.655000	0.94253	CGC		0.701	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
VSIG8	391123	hgsc.bcm.edu	37	1	159826358	159826358	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:159826358T>A	ENST00000368100.1	-	5	863	c.728A>T	c.(727-729)aAc>aTc	p.N243I	C1orf204_ENST00000491974.1_5'Flank|C1orf204_ENST00000368102.1_5'Flank	NM_001013661.1	NP_001013683.1	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	243	Ig-like V-type 2.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	poly(A) RNA binding (GO:0044822)	p.N243I(1)		central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	8	all_hematologic(112;0.0597)					GCCCACGTTGTTGGCCACTGT	0.552																																					p.N243I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A728T	1						.						330.0	257.0	282.0					1																	159826358		2203	4300	6503	158092982	SO:0001583	missense	391123	exon5				CCDS30913.1	1q23.2	2013-01-11			ENSG00000243284	ENSG00000243284		"""Immunoglobulin superfamily / V-set domain containing"""	32063	protein-coding gene	gene with protein product							Standard	NM_001013661		Approved		uc001fuh.3	Q5VU13	OTTHUMG00000168834	ENST00000368100.1:c.728A>T	1.37:g.159826358T>A	ENSP00000357080:p.Asn243Ile		158092982	NM_001013661	Q5VU14	Missense_Mutation	SNP	ENST00000368100.1	37	CCDS30913.1	.	.	.	.	.	.	.	.	.	.	T	18.24	3.579274	0.65878	.	.	ENSG00000243284	ENST00000368100	T	0.05513	3.43	4.91	3.78	0.43462	Immunoglobulin V-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.20251	0.0487	H	0.94734	3.575	0.49582	D	0.999803	D	0.76494	0.999	D	0.91635	0.999	T	0.02743	-1.1116	10	0.87932	D	0	.	7.2516	0.26152	0.0:0.1013:0.0:0.8987	.	243	Q5VU13	VSIG8_HUMAN	I	243	ENSP00000357080:N243I	ENSP00000357080:N243I	N	-	2	0	VSIG8	158092982	1.000000	0.71417	0.910000	0.35882	0.987000	0.75469	2.897000	0.48664	0.731000	0.32448	0.459000	0.35465	AAC		0.552	VSIG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085978.8	NM_001013661	
F5	2153	hgsc.bcm.edu	37	1	169511553	169511553	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:169511553C>A	ENST00000367797.3	-	13	2976	c.2775G>T	c.(2773-2775)aaG>aaT	p.K925N	F5_ENST00000367796.3_Missense_Mutation_p.K930N	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	925	2 X 17 AA tandem repeats.|B.		K -> E (in dbSNP:rs6032). {ECO:0000269|PubMed:10391209, ECO:0000269|PubMed:11758222, ECO:0000269|PubMed:2827731, ECO:0000269|PubMed:3110773, ECO:0000269|Ref.3}.		blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.K925N(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TAGGAGGGTCCTTCCAGGGCC	0.473																																					p.K925N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2775T	1						.						104.0	111.0	108.0					1																	169511553		2203	4300	6503	167778177	SO:0001583	missense	2153	exon13			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.2775G>T	1.37:g.169511553C>A	ENSP00000356771:p.Lys925Asn		167778177	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.686621	0.29962	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.19669	2.13;2.13	4.78	0.537	0.17144	.	0.944141	0.08852	N	0.884318	T	0.04634	0.0126	L	0.34521	1.04	0.09310	N	0.999994	B	0.14438	0.01	B	0.06405	0.002	T	0.39121	-0.9629	9	0.32370	T	0.25	.	3.9654	0.09429	0.0:0.5201:0.1768:0.3032	.	925	P12259	FA5_HUMAN	N	925;930	ENSP00000356771:K925N;ENSP00000356770:K930N	ENSP00000356770:K930N	K	-	3	2	F5	167778177	0.003000	0.15002	0.020000	0.16555	0.105000	0.19272	0.116000	0.15561	0.578000	0.29487	-0.655000	0.03904	AAG		0.473	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
KIFAP3	22920	hgsc.bcm.edu	37	1	169951949	169951949	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:169951949A>C	ENST00000361580.2	-	14	1793	c.1566T>G	c.(1564-1566)atT>atG	p.I522M	KIFAP3_ENST00000367765.1_Missense_Mutation_p.I482M|KIFAP3_ENST00000540905.1_Missense_Mutation_p.I224M|KIFAP3_ENST00000367767.1_Missense_Mutation_p.I478M|KIFAP3_ENST00000538366.1_Missense_Mutation_p.I444M	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	522					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)	p.I522M(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCAAACATTCAATCACAAACT	0.328																																					p.I522M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1566G	1						.						73.0	74.0	74.0					1																	169951949		2203	4300	6503	168218573	SO:0001583	missense	22920	exon14			U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.1566T>G	1.37:g.169951949A>C	ENSP00000354560:p.Ile522Met		168218573	NM_014970	B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Missense_Mutation	SNP	ENST00000361580.2	37	CCDS1288.1	.	.	.	.	.	.	.	.	.	.	A	17.20	3.330159	0.60743	.	.	ENSG00000075945	ENST00000361580;ENST00000367765;ENST00000367767;ENST00000540905;ENST00000538366	T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7	5.49	-0.818	0.10833	Armadillo-like helical (1);Armadillo-type fold (1);	0.097082	0.64402	D	0.000002	T	0.34366	0.0895	L	0.52364	1.645	0.53688	D	0.999978	D	0.54772	0.968	P	0.57620	0.824	T	0.21724	-1.0237	9	.	.	.	-19.0236	5.5763	0.17225	0.4623:0.0:0.3259:0.2117	.	522	Q92845	KIFA3_HUMAN	M	522;482;478;224;444	ENSP00000354560:I522M;ENSP00000356739:I482M;ENSP00000356741:I478M;ENSP00000442712:I224M;ENSP00000444622:I444M	.	I	-	3	3	KIFAP3	168218573	0.358000	0.24947	0.998000	0.56505	0.996000	0.88848	-0.327000	0.07955	-0.072000	0.12864	0.528000	0.53228	ATT		0.328	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1	NM_014970	
TDRD5	163589	hgsc.bcm.edu	37	1	179631313	179631313	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:179631313A>G	ENST00000367614.1	+	14	2594	c.2235A>G	c.(2233-2235)ttA>ttG	p.L745L	TDRD5_ENST00000444136.1_Silent_p.L799L|TDRD5_ENST00000294848.8_Silent_p.L745L	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	745					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)		p.L745L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						AGAACTGGTTACCTCTACAGG	0.433																																					p.L799L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2397G	1						.						159.0	136.0	144.0					1																	179631313		2203	4300	6503	177897936	SO:0001819	synonymous_variant	163589	exon15			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2235A>G	1.37:g.179631313A>G			177897936	NM_001199085	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Silent	SNP	ENST00000367614.1	37	CCDS1332.1																																																																																				0.433	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
TOR1AIP2	163590	hgsc.bcm.edu	37	1	179815683	179815683	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:179815683G>A	ENST00000367612.3	-	6	1323	c.936C>T	c.(934-936)agC>agT	p.S312S	TOR1AIP2_ENST00000609928.1_Silent_p.S312S	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0								p.S312S(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						CAACATGGTGGCTCAGGCACT	0.542																																					p.S312S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C936T	1						.						121.0	107.0	112.0					1																	179815683		2203	4300	6503	178082306	SO:0001819	synonymous_variant	163590	exon6				CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.936C>T	1.37:g.179815683G>A			178082306	NM_145034	Q05BU2	Silent	SNP	ENST00000367612.3	37	CCDS1334.1																																																																																				0.542	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085304.1	NM_145034	
HMCN1	83872	hgsc.bcm.edu	37	1	186094870	186094870	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:186094870T>G	ENST00000271588.4	+	82	12863	c.12634T>G	c.(12634-12636)Ttg>Gtg	p.L4212V	HMCN1_ENST00000367492.2_Missense_Mutation_p.L4212V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4212	Ig-like C2-type 41.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.L4212V(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTTAGCTAACTTGTTAGGAAA	0.378																																					p.L4212V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T12634G	1						.						94.0	94.0	94.0					1																	186094870		2203	4300	6503	184361493	SO:0001583	missense	83872	exon82			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12634T>G	1.37:g.186094870T>G	ENSP00000271588:p.Leu4212Val		184361493	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	T	11.38	1.622917	0.28889	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.72051	-0.62;-0.62	5.04	2.56	0.30785	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.449448	0.24238	N	0.040291	T	0.65709	0.2717	N	0.17248	0.465	0.26436	N	0.975856	D	0.64830	0.994	D	0.79108	0.992	T	0.53344	-0.8452	10	0.30078	T	0.28	.	4.6346	0.12518	0.34:0.0938:0.0:0.5661	.	4212	Q96RW7	HMCN1_HUMAN	V	4212	ENSP00000271588:L4212V;ENSP00000356462:L4212V	ENSP00000271588:L4212V	L	+	1	2	HMCN1	184361493	0.989000	0.36119	0.999000	0.59377	0.987000	0.75469	3.396000	0.52565	0.876000	0.35872	0.528000	0.53228	TTG		0.378	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HMCN1	83872	hgsc.bcm.edu	37	1	186147887	186147887	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:186147887A>C	ENST00000271588.4	+	104	16512	c.16283A>C	c.(16282-16284)gAc>gCc	p.D5428A	HMCN1_ENST00000367492.2_Intron|GS1-174L6.4_ENST00000428391.1_RNA	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5428					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.D5428A(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GCAAGCCATGACACATGTGTA	0.438																																					p.D5428A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A16283C	1						.						90.0	86.0	87.0					1																	186147887		2203	4300	6503	184414510	SO:0001583	missense	83872	exon104			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16283A>C	1.37:g.186147887A>C	ENSP00000271588:p.Asp5428Ala		184414510	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	9.236	1.037095	0.19669	.	.	ENSG00000143341	ENST00000271588	D	0.87029	-2.2	5.77	4.54	0.55810	Growth factor, receptor (1);	0.319686	0.38381	N	0.001705	T	0.81763	0.4891	L	0.55834	1.745	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.75036	-0.3459	10	0.40728	T	0.16	.	6.2887	0.21047	0.7498:0.1506:0.0996:0.0	.	5428	Q96RW7	HMCN1_HUMAN	A	5428	ENSP00000271588:D5428A	ENSP00000271588:D5428A	D	+	2	0	HMCN1	184414510	1.000000	0.71417	0.954000	0.39281	0.996000	0.88848	1.031000	0.30165	0.982000	0.38575	0.533000	0.62120	GAC		0.438	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
RNPEP	6051	hgsc.bcm.edu	37	1	201969050	201969050	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:201969050G>T	ENST00000295640.4	+	6	1154	c.1111G>T	c.(1111-1113)Gag>Tag	p.E371*	RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.4_ENST00000415582.1_RNA|RP11-465N4.4_ENST00000419190.1_RNA|RNPEP_ENST00000367286.3_Nonsense_Mutation_p.E332*	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	371					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		CACCTGCTTGGAGGCTGCAAC	0.557											OREG0014093	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E371X	GBM(19;39 479 7473 13131 19462)											.	.	0			c.G1111T	1						.						80.0	69.0	73.0					1																	201969050		2203	4300	6503	200235673	SO:0001587	stop_gained	6051	exon6			BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.1111G>T	1.37:g.201969050G>T	ENSP00000295640:p.Glu371*	2125	200235673	NM_020216	Q9BVM9|Q9H1D4|Q9NPT7	Nonsense_Mutation	SNP	ENST00000295640.4	37	CCDS1418.1	.	.	.	.	.	.	.	.	.	.	G	37	6.036336	0.97226	.	.	ENSG00000176393	ENST00000295640;ENST00000367286;ENST00000447312	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-30.3491	17.5238	0.87794	0.0:0.0:1.0:0.0	.	.	.	.	X	371;332;240	.	ENSP00000295640:E371X	E	+	1	0	RNPEP	200235673	1.000000	0.71417	0.990000	0.47175	0.952000	0.60782	8.740000	0.91579	2.432000	0.82394	0.491000	0.48974	GAG		0.557	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087345.1	NM_020216	
EIF4G3	8672	hgsc.bcm.edu	37	1	21175924	21175924	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:21175924T>C	ENST00000264211.8	-	23	3898	c.3704A>G	c.(3703-3705)cAc>cGc	p.H1235R	EIF4G3_ENST00000537738.1_Missense_Mutation_p.H725R|EIF4G3_ENST00000374937.3_Missense_Mutation_p.H1241R|EIF4G3_ENST00000536266.1_Missense_Mutation_p.H839R|EIF4G3_ENST00000602326.1_Missense_Mutation_p.H1241R|EIF4G3_ENST00000400422.1_Missense_Mutation_p.H1235R|EIF4G3_ENST00000374935.3_Missense_Mutation_p.H955R	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1235	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.H1241R(1)|p.H1235R(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		ATCATTAATGTGTAGAAATTC	0.348																																					p.H1235R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A3704G	1						.						72.0	67.0	69.0					1																	21175924		2203	4300	6503	21048511	SO:0001583	missense	8672	exon24			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.3704A>G	1.37:g.21175924T>C	ENSP00000264211:p.His1235Arg		21048511	NM_003760	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.374592	0.82573	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58	5.87	5.87	0.94306	Initiation factor eIF-4 gamma, MA3 (3);Armadillo-type fold (1);	0.049712	0.85682	D	0.000000	T	0.50309	0.1608	L	0.46157	1.445	0.80722	D	1	D;P;P;P;D	0.89917	1.0;0.824;0.87;0.738;0.999	D;P;P;B;D	0.87578	0.998;0.574;0.635;0.429;0.981	T	0.48969	-0.8987	10	0.62326	D	0.03	-10.8307	16.27	0.82612	0.0:0.0:0.0:1.0	.	1430;955;839;1241;1235	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	R	1235;1431;1235;955;725;1241;839	ENSP00000264211:H1235R;ENSP00000383274:H1235R;ENSP00000364071:H955R;ENSP00000442010:H725R;ENSP00000364073:H1241R;ENSP00000444693:H839R	ENSP00000264211:H1235R	H	-	2	0	EIF4G3	21048511	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.669000	0.68081	2.248000	0.74166	0.533000	0.62120	CAC		0.348	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
PLEKHA6	22874	hgsc.bcm.edu	37	1	204217949	204217949	+	Splice_Site	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:204217949C>T	ENST00000272203.3	-	12	2140	c.1824G>A	c.(1822-1824)acG>acA	p.T608T	PLEKHA6_ENST00000414478.1_Splice_Site_p.T628T	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	608								p.T608T(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CCTGGGTTACCGTGGTCGCCT	0.587																																					p.T608T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1824A	1						.						70.0	66.0	68.0					1																	204217949		2203	4300	6503	202484572	SO:0001630	splice_region_variant	22874	exon12			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.1824+1G>A	1.37:g.204217949C>T			202484572	NM_014935	A7MD51|Q5VTI6	Silent	SNP	ENST00000272203.3	37	CCDS1444.1																																																																																				0.587	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	Silent
USH2A	7399	hgsc.bcm.edu	37	1	215848824	215848824	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:215848824C>T	ENST00000307340.3	-	63	12815	c.12429G>A	c.(12427-12429)tcG>tcA	p.S4143S	USH2A_ENST00000366943.2_Silent_p.S4143S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4143	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.S4143S(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCTGAGGCGCCGAGTGTGCAC	0.572										HNSCC(13;0.011)																											p.S4143S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G12429A	1						.						45.0	46.0	46.0					1																	215848824		2203	4300	6503	213915447	SO:0001819	synonymous_variant	7399	exon63			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12429G>A	1.37:g.215848824C>T			213915447	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																				0.572	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
RRP15	51018	hgsc.bcm.edu	37	1	218504432	218504432	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:218504432A>G	ENST00000366932.3	+	5	878	c.848A>G	c.(847-849)tAa>tGa	p.*283*		NM_016052.3	NP_057136.2	Q9Y3B9	RRP15_HUMAN	ribosomal RNA processing 15 homolog (S. cerevisiae)	0						mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.*283*(1)	ACBD6/RRP15(2)	NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14				all cancers(67;0.0315)|OV - Ovarian serous cystadenocarcinoma(81;0.0411)|GBM - Glioblastoma multiforme(131;0.06)|Epithelial(68;0.248)		TCTGATACATAAAGCATCATA	0.378																																					p.X283X												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A848G	1						.						58.0	56.0	57.0					1																	218504432		2203	4300	6503	216571055	SO:0001819	synonymous_variant	51018	exon5				CCDS1520.2	1q41	2008-02-05			ENSG00000067533	ENSG00000067533			24255	protein-coding gene	gene with protein product		611193	"""KIAA0507"""	KIAA0507		15769876	Standard	NM_016052		Approved	CGI-115	uc001hlj.3	Q9Y3B9	OTTHUMG00000039494	ENST00000366932.3:c.848A>G	1.37:g.218504432A>G			216571055	NM_016052		Silent	SNP	ENST00000366932.3	37	CCDS1520.2																																																																																				0.378	RRP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095284.1	NM_016052	
PARP1	142	hgsc.bcm.edu	37	1	226564878	226564878	+	Silent	SNP	G	G	A	rs147221209	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:226564878G>A	ENST00000366794.5	-	13	2015	c.1872C>T	c.(1870-1872)aaC>aaT	p.N624N		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	624					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.N624N(1)		breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		AGTGCCAAGCGTTCCCGGTTT	0.463								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.N624N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1872T	1						.	G		4,4402	9.9+/-24.2	0,4,2199	201.0	211.0	207.0		1872	-7.3	0.8	1	dbSNP_134	207	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	PARP1	NM_001618.3		0,8,6495	AA,AG,GG		0.0465,0.0908,0.0615		624/1015	226564878	8,12998	2203	4300	6503	224631501	SO:0001819	synonymous_variant	142	exon13			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1872C>T	1.37:g.226564878G>A			224631501	NM_001618	B1ANJ4|Q8IUZ9	Silent	SNP	ENST00000366794.5	37	CCDS1554.1																																																																																				0.463	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
LYST	1130	hgsc.bcm.edu	37	1	235887410	235887410	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:235887410C>T	ENST00000389794.3	-	39	9407	c.9233G>A	c.(9232-9234)cGt>cAt	p.R3078H	LYST_ENST00000473037.1_5'UTR|LYST_ENST00000389793.2_Missense_Mutation_p.R3078H			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3078					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.R3078H(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTGCCACCAACGCTTGTGAAC	0.373																																					p.R3078H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9233A	1						.						105.0	103.0	104.0					1																	235887410		2203	4300	6503	233954033	SO:0001583	missense	1130	exon39			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.9233G>A	1.37:g.235887410C>T	ENSP00000374444:p.Arg3078His		233954033	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	C	34	5.360700	0.95877	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.73363	-0.74;-0.74	5.53	5.53	0.82687	PH-BEACH domain (1);	0.000000	0.85682	D	0.000000	D	0.88340	0.6410	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89666	0.3880	10	0.87932	D	0	.	19.4728	0.94969	0.0:1.0:0.0:0.0	.	3078	Q99698	LYST_HUMAN	H	3078	ENSP00000374444:R3078H;ENSP00000374443:R3078H	ENSP00000374443:R3078H	R	-	2	0	LYST	233954033	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.818000	0.86416	2.602000	0.87976	0.467000	0.42956	CGT		0.373	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
CAMTA1	23261	hgsc.bcm.edu	37	1	7721822	7721822	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:7721822G>A	ENST00000303635.7	+	8	908	c.701G>A	c.(700-702)aGc>aAc	p.S234N	CAMTA1_ENST00000439411.2_Missense_Mutation_p.S234N	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S234N(1)		breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		AATGGGAACAGCAGCTCAGGC	0.652			T	WWTR1	epitheliod hemangioendothelioma																																p.S234N			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G701A	1						.						75.0	69.0	71.0					1																	7721822		2203	4300	6503	7644409	SO:0001583	missense	23261	exon8			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.701G>A	1.37:g.7721822G>A	ENSP00000306522:p.Ser234Asn		7644409	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	g	19.97	3.925187	0.73213	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.21543	2.0;2.0	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.11750	0.0286	N	0.08118	0	0.54753	D	0.999985	P	0.36282	0.546	B	0.34722	0.188	T	0.19811	-1.0294	10	0.15066	T	0.55	-20.7759	17.8642	0.88791	0.0:0.0:1.0:0.0	.	234	Q9Y6Y1	CMTA1_HUMAN	N	234	ENSP00000306522:S234N;ENSP00000402561:S234N	ENSP00000306522:S234N	S	+	2	0	CAMTA1	7644409	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.572000	0.98179	2.305000	0.77605	0.543000	0.68304	AGC		0.652	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
ARID1A	8289	hgsc.bcm.edu	37	1	27105866	27105866	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:27105866A>G	ENST00000324856.7	+	20	5848	c.5477A>G	c.(5476-5478)gAc>gGc	p.D1826G	ARID1A_ENST00000457599.2_Missense_Mutation_p.D1609G|ARID1A_ENST00000540690.1_Missense_Mutation_p.D154G|ARID1A_ENST00000374152.2_Missense_Mutation_p.D1443G	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1826					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.D1826G(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TTTGTGGTGGACTGCTCAGAT	0.507			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.D1826G			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5477G	1						.						93.0	78.0	83.0					1																	27105866		2203	4300	6503	26978453	SO:0001583	missense	8289	exon20			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5477A>G	1.37:g.27105866A>G	ENSP00000320485:p.Asp1826Gly		26978453	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.981380	0.34942	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	T;T;T;T	0.13778	4.18;3.99;3.98;2.56	4.74	4.74	0.60224	.	0.204155	0.51477	D	0.000085	T	0.15522	0.0374	L	0.51914	1.62	0.50313	D	0.999864	B;B;B	0.18013	0.002;0.002;0.025	B;B;B	0.18561	0.003;0.004;0.022	T	0.02567	-1.1140	10	0.42905	T	0.14	-15.5186	14.685	0.69042	1.0:0.0:0.0:0.0	.	1443;1826;1609	O14497-3;O14497;O14497-2	.;ARI1A_HUMAN;.	G	1826;1609;1443;154	ENSP00000320485:D1826G;ENSP00000387636:D1609G;ENSP00000363267:D1443G;ENSP00000442437:D154G	ENSP00000320485:D1826G	D	+	2	0	ARID1A	26978453	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.346000	0.59367	2.117000	0.64856	0.402000	0.26972	GAC		0.507	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
TMEM222	84065	hgsc.bcm.edu	37	1	27661878	27661878	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:27661878C>G	ENST00000374076.4	+	6	586	c.548C>G	c.(547-549)gCc>gGc	p.A183G	TMEM222_ENST00000608611.1_Missense_Mutation_p.A150G	NM_032125.2	NP_115501.2	Q9H0R3	TM222_HUMAN	transmembrane protein 222	183						integral component of membrane (GO:0016021)		p.A183G(1)		biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						AGCGTTGGGGCCTTCGTGAAG	0.632																																					p.A183G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C548G	1						.						225.0	159.0	182.0					1																	27661878		2203	4300	6503	27534465	SO:0001583	missense	84065	exon6			AL136683	CCDS297.2	1p36.11	2008-07-07	2008-07-07	2008-07-07	ENSG00000186501	ENSG00000186501			25363	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 160"""	C1orf160		11230166	Standard	NM_032125		Approved	DKFZP564D0478	uc001bnr.4	Q9H0R3	OTTHUMG00000004410	ENST00000374076.4:c.548C>G	1.37:g.27661878C>G	ENSP00000363189:p.Ala183Gly		27534465	NM_032125	D3DPL6|Q53HD8|Q5FVE9	Missense_Mutation	SNP	ENST00000374076.4	37	CCDS297.2	.	.	.	.	.	.	.	.	.	.	C	3.795	-0.042911	0.07452	.	.	ENSG00000186501	ENST00000374076;ENST00000374073;ENST00000498220	.	.	.	5.63	5.63	0.86233	.	0.233433	0.42821	D	0.000660	T	0.24586	0.0596	N	0.02169	-0.655	0.50313	D	0.999862	B	0.12013	0.005	B	0.10450	0.005	T	0.27331	-1.0077	9	0.02654	T	1	-31.5811	15.8515	0.78934	0.0:0.8277:0.1723:0.0	.	183	Q9H0R3	TM222_HUMAN	G	183;175;174	.	ENSP00000363186:A175G	A	+	2	0	TMEM222	27534465	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	3.641000	0.54360	2.815000	0.96918	0.561000	0.74099	GCC		0.632	TMEM222-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000012809.2	NM_032125	
ZMYM6	9204	hgsc.bcm.edu	37	1	35485149	35485149	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:35485149A>G	ENST00000357182.4	-	4	460	c.233T>C	c.(232-234)gTg>gCg	p.V78A	ZMYM6_ENST00000487874.1_Missense_Mutation_p.V78A|ZMYM6_ENST00000373333.1_Missense_Mutation_p.V78A|ZMYM6_ENST00000493328.1_Intron|ZMYM6_ENST00000317538.5_Missense_Mutation_p.V78A|ZMYM6_ENST00000373340.2_Missense_Mutation_p.V78A	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	78					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V78A(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				AGGAAGCAACACACTTGGGCC	0.368																																					p.V78A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T233C	1						.						67.0	66.0	66.0					1																	35485149		2203	4300	6503	35257736	SO:0001583	missense	9204	exon4			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.233T>C	1.37:g.35485149A>G	ENSP00000349708:p.Val78Ala		35257736	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	ENST00000357182.4	37	CCDS387.2	.	.	.	.	.	.	.	.	.	.	A	1.789	-0.479901	0.04383	.	.	ENSG00000163867	ENST00000373340;ENST00000357182;ENST00000415531;ENST00000317538;ENST00000373333	T;T;T;T;T	0.41065	2.04;3.22;1.62;1.01;1.01	5.15	-4.08	0.03963	.	1.724340	0.02659	N	0.107250	T	0.28234	0.0697	L	0.36672	1.1	0.09310	N	1	B;B;B	0.11235	0.001;0.004;0.001	B;B;B	0.12156	0.001;0.007;0.007	T	0.08889	-1.0700	10	0.28530	T	0.3	1.4883	2.3511	0.04283	0.2395:0.1122:0.4186:0.2297	.	78;78;78	O95789-4;O95789;O95789-1	.;ZMYM6_HUMAN;.	A	78	ENSP00000362437:V78A;ENSP00000349708:V78A;ENSP00000391337:V78A;ENSP00000326695:V78A;ENSP00000362430:V78A	ENSP00000326695:V78A	V	-	2	0	ZMYM6	35257736	0.002000	0.14202	0.000000	0.03702	0.008000	0.06430	0.304000	0.19228	-0.438000	0.07232	-0.334000	0.08254	GTG		0.368	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
CLSPN	63967	hgsc.bcm.edu	37	1	36230900	36230900	+	Missense_Mutation	SNP	C	C	T	rs149493561	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:36230900C>T	ENST00000318121.3	-	2	109	c.52G>A	c.(52-54)Gtc>Atc	p.V18I	CLSPN_ENST00000373220.3_Missense_Mutation_p.V18I|CLSPN_ENST00000520551.1_Missense_Mutation_p.V18I|CLSPN_ENST00000251195.5_Missense_Mutation_p.V18I	NM_022111.3	NP_071394.2	Q9HAW4	CLSPN_HUMAN	claspin	18					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|mitotic DNA replication checkpoint (GO:0033314)|peptidyl-serine phosphorylation (GO:0018105)	nucleoplasm (GO:0005654)	anaphase-promoting complex binding (GO:0010997)|DNA binding (GO:0003677)	p.V18I(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TGTGAAATGACGTTTGGGTCA	0.393													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19762	0.0		0.0	False		,,,				2504	0.0				p.V18I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G52A	1						.	C	ILE/VAL,ILE/VAL	3,4403	6.2+/-15.9	0,3,2200	143.0	130.0	134.0		52,52	-0.7	0.0	1	dbSNP_134	134	0,8600		0,0,4300	no	missense,missense	CLSPN	NM_001190481.1,NM_022111.3	29,29	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign,benign	18/1276,18/1340	36230900	3,13003	2203	4300	6503	36003487	SO:0001583	missense	63967	exon2			AF297866	CCDS396.1, CCDS53297.1	1p34.3	2010-06-24	2010-06-24		ENSG00000092853	ENSG00000092853			19715	protein-coding gene	gene with protein product		605434	"""claspin homolog (Xenopus laevis)"""			11090622, 12766152	Standard	NM_022111		Approved		uc001bzi.3	Q9HAW4	OTTHUMG00000004168	ENST00000318121.3:c.52G>A	1.37:g.36230900C>T	ENSP00000312995:p.Val18Ile		36003487	NM_001190481	A6NFL4|Q1RMC6|Q2KHM3|Q5VYG0|Q6P6H5|Q8IWI1	Missense_Mutation	SNP	ENST00000318121.3	37	CCDS396.1	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.473650	0.01044	6.81E-4	0.0	ENSG00000092853	ENST00000251195;ENST00000318121;ENST00000373220;ENST00000520551;ENST00000544356	T;T;T;T	0.23950	1.9;1.91;1.88;1.89	5.92	-0.7	0.11273	.	0.516425	0.18645	N	0.135164	T	0.08582	0.0213	N	0.08118	0	0.09310	N	1	B;B	0.19706	0.003;0.038	B;B	0.11329	0.003;0.006	T	0.22765	-1.0207	10	0.20046	T	0.44	-0.6764	1.9713	0.03406	0.1508:0.2569:0.3696:0.2227	.	18;18	Q9HAW4-2;Q9HAW4	.;CLSPN_HUMAN	I	18	ENSP00000251195:V18I;ENSP00000312995:V18I;ENSP00000362317:V18I;ENSP00000428848:V18I	ENSP00000251195:V18I	V	-	1	0	CLSPN	36003487	0.204000	0.23447	0.020000	0.16555	0.187000	0.23431	0.080000	0.14802	0.117000	0.18138	-0.136000	0.14681	GTC		0.393	CLSPN-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377857.1	NM_022111	
GRIK3	2899	hgsc.bcm.edu	37	1	37270737	37270737	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:37270737G>A	ENST00000373091.3	-	15	2432	c.2416C>T	c.(2416-2418)Cct>Tct	p.P806S	GRIK3_ENST00000373093.4_Missense_Mutation_p.P806S	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	806					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.P806S(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				TCCTCCTCAGGACACCCGCTG	0.607																																					p.P806S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2416T	1						.						64.0	67.0	66.0					1																	37270737		2203	4300	6503	37043324	SO:0001583	missense	2899	exon15			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2416C>T	1.37:g.37270737G>A	ENSP00000362183:p.Pro806Ser		37043324	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.370649	0.24771	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.50277	0.75;0.75	4.59	3.68	0.42216	Ionotropic glutamate receptor (1);	0.078950	0.53938	D	0.000051	T	0.36026	0.0952	L	0.28740	0.885	0.38105	D	0.937385	P;P	0.36753	0.568;0.568	B;B	0.38842	0.283;0.283	T	0.18116	-1.0347	10	0.22109	T	0.4	.	12.54	0.56163	0.0815:0.0:0.9185:0.0	.	806;806	A9Z1Z8;Q13003	.;GRIK3_HUMAN	S	806	ENSP00000362183:P806S;ENSP00000362185:P806S	ENSP00000362183:P806S	P	-	1	0	GRIK3	37043324	1.000000	0.71417	0.467000	0.27180	0.884000	0.51177	5.523000	0.67099	0.916000	0.36871	0.551000	0.68910	CCT		0.607	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
GRIK3	2899	hgsc.bcm.edu	37	1	37282758	37282758	+	Missense_Mutation	SNP	C	C	T	rs569239695		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:37282758C>T	ENST00000373091.3	-	13	2010	c.1994G>A	c.(1993-1995)cGc>cAc	p.R665H	GRIK3_ENST00000373093.4_Missense_Mutation_p.R665H	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	665					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.R665H(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				TGATTCCATGCGCTCCACGGT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		21339	0.0		0.001	False		,,,				2504	0.0				p.R665H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1994A	1						.						163.0	134.0	144.0					1																	37282758		2203	4300	6503	37055345	SO:0001583	missense	2899	exon13			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1994G>A	1.37:g.37282758C>T	ENSP00000362183:p.Arg665His		37055345	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	35	5.450572	0.96205	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.57907	0.37;0.37	5.74	5.74	0.90152	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.80670	0.4667	M	0.92367	3.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84639	0.0694	10	0.87932	D	0	.	19.9326	0.97124	0.0:1.0:0.0:0.0	.	665;665	A9Z1Z8;Q13003	.;GRIK3_HUMAN	H	665	ENSP00000362183:R665H;ENSP00000362185:R665H	ENSP00000362183:R665H	R	-	2	0	GRIK3	37055345	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.070000	0.71220	2.720000	0.93068	0.650000	0.86243	CGC		0.547	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
FHL3	2275	hgsc.bcm.edu	37	1	38465011	38465011	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:38465011C>T	ENST00000373016.3	-	2	242	c.74G>A	c.(73-75)gGc>gAc	p.G25D	FHL3_ENST00000485803.1_Intron	NM_001243878.1|NM_004468.4	NP_001230807.1|NP_004459.2	Q13643	FHL3_HUMAN	four and a half LIM domains 3	25					actin cytoskeleton organization (GO:0030036)|muscle organ development (GO:0007517)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)|Z disc (GO:0030018)	zinc ion binding (GO:0008270)	p.G25D(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ACAGTAGGGGCCGCTGTCTGT	0.552																																					p.G25D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G74A	1						.						113.0	99.0	104.0					1																	38465011		2203	4300	6503	38237598	SO:0001583	missense	2275	exon2			BC011697	CCDS30678.1	1p34.3	2008-02-05			ENSG00000183386	ENSG00000183386			3704	protein-coding gene	gene with protein product		602790				8753811, 10226657	Standard	NM_004468		Approved	SLIM2	uc001cck.3	Q13643	OTTHUMG00000004434	ENST00000373016.3:c.74G>A	1.37:g.38465011C>T	ENSP00000362107:p.Gly25Asp		38237598	NM_004468	D3DPT6|Q6I9T0|Q9BVA2	Missense_Mutation	SNP	ENST00000373016.3	37	CCDS30678.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.786639	0.49997	.	.	ENSG00000183386	ENST00000373016	D	0.86627	-2.15	5.77	5.77	0.91146	Zinc finger, LIM-type (1);	0.096442	0.64402	D	0.000001	D	0.83303	0.5225	L	0.45581	1.43	0.58432	D	0.999999	P;P	0.37423	0.594;0.483	B;B	0.33454	0.164;0.084	T	0.80547	-0.1334	10	0.20046	T	0.44	.	19.9961	0.97386	0.0:1.0:0.0:0.0	.	25;25	Q9P100;Q13643	.;FHL3_HUMAN	D	25	ENSP00000362107:G25D	ENSP00000362107:G25D	G	-	2	0	FHL3	38237598	1.000000	0.71417	0.839000	0.33178	0.990000	0.78478	3.563000	0.53784	2.744000	0.94065	0.561000	0.74099	GGC		0.552	FHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012958.1	NM_004468	
MACF1	23499	hgsc.bcm.edu	37	1	39898252	39898252	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:39898252A>G	ENST00000372915.3	+	65	17158	c.17071A>G	c.(17071-17073)Aaa>Gaa	p.K5691E	MACF1_ENST00000564288.1_Missense_Mutation_p.K5795E|MACF1_ENST00000289893.4_Missense_Mutation_p.K4235E|MACF1_ENST00000539005.1_Missense_Mutation_p.K3603E|MACF1_ENST00000567887.1_Missense_Mutation_p.K5832E|MACF1_ENST00000361689.2_Missense_Mutation_p.K3733E|MACF1_ENST00000317713.7_Missense_Mutation_p.K3733E|MACF1_ENST00000545844.1_Missense_Mutation_p.K3733E			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5691					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.K4235E(1)|p.K3733E(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGCTGAAACAAAACGGAAACT	0.453																																					p.K3733E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A11197G	1						.						79.0	78.0	78.0					1																	39898252		2203	4300	6503	39670839	SO:0001583	missense	23499	exon63			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.17071A>G	1.37:g.39898252A>G	ENSP00000362006:p.Lys5691Glu		39670839	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.557|8.557	0.876909|0.876909	0.17395|0.17395	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.57907|.	1.89;0.37;1.89;1.29;1.89;1.89|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.000000|0.000000	0.64402|0.64402	D|D	0.000006|0.000006	T|T	0.46756|0.46756	0.1409|0.1409	N|N	0.10782|0.10782	0.045|0.045	0.80722|0.80722	D|D	1|1	B;B;B|.	0.32573|.	0.376;0.137;0.024|.	B;B;B|.	0.41088|.	0.347;0.076;0.012|.	T|T	0.44922|0.44922	-0.9296|-0.9296	10|6	0.02654|.	T|.	1|.	.|.	16.8061|16.8061	0.85666|0.85666	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	5691;3733;3677|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	E|R	3733;5691;3733;3733;3603;4235|2736	ENSP00000439537:K3733E;ENSP00000362006:K5691E;ENSP00000354573:K3733E;ENSP00000313438:K3733E;ENSP00000444364:K3603E;ENSP00000289893:K4235E|.	ENSP00000289893:K4235E|.	K|K	+|+	1|2	0|0	MACF1|MACF1	39670839|39670839	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.376000|4.376000	0.59556|0.59556	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	AAA|AAA		0.453	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
IPO13	9670	hgsc.bcm.edu	37	1	44424161	44424161	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:44424161C>T	ENST00000372343.3	+	10	2440	c.1778C>T	c.(1777-1779)gCg>gTg	p.A593V		NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	593					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A593V(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				CTGATGCAGGCGCTGGGCTTC	0.537																																					p.A593V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1778T	1						.						81.0	84.0	83.0					1																	44424161		2203	4300	6503	44196748	SO:0001583	missense	9670	exon10			AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.1778C>T	1.37:g.44424161C>T	ENSP00000361418:p.Ala593Val		44196748	NM_014652	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Missense_Mutation	SNP	ENST00000372343.3	37	CCDS503.1	.	.	.	.	.	.	.	.	.	.	C	35	5.495157	0.96339	.	.	ENSG00000117408	ENST00000372343	T	0.70749	-0.51	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64571	0.2610	L	0.44542	1.39	0.80722	D	1	P	0.42203	0.773	B	0.33960	0.173	T	0.70238	-0.4927	10	0.87932	D	0	-16.7637	20.0817	0.97778	0.0:1.0:0.0:0.0	.	593	O94829	IPO13_HUMAN	V	593	ENSP00000361418:A593V	ENSP00000361418:A593V	A	+	2	0	IPO13	44196748	1.000000	0.71417	0.973000	0.42090	0.984000	0.73092	7.385000	0.79763	2.743000	0.94032	0.650000	0.86243	GCG		0.537	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022846.1	NM_014652	
ORC1	4998	hgsc.bcm.edu	37	1	52847347	52847347	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:52847347A>G	ENST00000371568.3	-	14	2318	c.2100T>C	c.(2098-2100)ttT>ttC	p.F700F	ORC1_ENST00000371566.1_Silent_p.F700F	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	700	Necessary and sufficient for ORC complex assembly.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CATCATCTTCAAAGGCCTTTA	0.522																																					p.F700F												.	.	0			c.T2100C	1						.						103.0	92.0	96.0					1																	52847347		2203	4300	6503	52619935	SO:0001819	synonymous_variant	4998	exon14				CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.2100T>C	1.37:g.52847347A>G			52619935	NM_001190818	D3DQ34|Q13471|Q5T0F5	Silent	SNP	ENST00000371568.3	37	CCDS566.1																																																																																				0.522	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1	NM_004153	
ECHDC2	55268	hgsc.bcm.edu	37	1	53362251	53362251	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:53362251G>A	ENST00000371522.4	-	10	913	c.820C>T	c.(820-822)Cgg>Tgg	p.R274W	ECHDC2_ENST00000358358.5_Missense_Mutation_p.R243W|ECHDC2_ENST00000536120.1_Missense_Mutation_p.R228W	NM_001198961.1	NP_001185890.1	Q86YB7	ECHD2_HUMAN	enoyl CoA hydratase domain containing 2	274					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	lyase activity (GO:0016829)	p.R243W(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	12						CCCTCTAGCCGGTCCCGGGTT	0.512																																					p.R226W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C676T	1						.						50.0	54.0	53.0					1																	53362251		2203	4300	6503	53134839	SO:0001583	missense	55268	exon8			AF258590	CCDS571.1, CCDS55600.1, CCDS72794.1	1p32.3	2010-04-30	2010-04-30		ENSG00000121310	ENSG00000121310			23408	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 2"""				Standard	NM_018281		Approved	FLJ10948	uc001cup.4	Q86YB7	OTTHUMG00000008927	ENST00000371522.4:c.820C>T	1.37:g.53362251G>A	ENSP00000360577:p.Arg274Trp		53134839	NM_001198962	D3DQ36|Q9NV38	Missense_Mutation	SNP	ENST00000371522.4	37	CCDS55600.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534706	0.64972	.	.	ENSG00000121310	ENST00000371522;ENST00000358358;ENST00000536120	T;T;T	0.68331	-0.32;-0.32;-0.32	5.26	2.2	0.27929	Crontonase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81230	0.4779	M	0.89163	3.01	0.80722	D	1	D;D	0.89917	1.0;0.981	D;P	0.78314	0.991;0.548	T	0.81662	-0.0831	10	0.87932	D	0	.	8.6256	0.33888	0.0738:0.0:0.6586:0.2676	.	274;243	Q86YB7;Q86YB7-2	ECHD2_HUMAN;.	W	274;243;228	ENSP00000360577:R274W;ENSP00000351125:R243W;ENSP00000439264:R228W	ENSP00000351125:R243W	R	-	1	2	ECHDC2	53134839	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	2.190000	0.42630	0.768000	0.33290	0.655000	0.94253	CGG		0.512	ECHDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024712.3	NM_018281	
LRRC8C	84230	hgsc.bcm.edu	37	1	90179905	90179905	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:90179905A>G	ENST00000370454.4	+	3	2031	c.1776A>G	c.(1774-1776)acA>acG	p.T592T	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	592					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.T592T(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CCAATCTGACAGAGCTGGAGC	0.473																																					p.T592T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1776G	1						.						65.0	62.0	63.0					1																	90179905		2203	4300	6503	89952493	SO:0001819	synonymous_variant	84230	exon3				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1776A>G	1.37:g.90179905A>G			89952493	NM_032270	B3KXS9|Q29RV6|Q9H075	Silent	SNP	ENST00000370454.4	37	CCDS725.1																																																																																				0.473	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
OR2L2	26246	hgsc.bcm.edu	37	1	248201886	248201886	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr1:248201886T>C	ENST00000366479.2	+	1	413	c.317T>C	c.(316-318)tTa>tCa	p.L106S	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L106S(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TTCTTGACTTTAGCAGTTGCA	0.428																																					p.L106S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T317C	1						.						129.0	122.0	124.0					1																	248201886		2203	4300	6503	246268509	SO:0001583	missense	26246	exon1			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.317T>C	1.37:g.248201886T>C	ENSP00000355435:p.Leu106Ser		246268509	NM_001004686	Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	37	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	12.70	2.016221	0.35606	.	.	ENSG00000203663	ENST00000366479	T	0.02472	4.28	1.9	1.9	0.25705	GPCR, rhodopsin-like superfamily (1);	0.495622	0.13079	U	0.415430	T	0.06005	0.0156	L	0.41027	1.25	0.09310	N	1	P	0.49862	0.929	P	0.57468	0.821	T	0.34153	-0.9840	10	0.87932	D	0	.	4.963	0.14076	0.0:0.1559:0.0:0.8441	.	106	Q8NH16	OR2L2_HUMAN	S	106	ENSP00000355435:L106S	ENSP00000355435:L106S	L	+	2	0	OR2L2	246268509	0.000000	0.05858	0.956000	0.39512	0.251000	0.25915	0.041000	0.13927	0.746000	0.32786	0.163000	0.16589	TTA		0.428	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686	
TRPC6	7225	hgsc.bcm.edu	37	11	101347073	101347073	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:101347073G>A	ENST00000344327.3	-	6	2127	c.1703C>T	c.(1702-1704)aCg>aTg	p.T568M	TRPC6_ENST00000532133.1_Intron|TRPC6_ENST00000348423.4_Missense_Mutation_p.T452M|TRPC6_ENST00000360497.4_Missense_Mutation_p.T513M	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	568					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.T568M(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TGTTACTTTCGTCAAGTCCTT	0.368																																					p.T568M	Colon(166;1315 1927 11094 12848 34731)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1703T	11						.						97.0	84.0	88.0					11																	101347073		2203	4299	6502	100852283	SO:0001583	missense	7225	exon6			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1703C>T	11.37:g.101347073G>A	ENSP00000340913:p.Thr568Met		100852283	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.498650	0.85069	.	.	ENSG00000137672	ENST00000344327;ENST00000348423;ENST00000360497	T;T;T	0.79845	-1.15;-1.06;-1.31	5.67	5.67	0.87782	Ion transport (1);	0.211174	0.49305	D	0.000152	T	0.81029	0.4738	N	0.19112	0.55	0.53688	D	0.999971	D;D;D	0.71674	0.995;0.998;0.993	P;P;P	0.56042	0.686;0.729;0.79	T	0.82758	-0.0299	10	0.59425	D	0.04	-12.4108	20.1403	0.98057	0.0:0.0:1.0:0.0	.	513;452;568	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	M	568;452;513	ENSP00000340913:T568M;ENSP00000343672:T452M;ENSP00000353687:T513M	ENSP00000340913:T568M	T	-	2	0	TRPC6	100852283	0.999000	0.42202	0.997000	0.53966	0.895000	0.52256	5.600000	0.67599	2.831000	0.97527	0.643000	0.83706	ACG		0.368	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
FAM160A2	84067	hgsc.bcm.edu	37	11	6239987	6239987	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:6239987A>G	ENST00000449352.2	-	8	1541	c.1278T>C	c.(1276-1278)ctT>ctC	p.L426L	FAM160A2_ENST00000265978.4_Silent_p.L426L|FAM160A2_ENST00000524416.1_Silent_p.L426L			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	426					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)		p.L426L(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TACATGGAACAAGATACCTGA	0.502																																					p.L426L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1278C	11						.						119.0	105.0	109.0					11																	6239987		2201	4296	6497	6196563	SO:0001819	synonymous_variant	84067	exon8				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.1278T>C	11.37:g.6239987A>G			6196563	NM_032127	Q9C0A4|Q9H0N3|Q9H624	Silent	SNP	ENST00000449352.2	37	CCDS44530.1																																																																																				0.502	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1	NM_032127	
TPP1	1200	hgsc.bcm.edu	37	11	6638228	6638228	+	Missense_Mutation	SNP	T	T	A	rs372787642		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:6638228T>A	ENST00000299427.6	-	6	725	c.665A>T	c.(664-666)aAt>aTt	p.N222I	TPP1_ENST00000533371.1_5'UTR|TPP1_ENST00000534644.1_5'Flank|RP11-732A19.9_ENST00000545572.1_RNA	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)	p.N222I(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	TTGGCTGTTATTGCTGGTGCC	0.582																																					p.N222I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A665T	11						.						118.0	100.0	106.0					11																	6638228		2201	4296	6497	6594804	SO:0001583	missense	1200	exon6			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.665A>T	11.37:g.6638228T>A	ENSP00000299427:p.Asn222Ile		6594804	NM_000391	Q71V64	Missense_Mutation	SNP	ENST00000299427.6	37	CCDS7770.1	.	.	.	.	.	.	.	.	.	.	T	18.65	3.669430	0.67814	.	.	ENSG00000166340	ENST00000299427	D	0.99129	-5.46	4.07	4.07	0.47477	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.048570	0.85682	D	0.000000	D	0.99058	0.9677	M	0.80422	2.495	0.80722	D	1	D	0.63880	0.993	D	0.68039	0.955	D	0.99236	1.0883	10	0.62326	D	0.03	-21.1313	12.0091	0.53276	0.0:0.0:0.0:1.0	.	222	O14773	TPP1_HUMAN	I	222	ENSP00000299427:N222I	ENSP00000299427:N222I	N	-	2	0	TPP1	6594804	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.348000	0.73009	1.715000	0.51383	0.377000	0.23210	AAT		0.582	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257261.2		
ST5	6764	hgsc.bcm.edu	37	11	8739297	8739297	+	Silent	SNP	C	C	T	rs142007803	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:8739297C>T	ENST00000534127.1	-	8	2005	c.1620G>A	c.(1618-1620)ccG>ccA	p.P540P	ST5_ENST00000526757.1_Silent_p.P120P|ST5_ENST00000313726.6_Silent_p.P540P|ST5_ENST00000530991.1_Silent_p.P12P|ST5_ENST00000530438.1_Silent_p.P120P|ST5_ENST00000526099.1_Silent_p.P53P|ST5_ENST00000357665.1_Silent_p.P540P	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	540					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.P540P(1)		NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CCTGTGTGGGCGGGCTGTTGT	0.577													C|||	4	0.000798722	0.0008	0.0	5008	,	,		15478	0.001		0.0	False		,,,				2504	0.002				p.P540P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1620A	11						.	C	,,	0,4402		0,0,2201	154.0	115.0	128.0		1620,360,1620	-4.6	0.8	11	dbSNP_134	128	2,8590	2.2+/-6.3	0,2,4294	no	coding-synonymous,coding-synonymous,coding-synonymous	ST5	NM_005418.3,NM_139157.2,NM_213618.1	,,	0,2,6495	TT,TC,CC		0.0233,0.0,0.0154	,,	540/1138,120/718,540/1138	8739297	2,12992	2201	4296	6497	8695873	SO:0001819	synonymous_variant	6764	exon8			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.1620G>A	11.37:g.8739297C>T			8695873	NM_005418	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Silent	SNP	ENST00000534127.1	37	CCDS7791.1																																																																																				0.577	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386518.1	NM_005418	
MYOD1	4654	hgsc.bcm.edu	37	11	17741434	17741434	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:17741434C>T	ENST00000250003.3	+	1	320	c.105C>T	c.(103-105)ttC>ttT	p.F35F		NM_002478.4	NP_002469.2	P15172	MYOD1_HUMAN	myogenic differentiation 1	35					cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to oxygen levels (GO:0071453)|cellular response to starvation (GO:0009267)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|myoblast fate determination (GO:0007518)|myotube cell development (GO:0014904)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|transcription from RNA polymerase II promoter (GO:0006366)	myofibril (GO:0030016)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription coactivator activity (GO:0003713)	p.F35F(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	17						ACCCGTGTTTCGACTCCCCGG	0.657																																					p.F35F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C105T	11						.						52.0	55.0	54.0					11																	17741434		2200	4293	6493	17698010	SO:0001819	synonymous_variant	4654	exon1			AF027148	CCDS7826.1	11p15	2013-05-21	2005-09-12			ENSG00000129152		"""Basic helix-loop-helix proteins"""	7611	protein-coding gene	gene with protein product	"""myoblast determination protein 1"""	159970	"""myogenic factor 3"""	MYF3			Standard	NM_002478		Approved	PUM, MYOD, bHLHc1	uc001mni.3	P15172		ENST00000250003.3:c.105C>T	11.37:g.17741434C>T			17698010	NM_002478	O75321	Silent	SNP	ENST00000250003.3	37	CCDS7826.1																																																																																				0.657	MYOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389387.1	NM_002478	
KCNC1	3746	hgsc.bcm.edu	37	11	17757725	17757725	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:17757725G>A	ENST00000379472.3	+	1	206	c.176G>A	c.(175-177)cGc>cAc	p.R59H	KCNC1_ENST00000265969.6_Missense_Mutation_p.R59H	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	59					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)	p.R59H(1)		breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	TTCTTCGACCGCCACCCCGGC	0.697																																					p.R59H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G176A	11						.						51.0	44.0	47.0					11																	17757725		2200	4293	6493	17714301	SO:0001583	missense	3746	exon1			M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.176G>A	11.37:g.17757725G>A	ENSP00000368785:p.Arg59His		17714301	NM_004976	K4DI87	Missense_Mutation	SNP	ENST00000379472.3	37	CCDS7827.1	.	.	.	.	.	.	.	.	.	.	G	33	5.260484	0.95368	.	.	ENSG00000129159	ENST00000265969;ENST00000379472	D;D	0.90261	-2.64;-2.64	5.03	5.03	0.67393	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.113950	0.64402	D	0.000008	D	0.97470	0.9172	H	0.98388	4.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99445	1.0939	10	0.87932	D	0	.	18.3563	0.90358	0.0:0.0:1.0:0.0	.	59;59	Q3KNS8;P48547	.;KCNC1_HUMAN	H	59	ENSP00000265969:R59H;ENSP00000368785:R59H	ENSP00000265969:R59H	R	+	2	0	KCNC1	17714301	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.327000	0.79052	0.491000	0.48974	CGC		0.697	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	NM_004976	
SLC6A5	9152	hgsc.bcm.edu	37	11	20660032	20660032	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:20660032G>A	ENST00000525748.1	+	13	2170	c.1897G>A	c.(1897-1899)Gac>Aac	p.D633N	SLC6A5_ENST00000528440.1_3'UTR	NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	633					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)	p.D633N(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	TCAGCTTGTGGACACCTATGC	0.468																																					p.D633N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1897A	11						.						402.0	310.0	341.0					11																	20660032		2203	4300	6503	20616608	SO:0001583	missense	9152	exon13			AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.1897G>A	11.37:g.20660032G>A	ENSP00000434364:p.Asp633Asn		20616608	NM_004211	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	37	CCDS7854.1	.	.	.	.	.	.	.	.	.	.	G	35	5.546229	0.96488	.	.	ENSG00000165970	ENST00000525748	D	0.81739	-1.53	5.65	5.65	0.86999	.	0.083487	0.85682	D	0.000000	D	0.88901	0.6563	M	0.73319	2.225	0.80722	D	1	D	0.71674	0.998	D	0.63283	0.913	D	0.89205	0.3560	10	0.87932	D	0	.	20.1	0.97870	0.0:0.0:1.0:0.0	.	633	Q9Y345	SC6A5_HUMAN	N	633	ENSP00000434364:D633N	ENSP00000434364:D633N	D	+	1	0	SLC6A5	20616608	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.754000	0.98908	2.829000	0.97493	0.655000	0.94253	GAC		0.468	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2	NM_004211	
METTL15	196074	hgsc.bcm.edu	37	11	28232738	28232738	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:28232738T>C	ENST00000407364.3	+	4	752	c.400T>C	c.(400-402)Ttg>Ctg	p.L134L	METTL15_ENST00000342303.5_Silent_p.L134L|METTL15_ENST00000406787.3_Silent_p.L134L|METTL15_ENST00000303459.6_Silent_p.L134L			A6NJ78	MET15_HUMAN	methyltransferase like 15	134							methyltransferase activity (GO:0008168)	p.L134L(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	14						TCTTTCAGAGTTGTATCCGTA	0.408																																					p.L134L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T400C	11						.						113.0	99.0	104.0					11																	28232738		2202	4299	6501	28189314	SO:0001819	synonymous_variant	196074	exon4			AL832668	CCDS31450.1, CCDS44559.1, CCDS73269.1	11p14.1	2011-03-02	2011-03-02	2011-03-02	ENSG00000169519	ENSG00000169519			26606	protein-coding gene	gene with protein product			"""methyltransferase 5 domain containing 1"""	METT5D1		12477932	Standard	NM_152636		Approved	FLJ33979	uc001msh.2	A6NJ78	OTTHUMG00000150448	ENST00000407364.3:c.400T>C	11.37:g.28232738T>C			28189314	NM_152636	A8MRS5|B7WNU2|Q3MHD3|Q8N601|Q8NBA7	Silent	SNP	ENST00000407364.3	37	CCDS44559.1																																																																																				0.408	METTL15-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318135.2	NM_152636	
ACCS	84680	hgsc.bcm.edu	37	11	44101105	44101105	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:44101105T>C	ENST00000263776.8	+	10	1292	c.858T>C	c.(856-858)gaT>gaC	p.D286D		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	286					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.D286D(1)		breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						TGATTGTGGATGAGGTCTACA	0.572																																					p.D286D	Esophageal Squamous(158;148 1889 8077 23160 41213)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T858C	11						.						200.0	127.0	152.0					11																	44101105		2203	4300	6503	44057681	SO:0001819	synonymous_variant	84680	exon10			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.858T>C	11.37:g.44101105T>C			44057681	NM_032592	B4E219|Q8WUL4|Q96LX5	Silent	SNP	ENST00000263776.8	37	CCDS7907.1																																																																																				0.572	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	NM_032592	
NR1H3	10062	hgsc.bcm.edu	37	11	47280785	47280785	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:47280785G>A	ENST00000467728.1	+	1	1256	c.18G>A	c.(16-18)ggG>ggA	p.G6G	NR1H3_ENST00000481889.2_Intron|NR1H3_ENST00000529540.1_Intron|NR1H3_ENST00000405853.3_Silent_p.G6G|NR1H3_ENST00000405576.1_Intron|NR1H3_ENST00000395397.3_Intron|NR1H3_ENST00000407404.1_Silent_p.G6G|NR1H3_ENST00000527949.1_5'Flank|NR1H3_ENST00000441012.2_Silent_p.G6G			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	6					apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.G6G(1)		endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						TGTGGCTGGGGGCCCCTGTGC	0.572											OREG0020956	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G6G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G18A	11						.						184.0	149.0	161.0					11																	47280785		2201	4298	6499	47237361	SO:0001819	synonymous_variant	10062	exon2			U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.18G>A	11.37:g.47280785G>A		945	47237361	NM_005693	A8K3J9|D3DQR1|Q8IW13|Q96H87	Silent	SNP	ENST00000467728.1	37	CCDS7929.1																																																																																				0.572	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3		
SLC43A3	29015	hgsc.bcm.edu	37	11	57175328	57175328	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:57175328G>A	ENST00000395123.2	-	14	1717	c.1413C>T	c.(1411-1413)ttC>ttT	p.F471F	SLC43A3_ENST00000533524.1_Silent_p.F484F|SLC43A3_ENST00000395124.1_Silent_p.F471F|RP11-872D17.8_ENST00000529411.1_Intron|SLC43A3_ENST00000529554.1_Silent_p.F471F|SLC43A3_ENST00000352187.1_Silent_p.F471F	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	471					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.F471F(1)		central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						GAAAGGGGTGGAAGAATGTCA	0.468																																					p.F471F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1413T	11						.						129.0	106.0	114.0					11																	57175328		2201	4296	6497	56931904	SO:0001819	synonymous_variant	29015	exon14			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.1413C>T	11.37:g.57175328G>A			56931904	NM_199329	B4DNR8|E7EQD2|Q9NSS4	Silent	SNP	ENST00000395123.2	37	CCDS7956.1																																																																																				0.468	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611	
PGA5	5222	hgsc.bcm.edu	37	11	61017166	61017166	+	Missense_Mutation	SNP	G	G	A	rs376490431		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:61017166G>A	ENST00000312403.5	+	7	984	c.799G>A	c.(799-801)Gcc>Acc	p.A267T	PGA5_ENST00000541528.1_Missense_Mutation_p.A7T|CTD-2331C18.5_ENST00000537594.1_RNA|PGA4_ENST00000422676.2_Missense_Mutation_p.A267T|PGA5_ENST00000451616.2_Missense_Mutation_p.A113T	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)	267					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.A267T(1)		large_intestine(1)|skin(1)	2						AGAGACCATCGCCTGTGCTGA	0.597																																					p.A267T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G799A	11						.	G	THR/ALA	1,4403	2.1+/-5.4	0,1,2201	145.0	143.0	144.0		799	2.9	0.0	11		144	1,8597	1.2+/-3.3	0,1,4298	no	missense	PGA5	NM_014224.2	58	0,2,6499	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	267/389	61017166	2,13000	2202	4299	6501	60773742	SO:0001583	missense	5222	exon7			BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.799G>A	11.37:g.61017166G>A	ENSP00000309542:p.Ala267Thr		60773742	NM_014224	A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	ENST00000312403.5	37	CCDS8001.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.101861	0.76983	2.27E-4	1.16E-4	ENSG00000229183;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713	ENST00000422676;ENST00000312403;ENST00000537359;ENST00000544083;ENST00000451616;ENST00000541528	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	2.91	2.91	0.33838	.	0.077386	0.49305	D	0.000141	T	0.72095	0.3418	M	0.83312	2.635	0.35267	D	0.780118	D	0.89917	1.0	D	0.73380	0.98	T	0.82940	-0.0208	10	0.72032	D	0.01	.	13.8637	0.63576	0.0:0.0:1.0:0.0	.	267	B7ZW62	.	T	267;267;224;126;113;7	ENSP00000395402:A267T;ENSP00000309542:A267T;ENSP00000408739:A113T;ENSP00000441981:A7T	ENSP00000395402:A267T	A	+	1	0	PGA4;PGA5	60773742	1.000000	0.71417	0.026000	0.17262	0.161000	0.22273	5.634000	0.67833	1.991000	0.58162	0.420000	0.28162	GCC		0.597	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397972.1	NM_014224	
VWCE	220001	hgsc.bcm.edu	37	11	61032610	61032610	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:61032610G>A	ENST00000335613.5	-	17	2426	c.2040C>T	c.(2038-2040)tgC>tgT	p.C680C	VWCE_ENST00000535710.1_Silent_p.C145C	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	680	VWFC 5. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.C680C(1)		biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						ACACGGGGCAGCACTCCCCGT	0.652																																					p.C680C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2040T	11						.						40.0	34.0	36.0					11																	61032610		2199	4299	6498	60789186	SO:0001819	synonymous_variant	220001	exon17			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.2040C>T	11.37:g.61032610G>A			60789186	NM_152718	A5PKV0|Q7Z7L6|Q86WK8	Silent	SNP	ENST00000335613.5	37	CCDS8002.1																																																																																				0.652	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
FEN1	2237	hgsc.bcm.edu	37	11	61563459	61563459	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:61563459T>C	ENST00000305885.2	+	2	1039	c.626T>C	c.(625-627)cTg>cCg	p.L209P	FADS2_ENST00000574708.1_Intron	NM_004111.5	NP_004102.1			flap structure-specific endonuclease 1									p.L209P(1)		endometrium(1)|large_intestine(4)|lung(1)|ovary(1)	7						GAATTCCACCTGAGCCGGATT	0.562								Editing and processing nucleases																													p.L209P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T626C	11						.						57.0	60.0	59.0					11																	61563459		2202	4299	6501	61320035	SO:0001583	missense	2237	exon2			L37374	CCDS8010.1	11q12	2013-05-08			ENSG00000168496	ENSG00000168496			3650	protein-coding gene	gene with protein product	"""maturation factor-1"", ""DNase IV"""	600393		RAD2		7774922	Standard	NM_004111		Approved	FEN-1, MF1	uc001nsg.3	P39748	OTTHUMG00000168162	ENST00000305885.2:c.626T>C	11.37:g.61563459T>C	ENSP00000305480:p.Leu209Pro		61320035	NM_004111		Missense_Mutation	SNP	ENST00000305885.2	37	CCDS8010.1	.	.	.	.	.	.	.	.	.	.	T	19.34	3.809632	0.70797	.	.	ENSG00000168496	ENST00000305885	T	0.73363	-0.74	4.92	4.92	0.64577	XPG/RAD2 endonuclease (2);	0.198544	0.44483	D	0.000445	D	0.87799	0.6268	H	0.95043	3.615	0.80722	D	1	P	0.47191	0.891	P	0.54499	0.754	D	0.91313	0.5076	10	0.72032	D	0.01	-6.6034	15.0419	0.71796	0.0:0.0:0.0:1.0	.	209	P39748	FEN1_HUMAN	P	209	ENSP00000305480:L209P	ENSP00000305480:L209P	L	+	2	0	FEN1	61320035	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	6.772000	0.75001	2.200000	0.70718	0.459000	0.35465	CTG		0.562	FEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398526.1	NM_004111	
BEST1	7439	hgsc.bcm.edu	37	11	61730092	61730092	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:61730092T>C	ENST00000378043.4	+	10	2109	c.1466T>C	c.(1465-1467)cTt>cCt	p.L489P	BEST1_ENST00000301774.9_Missense_Mutation_p.L117P|BEST1_ENST00000378042.3_Missense_Mutation_p.L402P|FTH1_ENST00000529191.1_Intron|BEST1_ENST00000449131.2_Missense_Mutation_p.L429P|BEST1_ENST00000534553.1_3'UTR|FTH1_ENST00000529631.1_Intron	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	489					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.L489P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						CCGTCAAAGCTTCACAGTGTC	0.542																																					p.L489P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1466C	11						.						79.0	71.0	73.0					11																	61730092		2202	4299	6501	61486668	SO:0001583	missense	7439	exon10			AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.1466T>C	11.37:g.61730092T>C	ENSP00000367282:p.Leu489Pro		61486668	NM_004183	A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Missense_Mutation	SNP	ENST00000378043.4	37	CCDS31580.1	.	.	.	.	.	.	.	.	.	.	T	11.52	1.663635	0.29515	.	.	ENSG00000167995	ENST00000378043;ENST00000378042;ENST00000301774;ENST00000449131	D;D;T;D	0.97089	-4.24;-3.93;-0.18;-4.23	4.59	-1.26	0.09376	.	1.046170	0.07604	N	0.924203	D	0.91686	0.7372	L	0.27053	0.805	0.22675	N	0.998866	B;B;B	0.12013	0.002;0.001;0.005	B;B;B	0.09377	0.004;0.002;0.004	T	0.82345	-0.0503	10	0.32370	T	0.25	-0.5638	3.7909	0.08719	0.2608:0.3133:0.0:0.4259	.	402;489;429	O76090-4;O76090;O76090-3	.;BEST1_HUMAN;.	P	489;402;117;429	ENSP00000367282:L489P;ENSP00000367281:L402P;ENSP00000301774:L117P;ENSP00000399709:L429P	ENSP00000301774:L117P	L	+	2	0	BEST1	61486668	0.000000	0.05858	0.000000	0.03702	0.454000	0.32378	-1.037000	0.03557	-0.064000	0.13043	0.533000	0.62120	CTT		0.542	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1	NM_004183	
MARK2	2011	hgsc.bcm.edu	37	11	63662726	63662726	+	Silent	SNP	T	T	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:63662726T>A	ENST00000509502.2	+	2	514	c.51T>A	c.(49-51)atT>atA	p.I17I	MARK2_ENST00000408948.3_Silent_p.I17I|MARK2_ENST00000502399.3_Silent_p.I50I|MARK2_ENST00000350490.7_Silent_p.I50I|MARK2_ENST00000425897.2_Silent_p.I17I|MARK2_ENST00000377809.4_Silent_p.I50I|MARK2_ENST00000315032.8_Silent_p.I50I|MARK2_ENST00000513765.2_Silent_p.I17I|MARK2_ENST00000413835.2_Silent_p.I50I|MARK2_ENST00000402010.2_Silent_p.I50I|MARK2_ENST00000361128.5_Silent_p.I50I|MARK2_ENST00000508192.1_Silent_p.I50I|MARK2_ENST00000377810.3_Silent_p.I17I	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2									p.I17I(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						AGCCCCACATTGGAAACTACC	0.567																																					p.I17I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T51A	11						.						55.0	53.0	54.0					11																	63662726		2201	4298	6499	63419302	SO:0001819	synonymous_variant	2011	exon2			BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.51T>A	11.37:g.63662726T>A			63419302	NM_017490		Silent	SNP	ENST00000509502.2	37	CCDS41665.1																																																																																				0.567	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360862.2	NM_017490	
PLCB3	5331	hgsc.bcm.edu	37	11	64030998	64030998	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:64030998G>A	ENST00000540288.1	+	20	2487	c.2384G>A	c.(2383-2385)cGc>cAc	p.R795H	PLCB3_ENST00000279230.6_Missense_Mutation_p.R795H|PLCB3_ENST00000325234.5_Missense_Mutation_p.R728H	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	795	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.R795H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						GCTTCACTTCGCATTGCAGCC	0.642																																					p.R728H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2183A	11						.						42.0	27.0	32.0					11																	64030998		2181	4277	6458	63787574	SO:0001583	missense	5331	exon18			Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.2384G>A	11.37:g.64030998G>A	ENSP00000443631:p.Arg795His		63787574	NM_001184883	A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	ENST00000540288.1	37	CCDS8064.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795404	0.90453	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.68624	-0.34;-0.34;-0.34	4.95	4.95	0.65309	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.86497	0.5947	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90198	0.4255	10	0.87932	D	0	.	17.3208	0.87235	0.0:0.0:1.0:0.0	.	728;795	G5E960;Q01970	.;PLCB3_HUMAN	H	795;795;728	ENSP00000279230:R795H;ENSP00000443631:R795H;ENSP00000324660:R728H	ENSP00000279230:R795H	R	+	2	0	PLCB3	63787574	0.999000	0.42202	0.992000	0.48379	0.532000	0.34746	7.545000	0.82128	2.462000	0.83206	0.561000	0.74099	CGC		0.642	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1		
CPT1A	1374	hgsc.bcm.edu	37	11	68529027	68529027	+	Silent	SNP	A	A	C	rs2228503	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:68529027A>C	ENST00000265641.5	-	16	2158	c.2004T>G	c.(2002-2004)gcT>gcG	p.A668A	CPT1A_ENST00000537756.2_5'Flank|CPT1A_ENST00000540367.1_Silent_p.A668A|CPT1A_ENST00000539743.1_Silent_p.A668A|CPT1A_ENST00000376618.2_Silent_p.A668A	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	668					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)	p.A668A(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	GGGACTCCACAGCGAGATATT	0.473																																					p.A668A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2004G	11						.						176.0	173.0	174.0					11																	68529027		2200	4294	6494	68285603	SO:0001819	synonymous_variant	1374	exon16			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.2004T>G	11.37:g.68529027A>C			68285603	NM_001031847	Q8TCU0|Q9BWK0	Silent	SNP	ENST00000265641.5	37	CCDS8185.1																																																																																				0.473	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	
FOLR1	2348	hgsc.bcm.edu	37	11	71907070	71907070	+	Missense_Mutation	SNP	G	G	A	rs145250531		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:71907070G>A	ENST00000393679.1	+	5	1059	c.623G>A	c.(622-624)cGc>cAc	p.R208H	FOLR1_ENST00000312293.4_Missense_Mutation_p.R208H|FOLR1_ENST00000393676.3_Missense_Mutation_p.R208H|RP11-807H22.7_ENST00000378140.3_RNA|FOLR1_ENST00000393681.2_Missense_Mutation_p.R208H			P15328	FOLR1_HUMAN	folate receptor 1 (adult)	208					cell death (GO:0008219)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|receptor-mediated endocytosis (GO:0006898)	anchored component of external side of plasma membrane (GO:0031362)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|receptor activity (GO:0004872)	p.R208H(1)		cervix(2)|endometrium(1)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	14					Methotrexate(DB00563)	GGGAGTGGCCGCTGCATCCAG	0.587																																					p.R208H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G623A	11						.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4399	2.1+/-5.4	0,1,2199	89.0	79.0	83.0		623,623,623,623	3.2	1.0	11	dbSNP_134	83	0,8586		0,0,4293	no	missense,missense,missense,missense	FOLR1	NM_000802.3,NM_016724.2,NM_016725.2,NM_016729.2	29,29,29,29	0,1,6492	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	208/258,208/258,208/258,208/258	71907070	1,12985	2200	4293	6493	71584718	SO:0001583	missense	2348	exon6			J05013	CCDS8211.1	11q13.3-q14.1	2010-04-09			ENSG00000110195	ENSG00000110195			3791	protein-coding gene	gene with protein product		136430		FOLR		1717147	Standard	NM_000802		Approved		uc001osa.2	P15328		ENST00000393679.1:c.623G>A	11.37:g.71907070G>A	ENSP00000377284:p.Arg208His		71584718	NM_016724	Q53EW2|Q6FGT8|Q6LC90|Q9UCT2	Missense_Mutation	SNP	ENST00000393679.1	37	CCDS8211.1	.	.	.	.	.	.	.	.	.	.	g	19.03	3.748161	0.69533	2.27E-4	0.0	ENSG00000110195	ENST00000312293;ENST00000393681;ENST00000393679;ENST00000393676	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	4.11	3.19	0.36642	Folate receptor-like (1);	0.060361	0.64402	D	0.000004	T	0.73528	0.3598	M	0.74546	2.27	0.50313	D	0.999862	P	0.46142	0.873	B	0.40901	0.343	T	0.73113	-0.4085	10	0.32370	T	0.25	-4.2745	9.5487	0.39297	0.1073:0.0:0.8927:0.0	.	208	P15328	FOLR1_HUMAN	H	208	ENSP00000308137:R208H;ENSP00000377286:R208H;ENSP00000377284:R208H;ENSP00000377281:R208H	ENSP00000308137:R208H	R	+	2	0	FOLR1	71584718	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.433000	0.52834	2.266000	0.75297	0.563000	0.77884	CGC		0.587	FOLR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396773.1	NM_016725	
NAALAD2	10003	hgsc.bcm.edu	37	11	89902141	89902141	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:89902141C>G	ENST00000534061.1	+	12	1553	c.1323C>G	c.(1321-1323)aaC>aaG	p.N441K	NAALAD2_ENST00000321955.4_Missense_Mutation_p.N408K|NAALAD2_ENST00000375944.3_Intron	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	441	NAALADase.				neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)	p.N441K(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CTTATATCAACTCGGATTCAT	0.289																																					p.N441K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1323G	11						.						59.0	63.0	61.0					11																	89902141		2201	4295	6496	89541789	SO:0001583	missense	10003	exon12			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.1323C>G	11.37:g.89902141C>G	ENSP00000432481:p.Asn441Lys		89541789	NM_005467	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	ENST00000534061.1	37	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531626	0.64972	.	.	ENSG00000077616	ENST00000534061;ENST00000321955	T;T	0.55760	0.5;0.5	5.75	2.53	0.30540	Peptidase M28 (1);	0.130386	0.52532	D	0.000073	T	0.78541	0.4299	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81136	-0.1070	9	.	.	.	-22.0773	9.0272	0.36236	0.0:0.656:0.0:0.344	.	441	Q9Y3Q0	NALD2_HUMAN	K	441;408	ENSP00000432481:N441K;ENSP00000320083:N408K	.	N	+	3	2	NAALAD2	89541789	0.995000	0.38212	1.000000	0.80357	0.996000	0.88848	0.530000	0.23036	0.797000	0.33971	0.650000	0.86243	AAC		0.289	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467	
PANX1	24145	hgsc.bcm.edu	37	11	93886771	93886771	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:93886771G>A	ENST00000227638.3	+	2	681	c.296G>A	c.(295-297)gGa>gAa	p.G99E	PANX1_ENST00000436171.2_Missense_Mutation_p.G99E	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	99					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)	p.G99E(1)		endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	AGCGAGTCTGGAAACCTCCCA	0.483																																					p.G99E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G296A	11						.						103.0	99.0	100.0					11																	93886771		2201	4298	6499	93526419	SO:0001583	missense	24145	exon2			AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.296G>A	11.37:g.93886771G>A	ENSP00000227638:p.Gly99Glu		93526419	NM_015368	O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Missense_Mutation	SNP	ENST00000227638.3	37	CCDS8296.1	.	.	.	.	.	.	.	.	.	.	G	9.026	0.986167	0.18889	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	T;T	0.26660	1.72;1.72	4.58	3.65	0.41850	.	0.334531	0.30879	N	0.008686	T	0.18676	0.0448	L	0.43152	1.355	0.48762	D	0.999707	B;B	0.19817	0.039;0.031	B;B	0.23419	0.046;0.027	T	0.04005	-1.0985	10	0.02654	T	1	-11.4826	11.9902	0.53171	0.0892:0.0:0.9108:0.0	.	99;99	Q96RD7;Q96RD7-2	PANX1_HUMAN;.	E	99	ENSP00000227638:G99E;ENSP00000411461:G99E	ENSP00000227638:G99E	G	+	2	0	PANX1	93526419	0.999000	0.42202	0.993000	0.49108	0.145000	0.21501	3.120000	0.50430	2.088000	0.63022	0.655000	0.94253	GGA		0.483	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396121.1	NM_015368	
KDM4D	55693	hgsc.bcm.edu	37	11	94730676	94730676	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:94730676G>A	ENST00000335080.5	+	3	972	c.140G>A	c.(139-141)gGc>gAc	p.G47D	KDM4D_ENST00000536741.1_Missense_Mutation_p.G47D	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D	47	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.G47D(1)		endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CACAGAGCTGGCTTGGCTAAG	0.393																																					p.G47D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G140A	11						.						97.0	104.0	102.0					11																	94730676		2201	4298	6499	94370324	SO:0001583	missense	55693	exon3			AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838	ENST00000335080.5:c.140G>A	11.37:g.94730676G>A	ENSP00000334181:p.Gly47Asp		94370324	NM_018039	B3KPC4|Q0VF39|Q9NT41|Q9NW76	Missense_Mutation	SNP	ENST00000335080.5	37	CCDS8302.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232011	0.39399	.	.	ENSG00000186280	ENST00000335080	D	0.96554	-4.05	3.76	3.76	0.43208	Transcription factor jumonji, JmjN (2);	0.000000	0.64402	U	0.000002	D	0.98544	0.9514	H	0.95328	3.655	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	D	0.98832	1.0751	10	0.87932	D	0	-26.7027	13.9092	0.63855	0.0:0.0:1.0:0.0	.	47	Q6B0I6	KDM4D_HUMAN	D	47	ENSP00000334181:G47D	ENSP00000334181:G47D	G	+	2	0	KDM4D	94370324	1.000000	0.71417	0.133000	0.22050	0.026000	0.11368	6.984000	0.76186	2.397000	0.81536	0.561000	0.74099	GGC		0.393	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396558.2	NM_018039	
MTMR2	8898	hgsc.bcm.edu	37	11	95569471	95569471	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:95569471A>G	ENST00000346299.5	-	14	1951	c.1611T>C	c.(1609-1611)acT>acC	p.T537T	MTMR2_ENST00000352297.7_Silent_p.T465T|MTMR2_ENST00000393223.3_Silent_p.T465T|MTMR2_ENST00000409459.1_Silent_p.T465T	NM_016156.5	NP_057240.3	Q13614	MTMR2_HUMAN	myotubularin related protein 2	537	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|dendritic spine maintenance (GO:0097062)|inositol phosphate dephosphorylation (GO:0046855)|myelin assembly (GO:0032288)|negative regulation of endocytosis (GO:0045806)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of myelination (GO:0031642)|negative regulation of receptor catabolic process (GO:2000645)|negative regulation of receptor internalization (GO:0002091)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of early endosome to late endosome transport (GO:2000643)|protein dephosphorylation (GO:0006470)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endosome (GO:0005768)|neuronal postsynaptic density (GO:0097481)|nucleus (GO:0005634)|synaptic membrane (GO:0097060)|synaptic vesicle (GO:0008021)|vacuolar membrane (GO:0005774)	phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.T465T(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	19		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ACAGTGACACAGTCCTTTTAG	0.403																																					p.T465T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1395C	11						.						107.0	105.0	106.0					11																	95569471		2201	4298	6499	95209119	SO:0001819	synonymous_variant	8898	exon16			U58033	CCDS8305.1, CCDS8306.1	11q22	2014-09-17			ENSG00000087053	ENSG00000087053		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7450	protein-coding gene	gene with protein product		603557		CMT4B		8640223, 9736772	Standard	NM_016156		Approved	KIAA1073	uc001pfu.3	Q13614	OTTHUMG00000153837	ENST00000346299.5:c.1611T>C	11.37:g.95569471A>G			95209119	NM_201278	A6NN98|Q9UPS9	Silent	SNP	ENST00000346299.5	37	CCDS8305.1																																																																																				0.403	MTMR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332620.1	NM_016156	
CRTAM	56253	hgsc.bcm.edu	37	11	122722432	122722432	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr11:122722432T>G	ENST00000227348.4	+	3	272	c.225T>G	c.(223-225)caT>caG	p.H75Q		NM_019604.2	NP_062550.2			cytotoxic and regulatory T cell molecule									p.H75Q(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|prostate(1)	19		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		AGCTTCTTCATCACTCGGCCA	0.448																																					p.H75Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T225G	11						.						160.0	147.0	151.0					11																	122722432		2202	4299	6501	122227642	SO:0001583	missense	56253	exon3			AF001622	CCDS8437.1	11q24.1	2013-01-11			ENSG00000109943	ENSG00000109943		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24313	protein-coding gene	gene with protein product	"""class I MHC restricted T cell associated molecule"""	612597				10811014, 16300832	Standard	NM_019604		Approved	CD355	uc001pyj.3	O95727	OTTHUMG00000166026	ENST00000227348.4:c.225T>G	11.37:g.122722432T>G	ENSP00000227348:p.His75Gln		122227642	NM_019604		Missense_Mutation	SNP	ENST00000227348.4	37	CCDS8437.1	.	.	.	.	.	.	.	.	.	.	T	11.64	1.697459	0.30142	.	.	ENSG00000109943	ENST00000227348	T	0.64803	-0.12	5.03	-9.89	0.00464	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.592821	0.16960	N	0.192523	T	0.44286	0.1286	L	0.48642	1.525	0.18873	N	0.999987	B	0.31548	0.328	B	0.36534	0.227	T	0.35968	-0.9767	10	0.56958	D	0.05	.	4.885	0.13699	0.2019:0.4965:0.1024:0.1992	.	75	O95727	CRTAM_HUMAN	Q	75	ENSP00000227348:H75Q	ENSP00000227348:H75Q	H	+	3	2	CRTAM	122227642	0.000000	0.05858	0.102000	0.21198	0.473000	0.32948	-0.781000	0.04648	-1.374000	0.02131	-0.710000	0.03640	CAT		0.448	CRTAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387507.1	NM_019604	
ASCC3	10973	hgsc.bcm.edu	37	6	101073184	101073184	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:101073184G>T	ENST00000369162.2	-	30	5013	c.4669C>A	c.(4669-4671)Cct>Act	p.P1557T		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1557	Helicase C-terminal 2. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)	p.P1557T(1)		breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		ATCAAAACAGGTTTGGCTGGA	0.373																																					p.P1557T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4669A	6						.						84.0	85.0	85.0					6																	101073184		2203	4300	6503	101179905	SO:0001583	missense	10973	exon30			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4669C>A	6.37:g.101073184G>T	ENSP00000358159:p.Pro1557Thr		101179905	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.702809	0.88924	.	.	ENSG00000112249	ENST00000369162	D	0.92965	-3.14	5.96	5.96	0.96718	Helicase, C-terminal (1);	0.056074	0.64402	D	0.000001	D	0.97720	0.9252	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97978	1.0347	10	0.66056	D	0.02	.	20.394	0.98981	0.0:0.0:1.0:0.0	.	1557	Q8N3C0	HELC1_HUMAN	T	1557	ENSP00000358159:P1557T	ENSP00000358159:P1557T	P	-	1	0	ASCC3	101179905	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	9.869000	0.99810	2.830000	0.97506	0.585000	0.79938	CCT		0.373	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
BEND3	57673	hgsc.bcm.edu	37	6	107419769	107419769	+	Missense_Mutation	SNP	G	G	A	rs374883376		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:107419769G>A	ENST00000369042.1	-	3	416	c.226C>T	c.(226-228)Cgg>Tgg	p.R76W	BEND3_ENST00000429433.2_Missense_Mutation_p.R76W			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	76								p.R76W(1)		central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						GGGATCAGCCGCCTCCTCTTC	0.587																																					p.R76W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C226T	6						.	G	TRP/ARG	0,4406		0,0,2203	49.0	46.0	47.0		226	5.9	1.0	6		47	1,8599	1.2+/-3.3	0,1,4299	no	missense	BEND3	NM_001080450.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	76/829	107419769	1,13005	2203	4300	6503	107526462	SO:0001583	missense	57673	exon4			AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.226C>T	6.37:g.107419769G>A	ENSP00000358038:p.Arg76Trp		107526462	NM_001080450	A2RRH2|Q9HCL9	Missense_Mutation	SNP	ENST00000369042.1	37	CCDS34507.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611395	0.87258	0.0	1.16E-4	ENSG00000178409	ENST00000369042;ENST00000429433	.	.	.	5.86	5.86	0.93980	.	0.181944	0.32068	N	0.006627	T	0.57858	0.2082	N	0.24115	0.695	0.45528	D	0.998489	D	0.89917	1.0	D	0.75020	0.985	T	0.63862	-0.6541	9	0.87932	D	0	-22.8269	16.9016	0.86115	0.0:0.0:1.0:0.0	.	76	Q5T5X7	BEND3_HUMAN	W	76	.	ENSP00000358038:R76W	R	-	1	2	BEND3	107526462	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	4.078000	0.57606	2.771000	0.95319	0.650000	0.86243	CGG		0.587	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913	
SLC16A10	117247	hgsc.bcm.edu	37	6	111498832	111498832	+	Silent	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:111498832T>G	ENST00000368851.5	+	3	1081	c.906T>G	c.(904-906)ctT>ctG	p.L302L	SLC16A10_ENST00000368850.3_5'UTR|SLC16A10_ENST00000465319.1_3'UTR	NM_018593.4	NP_061063.2	Q8TF71	MOT10_HUMAN	solute carrier family 16 (aromatic amino acid transporter), member 10	302					amino acid transport (GO:0006865)|aromatic amino acid transport (GO:0015801)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L302L(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)	12		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)	Droxidopa(DB06262)|Glycine(DB00145)|L-Alanine(DB00160)|L-Arginine(DB00125)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Cystine(DB00138)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Histidine(DB00117)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Lysine(DB00123)|L-Methionine(DB00134)|L-Phenylalanine(DB00120)|L-Proline(DB00172)|L-Serine(DB00133)|L-Threonine(DB00156)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|L-Valine(DB00161)|Liothyronine(DB00279)|Liotrix(DB01583)|Pyruvic acid(DB00119)	GAATACCACTTGCACTTTTTG	0.368																																					p.L302L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T906G	6						.						88.0	86.0	87.0					6																	111498832		2203	4300	6503	111605525	SO:0001819	synonymous_variant	117247	exon3			AF116652	CCDS5089.1	6q21-q22	2014-01-28	2013-07-18		ENSG00000112394	ENSG00000112394		"""Solute carriers"""	17027	protein-coding gene	gene with protein product		607550	"""solute carrier family 16 (monocarboxylic acid transporters), member 10"""			11278508, 11827462	Standard	NM_018593		Approved	TAT1, MCT10	uc003pus.3	Q8TF71	OTTHUMG00000015371	ENST00000368851.5:c.906T>G	6.37:g.111498832T>G			111605525	NM_018593	B3KWY0|Q6ZMG0|Q8WVI5	Silent	SNP	ENST00000368851.5	37	CCDS5089.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.151|8.151	0.787291|0.787291	0.16258|0.16258	.|.	.|.	ENSG00000112394|ENSG00000112394	ENST00000535637|ENST00000419619;ENST00000439288	.|D;D	.|0.81996	.|-1.56;-1.56	5.41|5.41	-1.42|-1.42	0.08913|0.08913	.|.	.|0.522166	.|0.20271	.|N	.|0.095653	T|T	0.78104|0.78104	0.4231|0.4231	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.77587|0.77587	-0.2532|-0.2532	5|7	0.48119|0.87932	T|D	0.1|0	.|.	7.8424|7.8424	0.29406|0.29406	0.0:0.133:0.4907:0.3763|0.0:0.133:0.4907:0.3763	.|.	.|.	.|.	.|.	G|W	302|188	.|ENSP00000399601:L188W;ENSP00000387501:L188W	ENSP00000439389:C302G|ENSP00000399601:L188W	C|L	+|+	1|2	0|0	SLC16A10|SLC16A10	111605525|111605525	0.767000|0.767000	0.28508|0.28508	0.940000|0.940000	0.37924|0.37924	0.912000|0.912000	0.54170|0.54170	-0.253000|-0.253000	0.08794|0.08794	-0.142000|-0.142000	0.11354|0.11354	-0.460000|-0.460000	0.05396|0.05396	TGC|TTG		0.368	SLC16A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041822.2		
IGF2R	3482	hgsc.bcm.edu	37	6	160485520	160485520	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Visver			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:160485520G>A	ENST00000356956.1	+	28	4122	c.3974G>A	c.(3973-3975)cGc>cAc	p.R1325H		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1325					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.R1325H(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GTTTATCAGCGCTCCACAGCC	0.547																																					p.R1325H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3974A	6						.						91.0	97.0	95.0					6																	160485520		2203	4300	6503	160405510	SO:0001583	missense	3482	exon28			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.3974G>A	6.37:g.160485520G>A	ENSP00000349437:p.Arg1325His		160405510	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	G	33	5.289211	0.95517	.	.	ENSG00000197081	ENST00000356956	T	0.05717	3.4	5.48	5.48	0.80851	Mannose-6-phosphate receptor, binding (1);	0.000000	0.85682	D	0.000000	T	0.29321	0.0730	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.35895	-0.9770	10	0.72032	D	0.01	-10.5374	19.3709	0.94484	0.0:0.0:1.0:0.0	.	1325	P11717	MPRI_HUMAN	H	1325	ENSP00000349437:R1325H	ENSP00000349437:R1325H	R	+	2	0	IGF2R	160405510	1.000000	0.71417	0.948000	0.38648	0.838000	0.47535	9.022000	0.93678	2.576000	0.86940	0.655000	0.94253	CGC		0.547	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
QKI	9444	hgsc.bcm.edu	37	6	163987822	163987822	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:163987822A>C	ENST00000361752.3	+	7	1555	c.1004A>C	c.(1003-1005)gAc>gCc	p.D335A	QKI_ENST00000361195.2_Missense_Mutation_p.D327A|QKI_ENST00000275262.7_3'UTR|QKI_ENST00000392127.2_3'UTR|QKI_ENST00000453779.2_3'UTR	NM_006775.2|NM_206853.2|NM_206854.2|NM_206855.2	NP_006766.1|NP_996735.1|NP_996736.1|NP_996737.1	Q96PU8	QKI_HUMAN	QKI, KH domain containing, RNA binding	335					long-chain fatty acid biosynthetic process (GO:0042759)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|muscle cell differentiation (GO:0042692)|myelination (GO:0042552)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|spermatid development (GO:0007286)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.D335A(1)		central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(5)|ovary(1)|prostate(3)|urinary_tract(2)	27		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		GTGACCGCAGACCGAGGTTAG	0.418																																					p.D335A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1004C	6						.						120.0	102.0	108.0					6																	163987822		2203	4300	6503	163907812	SO:0001583	missense	9444	exon7			AB067798	CCDS5285.1, CCDS5286.1, CCDS5287.1, CCDS43525.1, CCDS75546.1	6q26	2011-09-12	2011-09-12		ENSG00000112531	ENSG00000112531			21100	protein-coding gene	gene with protein product		609590	"""quaking homolog, KH domain RNA binding (mouse)"""			10535969	Standard	NM_006775		Approved	QK3	uc003qui.3	Q96PU8	OTTHUMG00000015977	ENST00000361752.3:c.1004A>C	6.37:g.163987822A>C	ENSP00000355094:p.Asp335Ala		163907812	NM_006775	Q2I375|Q5MJQ1|Q969L9|Q96EJ3|Q96KA3|Q96PU6|Q96PU7|Q9P0X6|Q9P0X7|Q9P0X8|Q9P0X9|Q9P0Y0|Q9P0Y1	Missense_Mutation	SNP	ENST00000361752.3	37	CCDS5285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.87|14.87	2.664633|2.664633	0.47572|0.47572	.|.	.|.	ENSG00000112531|ENSG00000112531	ENST00000361752;ENST00000361195|ENST00000537883;ENST00000544361	.|.	.|.	.|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.047201|.	0.85682|.	D|.	0.000000|.	T|T	0.47673|0.47673	0.1458|0.1458	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	P;B|.	0.38370|.	0.628;0.141|.	B;B|.	0.40066|.	0.318;0.091|.	T|T	0.44651|0.44651	-0.9314|-0.9314	9|5	0.62326|.	D|.	0.03|.	-3.1502|-3.1502	16.2076|16.2076	0.82138|0.82138	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	327;335|.	Q96PU8-3;Q96PU8|.	.;QKI_HUMAN|.	A|S	335;327|231;168	.|.	ENSP00000354867:D327A|.	D|R	+|+	2|3	0|2	QKI|QKI	163907812|163907812	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.910000|8.910000	0.92685|0.92685	2.285000|2.285000	0.76669|0.76669	0.477000|0.477000	0.44152|0.44152	GAC|AGA		0.418	QKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043016.2	NM_006775	
PRPF4B	8899	hgsc.bcm.edu	37	6	4042801	4042801	+	Splice_Site	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:4042801A>G	ENST00000337659.6	+	5	1749	c.1649A>G	c.(1648-1650)cAg>cGg	p.Q550R	PRPF4B_ENST00000538861.1_Splice_Site_p.Q536R	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	550					mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q39R(1)|p.Q550R(1)		breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GCAATTGTTCAGGTATGTGAT	0.308																																					p.Q550R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1649G	6						.						66.0	70.0	69.0					6																	4042801		2203	4299	6502	3987800	SO:0001630	splice_region_variant	8899	exon5			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1650+1A>G	6.37:g.4042801A>G			3987800	NM_003913	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	ENST00000337659.6	37	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.600080	0.66332	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.68025	-0.29;-0.3	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000003	T	0.66587	0.2804	L	0.38531	1.155	0.80722	D	1	D	0.54601	0.967	D	0.65140	0.932	T	0.68326	-0.5438	10	0.44086	T	0.13	.	15.8028	0.78468	1.0:0.0:0.0:0.0	.	550	Q13523	PRP4B_HUMAN	R	550;536	ENSP00000337194:Q550R;ENSP00000439331:Q536R	ENSP00000337194:Q550R	Q	+	2	0	PRPF4B	3987800	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.823000	0.69272	2.196000	0.70406	0.460000	0.39030	CAG		0.308	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		Missense_Mutation
KDM1B	221656	hgsc.bcm.edu	37	6	18186011	18186011	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:18186011C>T	ENST00000297792.5	+	8	720	c.543C>T	c.(541-543)acC>acT	p.T181T	KDM1B_ENST00000546309.2_Intron|KDM1B_ENST00000388870.2_Silent_p.T181T|KDM1B_ENST00000397244.1_Silent_p.T181T			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	181					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)	p.T181T(1)		breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						AGCCTGAGACCTCAGATCATT	0.373																																					p.T181T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C543T	6						.						230.0	216.0	221.0					6																	18186011		2203	4300	6503	18293990	SO:0001819	synonymous_variant	221656	exon8			AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.543C>T	6.37:g.18186011C>T			18293990	NM_153042	A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Silent	SNP	ENST00000297792.5	37	CCDS34343.1																																																																																				0.373	KDM1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277080.1	NM_153042	
TRIM27	5987	hgsc.bcm.edu	37	6	28872120	28872120	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:28872120T>C	ENST00000377199.3	-	8	1625	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	TRIM27_ENST00000377194.3_Intron	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	423	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P423P(1)		endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GGGCAGTCATTGGGGAGGTAA	0.542			T	RET	papillary thyroid																																p.P423P			Dom	yes		6	6p22	5987	tripartite motif-containing 27		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1269G	6						.						87.0	98.0	94.0					6																	28872120		1511	2708	4219	28980099	SO:0001819	synonymous_variant	5987	exon8			Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.1269A>G	6.37:g.28872120T>C			28980099	NM_006510	A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Silent	SNP	ENST00000377199.3	37	CCDS4654.1	.	.	.	.	.	.	.	.	.	.	T	7.362	0.624987	0.14257	.	.	ENSG00000204713	ENST00000414543	.	.	.	4.89	-9.77	0.00500	.	.	.	.	.	T	0.30634	0.0771	.	.	.	0.51767	D	0.999934	.	.	.	.	.	.	T	0.62676	-0.6804	4	.	.	.	.	10.5293	0.44967	0.0:0.1949:0.2206:0.5846	.	.	.	.	D	158	.	.	N	-	1	0	TRIM27	28980099	0.000000	0.05858	0.115000	0.21578	0.982000	0.71751	-4.628000	0.00206	-3.926000	0.00090	-1.119000	0.02030	AAT		0.542	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076442.2	NM_030950	
NCR3	259197	hgsc.bcm.edu	37	6	31557743	31557743	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:31557743A>G	ENST00000340027.5	-	2	467	c.204T>C	c.(202-204)aaT>aaC	p.N68N	NCR3_ENST00000376072.3_Silent_p.N68N|NCR3_ENST00000376073.4_Silent_p.N68N|NCR3_ENST00000491161.1_5'UTR|NCR3_ENST00000376071.4_Intron	NM_147130.2	NP_667341.1	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3	68	Ig-like.				cell recognition (GO:0008037)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	integral component of plasma membrane (GO:0005887)		p.N68N(1)		cervix(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)	9						CTGGGGTTCCATTCCTCACCT	0.622																																					p.N68N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T204C	6						.						126.0	121.0	122.0					6																	31557743		1511	2709	4220	31665722	SO:0001819	synonymous_variant	259197	exon2			AB055881	CCDS34397.1, CCDS47401.1, CCDS47402.1	6p21.3	2013-01-11	2002-11-13	2002-11-15	ENSG00000204475	ENSG00000204475		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19077	protein-coding gene	gene with protein product		611550	"""lymphocyte antigen 117"""	LY117		8824804, 11782277	Standard	NM_001145466		Approved	1C7, NKp30, CD337	uc003nuv.2	O14931	OTTHUMG00000031123	ENST00000340027.5:c.204T>C	6.37:g.31557743A>G			31665722	NM_147130	B0S8F2|B0S8F4|B0S8F5|O14930|O14932|O95667|O95668|O95669|Q5ST89|Q5ST90|Q5ST91|Q5ST92|Q5STA3	Silent	SNP	ENST00000340027.5	37	CCDS34397.1																																																																																				0.622	NCR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076210.2		
NOTCH4	4855	hgsc.bcm.edu	37	6	32180306	32180306	+	Silent	SNP	G	G	A	rs537720984		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:32180306G>A	ENST00000375023.3	-	17	2763	c.2625C>T	c.(2623-2625)acC>acT	p.T875T	NOTCH4_ENST00000465528.1_5'UTR	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	875	EGF-like 22. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.T875T(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						AGAGAGGCCCGGTCCATCCCT	0.577																																					p.G875G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2625T	6						.						141.0	124.0	130.0					6																	32180306		1510	2709	4219	32288284	SO:0001819	synonymous_variant	4855	exon17				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.2625C>T	6.37:g.32180306G>A			32288284	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	ENST00000375023.3	37	CCDS34420.1																																																																																				0.577	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
IP6K3	117283	hgsc.bcm.edu	37	6	33690551	33690551	+	Silent	SNP	A	A	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:33690551A>T	ENST00000293756.4	-	6	1505	c.1179T>A	c.(1177-1179)atT>atA	p.I393I	IP6K3_ENST00000451316.1_Silent_p.I393I	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	393					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.I393I(1)		skin(1)	1						CCAGGCCAAAAATATAGCCAG	0.468																																					p.I393I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1179A	6						.						136.0	141.0	140.0					6																	33690551		2203	4300	6503	33798529	SO:0001819	synonymous_variant	117283	exon6			AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.1179T>A	6.37:g.33690551A>T			33798529	NM_054111	Q96MQ9	Silent	SNP	ENST00000293756.4	37	CCDS34435.1																																																																																				0.468	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111	
MUT	4594	hgsc.bcm.edu	37	6	49421313	49421313	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:49421313C>T	ENST00000274813.3	-	5	1195	c.1068G>A	c.(1066-1068)tgG>tgA	p.W356*		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	356					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)	p.W356*(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGTAAGTGACCATCCAGATG	0.338																																					p.W356X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1068A	6						.						79.0	79.0	79.0					6																	49421313		2203	4300	6503	49529272	SO:0001587	stop_gained	4594	exon5				CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.1068G>A	6.37:g.49421313C>T	ENSP00000274813:p.Trp356*		49529272	NM_000255	A8K953|Q5SYZ3|Q96B11|Q9UD64	Nonsense_Mutation	SNP	ENST00000274813.3	37	CCDS4924.1	.	.	.	.	.	.	.	.	.	.	C	39	7.464614	0.98299	.	.	ENSG00000146085	ENST00000274813	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.1415	19.1433	0.93455	0.0:1.0:0.0:0.0	.	.	.	.	X	356	.	ENSP00000274813:W356X	W	-	3	0	MUT	49529272	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.760000	0.94817	0.655000	0.94253	TGG		0.338	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1		
PKHD1	5314	hgsc.bcm.edu	37	6	51799081	51799081	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:51799081A>C	ENST00000371117.3	-	37	6223	c.5948T>G	c.(5947-5949)cTc>cGc	p.L1983R	PKHD1_ENST00000340994.4_Missense_Mutation_p.L1983R	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1983	G8 1. {ECO:0000255|PROSITE- ProRule:PRU00817}.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.L1983R(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GTGTGCCCTGAGCTCGATGGG	0.532											OREG0017491	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1983R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T5948G	6						.						108.0	100.0	103.0					6																	51799081		2203	4300	6503	51907040	SO:0001583	missense	5314	exon37			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.5948T>G	6.37:g.51799081A>C	ENSP00000360158:p.Leu1983Arg	980	51907040	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.491848	0.84962	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.91577	-2.87;-2.87	5.59	5.59	0.84812	G8 domain (2);	0.086607	0.49916	D	0.000139	D	0.95928	0.8674	M	0.92317	3.295	0.46798	D	0.999201	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96959	0.9700	10	0.87932	D	0	.	14.9553	0.71107	1.0:0.0:0.0:0.0	.	1983;1983;1983	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	R	1983	ENSP00000360158:L1983R;ENSP00000341097:L1983R	ENSP00000341097:L1983R	L	-	2	0	PKHD1	51907040	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	6.954000	0.76001	2.111000	0.64477	0.533000	0.62120	CTC		0.532	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PKHD1	5314	hgsc.bcm.edu	37	6	51934306	51934306	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:51934306C>T	ENST00000371117.3	-	11	1002	c.727G>A	c.(727-729)Gca>Aca	p.A243T	PKHD1_ENST00000340994.4_Missense_Mutation_p.A243T	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	243					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.A243T(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					ATCAGCCATGCCTTCTTGTGG	0.438																																					p.A243T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G727A	6						.						266.0	244.0	251.0					6																	51934306		2203	4300	6503	52042265	SO:0001583	missense	5314	exon11			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.727G>A	6.37:g.51934306C>T	ENSP00000360158:p.Ala243Thr		52042265	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.882862	0.91740	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87334	-2.04;-2.24	5.28	5.28	0.74379	.	0.161178	0.42964	D	0.000633	D	0.88829	0.6543	L	0.47716	1.5	0.37881	D	0.930386	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.85314	0.1080	10	0.20046	T	0.44	.	18.3185	0.90229	0.0:1.0:0.0:0.0	.	243;243	P08F94-2;P08F94	.;PKHD1_HUMAN	T	243	ENSP00000360158:A243T;ENSP00000341097:A243T	ENSP00000341097:A243T	A	-	1	0	PKHD1	52042265	0.997000	0.39634	0.346000	0.25655	0.363000	0.29612	4.761000	0.62243	2.654000	0.90174	0.650000	0.86243	GCA		0.438	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
ICK	22858	hgsc.bcm.edu	37	6	52895881	52895881	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:52895881C>T	ENST00000350082.5	-	5	686	c.340G>A	c.(340-342)Gca>Aca	p.A114T	ICK_ENST00000356971.3_Missense_Mutation_p.A114T	NM_014920.3	NP_055735.1	Q9UPZ9	ICK_HUMAN	intestinal cell (MAK-like) kinase	114	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				intracellular signal transduction (GO:0035556)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.A114T(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(3)|stomach(1)	31	Lung NSC(77;0.103)					TGAATAAATGCGAGTCCTTGT	0.343																																					p.A114T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G340A	6						.						104.0	90.0	95.0					6																	52895881		2203	4300	6503	53003840	SO:0001583	missense	22858	exon6			AB023153	CCDS4949.1	6p12.3-p11.2	2008-02-05			ENSG00000112144	ENSG00000112144			21219	protein-coding gene	gene with protein product		612325				12103360	Standard	NM_014920		Approved	MRK, LCK2, KIAA0936, MGC46090	uc003pbi.2	Q9UPZ9	OTTHUMG00000014870	ENST00000350082.5:c.340G>A	6.37:g.52895881C>T	ENSP00000263043:p.Ala114Thr		53003840	NM_016513	A7MD41|O75985|Q5THL2|Q8IYH8|Q9BX17|Q9NYX3	Missense_Mutation	SNP	ENST00000350082.5	37	CCDS4949.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700129	0.88924	.	.	ENSG00000112144	ENST00000350082;ENST00000356971	T;T	0.66995	-0.24;-0.24	5.92	5.92	0.95590	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.055766	0.64402	D	0.000001	T	0.73984	0.3657	M	0.77406	2.37	0.80722	D	1	B;D	0.56746	0.119;0.977	B;P	0.51777	0.063;0.679	T	0.77310	-0.2635	10	0.87932	D	0	-18.4761	20.3343	0.98733	0.0:1.0:0.0:0.0	.	114;114	Q9UPZ9-2;Q9UPZ9	.;ICK_HUMAN	T	114	ENSP00000263043:A114T;ENSP00000349458:A114T	ENSP00000263043:A114T	A	-	1	0	ICK	53003840	0.991000	0.36638	0.998000	0.56505	0.914000	0.54420	2.980000	0.49321	2.822000	0.97130	0.650000	0.86243	GCA		0.343	ICK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040952.1	NM_016513	
MB21D1	115004	hgsc.bcm.edu	37	6	74138492	74138492	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:74138492A>T	ENST00000370315.3	-	4	1251	c.1157T>A	c.(1156-1158)aTt>aAt	p.I386N	MB21D1_ENST00000370318.1_Missense_Mutation_p.I386N	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	386	DNA-binding. {ECO:0000305|PubMed:23707061}.				activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.I386N(1)		central_nervous_system(1)|large_intestine(4)|lung(1)	6						ATTGTTCAAAATTTCCTTTTC	0.328																																					p.I386N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1157A	6						.						120.0	109.0	112.0					6																	74138492		2203	4300	6503	74195213	SO:0001583	missense	115004	exon4			BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.1157T>A	6.37:g.74138492A>T	ENSP00000359339:p.Ile386Asn		74195213	NM_138441	L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Missense_Mutation	SNP	ENST00000370315.3	37	CCDS4978.1	.	.	.	.	.	.	.	.	.	.	A	15.34	2.803536	0.50315	.	.	ENSG00000164430	ENST00000370318;ENST00000370315;ENST00000296913	T;T	0.09723	2.95;2.95	5.14	5.14	0.70334	.	0.153148	0.40728	N	0.001028	T	0.21427	0.0516	M	0.72118	2.19	0.35972	D	0.835415	D	0.69078	0.997	D	0.69479	0.964	T	0.02431	-1.1160	10	0.87932	D	0	-9.3617	13.7992	0.63190	1.0:0.0:0.0:0.0	.	386	Q8N884	M21D1_HUMAN	N	386	ENSP00000359342:I386N;ENSP00000359339:I386N	ENSP00000296913:I386N	I	-	2	0	MB21D1	74195213	0.999000	0.42202	0.746000	0.31095	0.189000	0.23516	6.567000	0.73983	2.058000	0.61347	0.533000	0.62120	ATT		0.328	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041221.5	NM_138441	
MPC1	51660	hgsc.bcm.edu	37	6	166779478	166779478	+	Missense_Mutation	SNP	G	G	A	rs387907237		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:166779478G>A	ENST00000360961.6	-	4	410	c.289C>T	c.(289-291)Cgg>Tgg	p.R97W	MPC1_ENST00000341756.6_Missense_Mutation_p.R97W|MPC1_ENST00000487218.1_5'UTR	NM_001270879.1|NM_016098.3	NP_001257808.1|NP_057182.1	Q9Y5U8	MPC1_HUMAN	mitochondrial pyruvate carrier 1	97			R -> W (in MPYCD; inactive). {ECO:0000269|PubMed:22628558}.		cellular metabolic process (GO:0044237)|mitochondrial pyruvate transport (GO:0006850)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	pyruvate transmembrane transporter activity (GO:0050833)	p.R97W(1)									TTGATAAGCCGCCCTCCCTGG	0.433																																					p.G96G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C288T	6						.						96.0	87.0	90.0					6																	166779478		2203	4300	6503	166699468	SO:0001583	missense	51660	exon3			AF125101	CCDS5293.1, CCDS75547.1	6q27	2012-08-01	2012-07-30	2012-07-30	ENSG00000060762	ENSG00000060762			21606	protein-coding gene	gene with protein product		614738	"""brain protein 44-like"""	BRP44L		22628558	Standard	NM_016098		Approved	dJ68L15.3, CGI-129	uc031sra.1	Q9Y5U8	OTTHUMG00000015999	ENST00000360961.6:c.289C>T	6.37:g.166779478G>A	ENSP00000354223:p.Arg97Trp		166699468	NM_016098	B2R5I7|Q5TI66|Q9HB67|Q9UQN4	Missense_Mutation	SNP	ENST00000360961.6	37	CCDS5293.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570515	0.65765	.	.	ENSG00000060762	ENST00000360961;ENST00000341756;ENST00000392123	D;D	0.84442	-1.85;-1.85	6.17	2.16	0.27623	.	0.162341	0.56097	D	0.000037	D	0.89396	0.6703	H	0.97465	4.01	0.80722	D	1	D	0.56287	0.975	P	0.54060	0.741	D	0.87795	0.2621	10	0.87932	D	0	-16.6049	5.3077	0.15813	0.0704:0.126:0.5431:0.2605	.	97	Q9Y5U8	BR44L_HUMAN	W	97;97;54	ENSP00000354223:R97W;ENSP00000340784:R97W	ENSP00000340784:R97W	R	-	1	2	BRP44L	166699468	1.000000	0.71417	0.003000	0.11579	0.707000	0.40811	3.576000	0.53878	0.432000	0.26286	0.655000	0.94253	CGG		0.433	MPC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043052.1	NM_016098	
DNAH9	1770	hgsc.bcm.edu	37	17	11550472	11550472	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:11550472G>A	ENST00000262442.4	+	12	2122	c.2054G>A	c.(2053-2055)cGt>cAt	p.R685H	DNAH9_ENST00000454412.2_Missense_Mutation_p.R685H	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	685	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R685H(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CTTCTAAAACGTGACCCAGAG	0.458																																					p.R685H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2054A	17						.						178.0	165.0	170.0					17																	11550472		2203	4300	6503	11491197	SO:0001583	missense	1770	exon12			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.2054G>A	17.37:g.11550472G>A	ENSP00000262442:p.Arg685His		11491197	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.370514	0.61624	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.57107	0.42;0.42	5.24	4.25	0.50352	Dynein heavy chain, domain-1 (1);	2.209180	0.02189	N	0.061209	T	0.56819	0.2011	L	0.60904	1.88	0.80722	D	1	P	0.39940	0.696	B	0.37989	0.262	T	0.54070	-0.8348	10	0.45353	T	0.12	.	14.7161	0.69269	0.0735:0.0:0.9264:0.0	.	685	Q9NYC9	DYH9_HUMAN	H	685	ENSP00000262442:R685H;ENSP00000414874:R685H	ENSP00000262442:R685H	R	+	2	0	DNAH9	11491197	1.000000	0.71417	0.972000	0.41901	0.946000	0.59487	5.547000	0.67249	2.609000	0.88269	0.655000	0.94253	CGT		0.458	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
CENPV	201161	hgsc.bcm.edu	37	17	16246187	16246187	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:16246187C>T	ENST00000299736.4	-	5	825	c.763G>A	c.(763-765)Gat>Aat	p.D255N	PIGL_ENST00000581006.1_Intron|CENPV_ENST00000476243.1_Missense_Mutation_p.D101N	NM_181716.2	NP_859067.2	Q7Z7K6	CENPV_HUMAN	centromere protein V	258					ameboidal cell migration (GO:0001667)|centromere complex assembly (GO:0034508)|mitotic nuclear division (GO:0007067)|pericentric heterochromatin assembly (GO:0031508)|positive regulation of cytokinesis (GO:0032467)|regulation of chromosome organization (GO:0033044)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle midzone (GO:0051233)	carbon-sulfur lyase activity (GO:0016846)	p.D255N(1)		endometrium(1)|large_intestine(2)	3						TTCTCCCAATCGCTGCCATTG	0.527																																					p.D255N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G763A	17						.						176.0	129.0	145.0					17																	16246187		2203	4300	6503	16186912	SO:0001583	missense	201161	exon5			AF514992	CCDS32575.1	17p11.2	2013-11-05	2008-10-29	2008-10-29	ENSG00000166582	ENSG00000166582			29920	protein-coding gene	gene with protein product		608139	"""proline rich 6"""	PRR6		12196509, 18772885	Standard	NM_181716		Approved	p30, CENP-V	uc002gpw.3	Q7Z7K6	OTTHUMG00000059345	ENST00000299736.4:c.763G>A	17.37:g.16246187C>T	ENSP00000299736:p.Asp255Asn		16186912	NM_181716	B2RPK2|Q3L8N5|Q8NFH6	Missense_Mutation	SNP	ENST00000299736.4	37	CCDS32575.1	.	.	.	.	.	.	.	.	.	.	C	4.459	0.084972	0.08583	.	.	ENSG00000166582	ENST00000299736	.	.	.	4.6	1.51	0.23008	.	0.357444	0.31156	N	0.008153	T	0.07413	0.0187	N	0.00926	-1.1	0.21020	N	0.999809	B	0.30664	0.289	B	0.15870	0.014	T	0.36261	-0.9755	9	0.14656	T	0.56	.	8.1126	0.30924	0.0:0.7255:0.0:0.2745	.	255	Q7Z7K6-3	.	N	255	.	ENSP00000299736:D255N	D	-	1	0	CENPV	16186912	0.955000	0.32602	0.032000	0.17829	0.400000	0.30750	1.868000	0.39509	0.141000	0.18875	-0.448000	0.05591	GAT		0.527	CENPV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131877.1	NM_181716	
MAP2K3	5606	hgsc.bcm.edu	37	17	21204257	21204257	+	Silent	SNP	G	G	A	rs56166328	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:21204257G>A	ENST00000342679.4	+	5	600	c.351G>A	c.(349-351)acG>acA	p.T117T	MAP2K3_ENST00000361818.5_Silent_p.T88T|MAP2K3_ENST00000316920.6_Silent_p.T88T	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	117	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.T121T(1)							COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		ACATGCGCACGGTCGACTGTT	0.582																																					p.T88T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G264A	17						.																																			21144850	SO:0001819	synonymous_variant	5606	exon5			L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.351G>A	17.37:g.21204257G>A			21144850	NM_002756	B3KSK7|Q99441|Q9UE71|Q9UE72	Silent	SNP	ENST00000342679.4	37	CCDS11217.1																																																																																				0.582	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109	
TRPV3	162514	hgsc.bcm.edu	37	17	3427633	3427633	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:3427633T>C	ENST00000576742.1	-	13	1923	c.1602A>G	c.(1600-1602)atA>atG	p.I534M	TRPV3_ENST00000301365.4_Missense_Mutation_p.I534M|TRPV3_ENST00000572519.1_Missense_Mutation_p.I534M	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	534					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)	p.I534M(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	AGACAGACAGTATCACAAGCA	0.517																																					p.I534M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1602G	17						.						109.0	99.0	103.0					17																	3427633		2203	4300	6503	3374383	SO:0001583	missense	162514	exon13			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.1602A>G	17.37:g.3427633T>C	ENSP00000461518:p.Ile534Met		3374383	NM_145068	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	37	CCDS11029.1	.	.	.	.	.	.	.	.	.	.	t	16.14	3.038571	0.55003	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	D	0.89050	-2.46	4.98	3.82	0.43975	.	0.070349	0.56097	D	0.000028	D	0.89451	0.6719	L	0.28115	0.83	0.39960	D	0.974659	P;B;P;B;D;D;D	0.89917	0.567;0.11;0.638;0.11;0.993;1.0;1.0	P;B;P;B;P;D;D	0.91635	0.561;0.292;0.702;0.292;0.906;0.999;0.997	D	0.90370	0.4380	10	0.72032	D	0.01	-7.6539	10.8406	0.46712	0.0:0.0:0.2348:0.7652	.	518;518;534;518;534;534;534	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	M	534;534;518	ENSP00000301365:I534M	ENSP00000301365:I534M	I	-	3	3	TRPV3	3374383	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	0.197000	0.17197	2.016000	0.59253	0.460000	0.39030	ATA		0.517	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
NSRP1	84081	hgsc.bcm.edu	37	17	28506220	28506220	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:28506220A>C	ENST00000247026.5	+	5	476	c.413A>C	c.(412-414)gAt>gCt	p.D138A	NSRP1_ENST00000540900.3_3'UTR	NM_001261467.1|NM_032141.3	NP_001248396.1|NP_115517.1	Q9H0G5	NSRP1_HUMAN	nuclear speckle splicing regulatory protein 1	138	Necessary for alternative splicing activity.				developmental process (GO:0032502)|mRNA processing (GO:0006397)|nucleocytoplasmic transport (GO:0006913)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.D138A(1)		autonomic_ganglia(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	14						GGGGAGTTTGATGATAAAGAA	0.378																																					p.D138A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A413C	17						.						38.0	39.0	39.0					17																	28506220		2203	4300	6503	25530346	SO:0001583	missense	84081	exon5			AL136806	CCDS11255.1, CCDS74025.1	17q11.2	2011-05-24	2011-05-24	2011-05-24	ENSG00000126653	ENSG00000126653			25305	protein-coding gene	gene with protein product			"""coiled-coil domain containing 55"""	CCDC55		11230166	Standard	NM_032141		Approved	DKFZP434K1421, NSrp70	uc002heu.4	Q9H0G5	OTTHUMG00000132754	ENST00000247026.5:c.413A>C	17.37:g.28506220A>C	ENSP00000247026:p.Asp138Ala		25530346	NM_032141	Q6FI71	Missense_Mutation	SNP	ENST00000247026.5	37	CCDS11255.1	.	.	.	.	.	.	.	.	.	.	A	12.43	1.934362	0.34096	.	.	ENSG00000126653	ENST00000247026;ENST00000540900;ENST00000394826	T	0.37915	1.17	5.29	5.29	0.74685	Domain of unknown function DUF2040 (1);	0.197323	0.46758	D	0.000269	T	0.13756	0.0333	N	0.00859	-1.14	0.80722	D	1	P	0.34724	0.465	B	0.38225	0.268	T	0.27739	-1.0065	10	0.19147	T	0.46	-15.3793	11.137	0.48381	0.8343:0.1657:0.0:0.0	.	138	Q9H0G5	NSRP1_HUMAN	A	138;69;84	ENSP00000247026:D138A	ENSP00000247026:D138A	D	+	2	0	NSRP1	25530346	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.886000	0.56190	1.998000	0.58463	0.482000	0.46254	GAT		0.378	NSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256121.2	NM_032141	
PLXDC1	57125	hgsc.bcm.edu	37	17	37226255	37226255	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:37226255G>T	ENST00000315392.4	-	13	1448	c.1237C>A	c.(1237-1239)Ctg>Atg	p.L413M	PLXDC1_ENST00000493200.1_5'UTR|PLXDC1_ENST00000444911.2_Missense_Mutation_p.L373M|CTD-2206N4.4_ENST00000583447.1_RNA|PLXDC1_ENST00000539608.1_3'UTR	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	413					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)	p.L413M(1)		kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						TTGGGGGACAGGTTGTTCTGA	0.582											OREG0024368	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L413M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1237A	17						.						87.0	78.0	81.0					17																	37226255		2203	4300	6503	34479781	SO:0001583	missense	57125	exon13			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.1237C>A	17.37:g.37226255G>T	ENSP00000323927:p.Leu413Met	869	34479781	NM_020405	B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Missense_Mutation	SNP	ENST00000315392.4	37	CCDS11333.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.704077	0.30232	.	.	ENSG00000161381	ENST00000315392;ENST00000394318;ENST00000444911	T;T	0.24151	1.87;1.87	5.33	4.36	0.52297	.	0.996892	0.08127	N	0.993863	T	0.24005	0.0581	N	0.22421	0.69	0.80722	D	1	P;P	0.44578	0.838;0.736	P;B	0.44990	0.466;0.372	T	0.00970	-1.1496	10	0.46703	T	0.11	-7.7148	10.1824	0.42977	0.0953:0.0:0.9047:0.0	.	373;413	B4E173;Q8IUK5	.;PXDC1_HUMAN	M	413;340;373	ENSP00000323927:L413M;ENSP00000409687:L373M	ENSP00000323927:L413M	L	-	1	2	PLXDC1	34479781	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.478000	0.35442	1.227000	0.43598	0.462000	0.41574	CTG		0.582	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256892.2	NM_020405	
GSDMB	55876	hgsc.bcm.edu	37	17	38073439	38073439	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:38073439C>T	ENST00000394179.1	-	2	261	c.131G>A	c.(130-132)aGa>aAa	p.R44K	GSDMB_ENST00000520542.1_Missense_Mutation_p.R44K|GSDMB_ENST00000418519.1_Missense_Mutation_p.R44K|GSDMB_ENST00000394175.2_Missense_Mutation_p.R44K|GSDMB_ENST00000360317.3_Missense_Mutation_p.R44K|GSDMB_ENST00000309481.7_Missense_Mutation_p.R44K			Q8TAX9	GSDMB_HUMAN	gasdermin B	44						cytoplasm (GO:0005737)		p.R44K(2)		breast(2)|endometrium(3)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|stomach(2)	21						AAAGAAAGTTCTCTTCTCCCC	0.498																																					p.R44K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G131A	17						.						203.0	182.0	189.0					17																	38073439		2203	4300	6503	35326965	SO:0001583	missense	55876	exon2			AF119884	CCDS11354.1, CCDS42313.1, CCDS54119.1, CCDS54120.1	17q21.2	2008-07-31	2008-07-31	2008-07-31	ENSG00000073605	ENSG00000073605			23690	protein-coding gene	gene with protein product		611221	"""gasdermin-like"""	GSDML		12883658, 15010812, 17350798	Standard	NM_001042471		Approved	PRO2521	uc010cwj.3	Q8TAX9	OTTHUMG00000133248	ENST00000394179.1:c.131G>A	17.37:g.38073439C>T	ENSP00000377733:p.Arg44Lys		35326965	NM_001042471	B4DKK7|Q7Z377|Q8WY76|Q9NX71|Q9P163	Missense_Mutation	SNP	ENST00000394179.1	37		.	.	.	.	.	.	.	.	.	.	C	10.87	1.474098	0.26423	.	.	ENSG00000073605	ENST00000360317;ENST00000394175;ENST00000309481;ENST00000520542;ENST00000418519;ENST00000394179	T;T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05;2.05	3.72	-2.85	0.05734	.	0.826534	0.10330	N	0.687658	T	0.13798	0.0334	L	0.47190	1.495	0.09310	N	1	B;B;B;B	0.25312	0.011;0.123;0.123;0.123	B;B;B;B	0.18561	0.022;0.015;0.015;0.015	T	0.27806	-1.0063	9	.	.	.	.	4.4197	0.11474	0.0:0.315:0.1764:0.5086	.	44;44;44;44	B4DKK7;Q8TAX9-4;Q8TAX9-3;Q8TAX9-2	.;.;.;.	K	44	ENSP00000353465:R44K;ENSP00000377729:R44K;ENSP00000312584:R44K;ENSP00000430157:R44K;ENSP00000415049:R44K;ENSP00000377733:R44K	.	R	-	2	0	GSDMB	35326965	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.650000	0.01991	-0.689000	0.05149	-0.263000	0.10527	AGA		0.498	GSDMB-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_018530	
KRT36	8689	hgsc.bcm.edu	37	17	39643874	39643874	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:39643874A>G	ENST00000328119.6	-	4	814	c.815T>C	c.(814-816)cTg>cCg	p.L272P	KRT36_ENST00000393986.2_Missense_Mutation_p.L222P	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	272	Coil 2.|Rod.				regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)	p.L272P(1)		breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				ATTCTCCACCAGGGCCTCGTA	0.607																																					p.L272P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T815C	17						.						122.0	110.0	114.0					17																	39643874		2203	4300	6503	36897400	SO:0001583	missense	8689	exon4			Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.815T>C	17.37:g.39643874A>G	ENSP00000329165:p.Leu272Pro		36897400	NM_003771	Q86XG4	Missense_Mutation	SNP	ENST00000328119.6	37	CCDS11395.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.563892	0.65651	.	.	ENSG00000126337	ENST00000393986;ENST00000328119	T;T	0.78481	-1.18;-1.18	5.83	4.75	0.60458	Filament (1);	0.000000	0.39615	N	0.001318	D	0.88366	0.6417	M	0.86420	2.815	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	D	0.89318	0.3638	10	0.87932	D	0	.	11.7817	0.52018	0.9317:0.0:0.0683:0.0	.	272	O76013	KRT36_HUMAN	P	222;272	ENSP00000377555:L222P;ENSP00000329165:L272P	ENSP00000329165:L272P	L	-	2	0	KRT36	36897400	0.906000	0.30813	0.996000	0.52242	0.459000	0.32528	7.271000	0.78506	1.043000	0.40175	0.533000	0.62120	CTG		0.607	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259508.1	NM_003771	
ATP6V0A1	535	hgsc.bcm.edu	37	17	40639198	40639198	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:40639198G>A	ENST00000343619.4	+	10	959	c.836G>A	c.(835-837)cGc>cAc	p.R279H	ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.R279H|ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.R236H|ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.R236H|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.R286H|ATP6V0A1_ENST00000544137.1_Intron|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.R279H	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	279					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)	p.R279H(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		GAGGATCACCGCCAGAGGGTT	0.483																																					p.R279H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G836A	17						.						92.0	87.0	89.0					17																	40639198		2203	4300	6503	37892724	SO:0001583	missense	535	exon10			U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.836G>A	17.37:g.40639198G>A	ENSP00000342951:p.Arg279His		37892724	NM_001130021	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	37	CCDS45684.1	.	.	.	.	.	.	.	.	.	.	G	36	5.684649	0.96784	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728	D;D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08;-2.08	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.95449	0.8522	M	0.92649	3.33	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.986;0.986;1.0;1.0	D	0.95590	0.8654	10	0.66056	D	0.02	-15.382	20.1511	0.98086	0.0:0.0:1.0:0.0	.	236;236;286;279;279	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	H	279;279;279;286;236	ENSP00000342951:R279H;ENSP00000444676:R279H;ENSP00000377415:R279H;ENSP00000264649:R286H;ENSP00000443991:R236H	ENSP00000264649:R286H	R	+	2	0	ATP6V0A1	37892724	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.857000	0.99534	2.769000	0.95229	0.650000	0.86243	CGC		0.483	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020	
NAGLU	4669	hgsc.bcm.edu	37	17	40693128	40693128	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:40693128T>C	ENST00000225927.2	+	5	1026	c.925T>C	c.(925-927)Tat>Cat	p.Y309H	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	309			Y -> C (in MPS3B; does not yield active enzyme). {ECO:0000269|PubMed:11836372, ECO:0000269|PubMed:16151907}.		carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)	p.Y309H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	AGACCACATCTATGGGGCCGA	0.572																																					p.Y309H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T925C	17						.						123.0	113.0	116.0					17																	40693128		2203	4300	6503	37946654	SO:0001583	missense	4669	exon5				CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.925T>C	17.37:g.40693128T>C	ENSP00000225927:p.Tyr309His		37946654	NM_000263		Missense_Mutation	SNP	ENST00000225927.2	37	CCDS11427.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.473988	0.84640	.	.	ENSG00000108784	ENST00000225927	D	0.99591	-6.24	5.03	5.03	0.67393	Alpha-N-acetylglucosaminidase, tim-barrel domain (1);	0.270967	0.37715	N	0.001976	D	0.99551	0.9839	H	0.94542	3.55	0.53005	D	0.999969	P	0.48998	0.918	P	0.51742	0.678	D	0.97998	1.0358	10	0.87932	D	0	-1.8624	13.7622	0.62973	0.0:0.0:0.0:1.0	.	309	P54802	ANAG_HUMAN	H	309	ENSP00000225927:Y309H	ENSP00000225927:Y309H	Y	+	1	0	NAGLU	37946654	1.000000	0.71417	0.927000	0.36925	0.752000	0.42762	7.858000	0.86971	2.129000	0.65627	0.454000	0.30748	TAT		0.572	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450385.1	NM_000263	
ETV4	2118	hgsc.bcm.edu	37	17	41613828	41613828	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:41613828A>G	ENST00000319349.5	-	5	520	c.222T>C	c.(220-222)gaT>gaC	p.D74D	ETV4_ENST00000538265.1_Silent_p.D35D|ETV4_ENST00000393664.2_Silent_p.D74D|ETV4_ENST00000545089.1_Silent_p.D74D|ETV4_ENST00000545954.1_Silent_p.D35D|ETV4_ENST00000591713.1_Silent_p.D74D	NM_001079675.2	NP_001073143.1	P43268	ETV4_HUMAN	ets variant 4	74	Asp/Glu-rich (acidic).				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|motor neuron axon guidance (GO:0008045)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.D74D(1)	EWSR1/ETV4(6)|CANT1/ETV4(3)|TMPRSS2/ETV4(13)|DDX5_ENST00000540698/ETV4(2)|KLK2/ETV4(2)	ovary(2)|upper_aerodigestive_tract(1)	3		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)		CAAACTGCTCATCACTGTCTG	0.532			T	"""EWSR1, TMPRSS2, DDX5, KLK2, CANT1"""	"""Ewing sarcoma, Prostate carcinoma"""																																p.D74D	Esophageal Squamous(116;1540 1611 12927 31103 34118)		Dom	yes		17	17q21	2118	"""ets variant gene 4 (E1A enhancer binding protein, E1AF)"""		"""M, E"""	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T222C	17						.						150.0	143.0	145.0					17																	41613828		2203	4300	6503	38969354	SO:0001819	synonymous_variant	2118	exon5			U18018	CCDS11465.1, CCDS58553.1, CCDS59292.1	17q21	2014-04-30	2008-09-12			ENSG00000175832			3493	protein-coding gene	gene with protein product	"""E1A enhancer binding protein"""	600711	"""ets variant gene 4 (E1A enhancer-binding protein, E1AF)"""			8530053, 1547944	Standard	NM_001986		Approved	E1A-F, E1AF, PEA3	uc002idw.3	P43268		ENST00000319349.5:c.222T>C	17.37:g.41613828A>G			38969354	NM_001986	A8K314|B7Z5J3|B7Z9J6|Q96AW9	Silent	SNP	ENST00000319349.5	37	CCDS11465.1																																																																																				0.532	ETV4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453489.1	NM_001986	
SNX11	29916	hgsc.bcm.edu	37	17	46198832	46198832	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:46198832T>G	ENST00000393405.2	+	8	1129	c.775T>G	c.(775-777)Ttg>Gtg	p.L259V	SNX11_ENST00000452859.2_Missense_Mutation_p.L115V|SNX11_ENST00000439357.2_Missense_Mutation_p.L198V|SNX11_ENST00000359238.2_Missense_Mutation_p.L259V|SNX11_ENST00000582104.1_Missense_Mutation_p.L251V|SNX11_ENST00000580219.1_Missense_Mutation_p.L251V	NM_152244.1	NP_689450.1	Q9Y5W9	SNX11_HUMAN	sorting nexin 11	259					intracellular protein transport (GO:0006886)|vesicle organization (GO:0016050)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol phosphate binding (GO:1901981)	p.L259V(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	14						TGCTGTGCCTTTGGACCCTGG	0.522																																					p.L259V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T775G	17						.						138.0	128.0	131.0					17																	46198832		2203	4300	6503	43553831	SO:0001583	missense	29916	exon7			AF121861	CCDS11526.1	17q21.32	2011-05-03			ENSG00000002919	ENSG00000002919		"""Sorting nexins"""	14975	protein-coding gene	gene with protein product		614906					Standard	NM_013323		Approved		uc002ing.1	Q9Y5W9		ENST00000393405.2:c.775T>G	17.37:g.46198832T>G	ENSP00000377059:p.Leu259Val		43553831	NM_013323	B3KRL6|B4DPY5|D3DTV0|Q53YC0|Q9H885	Missense_Mutation	SNP	ENST00000393405.2	37	CCDS11526.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.913910	0.52439	.	.	ENSG00000002919	ENST00000452859;ENST00000393405;ENST00000439357;ENST00000359238	T;T	0.65916	-0.18;-0.18	6.16	2.77	0.32553	.	0.540899	0.17239	N	0.181619	T	0.41166	0.1147	N	0.22421	0.69	0.23132	N	0.998244	B;B;B	0.30793	0.295;0.043;0.043	B;B;B	0.27608	0.081;0.04;0.04	T	0.25779	-1.0122	10	0.45353	T	0.12	-11.9404	3.9357	0.09305	0.1537:0.1621:0.0:0.6841	.	198;251;259	B4DKH7;B4DPY5;Q9Y5W9	.;.;SNX11_HUMAN	V	115;259;198;259	ENSP00000377059:L259V;ENSP00000352175:L259V	ENSP00000352175:L259V	L	+	1	2	SNX11	43553831	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	1.448000	0.35112	0.536000	0.28733	0.528000	0.53228	TTG		0.522	SNX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443423.1		
SKAP1	8631	hgsc.bcm.edu	37	17	46423316	46423316	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:46423316G>A	ENST00000336915.6	-	4	300	c.231C>T	c.(229-231)ggC>ggT	p.G77G	SKAP1_ENST00000584924.1_Silent_p.G77G	NM_001075099.1|NM_003726.3	NP_001068567.1|NP_003717.3	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1	77					positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)	p.G77G(1)		large_intestine(1)|lung(10)|prostate(2)|skin(4)|urinary_tract(1)	18						TGAGGGACAGGCCAAGAGTCC	0.453																																					p.G77G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C231T	17						.						88.0	75.0	79.0					17																	46423316		2203	4300	6503	43778315	SO:0001819	synonymous_variant	8631	exon4			Y11215	CCDS32674.1	17q21.32	2013-01-10	2006-09-28	2006-09-28		ENSG00000141293		"""Pleckstrin homology (PH) domain containing"""	15605	protein-coding gene	gene with protein product		604969	"""src family associated phosphoprotein 1"""	SCAP1		9195899	Standard	NM_003726		Approved	SKAP55	uc002ini.1	Q86WV1		ENST00000336915.6:c.231C>T	17.37:g.46423316G>A			43778315	NM_001075099	D3DTV1|O15268	Silent	SNP	ENST00000336915.6	37	CCDS32674.1																																																																																				0.453	SKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443432.1	NM_003726	
NOL11	25926	hgsc.bcm.edu	37	17	65730492	65730492	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:65730492A>G	ENST00000253247.4	+	8	982	c.867A>G	c.(865-867)gtA>gtG	p.V289V	NOL11_ENST00000535137.1_Silent_p.V107V	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	289					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)	p.V289V(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			GCCTCTCTGTATGGAACATAA	0.323																																					p.V289V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A867G	17						.						46.0	48.0	48.0					17																	65730492		2203	4299	6502	63160954	SO:0001819	synonymous_variant	25926	exon8			AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.867A>G	17.37:g.65730492A>G			63160954	NM_015462	B7Z5V9|Q7L5S1|Q9UG18	Silent	SNP	ENST00000253247.4	37	CCDS11671.1																																																																																				0.323	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448074.1	NM_015462	
ASGR1	432	hgsc.bcm.edu	37	17	7080157	7080157	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:7080157A>G	ENST00000269299.3	-	5	746	c.347T>C	c.(346-348)cTg>cCg	p.L116P	ASGR1_ENST00000574388.1_Missense_Mutation_p.L77P|ASGR1_ENST00000380920.4_Missense_Mutation_p.L15P|ASGR1_ENST00000572879.1_Intron	NM_001197216.2|NM_001671.4	NP_001184145.1|NP_001662.1	P07306	ASGR1_HUMAN	asialoglycoprotein receptor 1	116					cellular response to extracellular stimulus (GO:0031668)|receptor-mediated endocytosis (GO:0006898)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	asialoglycoprotein receptor activity (GO:0004873)|carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.L116P(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	10						ACCTTCACTCAGGTCCTTCTG	0.537																																					p.L77P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T230C	17						.						198.0	166.0	177.0					17																	7080157		2203	4300	6503	7020881	SO:0001583	missense	432	exon4				CCDS11089.1, CCDS56017.1	17p13-p11	2011-08-30			ENSG00000141505	ENSG00000141505		"""C-type lectin domain containing"""	742	protein-coding gene	gene with protein product		108360					Standard	NM_001671		Approved	CLEC4H1	uc002ges.4	P07306	OTTHUMG00000102159	ENST00000269299.3:c.347T>C	17.37:g.7080157A>G	ENSP00000269299:p.Leu116Pro		7020881	NM_001197216	I3L1X1	Missense_Mutation	SNP	ENST00000269299.3	37	CCDS11089.1	.	.	.	.	.	.	.	.	.	.	A	12.39	1.923695	0.34002	.	.	ENSG00000141505	ENST00000269299;ENST00000380920	T	0.36340	1.26	4.89	3.73	0.42828	Hepatic lectin, N-terminal (1);	0.388894	0.19419	N	0.114747	T	0.54967	0.1891	M	0.78049	2.395	0.23640	N	0.997222	D	0.64830	0.994	D	0.65874	0.939	T	0.44982	-0.9292	10	0.87932	D	0	.	8.2134	0.31496	0.7974:0.2026:0.0:0.0	.	116	P07306	ASGR1_HUMAN	P	116;77	ENSP00000269299:L116P	ENSP00000269299:L116P	L	-	2	0	ASGR1	7020881	0.075000	0.21258	0.038000	0.18304	0.358000	0.29455	1.772000	0.38552	2.180000	0.69256	0.379000	0.24179	CTG		0.537	ASGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220004.3	NM_001671	
GPR142	350383	hgsc.bcm.edu	37	17	72366757	72366757	+	Silent	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr17:72366757G>T	ENST00000335666.4	+	3	504	c.456G>T	c.(454-456)ccG>ccT	p.P152P		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	152						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.P152P(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						AGAGGTCCCCGTGTGTGGCTG	0.652																																					p.P152P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G456T	17						.						97.0	81.0	86.0					17																	72366757		2203	4300	6503	69878352	SO:0001819	synonymous_variant	350383	exon3			AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.456G>T	17.37:g.72366757G>T			69878352	NM_181790	A4CYJ8|Q86SL3	Silent	SNP	ENST00000335666.4	37	CCDS11698.1																																																																																				0.652	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790	
CXADR	1525	hgsc.bcm.edu	37	21	18937774	18937774	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr21:18937774A>G	ENST00000284878.7	+	7	1610	c.862A>G	c.(862-864)Acg>Gcg	p.T288A	CXADR_ENST00000306618.10_Missense_Mutation_p.T247A|CXADR_ENST00000400169.1_Missense_Mutation_p.T288A|CXADR_ENST00000356275.6_Missense_Mutation_p.Y80C|CXADR_ENST00000400166.1_Silent_p.V200V|CXADR_ENST00000400165.1_Silent_p.V148V	NM_001338.4	NP_001329.1	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	288					actin cytoskeleton reorganization (GO:0031532)|AV node cell to bundle of His cell communication (GO:0086067)|blood coagulation (GO:0007596)|cardiac muscle fiber development (GO:0048739)|cell-cell junction organization (GO:0045216)|defense response to virus (GO:0051607)|epithelial structure maintenance (GO:0010669)|gamma-delta T cell activation (GO:0046629)|germ cell migration (GO:0008354)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|homotypic cell-cell adhesion (GO:0034109)|leukocyte migration (GO:0050900)|mitochondrion organization (GO:0007005)|neutrophil chemotaxis (GO:0030593)|regulation of immune response (GO:0050776)|transepithelial transport (GO:0070633)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|adherens junction (GO:0005912)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|filopodium (GO:0030175)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|cell adhesion molecule binding (GO:0050839)|connexin binding (GO:0071253)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|virus receptor activity (GO:0001618)	p.T288A(1)		endometrium(2)|large_intestine(5)|lung(1)|ovary(1)|prostate(2)	11				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		AAAGAGCCGTACGTCCACTGC	0.438																																					p.T288A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A862G	21						.						76.0	78.0	78.0					21																	18937774		2203	4300	6503	17859645	SO:0001583	missense	1525	exon7			Y07593	CCDS33519.1, CCDS56204.1, CCDS56205.1, CCDS56206.1, CCDS56207.1	21q21.1	2013-01-29			ENSG00000154639	ENSG00000154639		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2559	protein-coding gene	gene with protein product		602621				9036860, 9096397	Standard	NM_001338		Approved	CAR	uc002yki.3	P78310	OTTHUMG00000074508	ENST00000284878.7:c.862A>G	21.37:g.18937774A>G	ENSP00000284878:p.Thr288Ala		17859645	NM_001338	B2R8V8|B7WPI3|D3YHP0|O00694|Q8WWT6|Q8WWT7|Q8WWT8|Q9UKV4	Missense_Mutation	SNP	ENST00000284878.7	37	CCDS33519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.11|12.11	1.839078|1.839078	0.32513|0.32513	.|.	.|.	ENSG00000154639|ENSG00000154639	ENST00000284878;ENST00000400169;ENST00000306618|ENST00000356275	T;T;D|.	0.86366|.	-0.94;-1.02;-2.11|.	5.3|5.3	4.15|4.15	0.48705|0.48705	.|.	0.279446|.	0.41712|.	D|.	0.000829|.	T|T	0.37517|0.37517	0.1006|0.1006	.|.	.|.	.|.	0.19945|0.19945	N|N	0.999945|0.999945	B;B|B	0.06786|0.06786	0.001;0.001|0.001	B;B|B	0.08055|0.04013	0.003;0.002|0.001	T|T	0.28170|0.28170	-1.0052|-1.0052	9|7	0.07175|0.87932	T|D	0.84|0	.|.	10.0863|10.0863	0.42421|0.42421	0.9212:0.0:0.0788:0.0|0.9212:0.0:0.0788:0.0	.|.	288;288|80	B7WPI3;P78310|P78310-3	.;CXAR_HUMAN|.	A|C	288;288;247|80	ENSP00000284878:T288A;ENSP00000383033:T288A;ENSP00000303395:T247A|.	ENSP00000284878:T288A|ENSP00000348620:Y80C	T|Y	+|+	1|2	0|0	CXADR|CXADR	17859645|17859645	0.905000|0.905000	0.30787|0.30787	0.738000|0.738000	0.30950|0.30950	0.975000|0.975000	0.68041|0.68041	3.756000|3.756000	0.55205|0.55205	2.137000|2.137000	0.66172|0.66172	0.459000|0.459000	0.35465|0.35465	ACG|TAC		0.438	CXADR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000158209.1		
LTN1	26046	hgsc.bcm.edu	37	21	30332952	30332952	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr21:30332952T>A	ENST00000361371.5	-	12	2319	c.2240A>T	c.(2239-2241)aAc>aTc	p.N747I	LTN1_ENST00000389194.2_Missense_Mutation_p.N793I			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	747					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.N747I(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						ATCTGCCAAGTTGACCAATTT	0.388																																					p.N793I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2378T	21						.						114.0	101.0	105.0					21																	30332952		2203	4300	6503	29254823	SO:0001583	missense	26046	exon12			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.2240A>T	21.37:g.30332952T>A	ENSP00000354977:p.Asn747Ile		29254823	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	37		.	.	.	.	.	.	.	.	.	.	T	5.345	0.248988	0.10130	.	.	ENSG00000198862	ENST00000389194;ENST00000361371	T;T	0.17370	2.28;2.29	5.25	1.05	0.20165	.	0.979287	0.08440	N	0.945585	T	0.07324	0.0185	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38714	-0.9648	10	0.33141	T	0.24	.	1.5874	0.02647	0.1501:0.2092:0.342:0.2987	.	747	O94822	LTN1_HUMAN	I	793;747	ENSP00000373846:N793I;ENSP00000354977:N747I	ENSP00000354977:N747I	N	-	2	0	LTN1	29254823	0.026000	0.19158	0.015000	0.15790	0.267000	0.26476	1.273000	0.33121	0.063000	0.16370	-0.435000	0.05868	AAC		0.388	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
RWDD2B	10069	hgsc.bcm.edu	37	21	30380747	30380747	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr21:30380747T>A	ENST00000493196.1	-	2	363	c.263A>T	c.(262-264)aAt>aTt	p.N88I	RWDD2B_ENST00000486719.1_5'UTR	NM_016940.2	NP_058636.1	P57060	RWD2B_HUMAN	RWD domain containing 2B	88	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.							p.N88I(1)		endometrium(1)|kidney(1)|large_intestine(8)|lung(2)	12						CAGGTTCATATTGATAGTAAA	0.368																																					p.N88I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A263T	21						.						118.0	115.0	116.0					21																	30380747		2203	4300	6503	29302618	SO:0001583	missense	10069	exon2			AF212232	CCDS13582.1	21q22.11	2012-12-07	2007-07-17	2007-07-17	ENSG00000156253	ENSG00000156253			1302	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 6"""	C21orf6		10729227	Standard	NM_016940		Approved	GL011	uc002yms.3	P57060	OTTHUMG00000078805	ENST00000493196.1:c.263A>T	21.37:g.30380747T>A	ENSP00000418693:p.Asn88Ile		29302618	NM_016940		Missense_Mutation	SNP	ENST00000493196.1	37	CCDS13582.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.688710	0.48097	.	.	ENSG00000156253	ENST00000493196	T	0.21932	1.98	5.49	0.43	0.16515	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.134911	0.64402	D	0.000003	T	0.17916	0.0430	M	0.68952	2.095	0.28953	N	0.890281	B	0.20164	0.042	B	0.24394	0.053	T	0.13522	-1.0506	10	0.36615	T	0.2	-15.8143	2.9337	0.05808	0.1168:0.1284:0.1223:0.6325	.	88	P57060	RWD2B_HUMAN	I	88	ENSP00000418693:N88I	ENSP00000418693:N88I	N	-	2	0	RWDD2B	29302618	0.989000	0.36119	0.703000	0.30354	0.977000	0.68977	2.263000	0.43293	-0.060000	0.13132	-0.250000	0.11733	AAT		0.368	RWDD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171858.1		
TIAM1	7074	hgsc.bcm.edu	37	21	32595799	32595799	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr21:32595799G>T	ENST00000286827.3	-	9	2389	c.1918C>A	c.(1918-1920)Ctc>Atc	p.L640I	TIAM1_ENST00000541036.1_Missense_Mutation_p.L640I|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	640					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L640I(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GCAAAAGCGAGAAGCCTTTTG	0.498																																					p.L640I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1918A	21						.						84.0	86.0	86.0					21																	32595799		2203	4300	6503	31517670	SO:0001583	missense	7074	exon9				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1918C>A	21.37:g.32595799G>T	ENSP00000286827:p.Leu640Ile		31517670	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552462	0.86127	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.63913	-0.02;-0.07	4.5	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.72614	0.3482	M	0.73217	2.22	0.58432	D	0.999999	P;P;P;P	0.50528	0.925;0.878;0.936;0.878	P;P;P;P	0.52627	0.704;0.665;0.659;0.509	T	0.77885	-0.2421	10	0.87932	D	0	.	17.7573	0.88453	0.0:0.0:1.0:0.0	.	640;640;481;640	F5GZ53;B7ZLR6;E9PD83;Q13009	.;.;.;TIAM1_HUMAN	I	640;481;640	ENSP00000286827:L640I;ENSP00000441570:L640I	ENSP00000286827:L640I	L	-	1	0	TIAM1	31517670	1.000000	0.71417	0.593000	0.28771	0.946000	0.59487	6.521000	0.73778	2.496000	0.84212	0.655000	0.94253	CTC		0.498	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
BRWD1	54014	hgsc.bcm.edu	37	21	40574405	40574405	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr21:40574405G>A	ENST00000333229.2	-	38	4758	c.4431C>T	c.(4429-4431)acC>acT	p.T1477T	BRWD1_ENST00000380800.3_Silent_p.T1477T|BRWD1_ENST00000342449.3_Silent_p.T1477T	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1477					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				AGGTAGACTGGGTAGGAGAAC	0.418																																					p.T1477T	Melanoma(170;988 1986 4794 16843 39731)											.	.	0			c.C4431T	21						.						89.0	81.0	84.0					21																	40574405		2203	4300	6503	39496275	SO:0001819	synonymous_variant	54014	exon38			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.4431C>T	21.37:g.40574405G>A			39496275	NM_033656	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Silent	SNP	ENST00000333229.2	37	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	G	6.880	0.531825	0.13127	.	.	ENSG00000185658	ENST00000424441	.	.	.	5.27	-4.75	0.03239	.	.	.	.	.	T	0.40222	0.1108	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40289	-0.9571	4	.	.	.	0.2813	4.2238	0.10570	0.4677:0.0968:0.3377:0.0978	.	.	.	.	S	415	.	.	P	-	1	0	BRWD1	39496275	0.016000	0.18221	0.080000	0.20451	0.895000	0.52256	-0.301000	0.08232	-0.560000	0.06102	0.655000	0.94253	CCA		0.418	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
ATF7IP2	80063	hgsc.bcm.edu	37	16	10532080	10532080	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:10532080T>C	ENST00000396560.2	+	5	1310	c.1083T>C	c.(1081-1083)gcT>gcC	p.A361A	ATF7IP2_ENST00000543967.1_Intron|ATF7IP2_ENST00000324570.5_Silent_p.A361A|ATF7IP2_ENST00000356427.2_Silent_p.A361A|ATF7IP2_ENST00000396559.1_Silent_p.A361A	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	361					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A361A(1)		large_intestine(3)	3						AAGGAATAGCTGATAAACTTT	0.393																																					p.A361A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1083C	16						.						169.0	166.0	167.0					16																	10532080		2197	4300	6497	10439581	SO:0001819	synonymous_variant	80063	exon4			AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.1083T>C	16.37:g.10532080T>C			10439581	NM_024997	B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Silent	SNP	ENST00000396560.2	37	CCDS10540.1																																																																																				0.393	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251961.1	NM_024997	
TNFRSF17	608	hgsc.bcm.edu	37	16	12060086	12060086	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:12060086T>G	ENST00000053243.1	+	2	383	c.165T>G	c.(163-165)atT>atG	p.I55M	TNFRSF17_ENST00000396495.3_Intron|RP11-166B2.1_ENST00000532936.1_Intron	NM_001192.2	NP_001183.2	Q02223	TNR17_HUMAN	tumor necrosis factor receptor superfamily, member 17	55					cell proliferation (GO:0008283)|immune system process (GO:0002376)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.I55M(1)		large_intestine(3)|lung(3)	6						CGAATGCGATTCTCTGGACCT	0.353			T	IL2	intestinal T-cell lymphoma																																p.I55M			Dom	yes		16	16p13.1	608	"""tumor necrosis factor receptor superfamily, member 17"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T165G	16						.						131.0	120.0	124.0					16																	12060086		2197	4300	6497	11967587	SO:0001583	missense	608	exon2			Z29574	CCDS10552.1	16p13.1	2013-05-22			ENSG00000048462	ENSG00000048462		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11913	protein-coding gene	gene with protein product		109545		BCMA		1396583, 8165126	Standard	NM_001192		Approved	BCM, CD269, TNFRSF13A	uc002dbv.3	Q02223	OTTHUMG00000129826	ENST00000053243.1:c.165T>G	16.37:g.12060086T>G	ENSP00000053243:p.Ile55Met		11967587	NM_001192	Q2TQ40	Missense_Mutation	SNP	ENST00000053243.1	37	CCDS10552.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.364440	0.41902	.	.	ENSG00000048462	ENST00000053243;ENST00000435355	T	0.10960	2.82	6.06	-0.278	0.12894	.	0.369852	0.23382	N	0.048796	T	0.15609	0.0376	L	0.57536	1.79	0.35827	D	0.825024	D;P	0.60160	0.987;0.868	P;P	0.56916	0.809;0.483	T	0.23476	-1.0187	10	0.72032	D	0.01	-13.181	1.4588	0.02391	0.1295:0.2204:0.1347:0.5154	.	52;55	E7EQ20;Q02223	.;TNR17_HUMAN	M	55;52	ENSP00000053243:I55M	ENSP00000053243:I55M	I	+	3	3	TNFRSF17	11967587	0.990000	0.36364	0.340000	0.25575	0.543000	0.35085	0.336000	0.19823	-0.335000	0.08451	-0.290000	0.09829	ATT		0.353	TNFRSF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252062.1		
DCUN1D3	123879	hgsc.bcm.edu	37	16	20871444	20871444	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:20871444A>C	ENST00000324344.4	-	3	964	c.679T>G	c.(679-681)Ttc>Gtc	p.F227V	DCUN1D3_ENST00000563934.1_Missense_Mutation_p.F227V|ERI2_ENST00000564349.1_Intron	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	227	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.				negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)		p.F227V(1)		NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		TCTGTTAGGAAGTTTAGCCAT	0.512																																					p.F227V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T679G	16						.						148.0	148.0	148.0					16																	20871444		2201	4300	6501	20778945	SO:0001583	missense	123879	exon3			BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.679T>G	16.37:g.20871444A>C	ENSP00000319482:p.Phe227Val		20778945	NM_173475	B3KVY4	Missense_Mutation	SNP	ENST00000324344.4	37	CCDS10592.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.620075	0.87460	.	.	ENSG00000188215	ENST00000324344	.	.	.	6.08	6.08	0.98989	Domain of unknown function DUF298 (2);	0.000000	0.85682	D	0.000000	D	0.87676	0.6237	H	0.96142	3.775	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	D	0.91410	0.5150	9	0.87932	D	0	-28.0802	16.6438	0.85155	1.0:0.0:0.0:0.0	.	227	Q8IWE4	DCNL3_HUMAN	V	227	.	ENSP00000319482:F227V	F	-	1	0	DCUN1D3	20778945	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.268000	0.95675	2.333000	0.79357	0.533000	0.62120	TTC		0.512	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254415.2	NM_173475	
DNAH3	55567	hgsc.bcm.edu	37	16	20975825	20975825	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:20975825A>G	ENST00000261383.3	-	53	9380	c.9381T>C	c.(9379-9381)atT>atC	p.I3127I	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3127	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.I3127I(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CAATGTTTTCAATCAAGACAG	0.458																																					p.I3127I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T9381C	16						.						176.0	169.0	171.0					16																	20975825		2201	4300	6501	20883326	SO:0001819	synonymous_variant	55567	exon53			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.9381T>C	16.37:g.20975825A>G			20883326	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	37	CCDS10594.1																																																																																				0.458	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
DNAH3	55567	hgsc.bcm.edu	37	16	21128625	21128625	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:21128625A>G	ENST00000261383.3	-	12	1712	c.1713T>C	c.(1711-1713)taT>taC	p.Y571Y	DNAH3_ENST00000415178.1_Silent_p.Y571Y	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	571	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.Y571Y(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GGAGCAGATTATATCCTTTCA	0.398																																					p.Y571Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1713C	16						.						62.0	59.0	60.0					16																	21128625		2200	4299	6499	21036126	SO:0001819	synonymous_variant	55567	exon12			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.1713T>C	16.37:g.21128625A>G			21036126	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	37	CCDS10594.1																																																																																				0.398	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
GTF3C1	2975	hgsc.bcm.edu	37	16	27517276	27517276	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:27517276C>T	ENST00000356183.4	-	10	1729	c.1714G>A	c.(1714-1716)Gac>Aac	p.D572N	GTF3C1_ENST00000561623.1_Missense_Mutation_p.D572N	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	572					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.D572N(1)		breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						CTGTTGCTGTCCGCACAGTGG	0.562																																					p.D572N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1714A	16						.						138.0	115.0	123.0					16																	27517276		2197	4300	6497	27424777	SO:0001583	missense	2975	exon10			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.1714G>A	16.37:g.27517276C>T	ENSP00000348510:p.Asp572Asn		27424777	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	C	11.65	1.703371	0.30232	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.26518	1.73	5.39	3.44	0.39384	.	0.980801	0.08390	N	0.953059	T	0.23210	0.0561	L	0.43152	1.355	0.09310	N	1	B;B	0.16603	0.013;0.018	B;B	0.17433	0.012;0.018	T	0.28396	-1.0045	10	0.27785	T	0.31	-5.2129	9.0516	0.36380	0.0:0.842:0.0:0.158	.	572;572	Q12789;Q12789-3	TF3C1_HUMAN;.	N	572;570	ENSP00000348510:D572N	ENSP00000348510:D572N	D	-	1	0	GTF3C1	27424777	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	0.844000	0.27654	0.756000	0.33013	0.655000	0.94253	GAC		0.562	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
SHCBP1	79801	hgsc.bcm.edu	37	16	46617568	46617568	+	Splice_Site	SNP	T	T	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:46617568T>A	ENST00000303383.3	-	12	1819	c.1553A>T	c.(1552-1554)gAc>gTc	p.D518V		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	518					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)			p.D518V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				ATCTAAGAAGTCCTGTGACAT	0.299																																					p.D518V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1553T	16						.						60.0	60.0	60.0					16																	46617568		2201	4298	6499	45175069	SO:0001630	splice_region_variant	79801	exon12			AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.1552-1A>T	16.37:g.46617568T>A			45175069	NM_024745	Q96N60|Q9BVS0|Q9H6P6	Missense_Mutation	SNP	ENST00000303383.3	37	CCDS10720.1	.	.	.	.	.	.	.	.	.	.	T	6.919	0.539124	0.13250	.	.	ENSG00000171241	ENST00000303383	T	0.80214	-1.35	3.91	3.91	0.45181	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.093945	0.64402	D	0.000001	D	0.83936	0.5362	L	0.50333	1.59	0.80722	D	1	D	0.69078	0.997	D	0.68039	0.955	T	0.80518	-0.1347	10	0.18276	T	0.48	-18.7256	13.1972	0.59745	0.0:0.0:0.0:1.0	.	518	Q8NEM2	SHCBP_HUMAN	V	518	ENSP00000306473:D518V	ENSP00000306473:D518V	D	-	2	0	SHCBP1	45175069	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	6.399000	0.73248	1.768000	0.52137	0.377000	0.23210	GAC		0.299	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255740.1	NM_024745	Missense_Mutation
PMFBP1	83449	hgsc.bcm.edu	37	16	72163020	72163020	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:72163020A>C	ENST00000237353.10	-	13	2156	c.1895T>G	c.(1894-1896)cTg>cGg	p.L632R	PMFBP1_ENST00000537465.1_Missense_Mutation_p.L637R|PMFBP1_ENST00000355636.6_Missense_Mutation_p.L487R	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	637						cytoplasm (GO:0005737)		p.L632R(1)		NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				TCCCTCCATCAGCTTCTCATG	0.493																																					p.L487R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1460G	16						.						260.0	264.0	262.0					16																	72163020		2198	4300	6498	70720521	SO:0001583	missense	83449	exon14			AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.1895T>G	16.37:g.72163020A>C	ENSP00000237353:p.Leu632Arg		70720521	NM_001160213	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	37	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	A	0.206	-1.040904	0.02013	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000355636	T;T;T	0.11930	2.73;2.73;2.73	4.55	-0.278	0.12894	.	1.653550	0.03962	N	0.290242	T	0.07954	0.0199	N	0.24115	0.695	0.09310	N	1	B;B;B	0.19583	0.009;0.037;0.037	B;B;B	0.19946	0.027;0.027;0.027	T	0.31916	-0.9926	10	0.17369	T	0.5	3.3464	0.4982	0.00575	0.4417:0.1817:0.2014:0.1752	.	637;632;637	Q8TBY8;Q8TBY8-2;G3V1Q7	PMFBP_HUMAN;.;.	R	637;632;487	ENSP00000443817:L637R;ENSP00000237353:L632R;ENSP00000347854:L487R	ENSP00000237353:L632R	L	-	2	0	PMFBP1	70720521	0.001000	0.12720	0.000000	0.03702	0.050000	0.14768	1.001000	0.29783	-0.077000	0.12752	0.533000	0.62120	CTG		0.493	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293	
ZFHX3	463	hgsc.bcm.edu	37	16	72829691	72829691	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:72829691G>A	ENST00000268489.5	-	9	7562	c.6890C>T	c.(6889-6891)gCc>gTc	p.A2297V	ZFHX3_ENST00000397992.5_Missense_Mutation_p.A1383V	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2297					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.A2297V(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				ATTCTTCCTGGCCTTCTGTCG	0.448																																					p.A2297V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6890T	16						.						134.0	138.0	136.0					16																	72829691		2198	4300	6498	71387192	SO:0001583	missense	463	exon9			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6890C>T	16.37:g.72829691G>A	ENSP00000268489:p.Ala2297Val		71387192	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001089	0.74818	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	D;D	0.96232	-3.95;-3.95	5.65	5.65	0.86999	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.49916	D	0.000136	D	0.97312	0.9121	L	0.43923	1.385	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.97969	1.0342	10	0.72032	D	0.01	.	19.722	0.96147	0.0:0.0:1.0:0.0	.	2297	Q15911	ZFHX3_HUMAN	V	2297;1383	ENSP00000268489:A2297V;ENSP00000438926:A1383V	ENSP00000268489:A2297V	A	-	2	0	ZFHX3	71387192	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.657000	0.90304	0.561000	0.74099	GCC		0.448	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ADAT1	23536	hgsc.bcm.edu	37	16	75642128	75642128	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:75642128T>C	ENST00000307921.3	-	9	1428	c.1283A>G	c.(1282-1284)cAg>cGg	p.Q428R	RP11-77K12.8_ENST00000564489.1_RNA	NM_012091.3	NP_036223.2	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	428	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|RNA binding (GO:0003723)|tRNA-specific adenosine deaminase activity (GO:0008251)	p.Q428R(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)	19						GTACCTTGCCTGAAGGCTTCC	0.448																																					p.Q428R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1283G	16						.						258.0	230.0	240.0					16																	75642128		2198	4300	6498	74199629	SO:0001583	missense	23536	exon9			AF125188	CCDS10922.1	16q23	2008-02-05			ENSG00000065457	ENSG00000065457			228	protein-coding gene	gene with protein product		604230				10430867	Standard	NM_012091		Approved		uc002feo.2	Q9BUB4	OTTHUMG00000137611	ENST00000307921.3:c.1283A>G	16.37:g.75642128T>C	ENSP00000310015:p.Gln428Arg		74199629	NM_012091	Q9NVB7|Q9UNG3	Missense_Mutation	SNP	ENST00000307921.3	37	CCDS10922.1	.	.	.	.	.	.	.	.	.	.	T	14.40	2.522837	0.44866	.	.	ENSG00000065457	ENST00000307921;ENST00000542252	D	0.93488	-3.23	5.41	3.17	0.36434	Adenosine deaminase/editase (3);	0.481939	0.23048	N	0.052526	D	0.88134	0.6355	L	0.46885	1.475	0.36704	D	0.880263	B	0.16603	0.018	B	0.21360	0.034	T	0.79029	-0.1970	10	0.11485	T	0.65	-0.0488	8.2691	0.31833	0.0:0.1674:0.0:0.8326	.	428	Q9BUB4	ADAT1_HUMAN	R	428;399	ENSP00000310015:Q428R	ENSP00000310015:Q428R	Q	-	2	0	ADAT1	74199629	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	4.331000	0.59273	0.377000	0.24735	0.460000	0.39030	CAG		0.448	ADAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269027.1	NM_012091	
ADAMTS18	170692	hgsc.bcm.edu	37	16	77334179	77334179	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:77334179G>A	ENST00000282849.5	-	17	3073	c.2655C>T	c.(2653-2655)tgC>tgT	p.C885C		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	885					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.C885C(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						AGGAGACGGAGCACTCTGACT	0.463																																					p.C885C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2655T	16						.						153.0	125.0	134.0					16																	77334179		2198	4300	6498	75891680	SO:0001819	synonymous_variant	170692	exon17			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2655C>T	16.37:g.77334179G>A			75891680	NM_199355	Q6P4R5|Q6ZWJ9	Silent	SNP	ENST00000282849.5	37	CCDS10926.1																																																																																				0.463	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
MBTPS1	8720	hgsc.bcm.edu	37	16	84132698	84132698	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr16:84132698C>T	ENST00000343411.3	-	3	876	c.381G>A	c.(379-381)acG>acA	p.T127T		NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	127					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)	p.T127T(2)		NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TTCGTTGGGGCGTGACCCGTT	0.418																																					p.T127T												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.G381A	16						.						192.0	178.0	182.0					16																	84132698		2200	4300	6500	82690199	SO:0001819	synonymous_variant	8720	exon3			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.381G>A	16.37:g.84132698C>T			82690199	NM_003791	A8K6V8|Q24JQ2|Q9UF67	Silent	SNP	ENST00000343411.3	37	CCDS10941.1																																																																																				0.418	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
LPIN2	9663	hgsc.bcm.edu	37	18	2951184	2951184	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr18:2951184T>G	ENST00000261596.4	-	4	697	c.459A>C	c.(457-459)aaA>aaC	p.K153N	RP11-737O24.2_ENST00000581488.1_RNA|RP11-737O24.2_ENST00000584431.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	153					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GTTTTTTCTTTTTCACAGAAC	0.448																																					p.K153N												.	.	0			c.A459C	18						.						125.0	106.0	112.0					18																	2951184		2203	4300	6503	2941184	SO:0001583	missense	9663	exon4			D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.459A>C	18.37:g.2951184T>G	ENSP00000261596:p.Lys153Asn		2941184	NM_014646	A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	37	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	T	19.96	3.924121	0.73213	.	.	ENSG00000101577	ENST00000261596;ENST00000455369	D	0.85013	-1.93	5.92	3.57	0.40892	.	0.086507	0.85682	D	0.000000	D	0.90837	0.7122	M	0.82716	2.605	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.88794	0.3280	10	0.33940	T	0.23	.	8.517	0.33253	0.0:0.2436:0.0:0.7564	.	153	Q92539	LPIN2_HUMAN	N	153	ENSP00000261596:K153N	ENSP00000261596:K153N	K	-	3	2	LPIN2	2941184	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.581000	0.23819	1.062000	0.40625	0.533000	0.62120	AAA		0.448	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
FHOD3	80206	hgsc.bcm.edu	37	18	34174816	34174816	+	Missense_Mutation	SNP	G	G	A	rs144223411		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr18:34174816G>A	ENST00000359247.4	+	7	673	c.673G>A	c.(673-675)Gca>Aca	p.A225T	FHOD3_ENST00000590592.1_Missense_Mutation_p.A225T|FHOD3_ENST00000257209.4_Missense_Mutation_p.A225T|FHOD3_ENST00000445677.1_Missense_Mutation_p.A225T|FHOD3_ENST00000591635.1_5'UTR	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	225	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)		p.A225T(2)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GGAGTCCAACGCACCTCTCCT	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		20901	0.0		0.001	False		,,,				2504	0.0				p.A225T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G673A	18						.	G	THR/ALA	0,4406		0,0,2203	151.0	117.0	128.0		673	5.3	0.4	18	dbSNP_134	128	8,8592	6.4+/-24.3	0,8,4292	yes	missense	FHOD3	NM_025135.2	58	0,8,6495	AA,AG,GG		0.093,0.0,0.0615	probably-damaging	225/1440	34174816	8,12998	2203	4300	6503	32428814	SO:0001583	missense	80206	exon7			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.673G>A	18.37:g.34174816G>A	ENSP00000352186:p.Ala225Thr		32428814	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		.	.	.	.	.	.	.	.	.	.	G	16.89	3.248499	0.59103	0.0	9.3E-4	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.78481	-1.18;-1.18;-1.18	5.3	5.3	0.74995	GTPase-binding/formin homology 3 (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.051376	0.85682	D	0.000000	D	0.84370	0.5457	M	0.70595	2.14	0.47037	D	0.999296	D;D;D	0.89917	0.999;1.0;0.998	P;P;P	0.60173	0.87;0.837;0.846	D	0.85804	0.1375	10	0.87932	D	0	.	11.8602	0.52461	0.0:0.0:0.8253:0.1746	.	225;225;225	Q2V2M9;Q2V2M9-3;E5F5Q0	FHOD3_HUMAN;.;.	T	225	ENSP00000257209:A225T;ENSP00000352186:A225T;ENSP00000411430:A225T	ENSP00000257209:A225T	A	+	1	0	FHOD3	32428814	1.000000	0.71417	0.407000	0.26434	0.001000	0.01503	7.500000	0.81588	2.625000	0.88918	0.655000	0.94253	GCA		0.517	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
MC4R	4160	hgsc.bcm.edu	37	18	58038742	58038742	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr18:58038742T>C	ENST00000299766.3	-	1	1259	c.841A>G	c.(841-843)Atg>Gtg	p.M281V		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	281					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)	p.M281V(1)		endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				AAGTGAGACATGAAGCACACA	0.418																																					p.M281V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A841G	18						.						128.0	113.0	118.0					18																	58038742		2203	4300	6503	56189722	SO:0001583	missense	4160	exon1			AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.841A>G	18.37:g.58038742T>C	ENSP00000299766:p.Met281Val		56189722	NM_005912	B2RAC3|Q16317|Q3MIJ6	Missense_Mutation	SNP	ENST00000299766.3	37	CCDS11976.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.455339	0.63401	.	.	ENSG00000166603	ENST00000299766	T	0.71579	-0.58	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.68348	0.2991	L	0.45470	1.425	0.58432	D	0.999997	P	0.42871	0.792	B	0.43194	0.411	T	0.72164	-0.4373	10	0.66056	D	0.02	.	14.1876	0.65617	0.0:0.0:0.0:1.0	.	281	P32245	MC4R_HUMAN	V	281	ENSP00000299766:M281V	ENSP00000299766:M281V	M	-	1	0	MC4R	56189722	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.238000	0.73509	0.533000	0.62120	ATG		0.418	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256139.1	NM_005912	
ENOSF1	55556	hgsc.bcm.edu	37	18	690585	690585	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr18:690585G>A	ENST00000251101.7	-	8	670	c.582C>T	c.(580-582)tgC>tgT	p.C194C	ENOSF1_ENST00000580982.1_Silent_p.C118C|ENOSF1_ENST00000340116.7_Silent_p.C215C|ENOSF1_ENST00000383578.3_Silent_p.C112C|ENOSF1_ENST00000319815.6_5'Flank|ENOSF1_ENST00000583973.1_5'Flank	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1	194					cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)	p.C194C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						CCAGCCAGGCGCACGATGTCG	0.502																																					p.C112C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C336T	18						.						123.0	106.0	112.0					18																	690585		2203	4300	6503	680585	SO:0001819	synonymous_variant	55556	exon7			X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.582C>T	18.37:g.690585G>A			680585	NM_001126123	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Silent	SNP	ENST00000251101.7	37	CCDS11822.1																																																																																				0.502	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254312.2	NM_017512	
CCDC102B	79839	hgsc.bcm.edu	37	18	66721369	66721369	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr18:66721369T>C	ENST00000360242.5	+	8	1654	c.1537T>C	c.(1537-1539)Tgg>Cgg	p.W513R	CCDC102B_ENST00000319445.6_Missense_Mutation_p.W513R	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	513								p.W513R(1)		breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				CTTGCAAAACTGGTAATTTTT	0.333																																					p.W513R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1537C	18						.						53.0	55.0	54.0					18																	66721369		2202	4300	6502	64872349	SO:0001583	missense	79839	exon10			AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.1537T>C	18.37:g.66721369T>C	ENSP00000353377:p.Trp513Arg		64872349	NM_001093729	Q7Z467|Q8NDK7|Q9H5C1	Missense_Mutation	SNP	ENST00000360242.5	37	CCDS11996.2	.	.	.	.	.	.	.	.	.	.	T	10.85	1.467819	0.26335	.	.	ENSG00000150636	ENST00000319445;ENST00000360242	T;T	0.11712	2.75;2.75	5.01	-7.05	0.01573	.	1.070570	0.07558	N	0.916588	T	0.04907	0.0132	N	0.14661	0.345	0.27769	N	0.94356	B	0.02656	0.0	B	0.01281	0.0	T	0.43845	-0.9366	10	0.87932	D	0	12.7524	4.2271	0.10585	0.4049:0.2443:0.0:0.3508	.	513	Q68D86	C102B_HUMAN	R	513	ENSP00000316237:W513R;ENSP00000353377:W513R	ENSP00000316237:W513R	W	+	1	0	CCDC102B	64872349	0.000000	0.05858	0.002000	0.10522	0.035000	0.12851	-1.230000	0.02942	-0.963000	0.03600	-0.478000	0.04885	TGG		0.333	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256225.2	NM_024781	
TIMM21	29090	hgsc.bcm.edu	37	18	71825479	71825479	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr18:71825479A>G	ENST00000169551.6	+	5	908	c.610A>G	c.(610-612)Aag>Gag	p.K204E		NM_014177.2	NP_054896.2	Q9BVV7	TIM21_HUMAN	translocase of inner mitochondrial membrane 21 homolog (yeast)	204					cellular protein metabolic process (GO:0044267)|mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|protein import into mitochondrial matrix (GO:0030150)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane presequence translocase complex (GO:0005744)		p.K204E(1)									TGAGCCAGGGAAGCAAGGAAC	0.463																																					p.K204E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A610G	18						.						105.0	105.0	105.0					18																	71825479		2203	4300	6503	69976459	SO:0001583	missense	29090	exon5			BC000892	CCDS12003.1	18q22.3	2011-11-25	2011-11-25	2011-11-25	ENSG00000075336	ENSG00000075336			25010	protein-coding gene	gene with protein product		615180	"""chromosome 18 open reading frame 55"""	C18orf55		11042152	Standard	NM_014177		Approved	HSPC154, TIM21	uc010dqr.1	Q9BVV7	OTTHUMG00000132844	ENST00000169551.6:c.610A>G	18.37:g.71825479A>G	ENSP00000169551:p.Lys204Glu		69976459	NM_014177	Q9P010	Missense_Mutation	SNP	ENST00000169551.6	37	CCDS12003.1	.	.	.	.	.	.	.	.	.	.	A	11.16	1.556339	0.27827	.	.	ENSG00000075336	ENST00000169551	T	0.47869	0.83	5.57	5.57	0.84162	.	0.344773	0.32987	N	0.005403	T	0.45216	0.1331	M	0.61703	1.905	0.80722	D	1	B	0.22746	0.074	B	0.24006	0.05	T	0.40040	-0.9584	10	0.10111	T	0.7	-16.6796	15.7325	0.77817	1.0:0.0:0.0:0.0	.	204	Q9BVV7	TI21L_HUMAN	E	204	ENSP00000169551:K204E	ENSP00000169551:K204E	K	+	1	0	C18orf55	69976459	0.768000	0.28519	1.000000	0.80357	0.369000	0.29798	1.450000	0.35134	2.116000	0.64780	0.460000	0.39030	AAG		0.463	TIMM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256318.1	NM_014177	
CNDP1	84735	hgsc.bcm.edu	37	18	72247374	72247374	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr18:72247374A>G	ENST00000358821.3	+	10	1404	c.1176A>G	c.(1174-1176)cgA>cgG	p.R392R	CNDP1_ENST00000582365.1_Silent_p.R349R	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	392						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.R392R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		AGGTGACACGACATCTTGAAG	0.368																																					p.R392R	Melanoma(32;1029 1042 25286 38395 44237)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1176G	18						.						85.0	79.0	81.0					18																	72247374		2203	4300	6503	70398354	SO:0001819	synonymous_variant	84735	exon10				CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.1176A>G	18.37:g.72247374A>G			70398354	NM_032649	Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Silent	SNP	ENST00000358821.3	37	CCDS12007.1																																																																																				0.368	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256326.1	NM_032649	
SALL3	27164	hgsc.bcm.edu	37	18	76757020	76757020	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr18:76757020G>T	ENST00000537592.2	+	3	3601	c.3601G>T	c.(3601-3603)Gca>Tca	p.A1201S	SALL3_ENST00000575389.2_Missense_Mutation_p.A1129S|SALL3_ENST00000536229.3_Missense_Mutation_p.A996S	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1201					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A1201S(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GAAGGACCTGGCAGCTCGGGC	0.592																																					p.A1201S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3601T	18						.						72.0	70.0	71.0					18																	76757020		2203	4300	6503	74858008	SO:0001583	missense	27164	exon3			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3601G>T	18.37:g.76757020G>T	ENSP00000441823:p.Ala1201Ser		74858008	NM_171999	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695285	0.30052	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.51071	0.72	5.09	5.09	0.68999	.	0.000000	0.56097	D	0.000028	T	0.59824	0.2222	L	0.47716	1.5	0.80722	D	1	D;D	0.62365	0.991;0.991	P;P	0.60541	0.798;0.876	T	0.56565	-0.7958	10	0.34782	T	0.22	-18.2689	18.5211	0.90952	0.0:0.0:1.0:0.0	.	861;1201	F5GXY4;Q9BXA9	.;SALL3_HUMAN	S	1201;1129;861	ENSP00000441823:A1201S	ENSP00000299466:A1201S	A	+	1	0	SALL3	74858008	1.000000	0.71417	0.958000	0.39756	0.281000	0.26958	9.782000	0.99034	2.351000	0.79841	0.561000	0.74099	GCA		0.592	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
TFG	10342	hgsc.bcm.edu	37	3	100463721	100463721	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:100463721C>T	ENST00000240851.4	+	7	1106	c.766C>T	c.(766-768)Cag>Tag	p.Q256*	TFG_ENST00000490574.1_Nonsense_Mutation_p.Q256*|TFG_ENST00000418917.2_Nonsense_Mutation_p.Q252*|TFG_ENST00000481203.1_3'UTR|TFG_ENST00000476228.1_Nonsense_Mutation_p.Q252*	NM_001195478.1|NM_001195479.1|NM_006070.5	NP_001182407.1|NP_001182408.1|NP_006061.2	Q92734	TFG_HUMAN	TRK-fused gene	256					cell death (GO:0008219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	signal transducer activity (GO:0004871)	p.Q256*(1)	TFG/NR4A3(2)|TFG/NTRK1_ENST00000392302(5)|TFG/ALK(9)	large_intestine(4)|lung(2)|prostate(1)|stomach(1)	8						CTATGGTGCACAGCAGCCGCA	0.478			T	"""NTRK1, ALK"""	"""papillary thyroid, ALCL, NSCLC"""																																p.Q256X			Dom	yes		3	3q11-q12	10342	TRK-fused gene		"""E, L"""	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C766T	3						.						107.0	106.0	107.0					3																	100463721		2203	4300	6503	101946411	SO:0001587	stop_gained	10342	exon7			BC009241	CCDS2939.1, CCDS56266.1	3q12.2	2013-03-13	2001-12-04		ENSG00000114354	ENSG00000114354			11758	protein-coding gene	gene with protein product		602498				9169129, 23479643	Standard	NM_001007565		Approved	TF6, FLJ36137, SPG57	uc003dui.3	Q92734	OTTHUMG00000159085	ENST00000240851.4:c.766C>T	3.37:g.100463721C>T	ENSP00000240851:p.Gln256*		101946411	NM_006070	D3DN49|G5E9V1|Q15656|Q969I2	Nonsense_Mutation	SNP	ENST00000240851.4	37	CCDS2939.1	.	.	.	.	.	.	.	.	.	.	C	40	8.081188	0.98643	.	.	ENSG00000114354	ENST00000418917;ENST00000490574;ENST00000240851;ENST00000476228	.	.	.	5.84	5.84	0.93424	.	0.185453	0.49305	D	0.000142	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-2.7716	20.1533	0.98095	0.0:1.0:0.0:0.0	.	.	.	.	X	252;256;256;252	.	ENSP00000240851:Q256X	Q	+	1	0	TFG	101946411	1.000000	0.71417	0.826000	0.32828	0.823000	0.46562	6.899000	0.75682	2.758000	0.94735	0.655000	0.94253	CAG		0.478	TFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353242.1	NM_006070	
MORC1	27136	hgsc.bcm.edu	37	3	108698450	108698450	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:108698450T>G	ENST00000483760.1	-	23	2369	c.2326A>C	c.(2326-2328)Agt>Cgt	p.S776R	MORC1_ENST00000232603.5_Missense_Mutation_p.S797R					MORC family CW-type zinc finger 1									p.S797R(1)		breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						CAACTGCCACTCACAGAAACT	0.408																																					p.S797R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2389C	3						.						119.0	113.0	115.0					3																	108698450		2203	4300	6503	110181140	SO:0001583	missense	27136	exon24			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2326A>C	3.37:g.108698450T>G	ENSP00000417282:p.Ser776Arg		110181140	NM_014429		Missense_Mutation	SNP	ENST00000483760.1	37		.	.	.	.	.	.	.	.	.	.	T	10.60	1.395129	0.25205	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.07114	3.26;3.22	5.25	0.0268	0.14151	.	1.666880	0.03032	N	0.152287	T	0.05410	0.0143	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.37244	-0.9714	10	0.29301	T	0.29	-0.0757	1.2358	0.01952	0.1468:0.1663:0.1527:0.5342	.	776;797	E7ERX1;Q86VD1	.;MORC1_HUMAN	R	797;776	ENSP00000232603:S797R;ENSP00000417282:S776R	ENSP00000232603:S797R	S	-	1	0	MORC1	110181140	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.101000	0.15251	0.113000	0.18004	-0.291000	0.09656	AGT		0.408	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
NR1I2	8856	hgsc.bcm.edu	37	3	119534199	119534199	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:119534199A>G	ENST00000337940.4	+	7	1132	c.1084A>G	c.(1084-1086)Atg>Gtg	p.M362V	NR1I2_ENST00000466380.1_Missense_Mutation_p.M286V|NR1I2_ENST00000393716.2_Missense_Mutation_p.M323V	NM_022002.2	NP_071285.1	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	323	Ligand-binding.				drug export (GO:0046618)|exogenous drug catabolic process (GO:0042738)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|steroid metabolic process (GO:0008202)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)|xenobiotic transport (GO:0042908)	nucleoplasm (GO:0005654)	drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.M362V(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.175)	Docetaxel(DB01248)|Erlotinib(DB00530)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Paclitaxel(DB01229)|Rifampicin(DB01045)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Vitamin E(DB00163)	ACTGGAGCCCATGCTGAAATT	0.532																																					p.M323V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A967G	3						.						103.0	98.0	100.0					3																	119534199		2203	4300	6503	121016889	SO:0001583	missense	8856	exon7			AF061056	CCDS2995.1, CCDS43136.1, CCDS54627.1	3q12-q13.3	2013-03-25			ENSG00000144852	ENSG00000144852		"""Nuclear hormone receptors"""	7968	protein-coding gene	gene with protein product	"""pregnane X receptor"", ""orphan nuclear receptor PXR"""	603065				9727070, 9770465	Standard	NM_003889		Approved	ONR1, PXR, BXR, SXR, PAR2	uc003edk.3	O75469	OTTHUMG00000159400	ENST00000337940.4:c.1084A>G	3.37:g.119534199A>G	ENSP00000336528:p.Met362Val		121016889	NM_003889	Q006P5|Q008C8|Q96AC7|Q9UJ22|Q9UJ23|Q9UJ24|Q9UJ25|Q9UJ26|Q9UJ27|Q9UNW4	Missense_Mutation	SNP	ENST00000337940.4	37	CCDS2995.1	.	.	.	.	.	.	.	.	.	.	A	9.382	1.073278	0.20147	.	.	ENSG00000144852	ENST00000393716;ENST00000466380;ENST00000337940	D;D;D	0.96619	-4.07;-4.07;-4.07	4.63	-1.18	0.09617	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.669290	0.14958	N	0.288542	D	0.87838	0.6278	N	0.13140	0.3	0.09310	N	0.999999	B;B;B	0.09022	0.002;0.0;0.001	B;B;B	0.09377	0.003;0.001;0.004	T	0.77381	-0.2609	10	0.56958	D	0.05	.	0.498	0.00575	0.2021:0.2755:0.2258:0.2966	.	323;362;309	O75469;F1D8P9;O75469-6	NR1I2_HUMAN;.;.	V	323;286;362	ENSP00000377319:M323V;ENSP00000420297:M286V;ENSP00000336528:M362V	ENSP00000336528:M362V	M	+	1	0	NR1I2	121016889	0.001000	0.12720	0.001000	0.08648	0.980000	0.70556	-0.122000	0.10627	-0.488000	0.06726	0.459000	0.35465	ATG		0.532	NR1I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355126.1		
SEC61A1	29927	hgsc.bcm.edu	37	3	127783746	127783746	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:127783746G>A	ENST00000243253.3	+	8	827	c.643G>A	c.(643-645)Gca>Aca	p.A215T	SEC61A1_ENST00000483956.1_3'UTR|RUVBL1_ENST00000464873.1_3'UTR|SEC61A1_ENST00000424880.2_Missense_Mutation_p.A95T|SEC61A1_ENST00000464451.1_Missense_Mutation_p.A221T	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	215					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)	p.A215T(1)		central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						TGCTATCATCGCACTTTTCCA	0.507																																					p.A215T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G643A	3						.						118.0	105.0	110.0					3																	127783746		2203	4300	6503	129266436	SO:0001583	missense	29927	exon8			AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.643G>A	3.37:g.127783746G>A	ENSP00000243253:p.Ala215Thr		129266436	NM_013336	P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Missense_Mutation	SNP	ENST00000243253.3	37	CCDS3046.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178511	0.78564	.	.	ENSG00000058262	ENST00000464451;ENST00000243253;ENST00000424880	.	.	.	5.6	5.6	0.85130	SecY subunit domain (2);	0.000000	0.85682	D	0.000000	D	0.82701	0.5094	M	0.80982	2.52	0.80722	D	1	D	0.61697	0.99	D	0.64595	0.927	D	0.84435	0.0579	9	0.72032	D	0.01	.	19.621	0.95656	0.0:0.0:1.0:0.0	.	215	P61619	S61A1_HUMAN	T	221;215;95	.	ENSP00000243253:A215T	A	+	1	0	SEC61A1	129266436	1.000000	0.71417	0.161000	0.22692	0.008000	0.06430	9.869000	0.99810	2.627000	0.88993	0.655000	0.94253	GCA		0.507	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356541.2	NM_013336	
IFT122	55764	hgsc.bcm.edu	37	3	129239080	129239080	+	Missense_Mutation	SNP	G	G	A	rs201755623		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:129239080G>A	ENST00000348417.2	+	30	3775	c.3698G>A	c.(3697-3699)cGc>cAc	p.R1233H	IFT122_ENST00000504021.1_Missense_Mutation_p.R1110H|IFT122_ENST00000349441.2_Missense_Mutation_p.R1123H|IFT122_ENST00000507564.1_Missense_Mutation_p.R1226H|IFT122_ENST00000440957.2_Missense_Mutation_p.R1024H|IFT122_ENST00000347300.2_Missense_Mutation_p.R1174H|IFT122_ENST00000296266.3_Missense_Mutation_p.R1284H|IFT122_ENST00000431818.2_Missense_Mutation_p.R1083H	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	1233					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)		p.R1284H(2)		breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						CCCTACTGCCGCAGGTGCAAG	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		17277	0.0		0.001	False		,,,				2504	0.0				p.R1123H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G3368A	3						.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	76.0	62.0	67.0		3521,3851,3698,3368	5.8	1.0	3		67	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense,missense	IFT122	NM_018262.2,NM_052985.2,NM_052989.1,NM_052990.1	29,29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	1174/1183,1284/1293,1233/1242,1123/1132	129239080	1,13005	2203	4300	6503	130721770	SO:0001583	missense	55764	exon27			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.3698G>A	3.37:g.129239080G>A	ENSP00000324005:p.Arg1233His		130721770	NM_052990	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	ENST00000348417.2	37	CCDS3061.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	25.9	4.681208	0.88542	0.0	1.16E-4	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957	T;T;T;T;T;T;T;T	0.70749	0.16;-0.51;-0.35;-0.3;0.33;0.31;0.14;-0.26	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.80481	0.4631	L	0.61387	1.9	0.80722	D	1	D;P;D;D;P;D;D;P;D;D	0.76494	0.988;0.862;0.976;0.999;0.902;0.968;0.979;0.941;0.98;0.993	P;B;B;D;B;P;P;P;P;P	0.64687	0.681;0.333;0.403;0.928;0.371;0.709;0.473;0.673;0.483;0.681	T	0.79888	-0.1613	10	0.48119	T	0.1	-23.6646	14.2837	0.66232	0.0708:0.0:0.9292:0.0	.	1024;559;1226;621;1110;1075;1123;1174;1233;1284	E9PDG2;B3KUD1;E7EQF4;B3KT43;B4DEY9;B4DPW7;Q9BTY4;Q9HBG6-3;Q9HBG6;G3XAB1	.;.;.;.;.;.;.;.;IF122_HUMAN;.	H	1174;1284;1226;1083;1110;1123;1233;1075;1024	ENSP00000323973:R1174H;ENSP00000296266:R1284H;ENSP00000425536:R1226H;ENSP00000410946:R1083H;ENSP00000422179:R1110H;ENSP00000324165:R1123H;ENSP00000324005:R1233H;ENSP00000401569:R1024H	ENSP00000296266:R1284H	R	+	2	0	IFT122	130721770	1.000000	0.71417	0.969000	0.41365	0.903000	0.53119	7.955000	0.87856	2.757000	0.94681	0.655000	0.94253	CGC		0.587	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262	
NUP210	23225	hgsc.bcm.edu	37	3	13373805	13373805	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:13373805A>C	ENST00000254508.5	-	29	4005	c.3923T>G	c.(3922-3924)cTg>cGg	p.L1308R		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1308					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.L1308R(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GTTTGTCTGCAGCTTTATATA	0.478																																					p.L1308R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3923G	3						.						263.0	256.0	259.0					3																	13373805		2203	4300	6503	13348805	SO:0001583	missense	23225	exon29			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.3923T>G	3.37:g.13373805A>C	ENSP00000254508:p.Leu1308Arg		13348805	NM_024923	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	A	17.46	3.393985	0.62066	.	.	ENSG00000132182	ENST00000254508	T	0.10382	2.88	5.13	5.13	0.70059	.	0.000000	0.64402	D	0.000001	T	0.35913	0.0948	M	0.83012	2.62	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.26710	-1.0095	10	0.66056	D	0.02	-21.8532	15.2329	0.73404	1.0:0.0:0.0:0.0	.	1308	Q8TEM1	PO210_HUMAN	R	1308	ENSP00000254508:L1308R	ENSP00000254508:L1308R	L	-	2	0	NUP210	13348805	1.000000	0.71417	0.980000	0.43619	0.287000	0.27160	9.287000	0.95975	2.054000	0.61138	0.460000	0.39030	CTG		0.478	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
PIK3R4	30849	hgsc.bcm.edu	37	3	130452700	130452700	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:130452700A>G	ENST00000356763.3	-	4	1699	c.1142T>C	c.(1141-1143)gTt>gCt	p.V381A		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	381					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V381A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						GGATGTTATAACAGATACCAA	0.408																																					p.V381A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1142C	3						.						147.0	144.0	145.0					3																	130452700		2203	4300	6503	131935390	SO:0001583	missense	30849	exon4			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.1142T>C	3.37:g.130452700A>G	ENSP00000349205:p.Val381Ala		131935390	NM_014602	Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	37	CCDS3067.1	.	.	.	.	.	.	.	.	.	.	A	19.22	3.786513	0.70337	.	.	ENSG00000196455	ENST00000356763	T	0.31247	1.5	6.17	6.17	0.99709	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.42404	0.1201	L	0.47716	1.5	0.80722	D	1	D	0.59357	0.985	P	0.53401	0.725	T	0.16424	-1.0403	10	0.51188	T	0.08	-34.2793	16.8222	0.85835	1.0:0.0:0.0:0.0	.	381	Q99570	PI3R4_HUMAN	A	381	ENSP00000349205:V381A	ENSP00000349205:V381A	V	-	2	0	PIK3R4	131935390	1.000000	0.71417	0.984000	0.44739	0.992000	0.81027	8.730000	0.91510	2.371000	0.80710	0.533000	0.62120	GTT		0.408	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
ACPP	55	hgsc.bcm.edu	37	3	132036377	132036377	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:132036377T>C	ENST00000336375.5	+	1	167	c.77T>C	c.(76-78)cTa>cCa	p.L26P	ACPP_ENST00000475741.1_Missense_Mutation_p.L26P|ACPP_ENST00000351273.7_Missense_Mutation_p.L26P|ACPP_ENST00000489084.1_3'UTR	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	26					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)	p.L26P(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						TTTTTCTGGCTAGACCGAAGT	0.473																																					p.L26P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T77C	3						.						90.0	79.0	83.0					3																	132036377		2203	4300	6503	133519067	SO:0001583	missense	55	exon1				CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.77T>C	3.37:g.132036377T>C	ENSP00000337471:p.Leu26Pro		133519067	NM_001099	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	ENST00000336375.5	37	CCDS3073.1	.	.	.	.	.	.	.	.	.	.	T	12.17	1.857562	0.32791	.	.	ENSG00000014257	ENST00000336375;ENST00000495911;ENST00000475741;ENST00000351273	T;T;T;T	0.26810	2.9;1.71;2.89;3.04	5.08	-6.6	0.01824	.	0.903848	0.08900	N	0.877324	T	0.15478	0.0373	N	0.19112	0.55	0.19300	N	0.99997	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.21211	-1.0252	10	0.40728	T	0.16	.	14.912	0.70764	0.0:0.6175:0.0:0.3825	.	26;26;26	P15309;P15309-2;Q5FBY0	PPAP_HUMAN;.;.	P	26	ENSP00000337471:L26P;ENSP00000418366:L26P;ENSP00000417744:L26P;ENSP00000323036:L26P	ENSP00000337471:L26P	L	+	2	0	ACPP	133519067	0.000000	0.05858	0.000000	0.03702	0.230000	0.25150	-1.326000	0.02685	-1.249000	0.02500	0.533000	0.62120	CTA		0.473	ACPP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356699.2	NM_001099	
SLC25A36	55186	hgsc.bcm.edu	37	3	140675433	140675433	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:140675433T>C	ENST00000324194.6	+	2	274	c.106T>C	c.(106-108)Tca>Cca	p.S36P	SLC25A36_ENST00000393015.4_3'UTR|SLC25A36_ENST00000507429.1_Missense_Mutation_p.S36P|SLC25A36_ENST00000446041.2_Missense_Mutation_p.S36P|SLC25A36_ENST00000453248.2_Missense_Mutation_p.S36P			Q96CQ1	S2536_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier ), member 36	36					response to estradiol (GO:0032355)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.S36P(1)		endometrium(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						ACGACTGCAGTCATCTTCTGT	0.423																																					p.S36P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T106C	3						.						120.0	113.0	116.0					3																	140675433		2203	4300	6503	142158123	SO:0001583	missense	55186	exon2			AK001480	CCDS3114.1, CCDS46927.1	3q23	2013-05-22	2012-03-29		ENSG00000114120	ENSG00000114120		"""Solute carriers"""	25554	protein-coding gene	gene with protein product			"""solute carrier family 25, member 36"""				Standard	NM_001104647		Approved	FLJ10618, PNC2	uc003etr.2	Q96CQ1	OTTHUMG00000160260	ENST00000324194.6:c.106T>C	3.37:g.140675433T>C	ENSP00000320688:p.Ser36Pro		142158123	NM_001104647	A8MYF7|Q05CY1|Q9H0G8|Q9NVN5	Missense_Mutation	SNP	ENST00000324194.6	37	CCDS46927.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.753435	0.89753	.	.	ENSG00000114120	ENST00000446041;ENST00000507429;ENST00000324194;ENST00000453248	T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25	5.29	5.29	0.74685	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.88062	0.6336	M	0.84326	2.69	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;0.998;0.996;0.999	D	0.88854	0.3321	10	0.51188	T	0.08	-12.2957	13.4611	0.61227	0.0:0.0:0.0:1.0	.	36;36;36;36	B4DL01;Q96CQ1-3;Q96CQ1;F6SDC8	.;.;S2536_HUMAN;.	P	36	ENSP00000401938:S36P;ENSP00000421470:S36P;ENSP00000320688:S36P;ENSP00000391521:S36P	ENSP00000320688:S36P	S	+	1	0	SLC25A36	142158123	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.578000	0.82498	2.131000	0.65755	0.528000	0.53228	TCA		0.423	SLC25A36-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359929.1	NM_018155	
XRN1	54464	hgsc.bcm.edu	37	3	142102234	142102234	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:142102234G>T	ENST00000264951.4	-	22	2641	c.2524C>A	c.(2524-2526)Cgt>Agt	p.R842S	XRN1_ENST00000392981.2_Missense_Mutation_p.R842S	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	842					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.R842S(1)		NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TTGGAGAAACGGGAGTCGAAA	0.353																																					p.R842S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2524A	3						.						72.0	71.0	71.0					3																	142102234		2203	4300	6503	143584924	SO:0001583	missense	54464	exon22			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.2524C>A	3.37:g.142102234G>T	ENSP00000264951:p.Arg842Ser		143584924	NM_019001	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	ENST00000264951.4	37	CCDS3123.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.701049	0.30142	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.35048	1.33;1.34	5.97	5.97	0.96955	.	0.169118	0.56097	D	0.000032	T	0.29158	0.0725	N	0.26092	0.79	0.80722	D	1	B;B;B	0.14438	0.0;0.01;0.006	B;B;B	0.15484	0.0;0.013;0.006	T	0.02698	-1.1122	10	0.41790	T	0.15	-16.1482	15.8636	0.79043	0.0:0.1348:0.8652:0.0	.	703;842;842	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	S	842	ENSP00000264951:R842S;ENSP00000376707:R842S	ENSP00000264951:R842S	R	-	1	0	XRN1	143584924	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.659000	0.61504	2.833000	0.97629	0.585000	0.79938	CGT		0.353	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
TRPC1	7220	hgsc.bcm.edu	37	3	142503876	142503876	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:142503876A>T	ENST00000476941.1	+	7	1777	c.1291A>T	c.(1291-1293)Att>Ttt	p.I431F	TRPC1_ENST00000273482.6_Missense_Mutation_p.I397F	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	431					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)	p.I397F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						TATTCTGTGGATTATTGGTAA	0.353																																					p.I397F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1189T	3						.						48.0	50.0	49.0					3																	142503876		2199	4300	6499	143986566	SO:0001583	missense	7220	exon6			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1291A>T	3.37:g.142503876A>T	ENSP00000419313:p.Ile431Phe		143986566	NM_003304	Q14CE4	Missense_Mutation	SNP	ENST00000476941.1	37	CCDS58856.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.244753	0.59103	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	D;D	0.98567	-5.0;-5.0	5.68	4.57	0.56435	Ion transport (1);	0.104529	0.64402	D	0.000003	D	0.97281	0.9111	L	0.60067	1.865	0.80722	D	1	B;P	0.35745	0.085;0.518	B;B	0.43916	0.077;0.436	D	0.97291	0.9924	10	0.66056	D	0.02	-11.0935	10.8525	0.46777	0.6014:0.3986:0.0:0.0	.	431;397	P48995;P48995-2	TRPC1_HUMAN;.	F	431;397	ENSP00000419313:I431F;ENSP00000273482:I397F	ENSP00000273482:I397F	I	+	1	0	TRPC1	143986566	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.388000	0.59633	2.164000	0.68074	0.477000	0.44152	ATT		0.353	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354520.1	NM_003304	
PCOLCE2	26577	hgsc.bcm.edu	37	3	142567247	142567247	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:142567247C>T	ENST00000295992.3	-	3	566	c.260G>A	c.(259-261)cGc>cAc	p.R87H	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.R87H	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	87	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.R87H(2)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						AAAGTCATAGCGGCACAGGTT	0.517																																					p.R87H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G260A	3						.						88.0	85.0	86.0					3																	142567247		2203	4300	6503	144049937	SO:0001583	missense	26577	exon3			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.260G>A	3.37:g.142567247C>T	ENSP00000295992:p.Arg87His		144049937	NM_013363	B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	ENST00000295992.3	37	CCDS3127.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397113	0.83120	.	.	ENSG00000163710	ENST00000295992;ENST00000485766	T;T	0.28895	1.59;1.59	5.1	5.1	0.69264	CUB (5);	0.000000	0.85682	D	0.000000	T	0.54078	0.1836	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.49698	-0.8912	10	0.42905	T	0.14	-15.5768	18.7404	0.91772	0.0:1.0:0.0:0.0	.	87	Q9UKZ9	PCOC2_HUMAN	H	87	ENSP00000295992:R87H;ENSP00000419842:R87H	ENSP00000295992:R87H	R	-	2	0	PCOLCE2	144049937	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.320000	0.79064	2.666000	0.90696	0.644000	0.83932	CGC		0.517	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354509.1	NM_013363	
P2RY14	9934	hgsc.bcm.edu	37	3	150931678	150931678	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:150931678C>T	ENST00000309170.3	-	3	739	c.427G>A	c.(427-429)Gtg>Atg	p.V143M	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|P2RY14_ENST00000424796.2_Missense_Mutation_p.V143M	NM_001081455.1|NM_014879.3	NP_001074924.1|NP_055694.3	Q15391	P2Y14_HUMAN	purinergic receptor P2Y, G-protein coupled, 14	143					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|UDP-activated nucleotide receptor activity (GO:0045029)	p.V143M(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)	20			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CATACTATCACTGACAGAAGT	0.383																																					p.V143M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G427A	3						.						105.0	98.0	101.0					3																	150931678		2203	4300	6503	152414368	SO:0001583	missense	9934	exon3			D13626	CCDS3156.1	3q21-q25	2012-08-08	2004-07-12	2004-07-14	ENSG00000174944	ENSG00000174944		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	16442	protein-coding gene	gene with protein product		610116	"""G protein-coupled receptor 105"""	GPR105			Standard	NM_014879		Approved	KIAA0001	uc003eys.1	Q15391	OTTHUMG00000159859	ENST00000309170.3:c.427G>A	3.37:g.150931678C>T	ENSP00000308361:p.Val143Met		152414368	NM_014879	Q8IYT7	Missense_Mutation	SNP	ENST00000309170.3	37	CCDS3156.1	.	.	.	.	.	.	.	.	.	.	C	11.42	1.632883	0.29068	.	.	ENSG00000174944	ENST00000309170;ENST00000424796	T;T	0.39787	1.06;1.06	5.9	0.273	0.15650	GPCR, rhodopsin-like superfamily (1);	0.437392	0.20574	N	0.089671	T	0.49150	0.1540	M	0.65975	2.015	0.09310	N	1	P	0.45986	0.87	P	0.53861	0.736	T	0.38585	-0.9654	10	0.72032	D	0.01	-9.4045	7.4669	0.27326	0.1116:0.4682:0.3567:0.0635	.	143	Q15391	P2Y14_HUMAN	M	143	ENSP00000308361:V143M;ENSP00000408733:V143M	ENSP00000308361:V143M	V	-	1	0	P2RY14	152414368	0.000000	0.05858	0.003000	0.11579	0.019000	0.09904	-1.075000	0.03423	0.358000	0.24211	0.650000	0.86243	GTG		0.383	P2RY14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357789.1	NM_014879	
HACL1	26061	hgsc.bcm.edu	37	3	15613192	15613192	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:15613192T>C	ENST00000321169.5	-	12	1445	c.1078A>G	c.(1078-1080)Aat>Gat	p.N360D	HACL1_ENST00000435217.2_Missense_Mutation_p.N119D|HACL1_ENST00000456194.2_Missense_Mutation_p.N333D|HACL1_ENST00000451445.2_Missense_Mutation_p.N278D|HACL1_ENST00000457447.2_Intron	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1	360					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)	p.N360D(1)		NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						GCAGCTTCATTGCTCTTCATT	0.403																																					p.N360D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1078G	3						.						243.0	209.0	220.0					3																	15613192		2203	4300	6503	15588196	SO:0001583	missense	26061	exon12			AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.1078A>G	3.37:g.15613192T>C	ENSP00000323811:p.Asn360Asp		15588196	NM_012260	B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Missense_Mutation	SNP	ENST00000321169.5	37	CCDS2627.1	.	.	.	.	.	.	.	.	.	.	T	16.02	3.004751	0.54254	.	.	ENSG00000131373	ENST00000321169;ENST00000435217;ENST00000451445;ENST00000456194	T;T;T;T	0.48522	1.51;0.81;1.5;1.5	5.08	3.9	0.45041	.	0.525534	0.21849	N	0.068216	T	0.65344	0.2682	M	0.78456	2.415	0.80722	D	1	D;D;D;P	0.69078	0.958;0.997;0.997;0.949	P;D;P;P	0.64687	0.613;0.928;0.804;0.607	T	0.66842	-0.5821	10	0.56958	D	0.05	.	11.4397	0.50090	0.1353:0.0:0.0:0.8647	.	278;333;119;360	B4DXI5;B4DWI1;B3KPX4;Q9UJ83	.;.;.;HACL1_HUMAN	D	360;119;278;333	ENSP00000323811:N360D;ENSP00000395278:N119D;ENSP00000403656:N278D;ENSP00000390699:N333D	ENSP00000323811:N360D	N	-	1	0	HACL1	15588196	1.000000	0.71417	0.777000	0.31699	0.230000	0.25150	6.701000	0.74624	0.855000	0.35359	0.529000	0.55759	AAT		0.403	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252104.3	NM_012260	
IGSF10	285313	hgsc.bcm.edu	37	3	151174863	151174863	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:151174863C>T	ENST00000282466.3	-	2	274	c.275G>A	c.(274-276)gGc>gAc	p.G92D		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	92					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.G92D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGTGTGAATGCCATTGCTGTG	0.448																																					p.G92D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G275A	3						.						124.0	109.0	114.0					3																	151174863		2203	4300	6503	152657553	SO:0001583	missense	285313	exon2			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.275G>A	3.37:g.151174863C>T	ENSP00000282466:p.Gly92Asp		152657553	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.107345	0.37145	.	.	ENSG00000152580	ENST00000282466	T	0.56941	0.43	5.87	2.67	0.31697	.	0.473004	0.17792	N	0.161873	T	0.27832	0.0685	N	0.11789	0.175	0.30671	N	0.753376	P	0.39352	0.669	B	0.40901	0.343	T	0.17531	-1.0366	10	0.09338	T	0.73	.	4.1818	0.10380	0.0:0.3389:0.4791:0.182	.	92	Q6WRI0	IGS10_HUMAN	D	92	ENSP00000282466:G92D	ENSP00000282466:G92D	G	-	2	0	IGSF10	152657553	0.353000	0.24904	0.996000	0.52242	0.778000	0.44026	0.011000	0.13264	1.452000	0.47756	0.655000	0.94253	GGC		0.448	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
SMC4	10051	hgsc.bcm.edu	37	3	160132298	160132298	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:160132298A>G	ENST00000357388.3	+	9	1716	c.1265A>G	c.(1264-1266)aAa>aGa	p.K422R	SMC4_ENST00000344722.5_Missense_Mutation_p.K422R|SMC4_ENST00000469762.1_Missense_Mutation_p.K397R|SMC4_ENST00000462787.1_Missense_Mutation_p.K422R|SMC4_ENST00000360111.2_Missense_Mutation_p.K422R|RP11-432B6.3_ENST00000483754.1_Intron	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	422					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.K422R(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CAAAAAGATAAAGAAAAGGTA	0.323																																					p.K422R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1265G	3						.						29.0	29.0	29.0					3																	160132298		2202	4297	6499	161614992	SO:0001583	missense	10051	exon9			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.1265A>G	3.37:g.160132298A>G	ENSP00000349961:p.Lys422Arg		161614992	NM_001002800	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.532633	0.64972	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000489573;ENST00000462787;ENST00000344722;ENST00000545277	T;T;T;T;T;T	0.75589	-0.95;-0.94;-0.95;0.08;-0.94;-0.95	5.68	5.68	0.88126	RecF/RecN/SMC (1);	0.095399	0.64402	D	0.000001	T	0.74191	0.3684	L	0.39514	1.22	0.49483	D	0.999797	P;B;P;P	0.49559	0.87;0.037;0.925;0.569	B;B;P;B	0.49922	0.406;0.05;0.626;0.284	T	0.73594	-0.3933	10	0.36615	T	0.2	-30.7748	15.9325	0.79675	1.0:0.0:0.0:0.0	.	422;397;397;422	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	R	422;422;397;422;422;422;16	ENSP00000349961:K422R;ENSP00000353225:K422R;ENSP00000417964:K397R;ENSP00000420121:K422R;ENSP00000420734:K422R;ENSP00000341382:K422R	ENSP00000341382:K422R	K	+	2	0	SMC4	161614992	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	5.285000	0.65633	2.169000	0.68431	0.528000	0.53228	AAA		0.323	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
FNDC3B	64778	hgsc.bcm.edu	37	3	172025275	172025275	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:172025275T>C	ENST00000336824.4	+	10	1283	c.1184T>C	c.(1183-1185)cTa>cCa	p.L395P	FNDC3B_ENST00000415807.2_Missense_Mutation_p.L395P|FNDC3B_ENST00000416957.1_Missense_Mutation_p.L395P	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	395	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.L395P(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		AAAAGTTCACTAACCCTGCAG	0.517																																					p.L395P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1184C	3						.						104.0	93.0	97.0					3																	172025275		2203	4300	6503	173507969	SO:0001583	missense	64778	exon10			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1184T>C	3.37:g.172025275T>C	ENSP00000338523:p.Leu395Pro		173507969	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.359607	0.82353	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.58797	0.31;0.31;0.31	5.93	5.93	0.95920	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.80319	0.4601	M	0.89353	3.025	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.84182	0.0440	10	0.87932	D	0	-14.6851	16.0558	0.80805	0.0:0.0:0.0:1.0	.	395;395	Q53EP0-2;Q53EP0	.;FND3B_HUMAN	P	395	ENSP00000411242:L395P;ENSP00000338523:L395P;ENSP00000389094:L395P	ENSP00000338523:L395P	L	+	2	0	FNDC3B	173507969	0.991000	0.36638	0.847000	0.33407	0.971000	0.66376	7.108000	0.77055	2.281000	0.76405	0.533000	0.62120	CTA		0.517	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
RTP2	344892	hgsc.bcm.edu	37	3	187416388	187416388	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:187416388G>A	ENST00000358241.1	-	2	1004	c.576C>T	c.(574-576)tcC>tcT	p.S192S		NM_001004312.2	NP_001004312.2	Q5QGT7	RTP2_HUMAN	receptor (chemosensory) transporter protein 2	192					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)	p.S192S(2)		large_intestine(3)|lung(14)|skin(1)	18	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		AGTTGTAGCCGGATCCCGCCT	0.587																																					p.S192S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C576T	3						.						77.0	83.0	81.0					3																	187416388		2203	4300	6503	188899082	SO:0001819	synonymous_variant	344892	exon2			AY562236	CCDS33911.1	3q27.3	2014-02-20	2006-11-21		ENSG00000198471	ENSG00000198471		"""Receptor transporter proteins"""	32486	protein-coding gene	gene with protein product	"""receptor transporting protein 2"", ""zinc finger, 3CxxC-type 2"""	609138	"""receptor transporter protein 2"""			16271481, 15550249, 16720576	Standard	NM_001004312		Approved	MGC78665, Z3CXXC2	uc003fro.1	Q5QGT7	OTTHUMG00000156458	ENST00000358241.1:c.576C>T	3.37:g.187416388G>A			188899082	NM_001004312	Q6NVH4	Silent	SNP	ENST00000358241.1	37	CCDS33911.1																																																																																				0.587	RTP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344259.1	NM_001004312	
ATP13A4	84239	hgsc.bcm.edu	37	3	193272535	193272535	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:193272535A>G	ENST00000342695.4	-	1	376	c.54T>C	c.(52-54)aaT>aaC	p.N18N	ATP13A4-AS1_ENST00000431512.1_RNA|ATP13A4-AS1_ENST00000426459.1_RNA|ATP13A4_ENST00000392443.3_Silent_p.N18N|ATP13A4_ENST00000295548.3_Silent_p.N18N	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	18						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TTACCATCTCATTCTCTTCTC	0.512																																					p.N18N												.	.	0			c.T54C	3						.						307.0	262.0	278.0					3																	193272535		2203	4300	6503	194755229	SO:0001819	synonymous_variant	84239	exon1			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.54T>C	3.37:g.193272535A>G			194755229	NM_032279	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Silent	SNP	ENST00000342695.4	37	CCDS3304.2																																																																																				0.512	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157244.4	NM_032279	
RAD18	56852	hgsc.bcm.edu	37	3	9005034	9005034	+	Silent	SNP	G	G	A	rs112870242	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:9005034G>A	ENST00000264926.2	-	1	152	c.36C>T	c.(34-36)ggC>ggT	p.G12G	RAD18_ENST00000495087.1_5'UTR	NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase	12					DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)	p.G12G(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		TGACTGCCAGGCCCGGAGGCC	0.657								Rad6 pathway																													p.G12G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C36T	3						.						22.0	23.0	23.0					3																	9005034		2202	4300	6502	8980034	SO:0001819	synonymous_variant	56852	exon1				CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.36C>T	3.37:g.9005034G>A			8980034	NM_020165	Q58F55|Q9NRT6	Silent	SNP	ENST00000264926.2	37	CCDS2571.1																																																																																				0.657	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207071.2	NM_020165	
TADA3	10474	hgsc.bcm.edu	37	3	9831469	9831469	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:9831469T>C	ENST00000301964.2	-	3	944	c.386A>G	c.(385-387)aAg>aGg	p.K129R	TADA3_ENST00000492635.1_5'UTR|ARPC4_ENST00000498623.2_5'Flank|ARPC4_ENST00000397261.3_5'Flank|TADA3_ENST00000343450.2_Missense_Mutation_p.K129R|TADA3_ENST00000440161.1_Missense_Mutation_p.K129R|ARPC4_ENST00000287613.7_5'Flank	NM_006354.2	NP_006345.1	O75528	TADA3_HUMAN	transcriptional adaptor 3	129					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|intracellular estrogen receptor signaling pathway (GO:0030520)|mitotic nuclear division (GO:0007067)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of histone deacetylation (GO:0031063)|regulation of protein phosphorylation (GO:0001932)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of tubulin deacetylation (GO:0090043)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|intracellular (GO:0005622)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.K129R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16						TTCCTGGATCTTGGGCTGAAG	0.552																																					p.K129R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A386G	3						.						121.0	104.0	110.0					3																	9831469		2203	4300	6503	9806469	SO:0001583	missense	10474	exon3			AF069733	CCDS2583.1, CCDS2584.1	3p25.3	2010-08-13	2009-10-02	2009-10-02	ENSG00000171148	ENSG00000171148			19422	protein-coding gene	gene with protein product		602945	"""transcriptional adaptor 3 (NGG1 homolog, yeast)-like"""	TADA3L		9674425, 11707411	Standard	NM_006354		Approved	FLJ20221, FLJ21329, ADA3, hADA3, NGG1	uc010hcn.2	O75528	OTTHUMG00000128440	ENST00000301964.2:c.386A>G	3.37:g.9831469T>C	ENSP00000307684:p.Lys129Arg		9806469	NM_133480	Q6FI83|Q9UFS2	Missense_Mutation	SNP	ENST00000301964.2	37	CCDS2583.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.882580	0.91740	.	.	ENSG00000171148	ENST00000301964;ENST00000440161;ENST00000343450	.	.	.	5.6	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.63224	0.2493	L	0.41236	1.265	0.54753	D	0.999988	D	0.89917	1.0	D	0.63283	0.913	T	0.59627	-0.7419	9	0.33940	T	0.23	-19.9792	11.8896	0.52622	0.1309:0.0:0.0:0.8691	.	129	O75528	TADA3_HUMAN	R	129	.	ENSP00000307684:K129R	K	-	2	0	TADA3	9806469	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.356000	0.79445	0.925000	0.37094	0.533000	0.62120	AAG		0.552	TADA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250236.1		
GOLGA4	2803	hgsc.bcm.edu	37	3	37343758	37343758	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:37343758G>A	ENST00000361924.2	+	10	1543	c.1169G>A	c.(1168-1170)cGc>cAc	p.R390H	GOLGA4_ENST00000356847.4_Missense_Mutation_p.R412H|GOLGA4_ENST00000435830.2_3'UTR|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	390	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)	p.R390H(2)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CTCCGTAGTCGCATCAAACAG	0.423																																					p.R412H												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G1235A	3						.						66.0	66.0	66.0					3																	37343758		2203	4300	6503	37318762	SO:0001583	missense	2803	exon11			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1169G>A	3.37:g.37343758G>A	ENSP00000354486:p.Arg390His		37318762	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	37	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934299	0.52866	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000450863;ENST00000437131	T;T;T	0.25912	1.78;1.78;1.77	5.88	1.07	0.20283	.	0.483070	0.15595	N	0.254197	T	0.15739	0.0379	L	0.35593	1.075	0.29418	N	0.860754	B;B;B	0.33826	0.023;0.427;0.04	B;B;B	0.22880	0.004;0.042;0.003	T	0.06789	-1.0807	10	0.40728	T	0.16	.	10.0576	0.42255	0.3966:0.0:0.6034:0.0	.	390;412;390	Q13439-4;F8W8Q7;Q13439	.;.;GOGA4_HUMAN	H	390;412;395;261	ENSP00000354486:R390H;ENSP00000349305:R412H;ENSP00000405842:R261H	ENSP00000349305:R412H	R	+	2	0	GOLGA4	37318762	0.998000	0.40836	0.576000	0.28549	0.982000	0.71751	1.989000	0.40707	-0.080000	0.12685	-0.157000	0.13467	CGC		0.423	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
SCN11A	11280	hgsc.bcm.edu	37	3	38938451	38938451	+	Missense_Mutation	SNP	C	C	T	rs372078622		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:38938451C>T	ENST00000302328.3	-	14	2486	c.2288G>A	c.(2287-2289)cGc>cAc	p.R763H	SCN11A_ENST00000450244.1_Missense_Mutation_p.R763H|SCN11A_ENST00000456224.3_Missense_Mutation_p.R763H|SCN11A_ENST00000444237.2_Missense_Mutation_p.R763H	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	763					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R763H(3)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCAGAGGATGCGGAATACCAC	0.473													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17032	0.0		0.0	False		,,,				2504	0.0				p.R763H												.	.	3	Substitution - Missense(3)	prostate(2)|large_intestine(1)	c.G2288A	3						.	C	HIS/ARG	0,4406		0,0,2203	125.0	114.0	118.0		2288	5.9	1.0	3		118	1,8599	1.2+/-3.3	0,1,4299	no	missense	SCN11A	NM_014139.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	763/1792	38938451	1,13005	2203	4300	6503	38913455	SO:0001583	missense	11280	exon14			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.2288G>A	3.37:g.38938451C>T	ENSP00000307599:p.Arg763His		38913455	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	36	5.792860	0.96952	0.0	1.16E-4	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4	5.95	5.95	0.96441	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99208	0.9725	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98760	1.0724	10	0.87932	D	0	.	20.4024	0.99000	0.0:1.0:0.0:0.0	.	763	Q9UI33	SCNBA_HUMAN	H	763	ENSP00000307599:R763H;ENSP00000400945:R763H;ENSP00000416757:R763H;ENSP00000408028:R763H	ENSP00000307599:R763H	R	-	2	0	SCN11A	38913455	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.747000	0.85070	2.827000	0.97445	0.650000	0.86243	CGC		0.473	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
SEC22C	9117	hgsc.bcm.edu	37	3	42597435	42597435	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:42597435G>A	ENST00000264454.3	-	6	841	c.698C>T	c.(697-699)gCc>gTc	p.A233V	SEC22C_ENST00000536332.1_Missense_Mutation_p.A163V|SEC22C_ENST00000423701.2_Intron|SEC22C_ENST00000417572.1_Missense_Mutation_p.A233V|SEC22C_ENST00000273156.7_Missense_Mutation_p.A233V			Q9BRL7	SC22C_HUMAN	SEC22 vesicle trafficking protein homolog C (S. cerevisiae)	233					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.A233V(1)		endometrium(1)|large_intestine(2)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		GAAAATGCAGGCTACGAAAGG	0.388																																					p.A233V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C698T	3						.						107.0	94.0	99.0					3																	42597435		2203	4300	6503	42572439	SO:0001583	missense	9117	exon6			AF039568	CCDS2699.1, CCDS2700.1, CCDS56246.1	3p24.3-p22.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000093183	ENSG00000093183			16828	protein-coding gene	gene with protein product		604028	"""SEC22 vesicle trafficking protein-like 3 (S. cerevisiae)"""	SEC22L3		9501016, 11001058	Standard	NM_004206		Approved	MGC13261, MGC5373	uc003clj.3	Q9BRL7	OTTHUMG00000131797	ENST00000264454.3:c.698C>T	3.37:g.42597435G>A	ENSP00000264454:p.Ala233Val		42572439	NM_004206	O95152|Q68CX3|Q6UW18	Missense_Mutation	SNP	ENST00000264454.3	37	CCDS2700.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.588674	0.86851	.	.	ENSG00000093183	ENST00000273156;ENST00000417572;ENST00000536332;ENST00000264454;ENST00000456515	T;T;T;T;T	0.27256	2.07;2.07;1.68;2.03;1.9	5.2	5.2	0.72013	.	0.112545	0.64402	D	0.000011	T	0.47154	0.1430	M	0.68317	2.08	0.41867	D	0.990256	D;D;D	0.59767	0.975;0.976;0.986	P;P;P	0.60886	0.736;0.761;0.88	T	0.46219	-0.9207	10	0.62326	D	0.03	-18.2105	16.8526	0.85998	0.0:0.0:1.0:0.0	.	163;233;233	F5H0H7;Q9BRL7;Q9BRL7-2	.;SC22C_HUMAN;.	V	233;233;163;233;233	ENSP00000273156:A233V;ENSP00000407564:A233V;ENSP00000439845:A163V;ENSP00000264454:A233V;ENSP00000391170:A233V	ENSP00000264454:A233V	A	-	2	0	SEC22C	42572439	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.256000	0.58810	2.578000	0.87016	0.650000	0.86243	GCC		0.388	SEC22C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254734.1	NM_004206	
IP6K2	51447	hgsc.bcm.edu	37	3	48732549	48732549	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:48732549A>G	ENST00000328631.5	-	2	399	c.176T>C	c.(175-177)aTg>aCg	p.M59T	IP6K2_ENST00000431721.2_Missense_Mutation_p.M114T|IP6K2_ENST00000446860.1_Missense_Mutation_p.M117T|IP6K2_ENST00000453202.1_Missense_Mutation_p.M59T|IP6K2_ENST00000449610.1_Missense_Mutation_p.M59T|IP6K2_ENST00000413298.1_Missense_Mutation_p.M59T|IP6K2_ENST00000432678.2_Missense_Mutation_p.M59T|IP6K2_ENST00000340879.4_Missense_Mutation_p.M59T|IP6K2_ENST00000436134.1_5'UTR|IP6K2_ENST00000450045.1_Missense_Mutation_p.M113T|IP6K2_ENST00000443964.1_Missense_Mutation_p.M118T|IP6K2_ENST00000417896.1_Missense_Mutation_p.M59T	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	59					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.M59T(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						GAATTTGCGCATCTCAGCAGG	0.592																																					p.M117T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T350C	3						.						108.0	101.0	103.0					3																	48732549		2203	4300	6503	48707553	SO:0001583	missense	51447	exon3			AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.176T>C	3.37:g.48732549A>G	ENSP00000331103:p.Met59Thr		48707553	NM_001190317	A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Missense_Mutation	SNP	ENST00000328631.5	37	CCDS2777.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.364273	0.82463	.	.	ENSG00000068745	ENST00000328631;ENST00000449563;ENST00000413654;ENST00000443853;ENST00000437427;ENST00000412850;ENST00000454335;ENST00000340879;ENST00000432678;ENST00000431721;ENST00000449610;ENST00000413298;ENST00000450045;ENST00000446860;ENST00000455545;ENST00000417896;ENST00000443964;ENST00000453202	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.77	5.77	0.91146	.	0.034734	0.85682	D	0.000000	T	0.61350	0.2340	M	0.78916	2.43	0.58432	D	0.999999	P;P;P;P;P;P;P	0.52692	0.955;0.955;0.955;0.874;0.501;0.955;0.501	P;P;P;B;B;B;B	0.50270	0.519;0.636;0.636;0.443;0.081;0.443;0.081	T	0.67783	-0.5581	10	0.87932	D	0	-17.2271	16.0965	0.81129	1.0:0.0:0.0:0.0	.	117;113;114;113;59;113;59	B4E3G6;A8K636;A8K3B1;C9J124;B2RCP4;C9JRM0;Q9UHH9	.;.;.;.;.;.;IP6K2_HUMAN	T	59;59;59;59;59;59;113;59;59;114;59;59;113;117;117;59;118;59	ENSP00000331103:M59T;ENSP00000411776:M59T;ENSP00000414428:M59T;ENSP00000389761:M59T;ENSP00000403968:M59T;ENSP00000395819:M59T;ENSP00000412121:M113T;ENSP00000341925:M59T;ENSP00000400812:M59T;ENSP00000414139:M114T;ENSP00000393077:M59T;ENSP00000396203:M59T;ENSP00000394488:M113T;ENSP00000399052:M117T;ENSP00000410454:M117T;ENSP00000388116:M59T;ENSP00000410950:M118T;ENSP00000387394:M59T	ENSP00000331103:M59T	M	-	2	0	IP6K2	48707553	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.323000	0.96364	2.209000	0.71365	0.254000	0.18369	ATG		0.592	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257521.2	NM_016291	
CCDC71	64925	hgsc.bcm.edu	37	3	49200342	49200342	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:49200342G>A	ENST00000321895.6	-	2	1406	c.1300C>T	c.(1300-1302)Cgg>Tgg	p.R434W		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	434								p.R434W(1)		endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCCGAGGACCGCCTATCTACC	0.577																																					p.R434W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1300T	3						.						76.0	72.0	73.0					3																	49200342		2203	4300	6503	49175346	SO:0001583	missense	64925	exon2			AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.1300C>T	3.37:g.49200342G>A	ENSP00000319006:p.Arg434Trp		49175346	NM_022903	Q6IPE2|Q9H8H4|Q9H9F1	Missense_Mutation	SNP	ENST00000321895.6	37	CCDS2790.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.362149	0.24684	.	.	ENSG00000177352	ENST00000321895	T	0.32515	1.45	5.9	-3.21	0.05140	.	2.218800	0.03232	N	0.179176	T	0.24314	0.0589	L	0.40543	1.245	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.34900	-0.9810	10	0.66056	D	0.02	-32.5149	5.3824	0.16199	0.3735:0.0:0.2067:0.4198	.	434	Q8IV32	CCD71_HUMAN	W	434	ENSP00000319006:R434W	ENSP00000319006:R434W	R	-	1	2	CCDC71	49175346	0.000000	0.05858	0.000000	0.03702	0.701000	0.40568	-0.396000	0.07278	-0.528000	0.06366	0.563000	0.77884	CGG		0.577	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345980.1	NM_022903	
LRTM1	57408	hgsc.bcm.edu	37	3	54959076	54959076	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:54959076T>G	ENST00000273286.5	-	2	336	c.174A>C	c.(172-174)caA>caC	p.Q58H	CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000490478.1_Intron|LRTM1_ENST00000493075.1_5'UTR	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	58						integral component of membrane (GO:0016021)		p.Q58H(1)		breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		TCTGATTATCTTGTAAATGCA	0.458																																					p.Q58H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A174C	3						.						69.0	66.0	67.0					3																	54959076		2203	4300	6503	54934116	SO:0001583	missense	57408	exon2			AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.174A>C	3.37:g.54959076T>G	ENSP00000273286:p.Gln58His		54934116	NM_020678	Q8IUU2	Missense_Mutation	SNP	ENST00000273286.5	37	CCDS2876.1	.	.	.	.	.	.	.	.	.	.	T	13.89	2.371013	0.42003	.	.	ENSG00000144771	ENST00000273286	T	0.02472	4.28	5.74	0.604	0.17547	.	0.052792	0.85682	D	0.000000	T	0.06142	0.0159	L	0.35644	1.08	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.43589	-0.9382	10	0.42905	T	0.14	.	5.937	0.19171	0.0:0.4112:0.147:0.4418	.	58	Q9HBL6	LRTM1_HUMAN	H	58	ENSP00000273286:Q58H	ENSP00000273286:Q58H	Q	-	3	2	LRTM1	54934116	1.000000	0.71417	1.000000	0.80357	0.509000	0.34042	0.980000	0.29513	0.107000	0.17824	0.533000	0.62120	CAA		0.458	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351399.1	NM_020678	
FLNB	2317	hgsc.bcm.edu	37	3	58154290	58154290	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:58154290T>C	ENST00000295956.4	+	44	7487	c.7322T>C	c.(7321-7323)aTg>aCg	p.M2441T	FLNB_ENST00000419752.2_Missense_Mutation_p.M2261T|FLNB-AS1_ENST00000488720.1_RNA|FLNB_ENST00000357272.4_3'UTR|FLNB_ENST00000429972.2_Missense_Mutation_p.M2430T|FLNB_ENST00000484981.1_3'UTR|FLNB_ENST00000490882.1_Missense_Mutation_p.M2472T|FLNB_ENST00000348383.5_Missense_Mutation_p.M2400T|FLNB_ENST00000493452.1_Missense_Mutation_p.M2248T|FLNB_ENST00000358537.3_Missense_Mutation_p.M2417T	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	2441	Interaction with INPPL1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.M2441T(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TACAAAGTCATGTACACCCCC	0.537																																					p.M2472T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T7415C	3						.						111.0	92.0	98.0					3																	58154290		2203	4300	6503	58129330	SO:0001583	missense	2317	exon45			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.7322T>C	3.37:g.58154290T>C	ENSP00000295956:p.Met2441Thr		58129330	NM_001164317	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	T	1.516	-0.548262	0.04024	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7	4.67	4.67	0.58626	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.184234	0.52532	D	0.000072	T	0.59348	0.2187	N	0.00182	-1.905	0.40735	D	0.982783	B;B;B;B;B;B	0.30914	0.23;0.004;0.3;0.0;0.01;0.01	B;B;P;B;B;B	0.45506	0.173;0.005;0.483;0.004;0.038;0.028	T	0.67496	-0.5656	10	0.02654	T	1	.	14.3123	0.66424	0.0:0.0:0.0:1.0	.	2417;2472;2248;2261;2430;2441	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	T	2441;2472;2417;2430;2400;2248;2261	ENSP00000295956:M2441T;ENSP00000420213:M2472T;ENSP00000351339:M2417T;ENSP00000415599:M2430T;ENSP00000232447:M2400T;ENSP00000418510:M2248T;ENSP00000414532:M2261T	ENSP00000295956:M2441T	M	+	2	0	FLNB	58129330	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.809000	0.38922	1.966000	0.57179	0.460000	0.39030	ATG		0.537	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
C3orf67	200844	hgsc.bcm.edu	37	3	58849349	58849349	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:58849349T>C	ENST00000482387.1	-	8	1249	c.1153A>G	c.(1153-1155)Aac>Gac	p.N385D	C3orf67_ENST00000472469.1_Missense_Mutation_p.N292D|C3orf67_ENST00000295966.7_Missense_Mutation_p.N385D|RP11-147N17.1_ENST00000482372.1_RNA|RP11-147N17.1_ENST00000463703.1_RNA|RP11-147N17.1_ENST00000493123.1_RNA|RP11-147N17.1_ENST00000492031.1_RNA			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	385								p.N385D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		GTCACACTGTTATCCTCTTTT	0.438																																					p.N385D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1153G	3						.						98.0	91.0	93.0					3																	58849349		2203	4300	6503	58824389	SO:0001583	missense	200844	exon12			AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.1153A>G	3.37:g.58849349T>C	ENSP00000417122:p.Asn385Asp		58824389	NM_198463	B9EKV6|Q6ZV69	Missense_Mutation	SNP	ENST00000482387.1	37		.	.	.	.	.	.	.	.	.	.	T	5.612	0.297654	0.10622	.	.	ENSG00000163689	ENST00000295966;ENST00000482387;ENST00000394474;ENST00000472469	T;T;T	0.16743	2.33;2.34;2.32	5.41	-1.21	0.09524	.	1.204700	0.05525	N	0.562903	T	0.09113	0.0225	N	0.14661	0.345	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.08055	0.003;0.001;0.002	T	0.38045	-0.9679	10	0.14252	T	0.57	0.1762	7.0504	0.25069	0.0:0.3414:0.1186:0.54	.	292;385;385	C9J3M8;Q6ZVT6-2;Q6ZVT6	.;.;CC067_HUMAN	D	385;385;90;292	ENSP00000295966:N385D;ENSP00000417122:N385D;ENSP00000417271:N292D	ENSP00000295966:N385D	N	-	1	0	C3orf67	58824389	0.000000	0.05858	0.000000	0.03702	0.773000	0.43773	-0.484000	0.06528	-0.113000	0.11958	0.533000	0.62120	AAC		0.438	C3orf67-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000353803.1	NM_198463	
FEZF2	55079	hgsc.bcm.edu	37	3	62356971	62356971	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:62356971C>T	ENST00000283268.3	-	4	1335	c.1041G>A	c.(1039-1041)acG>acA	p.T347T	FEZF2_ENST00000486811.1_Silent_p.T347T|PTPRG-AS1_ENST00000490916.1_RNA|FEZF2_ENST00000475839.1_Silent_p.T347T|PTPRG-AS1_ENST00000495542.1_RNA	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	347					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.T347T(2)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		GCGTGTTGAGCGTGGAGCTGC	0.567																																					p.T347T	NSCLC(170;1772 2053 12525 15604 23984)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1041A	3						.						150.0	131.0	138.0					3																	62356971		2203	4300	6503	62332011	SO:0001819	synonymous_variant	55079	exon4			AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.1041G>A	3.37:g.62356971C>T			62332011	NM_018008	A8K349|Q9BZ91|Q9NWB9	Silent	SNP	ENST00000283268.3	37	CCDS2897.1																																																																																				0.567	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351813.1	NM_018008	
ADAMTS9	56999	hgsc.bcm.edu	37	3	64547424	64547424	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:64547424A>C	ENST00000498707.1	-	30	4870	c.4528T>G	c.(4528-4530)Tct>Gct	p.S1510A	ADAMTS9-AS1_ENST00000594810.1_RNA|ADAMTS9-AS1_ENST00000601022.1_RNA|ADAMTS9-AS1_ENST00000470447.1_RNA|ADAMTS9_ENST00000295903.4_Missense_Mutation_p.S1482A|ADAMTS9-AS1_ENST00000492209.1_RNA|ADAMTS9-AS1_ENST00000474313.1_RNA|ADAMTS9-AS1_ENST00000493124.1_RNA|ADAMTS9-AS1_ENST00000480831.1_RNA	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1510	TSP type-1 12. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.S1510A(1)		breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CAGGACACAGAGCACTAAGAA	0.557																																					p.S1510A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4528G	3						.						99.0	89.0	92.0					3																	64547424		2203	4300	6503	64522464	SO:0001583	missense	56999	exon30			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4528T>G	3.37:g.64547424A>C	ENSP00000418735:p.Ser1510Ala		64522464	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.506479	0.85282	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.68025	-0.3;-0.3	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.88209	0.6375	H	0.97540	4.025	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.77557	0.968;0.99;0.955	D	0.91661	0.5342	10	0.52906	T	0.07	.	16.1435	0.81544	1.0:0.0:0.0:0.0	.	1482;1510;1510	B7ZVX9;Q9P2N4-1;Q9P2N4	.;.;ATS9_HUMAN	A	1482;1510	ENSP00000295903:S1482A;ENSP00000418735:S1510A	ENSP00000295903:S1482A	S	-	1	0	ADAMTS9	64522464	1.000000	0.71417	0.998000	0.56505	0.913000	0.54294	7.387000	0.79785	2.212000	0.71576	0.528000	0.53228	TCT		0.557	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
MITF	4286	hgsc.bcm.edu	37	3	70008502	70008502	+	Silent	SNP	C	C	T	rs576634776		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:70008502C>T	ENST00000448226.2	+	9	1237	c.1110C>T	c.(1108-1110)cgC>cgT	p.R370R	MITF_ENST00000352241.4_Silent_p.R364R|MITF_ENST00000314557.6_Silent_p.R257R|MITF_ENST00000531774.1_Silent_p.R201R|MITF_ENST00000314589.5_Silent_p.R348R|MITF_ENST00000472437.1_Silent_p.R312R|MITF_ENST00000328528.6_Silent_p.R363R|MITF_ENST00000394351.3_Silent_p.R263R|MITF_ENST00000394355.2_Silent_p.R339R			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	370					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)	p.R263R(1)		NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		AACAGCAACGCGCAAAAGAAC	0.463			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""						C|||	1	0.000199681	0.0008	0.0	5008	,	,		16219	0.0		0.0	False		,,,				2504	0.0				p.R257R	Melanoma(29;269 969 31479 41502 42961)		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C771T	3						.						93.0	81.0	85.0					3																	70008502		2203	4300	6503	70091192	SO:0001819	synonymous_variant	4286	exon8				CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.1110C>T	3.37:g.70008502C>T			70091192	NM_198158	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	37																																																																																					0.463	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
OPA1	4976	hgsc.bcm.edu	37	3	193361824	193361824	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr3:193361824A>G	ENST00000392438.3	+	14	1607	c.1373A>G	c.(1372-1374)cAt>cGt	p.H458R	OPA1_ENST00000361828.2_Missense_Mutation_p.H476R|OPA1_ENST00000361150.2_Missense_Mutation_p.H459R|OPA1_ENST00000361908.3_Missense_Mutation_p.H495R|OPA1_ENST00000361715.2_Missense_Mutation_p.H477R|OPA1_ENST00000361510.2_Missense_Mutation_p.H513R	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	458	Dynamin-type G.				apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)	p.H513R(1)		breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		ATGGACCCTCATGGAAGGAGA	0.403																																					p.H440R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1319G	3						.						92.0	87.0	89.0					3																	193361824		2203	4300	6503	194844518	SO:0001583	missense	4976	exon14			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.1373A>G	3.37:g.193361824A>G	ENSP00000376233:p.His458Arg		194844518	NM_130832	D3DNW4	Missense_Mutation	SNP	ENST00000392438.3	37	CCDS43186.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.471648	0.43942	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	D;D;D;D;D;D	0.96651	-4.08;-4.08;-4.08;-4.08;-4.08;-4.08	5.8	5.8	0.92144	Dynamin, GTPase domain (2);	0.099373	0.64402	D	0.000001	D	0.91794	0.7404	N	0.10707	0.03	0.53688	D	0.999977	B;B;B;B;B;B;B;B	0.22909	0.011;0.061;0.025;0.011;0.077;0.025;0.061;0.047	B;B;B;B;B;B;B;B	0.33121	0.065;0.038;0.102;0.103;0.057;0.158;0.062;0.158	D	0.88762	0.3258	10	0.33940	T	0.23	-21.2114	15.3361	0.74255	1.0:0.0:0.0:0.0	.	422;458;440;459;476;495;477;513	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	R	495;458;513;477;476;459	ENSP00000354681:H495R;ENSP00000376233:H458R;ENSP00000355324:H513R;ENSP00000355311:H477R;ENSP00000354429:H476R;ENSP00000354781:H459R	ENSP00000354781:H459R	H	+	2	0	OPA1	194844518	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.307000	0.96226	2.209000	0.71365	0.533000	0.62120	CAT		0.403	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313812.2	NM_130837	
ANO4	121601	hgsc.bcm.edu	37	12	101505456	101505456	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:101505456A>G	ENST00000392977.3	+	24	2628	c.2418A>G	c.(2416-2418)ggA>ggG	p.G806G	ANO4_ENST00000392979.3_Silent_p.G771G|ANO4_ENST00000299222.9_Silent_p.G326G|ANO4_ENST00000550015.1_Silent_p.G326G			Q32M45	ANO4_HUMAN	anoctamin 4	806					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.G771G(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						ATAAGTATGGACCTTGTGCAG	0.398										HNSCC(74;0.22)																											p.G771G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2313G	12						.						111.0	99.0	103.0					12																	101505456		2203	4300	6503	100029587	SO:0001819	synonymous_variant	121601	exon23			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2418A>G	12.37:g.101505456A>G			100029587	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Silent	SNP	ENST00000392977.3	37																																																																																					0.398	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
CCDC60	160777	hgsc.bcm.edu	37	12	119968726	119968726	+	Missense_Mutation	SNP	G	G	A	rs146415894		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:119968726G>A	ENST00000327554.2	+	13	1874	c.1409G>A	c.(1408-1410)cGc>cAc	p.R470H	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	470								p.R470H(1)		endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		AAGAACTTCCGCCCCGCCAAA	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		18801	0.001		0.0	False		,,,				2504	0.0				p.R470H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1409A	12						.	G	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	89.0	87.0	88.0		1409	2.7	1.0	12	dbSNP_134	88	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CCDC60	NM_178499.3	29	0,4,6499	AA,AG,GG		0.0233,0.0454,0.0308	possibly-damaging	470/551	119968726	4,13002	2203	4300	6503	118453109	SO:0001583	missense	160777	exon13			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1409G>A	12.37:g.119968726G>A	ENSP00000333374:p.Arg470His		118453109	NM_178499		Missense_Mutation	SNP	ENST00000327554.2	37	CCDS9190.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.928973	0.52759	4.54E-4	2.33E-4	ENSG00000183273	ENST00000327554	T	0.24723	1.84	5.82	2.72	0.32119	.	0.383807	0.25164	N	0.032648	T	0.37461	0.1004	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.66196	0.942	T	0.10847	-1.0612	9	.	.	.	-13.2127	4.5915	0.12310	0.1431:0.0:0.3948:0.4621	.	470	Q8IWA6	CCD60_HUMAN	H	470	ENSP00000333374:R470H	.	R	+	2	0	CCDC60	118453109	0.832000	0.29368	0.997000	0.53966	0.977000	0.68977	0.044000	0.13992	0.601000	0.29879	0.655000	0.94253	CGC		0.493	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499	
MANSC1	54682	hgsc.bcm.edu	37	12	12483157	12483157	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:12483157G>A	ENST00000535902.1	-	4	1663	c.1100C>T	c.(1099-1101)tCc>tTc	p.S367F	MANSC1_ENST00000545735.1_Missense_Mutation_p.S286F|MANSC1_ENST00000396349.3_Missense_Mutation_p.S333F			Q9H8J5	MANS1_HUMAN	MANSC domain containing 1	367						integral component of membrane (GO:0016021)		p.S367F(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|stomach(4)	23		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		GCCCTGGGAGGAACTGCCTGG	0.483																																					p.S367F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1100T	12						.						83.0	85.0	84.0					12																	12483157		2203	4300	6503	12374424	SO:0001583	missense	54682	exon4			AK001160	CCDS8648.1	12p13.2	2006-04-12				ENSG00000111261			25505	protein-coding gene	gene with protein product						12975309	Standard	NM_018050		Approved	FLJ10298, LOH12CR3	uc001rai.1	Q9H8J5		ENST00000535902.1:c.1100C>T	12.37:g.12483157G>A	ENSP00000438205:p.Ser367Phe		12374424	NM_018050	Q8NEC1|Q9NW60	Missense_Mutation	SNP	ENST00000535902.1	37	CCDS8648.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.664714	0.47572	.	.	ENSG00000111261	ENST00000535902;ENST00000396349;ENST00000355566;ENST00000545735	T;T;T	0.25250	2.11;2.13;1.81	5.12	4.22	0.49857	.	1.146350	0.06706	N	0.772303	T	0.30230	0.0758	L	0.40543	1.245	0.09310	N	1	P;P;P	0.50617	0.937;0.937;0.879	P;P;P	0.46758	0.526;0.526;0.526	T	0.20042	-1.0287	10	0.66056	D	0.02	-1.1526	9.9466	0.41613	0.097:0.0:0.903:0.0	.	301;333;367	B4DQ82;Q9NW60;Q9H8J5	.;.;MANS1_HUMAN	F	367;333;286;286	ENSP00000438205:S367F;ENSP00000379638:S333F;ENSP00000445303:S286F	ENSP00000347765:S286F	S	-	2	0	MANSC1	12374424	0.447000	0.25673	0.014000	0.15608	0.012000	0.07955	1.557000	0.36299	1.125000	0.41998	0.491000	0.48974	TCC		0.483	MANSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400144.1	NM_018050	
KIAA1467	57613	hgsc.bcm.edu	37	12	13238141	13238141	+	IGR	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:13238141C>T	ENST00000197268.8	+	0	4808				GSG1_ENST00000432710.2_Silent_p.S238S|GSG1_ENST00000457134.2_Silent_p.S174S|GSG1_ENST00000337630.6_Silent_p.S225S|GSG1_ENST00000324458.8_Silent_p.S261S|GSG1_ENST00000396302.3_Missense_Mutation_p.G267S|GSG1_ENST00000537302.1_Silent_p.S197S|GSG1_ENST00000396310.2_Silent_p.S194S|GSG1_ENST00000351606.6_Missense_Mutation_p.G303S	NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467							integral component of membrane (GO:0016021)		p.G267S(1)		NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		TGGTGACAGCCGACGCCATGC	0.493																																					p.G303S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G907A	12						.						88.0	61.0	70.0					12																	13238141		2203	4300	6503	13129408	SO:0001628	intergenic_variant	83445	exon7			AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67			12.37:g.13238141C>T			13129408	NM_001080554	Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Missense_Mutation	SNP	ENST00000197268.8	37	CCDS31750.1	.	.	.	.	.	.	.	.	.	.	C	0.735	-0.778321	0.02929	.	.	ENSG00000111305	ENST00000396302;ENST00000351606;ENST00000405543	T;T	0.39997	1.08;1.05	5.66	-11.3	0.00108	.	.	.	.	.	T	0.19685	0.0473	.	.	.	0.80722	D	1	B;B;B	0.15719	0.014;0.014;0.014	B;B;B	0.12837	0.008;0.008;0.003	T	0.42481	-0.9449	7	.	.	.	.	6.9217	0.24391	0.2936:0.4849:0.1194:0.1022	.	303;303;267	Q2KHT4-7;G3XAB9;F1T0A0	.;.;.	S	267;303;264	ENSP00000379596:G267S;ENSP00000336857:G303S	.	G	-	1	0	GSG1	13129408	0.000000	0.05858	0.000000	0.03702	0.569000	0.35902	-3.785000	0.00367	-4.452000	0.00048	-1.267000	0.01435	GGC		0.493	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401007.1	NM_020853	
CIT	11113	hgsc.bcm.edu	37	12	120152116	120152116	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:120152116G>A	ENST00000261833.7	-	32	4118	c.4066C>T	c.(4066-4068)Cgc>Tgc	p.R1356C	CIT_ENST00000537607.1_5'UTR|MIR1178_ENST00000408396.1_RNA|CIT_ENST00000392521.2_Missense_Mutation_p.R1398C	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1356					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R1356C(1)|p.R1384C(1)		breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TGGTGCATGCGTTCCTTAAGA	0.453																																					p.R1356C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C4066T	12						.						170.0	133.0	146.0					12																	120152116		2203	4300	6503	118636499	SO:0001583	missense	11113	exon32			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.4066C>T	12.37:g.120152116G>A	ENSP00000261833:p.Arg1356Cys		118636499	NM_007174	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	37	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216673	0.79352	.	.	ENSG00000122966	ENST00000392521;ENST00000261833	D;D	0.85088	-1.94;-1.94	6.06	5.12	0.69794	.	0.057396	0.64402	D	0.000002	D	0.90827	0.7119	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.993;0.963	D	0.91063	0.4887	10	0.87932	D	0	.	13.9773	0.64282	0.0:0.0:0.735:0.265	.	1398;1356;874	Q2M5E1;O14578;O14578-3	.;CTRO_HUMAN;.	C	1398;1356	ENSP00000376306:R1398C;ENSP00000261833:R1356C	ENSP00000261833:R1356C	R	-	1	0	CIT	118636499	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.440000	0.52886	2.882000	0.98803	0.655000	0.94253	CGC		0.453	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
ARHGDIB	397	hgsc.bcm.edu	37	12	15103502	15103502	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:15103502T>C	ENST00000228945.4	-	2	289	c.145A>G	c.(145-147)Aag>Gag	p.K49E	ARHGDIB_ENST00000541546.1_Missense_Mutation_p.K49E|ARHGDIB_ENST00000541644.1_Missense_Mutation_p.K49E|ARHGDIB_ENST00000539131.1_5'Flank	NM_001175.4	NP_001166.3	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta	49					actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of cell adhesion (GO:0007162)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)	p.K49E(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	15						AGCGTTTTCTTGTACTTAATT	0.478																																					p.K49E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A145G	12						.						260.0	222.0	235.0					12																	15103502		2203	4300	6503	14994769	SO:0001583	missense	397	exon2			L07916	CCDS8671.1	12p12.3	2014-01-30				ENSG00000111348		"""Endogenous ligands"""	679	protein-coding gene	gene with protein product		602843		RAP1GN1, GDIA2, GDID4		8434008, 8356058	Standard	NM_001175		Approved	Ly-GDI, RhoGDI2	uc001rcq.1	P52566		ENST00000228945.4:c.145A>G	12.37:g.15103502T>C	ENSP00000228945:p.Lys49Glu		14994769	NM_001175	B5BU79	Missense_Mutation	SNP	ENST00000228945.4	37	CCDS8671.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.6|25.6	4.657065|4.657065	0.88154|0.88154	.|.	.|.	ENSG00000111348|ENSG00000111348	ENST00000228945;ENST00000541644;ENST00000541546;ENST00000545895;ENST00000541380;ENST00000542276|ENST00000536592	.|.	.|.	.|.	5.19|5.19	5.19|5.19	0.71726|0.71726	Immunoglobulin E-set (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87172|0.87172	0.6111|0.6111	H|H	0.96970|0.96970	3.915|3.915	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.90935|0.90935	0.4793|0.4793	9|5	0.87932|.	D|.	0|.	-23.076|-23.076	13.0442|13.0442	0.58916|0.58916	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	49|.	P52566|.	GDIR2_HUMAN|.	E|R	49|43	.|.	ENSP00000228945:K49E|.	K|Q	-|-	1|2	0|0	ARHGDIB|ARHGDIB	14994769|14994769	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.836000|0.836000	0.47400|0.47400	7.521000|7.521000	0.81832|0.81832	2.179000|2.179000	0.69175|0.69175	0.482000|0.482000	0.46254|0.46254	AAG|CAA		0.478	ARHGDIB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400871.1	NM_001175	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
RASSF8	11228	hgsc.bcm.edu	37	12	26217530	26217530	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:26217530A>C	ENST00000405154.2	+	3	402	c.203A>C	c.(202-204)cAg>cCg	p.Q68P	RASSF8_ENST00000541490.1_Missense_Mutation_p.Q68P|RASSF8_ENST00000381352.3_Missense_Mutation_p.Q68P|RASSF8_ENST00000542865.1_Missense_Mutation_p.Q68P|RASSF8_ENST00000282884.9_Missense_Mutation_p.Q68P	NM_001164748.1	NP_001158220.1	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 8	68	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				signal transduction (GO:0007165)			p.Q68P(1)		cervix(2)|endometrium(1)|large_intestine(6)|lung(15)|urinary_tract(1)	25	Colorectal(261;0.0847)					AAATGGGGGCAGTATGCTAGT	0.458																																					p.Q68P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A203C	12						.						125.0	124.0	124.0					12																	26217530		2203	4300	6503	26108797	SO:0001583	missense	11228	exon4			U82396	CCDS8705.1, CCDS53765.1	12p12.3	2013-05-30	2008-02-22	2005-09-14	ENSG00000123094	ENSG00000123094			13232	protein-coding gene	gene with protein product		608231	"""chromosome 12 open reading frame 2"""	C12orf2			Standard	NM_007211		Approved	HoJ-1	uc001rgx.3	Q8NHQ8	OTTHUMG00000169087	ENST00000405154.2:c.203A>C	12.37:g.26217530A>C	ENSP00000384491:p.Gln68Pro		26108797	NM_007211	A8K1Z0|O95647|Q5SCI2|Q76KB6	Missense_Mutation	SNP	ENST00000405154.2	37	CCDS53765.1	.	.	.	.	.	.	.	.	.	.	A	19.03	3.747887	0.69533	.	.	ENSG00000123094	ENST00000381352;ENST00000535907;ENST00000405154;ENST00000542865;ENST00000541490;ENST00000542004;ENST00000542315;ENST00000541218;ENST00000282884;ENST00000545413;ENST00000541934	T;T;T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.39	5.39	0.77823	Ras-association (3);	0.000000	0.85682	D	0.000000	T	0.51466	0.1676	L	0.41573	1.285	0.80722	D	1	B;D	0.65815	0.39;0.995	B;P	0.62382	0.37;0.901	T	0.42068	-0.9473	10	0.28530	T	0.3	-20.7847	14.8942	0.70630	1.0:0.0:0.0:0.0	.	68;68	Q8NHQ8-2;Q8NHQ8	.;RASF8_HUMAN	P	68	ENSP00000370756:Q68P;ENSP00000442036:Q68P;ENSP00000384491:Q68P;ENSP00000439839:Q68P;ENSP00000443096:Q68P;ENSP00000442485:Q68P;ENSP00000441294:Q68P;ENSP00000445970:Q68P;ENSP00000282884:Q68P;ENSP00000443696:Q68P	ENSP00000282884:Q68P	Q	+	2	0	RASSF8	26108797	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	8.893000	0.92498	2.188000	0.69820	0.533000	0.62120	CAG		0.458	RASSF8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402209.2	NM_007211	
CCDC91	55297	hgsc.bcm.edu	37	12	28702060	28702060	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:28702060A>C	ENST00000545336.1	+	16	1699	c.1280A>C	c.(1279-1281)aAa>aCa	p.K427T	CCDC91_ENST00000306172.5_Missense_Mutation_p.K397T|CCDC91_ENST00000539107.1_Missense_Mutation_p.K391T|CCDC91_ENST00000540401.1_3'UTR|CCDC91_ENST00000381256.1_Missense_Mutation_p.K391T|CCDC91_ENST00000381259.1_Missense_Mutation_p.K427T			Q7Z6B0	CCD91_HUMAN	coiled-coil domain containing 91	427					protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|skin(1)	22	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					TGTGCACAGAAACAGTTAAGT	0.383																																					p.K427T												.	.	0			c.A1280C	12						.						142.0	140.0	141.0					12																	28702060		2203	4300	6503	28593327	SO:0001583	missense	55297	exon12			AK093152	CCDS8716.1	12p11.22	2006-03-17				ENSG00000123106			24855	protein-coding gene	gene with protein product	"""GGA binding partner"""					12808037	Standard	XM_005253413		Approved	p56, FLJ11088, DKFZp779L1558	uc001riq.3	Q7Z6B0		ENST00000545336.1:c.1280A>C	12.37:g.28702060A>C	ENSP00000438040:p.Lys427Thr		28593327	NM_018318	B3KSA3|C9JR07|Q68D43|Q6IA78|Q8NEN7|Q9NUW9	Missense_Mutation	SNP	ENST00000545336.1	37	CCDS8716.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.69|19.69	3.875496|3.875496	0.72180|0.72180	.|.	.|.	ENSG00000123106|ENSG00000123106	ENST00000539107;ENST00000545336;ENST00000381259;ENST00000381256;ENST00000306172;ENST00000542814;ENST00000541792|ENST00000542801;ENST00000543019	T;T;T;T;T|.	0.43688|.	0.94;1.3;1.3;0.94;1.29|.	5.84|5.84	4.7|4.7	0.59300|0.59300	.|.	0.175449|.	0.40144|.	N|.	0.001165|.	T|T	0.30823|0.30823	0.0777|0.0777	N|N	0.19112|0.19112	0.55|0.55	0.30230|0.30230	N|N	0.796021|0.796021	P;D;P|.	0.55800|.	0.835;0.973;0.933|.	B;P;P|.	0.56563|.	0.384;0.801;0.732|.	T|T	0.25187|0.25187	-1.0139|-1.0139	10|5	0.72032|.	D|.	0.01|.	-19.0333|-19.0333	9.7182|9.7182	0.40286|0.40286	0.9224:0.0:0.0776:0.0|0.9224:0.0:0.0776:0.0	.|.	391;427;397|.	Q7Z6B0-3;Q7Z6B0;Q7Z6B0-2|.	.;CCD91_HUMAN;.|.	T|H	391;427;427;391;397;22;22|98;22	ENSP00000440513:K391T;ENSP00000438040:K427T;ENSP00000370658:K427T;ENSP00000370655:K391T;ENSP00000305075:K397T|.	ENSP00000305075:K397T|.	K|N	+|+	2|1	0|0	CCDC91|CCDC91	28593327|28593327	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	4.355000|4.355000	0.59424|0.59424	1.055000|1.055000	0.40461|0.40461	0.533000|0.533000	0.62120|0.62120	AAA|AAC		0.383	CCDC91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402447.1	NM_018318	
FAR2	55711	hgsc.bcm.edu	37	12	29469923	29469923	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:29469923C>T	ENST00000536681.3	+	9	1351	c.1105C>T	c.(1105-1107)Cgg>Tgg	p.R369W	FAR2_ENST00000547116.1_Missense_Mutation_p.R272W|RP11-996F15.2_ENST00000553105.1_RNA|FAR2_ENST00000182377.4_Missense_Mutation_p.R369W	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	369					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)	p.R369W(1)		central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						CTGCTATCTGCGGCTCACTGG	0.507																																					p.R369W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1105T	12						.						124.0	125.0	125.0					12																	29469923		2203	4300	6503	29361190	SO:0001583	missense	55711	exon9			AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.1105C>T	12.37:g.29469923C>T	ENSP00000443291:p.Arg369Trp		29361190	NM_018099	F8VV73|Q9H0D5|Q9NVW8	Missense_Mutation	SNP	ENST00000536681.3	37	CCDS8717.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.434912	0.25813	.	.	ENSG00000064763	ENST00000536681;ENST00000182377;ENST00000547116	T;T;T	0.33438	1.82;1.82;1.41	4.44	-2.56	0.06268	.	0.069786	0.53938	N	0.000043	T	0.26268	0.0641	M	0.79475	2.455	0.22446	N	0.999095	B	0.31054	0.306	B	0.30179	0.112	T	0.14643	-1.0465	10	0.35671	T	0.21	-19.8622	5.299	0.15768	0.604:0.2031:0.1138:0.0791	.	369	Q96K12	FACR2_HUMAN	W	369;369;272	ENSP00000443291:R369W;ENSP00000182377:R369W;ENSP00000449349:R272W	ENSP00000182377:R369W	R	+	1	2	FAR2	29361190	0.260000	0.24053	0.010000	0.14722	0.762000	0.43233	0.043000	0.13971	-0.844000	0.04184	0.467000	0.42956	CGG		0.507	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099	
IPO8	10526	hgsc.bcm.edu	37	12	30829461	30829461	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:30829461G>A	ENST00000256079.4	-	6	1038	c.700C>T	c.(700-702)Cga>Tga	p.R234*	IPO8_ENST00000544829.1_Nonsense_Mutation_p.R29*	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	234					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)	p.R234*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ATAATAGTTCGGAAGATCTCC	0.418																																					p.R234X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C700T	12						.						153.0	134.0	141.0					12																	30829461		2203	4300	6503	30720728	SO:0001587	stop_gained	10526	exon6			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.700C>T	12.37:g.30829461G>A	ENSP00000256079:p.Arg234*		30720728	NM_006390	B7Z7M3	Nonsense_Mutation	SNP	ENST00000256079.4	37	CCDS8719.1	.	.	.	.	.	.	.	.	.	.	G	41	8.833212	0.98970	.	.	ENSG00000133704	ENST00000256079;ENST00000544829;ENST00000542464	.	.	.	5.16	4.26	0.50523	.	0.063152	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-10.828	12.8555	0.57882	0.0:0.0:0.7036:0.2964	.	.	.	.	X	234;29;48	.	ENSP00000256079:R234X	R	-	1	2	IPO8	30720728	0.994000	0.37717	0.830000	0.32933	0.997000	0.91878	1.792000	0.38754	1.140000	0.42260	0.655000	0.94253	CGA		0.418	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
PDZRN4	29951	hgsc.bcm.edu	37	12	41961694	41961694	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:41961694T>C	ENST00000402685.2	+	9	1585	c.1577T>C	c.(1576-1578)gTg>gCg	p.V526A	PDZRN4_ENST00000298919.7_Missense_Mutation_p.V266A|PDZRN4_ENST00000539469.2_Missense_Mutation_p.V268A	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	526							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V268A(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GCCAATGAGGTGGAGCAGGTA	0.388																																					p.V526A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1577C	12						.						102.0	89.0	93.0					12																	41961694		2203	4300	6503	40247961	SO:0001583	missense	29951	exon9			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1577T>C	12.37:g.41961694T>C	ENSP00000384197:p.Val526Ala		40247961	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	T	11.05	1.524475	0.27299	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.71934	-0.61;3.84;3.84	4.85	2.48	0.30137	.	0.294132	0.28130	N	0.016486	T	0.53077	0.1774	L	0.27053	0.805	0.28811	N	0.898243	B;B;B	0.25609	0.13;0.068;0.001	B;B;B	0.20184	0.028;0.026;0.015	T	0.44375	-0.9332	10	0.34782	T	0.22	-11.7229	9.1205	0.36784	0.0:0.1529:0.0:0.8471	.	526;266;268	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	A	526;268;266	ENSP00000384197:V526A;ENSP00000439990:V268A;ENSP00000298919:V266A	ENSP00000298919:V266A	V	+	2	0	PDZRN4	40247961	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	2.231000	0.43009	0.411000	0.25702	0.477000	0.44152	GTG		0.388	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
PCED1B	91523	hgsc.bcm.edu	37	12	47471492	47471492	+	5'Flank	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:47471492T>C	ENST00000546455.1	+	0	0				AMIGO2_ENST00000429635.1_Missense_Mutation_p.K432E|AMIGO2_ENST00000321382.3_Missense_Mutation_p.K432E|AMIGO2_ENST00000550413.1_Missense_Mutation_p.K432E|AMIGO2_ENST00000266581.4_Missense_Mutation_p.K432E			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B								hydrolase activity (GO:0016787)	p.K432E(1)									AGCATATTTTTCTGTCTCTTG	0.488																																					p.K432E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1294G	12						.						147.0	156.0	153.0					12																	47471492		2203	4300	6503	45757759	SO:0001631	upstream_gene_variant	347902	exon2			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617		12.37:g.47471492T>C	Exception_encountered		45757759	NM_181847	Q96B20	Missense_Mutation	SNP	ENST00000546455.1	37	CCDS8752.1	.	.	.	.	.	.	.	.	.	.	T	15.58	2.876285	0.51801	.	.	ENSG00000139211	ENST00000266581;ENST00000550413;ENST00000429635;ENST00000321382	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	5.08	5.08	0.68730	.	0.243789	0.40908	D	0.000993	T	0.50292	0.1607	L	0.46157	1.445	0.54753	D	0.99998	P	0.52316	0.952	P	0.49477	0.612	T	0.50127	-0.8864	10	0.44086	T	0.13	-11.2548	14.7375	0.69427	0.0:0.0:0.0:1.0	.	432	Q86SJ2	AMGO2_HUMAN	E	432	ENSP00000266581:K432E;ENSP00000449034:K432E;ENSP00000406020:K432E;ENSP00000320848:K432E	ENSP00000266581:K432E	K	-	1	0	AMIGO2	45757759	1.000000	0.71417	0.953000	0.39169	0.986000	0.74619	5.699000	0.68310	2.212000	0.71576	0.454000	0.30748	AAA		0.488	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405079.1	NM_138371	
ERBB3	2065	hgsc.bcm.edu	37	12	56478854	56478854	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:56478854G>T	ENST00000267101.3	+	3	750	c.310G>T	c.(310-312)Gtg>Ttg	p.V104L	ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000415288.2_Missense_Mutation_p.V45L|ERBB3_ENST00000411731.2_Missense_Mutation_p.V104L	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	104			V -> M (in an ovarian mucinous carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.V104M(7)|p.V104L(2)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CAACCTCCGCGTGGTGCGAGG	0.517																																					p.V104L												ERBB3,ovary,NS,Substitution - Missense,0	.	9	Substitution - Missense(9)	large_intestine(5)|endometrium(2)|ovary(1)|NS(1)	c.G310T	12						.						186.0	159.0	168.0					12																	56478854		2203	4300	6503	54765121	SO:0001583	missense	2065	exon3			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.310G>T	12.37:g.56478854G>T	ENSP00000267101:p.Val104Leu		54765121	NM_001005915	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.745072	0.30865	.	.	ENSG00000065361	ENST00000549282;ENST00000549061;ENST00000267101;ENST00000394099;ENST00000411731;ENST00000549672;ENST00000415288	T;T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36;-1.36	5.82	4.93	0.64822	EGF receptor, L domain (1);	0.096412	0.43416	N	0.000573	T	0.67050	0.2852	N	0.25825	0.765	0.80722	D	1	B;P	0.42483	0.282;0.781	B;B	0.35859	0.149;0.212	T	0.69003	-0.5260	10	0.49607	T	0.09	.	10.6531	0.45659	0.1547:0.0:0.8453:0.0	.	104;104	P21860;P21860-2	ERBB3_HUMAN;.	L	104;45;104;104;104;45;45	ENSP00000448636:V104L;ENSP00000449138:V45L;ENSP00000267101:V104L;ENSP00000415753:V104L;ENSP00000449713:V45L;ENSP00000408340:V45L	ENSP00000267101:V104L	V	+	1	0	ERBB3	54765121	1.000000	0.71417	0.892000	0.35008	0.052000	0.14988	4.300000	0.59079	1.450000	0.47717	0.655000	0.94253	GTG		0.517	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
LRIG3	121227	hgsc.bcm.edu	37	12	59284453	59284453	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:59284453T>G	ENST00000320743.3	-	4	795	c.509A>C	c.(508-510)aAa>aCa	p.K170T	LRIG3_ENST00000379141.4_Missense_Mutation_p.K110T	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	170					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.K170T(1)	LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			TTACAGATATTTGAGCTGTAG	0.343			T	ROS1	NSCLC																																p.K170T			Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A509C	12						.						84.0	86.0	85.0					12																	59284453		2203	4300	6503	57570720	SO:0001583	missense	121227	exon4			AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.509A>C	12.37:g.59284453T>G	ENSP00000326759:p.Lys170Thr		57570720	NM_153377	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	37	CCDS8960.1	.	.	.	.	.	.	.	.	.	.	T	16.97	3.269513	0.59540	.	.	ENSG00000139263	ENST00000379141;ENST00000320743;ENST00000552267	T;T;T	0.59364	0.27;0.27;0.27	5.65	5.65	0.86999	.	0.000000	0.38959	N	0.001519	T	0.58750	0.2144	N	0.11131	0.1	0.58432	D	0.999998	B;D	0.89917	0.357;1.0	B;D	0.91635	0.236;0.999	T	0.60924	-0.7166	9	.	.	.	.	16.1778	0.81874	0.0:0.0:0.0:1.0	.	110;170	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	T	110;170;77	ENSP00000368436:K110T;ENSP00000326759:K170T;ENSP00000449109:K77T	.	K	-	2	0	LRIG3	57570720	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	6.215000	0.72206	2.279000	0.76181	0.533000	0.62120	AAA		0.343	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
KRR1	11103	hgsc.bcm.edu	37	12	75893613	75893613	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:75893613T>C	ENST00000229214.4	-	10	1145	c.1122A>G	c.(1120-1122)gaA>gaG	p.E374E	KRR1_ENST00000438169.2_Silent_p.E317E|GLIPR1_ENST00000266659.3_3'UTR	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	374	Lys-rich.				rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						TCTTTTTCTTTTCATCTGCCT	0.358																																					p.E374E												.	.	0			c.A1122G	12						.						79.0	73.0	75.0					12																	75893613		2203	4300	6503	74179880	SO:0001819	synonymous_variant	11103	exon10			U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.1122A>G	12.37:g.75893613T>C			74179880	NM_007043	A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Silent	SNP	ENST00000229214.4	37	CCDS9012.1																																																																																				0.358	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405727.1	NM_007043	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85450813	85450813	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:85450813T>C	ENST00000393217.2	+	8	2303	c.2242T>C	c.(2242-2244)Tca>Cca	p.S748P		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	748								p.S748P(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		CTGGATAAAATCATTTAAACC	0.388																																					p.S748P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2242C	12						.						169.0	190.0	183.0					12																	85450813		2202	4299	6501	83974944	SO:0001583	missense	84125	exon8			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2242T>C	12.37:g.85450813T>C	ENSP00000376910:p.Ser748Pro		83974944	NM_032165	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	T	19.86	3.905396	0.72868	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.55234	0.53	5.56	1.33	0.21861	.	0.360022	0.22506	N	0.059179	T	0.53222	0.1783	L	0.43152	1.355	0.28132	N	0.93015	D;D	0.71674	0.996;0.998	P;P	0.59115	0.755;0.852	T	0.44065	-0.9352	10	0.72032	D	0.01	.	5.6184	0.17444	0.4785:0.0:0.1215:0.4	.	748;723	Q96JM4;C9JI57	LRIQ1_HUMAN;.	P	748;723;748	ENSP00000376910:S748P	ENSP00000256007:S748P	S	+	1	0	LRRIQ1	83974944	1.000000	0.71417	0.985000	0.45067	0.941000	0.58515	2.000000	0.40816	0.903000	0.36546	0.482000	0.46254	TCA		0.388	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
USP44	84101	hgsc.bcm.edu	37	12	95918457	95918457	+	Splice_Site	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:95918457T>C	ENST00000258499.3	-	4	2020	c.1732A>G	c.(1732-1734)Agg>Ggg	p.R578G	USP44_ENST00000552440.1_3'UTR|USP44_ENST00000537435.2_Splice_Site_p.R578G|USP44_ENST00000393091.2_Splice_Site_p.R578G	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	578	USP.				mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.R578G(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						ACTACAGACCTGAATCGTTTG	0.388																																					p.R578G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1732G	12						.						164.0	151.0	155.0					12																	95918457		2203	4300	6503	94442588	SO:0001630	splice_region_variant	84101	exon4			AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.1733+1A>G	12.37:g.95918457T>C			94442588	NM_001042403	B2RDW3	Missense_Mutation	SNP	ENST00000258499.3	37	CCDS9053.1	.	.	.	.	.	.	.	.	.	.	T	15.06	2.721069	0.48728	.	.	ENSG00000136014	ENST00000258499;ENST00000393091;ENST00000537435	T;T;T	0.30981	1.51;1.51;1.51	5.68	5.68	0.88126	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.041305	0.85682	D	0.000000	T	0.53530	0.1802	M	0.71581	2.175	0.52099	D	0.999946	D	0.89917	1.0	D	0.87578	0.998	T	0.57015	-0.7883	10	0.72032	D	0.01	.	11.8677	0.52503	0.0:0.0:0.1458:0.8542	.	578	Q9H0E7	UBP44_HUMAN	G	578	ENSP00000258499:R578G;ENSP00000376806:R578G;ENSP00000442629:R578G	ENSP00000258499:R578G	R	-	1	2	USP44	94442588	1.000000	0.71417	1.000000	0.80357	0.137000	0.21094	4.958000	0.63660	2.167000	0.68274	0.260000	0.18958	AGG		0.388	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147	Missense_Mutation
ZNF140	7699	hgsc.bcm.edu	37	12	133682199	133682199	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr12:133682199T>C	ENST00000355557.2	+	5	1619	c.336T>C	c.(334-336)ccT>ccC	p.P112P	ZNF140_ENST00000544426.1_Silent_p.P9P|ZNF140_ENST00000440550.2_Intron	NM_003440.2	NP_003431.2	P52738	ZN140_HUMAN	zinc finger protein 140	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P112P(1)		NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.114)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GTCAAGGCCCTGTGTATTCCA	0.388																																					p.P112P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T336C	12						.						1.0	1.0	1.0					12																	133682199		126	310	436	132192272	SO:0001819	synonymous_variant	7699	exon5			U09368	CCDS9282.1, CCDS73550.1	12q24.33	2013-01-08	2006-06-13		ENSG00000196387	ENSG00000196387		"""Zinc fingers, C2H2-type"", ""-"""	12925	protein-coding gene	gene with protein product		604082	"""zinc finger protein 140 (clone pHZ-39)"""			7557990	Standard	XR_245353		Approved	pHZ-39	uc001ulo.3	P52738	OTTHUMG00000167942	ENST00000355557.2:c.336T>C	12.37:g.133682199T>C			132192272	NM_003440	D3DXJ3|Q05CP6|Q8IV75	Silent	SNP	ENST00000355557.2	37	CCDS9282.1																																																																																				0.388	ZNF140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397169.1	NM_003440	
GPR176	11245	hgsc.bcm.edu	37	15	40094145	40094145	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:40094145G>A	ENST00000561100.1	-	3	1601	c.736C>T	c.(736-738)Cgg>Tgg	p.R246W	GPR176_ENST00000560729.1_5'UTR|GPR176_ENST00000543580.1_Missense_Mutation_p.R201W|GPR176_ENST00000299092.3_Missense_Mutation_p.R245W|RP11-37C7.1_ENST00000558616.1_RNA	NM_007223.1	NP_009154.1	Q14439	GP176_HUMAN	G protein-coupled receptor 176	246					G-protein coupled receptor signaling pathway (GO:0007186)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.R246W(1)		central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(9)|ovary(2)|pancreas(1)|skin(2)	23		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		TGTGGGGTCCGGAGCGCTGCT	0.577											OREG0023053	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R246W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C736T	15						.						112.0	112.0	112.0					15																	40094145		2203	4300	6503	37881437	SO:0001583	missense	11245	exon3			BC067106	CCDS10051.1, CCDS61588.1, CCDS61589.1	15q14-q15.1	2012-08-21			ENSG00000166073	ENSG00000166073		"""GPCR / Class A : Orphans"""	32370	protein-coding gene	gene with protein product		612183				7893747	Standard	NM_007223		Approved	Gm1012	uc010uck.2	Q14439	OTTHUMG00000129873	ENST00000561100.1:c.736C>T	15.37:g.40094145G>A	ENSP00000453076:p.Arg246Trp	890	37881437	NM_007223	Q6NXF6	Missense_Mutation	SNP	ENST00000561100.1	37	CCDS10051.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339747	0.60963	.	.	ENSG00000166073	ENST00000299092;ENST00000543580	T	0.40476	1.03	5.86	4.92	0.64577	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.58949	0.2158	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61466	-0.7057	10	0.66056	D	0.02	-25.1485	13.0795	0.59104	0.0:0.0:0.5435:0.4565	.	246	Q14439	GP176_HUMAN	W	246;201	ENSP00000439361:R201W	ENSP00000299092:R246W	R	-	1	2	GPR176	37881437	1.000000	0.71417	0.941000	0.38009	0.994000	0.84299	3.375000	0.52410	1.418000	0.47098	0.563000	0.77884	CGG		0.577	GPR176-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252117.2	NM_007223	
CDAN1	146059	hgsc.bcm.edu	37	15	43019958	43019958	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:43019958C>A	ENST00000356231.3	-	23	2980	c.2957G>T	c.(2956-2958)aGg>aTg	p.R986M		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	986					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R986M(1)		endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CACCTCCCTCCTGATCAGTGC	0.622																																					p.R986M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2957T	15						.						92.0	74.0	80.0					15																	43019958		2203	4299	6502	40807250	SO:0001583	missense	146059	exon23			AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.2957G>T	15.37:g.43019958C>A	ENSP00000348564:p.Arg986Met		40807250	NM_138477	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	37	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061540	0.76187	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.87029	-2.2	6.07	6.07	0.98685	.	0.093171	0.85682	D	0.000000	D	0.88883	0.6558	L	0.41236	1.265	0.33778	D	0.623884	D;D	0.71674	0.998;0.994	P;P	0.62560	0.904;0.902	D	0.91609	0.5301	10	0.87932	D	0	-17.2569	11.4039	0.49885	0.0:0.9189:0.0:0.0811	.	986;984	Q8IWY9;C9K0H8	CDAN1_HUMAN;.	M	986;984	ENSP00000348564:R986M	ENSP00000267892:R984M	R	-	2	0	CDAN1	40807250	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.436000	0.44819	2.884000	0.98904	0.655000	0.94253	AGG		0.622	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
GALK2	2585	hgsc.bcm.edu	37	15	49584555	49584555	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:49584555A>G	ENST00000560031.1	+	8	1095	c.788A>G	c.(787-789)gAc>gGc	p.D263G	GALK2_ENST00000544523.1_Missense_Mutation_p.D239G|GALK2_ENST00000327171.3_Missense_Mutation_p.D252G|GALK2_ENST00000543495.1_Missense_Mutation_p.D134G|GALK2_ENST00000396509.2_Missense_Mutation_p.D239G|GALK2_ENST00000559454.1_Missense_Mutation_p.D239G|GALK2_ENST00000561014.1_3'UTR			Q01415	GALK2_HUMAN	galactokinase 2	263					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)	p.D252G(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		TTGCAATGGGACAAAGTACTG	0.403																																					p.D263G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A788G	15						.						95.0	105.0	101.0					15																	49584555		2196	4295	6491	47371847	SO:0001583	missense	2585	exon8				CCDS32236.1, CCDS42034.1, CCDS73724.1	15q21.1-q21.2	2013-09-20			ENSG00000156958	ENSG00000156958	2.7.1.6		4119	protein-coding gene	gene with protein product		137028					Standard	XM_005254279		Approved	GK2	uc001zxj.1	Q01415	OTTHUMG00000172325	ENST00000560031.1:c.788A>G	15.37:g.49584555A>G	ENSP00000453129:p.Asp263Gly		47371847	NM_002044	Q7Z4Q4	Missense_Mutation	SNP	ENST00000560031.1	37	CCDS42034.1	.	.	.	.	.	.	.	.	.	.	A	2.580	-0.297648	0.05532	.	.	ENSG00000156958	ENST00000327171;ENST00000396509;ENST00000543495;ENST00000544523	D;T;D	0.85556	-2.0;-0.51;-1.99	5.6	0.456	0.16655	.	0.505894	0.25842	N	0.027947	T	0.58061	0.2096	N	0.01576	-0.805	0.19775	N	0.999951	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.51687	-0.8674	10	0.30078	T	0.28	-14.5832	5.5966	0.17331	0.6186:0.0:0.2667:0.1147	.	263;252	Q01415;Q7Z4Q4	GALK2_HUMAN;.	G	252;263;134;239	ENSP00000316632:D252G;ENSP00000443220:D134G;ENSP00000440312:D239G	ENSP00000316632:D252G	D	+	2	0	GALK2	47371847	0.970000	0.33590	0.081000	0.20488	0.001000	0.01503	2.189000	0.42621	0.094000	0.17404	-0.361000	0.07541	GAC		0.403	GALK2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417854.1		
MYZAP	100820829	hgsc.bcm.edu	37	15	57913814	57913814	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:57913814C>T	ENST00000267853.5	+	4	421	c.327C>T	c.(325-327)gcC>gcT	p.A109A	GCOM1_ENST00000587652.1_Silent_p.A109A|GCOM1_ENST00000380568.3_Silent_p.A109A|GCOM1_ENST00000380561.2_Intron|POLR2M_ENST00000380563.2_Intron|GCOM1_ENST00000574161.1_Silent_p.A109A|MYZAP_ENST00000380565.4_Silent_p.A109A|GCOM1_ENST00000380569.2_Silent_p.A109A|GCOM1_ENST00000572390.1_Silent_p.A109A|GCOM1_ENST00000396180.1_Intron|GCOM1_ENST00000380560.2_Intron			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	109					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)		p.A109A(1)									AGGTGAGAGCCACTTTGGAAA	0.378																																					p.A109A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C327T	15						.						123.0	120.0	121.0					15																	57913814		2192	4292	6484	55701106	SO:0001819	synonymous_variant	145781	exon4			FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.327C>T	15.37:g.57913814C>T			55701106	NM_152451	D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Silent	SNP	ENST00000267853.5	37	CCDS10162.1																																																																																				0.378	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255716.2	NM_001018100	
SLTM	79811	hgsc.bcm.edu	37	15	59182496	59182496	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:59182496C>T	ENST00000380516.2	-	15	2150	c.2063G>A	c.(2062-2064)cGc>cAc	p.R688H	SLTM_ENST00000536328.1_Missense_Mutation_p.R257H|AC025918.2_ENST00000452467.1_RNA	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	688	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R688H(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AATACGAATGCGTTCCCTTTC	0.413																																					p.R688H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G2063A	15						.						143.0	146.0	145.0					15																	59182496		2192	4291	6483	56969788	SO:0001583	missense	79811	exon15			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.2063G>A	15.37:g.59182496C>T	ENSP00000369887:p.Arg688His		56969788	NM_024755	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000380516.2	37	CCDS10168.2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987392	0.74589	.	.	ENSG00000137776	ENST00000380516;ENST00000432750;ENST00000536328	T	0.32515	1.45	5.86	5.86	0.93980	.	0.000000	0.56097	D	0.000021	T	0.58750	0.2144	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.59021	-0.7532	10	0.87932	D	0	.	20.1802	0.98196	0.0:1.0:0.0:0.0	.	688;257	Q9NWH9;A8K5V8	SLTM_HUMAN;.	H	688;254;257	ENSP00000369887:R688H	ENSP00000369887:R688H	R	-	2	0	SLTM	56969788	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.937000	0.75898	2.777000	0.95525	0.655000	0.94253	CGC		0.413	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755	
ZWILCH	55055	hgsc.bcm.edu	37	15	66811327	66811327	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:66811327A>G	ENST00000307897.5	+	5	811	c.431A>G	c.(430-432)gAt>gGt	p.D144G	ZWILCH_ENST00000565960.1_Intron|ZWILCH_ENST00000535141.2_Missense_Mutation_p.D30G|ZWILCH_ENST00000565627.1_Missense_Mutation_p.D30G|RPL4_ENST00000564517.1_Intron|ZWILCH_ENST00000446801.2_Missense_Mutation_p.D30G|RPL4_ENST00000568588.1_Intron	NM_017975.3	NP_060445.3	Q9H900	ZWILC_HUMAN	zwilch kinetochore protein	144					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)		p.D144G(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(1)|lung(6)|ovary(1)	18						GACAGTTCAGATCCTGAAGGT	0.433																																					p.D144G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A431G	15						.						175.0	162.0	167.0					15																	66811327		2201	4299	6500	64598381	SO:0001583	missense	55055	exon5			AK023175	CCDS10219.1, CCDS73746.1	15q22.31	2013-01-17	2012-12-13		ENSG00000174442	ENSG00000174442			25468	protein-coding gene	gene with protein product		609984	"""Zwilch, kinetochore associated, homolog (Drosophila)"""			12686595	Standard	NM_017975		Approved	FLJ10036, KNTC1AP	uc002aqb.3	Q9H900	OTTHUMG00000133194	ENST00000307897.5:c.431A>G	15.37:g.66811327A>G	ENSP00000311429:p.Asp144Gly		64598381	NM_017975	B3KVB8|Q6N049|Q8N404|Q96SY7|Q9NWG7	Missense_Mutation	SNP	ENST00000307897.5	37	CCDS10219.1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.683755	0.68157	.	.	ENSG00000174442	ENST00000307897;ENST00000446801;ENST00000535141	T;T;T	0.61158	0.13;0.13;0.13	5.76	5.76	0.90799	.	0.091972	0.64402	D	0.000001	T	0.69351	0.3101	M	0.68952	2.095	0.58432	D	0.999999	D	0.62365	0.991	P	0.58331	0.837	T	0.67760	-0.5587	10	0.30854	T	0.27	-16.9671	14.8992	0.70666	1.0:0.0:0.0:0.0	.	144	Q9H900	ZWILC_HUMAN	G	144;30;30	ENSP00000311429:D144G;ENSP00000402217:D30G;ENSP00000437749:D30G	ENSP00000311429:D144G	D	+	2	0	ZWILCH	64598381	1.000000	0.71417	1.000000	0.80357	0.199000	0.23934	7.526000	0.81920	2.180000	0.69256	0.528000	0.53228	GAT		0.433	ZWILCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256904.4	NM_017975	
LARP6	55323	hgsc.bcm.edu	37	15	71124932	71124932	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:71124932G>A	ENST00000299213.8	-	3	1005	c.935C>T	c.(934-936)gCg>gTg	p.A312V	RP11-138H8.7_ENST00000592096.1_lincRNA	NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	312					regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.A312V(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						GTGGATGCTCGCAGTGGGCTC	0.502																																					p.A312V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C935T	15						.						162.0	154.0	157.0					15																	71124932		2199	4297	6496	68911986	SO:0001583	missense	55323	exon3			BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.935C>T	15.37:g.71124932G>A	ENSP00000299213:p.Ala312Val		68911986	NM_018357	Q5XKE4|Q8N3N2|Q9NUR0	Missense_Mutation	SNP	ENST00000299213.8	37	CCDS32281.1	.	.	.	.	.	.	.	.	.	.	G	4.926	0.172086	0.09391	.	.	ENSG00000166173	ENST00000299213	T	0.44881	0.91	4.77	-6.06	0.02165	.	0.665601	0.16044	N	0.232265	T	0.16514	0.0397	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09465	-1.0673	10	0.26408	T	0.33	-0.4573	4.1997	0.10460	0.5434:0.1028:0.2498:0.104	.	312	Q9BRS8	LARP6_HUMAN	V	312	ENSP00000299213:A312V	ENSP00000299213:A312V	A	-	2	0	LARP6	68911986	0.000000	0.05858	0.000000	0.03702	0.408000	0.30992	-0.206000	0.09398	-0.905000	0.03871	-0.263000	0.10527	GCG		0.502	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417197.2	NM_018357	
PTPN9	5780	hgsc.bcm.edu	37	15	75798254	75798254	+	Missense_Mutation	SNP	C	C	T	rs144459324		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:75798254C>T	ENST00000306726.2	-	7	1242	c.730G>A	c.(730-732)Gcc>Acc	p.A244T	PTPN9_ENST00000564970.1_5'Flank	NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	244					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)	p.A244T(1)		central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TTCCAAGTGGCGAGATCAATT	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		20477	0.0		0.001	False		,,,				2504	0.0				p.A244T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G730A	15						.						91.0	88.0	89.0					15																	75798254		2197	4294	6491	73585309	SO:0001583	missense	5780	exon7				CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.730G>A	15.37:g.75798254C>T	ENSP00000303554:p.Ala244Thr		73585309	NM_002833	Q53XR9	Missense_Mutation	SNP	ENST00000306726.2	37	CCDS10280.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.86	1.470093	0.26423	.	.	ENSG00000169410	ENST00000306726;ENST00000544966	D	0.84146	-1.81	5.92	3.67	0.42095	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.710900	0.14911	N	0.291250	T	0.59046	0.2165	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50233	-0.8852	10	0.13108	T	0.6	.	6.9885	0.24741	0.1256:0.6578:0.1368:0.0797	.	244	P43378	PTN9_HUMAN	T	244;234	ENSP00000303554:A244T	ENSP00000303554:A244T	A	-	1	0	PTPN9	73585309	0.517000	0.26226	1.000000	0.80357	0.990000	0.78478	0.912000	0.28597	1.472000	0.48140	0.650000	0.86243	GCC		0.512	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286474.1		
ALPK3	57538	hgsc.bcm.edu	37	15	85383455	85383455	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:85383455G>A	ENST00000258888.5	+	5	1718	c.1551G>A	c.(1549-1551)aaG>aaA	p.K517K		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	517	Poly-Lys.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.K517K(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GTGGGGCCAAGAAGAAAAAGA	0.552																																					p.K517K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1551A	15						.						57.0	70.0	66.0					15																	85383455		2203	4298	6501	83184459	SO:0001819	synonymous_variant	57538	exon5			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.1551G>A	15.37:g.85383455G>A			83184459	NM_020778	Q9P2L6	Silent	SNP	ENST00000258888.5	37	CCDS10333.1																																																																																				0.552	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308997.1	NM_020778	
UNC45A	55898	hgsc.bcm.edu	37	15	91483667	91483667	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:91483667T>C	ENST00000418476.2	+	6	691	c.651T>C	c.(649-651)cgT>cgC	p.R217R	UNC45A_ENST00000553671.2_3'UTR|UNC45A_ENST00000394275.2_Silent_p.R202R	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	217					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.R217R(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CGGCTCTGCGTACGCTGGTTG	0.547																																					p.R202R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T606C	15						.						189.0	136.0	154.0					15																	91483667		2198	4298	6496	89284671	SO:0001819	synonymous_variant	55898	exon9				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.651T>C	15.37:g.91483667T>C			89284671	NM_001039675	A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Silent	SNP	ENST00000418476.2	37	CCDS10367.1																																																																																				0.547	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671	
TARSL2	123283	hgsc.bcm.edu	37	15	102224322	102224322	+	Missense_Mutation	SNP	G	G	A	rs34201431	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr15:102224322G>A	ENST00000335968.3	-	12	1822	c.1606C>T	c.(1606-1608)Cgc>Tgc	p.R536C	snoU13_ENST00000458877.1_RNA	NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	536					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)	p.R536C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGCTGGAAGCGCCTCACTCTG	0.488																																					p.R536C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1606T	15						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	88.0	76.0	80.0		1606	5.5	1.0	15	dbSNP_126	80	2,8598	2.2+/-6.3	0,2,4298	yes	missense	TARSL2	NM_152334.2	180	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging	536/803	102224322	3,13003	2203	4300	6503	100041845	SO:0001583	missense	123283	exon12			AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.1606C>T	15.37:g.102224322G>A	ENSP00000338093:p.Arg536Cys		100041845	NM_152334	B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Missense_Mutation	SNP	ENST00000335968.3	37	CCDS10394.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.895174	0.72639	2.27E-4	2.33E-4	ENSG00000185418	ENST00000335968;ENST00000333018;ENST00000539112	T;T	0.68479	-0.33;-0.33	5.46	5.46	0.80206	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.83022	0.5164	M	0.86097	2.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.82116	-0.0616	10	0.31617	T	0.26	-14.7939	16.7981	0.85607	0.0:0.0:1.0:0.0	rs34201431	536;441	A2RTX5;A2RTX5-2	SYTC2_HUMAN;.	C	536;441;536	ENSP00000338093:R536C;ENSP00000439899:R536C	ENSP00000329291:R441C	R	-	1	0	TARSL2	100041845	1.000000	0.71417	0.991000	0.47740	0.735000	0.41995	6.399000	0.73248	2.571000	0.86741	0.591000	0.81541	CGC		0.488	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313619.3	NM_152334	
ADH6	130	hgsc.bcm.edu	37	4	100131445	100131445	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:100131445T>G	ENST00000237653.7	-	5	745	c.361A>C	c.(361-363)Acc>Ccc	p.T121P	RP11-696N14.1_ENST00000500358.2_RNA|ADH6_ENST00000504257.1_5'UTR|RP11-696N14.1_ENST00000506454.1_RNA|RP11-696N14.1_ENST00000506160.1_RNA|ADH6_ENST00000394897.1_Missense_Mutation_p.T121P|ADH6_ENST00000394899.2_Missense_Mutation_p.T121P|ADH6_ENST00000407820.2_Intron	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)	121					ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)	p.T121P(1)		breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	ATCAGTTGGGTTTTTGACTGT	0.328																																					p.T121P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A361C	4						.						69.0	69.0	69.0					4																	100131445		2203	4300	6503	100350468	SO:0001583	missense	130	exon5			AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.361A>C	4.37:g.100131445T>G	ENSP00000237653:p.Thr121Pro		100350468	NM_000672	B3KS45|Q58F53	Missense_Mutation	SNP	ENST00000237653.7	37	CCDS3647.1	.	.	.	.	.	.	.	.	.	.	T	1.959	-0.439334	0.04636	.	.	ENSG00000172955	ENST00000394897;ENST00000394899;ENST00000237653	T;T;T	0.03330	3.97;3.97;3.97	3.93	-2.15	0.07102	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	1.868250	0.02730	N	0.115012	T	0.03136	0.0092	N	0.21373	0.66	0.09310	N	1	B;B;B	0.22003	0.006;0.001;0.063	B;B;B	0.20577	0.03;0.003;0.018	T	0.42548	-0.9445	10	0.48119	T	0.1	-1.0846	3.5958	0.08005	0.1206:0.0767:0.32:0.4827	.	121;121;121	E9PBI1;P28332;P28332-2	.;ADH6_HUMAN;.	P	121	ENSP00000378358:T121P;ENSP00000378359:T121P;ENSP00000237653:T121P	ENSP00000237653:T121P	T	-	1	0	ADH6	100350468	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.420000	0.07062	-0.869000	0.04052	-2.056000	0.00403	ACC		0.328	ADH6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253665.1	NM_000672	
JADE1	79960	hgsc.bcm.edu	37	4	129770249	129770249	+	Missense_Mutation	SNP	C	C	A	rs140538033		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:129770249C>A	ENST00000226319.6	+	5	691	c.411C>A	c.(409-411)agC>agA	p.S137R	PHF17_ENST00000452328.2_Missense_Mutation_p.S125R|PHF17_ENST00000413543.2_Missense_Mutation_p.S137R|PHF17_ENST00000511647.1_Missense_Mutation_p.S137R|PHF17_ENST00000512960.1_Missense_Mutation_p.S137R	NM_199320.2	NP_955352.1												p.S137R(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TGGCTGACAGCGTGTGTCGCT	0.488																																					p.S137R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C411A	4						.						153.0	128.0	137.0					4																	129770249		2203	4300	6503	129989699	SO:0001583	missense	79960	exon5																														ENST00000226319.6:c.411C>A	4.37:g.129770249C>A	ENSP00000226319:p.Ser137Arg		129989699	NM_199320		Missense_Mutation	SNP	ENST00000226319.6	37	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	C	11.51	1.660470	0.29515	.	.	ENSG00000077684	ENST00000226319;ENST00000511647;ENST00000452328;ENST00000512960;ENST00000535321;ENST00000510308;ENST00000413543	T;T;T;T;T	0.43294	1.09;0.95;0.95;1.09;0.95	4.69	-9.38	0.00623	Enhancer of polycomb-like, N-terminal (1);	0.211121	0.52532	D	0.000079	T	0.37237	0.0996	L	0.52573	1.65	0.21697	N	0.999586	B;B;B	0.32338	0.365;0.221;0.201	B;B;B	0.36534	0.227;0.174;0.154	T	0.41502	-0.9505	9	.	.	.	.	23.4472	0.99983	0.0:0.7008:0.0:0.2992	.	125;137;137	Q6IE81-2;Q6IE81;Q6IE81-3	.;JADE1_HUMAN;.	R	137;137;125;137;137;137;137	ENSP00000226319:S137R;ENSP00000423737:S137R;ENSP00000388015:S125R;ENSP00000425730:S137R;ENSP00000404211:S137R	.	S	+	3	2	PHF17	129989699	0.000000	0.05858	0.039000	0.18376	0.420000	0.31355	-3.430000	0.00473	-3.609000	0.00133	-1.814000	0.00607	AGC		0.488	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
PRMT9	90826	hgsc.bcm.edu	37	4	148575175	148575175	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:148575175C>T	ENST00000322396.6	-	9	2115	c.1873G>A	c.(1873-1875)Gcc>Acc	p.A625T	TMEM184C_ENST00000508208.1_Intron|PRMT10_ENST00000541232.1_Missense_Mutation_p.A512T	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		625	SAM-dependent MTase PRMT-type 2. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)	p.A625T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						AAGTGATTGGCTTCAGATATG	0.438																																					p.A625T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1873A	4						.						135.0	116.0	122.0					4																	148575175		2203	4300	6503	148794625	SO:0001583	missense	90826	exon9																														ENST00000322396.6:c.1873G>A	4.37:g.148575175C>T	ENSP00000314396:p.Ala625Thr		148794625	NM_138364	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Missense_Mutation	SNP	ENST00000322396.6	37	CCDS3771.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625728	0.46840	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	T;T	0.30448	1.53;1.53	5.93	5.93	0.95920	.	0.109203	0.64402	D	0.000008	T	0.30823	0.0777	M	0.70595	2.14	0.37494	D	0.916505	P	0.42203	0.773	B	0.34418	0.182	T	0.28522	-1.0041	10	0.31617	T	0.26	-33.6043	13.5312	0.61623	0.0:0.9294:0.0:0.0706	.	625	Q6P2P2	ANM10_HUMAN	T	625;512	ENSP00000314396:A625T;ENSP00000439508:A512T	ENSP00000314396:A625T	A	-	1	0	PRMT10	148794625	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.959000	0.49153	2.826000	0.97356	0.655000	0.94253	GCC		0.438	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1		
NR3C2	4306	hgsc.bcm.edu	37	4	149181245	149181245	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:149181245A>G	ENST00000358102.3	-	3	2144	c.1782T>C	c.(1780-1782)acT>acC	p.T594T	NR3C2_ENST00000511528.1_Silent_p.T594T|NR3C2_ENST00000355292.3_Silent_p.T594T|NR3C2_ENST00000512865.1_Silent_p.T594T|NR3C2_ENST00000344721.4_Silent_p.T594T	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	594	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.T594T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	TTGAAGATCCAGTAGAAACAC	0.413																																					p.T594T	Melanoma(27;428 957 40335 51025 51111)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1782C	4						.						100.0	95.0	97.0					4																	149181245		2203	4300	6503	149400695	SO:0001819	synonymous_variant	4306	exon3			M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1782T>C	4.37:g.149181245A>G			149400695	NM_001166104	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Silent	SNP	ENST00000358102.3	37	CCDS3772.1																																																																																				0.413	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
LRBA	987	hgsc.bcm.edu	37	4	151773763	151773763	+	Silent	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:151773763A>C	ENST00000357115.3	-	23	3342	c.3099T>G	c.(3097-3099)acT>acG	p.T1033T	LRBA_ENST00000535741.1_Silent_p.T1033T|LRBA_ENST00000507224.1_Silent_p.T1033T|LRBA_ENST00000510413.1_Silent_p.T1033T	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1033						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.T1033T(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TTTCTTCCAAAGTGCCTTCAT	0.343																																					p.T1033T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3099G	4						.						142.0	135.0	137.0					4																	151773763		2203	4300	6503	151993213	SO:0001819	synonymous_variant	987	exon23			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.3099T>G	4.37:g.151773763A>C			151993213	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	ENST00000357115.3	37	CCDS3773.1																																																																																				0.343	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
FBXW7	55294	hgsc.bcm.edu	37	4	153253788	153253788	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:153253788A>G	ENST00000281708.4	-	6	2174	c.945T>C	c.(943-945)gcT>gcC	p.A315A	FBXW7_ENST00000263981.5_Silent_p.A235A|FBXW7_ENST00000603841.1_Silent_p.A315A|FBXW7_ENST00000603548.1_Silent_p.A315A|FBXW7_ENST00000393956.3_Silent_p.A139A|FBXW7_ENST00000296555.5_Silent_p.A197A	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	315	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.A315A(2)|p.A76A(1)|p.?(1)|p.A235A(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				GGTTGTCTTCAGCCAAAATTC	0.398			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.A235A			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,stomach,NS,Substitution - Missense,-2	.	5	Substitution - coding silent(4)|Unknown(1)	large_intestine(4)|haematopoietic_and_lymphoid_tissue(1)	c.T705C	4						.						77.0	79.0	78.0					4																	153253788		2203	4300	6503	153473238	SO:0001819	synonymous_variant	55294	exon5			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.945T>C	4.37:g.153253788A>G			153473238	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Silent	SNP	ENST00000281708.4	37	CCDS3777.1																																																																																				0.398	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
FGA	2243	hgsc.bcm.edu	37	4	155505785	155505785	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:155505785T>G	ENST00000302053.3	-	6	2170	c.2092A>C	c.(2092-2094)Agc>Cgc	p.S698R		NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	698	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)	p.S698R(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TCATTCAGGCTGCCGAAACCT	0.483																																					p.S698R	NSCLC(143;340 1922 20892 22370 48145)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2092C	4						.						104.0	99.0	100.0					4																	155505785		2203	4300	6503	155725235	SO:0001583	missense	2243	exon6				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.2092A>C	4.37:g.155505785T>G	ENSP00000306361:p.Ser698Arg		155725235	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	T	15.17	2.753402	0.49362	.	.	ENSG00000171560	ENST00000302053	D	0.97279	-4.32	5.81	4.59	0.56863	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.265833	0.50627	D	0.000115	D	0.96106	0.8731	L	0.49778	1.585	0.80722	D	1	P	0.36065	0.535	P	0.44811	0.461	D	0.95867	0.8888	10	0.51188	T	0.08	.	13.1974	0.59746	0.0:0.0:0.1325:0.8675	.	698	P02671	FIBA_HUMAN	R	698	ENSP00000306361:S698R	ENSP00000306361:S698R	S	-	1	0	FGA	155725235	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.152000	0.50677	2.222000	0.72286	0.528000	0.53228	AGC		0.483	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
GLRB	2743	hgsc.bcm.edu	37	4	158091662	158091662	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:158091662T>A	ENST00000264428.4	+	10	1546	c.1276T>A	c.(1276-1278)Tta>Ata	p.L426I	GLRB_ENST00000512619.1_3'UTR|GLRB_ENST00000541722.1_3'UTR|GLRB_ENST00000509282.1_Missense_Mutation_p.L426I	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	426					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)	p.L426I(1)		central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	TGTTGGAAGCTTACCAAGAGA	0.373																																					p.L426I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1276A	4						.						84.0	84.0	84.0					4																	158091662		2203	4300	6503	158311112	SO:0001583	missense	2743	exon10			U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.1276T>A	4.37:g.158091662T>A	ENSP00000264428:p.Leu426Ile		158311112	NM_001166060	A8K3K2|D3DP23|F5GWE1	Missense_Mutation	SNP	ENST00000264428.4	37	CCDS3796.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141021	0.37825	.	.	ENSG00000109738	ENST00000264428;ENST00000509282	D;D	0.86030	-2.06;-2.06	5.94	4.77	0.60923	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.136065	0.48286	D	0.000188	D	0.87981	0.6315	L	0.55481	1.735	0.80722	D	1	D	0.57257	0.979	D	0.74023	0.982	D	0.84164	0.0430	10	0.17832	T	0.49	.	9.0171	0.36177	0.0:0.1406:0.0:0.8594	.	426	P48167	GLRB_HUMAN	I	426	ENSP00000264428:L426I;ENSP00000427186:L426I	ENSP00000264428:L426I	L	+	1	2	GLRB	158311112	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.084000	0.50143	1.086000	0.41228	0.528000	0.53228	TTA		0.373	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824	
NPY1R	4886	hgsc.bcm.edu	37	4	164247607	164247607	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:164247607G>T	ENST00000296533.2	-	2	631	c.100C>A	c.(100-102)Cat>Aat	p.H34N	NPY1R_ENST00000509586.1_Intron	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	34					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)	p.H34N(1)		breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				AAGGGCAGATGACAATCATCA	0.393																																					p.H34N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C100A	4						.						110.0	103.0	106.0					4																	164247607		2203	4300	6503	164467057	SO:0001583	missense	4886	exon2				CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.100C>A	4.37:g.164247607G>T	ENSP00000354652:p.His34Asn		164467057	NM_000909	B2R6H5	Missense_Mutation	SNP	ENST00000296533.2	37	CCDS34089.1	.	.	.	.	.	.	.	.	.	.	G	7.435	0.639469	0.14386	.	.	ENSG00000164128	ENST00000296533;ENST00000504790;ENST00000515701	T	0.36520	1.25	5.33	4.48	0.54585	.	0.296668	0.32444	N	0.006092	T	0.25344	0.0616	N	0.19112	0.55	0.80722	D	1	B	0.20988	0.05	B	0.19946	0.027	T	0.03175	-1.1064	10	0.29301	T	0.29	.	14.4502	0.67379	0.0:0.1469:0.8531:0.0	.	34	P25929	NPY1R_HUMAN	N	34	ENSP00000354652:H34N	ENSP00000354652:H34N	H	-	1	0	NPY1R	164467057	1.000000	0.71417	0.842000	0.33263	0.548000	0.35241	3.603000	0.54074	1.241000	0.43820	-0.172000	0.13284	CAT		0.393	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364685.1		
SPOCK3	50859	hgsc.bcm.edu	37	4	167833793	167833793	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:167833793T>C	ENST00000357154.3	-	6	598	c.461A>G	c.(460-462)gAt>gGt	p.D154G	SPOCK3_ENST00000512681.1_Intron|SPOCK3_ENST00000511531.1_Missense_Mutation_p.D154G|SPOCK3_ENST00000421836.2_Missense_Mutation_p.D103G|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000534949.1_Missense_Mutation_p.D58G|SPOCK3_ENST00000510741.1_Missense_Mutation_p.D151G|SPOCK3_ENST00000357545.4_Missense_Mutation_p.D151G|SPOCK3_ENST00000541637.1_Intron|SPOCK3_ENST00000506886.1_Missense_Mutation_p.D154G|SPOCK3_ENST00000511269.1_Missense_Mutation_p.D151G|SPOCK3_ENST00000502330.1_Missense_Mutation_p.D154G|SPOCK3_ENST00000504953.1_Missense_Mutation_p.D151G|SPOCK3_ENST00000535728.1_Missense_Mutation_p.D62G|SPOCK3_ENST00000512648.1_Missense_Mutation_p.D151G|SPOCK3_ENST00000541354.1_Missense_Mutation_p.D34G	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	154	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)	p.D151G(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		GGTATGACCATCTGAACCACA	0.428																																					p.D154G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A461G	4						.						125.0	121.0	122.0					4																	167833793		2203	4300	6503	168070368	SO:0001583	missense	50859	exon6			AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.461A>G	4.37:g.167833793T>C	ENSP00000349677:p.Asp154Gly		168070368	NM_016950	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	ENST00000357154.3	37	CCDS54817.1	.	.	.	.	.	.	.	.	.	.	T	17.25	3.342123	0.61073	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000541354;ENST00000511269;ENST00000535728;ENST00000421836;ENST00000534949;ENST00000512648;ENST00000509854	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.13307	2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6	5.04	5.04	0.67666	Proteinase inhibitor I1, Kazal (1);EF-hand-like domain (1);Protease inhibitor, Kazal-type (1);	0.000000	0.85682	D	0.000000	T	0.57257	0.2041	H	0.99582	4.64	0.58432	D	0.999997	D;D;D;D;P;P;D	0.76494	0.996;0.999;0.969;0.961;0.853;0.952;0.961	P;D;P;P;P;P;P	0.71414	0.834;0.973;0.725;0.721;0.51;0.523;0.655	T	0.77705	-0.2488	10	0.87932	D	0	-19.999	14.7489	0.69511	0.0:0.0:0.0:1.0	.	58;103;163;151;154;151;154	F5H099;B4DHB4;B4DFW5;E7EP61;Q9BQ16-2;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;TICN3_HUMAN	G	154;151;151;154;154;154;151;34;151;62;103;58;151;151	ENSP00000349677:D154G;ENSP00000350153:D151G;ENSP00000425570:D151G;ENSP00000420920:D154G;ENSP00000423421:D154G;ENSP00000423606:D154G;ENSP00000426716:D151G;ENSP00000444789:D34G;ENSP00000425502:D151G;ENSP00000441396:D62G;ENSP00000411344:D103G;ENSP00000438142:D58G;ENSP00000426177:D151G;ENSP00000423367:D151G	ENSP00000349677:D154G	D	-	2	0	SPOCK3	168070368	1.000000	0.71417	0.998000	0.56505	0.466000	0.32739	5.591000	0.67536	2.020000	0.59435	0.523000	0.50628	GAT		0.428	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1		
DDX60	55601	hgsc.bcm.edu	37	4	169146819	169146819	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:169146819A>G	ENST00000393743.3	-	34	4833	c.4542T>C	c.(4540-4542)ctT>ctC	p.L1514L		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1514					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)	p.L1514L(2)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		GGAGATCATCAAGGAACACCT	0.353																																					p.L1514L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T4542C	4						.						75.0	76.0	76.0					4																	169146819		2203	4299	6502	169383394	SO:0001819	synonymous_variant	55601	exon34			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.4542T>C	4.37:g.169146819A>G			169383394	NM_017631	Q6PK35|Q9NVE3	Silent	SNP	ENST00000393743.3	37	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	A	2.024	-0.423931	0.04734	.	.	ENSG00000137628	ENST00000511317	.	.	.	5.82	-11.6	0.00059	.	0.000000	0.51477	D	0.000082	T	0.48607	0.1509	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.65504	-0.6152	6	0.87932	D	0	.	4.3315	0.11066	0.1682:0.4815:0.1092:0.2411	.	.	.	.	S	7	.	ENSP00000422669:L7S	L	-	2	0	DDX60	169383394	0.414000	0.25408	0.388000	0.26195	0.187000	0.23431	-0.803000	0.04540	-1.958000	0.01019	-0.461000	0.05368	TTG		0.353	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
PDE6B	5158	hgsc.bcm.edu	37	4	656335	656335	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:656335C>A	ENST00000496514.1	+	14	1781	c.1760C>A	c.(1759-1761)gCc>gAc	p.A587D	RP11-1191J2.5_ENST00000609172.1_RNA|PDE6B_ENST00000255622.6_Missense_Mutation_p.A587D|PDE6B_ENST00000429163.2_Missense_Mutation_p.A308D			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	587					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)	p.A587D(1)		NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GACCTGGAGGCCTTCGCCATG	0.617																																					p.A308D	GBM(71;463 1194 9848 25922 46834)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C923A	4						.						83.0	74.0	77.0					4																	656335		2203	4300	6503	646335	SO:0001583	missense	5158	exon12			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1760C>A	4.37:g.656335C>A	ENSP00000420295:p.Ala587Asp		646335	NM_001145292	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.779144	0.49891	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163	T;T;T	0.77750	-1.12;-1.12;-1.12	4.55	4.55	0.56014	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.195686	0.44285	D	0.000474	T	0.81221	0.4777	M	0.82630	2.6	0.42989	D	0.994484	B;B	0.18166	0.015;0.026	B;B	0.30316	0.114;0.093	T	0.81967	-0.0690	10	0.72032	D	0.01	.	14.7893	0.69827	0.0:1.0:0.0:0.0	.	587;587	P35913;P35913-2	PDE6B_HUMAN;.	D	587;587;308	ENSP00000255622:A587D;ENSP00000420295:A587D;ENSP00000406334:A308D	ENSP00000255622:A587D	A	+	2	0	PDE6B	646335	0.842000	0.29525	1.000000	0.80357	0.980000	0.70556	1.501000	0.35693	2.059000	0.61396	0.639000	0.83563	GCC		0.617	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
POLN	353497	hgsc.bcm.edu	37	4	2129934	2129934	+	Missense_Mutation	SNP	G	G	A	rs201300268		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:2129934G>A	ENST00000511885.2	-	19	2241	c.1888C>T	c.(1888-1890)Cgc>Tgc	p.R630C	POLN_ENST00000382865.1_Missense_Mutation_p.R630C			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	630					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.R630C(1)		kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			GTAAGAATGCGCAATTCAATC	0.428								DNA polymerases (catalytic subunits)																													p.R630C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1888T	4						.						72.0	71.0	71.0					4																	2129934		2203	4300	6503	2099732	SO:0001583	missense	353497	exon17			AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.1888C>T	4.37:g.2129934G>A	ENSP00000435506:p.Arg630Cys		2099732	NM_181808	A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	ENST00000511885.2	37	CCDS3360.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.510732	0.64522	.	.	ENSG00000130997	ENST00000511885;ENST00000382865;ENST00000253313;ENST00000382857	D;D	0.97791	-4.54;-4.54	5.19	4.35	0.52113	DNA-directed DNA polymerase, family A, palm domain (2);	0.000000	0.85682	D	0.000000	D	0.98890	0.9624	H	0.95004	3.61	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99301	1.0901	10	0.87932	D	0	-6.5263	9.992	0.41877	0.0944:0.0:0.9056:0.0	.	161;321;630	C9JDP8;E9PE06;Q7Z5Q5	.;.;DPOLN_HUMAN	C	630;630;321;161	ENSP00000435506:R630C;ENSP00000372316:R630C	ENSP00000253313:R321C	R	-	1	0	POLN	2099732	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.748000	0.47483	1.335000	0.45486	-0.136000	0.14681	CGC		0.428	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205684.2	NM_181808	
ACOX3	8310	hgsc.bcm.edu	37	4	8412007	8412007	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:8412007C>T	ENST00000356406.5	-	6	696	c.619G>A	c.(619-621)Gcg>Acg	p.A207T	ACOX3_ENST00000503233.1_Missense_Mutation_p.A207T|ACOX3_ENST00000413009.2_Missense_Mutation_p.A207T	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	207					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)	p.A207T(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						AACACCACCGCGTGAGTGGCT	0.547																																					p.A207T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G619A	4						.						96.0	80.0	85.0					4																	8412007		2203	4300	6503	8462907	SO:0001583	missense	8310	exon6			Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.619G>A	4.37:g.8412007C>T	ENSP00000348775:p.Ala207Thr		8462907	NM_003501	Q96AJ8	Missense_Mutation	SNP	ENST00000356406.5	37	CCDS3401.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.617865	0.66787	.	.	ENSG00000087008	ENST00000413009;ENST00000356406;ENST00000503233	D;D;D	0.95518	-3.73;-3.73;-3.73	5.21	4.38	0.52667	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (2);	0.120235	0.56097	D	0.000028	D	0.95617	0.8575	M	0.62266	1.93	0.58432	D	0.999997	D;D;D	0.59357	0.985;0.981;0.985	P;P;P	0.53593	0.73;0.611;0.73	D	0.94804	0.7973	10	0.44086	T	0.13	-26.4829	12.8807	0.58015	0.0:0.9201:0.0:0.0799	.	207;207;207	B2R856;O15254-2;O15254	.;.;ACOX3_HUMAN	T	207	ENSP00000413994:A207T;ENSP00000348775:A207T;ENSP00000421625:A207T	ENSP00000348775:A207T	A	-	1	0	ACOX3	8462907	1.000000	0.71417	0.831000	0.32960	0.169000	0.22640	1.669000	0.37492	1.439000	0.47511	0.655000	0.94253	GCG		0.547	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206997.4		
LIMCH1	22998	hgsc.bcm.edu	37	4	41608016	41608016	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:41608016C>T	ENST00000313860.7	+	6	535	c.481C>T	c.(481-483)Cga>Tga	p.R161*	LIMCH1_ENST00000503057.1_Nonsense_Mutation_p.R2*|LIMCH1_ENST00000513024.1_Nonsense_Mutation_p.R2*|LIMCH1_ENST00000509638.1_Nonsense_Mutation_p.R2*|LIMCH1_ENST00000512632.1_Nonsense_Mutation_p.R161*|LIMCH1_ENST00000511496.1_Nonsense_Mutation_p.R2*|LIMCH1_ENST00000512820.1_Nonsense_Mutation_p.R161*|LIMCH1_ENST00000512946.1_Nonsense_Mutation_p.R161*|LIMCH1_ENST00000508501.1_Nonsense_Mutation_p.R161*	NM_014988.2	NP_055803.2	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1	161					actomyosin structure organization (GO:0031032)		zinc ion binding (GO:0008270)	p.R2*(1)|p.R161*(1)		central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(5)	41						GGCTCAGATGCGAAAGGTAAC	0.428																																					p.R161X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C481T	4						.						146.0	125.0	132.0					4																	41608016		2203	4300	6503	41302773	SO:0001587	stop_gained	22998	exon6			AB029025	CCDS33977.1, CCDS47047.1, CCDS54763.1, CCDS54764.1, CCDS54765.1, CCDS75119.1, CCDS75121.1	4p13	2007-06-14		2008-01-09	ENSG00000064042	ENSG00000064042			29191	protein-coding gene	gene with protein product						10470851	Standard	XM_005248057		Approved	DKFZP686A01247, LIMCH1A, LMO7B	uc003gvz.4	Q9UPQ0	OTTHUMG00000160575	ENST00000313860.7:c.481C>T	4.37:g.41608016C>T	ENSP00000316891:p.Arg161*		41302773	NM_001112717	A8MXC3|E9PHM7|Q503B5|Q5CZB1|Q5CZB6|Q5H9S8|Q68E07|Q6PJ44|Q7Z3G5|Q8N3S9|Q8N6M2	Nonsense_Mutation	SNP	ENST00000313860.7	37	CCDS33977.1	.	.	.	.	.	.	.	.	.	.	C	32	5.159468	0.94686	.	.	ENSG00000064042	ENST00000513024;ENST00000509638;ENST00000508501;ENST00000512946;ENST00000313860;ENST00000512632;ENST00000512820;ENST00000511424;ENST00000446625;ENST00000503057;ENST00000511496	.	.	.	5.56	1.35	0.21983	.	0.782162	0.11683	N	0.539644	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	14.8368	0.70190	0.5563:0.4437:0.0:0.0	.	.	.	.	X	2;2;161;161;161;161;161;2;2;2;2	.	ENSP00000316891:R161X	R	+	1	2	LIMCH1	41302773	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	1.605000	0.36815	0.333000	0.23563	-0.262000	0.10625	CGA		0.428	LIMCH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361249.2	NM_014988	
DCAF4L1	285429	hgsc.bcm.edu	37	4	41984027	41984027	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:41984027G>A	ENST00000333141.5	+	1	315	c.218G>A	c.(217-219)cGa>cAa	p.R73Q		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	73								p.R73Q(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						GCGAGCGACCGATTTAACTTC	0.537																																					p.R73Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G218A	4						.						92.0	79.0	83.0					4																	41984027		2203	4300	6503	41678784	SO:0001583	missense	285429	exon1			BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.218G>A	4.37:g.41984027G>A	ENSP00000327796:p.Arg73Gln		41678784	NM_001029955	B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	ENST00000333141.5	37	CCDS33978.1	.	.	.	.	.	.	.	.	.	.	G	7.473	0.647035	0.14516	.	.	ENSG00000182308	ENST00000333141	T	0.37915	1.17	0.688	-0.52	0.11935	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.409038	0.27473	N	0.019212	T	0.25791	0.0628	L	0.60455	1.87	0.25090	N	0.990865	P	0.44241	0.829	B	0.36989	0.238	T	0.16041	-1.0416	9	0.51188	T	0.08	.	.	.	.	.	73	Q3SXM0	DC4L1_HUMAN	Q	73	ENSP00000327796:R73Q	ENSP00000327796:R73Q	R	+	2	0	DCAF4L1	41678784	0.998000	0.40836	0.095000	0.20976	0.008000	0.06430	0.450000	0.21762	-0.335000	0.08451	-0.657000	0.03884	CGA		0.537	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360958.1	NM_001029955	
GABRG1	2565	hgsc.bcm.edu	37	4	46067524	46067524	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:46067524A>G	ENST00000295452.4	-	4	566	c.399T>C	c.(397-399)ctT>ctC	p.L133L		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	133					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.L133L(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGTTAAGCATAAGCACTTTCA	0.323																																					p.L133L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T399C	4						.						72.0	72.0	72.0					4																	46067524		2203	4300	6503	45762281	SO:0001819	synonymous_variant	2565	exon4			BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.399T>C	4.37:g.46067524A>G			45762281	NM_173536	Q5H9T8	Silent	SNP	ENST00000295452.4	37	CCDS3470.1																																																																																				0.323	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
GC	2638	hgsc.bcm.edu	37	4	72622539	72622539	+	Silent	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:72622539A>C	ENST00000273951.8	-	8	1267	c.924T>G	c.(922-924)gtT>gtG	p.V308V	GC_ENST00000513476.1_Silent_p.V308V|RNA5SP163_ENST00000410304.1_RNA|GC_ENST00000504199.1_Silent_p.V327V|GC_ENST00000503472.1_5'UTR	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	308	Albumin 2. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	TGCACACAAAAACGTCCATGG	0.428																																					p.V308V												.	.	0			c.T924G	4						.						90.0	88.0	89.0					4																	72622539		2203	4300	6503	72841403	SO:0001819	synonymous_variant	2638	exon8			L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.924T>G	4.37:g.72622539A>C			72841403	NM_000583	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Silent	SNP	ENST00000273951.8	37	CCDS3550.1																																																																																				0.428	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252167.2		
RASSF6	166824	hgsc.bcm.edu	37	4	74459234	74459234	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:74459234A>G	ENST00000342081.3	-	4	447	c.317T>C	c.(316-318)aTa>aCa	p.I106T	RASSF6_ENST00000307439.5_Missense_Mutation_p.I74T|RASSF6_ENST00000395777.2_Missense_Mutation_p.I74T|RASSF6_ENST00000335049.5_Missense_Mutation_p.I62T	NM_201431.2	NP_958834.1	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family member 6	106					apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)			p.I106T(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|pancreas(2)|skin(2)	17	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			CTCATCTTGTATTTTTAGCTG	0.373																																					p.I74T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T221C	4						.						114.0	115.0	115.0					4																	74459234		2203	4300	6503	74678098	SO:0001583	missense	166824	exon4			AY217664	CCDS3558.1, CCDS3559.1, CCDS58904.1, CCDS58905.1	4q21.1	2008-02-22	2008-02-22		ENSG00000169435	ENSG00000169435			20796	protein-coding gene	gene with protein product		612620					Standard	NM_177532		Approved		uc003hhd.2	Q6ZTQ3	OTTHUMG00000130007	ENST00000342081.3:c.317T>C	4.37:g.74459234A>G	ENSP00000340578:p.Ile106Thr		74678098	NM_177532	Q68DT2|Q6PDA6|Q86WG9|Q86WH0	Missense_Mutation	SNP	ENST00000342081.3	37	CCDS3558.1	.	.	.	.	.	.	.	.	.	.	A	17.53	3.413432	0.62511	.	.	ENSG00000169435	ENST00000307439;ENST00000342081;ENST00000395777;ENST00000335049	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.42	5.42	0.78866	.	0.082737	0.85682	D	0.000000	T	0.50888	0.1642	L	0.54323	1.7	0.45183	D	0.998192	D;D;D	0.76494	0.999;0.993;0.998	D;P;P	0.66351	0.943;0.869;0.878	T	0.46162	-0.9211	10	0.36615	T	0.2	-28.183	11.8484	0.52397	1.0:0.0:0.0:0.0	.	62;74;106	Q6ZTQ3-3;Q6ZTQ3-4;Q6ZTQ3	.;.;RASF6_HUMAN	T	74;106;74;62	ENSP00000303877:I74T;ENSP00000340578:I106T;ENSP00000379123:I74T;ENSP00000335582:I62T	ENSP00000303877:I74T	I	-	2	0	RASSF6	74678098	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	5.908000	0.69916	2.071000	0.62044	0.443000	0.29094	ATA		0.373	RASSF6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252279.1	NM_177532	
CXCL11	6373	hgsc.bcm.edu	37	4	76956487	76956487	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:76956487T>C	ENST00000503860.1	-	3	448	c.70A>G	c.(70-72)Atg>Gtg	p.M24V	ART3_ENST00000341029.5_Intron|CXCL11_ENST00000306621.3_Missense_Mutation_p.M24V			O14625	CXL11_HUMAN	chemokine (C-X-C motif) ligand 11	24					cell-cell signaling (GO:0007267)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|regulation of cell proliferation (GO:0042127)|signal transduction (GO:0007165)|T cell chemotaxis (GO:0010818)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|heparin binding (GO:0008201)	p.M24V(1)		kidney(1)|large_intestine(3)|lung(1)|skin(1)	6			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CTTTTGAACATGGGGAAGCCT	0.433																																					p.M24V	Pancreas(31;57 931 1690 18027 37686)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A70G	4						.						74.0	69.0	71.0					4																	76956487		2203	4300	6503	77175511	SO:0001583	missense	6373	exon2			U66096	CCDS3574.1	4q21	2013-02-25	2002-08-22	2002-08-23	ENSG00000169248	ENSG00000169248		"""Endogenous ligands"""	10638	protein-coding gene	gene with protein product		604852	"""small inducible cytokine subfamily B (Cys-X-Cys), member 11"""	SCYB9B, SCYB11		9730616	Standard	NM_005409		Approved	H174, b-R1, I-TAC, IP-9	uc003hjm.3	O14625	OTTHUMG00000130101	ENST00000503860.1:c.70A>G	4.37:g.76956487T>C	ENSP00000425819:p.Met24Val		77175511	NM_005409	Q53YA3|Q92840	Missense_Mutation	SNP	ENST00000503860.1	37	CCDS3574.1	.	.	.	.	.	.	.	.	.	.	T	2.989	-0.208691	0.06140	.	.	ENSG00000169248	ENST00000306621;ENST00000503860	T;T	0.39406	1.08;1.08	5.37	5.37	0.77165	Chemokine interleukin-8-like domain (1);	0.000000	0.64402	D	0.000001	T	0.49729	0.1574	.	.	.	0.24671	N	0.99341	D	0.57571	0.98	P	0.57152	0.814	T	0.42632	-0.9440	9	0.25106	T	0.35	-33.5126	12.0521	0.53513	0.0:0.0:0.0:1.0	.	24	O14625	CXL11_HUMAN	V	24	ENSP00000306884:M24V;ENSP00000425819:M24V	ENSP00000306884:M24V	M	-	1	0	CXCL11	77175511	0.997000	0.39634	0.933000	0.37362	0.124000	0.20399	2.327000	0.43858	2.152000	0.67230	0.455000	0.32223	ATG		0.433	CXCL11-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362816.1		
NUDT9	53343	hgsc.bcm.edu	37	4	88379089	88379089	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:88379089T>C	ENST00000302174.4	+	8	1293	c.969T>C	c.(967-969)agT>agC	p.S323S	RP11-710E1.2_ENST00000609450.1_lincRNA|NUDT9_ENST00000473942.1_Silent_p.S273S	NM_024047.4	NP_076952.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 9	323	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.S323S(1)		endometrium(1)|large_intestine(4)|lung(6)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		TTTATGCCAGTCACTCTCAAT	0.453																																					p.S273S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T819C	4						.						117.0	104.0	108.0					4																	88379089		2203	4300	6503	88598113	SO:0001819	synonymous_variant	53343	exon8			AY026252	CCDS3620.1, CCDS3621.1	4q22.1	2008-08-29			ENSG00000170502	ENSG00000170502		"""Nudix motif containing"""	8056	protein-coding gene	gene with protein product		606022				11385575, 12427752	Standard	NM_024047		Approved	MGC3037	uc003hqq.3	Q9BW91	OTTHUMG00000130591	ENST00000302174.4:c.969T>C	4.37:g.88379089T>C			88598113	NM_198038	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000302174.4	37	CCDS3620.1																																																																																				0.453	NUDT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253035.2		
ABCG2	9429	hgsc.bcm.edu	37	4	89034649	89034649	+	Missense_Mutation	SNP	C	C	T	rs3201997		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:89034649C>T	ENST00000237612.3	-	9	1545	c.1000G>A	c.(1000-1002)Gag>Aag	p.E334K	ABCG2_ENST00000515655.1_Missense_Mutation_p.E334K	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	334					cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)	p.E334K(1)		breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	ACATAAATCTCCGCTAATTTT	0.398																																					p.E334K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1000A	4	GRCh37	CM068172	ABCG2	M	rs3201997	.						120.0	121.0	120.0					4																	89034649		2203	4300	6503	89253673	SO:0001583	missense	9429	exon9			AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.1000G>A	4.37:g.89034649C>T	ENSP00000237612:p.Glu334Lys		89253673	NM_004827	A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	ENST00000237612.3	37	CCDS3628.1	.	.	.	.	.	.	.	.	.	.	C	13.18	2.159929	0.38119	.	.	ENSG00000118777	ENST00000515655;ENST00000237612	D;D	0.87571	-2.27;-2.13	5.67	5.67	0.87782	.	0.355187	0.34067	N	0.004286	D	0.83487	0.5265	L	0.41079	1.255	0.54753	D	0.999986	B;B;B	0.18741	0.03;0.003;0.001	B;B;B	0.17979	0.02;0.015;0.006	T	0.77343	-0.2623	10	0.25751	T	0.34	-6.3377	19.3847	0.94551	0.0:1.0:0.0:0.0	.	334;334;334	Q9UNQ0-2;Q9UNQ0;Q4W5I3	.;ABCG2_HUMAN;.	K	334	ENSP00000426917:E334K;ENSP00000237612:E334K	ENSP00000237612:E334K	E	-	1	0	ABCG2	89253673	0.992000	0.36948	0.615000	0.29064	0.033000	0.12548	3.872000	0.56085	2.663000	0.90544	0.557000	0.71058	GAG		0.398	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827	
MMRN1	22915	hgsc.bcm.edu	37	4	90856193	90856193	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:90856193T>C	ENST00000394980.1	+	7	1681	c.1362T>C	c.(1360-1362)acT>acC	p.T454T	MMRN1_ENST00000508372.1_Silent_p.T196T|MMRN1_ENST00000264790.2_Silent_p.T454T|MMRN1_ENST00000394981.1_Intron			Q13201	MMRN1_HUMAN	multimerin 1	454					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)		p.T454T(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CCACTTTGACTGATATAGTGG	0.373																																					p.T454T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1362C	4						.						66.0	68.0	68.0					4																	90856193		2202	4299	6501	91075216	SO:0001819	synonymous_variant	22915	exon6			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.1362T>C	4.37:g.90856193T>C			91075216	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	ENST00000394980.1	37	CCDS3635.1																																																																																				0.373	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
GRID2	2895	hgsc.bcm.edu	37	4	94138036	94138036	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:94138036A>C	ENST00000282020.4	+	6	1195	c.937A>C	c.(937-939)Aag>Cag	p.K313Q	GRID2_ENST00000510992.1_Missense_Mutation_p.K218Q|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	313					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.K313Q(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GTGTGATCCAAAGGATCCATT	0.418																																					p.K313Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A937C	4						.						141.0	141.0	141.0					4																	94138036		2203	4300	6503	94357059	SO:0001583	missense	2895	exon6			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.937A>C	4.37:g.94138036A>C	ENSP00000282020:p.Lys313Gln		94357059	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	A	10.44	1.351899	0.24512	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	D;D	0.82984	-1.67;-1.67	4.76	4.76	0.60689	Extracellular ligand-binding receptor (1);	0.121330	0.53938	D	0.000051	T	0.62295	0.2416	N	0.05280	-0.08	0.53688	D	0.999978	P;P	0.42078	0.77;0.77	B;B	0.37267	0.245;0.245	T	0.66348	-0.5946	10	0.07325	T	0.83	.	13.7424	0.62855	1.0:0.0:0.0:0.0	.	218;313	E9PH24;O43424	.;GRID2_HUMAN	Q	313;218	ENSP00000282020:K313Q;ENSP00000421257:K218Q	ENSP00000282020:K313Q	K	+	1	0	GRID2	94357059	1.000000	0.71417	0.973000	0.42090	0.986000	0.74619	5.597000	0.67577	1.909000	0.55274	0.482000	0.46254	AAG		0.418	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
FBXO8	26269	hgsc.bcm.edu	37	4	175162328	175162328	+	Silent	SNP	C	C	T	rs372217885		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr4:175162328C>T	ENST00000393674.2	-	4	1360	c.498G>A	c.(496-498)tcG>tcA	p.S166S	FBXO8_ENST00000503293.1_Silent_p.S125S	NM_012180.2	NP_036312.2	Q9NRD0	FBX8_HUMAN	F-box protein 8	166	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell junction (GO:0030054)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.S166S(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|urinary_tract(1)	14		Prostate(90;0.00201)|Melanoma(52;0.012)|Renal(120;0.0183)|all_neural(102;0.0887)|all_hematologic(60;0.107)		all cancers(43;7.29e-18)|Epithelial(43;1.85e-15)|OV - Ovarian serous cystadenocarcinoma(60;5.62e-09)|GBM - Glioblastoma multiforme(59;0.00115)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.1)		TTTCCTTTGGCGAATCATCCA	0.318																																					p.S166S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G498A	4						.	C		1,4405	2.1+/-5.4	0,1,2202	114.0	109.0	111.0		498	-5.9	0.9	4		111	0,8594		0,0,4297	no	coding-synonymous	FBXO8	NM_012180.2		0,1,6499	TT,TC,CC		0.0,0.0227,0.0077		166/320	175162328	1,12999	2203	4297	6500	175398903	SO:0001819	synonymous_variant	26269	exon4			AF174596	CCDS3820.1	4q34.1	2008-02-05	2004-06-15			ENSG00000164117		"""F-boxes /  ""other"""""	13587	protein-coding gene	gene with protein product		605649	"""F-box only protein 8"""			10531035, 10531037	Standard	NM_012180		Approved	FBX8, FBS	uc003itp.3	Q9NRD0		ENST00000393674.2:c.498G>A	4.37:g.175162328C>T			175398903	NM_012180	B2RB40|D3DP41|G5E9Z0|Q6UWN4|Q8IWE1|Q9NRP5|Q9UKC4	Silent	SNP	ENST00000393674.2	37	CCDS3820.1																																																																																				0.318	FBXO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362085.2	NM_012180	
TRMT2B	79979	hgsc.bcm.edu	37	X	100276091	100276091	+	Splice_Site	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:100276091A>G	ENST00000372936.3	-	10	1837	c.1065T>C	c.(1063-1065)acT>acC	p.T355T	TRMT2B_ENST00000372939.1_Splice_Site_p.T310T|TRMT2B_ENST00000338687.7_Splice_Site_p.T310T|TRMT2B_ENST00000372931.5_Splice_Site_p.T355T|TRMT2B_ENST00000545398.1_Splice_Site_p.T355T|TRMT2B_ENST00000478422.1_5'Flank|TRMT2B_ENST00000372935.1_Splice_Site_p.T355T	NM_024917.5	NP_079193.2	Q96GJ1	TRM2_HUMAN	tRNA methyltransferase 2 homolog B (S. cerevisiae)	355						mitochondrion (GO:0005739)	S-adenosylmethionine-dependent tRNA (m5U54) methyltransferase activity (GO:0030697)	p.T355T(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	24						TCCACTTGCCAGTTCCACAGC	0.567																																					p.T355T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1065C	X						.						83.0	70.0	74.0					X																	100276091		2203	4300	6503	100162747	SO:0001630	splice_region_variant	79979	exon10			BC020116	CCDS14477.1, CCDS55464.1	Xq22.1	2012-06-12	2012-06-12	2008-09-17	ENSG00000188917	ENSG00000188917			25748	protein-coding gene	gene with protein product			"""chromosome X open reading frame 34"""	CXorf34		14702039	Standard	NM_024917		Approved	FLJ12687	uc004egq.3	Q96GJ1	OTTHUMG00000022017	ENST00000372936.3:c.1066+1T>C	X.37:g.100276091A>G			100162747	NM_001167970	A6NDG5|A6NEI9|A6NMG6|Q5JPF0|Q5JVY6|Q96HU7|Q96IH9|Q9H9K2	Silent	SNP	ENST00000372936.3	37	CCDS14477.1																																																																																				0.567	TRMT2B-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057512.1	NM_024917	Silent
TENM1	10178	hgsc.bcm.edu	37	X	123654488	123654488	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:123654488T>C	ENST00000371130.3	-	18	3243	c.3180A>G	c.(3178-3180)gtA>gtG	p.V1060V	TENM1_ENST00000422452.2_Silent_p.V1060V	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1060					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.V1062V(1)									CTTCCACAGCTACTGTGAGGT	0.483																																					p.V1060V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3180G	X						.						133.0	116.0	122.0					X																	123654488		2203	4300	6503	123482169	SO:0001819	synonymous_variant	10178	exon18			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3180A>G	X.37:g.123654488T>C			123482169	NM_014253	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																				0.483	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
PLAC1	10761	hgsc.bcm.edu	37	X	133700505	133700505	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:133700505C>T	ENST00000359237.4	-	3	493	c.208G>A	c.(208-210)Gcc>Acc	p.A70T	PLAC1_ENST00000476971.1_5'UTR	NM_021796.3	NP_068568.1			placenta-specific 1									p.A70T(1)		large_intestine(4)|lung(1)|pancreas(1)	6	Acute lymphoblastic leukemia(192;0.000127)					AACTGGTAGGCGTGTGGCTGA	0.498																																					p.A70T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G208A	X						.						235.0	195.0	208.0					X																	133700505		2203	4300	6503	133528171	SO:0001583	missense	10761	exon3			AF234654	CCDS14642.1	Xq26.3	2013-10-14			ENSG00000170965	ENSG00000170965			9044	protein-coding gene	gene with protein product	"""cancer/testis antigen 92"""	300296				10995572	Standard	NM_021796		Approved	CT92, OOSP2L	uc004exo.1	Q9HBJ0	OTTHUMG00000022457	ENST00000359237.4:c.208G>A	X.37:g.133700505C>T	ENSP00000352173:p.Ala70Thr		133528171	NM_021796		Missense_Mutation	SNP	ENST00000359237.4	37	CCDS14642.1	.	.	.	.	.	.	.	.	.	.	C	3.407	-0.121035	0.06838	.	.	ENSG00000170965	ENST00000359237	D	0.82433	-1.61	4.35	-7.41	0.01392	.	1.733900	0.03331	N	0.193341	T	0.68118	0.2966	L	0.56769	1.78	0.09310	N	1	P	0.46327	0.876	B	0.31495	0.131	T	0.65952	-0.6043	10	0.19590	T	0.45	0.1211	2.3734	0.04336	0.2509:0.1355:0.1032:0.5104	.	70	Q9HBJ0	PLAC1_HUMAN	T	70	ENSP00000352173:A70T	ENSP00000352173:A70T	A	-	1	0	PLAC1	133528171	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.498000	0.02287	-2.254000	0.00697	-0.191000	0.12829	GCC		0.498	PLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058375.1	NM_021796	
LDOC1	23641	hgsc.bcm.edu	37	X	140270974	140270974	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:140270974T>C	ENST00000370526.2	-	1	336	c.233A>G	c.(232-234)aAc>aGc	p.N78S	LDOC1_ENST00000460721.1_Intron	NM_012317.2	NP_036449.1	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	78					negative regulation of cell proliferation (GO:0008285)	nucleus (GO:0005634)				endometrium(6)|large_intestine(1)|lung(6)|ovary(1)	14	Acute lymphoblastic leukemia(192;7.65e-05)					TCGGTTCTCGTTCACGAGCAT	0.602																																					p.N78S												.	.	0			c.A233G	X						.						117.0	96.0	103.0					X																	140270974		2203	4300	6503	140098640	SO:0001583	missense	23641	exon1			AB019527	CCDS14672.1	Xq27	2008-02-05			ENSG00000182195	ENSG00000182195			6548	protein-coding gene	gene with protein product		300402		BCUR1		10403563, 15716091, 16093683	Standard	NM_012317		Approved	Mar7, Mart7	uc004fbj.3	O95751	OTTHUMG00000022558	ENST00000370526.2:c.233A>G	X.37:g.140270974T>C	ENSP00000359557:p.Asn78Ser		140098640	NM_012317	Q6IAR6	Missense_Mutation	SNP	ENST00000370526.2	37	CCDS14672.1	.	.	.	.	.	.	.	.	.	.	.	8.089	0.774191	0.16051	.	.	ENSG00000182195	ENST00000370526	T	0.27104	1.69	3.67	3.67	0.42095	.	0.239177	0.29087	N	0.013196	T	0.27278	0.0669	L	0.47016	1.485	0.22050	N	0.99939	P	0.52170	0.951	P	0.50109	0.631	T	0.05971	-1.0853	10	0.30078	T	0.28	-13.0759	7.8896	0.29669	0.0:0.0:0.0:1.0	.	78	O95751	LDOC1_HUMAN	S	78	ENSP00000359557:N78S	ENSP00000359557:N78S	N	-	2	0	LDOC1	140098640	1.000000	0.71417	0.993000	0.49108	0.893000	0.52053	3.066000	0.50002	1.678000	0.50952	0.237000	0.17872	AAC		0.602	LDOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058592.1	NM_012317	
MTM1	4534	hgsc.bcm.edu	37	X	149826406	149826406	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:149826406C>T	ENST00000370396.2	+	11	1220	c.1166C>T	c.(1165-1167)gCc>gTc	p.A389V	MTM1_ENST00000542741.1_Missense_Mutation_p.A294V|MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000413012.2_Missense_Mutation_p.A352V|MTM1_ENST00000543350.1_Missense_Mutation_p.A274V	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	389	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.		A -> D (in CNMX; severe). {ECO:0000269|PubMed:12522554}.		endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)	p.A389V(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					ACATCCTTGGCCATGCTGATG	0.443																																					p.A389V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1166T	X	GRCh37	CM030250	MTM1	M		.						161.0	136.0	144.0					X																	149826406		2203	4300	6503	149577064	SO:0001583	missense	4534	exon11			U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.1166C>T	X.37:g.149826406C>T	ENSP00000359423:p.Ala389Val		149577064	NM_000252	A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	37	CCDS14694.1	.	.	.	.	.	.	.	.	.	.	C	35	5.577731	0.96565	.	.	ENSG00000171100	ENST00000370396;ENST00000542741;ENST00000543350;ENST00000413012	D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6	5.68	5.68	0.88126	Myotubularin phosphatase domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.049976	0.85682	D	0.000000	D	0.93028	0.7781	L	0.55743	1.74	0.80722	D	1	D;P	0.58970	0.984;0.941	D;P	0.65573	0.936;0.652	D	0.93545	0.6881	10	0.87932	D	0	.	18.8527	0.92238	0.0:1.0:0.0:0.0	.	352;389	B7Z491;Q13496	.;MTM1_HUMAN	V	389;294;274;352	ENSP00000359423:A389V;ENSP00000444015:A294V;ENSP00000439784:A274V;ENSP00000389157:A352V	ENSP00000359423:A389V	A	+	2	0	MTM1	149577064	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.782000	0.85680	2.399000	0.81585	0.538000	0.68166	GCC		0.443	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	NM_000252	
SHROOM2	357	hgsc.bcm.edu	37	X	9841820	9841820	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:9841820G>A	ENST00000380913.3	+	2	384	c.294G>A	c.(292-294)aaG>aaA	p.K98K	Y_RNA_ENST00000384117.1_RNA	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	98	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)	p.K98K(1)		breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				GGTCCCATAAGACCCTGAAGC	0.498											OREG0019659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K98K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G294A	X						.						85.0	70.0	75.0					X																	9841820		2203	4300	6503	9801820	SO:0001819	synonymous_variant	357	exon2			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.294G>A	X.37:g.9841820G>A		660	9801820	NM_001649	B9EIQ7	Silent	SNP	ENST00000380913.3	37	CCDS14135.1																																																																																				0.498	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649	
MAP3K15	389840	hgsc.bcm.edu	37	X	19413202	19413202	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:19413202C>G	ENST00000338883.4	-	16	2190	c.2191G>C	c.(2191-2193)Gga>Cga	p.G731R	MAP3K15_ENST00000359173.3_Missense_Mutation_p.G166R|MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000469203.2_Missense_Mutation_p.G563R	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	731	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.G778R(1)|p.G206R(1)		NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					TACTCACCTCCAGGCACCTGC	0.463																																					p.G731R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2191C	X						.						130.0	111.0	117.0					X																	19413202		2203	4300	6503	19323123	SO:0001583	missense	389840	exon16			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2191G>C	X.37:g.19413202C>G	ENSP00000345629:p.Gly731Arg		19323123	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	ENST00000338883.4	37		.	.	.	.	.	.	.	.	.	.	C	32	5.131179	0.94473	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.33216	1.42;1.42;1.42	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62183	0.2407	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.66638	-0.5873	10	0.87932	D	0	.	19.2177	0.93785	0.0:1.0:0.0:0.0	.	206;731	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	R	731;166;563	ENSP00000345629:G731R;ENSP00000352093:G166R;ENSP00000428356:G563R	ENSP00000345629:G731R	G	-	1	0	MAP3K15	19323123	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.429000	0.80309	2.489000	0.83994	0.597000	0.82753	GGA		0.463	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
CNKSR2	22866	hgsc.bcm.edu	37	X	21627197	21627197	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:21627197C>T	ENST00000379510.3	+	20	2190	c.2154C>T	c.(2152-2154)tgC>tgT	p.C718C	CNKSR2_ENST00000543067.1_Silent_p.C669C|CNKSR2_ENST00000425654.2_Silent_p.C688C|CNKSR2_ENST00000279451.4_Silent_p.C718C	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	718					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.C718C(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						AGATGAGTTGCGCCAGTCCTT	0.458																																					p.C669C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2007T	X						.						42.0	43.0	42.0					X																	21627197		2203	4300	6503	21537118	SO:0001819	synonymous_variant	22866	exon19			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2154C>T	X.37:g.21627197C>T			21537118	NM_001168649	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Silent	SNP	ENST00000379510.3	37	CCDS14198.1																																																																																				0.458	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
MAOB	4129	hgsc.bcm.edu	37	X	43656459	43656459	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:43656459G>A	ENST00000378069.4	-	6	678	c.531C>T	c.(529-531)acC>acT	p.T177T	MAOB_ENST00000536181.1_Silent_p.T161T|MAOB_ENST00000487544.1_5'UTR|MAOB_ENST00000538942.1_Silent_p.T161T	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	177					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	AGACCTCATGGGTCTCTGCAG	0.498																																					p.T177T												.	.	0			c.C531T	X						.						75.0	66.0	69.0					X																	43656459		2203	4300	6503	43541403	SO:0001819	synonymous_variant	4129	exon6				CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.531C>T	X.37:g.43656459G>A			43541403	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Silent	SNP	ENST00000378069.4	37	CCDS14261.1																																																																																				0.498	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	
USP11	8237	hgsc.bcm.edu	37	X	47106744	47106744	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:47106744A>T	ENST00000218348.3	+	19	2591	c.2591A>T	c.(2590-2592)gAg>gTg	p.E864V	USP11_ENST00000377107.2_Missense_Mutation_p.E821V	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	864	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)	p.E864V(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						CCACAGAATGAGTCGAATCCG	0.562																																					p.E864V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2591T	X						.						70.0	63.0	66.0					X																	47106744		2203	4300	6503	46991688	SO:0001583	missense	8237	exon19			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.2591A>T	X.37:g.47106744A>T	ENSP00000218348:p.Glu864Val		46991688	NM_004651	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	ENST00000218348.3	37	CCDS14277.1	.	.	.	.	.	.	.	.	.	.	a	6.334	0.429812	0.11987	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.33438	1.41;1.41	5.5	4.33	0.51752	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.822342	0.11592	N	0.548676	T	0.23492	0.0568	N	0.20574	0.59	0.20873	N	0.999831	P;P	0.36438	0.553;0.553	B;B	0.42214	0.38;0.316	T	0.19943	-1.0290	10	0.29301	T	0.29	-10.4827	7.1451	0.25579	0.8972:0.0:0.1028:0.0	.	590;864	B3KP28;P51784	.;UBP11_HUMAN	V	821;864	ENSP00000366311:E821V;ENSP00000218348:E864V	ENSP00000218348:E864V	E	+	2	0	USP11	46991688	1.000000	0.71417	0.005000	0.12908	0.155000	0.21991	3.677000	0.54619	0.733000	0.32492	0.352000	0.21897	GAG		0.562	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651	
RAB39B	116442	hgsc.bcm.edu	37	X	154493536	154493536	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chrX:154493536A>T	ENST00000369454.3	-	1	338	c.38T>A	c.(37-39)gTc>gAc	p.V13D		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	13					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)	p.V13D(1)		breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ATCCCCGATGACAATGAGCCG	0.667																																					p.V13D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T38A	X						.						83.0	84.0	83.0					X																	154493536		2203	4300	6503	154146730	SO:0001583	missense	116442	exon1			AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.38T>A	X.37:g.154493536A>T	ENSP00000358466:p.Val13Asp		154146730	NM_171998	Q5JT79|Q8NEX3	Missense_Mutation	SNP	ENST00000369454.3	37	CCDS14766.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.619008	0.87460	.	.	ENSG00000155961	ENST00000369454	D	0.83163	-1.69	5.12	5.12	0.69794	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000002	D	0.91808	0.7408	M	0.90145	3.09	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.93103	0.6510	10	0.87932	D	0	.	12.0569	0.53540	1.0:0.0:0.0:0.0	.	13	Q96DA2	RB39B_HUMAN	D	13	ENSP00000358466:V13D	ENSP00000358466:V13D	V	-	2	0	RAB39B	154146730	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.419000	0.80179	1.820000	0.53075	0.486000	0.48141	GTC		0.667	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058792.1	NM_171998	
ODC1	4953	hgsc.bcm.edu	37	2	10583628	10583628	+	Silent	SNP	A	A	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:10583628A>T	ENST00000234111.4	-	7	1164	c.654T>A	c.(652-654)gtT>gtA	p.V218V	ODC1_ENST00000405333.1_Silent_p.V218V|ODC1_ENST00000446285.1_5'Flank	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	218					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)	p.V218V(1)		NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	CCATGTCAAAAACACAGCGGG	0.478																																					p.V218V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T654A	2						.						88.0	91.0	90.0					2																	10583628		2203	4300	6503	10501079	SO:0001819	synonymous_variant	4953	exon7				CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.654T>A	2.37:g.10583628A>T			10501079	NM_002539	Q53TU3|Q6LDS9	Silent	SNP	ENST00000234111.4	37	CCDS1672.1																																																																																				0.478	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206896.2		
LCT	3938	hgsc.bcm.edu	37	2	136561527	136561527	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:136561527C>T	ENST00000264162.2	-	11	4646	c.4636G>A	c.(4636-4638)Ggc>Agc	p.G1546S		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1546	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.G1546S(1)|p.G1546C(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TAGCCATAGCCCTGGTAAGCA	0.498																																					p.G1546S												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G4636A	2						.						109.0	83.0	92.0					2																	136561527		2203	4300	6503	136277997	SO:0001583	missense	3938	exon11			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4636G>A	2.37:g.136561527C>T	ENSP00000264162:p.Gly1546Ser		136277997	NM_002299	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668673	0.88348	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.59224	0.28	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.76241	0.3960	M	0.75085	2.285	0.80722	D	1	P	0.46020	0.871	P	0.62491	0.903	T	0.73483	-0.3968	10	0.42905	T	0.14	-31.7491	20.0124	0.97464	0.0:1.0:0.0:0.0	.	1546	P09848	LPH_HUMAN	S	1546;978	ENSP00000264162:G1546S	ENSP00000264162:G1546S	G	-	1	0	LCT	136277997	1.000000	0.71417	0.979000	0.43373	0.242000	0.25591	7.818000	0.86416	2.749000	0.94314	0.655000	0.94253	GGC		0.498	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
LRP1B	53353	hgsc.bcm.edu	37	2	141459726	141459726	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:141459726T>C	ENST00000389484.3	-	39	7257	c.6286A>G	c.(6286-6288)Atc>Gtc	p.I2096V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2096					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.I2096V(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GACCAGTAGATGTAAGCCCCA	0.403										TSP Lung(27;0.18)																											p.I2096V	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6286G	2						.						159.0	136.0	144.0					2																	141459726		2203	4300	6503	141176196	SO:0001583	missense	53353	exon39			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6286A>G	2.37:g.141459726T>C	ENSP00000374135:p.Ile2096Val		141176196	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.803311	0.50315	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91295	-2.82	5.5	5.5	0.81552	Six-bladed beta-propeller, TolB-like (1);	0.146629	0.44097	U	0.000487	D	0.91875	0.7428	L	0.31845	0.965	0.50813	D	0.999891	D	0.59357	0.985	D	0.67548	0.952	D	0.91191	0.4984	10	0.34782	T	0.22	.	15.598	0.76602	0.0:0.0:0.0:1.0	.	2096	Q9NZR2	LRP1B_HUMAN	V	2096;2034	ENSP00000374135:I2096V	ENSP00000374135:I2096V	I	-	1	0	LRP1B	141176196	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.193000	0.72075	2.090000	0.63153	0.460000	0.39030	ATC		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRP1B	53353	hgsc.bcm.edu	37	2	141460072	141460072	+	Missense_Mutation	SNP	C	C	T	rs531700545		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:141460072C>T	ENST00000389484.3	-	38	7045	c.6074G>A	c.(6073-6075)cGc>cAc	p.R2025H		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2025					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.R2025H(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCCATCCAAGCGAGCCTTTCC	0.408										TSP Lung(27;0.18)																											p.R2025H	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6074A	2						.						103.0	95.0	98.0					2																	141460072		2203	4300	6503	141176542	SO:0001583	missense	53353	exon38			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6074G>A	2.37:g.141460072C>T	ENSP00000374135:p.Arg2025His		141176542	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064879	0.55432	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91124	-2.79	5.16	3.36	0.38483	Six-bladed beta-propeller, TolB-like (1);	0.346876	0.25433	N	0.030707	D	0.85643	0.5744	L	0.56199	1.76	0.40964	D	0.984641	B	0.17268	0.021	B	0.15484	0.013	T	0.76892	-0.2791	10	0.15066	T	0.55	.	9.7054	0.40211	0.0:0.7555:0.0:0.2445	.	2025	Q9NZR2	LRP1B_HUMAN	H	2025;1963	ENSP00000374135:R2025H	ENSP00000374135:R2025H	R	-	2	0	LRP1B	141176542	0.472000	0.25870	0.998000	0.56505	0.968000	0.65278	0.973000	0.29422	0.672000	0.31204	0.557000	0.71058	CGC		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
SCN2A	6326	hgsc.bcm.edu	37	2	166201270	166201270	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:166201270G>A	ENST00000375437.2	+	16	3058	c.2768G>A	c.(2767-2769)tGg>tAg	p.W923*	SCN2A_ENST00000283256.6_Nonsense_Mutation_p.W923*|SCN2A_ENST00000357398.3_Nonsense_Mutation_p.W923*|SCN2A_ENST00000375427.2_Nonsense_Mutation_p.W923*	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	923					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.W923*(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCCCACGCTGGCACATGCAT	0.493																																					p.W923X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2768A	2						.						239.0	213.0	222.0					2																	166201270		2203	4300	6503	165909516	SO:0001587	stop_gained	6326	exon15			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2768G>A	2.37:g.166201270G>A	ENSP00000364586:p.Trp923*		165909516	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Nonsense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	G	42	9.510732	0.99192	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	.	.	.	5.42	5.42	0.78866	.	0.138819	0.35320	N	0.003287	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.2493	0.93917	0.0:0.0:1.0:0.0	.	.	.	.	X	923	.	ENSP00000283256:W923X	W	+	2	0	SCN2A	165909516	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.714000	0.98744	2.542000	0.85734	0.650000	0.86243	TGG		0.493	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
SCN2A	6326	hgsc.bcm.edu	37	2	166246237	166246237	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:166246237C>T	ENST00000375437.2	+	27	6211	c.5921C>T	c.(5920-5922)tCg>tTg	p.S1974L	SCN2A_ENST00000283256.6_Missense_Mutation_p.S1974L|SCN2A_ENST00000357398.3_Missense_Mutation_p.S1974L|SCN2A_ENST00000375427.2_Missense_Mutation_p.S1974L	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1974					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.S1974L(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTCCACCCTCGTATGATAGT	0.373																																					p.S1974L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5921T	2						.						48.0	49.0	48.0					2																	166246237		2203	4300	6503	165954483	SO:0001583	missense	6326	exon26			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5921C>T	2.37:g.166246237C>T	ENSP00000364586:p.Ser1974Leu		165954483	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.800509	0.70567	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.96992	-4.2;-4.2;-4.2;-4.2	5.73	5.73	0.89815	.	0.000000	0.56097	D	0.000025	D	0.98340	0.9449	M	0.84948	2.725	0.58432	D	0.999995	P;D	0.71674	0.526;0.998	B;D	0.79108	0.084;0.992	D	0.98936	1.0789	10	0.87932	D	0	.	19.8883	0.96919	0.0:1.0:0.0:0.0	.	1974;1974	Q99250-2;Q99250	.;SCN2A_HUMAN	L	1974	ENSP00000364586:S1974L;ENSP00000349973:S1974L;ENSP00000283256:S1974L;ENSP00000364576:S1974L	ENSP00000283256:S1974L	S	+	2	0	SCN2A	165954483	1.000000	0.71417	0.953000	0.39169	0.832000	0.47134	7.818000	0.86416	2.698000	0.92095	0.585000	0.79938	TCG		0.373	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
AGPS	8540	hgsc.bcm.edu	37	2	178305757	178305757	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:178305757A>G	ENST00000264167.4	+	6	848	c.702A>G	c.(700-702)ccA>ccG	p.P234P	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	234	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)	p.P234P(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			GTATCATACCAATTGGTGGTA	0.279																																					p.P234P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A702G	2						.						136.0	135.0	135.0					2																	178305757		2202	4299	6501	178014003	SO:0001819	synonymous_variant	8540	exon6			Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.702A>G	2.37:g.178305757A>G			178014003	NM_003659	A5D8U9|Q2TU35	Silent	SNP	ENST00000264167.4	37	CCDS2275.1																																																																																				0.279	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255730.2		
ZNF804A	91752	hgsc.bcm.edu	37	2	185731162	185731162	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:185731162G>T	ENST00000302277.6	+	2	772	c.178G>T	c.(178-180)Gaa>Taa	p.E60*		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	60							metal ion binding (GO:0046872)	p.E60*(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TTTTTACTGTGAACTCTGTGA	0.353																																					p.E60X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G178T	2						.						74.0	74.0	74.0					2																	185731162		2203	4300	6503	185439407	SO:0001587	stop_gained	91752	exon2			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.178G>T	2.37:g.185731162G>T	ENSP00000303252:p.Glu60*		185439407	NM_194250	A7E253|Q6ZN26	Nonsense_Mutation	SNP	ENST00000302277.6	37	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	G	43	9.906794	0.99293	.	.	ENSG00000170396	ENST00000302277	.	.	.	5.68	5.68	0.88126	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-22.1685	19.1431	0.93452	0.0:0.0:1.0:0.0	.	.	.	.	X	60	.	ENSP00000303252:E60X	E	+	1	0	ZNF804A	185439407	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.772000	0.85439	2.838000	0.97847	0.591000	0.81541	GAA		0.353	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
MYO1B	4430	hgsc.bcm.edu	37	2	192228556	192228556	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:192228556T>C	ENST00000392318.3	+	10	1115	c.868T>C	c.(868-870)Tct>Cct	p.S290P	MYO1B_ENST00000392316.1_Missense_Mutation_p.S290P|MYO1B_ENST00000304164.4_Missense_Mutation_p.S290P|MYO1B_ENST00000339514.4_Missense_Mutation_p.S290P	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	290	Myosin motor.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.S290P(1)		NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			CAAGCCCGAATCTCGAGTGAA	0.433																																					p.S290P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T868C	2						.						136.0	125.0	129.0					2																	192228556		2203	4300	6503	191936801	SO:0001583	missense	4430	exon10			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.868T>C	2.37:g.192228556T>C	ENSP00000376132:p.Ser290Pro		191936801	NM_012223	O43794|Q7Z6L5	Missense_Mutation	SNP	ENST00000392318.3	37	CCDS46477.1	.	.	.	.	.	.	.	.	.	.	T	14.87	2.663333	0.47572	.	.	ENSG00000128641	ENST00000339514;ENST00000439452;ENST00000392318;ENST00000304164;ENST00000451437;ENST00000392316	D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23	5.92	5.92	0.95590	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.85923	0.5810	N	0.17800	0.525	0.80722	D	1	D;P	0.54601	0.967;0.956	P;P	0.56648	0.803;0.702	D	0.85848	0.1402	10	0.36615	T	0.2	.	14.9347	0.70944	0.0:0.0:0.0:1.0	.	290;290	O43795;O43795-2	MYO1B_HUMAN;.	P	290	ENSP00000341903:S290P;ENSP00000376132:S290P;ENSP00000306382:S290P;ENSP00000388140:S290P;ENSP00000376130:S290P	ENSP00000306382:S290P	S	+	1	0	MYO1B	191936801	1.000000	0.71417	0.919000	0.36401	0.890000	0.51754	5.907000	0.69908	2.267000	0.75376	0.528000	0.53228	TCT		0.433	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334774.1	NM_012223	
NABP1	64859	hgsc.bcm.edu	37	2	192550423	192550423	+	Missense_Mutation	SNP	A	A	T	rs200581859		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:192550423A>T	ENST00000425611.2	+	6	627	c.544A>T	c.(544-546)Aca>Tca	p.T182S	NABP1_ENST00000410026.2_Missense_Mutation_p.T102S|NABP1_ENST00000409510.1_Missense_Mutation_p.T102S	NM_001031716.2	NP_001026886.1	Q96AH0	SOSB2_HUMAN	nucleic acid binding protein 1	182					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SOSS complex (GO:0070876)	RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.T182S(1)									ACTACAAGGAACAGCTAGTAA	0.438																																					p.T182S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A544T	2						.						111.0	103.0	105.0					2																	192550423		2203	4300	6503	192258668	SO:0001583	missense	64859	exon6			BC017114	CCDS33352.1, CCDS58745.1	2q32.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000173559	ENSG00000173559			26232	protein-coding gene	gene with protein product	"""single-stranded DNA-binding protein 2"", ""sensor of single-strand DNA complex subunit B2"""	612103	"""oligonucleotide/oligosaccharide-binding fold containing 2A"""	OBFC2A			Standard	NM_001031716		Approved	FLJ22833, DKFZp667M1322, FLJ13624, MGC111163, SSB2, hSSB2, SOSS-B2	uc002usx.3	Q96AH0	OTTHUMG00000132720	ENST00000425611.2:c.544A>T	2.37:g.192550423A>T	ENSP00000403683:p.Thr182Ser		192258668	NM_001031716	Q658Y8|Q9H5X6	Missense_Mutation	SNP	ENST00000425611.2	37	CCDS33352.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.866|0.866	-0.733620|-0.733620	0.03111|0.03111	.|.	.|.	ENSG00000173559|ENSG00000173559	ENST00000435931|ENST00000410026;ENST00000409510;ENST00000425611	.|T;T;T	.|0.43688	.|0.94;0.94;0.94	5.35|5.35	-1.02|-1.02	0.10135|0.10135	.|.	.|0.576810	.|0.18988	.|N	.|0.125685	T|T	0.22627|0.22627	0.0546|0.0546	N|N	0.16478|0.16478	0.41|0.41	0.09310|0.09310	N|N	1|1	.|B;B	.|0.27068	.|0.167;0.001	.|B;B	.|0.31101	.|0.124;0.001	T|T	0.17806|0.17806	-1.0357|-1.0357	5|10	.|0.30854	.|T	.|0.27	.|.	7.089|7.089	0.25273|0.25273	0.4686:0.1611:0.3703:0.0|0.4686:0.1611:0.3703:0.0	.|.	.|102;182	.|Q96AH0-2;Q96AH0	.|.;SOSB2_HUMAN	D|S	145|102;102;182	.|ENSP00000387243:T102S;ENSP00000386605:T102S;ENSP00000403683:T182S	.|ENSP00000386605:T102S	E|T	+|+	3|1	2|0	OBFC2A|OBFC2A	192258668|192258668	0.018000|0.018000	0.18449|0.18449	0.434000|0.434000	0.26772|0.26772	0.021000|0.021000	0.10359|0.10359	-0.924000|-0.924000	0.03996|0.03996	-0.029000|-0.029000	0.13827|0.13827	0.533000|0.533000	0.62120|0.62120	GAA|ACA		0.438	NABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256060.1	NM_022837	
APOB	338	hgsc.bcm.edu	37	2	21257692	21257692	+	Silent	SNP	A	A	G	rs549628916		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:21257692A>G	ENST00000233242.1	-	8	1027	c.900T>C	c.(898-900)ggT>ggC	p.G300G	APOB_ENST00000399256.4_Silent_p.G300G	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	300	Heparin-binding.|Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.G300G(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTTACCTTCACCAAAGAAGC	0.448													A|||	1	0.000199681	0.0	0.0	5008	,	,		22427	0.0		0.0	False		,,,				2504	0.001				p.G300G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T900C	2						.						197.0	179.0	185.0					2																	21257692		2203	4300	6503	21111197	SO:0001819	synonymous_variant	338	exon8			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.900T>C	2.37:g.21257692A>G			21111197	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																				0.448	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
CASP8	841	hgsc.bcm.edu	37	2	202131216	202131216	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:202131216T>G	ENST00000432109.2	+	3	196	c.7T>G	c.(7-9)Ttc>Gtc	p.F3V	CASP8_ENST00000323492.7_Missense_Mutation_p.F3V|CASP8_ENST00000392258.3_Missense_Mutation_p.F3V|CASP8_ENST00000264275.5_Missense_Mutation_p.F3V|CASP8_ENST00000392266.3_Missense_Mutation_p.F3V|CASP8_ENST00000358485.4_Missense_Mutation_p.F62V|CASP8_ENST00000264274.9_Missense_Mutation_p.F3V|CASP8_ENST00000392259.2_Missense_Mutation_p.F3V	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	3	DED 1. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.F62V(1)|p.F3V(1)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						AAAGATGGACTTCAGCAGAAA	0.398										HNSCC(4;0.00038)																											p.F3V	Melanoma(82;831 1348 20716 36952 40159)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T7G	2						.						55.0	60.0	58.0					2																	202131216		2203	4300	6503	201839461	SO:0001583	missense	841	exon2			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.7T>G	2.37:g.202131216T>G	ENSP00000412523:p.Phe3Val		201839461	NM_033356	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	ENST00000432109.2	37	CCDS2342.1	.	.	.	.	.	.	.	.	.	.	T	12.12	1.843754	0.32606	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000392259;ENST00000392266;ENST00000432109;ENST00000264275;ENST00000440732;ENST00000392258;ENST00000447616;ENST00000358485;ENST00000392261;ENST00000413726;ENST00000323492;ENST00000429881	D;D;D;D;D;D;D;D;D;D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45	5.46	4.3	0.51218	DEATH-like (2);Death effector (3);	0.546114	0.21454	N	0.074287	D	0.94860	0.8339	M	0.92738	3.34	0.34046	D	0.655608	D;P;P;P;D;P;D;P;D	0.71674	0.975;0.684;0.798;0.934;0.993;0.759;0.998;0.843;0.993	P;B;P;P;P;P;D;P;P	0.70487	0.719;0.422;0.539;0.78;0.876;0.543;0.969;0.625;0.876	D	0.96326	0.9240	10	0.87932	D	0	.	9.2788	0.37716	0.0:0.0819:0.0:0.9181	.	3;3;3;3;62;3;3;3;3	Q14790-3;E7ETB7;Q14790-7;A8MU92;Q14790-9;Q14790;Q14790-2;Q14790-4;Q14790-5	.;.;.;.;.;CASP8_HUMAN;.;.;.	V	3;3;3;3;3;3;3;3;3;62;3;3;3;3	ENSP00000376091:F3V;ENSP00000264274:F3V;ENSP00000376088:F3V;ENSP00000376094:F3V;ENSP00000412523:F3V;ENSP00000264275:F3V;ENSP00000396869:F3V;ENSP00000376087:F3V;ENSP00000388306:F3V;ENSP00000351273:F62V;ENSP00000397528:F3V;ENSP00000325722:F3V;ENSP00000390641:F3V	ENSP00000264274:F3V	F	+	1	0	CASP8	201839461	0.997000	0.39634	0.668000	0.29813	0.013000	0.08279	2.854000	0.48325	0.887000	0.36136	0.533000	0.62120	TTC		0.398	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228	
ERBB4	2066	hgsc.bcm.edu	37	2	212812227	212812227	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:212812227A>G	ENST00000342788.4	-	3	659	c.349T>C	c.(349-351)Ttg>Ctg	p.L117L	ERBB4_ENST00000436443.1_Silent_p.L117L|ERBB4_ENST00000402597.1_Silent_p.L117L|ERBB4_ENST00000484474.1_5'UTR	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	117					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L117L(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	AATATTGCCAAGGCATATCGA	0.373										TSP Lung(8;0.080)																											p.L117L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T349C	2						.						114.0	108.0	110.0					2																	212812227		2203	4300	6503	212520472	SO:0001819	synonymous_variant	2066	exon3			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.349T>C	2.37:g.212812227A>G			212520472	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	ENST00000342788.4	37	CCDS2394.1																																																																																				0.373	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
ABCA12	26154	hgsc.bcm.edu	37	2	215823059	215823059	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:215823059T>G	ENST00000272895.7	-	41	6278	c.6059A>C	c.(6058-6060)cAg>cCg	p.Q2020P	ABCA12_ENST00000389661.4_Missense_Mutation_p.Q1702P|AC072062.1_ENST00000607412.1_RNA|AC072062.1_ENST00000420134.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2020					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.Q2020P(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGAAATGTGCTGCAACTGTTT	0.428																																					p.Q2020P	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6059C	2						.						244.0	207.0	220.0					2																	215823059		2203	4300	6503	215531304	SO:0001583	missense	26154	exon41			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6059A>C	2.37:g.215823059T>G	ENSP00000272895:p.Gln2020Pro		215531304	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.024378	0.75390	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.82711	-1.64;-1.64	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000008	D	0.92625	0.7657	M	0.89904	3.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.94062	0.7327	10	0.87932	D	0	.	15.9507	0.79835	0.0:0.0:0.0:1.0	.	2020;1702	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	P	2020;1702	ENSP00000272895:Q2020P;ENSP00000374312:Q1702P	ENSP00000272895:Q2020P	Q	-	2	0	ABCA12	215531304	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.997000	0.88414	2.232000	0.73038	0.528000	0.53228	CAG		0.428	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
ABCA12	26154	hgsc.bcm.edu	37	2	215845345	215845345	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:215845345C>T	ENST00000272895.7	-	31	4821	c.4602G>A	c.(4600-4602)acG>acA	p.T1534T	ABCA12_ENST00000389661.4_Silent_p.T1216T	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1534	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.T1534T(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CCAAGTGGTGCGTTGACAGAA	0.507																																					p.T1534T	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4602A	2						.						126.0	114.0	118.0					2																	215845345		2203	4300	6503	215553590	SO:0001819	synonymous_variant	26154	exon31			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4602G>A	2.37:g.215845345C>T			215553590	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	37	CCDS33372.1																																																																																				0.507	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
CXCR2	3579	hgsc.bcm.edu	37	2	219000444	219000444	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:219000444G>T	ENST00000318507.2	+	3	1347	c.920G>T	c.(919-921)aGc>aTc	p.S307I		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	307					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)	p.S307I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						ATCCTTCACAGCTGCCTCAAC	0.562																																					p.S307I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G920T	2						.						91.0	88.0	89.0					2																	219000444		2203	4300	6503	218708689	SO:0001583	missense	3579	exon3			U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.920G>T	2.37:g.219000444G>T	ENSP00000319635:p.Ser307Ile		218708689	NM_001557	Q8IUZ1|Q9P2T6|Q9P2T7	Missense_Mutation	SNP	ENST00000318507.2	37	CCDS2408.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646803	0.87958	.	.	ENSG00000180871	ENST00000318507	T	0.79653	-1.29	5.36	5.36	0.76844	GPCR, rhodopsin-like superfamily (1);	0.095215	0.64402	D	0.000001	D	0.94118	0.8114	H	0.98542	4.26	0.51482	D	0.999928	D	0.89917	1.0	D	0.85130	0.997	D	0.96330	0.9243	9	.	.	.	.	17.9176	0.88957	0.0:0.0:1.0:0.0	.	307	P25025	CXCR2_HUMAN	I	307	ENSP00000319635:S307I	.	S	+	2	0	CXCR2	218708689	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.861000	0.87004	2.529000	0.85273	0.456000	0.33151	AGC		0.562	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256772.2	NM_001557	
SP100	6672	hgsc.bcm.edu	37	2	231368967	231368967	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:231368967A>G	ENST00000264052.5	+	21	2187	c.1832A>G	c.(1831-1833)gAg>gGg	p.E611G	SP100_ENST00000340126.4_Missense_Mutation_p.E611G|RN7SL834P_ENST00000461450.2_RNA|SP100_ENST00000409112.1_Missense_Mutation_p.E611G	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	611	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.E611G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ACCTGTGGTGAGGTGAAGGGC	0.383																																					p.E611G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1832G	2						.						165.0	169.0	168.0					2																	231368967		2203	4300	6503	231077211	SO:0001583	missense	6672	exon21			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.1832A>G	2.37:g.231368967A>G	ENSP00000264052:p.Glu611Gly		231077211	NM_001080391	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	ENST00000264052.5	37	CCDS2477.1	.	.	.	.	.	.	.	.	.	.	A	1.029	-0.682395	0.03353	.	.	ENSG00000067066	ENST00000264052;ENST00000409112;ENST00000340126;ENST00000414648	T;T;T	0.64618	-0.11;-0.11;-0.11	4.54	0.784	0.18578	SAND domain-like (2);SAND domain (3);	1.521460	0.04679	N	0.411941	T	0.47469	0.1447	L	0.28694	0.88	0.09310	N	0.999997	B;B;B	0.30281	0.275;0.174;0.006	B;B;B	0.29077	0.087;0.098;0.007	T	0.27706	-1.0066	10	0.25106	T	0.35	.	5.4969	0.16807	0.4821:0.3497:0.0:0.1682	.	611;611;611	P23497-4;P23497;E7EUA7	.;SP100_HUMAN;.	G	611;611;611;94	ENSP00000264052:E611G;ENSP00000386427:E611G;ENSP00000343023:E611G	ENSP00000264052:E611G	E	+	2	0	SP100	231077211	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.111000	0.10807	0.129000	0.18514	0.533000	0.62120	GAG		0.383	SP100-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256914.2	NM_003113	
ILKAP	80895	hgsc.bcm.edu	37	2	239092307	239092307	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:239092307A>G	ENST00000254654.3	-	8	876	c.701T>C	c.(700-702)cTc>cCc	p.L234P		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	234	PP2C-like.				protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.L234P(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		ACTATCTCCGAGGTTGGCAAT	0.463																																					p.L234P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T701C	2						.						58.0	54.0	55.0					2																	239092307		2203	4300	6503	238757046	SO:0001583	missense	80895	exon8			AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.701T>C	2.37:g.239092307A>G	ENSP00000254654:p.Leu234Pro		238757046	NM_030768	B3KM39	Missense_Mutation	SNP	ENST00000254654.3	37	CCDS2526.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.222837	0.79464	.	.	ENSG00000132323	ENST00000254654;ENST00000450411	T;T	0.11495	2.77;2.77	5.42	5.42	0.78866	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.39784	0.1091	M	0.89163	3.01	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.46020	-0.9221	10	0.72032	D	0.01	4.676	14.457	0.67423	1.0:0.0:0.0:0.0	.	234	Q9H0C8	ILKAP_HUMAN	P	234;51	ENSP00000254654:L234P;ENSP00000406254:L51P	ENSP00000254654:L234P	L	-	2	0	ILKAP	238757046	1.000000	0.71417	0.972000	0.41901	0.995000	0.86356	7.693000	0.84214	2.062000	0.61559	0.533000	0.62120	CTC		0.463	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257163.2	NM_030768	
MBOAT2	129642	hgsc.bcm.edu	37	2	9017257	9017257	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:9017257T>C	ENST00000305997.3	-	7	791	c.593A>G	c.(592-594)tAc>tGc	p.Y198C	MBOAT2_ENST00000486484.1_5'UTR	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	198					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.Y198C(1)	MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GAAAGTAATGTAGTCTTTGTA	0.413																																					p.Y198C	Ovarian(194;1699 3813 22401)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A593G	2						.						168.0	150.0	156.0					2																	9017257		2203	4300	6503	8934708	SO:0001583	missense	129642	exon7			BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.593A>G	2.37:g.9017257T>C	ENSP00000302177:p.Tyr198Cys		8934708	NM_138799	A9EDR2|Q8NCE7|Q96KY4	Missense_Mutation	SNP	ENST00000305997.3	37	CCDS1660.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.530183	0.85706	.	.	ENSG00000143797	ENST00000305997;ENST00000462696	T;T	0.75704	-0.96;-0.96	5.56	5.56	0.83823	.	0.057535	0.64402	D	0.000001	D	0.89230	0.6656	M	0.92970	3.365	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76575	0.987;0.988	D	0.91856	0.5495	10	0.87932	D	0	-15.6607	15.7156	0.77667	0.0:0.0:0.0:1.0	.	198;198	B7Z3I3;Q6ZWT7	.;MBOA2_HUMAN	C	198;175	ENSP00000302177:Y198C;ENSP00000417409:Y175C	ENSP00000302177:Y198C	Y	-	2	0	MBOAT2	8934708	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.673000	0.83973	2.121000	0.65114	0.528000	0.53228	TAC		0.413	MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206735.1	NM_138799	
DNAJC27	51277	hgsc.bcm.edu	37	2	25180730	25180730	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:25180730A>G	ENST00000264711.2	-	4	543	c.354T>C	c.(352-354)ctT>ctC	p.L118L	DNAJC27_ENST00000534855.1_Silent_p.L47L|DNAJC27_ENST00000468467.1_5'UTR	NM_001198559.1|NM_016544.2	NP_001185488.1|NP_057628.1	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	118					small GTPase mediated signal transduction (GO:0007264)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)	p.L118L(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						CATGAGGTCCAAGCTCTTGCT	0.448																																					p.L118L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T354C	2						.						121.0	114.0	116.0					2																	25180730		2203	4300	6503	25034234	SO:0001819	synonymous_variant	51277	exon4				CCDS1716.1, CCDS74493.1	2p23.3	2011-09-02	2008-08-20	2008-08-20	ENSG00000115137	ENSG00000115137		"""Heat shock proteins / DNAJ (HSP40)"""	30290	protein-coding gene	gene with protein product		613527	"""rab and DnaJ domain containing"""	RBJ		14980719	Standard	NM_016544		Approved	RabJS	uc002rft.2	Q9NZQ0	OTTHUMG00000125524	ENST00000264711.2:c.354T>C	2.37:g.25180730A>G			25034234	NM_001198559	Q5JV88|Q86Y24	Silent	SNP	ENST00000264711.2	37	CCDS1716.1																																																																																				0.448	DNAJC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246855.3	NM_016544	
OTOF	9381	hgsc.bcm.edu	37	2	26703112	26703112	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:26703112C>A	ENST00000272371.2	-	16	1997	c.1871G>T	c.(1870-1872)cGg>cTg	p.R624L	OTOF_ENST00000402415.3_5'Flank|OTOF_ENST00000403946.3_Missense_Mutation_p.R624L|OTOF_ENST00000338581.6_5'Flank|OTOF_ENST00000339598.3_5'Flank	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	624					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.R624L(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCGTTTCTCCGGTCGATCAT	0.577																																					p.R624L	GBM(102;732 1451 20652 24062 31372)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1871T	2						.						98.0	96.0	97.0					2																	26703112		2203	4300	6503	26556616	SO:0001583	missense	9381	exon16			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.1871G>T	2.37:g.26703112C>A	ENSP00000272371:p.Arg624Leu		26556616	NM_194248	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.151589	0.78001	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	D;D	0.82167	-1.58;-1.58	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	D	0.91676	0.7369	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.92146	0.5724	10	0.46703	T	0.11	-26.7423	17.5382	0.87840	0.0:1.0:0.0:0.0	.	624	Q9HC10	OTOF_HUMAN	L	624	ENSP00000272371:R624L;ENSP00000385255:R624L	ENSP00000272371:R624L	R	-	2	0	OTOF	26556616	1.000000	0.71417	1.000000	0.80357	0.351000	0.29236	7.698000	0.84413	2.315000	0.78130	0.561000	0.74099	CGG		0.577	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
CENPA	1058	hgsc.bcm.edu	37	2	27015000	27015000	+	Splice_Site	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:27015000C>T	ENST00000335756.4	+	2	302	c.102C>T	c.(100-102)ggC>ggT	p.G34G	CENPA_ENST00000233505.8_Splice_Site_p.G34G|CENPA_ENST00000475662.1_3'UTR	NM_001809.3	NP_001800.1	P49450	CENPA_HUMAN	centromere protein A	34					CENP-A containing nucleosome assembly (GO:0034080)|establishment of mitotic spindle orientation (GO:0000132)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|protein localization to chromosome, centromeric region (GO:0071459)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|condensed chromosome inner kinetochore (GO:0000939)|condensed nuclear chromosome kinetochore (GO:0000778)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.G34G(1)		endometrium(1)|large_intestine(3)|lung(3)|urinary_tract(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTGCTCAGGCGCTTCCTCCC	0.493																																					p.G34G	Pancreas(28;769 878 30250 30578 41330)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C102T	2						.						56.0	53.0	54.0					2																	27015000		2203	4300	6503	26868504	SO:0001630	splice_region_variant	1058	exon2			U14518	CCDS1729.1, CCDS42662.1	2p23.3	2013-11-05	2006-06-16		ENSG00000115163	ENSG00000115163			1851	protein-coding gene	gene with protein product	"""centromere-specific histone"", ""histone H3-like centromeric protein A"""	117139	"""centromere protein A (17kD)"", ""centromere protein A, 17kDa"""				Standard	NM_001042426		Approved	CENP-A, CenH3	uc002rhr.3	P49450	OTTHUMG00000097073	ENST00000335756.4:c.101-1C>T	2.37:g.27015000C>T			26868504	NM_001042426	D6W544|Q53T74|Q9BVW2	Silent	SNP	ENST00000335756.4	37	CCDS1729.1																																																																																				0.493	CENPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214190.2	NM_001809	Silent
DHX57	90957	hgsc.bcm.edu	37	2	39070321	39070321	+	Missense_Mutation	SNP	G	G	A	rs140333800		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:39070321G>A	ENST00000295373.6	-	12	2377	c.2251C>T	c.(2251-2253)Cgg>Tgg	p.R751W		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	751							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.M750_M753delMRSM(1)|p.R751W(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TTCATGGACCGCATATATGGG	0.453																																					p.R751W	Melanoma(191;1090 2095 4375 23729 47341)											.	.	2	Substitution - Missense(1)|Deletion - In frame(1)	large_intestine(2)	c.C2251T	2						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	103.0	91.0	95.0		2251	6.0	1.0	2	dbSNP_134	95	0,8600		0,0,4300	no	missense	DHX57	NM_198963.1	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	751/1387	39070321	1,13005	2203	4300	6503	38923825	SO:0001583	missense	90957	exon12			AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.2251C>T	2.37:g.39070321G>A	ENSP00000295373:p.Arg751Trp		38923825	NM_198963	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	ENST00000295373.6	37	CCDS1800.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.080249|5.080249	0.94050|0.94050	2.27E-4|2.27E-4	0.0|0.0	ENSG00000163214|ENSG00000163214	ENST00000452978|ENST00000295373	.|T	.|0.14391	.|2.51	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	.|0.000000	.|0.52532	.|D	.|0.000070	T|T	0.32704|0.32704	0.0838|0.0838	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|P;P;D	.|0.69078	.|0.798;0.815;0.997	.|B;B;P	.|0.58172	.|0.146;0.111;0.834	T|T	0.00406|0.00406	-1.1759|-1.1759	5|10	.|0.87932	.|D	.|0	.|.	20.1421|20.1421	0.98061|0.98061	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|751;751;143	.|Q6P158;B4DKW2;Q59G60	.|DHX57_HUMAN;.;.	V|W	74|751	.|ENSP00000295373:R751W	.|ENSP00000295373:R751W	A|R	-|-	2|1	0|2	DHX57|DHX57	38923825|38923825	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.907000|0.907000	0.53573|0.53573	5.247000|5.247000	0.65416|0.65416	2.850000|2.850000	0.98022|0.98022	0.650000|0.650000	0.86243|0.86243	GCG|CGG		0.453	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
FBXO11	80204	hgsc.bcm.edu	37	2	48059591	48059591	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:48059591G>A	ENST00000403359.3	-	11	1367	c.1295C>T	c.(1294-1296)gCg>gTg	p.A432V	FBXO11_ENST00000402508.1_Missense_Mutation_p.A348V|FBXO11_ENST00000434523.2_5'Flank|FBXO11_ENST00000316377.4_Missense_Mutation_p.A348V	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	432					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A348V(2)|p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CCCAGCTAACGCATTATTGGA	0.333			"""Mis, F, D"""		DLBCL																																p.A432V			Rec	yes		2	2p16.3	80204	F-box protein 11		L	.	.	4	Substitution - Missense(2)|Whole gene deletion(2)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(2)	c.C1295T	2						.						74.0	75.0	75.0					2																	48059591		2203	4300	6503	47913095	SO:0001583	missense	80204	exon11			AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.1295C>T	2.37:g.48059591G>A	ENSP00000384823:p.Ala432Val		47913095	NM_001190274	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	37	CCDS54357.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.776807	0.90195	.	.	ENSG00000138081	ENST00000402508;ENST00000403359;ENST00000316377	T;T;T	0.80566	-1.39;0.95;-1.39	5.95	5.95	0.96441	Pectin lyase fold/virulence factor (1);Carbohydrate-binding/sugar hydrolysis domain (1);F-box domain, Skp2-like (1);Pectin lyase fold (1);	0.000000	0.85682	D	0.000000	D	0.88130	0.6354	L	0.58354	1.805	0.80722	D	1	D	0.63880	0.993	D	0.67725	0.953	D	0.86003	0.1496	10	0.41790	T	0.15	-5.6348	20.3747	0.98911	0.0:0.0:1.0:0.0	.	432	Q86XK2	FBX11_HUMAN	V	348;432;348	ENSP00000385398:A348V;ENSP00000384823:A432V;ENSP00000323822:A348V	ENSP00000323822:A348V	A	-	2	0	FBXO11	47913095	1.000000	0.71417	0.999000	0.59377	0.940000	0.58332	9.869000	0.99810	2.817000	0.96982	0.563000	0.77884	GCG		0.333	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	NM_012167, NM_018693, NM_025133	
PPP1R21	129285	hgsc.bcm.edu	37	2	48698263	48698263	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:48698263G>A	ENST00000294952.8	+	10	1092	c.935G>A	c.(934-936)cGc>cAc	p.R312H	PPP1R21_ENST00000281394.4_Missense_Mutation_p.R312H|PPP1R21_ENST00000449090.2_Missense_Mutation_p.R312H	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	312						membrane (GO:0016020)	phosphatase binding (GO:0019902)	p.R312H(1)		endometrium(2)|kidney(4)|lung(9)	15						TCCTATGTCCGCCCTCTTGAG	0.373																																					p.R312H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G935A	2						.						110.0	104.0	106.0					2																	48698263		2203	4300	6503	48551767	SO:0001583	missense	129285	exon10			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.935G>A	2.37:g.48698263G>A	ENSP00000294952:p.Arg312His		48551767	NM_001135629	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Missense_Mutation	SNP	ENST00000294952.8	37	CCDS46278.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002363	0.93227	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.76307	0.3969	L	0.53249	1.67	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.74023	0.98;0.959;0.966;0.982;0.982	T	0.75986	-0.3124	9	0.54805	T	0.06	-7.91	19.2914	0.94102	0.0:0.0:1.0:0.0	.	312;312;312;312;312	E1B6W7;Q6ZMI0;Q6ZMI0-2;Q6ZMI0-3;Q6ZMI0-4	.;PPR21_HUMAN;.;.;.	H	312	.	ENSP00000281394:R312H	R	+	2	0	KLRAQ1	48551767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.737000	0.91562	2.793000	0.96121	0.561000	0.74099	CGC		0.373	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251238.4	NM_152994	
PROM2	150696	hgsc.bcm.edu	37	2	95945594	95945594	+	Splice_Site	SNP	T	T	C	rs199504764		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:95945594T>C	ENST00000317620.9	+	11	1409	c.1276T>C	c.(1276-1278)Tgg>Cgg	p.W426R	PROM2_ENST00000317668.4_Splice_Site_p.W426R|PROM2_ENST00000403131.2_Splice_Site_p.W426R|PROM2_ENST00000542147.1_Splice_Site_p.W426R	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	426					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)	p.W426R(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						CTGTGGCAGGTGGATCGTGGG	0.627																																					p.W426R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1276C	2						.						115.0	91.0	99.0					2																	95945594		2203	4300	6503	95309321	SO:0001630	splice_region_variant	150696	exon11			AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.1275-1T>C	2.37:g.95945594T>C			95309321	NM_144707	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	37	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	T	17.91	3.504525	0.64410	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.02	5.02	0.67125	.	0.000000	0.64402	D	0.000003	T	0.65719	0.2718	M	0.78801	2.425	0.54753	D	0.999989	D	0.89917	1.0	D	0.97110	1.0	T	0.64385	-0.6420	10	0.24483	T	0.36	-13.0314	11.4157	0.49951	0.0:0.0:0.0:1.0	.	426	Q8N271	PROM2_HUMAN	R	426	ENSP00000385716:W426R;ENSP00000318520:W426R;ENSP00000318270:W426R;ENSP00000442542:W426R	ENSP00000318270:W426R	W	+	1	0	PROM2	95309321	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	5.815000	0.69215	2.019000	0.59389	0.533000	0.62120	TGG		0.627	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	Missense_Mutation
PASK	23178	hgsc.bcm.edu	37	2	242082263	242082263	+	Missense_Mutation	SNP	G	G	A	rs144572631	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr2:242082263G>A	ENST00000405260.1	-	2	883	c.185C>T	c.(184-186)aCa>aTa	p.T62I	PASK_ENST00000539818.1_Intron|PASK_ENST00000403638.3_Missense_Mutation_p.T62I|PASK_ENST00000234040.4_Missense_Mutation_p.T62I|PASK_ENST00000358649.4_Missense_Mutation_p.T62I|PASK_ENST00000544142.1_Nonsense_Mutation_p.Q11*	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	62					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.T62I(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		AGAGAGCGCTGTCCTGCTCTG	0.562													G|||	2	0.000399361	0.0	0.0	5008	,	,		20364	0.0		0.002	False		,,,				2504	0.0				p.T62I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C185T	2						.	G	ILE/THR	0,4406		0,0,2203	84.0	71.0	75.0		185	-4.0	0.0	2	dbSNP_134	75	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PASK	NM_015148.2	89	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	62/1324	242082263	2,13004	2203	4300	6503	241730936	SO:0001583	missense	23178	exon2			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.185C>T	2.37:g.242082263G>A	ENSP00000384016:p.Thr62Ile		241730936	NM_015148	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	CCDS2545.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.2|22.2	4.256444|4.256444	0.80246|0.80246	0.0|0.0	2.33E-4|2.33E-4	ENSG00000115687|ENSG00000115687	ENST00000544142|ENST00000234040;ENST00000405260;ENST00000358649;ENST00000403638;ENST00000452907	.|T;T;T;T	.|0.67523	.|-0.27;-0.27;-0.23;0.71	4.18|4.18	-3.97|-3.97	0.04094|0.04094	.|.	.|1.245370	.|0.05571	.|N	.|0.571164	.|T	.|0.44644	.|0.1303	N|N	0.12182|0.12182	0.205|0.205	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B;B;B	.|0.17852	.|0.024;0.017;0.008;0.024	.|B;B;B;B	.|0.14578	.|0.005;0.007;0.011;0.005	.|T	.|0.31081	.|-0.9956	.|10	0.87932|0.14656	D|T	0|0.56	.|.	11.1762|11.1762	0.48601|0.48601	0.2968:0.0:0.7032:0.0|0.2968:0.0:0.7032:0.0	.|.	.|62;62;62;62	.|B7Z7R6;Q96RG2-2;G5E9F1;Q96RG2	.|.;.;.;PASK_HUMAN	X|I	11|62	.|ENSP00000234040:T62I;ENSP00000384016:T62I;ENSP00000351475:T62I;ENSP00000384438:T62I	ENSP00000441374:Q11X|ENSP00000234040:T62I	Q|T	-|-	1|2	0|0	PASK|PASK	241730936|241730936	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.172000|0.172000	0.22775|0.22775	-0.008000|-0.008000	0.12788|0.12788	-0.905000|-0.905000	0.03871|0.03871	-0.367000|-0.367000	0.07326|0.07326	CAG|ACA		0.562	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
TMEFF1	8577	hgsc.bcm.edu	37	9	103310167	103310167	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:103310167T>G	ENST00000374879.4	+	6	1134	c.702T>G	c.(700-702)caT>caG	p.H234Q	TMEFF1_ENST00000334943.6_Missense_Mutation_p.H195Q|MSANTD3-TMEFF1_ENST00000502978.1_Missense_Mutation_p.L198V	NM_003692.4	NP_003683.2	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 1	234	Kazal-like 2. {ECO:0000255|PROSITE- ProRule:PRU00798}.				multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H234Q(1)		NS(1)|kidney(1)|large_intestine(7)|lung(9)|stomach(1)	19		Acute lymphoblastic leukemia(62;0.0452)				ATCTTGGTCATTGCACAGGTA	0.318																																					p.H234Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T702G	9						.						111.0	106.0	108.0					9																	103310167		2203	4299	6502	102349988	SO:0001583	missense	8577	exon6			U19878	CCDS6750.1	9q31	2010-05-04			ENSG00000241697	ENSG00000241697			11866	protein-coding gene	gene with protein product	"""tomoregulin-1"", ""cancer/testis antigen family 120, member 1"""	603421		C9orf2		9730596	Standard	NM_003692		Approved	H7365, CT120.1		Q8IYR6	OTTHUMG00000020367	ENST00000374879.4:c.702T>G	9.37:g.103310167T>G	ENSP00000364013:p.His234Gln		102349988	NM_003692	Q13086|Q8N3T8	Missense_Mutation	SNP	ENST00000374879.4	37	CCDS6750.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.40|11.40	1.628839|1.628839	0.28978|0.28978	.|.	.|.	ENSG00000241697|ENSG00000251349	ENST00000334943;ENST00000374879|ENST00000502978	T;T|.	0.04049|.	3.72;3.72|.	5.98|5.98	-1.67|-1.67	0.08238|0.08238	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);|.	0.311546|.	0.33792|.	N|.	0.004559|.	T|T	0.27900|0.27900	0.0687|0.0687	N|N	0.16266|0.16266	0.395|0.395	0.29626|0.29626	N|N	0.84586|0.84586	B;B|.	0.27732|.	0.034;0.187|.	B;B|.	0.26416|.	0.063;0.069|.	T|T	0.34601|0.34601	-0.9822|-0.9822	10|5	0.15066|.	T|.	0.55|.	-30.1399|-30.1399	12.4328|12.4328	0.55583|0.55583	0.0:0.6165:0.0:0.3835|0.0:0.6165:0.0:0.3835	.|.	234;195|.	Q8IYR6;Q8IYR6-2|.	TEFF1_HUMAN;.|.	Q|V	195;234|198	ENSP00000334447:H195Q;ENSP00000364013:H234Q|.	ENSP00000334447:H195Q|.	H|L	+|+	3|1	2|2	TMEFF1|C9orf30-TMEFF1	102349988|102349988	0.003000|0.003000	0.15002|0.15002	0.997000|0.997000	0.53966|0.53966	0.953000|0.953000	0.61014|0.61014	-0.873000|-0.873000	0.04214|0.04214	-0.137000|-0.137000	0.11455|0.11455	-0.462000|-0.462000	0.05337|0.05337	CAT|TTG		0.318	TMEFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053418.1	NM_003692	
TMEM246	84302	hgsc.bcm.edu	37	9	104239260	104239260	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:104239260C>T	ENST00000374851.1	-	4	1262	c.115G>A	c.(115-117)Gcc>Acc	p.A39T	RP11-490D19.6_ENST00000450109.1_RNA|RP11-490D19.6_ENST00000424154.1_RNA|TMEM246_ENST00000374848.3_Missense_Mutation_p.A39T|TMEM246_ENST00000374847.1_Missense_Mutation_p.A39T|RP11-490D19.6_ENST00000431507.1_RNA|RP11-490D19.6_ENST00000425734.1_RNA			Q9BRR3	TM246_HUMAN	transmembrane protein 246	39						integral component of membrane (GO:0016021)		p.A39T(1)									GCCAGGGGGGCCAGCAGGCCA	0.572																																					p.A39T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G115A	9						.						54.0	58.0	57.0					9																	104239260		2203	4300	6503	103279081	SO:0001583	missense	84302	exon2			BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.115G>A	9.37:g.104239260C>T	ENSP00000363984:p.Ala39Thr		103279081	NM_032342	Q49AQ4	Missense_Mutation	SNP	ENST00000374851.1	37	CCDS6757.1	.	.	.	.	.	.	.	.	.	.	c	18.68	3.676541	0.67928	.	.	ENSG00000165152	ENST00000374848;ENST00000374847;ENST00000374851	.	.	.	5.63	5.63	0.86233	.	0.215049	0.39687	N	0.001298	T	0.51736	0.1692	L	0.36672	1.1	0.34753	D	0.731942	B	0.15719	0.014	B	0.25884	0.064	T	0.57476	-0.7805	9	0.40728	T	0.16	-11.2937	16.8607	0.86017	0.0:1.0:0.0:0.0	.	39	Q9BRR3	CI125_HUMAN	T	39	.	ENSP00000363980:A39T	A	-	1	0	C9orf125	103279081	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	3.082000	0.50128	2.636000	0.89361	0.645000	0.84053	GCC		0.572	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053444.1	NM_032342	
SLC44A1	23446	hgsc.bcm.edu	37	9	108136923	108136923	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:108136923C>T	ENST00000374720.3	+	13	1786	c.1539C>T	c.(1537-1539)acC>acT	p.T513T	SLC44A1_ENST00000374724.1_Silent_p.T513T|SLC44A1_ENST00000374723.1_Silent_p.T513T|SLC44A1_ENST00000343170.7_Silent_p.T305T	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	513					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)	p.T513T(2)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	ACTTCTGCACCTCAGCAAAGG	0.413																																					p.T513T												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C1539T	9						.						199.0	173.0	182.0					9																	108136923		2203	4300	6503	107176744	SO:0001819	synonymous_variant	23446	exon13			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1539C>T	9.37:g.108136923C>T			107176744	NM_080546	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Silent	SNP	ENST00000374720.3	37	CCDS6763.1																																																																																				0.413	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053500.1	NM_080546	
ZNF462	58499	hgsc.bcm.edu	37	9	109689336	109689336	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:109689336A>G	ENST00000277225.5	+	3	3432	c.3143A>G	c.(3142-3144)cAt>cGt	p.H1048R	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.H1048R			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1048					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H1048R(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GTCTTGGTTCATTATCAGAAG	0.428																																					p.H1048R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3143G	9						.						209.0	203.0	205.0					9																	109689336		2203	4300	6503	108729157	SO:0001583	missense	58499	exon3			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3143A>G	9.37:g.109689336A>G	ENSP00000277225:p.His1048Arg		108729157	NM_021224	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.491624	0.64074	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.11169	2.8;3.19	5.6	5.6	0.85130	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.33323	0.0859	M	0.69823	2.125	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.79784	0.993;0.991	T	0.04708	-1.0932	10	0.87932	D	0	.	15.7935	0.78388	1.0:0.0:0.0:0.0	.	1048;1048	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	R	1048	ENSP00000277225:H1048R;ENSP00000414570:H1048R	ENSP00000277225:H1048R	H	+	2	0	ZNF462	108729157	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.211000	0.95120	2.125000	0.65367	0.533000	0.62120	CAT		0.428	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
COL27A1	85301	hgsc.bcm.edu	37	9	117020836	117020836	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:117020836C>T	ENST00000356083.3	+	28	3548	c.3157C>T	c.(3157-3159)Cga>Tga	p.R1053*		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1053	Collagen-like 7.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.R1053*(1)		central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						TCCAGGATCTCGAGGCCCACC	0.622																																					p.R1053X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3157T	9						.						49.0	47.0	47.0					9																	117020836		2203	4300	6503	116060657	SO:0001587	stop_gained	85301	exon28			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3157C>T	9.37:g.117020836C>T	ENSP00000348385:p.Arg1053*		116060657	NM_032888	Q66K43|Q96JF7	Nonsense_Mutation	SNP	ENST00000356083.3	37	CCDS6802.1	.	.	.	.	.	.	.	.	.	.	C	46	12.535050	0.99675	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9936	0.64382	0.0:1.0:0.0:0.0	.	.	.	.	X	1053	.	ENSP00000348385:R1053X	R	+	1	2	COL27A1	116060657	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.262000	0.58847	2.365000	0.80145	0.462000	0.41574	CGA		0.622	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
PAPPA	5069	hgsc.bcm.edu	37	9	118950060	118950060	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:118950060G>A	ENST00000328252.3	+	2	1412	c.1043G>A	c.(1042-1044)cGc>cAc	p.R348H	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	348	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R348H(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TCAAGTTTCCGCCAGCCCAAG	0.562																																					p.R348H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1043A	9						.						58.0	55.0	56.0					9																	118950060		2203	4300	6503	117989881	SO:0001583	missense	5069	exon2				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1043G>A	9.37:g.118950060G>A	ENSP00000330658:p.Arg348His		117989881	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.390838	0.82902	.	.	ENSG00000182752	ENST00000328252	T	0.58210	0.35	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.75027	0.3794	M	0.74389	2.26	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75706	-0.3224	10	0.87932	D	0	-28.8671	20.4777	0.99188	0.0:0.0:1.0:0.0	.	348	Q13219	PAPP1_HUMAN	H	348	ENSP00000330658:R348H	ENSP00000330658:R348H	R	+	2	0	PAPPA	117989881	1.000000	0.71417	0.955000	0.39395	0.522000	0.34438	9.818000	0.99354	2.840000	0.97914	0.655000	0.94253	CGC		0.562	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
PAPPA	5069	hgsc.bcm.edu	37	9	118997830	118997830	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:118997830G>T	ENST00000328252.3	+	7	3015	c.2646G>T	c.(2644-2646)aaG>aaT	p.K882N	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	882					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.K882N(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TACAGTGTAAGCCCCTGAAGT	0.512																																					p.K882N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2646T	9						.						94.0	77.0	83.0					9																	118997830		2203	4300	6503	118037651	SO:0001583	missense	5069	exon7				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.2646G>T	9.37:g.118997830G>T	ENSP00000330658:p.Lys882Asn		118037651	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.998352	0.35226	.	.	ENSG00000182752	ENST00000328252;ENST00000443904	T	0.55234	0.53	6.03	1.79	0.24919	.	0.189361	0.56097	D	0.000026	T	0.46698	0.1406	M	0.65498	2.005	0.80722	D	1	D;P	0.53312	0.959;0.698	B;B	0.42827	0.399;0.276	T	0.43861	-0.9365	10	0.72032	D	0.01	-21.8122	5.706	0.17909	0.4193:0.0:0.458:0.1227	.	326;882	E7EMD3;Q13219	.;PAPP1_HUMAN	N	882;326	ENSP00000330658:K882N	ENSP00000330658:K882N	K	+	3	2	PAPPA	118037651	0.861000	0.29849	0.995000	0.50966	0.275000	0.26752	-0.060000	0.11712	0.321000	0.23259	0.655000	0.94253	AAG		0.512	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
MORN5	254956	hgsc.bcm.edu	37	9	124962193	124962193	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:124962193A>G	ENST00000373764.3	+	5	531	c.469A>G	c.(469-471)Acc>Gcc	p.T157A	MORN5_ENST00000486801.1_3'UTR	NM_198469.2	NP_940871.2	Q5VZ52	MORN5_HUMAN	MORN repeat containing 5	157								p.T157A(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	9						GATCACCCGTACCTGTCGAAA	0.587																																					p.T157A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A469G	9						.						150.0	120.0	130.0					9																	124962193		2203	4300	6503	124002014	SO:0001583	missense	254956	exon5			AK128877	CCDS6836.1, CCDS75894.1	9q34.11	2008-06-23	2008-06-23	2008-06-23	ENSG00000185681	ENSG00000185681			17841	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 113"", ""chromosome 9 open reading frame 18"""	C9orf113, C9orf18			Standard	XM_005251878		Approved	FLJ46909	uc004blw.2	Q5VZ52	OTTHUMG00000020599	ENST00000373764.3:c.469A>G	9.37:g.124962193A>G	ENSP00000362869:p.Thr157Ala		124002014	NM_198469	B7Z7I5|Q6ZQN1	Missense_Mutation	SNP	ENST00000373764.3	37	CCDS6836.1	.	.	.	.	.	.	.	.	.	.	A	10.14	1.267342	0.23136	.	.	ENSG00000185681	ENST00000373764	T	0.21734	1.99	5.48	4.35	0.52113	.	0.157403	0.56097	D	0.000026	T	0.18173	0.0436	L	0.54323	1.7	0.80722	D	1	B	0.11235	0.004	B	0.08055	0.003	T	0.05194	-1.0900	10	0.10111	T	0.7	-9.6144	10.4274	0.44387	0.9241:0.0:0.0759:0.0	.	157	Q5VZ52	MORN5_HUMAN	A	157	ENSP00000362869:T157A	ENSP00000362869:T157A	T	+	1	0	MORN5	124002014	1.000000	0.71417	0.576000	0.28549	0.850000	0.48378	5.697000	0.68295	0.925000	0.37094	0.533000	0.62120	ACC		0.587	MORN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053910.2	NM_198469	
NEK6	10783	hgsc.bcm.edu	37	9	127089651	127089651	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:127089651G>A	ENST00000320246.5	+	7	694	c.549G>A	c.(547-549)acG>acA	p.T183T	NEK6_ENST00000394199.2_Silent_p.T217T|NEK6_ENST00000546191.1_Silent_p.T183T|NEK6_ENST00000539416.1_Silent_p.T208T|NEK6_ENST00000540326.1_Silent_p.T201T|NEK6_ENST00000545174.1_Silent_p.T183T|NEK6_ENST00000373603.1_Silent_p.T183T|NEK6_ENST00000373600.3_Silent_p.T217T	NM_014397.5	NP_055212.2	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6	183	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cellular senescence (GO:2000772)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.T176T(3)|p.T217T(2)		endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15						TCACAGCCACGGGCGTCGTGA	0.627																																					p.T201T	NSCLC(122;934 1785 18647 44295 45571)											.	.	5	Substitution - coding silent(5)	lung(4)|large_intestine(1)	c.G603A	9						.						253.0	226.0	235.0					9																	127089651		2203	4300	6503	126129472	SO:0001819	synonymous_variant	10783	exon7			AF087909	CCDS6854.1, CCDS48015.1, CCDS55338.1, CCDS55339.1	9q33.3-q34.11	2012-11-15	2012-11-15		ENSG00000119408	ENSG00000119408			7749	protein-coding gene	gene with protein product	"""putative serine-threonine protein kinase"""	604884	"""NIMA (never in mitosis gene a)-related kinase 6"""			10702691	Standard	NM_001145001		Approved	SID6-1512	uc004boh.3	Q9HC98	OTTHUMG00000020650	ENST00000320246.5:c.549G>A	9.37:g.127089651G>A			126129472	NM_001166167	B7Z2D9|Q5TBG3|Q5TBG9|Q6FG86|Q6IAR3|Q96E83|Q9ULX2	Silent	SNP	ENST00000320246.5	37	CCDS6854.1																																																																																				0.627	NEK6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054016.1	NM_014397	
LRRC8A	56262	hgsc.bcm.edu	37	9	131671064	131671064	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:131671064C>G	ENST00000259324.5	+	3	2144	c.1621C>G	c.(1621-1623)Cgg>Ggg	p.R541G	LRRC8A_ENST00000372599.3_Missense_Mutation_p.R541G|LRRC8A_ENST00000372600.4_Missense_Mutation_p.R541G	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	541					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R541G(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						CGACGGGCTGCGGGAGCTCAA	0.597																																					p.R541G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1621G	9						.						55.0	48.0	51.0					9																	131671064		2203	4300	6503	130710885	SO:0001583	missense	56262	exon3			AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.1621C>G	9.37:g.131671064C>G	ENSP00000259324:p.Arg541Gly		130710885	NM_019594	Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	ENST00000259324.5	37	CCDS35155.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313180	0.40895	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.22134	1.97;1.97;1.97	5.67	3.78	0.43462	.	0.116105	0.64402	D	0.000014	T	0.10895	0.0266	N	0.03324	-0.35	0.49915	D	0.999834	B	0.26318	0.146	B	0.37387	0.248	T	0.23048	-1.0199	10	0.20519	T	0.43	.	8.879	0.35363	0.2498:0.6763:0.0:0.0739	.	541	Q8IWT6	LRC8A_HUMAN	G	541	ENSP00000361682:R541G;ENSP00000361680:R541G;ENSP00000259324:R541G	ENSP00000259324:R541G	R	+	1	2	LRRC8A	130710885	1.000000	0.71417	0.997000	0.53966	0.821000	0.46438	4.081000	0.57627	1.409000	0.46915	0.561000	0.74099	CGG		0.597	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594	
ABL1	25	hgsc.bcm.edu	37	9	133748391	133748391	+	Missense_Mutation	SNP	T	T	C	rs121913457		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:133748391T>C	ENST00000318560.5	+	6	1433	c.1052T>C	c.(1051-1053)aTg>aCg	p.M351T		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	351	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)	p.M351T(18)		breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	TCGTCAGCCATGGAGTACCTG	0.597			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																p.M351T			Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	ABL1,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	18	Substitution - Missense(18)	haematopoietic_and_lymphoid_tissue(18)	c.T1052C	9						.						62.0	50.0	54.0					9																	133748391		2203	4300	6503	132738212	SO:0001583	missense	25	exon6			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1052T>C	9.37:g.133748391T>C	ENSP00000323315:p.Met351Thr		132738212	NM_005157	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	ENST00000318560.5	37	CCDS35166.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.623731	0.87460	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	T;T	0.64803	-0.12;-0.12	5.74	5.74	0.90152	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87748	0.6255	H	0.98951	4.38	0.80722	A	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92537	0.6038	9	0.87932	D	0	.	15.5232	0.75881	0.0:0.0:0.0:1.0	.	351;388	P00519;Q59FK4	ABL1_HUMAN;.	T	166;370;351	ENSP00000361423:M370T;ENSP00000323315:M351T	ENSP00000323315:M351T	M	+	2	0	ABL1	132738212	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.317000	0.78254	0.460000	0.39030	ATG		0.597	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
LAMC3	10319	hgsc.bcm.edu	37	9	133920995	133920995	+	Silent	SNP	C	C	T	rs374329361		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:133920995C>T	ENST00000361069.4	+	8	1600	c.1467C>T	c.(1465-1467)tgC>tgT	p.C489C	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	489	Laminin EGF-like 5; first part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.C489C(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CCAAGGTGTGCGCGTCCACTG	0.597																																					p.C489C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1467T	9						.						88.0	75.0	80.0					9																	133920995		2203	4300	6503	132910816	SO:0001819	synonymous_variant	10319	exon8			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1467C>T	9.37:g.133920995C>T			132910816	NM_006059	B1APX9|B1APY0|Q59H72	Silent	SNP	ENST00000361069.4	37	CCDS6938.1																																																																																				0.597	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
SLC24A2	25769	hgsc.bcm.edu	37	9	19516186	19516186	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:19516186C>A	ENST00000341998.2	-	10	2012	c.1951G>T	c.(1951-1953)Gaa>Taa	p.E651*	SLC24A2_ENST00000286344.3_Nonsense_Mutation_p.E634*	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	651					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)	p.E651*(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		ATTCTGTCTTCTAGGAGAACG	0.517																																					p.E651X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1951T	9						.						185.0	177.0	180.0					9																	19516186		2203	4300	6503	19506186	SO:0001587	stop_gained	25769	exon11			AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1951G>T	9.37:g.19516186C>A	ENSP00000344801:p.Glu651*		19506186	NM_020344	B7ZLL8|Q9NTN5|Q9NZQ4	Nonsense_Mutation	SNP	ENST00000341998.2	37	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	C	37	6.018089	0.97205	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2305	0.93836	0.0:1.0:0.0:0.0	.	.	.	.	X	651;634	.	.	E	-	1	0	SLC24A2	19506186	1.000000	0.71417	0.956000	0.39512	0.807000	0.45602	7.771000	0.85420	2.549000	0.85964	0.655000	0.94253	GAA		0.517	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
CAAP1	79886	hgsc.bcm.edu	37	9	26884813	26884813	+	Silent	SNP	G	G	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:26884813G>C	ENST00000333916.5	-	4	748	c.660C>G	c.(658-660)gtC>gtG	p.V220V	CAAP1_ENST00000495958.1_5'UTR|CAAP1_ENST00000520187.1_Intron|CAAP1_ENST00000535437.1_Silent_p.V75V	NM_001167575.1|NM_024828.3	NP_001161047.1|NP_079104.3	Q9H8G2	CAAP1_HUMAN	caspase activity and apoptosis inhibitor 1	220					apoptotic process (GO:0006915)			p.V220V(1)									CTTACTGACTGACTAAATCAG	0.303																																					p.V220V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C660G	9						.						116.0	128.0	124.0					9																	26884813		2203	4292	6495	26874813	SO:0001819	synonymous_variant	79886	exon4			BC014658	CCDS6516.1	9p21.2	2012-04-20	2012-04-20	2012-04-20	ENSG00000120159	ENSG00000120159			25834	protein-coding gene	gene with protein product	"""conserved anti-apoptotic protein"""		"""chromosome 9 open reading frame 82"""	C9orf82		21980415	Standard	NM_024828		Approved	FLJ13657, CAAP	uc003zqc.3	Q9H8G2	OTTHUMG00000019706	ENST00000333916.5:c.660C>G	9.37:g.26884813G>C			26874813	NM_024828	B4DWT4|D3DRK4|Q5VY32|Q6IPE6|Q96C59	Silent	SNP	ENST00000333916.5	37	CCDS6516.1																																																																																				0.303	CAAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051954.1	NM_024828	
NOL6	65083	hgsc.bcm.edu	37	9	33463428	33463428	+	Silent	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:33463428C>T	ENST00000455041.2	-	23	2909	c.2850G>A	c.(2848-2850)cgG>cgA	p.R950R	NOL6_ENST00000379471.2_Intron|NOL6_ENST00000464829.1_Intron			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	1002					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R1002R(1)		endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		CCAAGGGCGGCCGGAACACTG	0.622																																					p.R1002R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3006A	9						.						45.0	43.0	44.0					9																	33463428		2203	4300	6503	33453428	SO:0001819	synonymous_variant	65083	exon24			AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000455041.2:c.2850G>A	9.37:g.33463428C>T			33453428	NM_022917	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Silent	SNP	ENST00000455041.2	37																																																																																					0.622	NOL6-201	KNOWN	basic	protein_coding	protein_coding		NM_022917	
DNAJB5	25822	hgsc.bcm.edu	37	9	34996474	34996474	+	Missense_Mutation	SNP	G	G	A	rs150475871	byFrequency	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:34996474G>A	ENST00000541010.1	+	2	3436	c.424G>A	c.(424-426)Ggc>Agc	p.G142S	DNAJB5_ENST00000453597.3_Missense_Mutation_p.G256S|DNAJB5_ENST00000454002.2_Missense_Mutation_p.G214S|DNAJB5_ENST00000545841.1_Missense_Mutation_p.G142S|DNAJB5_ENST00000335998.3_Missense_Mutation_p.G176S|DNAJB5_ENST00000312316.5_Missense_Mutation_p.G142S			O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	142					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)	p.G142S(1)		kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(32;0.00575)			TGGCGCTTTCGGCCGTTTTGG	0.592																																					p.G214S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G640A	9						.	G	SER/GLY,SER/GLY,SER/GLY	2,4404	4.2+/-10.8	0,2,2201	71.0	69.0	70.0		766,640,424	2.3	1.0	9	dbSNP_134	70	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense	DNAJB5	NM_001135004.2,NM_001135005.2,NM_012266.5	56,56,56	0,5,6498	AA,AG,GG		0.0349,0.0454,0.0384	benign,benign,benign	256/463,214/421,142/349	34996474	5,13001	2203	4300	6503	34986474	SO:0001583	missense	25822	exon3			AF088982	CCDS35007.1, CCDS47959.1, CCDS47960.1, CCDS47960.2	9p	2011-09-02			ENSG00000137094	ENSG00000137094		"""Heat shock proteins / DNAJ (HSP40)"""	14887	protein-coding gene	gene with protein product		611328				10570961, 11147971	Standard	NM_001135004		Approved	Hsc40	uc003zvs.4	O75953	OTTHUMG00000019840	ENST00000541010.1:c.424G>A	9.37:g.34996474G>A	ENSP00000443151:p.Gly142Ser		34986474	NM_001135005	B3KN14|B4DSA6|J3KQM9|J3KR08|Q5T656|Q8TDR7|Q96EM4	Missense_Mutation	SNP	ENST00000541010.1	37	CCDS35007.1	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346108	0.24426	4.54E-4	3.49E-4	ENSG00000137094	ENST00000453597;ENST00000335998;ENST00000378751;ENST00000312316;ENST00000541010;ENST00000454002;ENST00000545841;ENST00000539059;ENST00000443266	T;T;T;T;T;T;T;T	0.71222	0.35;0.4;0.27;0.27;0.37;0.27;-0.55;-0.35	5.11	2.29	0.28610	.	0.419404	0.29053	N	0.013291	T	0.50701	0.1631	N	0.21097	0.63	0.51767	D	0.99993	B;B	0.28801	0.223;0.181	B;B	0.23150	0.044;0.011	T	0.31668	-0.9935	10	0.17832	T	0.49	.	10.7739	0.46338	0.1875:0.0:0.8125:0.0	.	214;142	B4DSA6;O75953	.;DNJB5_HUMAN	S	256;176;142;142;142;214;142;178;142	ENSP00000404079:G256S;ENSP00000337626:G176S;ENSP00000312517:G142S;ENSP00000443151:G142S;ENSP00000413684:G214S;ENSP00000441999:G142S;ENSP00000445536:G178S;ENSP00000396332:G142S	ENSP00000312517:G142S	G	+	1	0	DNAJB5	34986474	1.000000	0.71417	0.989000	0.46669	0.707000	0.40811	2.227000	0.42972	0.424000	0.26061	0.561000	0.74099	GGC		0.592	DNAJB5-008	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401397.1		
FANCG	2189	hgsc.bcm.edu	37	9	35076548	35076548	+	Silent	SNP	C	C	T	rs145092954|rs34100177		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:35076548C>T	ENST00000378643.3	-	8	1448	c.957G>A	c.(955-957)ccG>ccA	p.P319P	FANCG_ENST00000476212.1_5'UTR	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	319					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)	p.P319P(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			TGAGAAACTGCGGGGCTTTGG	0.448			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks					C|||	1	0.000199681	0.0	0.0	5008	,	,		21861	0.0		0.0	False		,,,				2504	0.001				p.P319P		yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G957A	9						.						109.0	94.0	99.0					9																	35076548		2203	4300	6503	35066548	SO:0001819	synonymous_variant	2189	exon8			AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.957G>A	9.37:g.35076548C>T			35066548	NM_004629		Silent	SNP	ENST00000378643.3	37	CCDS6574.1																																																																																				0.448	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052269.1	NM_004629	
NAA35	60560	hgsc.bcm.edu	37	9	88576971	88576971	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:88576971C>T	ENST00000361671.5	+	6	525	c.392C>T	c.(391-393)aCg>aTg	p.T131M	NAA35_ENST00000376040.1_Missense_Mutation_p.T131M	NM_024635.3	NP_078911.3	Q5VZE5	NAA35_HUMAN	N(alpha)-acetyltransferase 35, NatC auxiliary subunit	131					negative regulation of apoptotic process (GO:0043066)|smooth muscle cell proliferation (GO:0048659)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)		p.T131M(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	25						ACAGTATTTACGTGCCTTTAC	0.363																																					p.T131M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C392T	9						.						98.0	90.0	93.0					9																	88576971		2203	4300	6503	87766791	SO:0001583	missense	60560	exon6			AK025266	CCDS6673.1	9q22.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000135040	ENSG00000135040		"""N(alpha)-acetyltransferase subunits"""	24340	protein-coding gene	gene with protein product			"""MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae)"""	MAK10		14702039, 19660095	Standard	NM_024635		Approved	FLJ21613, FLJ22643, bA379P1.1	uc004aoi.4	Q5VZE5	OTTHUMG00000020131	ENST00000361671.5:c.392C>T	9.37:g.88576971C>T	ENSP00000354972:p.Thr131Met		87766791	NM_024635	Q5VZE6|Q9H631|Q9H703	Missense_Mutation	SNP	ENST00000361671.5	37	CCDS6673.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219392	0.79464	.	.	ENSG00000135040	ENST00000361671;ENST00000416045;ENST00000376040	.	.	.	5.92	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.83908	0.5356	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	D	0.87145	0.2205	9	0.87932	D	0	-6.9057	17.11	0.86673	0.0:0.8732:0.1268:0.0	.	131;131	Q5VZE6;Q5VZE5	.;NAA35_HUMAN	M	131	.	ENSP00000354972:T131M	T	+	2	0	NAA35	87766791	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.347000	0.79356	1.499000	0.48617	-0.283000	0.09986	ACG		0.363	NAA35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052906.1	NM_024635	
IPPK	64768	hgsc.bcm.edu	37	9	95397502	95397502	+	Silent	SNP	G	G	T	rs200546991		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:95397502G>T	ENST00000287996.3	-	10	1281	c.1005C>A	c.(1003-1005)atC>atA	p.I335I	IPPK_ENST00000375522.1_Silent_p.I7I	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	335					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)	p.I335I(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						AGAGGCCTTCGATGTCCAGCA	0.582											OREG0019315	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I335I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1005A	9						.						114.0	102.0	106.0					9																	95397502		2203	4300	6503	94437323	SO:0001819	synonymous_variant	64768	exon10			AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.1005C>A	9.37:g.95397502G>T		1312	94437323	NM_022755	Q5T9F7|Q9H7V8	Silent	SNP	ENST00000287996.3	37	CCDS6699.1																																																																																				0.582	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053101.1	NM_022755	
BICD2	23299	hgsc.bcm.edu	37	9	95485059	95485059	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:95485059C>T	ENST00000375512.3	-	3	552	c.485G>A	c.(484-486)cGc>cAc	p.R162H	BICD2_ENST00000356884.6_Missense_Mutation_p.R162H	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	162					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)	p.R162H(2)		cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						ATCCCGCAGGCGGCCACGCTG	0.582																																					p.R162H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G485A	9						.						91.0	80.0	84.0					9																	95485059		2203	4300	6503	94524880	SO:0001583	missense	23299	exon3			AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.485G>A	9.37:g.95485059C>T	ENSP00000364662:p.Arg162His		94524880	NM_015250	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	ENST00000375512.3	37	CCDS6700.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.439096	0.83885	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.53640	0.61;0.61	4.83	4.83	0.62350	.	0.129907	0.52532	D	0.000065	T	0.57388	0.2050	L	0.44542	1.39	0.58432	D	0.99999	D;D	0.65815	0.994;0.995	P;P	0.61070	0.814;0.883	T	0.56195	-0.8019	10	0.42905	T	0.14	-21.924	15.7894	0.78343	0.0:1.0:0.0:0.0	.	162;162	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	H	162	ENSP00000349351:R162H;ENSP00000364662:R162H	ENSP00000349351:R162H	R	-	2	0	BICD2	94524880	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.840000	0.69402	2.402000	0.81655	0.561000	0.74099	CGC		0.582	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055508.1	NM_015250	
C9orf171	389799	hgsc.bcm.edu	37	9	135418402	135418402	+	Missense_Mutation	SNP	G	G	A	rs372180431		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr9:135418402G>A	ENST00000343036.2	+	6	856	c.808G>A	c.(808-810)Gac>Aac	p.D270N	C9orf171_ENST00000393216.2_Missense_Mutation_p.D234N	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	270								p.D270N(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						CGTGAAGCTGGACACCCTCTG	0.592																																					p.D270N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G808A	9						.	G	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	154.0	132.0	139.0		808	4.2	0.7	9		139	0,8600		0,0,4300	no	missense	C9orf171	NM_207417.1	23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	270/321	135418402	1,13005	2203	4300	6503	134408223	SO:0001583	missense	389799	exon6			AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.808G>A	9.37:g.135418402G>A	ENSP00000343290:p.Asp270Asn		134408223	NM_207417	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	CCDS6949.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.520332	0.27211	2.27E-4	0.0	ENSG00000188523	ENST00000343036;ENST00000393216	T;T	0.21361	2.01;2.01	5.11	4.21	0.49690	.	0.583037	0.16465	N	0.213260	T	0.24314	0.0589	L	0.51422	1.61	0.29468	N	0.857261	P;B	0.51351	0.944;0.428	P;B	0.47470	0.548;0.109	T	0.04961	-1.0915	10	0.21540	T	0.41	.	11.0065	0.47637	0.0863:0.0:0.9137:0.0	.	234;270	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	N	270;234	ENSP00000343290:D270N;ENSP00000376909:D234N	ENSP00000343290:D270N	D	+	1	0	C9orf171	134408223	0.984000	0.35163	0.691000	0.30163	0.010000	0.07245	2.119000	0.41958	1.151000	0.42436	-0.140000	0.14226	GAC		0.592	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417	
EFNB2	1948	hgsc.bcm.edu	37	13	107145496	107145496	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:107145496G>A	ENST00000245323.4	-	5	1043	c.894C>T	c.(892-894)agC>agT	p.S298S		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	298					anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)	p.S298S(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					GGCAGAAGACGCTGTCCGCAG	0.612																																					p.S298S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C894T	13						.						125.0	91.0	102.0					13																	107145496		2203	4300	6503	105943497	SO:0001819	synonymous_variant	1948	exon5			L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.894C>T	13.37:g.107145496G>A			105943497	NM_004093	Q5JV56	Silent	SNP	ENST00000245323.4	37	CCDS9507.1																																																																																				0.612	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045733.4	NM_004093	
TUBA3C	7278	hgsc.bcm.edu	37	13	19748202	19748202	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:19748202G>A	ENST00000400113.3	-	5	1258	c.1154C>T	c.(1153-1155)gCg>gTg	p.A385V		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	385					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.A385V(2)|p.A385E(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CCAGGCCTCCGCGATGGCCGT	0.632																																					p.A385V												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.C1154T	13						.						98.0	88.0	91.0					13																	19748202		2203	4300	6503	18646202	SO:0001583	missense	7278	exon5			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.1154C>T	13.37:g.19748202G>A	ENSP00000382982:p.Ala385Val		18646202	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000400113.3	37	CCDS9284.1	.	.	.	.	.	.	.	.	.	.	g	11.65	1.701353	0.30142	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	D	0.82081	-1.57	1.22	1.22	0.21188	.	0.000000	0.46758	U	0.000268	D	0.84570	0.5501	.	.	.	0.42134	D	0.991481	.	.	.	.	.	.	D	0.84412	0.0566	7	0.87932	D	0	.	8.3643	0.32378	0.0:0.0:1.0:0.0	.	.	.	.	V	385	ENSP00000382982:A385V	ENSP00000354037:A385V	A	-	2	0	TUBA3C	18646202	1.000000	0.71417	0.917000	0.36280	0.930000	0.56654	7.948000	0.87774	0.982000	0.38575	0.194000	0.17425	GCG		0.632	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
MICU2	221154	hgsc.bcm.edu	37	13	22067402	22067402	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:22067402T>C	ENST00000382374.4	-	12	1356	c.1291A>G	c.(1291-1293)Aaa>Gaa	p.K431E	MICU2_ENST00000479790.1_5'UTR	NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	431					mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)	p.K431E(1)									AAAAGACCTTTTCCAGCTTGT	0.303																																					p.K431E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1291G	13						.						131.0	128.0	129.0					13																	22067402		2203	4298	6501	20965402	SO:0001583	missense	221154	exon12			AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.1291A>G	13.37:g.22067402T>C	ENSP00000371811:p.Lys431Glu		20965402	NM_152726	Q8N0T6|Q8NAX8	Missense_Mutation	SNP	ENST00000382374.4	37	CCDS9297.1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.645601	0.47258	.	.	ENSG00000165487	ENST00000382374	T	0.50001	0.76	5.92	4.71	0.59529	.	0.463923	0.28338	N	0.015717	T	0.34571	0.0902	L	0.29908	0.895	0.30902	N	0.729192	P	0.35745	0.518	B	0.28991	0.097	T	0.41378	-0.9512	10	0.72032	D	0.01	-3.1141	13.1124	0.59281	0.0:0.0:0.1338:0.8662	.	431	Q8IYU8	EFHA1_HUMAN	E	431	ENSP00000371811:K431E	ENSP00000371811:K431E	K	-	1	0	EFHA1	20965402	0.919000	0.31177	0.092000	0.20876	0.009000	0.06853	1.108000	0.31123	1.014000	0.39417	0.533000	0.62120	AAA		0.303	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144355.1	NM_152726	
SPATA13	221178	hgsc.bcm.edu	37	13	24871756	24871756	+	Missense_Mutation	SNP	G	G	A	rs199770674		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:24871756G>A	ENST00000382095.4	+	10	1998	c.1591G>A	c.(1591-1593)Gtc>Atc	p.V531I	SPATA13_ENST00000343003.6_Missense_Mutation_p.V475I|SPATA13_ENST00000424834.2_Missense_Mutation_p.V1156I|SPATA13_ENST00000399949.2_Missense_Mutation_p.V453I|SPATA13_ENST00000382108.3_Missense_Mutation_p.V1156I|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.V1034I|SPATA13_ENST00000409126.1_Missense_Mutation_p.V391I	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	531	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.V531I(2)		breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		CTTCAAGCTCGTCAGTAGGAC	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		21633	0.001		0.0	False		,,,				2504	0.0				p.V1156I												.	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.G3466A	13						.	G	ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	86.0	83.0	84.0		1591,3466	0.3	0.9	13		84	0,8600		0,0,4300	no	missense,missense	SPATA13	NM_153023.2,NM_001166271.1	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	531/653,1156/1278	24871756	1,13005	2203	4300	6503	23769756	SO:0001583	missense	221178	exon11			AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.1591G>A	13.37:g.24871756G>A	ENSP00000371527:p.Val531Ile		23769756	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	37	CCDS9305.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0017482517482517483|0.0017482517482517483	0|0	0.0|0.0	G|G	4.708|4.708	0.131672|0.131672	0.08981|0.08981	2.27E-4|2.27E-4	0.0|0.0	ENSG00000182957|ENSG00000182957	ENST00000424834|ENST00000382108;ENST00000382095;ENST00000434675;ENST00000438694;ENST00000399949;ENST00000409126;ENST00000343003	.|T;T;D;T;D;T	.|0.87256	.|1.58;1.58;-2.23;1.58;-2.23;1.58	4.79|4.79	0.304|0.304	0.15796|0.15796	.|Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.|0.539627	.|0.21552	.|N	.|0.072708	T|T	0.70254|0.70254	0.3203|0.3203	N|N	0.16166|0.16166	0.38|0.38	0.24154|0.24154	N|N	0.995685|0.995685	.|B;B;B;B;B;B;B	.|0.14012	.|0.003;0.001;0.002;0.003;0.009;0.001;0.002	.|B;B;B;B;B;B;B	.|0.13407	.|0.009;0.005;0.003;0.005;0.005;0.003;0.005	T|T	0.54510|0.54510	-0.8283|-0.8283	5|10	.|0.24483	.|T	.|0.36	.|.	4.5701|4.5701	0.12205|0.12205	0.443:0.1666:0.3905:0.0|0.443:0.1666:0.3905:0.0	.|.	.|391;475;415;477;391;453;531	.|E9PFR9;Q96N96-3;Q96N96-5;Q96N96-4;B4DMC2;Q96N96-2;Q96N96	.|.;.;.;.;.;.;SPT13_HUMAN	H|I	1193|1156;531;429;477;453;391;475	.|ENSP00000371542:V1156I;ENSP00000371527:V531I;ENSP00000401605:V429I;ENSP00000382830:V453I;ENSP00000386471:V391I;ENSP00000343631:V475I	.|ENSP00000343631:V475I	R|V	+|+	2|1	0|0	SPATA13|SPATA13	23769756|23769756	0.534000|0.534000	0.26362|0.26362	0.914000|0.914000	0.36105|0.36105	0.228000|0.228000	0.25075|0.25075	0.750000|0.750000	0.26334|0.26334	0.091000|0.091000	0.17302|0.17302	-0.258000|-0.258000	0.10820|0.10820	CGT|GTC		0.547	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
KL	9365	hgsc.bcm.edu	37	13	33638073	33638073	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:33638073A>G	ENST00000380099.3	+	5	2797	c.2789A>G	c.(2788-2790)tAt>tGt	p.Y930C	KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	930	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)	p.Y930C(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		CTCTATCGTTATGCTGCAGAT	0.443																																					p.Y930C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2789G	13						.						153.0	150.0	151.0					13																	33638073		2203	4300	6503	32536073	SO:0001583	missense	9365	exon5			AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2789A>G	13.37:g.33638073A>G	ENSP00000369442:p.Tyr930Cys		32536073	NM_004795	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	ENST00000380099.3	37	CCDS9347.1	.	.	.	.	.	.	.	.	.	.	A	10.59	1.391709	0.25118	.	.	ENSG00000133116	ENST00000380099	T	0.28895	1.59	5.33	4.14	0.48551	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.251260	0.41396	D	0.000881	T	0.52549	0.1741	M	0.68317	2.08	0.09310	N	1	D	0.76494	0.999	D	0.72075	0.976	T	0.51020	-0.8758	10	0.72032	D	0.01	-16.1766	13.7743	0.63044	0.883:0.0:0.0:0.1169	.	930	Q9UEF7	KLOT_HUMAN	C	930	ENSP00000369442:Y930C	ENSP00000369442:Y930C	Y	+	2	0	KL	32536073	0.895000	0.30542	0.008000	0.14137	0.315000	0.28087	2.697000	0.47060	0.326000	0.23384	-1.426000	0.01102	TAT		0.443	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		
SETDB2	83852	hgsc.bcm.edu	37	13	50035248	50035248	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:50035248T>C	ENST00000317257.8	+	4	983	c.158T>C	c.(157-159)aTg>aCg	p.M53T	SETDB2_ENST00000258672.5_Missense_Mutation_p.M53T|SETDB2_ENST00000354234.4_Missense_Mutation_p.M53T	NM_031915.2	NP_114121.2	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2	53					chromosome segregation (GO:0007059)|heart looping (GO:0001947)|histone H3-K9 methylation (GO:0051567)|left/right axis specification (GO:0070986)|mitotic nuclear division (GO:0007067)|negative regulation of transcription, DNA-templated (GO:0045892)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|zinc ion binding (GO:0008270)	p.M53T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	15		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		ATCCAAGCAATGATTCTAGTG	0.323																																					p.M53T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T158C	13						.						169.0	167.0	168.0					13																	50035248		2202	4298	6500	48933249	SO:0001583	missense	83852	exon3			AF334407	CCDS9417.1, CCDS53868.1	13q14	2011-07-01	2003-05-06	2003-05-09	ENSG00000136169	ENSG00000136169		"""Chromatin-modifying enzymes / K-methyltransferases"""	20263	protein-coding gene	gene with protein product		607865	"""chromosome 13 open reading frame 4"""	C13orf4		11306461	Standard	NM_031915		Approved	CLLD8, CLLL8, KMT1F	uc001vda.3	Q96T68	OTTHUMG00000016918	ENST00000317257.8:c.158T>C	13.37:g.50035248T>C	ENSP00000326477:p.Met53Thr		48933249	NM_001160308	Q5TC65|Q5TC66|Q5W0A7|Q659A7|Q86UD6|Q96AI6	Missense_Mutation	SNP	ENST00000317257.8	37	CCDS9417.1	.	.	.	.	.	.	.	.	.	.	T	15.34	2.803552	0.50315	.	.	ENSG00000136169	ENST00000354234;ENST00000317257;ENST00000258672	D;D;T	0.86956	-2.19;-2.18;1.12	5.87	4.69	0.59074	.	0.172820	0.64402	D	0.000012	D	0.87018	0.6073	L	0.27053	0.805	0.39878	D	0.973596	D;D;D	0.69078	0.992;0.997;0.995	D;D;P	0.71656	0.974;0.917;0.841	D	0.85519	0.1202	10	0.35671	T	0.21	.	9.0825	0.36561	0.0:0.083:0.0:0.917	.	53;53;53	Q96T68-3;Q96T68-2;Q96T68	.;.;SETB2_HUMAN	T	53	ENSP00000346175:M53T;ENSP00000326477:M53T;ENSP00000258672:M53T	ENSP00000258672:M53T	M	+	2	0	SETDB2	48933249	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	2.420000	0.44679	1.147000	0.42369	-0.290000	0.09829	ATG		0.323	SETDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044925.1	NM_031915	
KPNA3	3839	hgsc.bcm.edu	37	13	50296673	50296673	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:50296673G>A	ENST00000261667.3	-	8	910	c.496C>T	c.(496-498)Ctt>Ttt	p.L166F		NM_002267.3	NP_002258.2	O00505	IMA4_HUMAN	karyopherin alpha 3 (importin alpha 4)	166	NLS binding site (major). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)|protein complex assembly (GO:0006461)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)	p.L166F(1)		cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(4)	21		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GGTGAACGAAGAAGTCTCAGA	0.328																																					p.L166F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C496T	13						.						65.0	65.0	65.0					13																	50296673		2203	4300	6503	49194674	SO:0001583	missense	3839	exon8			D89618	CCDS9421.1	13q14.3	2013-02-14			ENSG00000102753	ENSG00000102753		"""Importins"", ""Armadillo repeat containing"""	6396	protein-coding gene	gene with protein product		601892				9154134, 9435235	Standard	NM_002267		Approved	SRP1gamma, SRP4, hSRP1, IPOA4	uc001vdj.2	O00505	OTTHUMG00000016922	ENST00000261667.3:c.496C>T	13.37:g.50296673G>A	ENSP00000261667:p.Leu166Phe		49194674	NM_002267	O00191|O43195|Q5JVM9|Q96AA7	Missense_Mutation	SNP	ENST00000261667.3	37	CCDS9421.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075791	0.76415	.	.	ENSG00000102753	ENST00000261667	D	0.84370	-1.84	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.94706	0.8292	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95589	0.8653	10	0.87932	D	0	-8.7521	19.4941	0.95064	0.0:0.0:1.0:0.0	.	166	O00505	IMA3_HUMAN	F	166	ENSP00000261667:L166F	ENSP00000261667:L166F	L	-	1	0	KPNA3	49194674	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.703000	0.74633	2.682000	0.91365	0.591000	0.81541	CTT		0.328	KPNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044939.2	NM_002267	
ALG11	440138	hgsc.bcm.edu	37	13	52598602	52598602	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:52598602C>A	ENST00000521508.1	+	3	741	c.736C>A	c.(736-738)Ctt>Att	p.L246I	ALG11_ENST00000523764.1_Intron|ALG11_ENST00000519151.1_3'UTR|UTP14C_ENST00000521776.2_5'Flank	NM_001004127.2	NP_001004127.2	Q2TAA5	ALG11_HUMAN	ALG11, alpha-1,2-mannosyltransferase	246					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GDP-Man:Man3GlcNAc2-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0004377)	p.L246I(1)		endometrium(1)|large_intestine(6)|lung(4)|ovary(2)	13		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.44e-08)		TATTTATGGACTTGTTGGTTC	0.338																																					p.L246I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C736A	13						.						117.0	117.0	117.0					13																	52598602		2203	4300	6503	51496603	SO:0001583	missense	440138	exon3			AK025456	CCDS31977.1	13q14.3	2013-02-22	2013-02-22		ENSG00000253710	ENSG00000253710	2.4.1.131	"""Glycosyltransferase group 1 domain containing"""	32456	protein-coding gene	gene with protein product	"""GDP-Man:Man(3)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"""	613666	"""asparagine-linked glycosylation 11 homolog (S. cerevisiae, alpha-1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)"""			20080937	Standard	NM_001004127		Approved	KIAA0266		Q2TAA5	OTTHUMG00000016959	ENST00000521508.1:c.736C>A	13.37:g.52598602C>A	ENSP00000430236:p.Leu246Ile		51496603	NM_001004127	A5PLP3|B4DKW9|Q5TAN9|Q6DKI6|Q96FI7	Missense_Mutation	SNP	ENST00000521508.1	37	CCDS31977.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.593198	0.28357	.	.	ENSG00000253710	ENST00000521508	T	0.79940	-1.32	6.03	3.26	0.37387	.	0.324668	0.29073	U	0.013231	T	0.74291	0.3697	M	0.72894	2.215	0.37354	D	0.910937	P	0.44986	0.847	B	0.40864	0.342	T	0.75119	-0.3430	10	0.38643	T	0.18	.	3.9231	0.09251	0.1762:0.525:0.0:0.2988	.	246	Q2TAA5	ALG11_HUMAN	I	246	ENSP00000430236:L246I	ENSP00000430236:L246I	L	+	1	0	ALG11	51496603	0.025000	0.19082	0.989000	0.46669	0.993000	0.82548	0.274000	0.18680	1.568000	0.49683	0.557000	0.71058	CTT		0.338	ALG11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045050.1	NM_001004127	
PCDH17	27253	hgsc.bcm.edu	37	13	58208004	58208004	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:58208004A>G	ENST00000377918.3	+	1	1350	c.1324A>G	c.(1324-1326)Atc>Gtc	p.I442V		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	442	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I442V(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CAACGTGACCATCGTGGCGCG	0.587																																					p.I442V	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1324G	13						.						52.0	39.0	43.0					13																	58208004		2202	4299	6501	57106005	SO:0001583	missense	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1324A>G	13.37:g.58208004A>G	ENSP00000367151:p.Ile442Val		57106005	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	A	7.621	0.676828	0.14841	.	.	ENSG00000118946	ENST00000377918	T	0.14640	2.49	5.7	5.7	0.88788	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.23451	0.0567	L	0.27944	0.81	0.46011	D	0.998814	D;D	0.64830	0.985;0.994	P;D	0.65323	0.891;0.934	T	0.02132	-1.1208	9	.	.	.	.	15.9762	0.80066	1.0:0.0:0.0:0.0	.	442;442	O14917-2;O14917	.;PCD17_HUMAN	V	442	ENSP00000367151:I442V	.	I	+	1	0	PCDH17	57106005	1.000000	0.71417	0.388000	0.26195	0.064000	0.16182	7.306000	0.78905	2.184000	0.69523	0.528000	0.53228	ATC		0.587	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
PCDH17	27253	hgsc.bcm.edu	37	13	58208073	58208073	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:58208073G>A	ENST00000377918.3	+	1	1419	c.1393G>A	c.(1393-1395)Gag>Aag	p.E465K		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	465	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E465K(2)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GATTCTAGACGAGAACGACAA	0.602																																					p.E465K	Melanoma(72;952 1291 1619 12849 33676)											.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.G1393A	13						.						50.0	43.0	45.0					13																	58208073		2203	4300	6503	57106074	SO:0001583	missense	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1393G>A	13.37:g.58208073G>A	ENSP00000367151:p.Glu465Lys		57106074	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491592	0.84962	.	.	ENSG00000118946	ENST00000377918	T	0.61274	0.12	5.58	5.58	0.84498	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.63295	0.2499	N	0.21448	0.665	0.80722	D	1	D;D	0.69078	0.997;0.994	D;P	0.63597	0.916;0.777	T	0.60301	-0.7290	9	.	.	.	.	19.5671	0.95398	0.0:0.0:1.0:0.0	.	465;465	O14917-2;O14917	.;PCD17_HUMAN	K	465	ENSP00000367151:E465K	.	E	+	1	0	PCDH17	57106074	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.869000	0.99810	2.640000	0.89533	0.561000	0.74099	GAG		0.602	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
MYO16	23026	hgsc.bcm.edu	37	13	109777545	109777545	+	Silent	SNP	G	G	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:109777545G>T	ENST00000357550.2	+	29	3596	c.3555G>T	c.(3553-3555)ctG>ctT	p.L1185L	MYO16_ENST00000356711.2_Silent_p.L1185L|MYO16_ENST00000457511.2_Silent_p.L697L	NM_001198950.1	NP_001185879.1			myosin XVI									p.L1185L(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ATAGCTTTCTGCAGAACACAG	0.453																																					p.L1207L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3621T	13						.						72.0	69.0	70.0					13																	109777545		2203	4300	6503	108575546	SO:0001819	synonymous_variant	23026	exon30				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3555G>T	13.37:g.109777545G>T			108575546	NM_001198950		Silent	SNP	ENST00000357550.2	37	CCDS32008.1																																																																																				0.453	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
ATP11A	23250	hgsc.bcm.edu	37	13	113460573	113460575	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	TCT	TCT	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr13:113460573_113460575delTCT	ENST00000487903.1	+	4	387_389	c.299_301delTCT	c.(298-303)ctcttc>ctc	p.F102del	ATP11A_ENST00000375645.3_In_Frame_Del_p.F102del|ATP11A_ENST00000283558.8_In_Frame_Del_p.F102del|ATP11A_ENST00000375630.2_In_Frame_Del_p.F102del			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	102					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.F102delF(2)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				GGACTTCCACTCTTCTTTGTCAT	0.384																																					p.100_101del												.	.	2	Deletion - In frame(2)	large_intestine(2)	c.299_301del	13						.																																			112508576	SO:0001651	inframe_deletion	23250	exon4			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.299_301delTCT	13.37:g.113460576_113460578delTCT	ENSP00000420387:p.Phe102del		112508574	NM_015205	Q5VXT2	In_Frame_Del	DEL	ENST00000487903.1	37	CCDS32011.1																																																																																				0.384	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	
CHUK	1147	hgsc.bcm.edu	37	10	101950630	101950630	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:101950630A>G	ENST00000370397.7	-	20	2290	c.2204T>C	c.(2203-2205)aTg>aCg	p.M735T	RP11-316M21.7_ENST00000443919.1_RNA|ERLIN1_ENST00000421367.2_5'Flank|CHUK_ENST00000590930.1_5'UTR	NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	735					anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)	p.M735T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	ACTTACCATCATACTATTGCC	0.418																																					p.M735T	Ovarian(159;52 1904 10536 35305 37148)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2204C	10						.						245.0	210.0	222.0					10																	101950630		2203	4300	6503	101940620	SO:0001583	missense	1147	exon20			AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.2204T>C	10.37:g.101950630A>G	ENSP00000359424:p.Met735Thr		101940620	NM_001278	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	ENST00000370397.7	37	CCDS7488.1	.	.	.	.	.	.	.	.	.	.	A	9.558	1.117693	0.20877	.	.	ENSG00000213341	ENST00000370397	T	0.22336	1.96	5.63	5.63	0.86233	I-kappa-kinase-beta NEMO binding domain (1);	0.339156	0.35436	N	0.003213	T	0.15869	0.0382	N	0.22421	0.69	0.30901	N	0.72929	B	0.25007	0.116	B	0.26693	0.072	T	0.08371	-1.0725	10	0.44086	T	0.13	-6.8515	12.2618	0.54655	1.0:0.0:0.0:0.0	.	735	O15111	IKKA_HUMAN	T	735	ENSP00000359424:M735T	ENSP00000359424:M735T	M	-	2	0	CHUK	101940620	1.000000	0.71417	0.927000	0.36925	0.089000	0.18198	6.879000	0.75572	2.145000	0.66743	0.533000	0.62120	ATG		0.418	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278	
PPRC1	23082	hgsc.bcm.edu	37	10	103908988	103908988	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:103908988T>C	ENST00000278070.2	+	13	4832	c.4793T>C	c.(4792-4794)aTt>aCt	p.I1598T	PPRC1_ENST00000413464.2_Missense_Mutation_p.I1334T|NOLC1_ENST00000605788.1_5'Flank|NOLC1_ENST00000405356.1_5'Flank|PPRC1_ENST00000370012.1_Missense_Mutation_p.I565T	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1598	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.I1598T(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TTTGCAGCCATTGAGAGTGGC	0.562																																					p.I1598T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4793C	10						.						100.0	95.0	97.0					10																	103908988		2203	4300	6503	103898978	SO:0001583	missense	23082	exon13			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.4793T>C	10.37:g.103908988T>C	ENSP00000278070:p.Ile1598Thr		103898978	NM_015062	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	37	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	t	23.5	4.422987	0.83559	.	.	ENSG00000148840	ENST00000278070;ENST00000413464;ENST00000370012	T;T;T	0.52754	0.65;0.65;0.65	5.49	5.49	0.81192	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.71517	0.3349	M	0.82630	2.6	0.54753	D	0.999984	D;D;D	0.89917	1.0;1.0;0.989	D;D;D	0.91635	0.999;0.999;0.977	T	0.76735	-0.2850	10	0.87932	D	0	.	15.5897	0.76517	0.0:0.0:0.0:1.0	.	1334;1476;1598	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	T	1598;1334;565	ENSP00000278070:I1598T;ENSP00000399743:I1334T;ENSP00000359029:I565T	ENSP00000278070:I1598T	I	+	2	0	PPRC1	103898978	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	8.032000	0.88838	2.081000	0.62600	0.363000	0.22086	ATT		0.562	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
NOLC1	9221	hgsc.bcm.edu	37	10	103919019	103919019	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:103919019G>A	ENST00000605788.1	+	6	912	c.677G>A	c.(676-678)aGc>aAc	p.S226N	NOLC1_ENST00000603742.1_5'UTR|NOLC1_ENST00000405356.1_Missense_Mutation_p.S226N|NOLC1_ENST00000488254.2_Missense_Mutation_p.S227N	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	226	11 X 12 AA approximate repeats of an acidic serine cluster.|Interacts with RPA194.				cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)	p.S226N(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		agcagcagtagcagTGATGAC	0.522																																					p.S226N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G677A	10						.						111.0	114.0	113.0					10																	103919019		2203	4300	6503	103909009	SO:0001583	missense	9221	exon6			Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.677G>A	10.37:g.103919019G>A	ENSP00000474710:p.Ser226Asn		103909009	NM_004741	Q15030|Q5VV70|Q9BUV3	Missense_Mutation	SNP	ENST00000605788.1	37	CCDS7530.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584890	0.46110	.	.	ENSG00000166197	ENST00000405356;ENST00000370007	T	0.40225	1.04	5.39	5.39	0.77823	.	0.152833	0.48767	D	0.000169	T	0.49304	0.1549	M	0.85197	2.74	0.46701	D	0.999168	P;P;P	0.45474	0.859;0.859;0.779	B;B;B	0.43155	0.41;0.41;0.232	T	0.55933	-0.8062	10	0.46703	T	0.11	-0.362	10.2565	0.43401	0.09:0.0:0.91:0.0	.	227;226;226	Q14978-3;Q14978-2;Q14978	.;.;NOLC1_HUMAN	N	226	ENSP00000385410:S226N	ENSP00000359024:S226N	S	+	2	0	NOLC1	103909009	1.000000	0.71417	0.968000	0.41197	0.527000	0.34593	5.763000	0.68818	2.506000	0.84524	0.655000	0.94253	AGC		0.522	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050012.2	NM_004741	
CNNM2	54805	hgsc.bcm.edu	37	10	104687137	104687137	+	Intron	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:104687137T>C	ENST00000369878.4	+	1	1809				CNNM2_ENST00000369875.3_Nonstop_Mutation_p.*553R|CNNM2_ENST00000433628.2_Intron	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2						magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)	p.*553R(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		ATACCAACACTGAAAAGAAGA	0.363																																					p.X553R												.	.	1	Nonstop extension(1)	large_intestine(1)	c.T1657C	10						.						155.0	147.0	150.0					10																	104687137		2203	4300	6503	104677127	SO:0001627	intron_variant	54805	exon2			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1621+7279T>C	10.37:g.104687137T>C			104677127	NM_199077	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	ENST00000369878.4	37	CCDS44474.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.56|11.56	1.674441|1.674441	0.29693|0.29693	.|.	.|.	ENSG00000148842|ENSG00000148842	ENST00000541201|ENST00000369875	.|.	.|.	.|.	2.7|2.7	1.52|1.52	0.23074|0.23074	.|.	.|.	.|.	.|.	.|.	T|.	0.25344|.	0.0616|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.22626|.	-1.0211|.	4|.	.|.	.|.	.|.	.|.	4.9888|4.9888	0.14203|0.14203	0.2674:0.0:0.0:0.7326|0.2674:0.0:0.0:0.7326	.|.	.|.	.|.	.|.	R|R	553|553	.|.	.|.	C|X	+|+	1|1	0|0	CNNM2|CNNM2	104677127|104677127	0.001000|0.001000	0.12720|0.12720	0.005000|0.005000	0.12908|0.12908	0.664000|0.664000	0.39144|0.39144	0.279000|0.279000	0.18771|0.18771	0.430000|0.430000	0.26230|0.26230	0.459000|0.459000	0.35465|0.35465	TGC|TGA		0.363	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649	
ITPRIP	85450	hgsc.bcm.edu	37	10	106074864	106074864	+	Missense_Mutation	SNP	C	C	T	rs144093219		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:106074864C>T	ENST00000337478.1	-	2	1117	c.946G>A	c.(946-948)Gcc>Acc	p.A316T	ITPRIP_ENST00000278071.2_Missense_Mutation_p.A316T|RP11-127L20.5_ENST00000472915.2_RNA|ITPRIP_ENST00000358187.2_Missense_Mutation_p.A316T	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	316						membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A316T(1)		breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						TACTTGTGGGCGATGCCCTTC	0.577																																					p.A316T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G946A	10						.	C	THR/ALA	0,4406		0,0,2203	82.0	81.0	81.0		946	1.8	1.0	10	dbSNP_134	81	1,8599	1.2+/-3.3	0,1,4299	no	missense	ITPRIP	NM_033397.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	316/548	106074864	1,13005	2203	4300	6503	106064854	SO:0001583	missense	85450	exon3			AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.946G>A	10.37:g.106074864C>T	ENSP00000337178:p.Ala316Thr		106064854	NM_033397	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	ENST00000337478.1	37	CCDS7557.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285208	0.40394	0.0	1.16E-4	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187	T;T;T	0.23552	1.9;1.9;1.9	5.22	1.77	0.24775	.	0.178998	0.51477	D	0.000099	T	0.16854	0.0405	L	0.46157	1.445	0.29851	N	0.828433	P	0.37176	0.586	B	0.28784	0.094	T	0.11060	-1.0603	10	0.48119	T	0.1	-7.4233	7.5041	0.27534	0.5194:0.3946:0.0:0.086	.	316	Q8IWB1	IPRI_HUMAN	T	316	ENSP00000337178:A316T;ENSP00000278071:A316T;ENSP00000350915:A316T	ENSP00000278071:A316T	A	-	1	0	ITPRIP	106064854	0.993000	0.37304	0.996000	0.52242	0.670000	0.39368	2.987000	0.49378	0.666000	0.31087	0.563000	0.77884	GCC		0.577	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050204.1	NM_033397	
SORCS3	22986	hgsc.bcm.edu	37	10	106976803	106976803	+	Missense_Mutation	SNP	C	C	T	rs145906256		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:106976803C>T	ENST00000369701.3	+	19	2884	c.2657C>T	c.(2656-2658)gCg>gTg	p.A886V	SORCS3_ENST00000369699.4_Missense_Mutation_p.A172V	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	886	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.A886V(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TATAAGAGTGCGGGGATCTTC	0.532																																					p.A886V	NSCLC(116;1497 1690 7108 13108 14106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2657T	10						.	C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	183.0	142.0	156.0		2657	5.9	1.0	10	dbSNP_134	156	0,8600		0,0,4300	no	missense	SORCS3	NM_014978.1	64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	886/1223	106976803	1,13005	2203	4300	6503	106966793	SO:0001583	missense	22986	exon19			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2657C>T	10.37:g.106976803C>T	ENSP00000358715:p.Ala886Val		106966793	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	C	9.570	1.120860	0.20877	2.27E-4	0.0	ENSG00000156395	ENST00000369701;ENST00000369699	T;T	0.64438	-0.1;-0.1	5.87	5.87	0.94306	PKD domain (4);	0.113257	0.64402	D	0.000010	T	0.40498	0.1119	N	0.02721	-0.515	0.51482	D	0.999927	B	0.22080	0.064	B	0.19148	0.024	T	0.35325	-0.9793	9	.	.	.	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	886	Q9UPU3	SORC3_HUMAN	V	886;172	ENSP00000358715:A886V;ENSP00000358713:A172V	.	A	+	2	0	SORCS3	106966793	0.997000	0.39634	0.961000	0.40146	0.907000	0.53573	3.749000	0.55150	2.941000	0.99782	0.655000	0.94253	GCG		0.532	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
TACC2	10579	hgsc.bcm.edu	37	10	123970983	123970983	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:123970983A>G	ENST00000369005.1	+	9	7383	c.7043A>G	c.(7042-7044)aAc>aGc	p.N2348S	TACC2_ENST00000369000.1_Missense_Mutation_p.N52S|TACC2_ENST00000334433.3_Missense_Mutation_p.N2348S|TACC2_ENST00000368999.1_Missense_Mutation_p.N426S|TACC2_ENST00000369001.1_Missense_Mutation_p.N52S|TACC2_ENST00000360561.3_Missense_Mutation_p.N426S|TACC2_ENST00000260733.3_Missense_Mutation_p.N426S|TACC2_ENST00000369004.3_Missense_Mutation_p.N426S|TACC2_ENST00000513429.1_Missense_Mutation_p.N494S|TACC2_ENST00000515603.1_Missense_Mutation_p.N2303S|TACC2_ENST00000358010.1_Missense_Mutation_p.N494S|TACC2_ENST00000515273.1_Missense_Mutation_p.N2352S|TACC2_ENST00000453444.2_Missense_Mutation_p.N2352S	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2348	SPAZ.				astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.N2348S(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CCCAATTTTAACCCTTTTTCT	0.478																																					p.N426S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1277G	10						.						185.0	199.0	194.0					10																	123970983		2203	4300	6503	123960973	SO:0001583	missense	10579	exon3			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.7043A>G	10.37:g.123970983A>G	ENSP00000358001:p.Asn2348Ser		123960973	NM_006997	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680839	0.68042	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000369001;ENST00000369000;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539;ENST00000496913	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.38560	3.1;2.66;3.22;3.17;3.1;2.66;3.22;1.15;1.13;2.5;2.53;2.5;2.51;2.33;1.49	4.74	4.74	0.60224	.	0.000000	0.40385	N	0.001110	T	0.59487	0.2197	M	0.61703	1.905	0.58432	D	0.99999	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.997;0.998;0.999;0.997;0.999;0.999;0.998;0.999;0.999	D;D;D;D;D;D;D;D;D;D	0.87578	0.998;0.993;0.986;0.996;0.993;0.997;0.997;0.997;0.997;0.997	T	0.56226	-0.8014	10	0.24483	T	0.36	-21.1351	14.5623	0.68148	1.0:0.0:0.0:0.0	.	443;2352;426;2303;2352;426;426;52;494;2348	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-2;O95359-5;O95359	.;.;.;.;.;.;.;.;.;TACC2_HUMAN	S	2348;494;2352;2303;2348;494;2352;2338;52;52;426;426;426;426;443;87	ENSP00000358001:N2348S;ENSP00000425062:N494S;ENSP00000424467:N2352S;ENSP00000427618:N2303S;ENSP00000334280:N2348S;ENSP00000350701:N494S;ENSP00000395048:N2352S;ENSP00000357997:N52S;ENSP00000357996:N52S;ENSP00000353763:N426S;ENSP00000357995:N426S;ENSP00000422815:N426S;ENSP00000260733:N426S;ENSP00000420967:N443S;ENSP00000422725:N87S	ENSP00000260733:N426S	N	+	2	0	TACC2	123960973	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.150000	0.94667	1.911000	0.55334	0.454000	0.30748	AAC		0.478	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
BCCIP	56647	hgsc.bcm.edu	37	10	127522353	127522353	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:127522353G>A	ENST00000278100.6	+	6	624	c.612G>A	c.(610-612)gcG>gcA	p.A204A	BCCIP_ENST00000368759.5_Silent_p.A204A|BCCIP_ENST00000299130.3_Silent_p.A204A|BCCIP_ENST00000429863.2_Silent_p.A174A	NM_078468.2	NP_510868.1	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A interacting protein	204	Interaction with CDKN1A.				cell cycle (GO:0007049)|DNA repair (GO:0006281)|neuroendocrine cell differentiation (GO:0061101)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nucleus (GO:0005634)	kinase regulator activity (GO:0019207)|poly(A) RNA binding (GO:0044822)	p.A204A(1)		breast(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)	8		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				AAGAACTGGCGGGGGCACACA	0.443																																					p.A204A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G612A	10						.						95.0	98.0	97.0					10																	127522353		2203	4300	6503	127512343	SO:0001819	synonymous_variant	56647	exon6			AB040451	CCDS7649.1, CCDS7650.1, CCDS7651.1	10q26.2	2008-05-14	2001-11-29		ENSG00000107949	ENSG00000107949			978	protein-coding gene	gene with protein product		611883	"""BRCA2 and CDKN1A-interacting protein"""			11313963, 10878006	Standard	NM_016567		Approved	BCCIPalpha, TOK-1	uc001ljd.4	Q9P287	OTTHUMG00000019237	ENST00000278100.6:c.612G>A	10.37:g.127522353G>A			127512343	NM_016567	B3KP45|Q8ND15|Q96GC4|Q9P288	Silent	SNP	ENST00000278100.6	37	CCDS7651.1																																																																																				0.443	BCCIP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050941.1		
FAM171A1	221061	hgsc.bcm.edu	37	10	15263017	15263017	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:15263017C>T	ENST00000378116.4	-	6	803	c.797G>A	c.(796-798)gGc>gAc	p.G266D	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	266						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.G266D(1)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CAGCTGGCTGCCTTCCTGGTG	0.567																																					p.G266D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G797A	10						.						100.0	86.0	91.0					10																	15263017		2203	4300	6503	15303023	SO:0001583	missense	221061	exon6			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.797G>A	10.37:g.15263017C>T	ENSP00000367356:p.Gly266Asp		15303023	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501589	0.85176	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.40756	1.02	5.66	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.59514	0.2199	L	0.55834	1.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61048	-0.7141	10	0.52906	T	0.07	-35.1448	14.6635	0.68891	0.0:0.9301:0.0:0.0699	.	266	Q5VUB5	F1711_HUMAN	D	266;267	ENSP00000367356:G266D	ENSP00000367356:G266D	G	-	2	0	FAM171A1	15303023	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.662000	0.61525	1.386000	0.46466	0.563000	0.77884	GGC		0.567	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
GAD2	2572	hgsc.bcm.edu	37	10	26581910	26581910	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:26581910G>A	ENST00000376261.3	+	15	2077	c.1574G>A	c.(1573-1575)cGc>cAc	p.R525H	GAD2_ENST00000259271.3_Missense_Mutation_p.R525H	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	525					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)	p.R525H(1)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						AGAATGAGTCGCCTCTCGAAG	0.463																																					p.R525H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1574A	10						.						169.0	164.0	166.0					10																	26581910		2203	4300	6503	26621916	SO:0001583	missense	2572	exon15			AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.1574G>A	10.37:g.26581910G>A	ENSP00000365437:p.Arg525His		26621916	NM_001134366	Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	37	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.145717	0.57044	.	.	ENSG00000136750	ENST00000376261;ENST00000259271	T;T	0.09445	2.98;2.98	5.22	5.22	0.72569	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.052856	0.85682	D	0.000000	T	0.20129	0.0484	M	0.81802	2.56	0.80722	D	1	B	0.18166	0.026	B	0.06405	0.002	T	0.03296	-1.1051	10	0.62326	D	0.03	-14.9734	18.7903	0.91971	0.0:0.0:1.0:0.0	.	525	Q05329	DCE2_HUMAN	H	525	ENSP00000365437:R525H;ENSP00000259271:R525H	ENSP00000259271:R525H	R	+	2	0	GAD2	26621916	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.401000	0.59716	2.430000	0.82344	0.655000	0.94253	CGC		0.463	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
BMS1	9790	hgsc.bcm.edu	37	10	43288002	43288002	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:43288002T>C	ENST00000374518.5	+	7	904	c.841T>C	c.(841-843)Tca>Cca	p.S281P		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	281					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.S281P(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CCGGAAGGTGTCACTTTATGG	0.363																																					p.S281P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T841C	10						.						103.0	107.0	106.0					10																	43288002		2203	4300	6503	42608008	SO:0001583	missense	9790	exon7			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.841T>C	10.37:g.43288002T>C	ENSP00000363642:p.Ser281Pro		42608008	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	t	21.1	4.101903	0.76983	.	.	ENSG00000165733	ENST00000374518	T	0.44083	0.93	5.48	5.48	0.80851	AARP2CN (2);	0.051454	0.85682	D	0.000000	T	0.59972	0.2233	M	0.72894	2.215	0.46798	D	0.999201	D	0.76494	0.999	D	0.75484	0.986	T	0.58819	-0.7569	10	0.31617	T	0.26	.	10.8738	0.46899	0.1405:0.0:0.0:0.8595	.	281	Q14692	BMS1_HUMAN	P	281	ENSP00000363642:S281P	ENSP00000363642:S281P	S	+	1	0	BMS1	42608008	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.601000	0.67606	2.112000	0.64535	0.467000	0.42956	TCA		0.363	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
PRKG1	5592	hgsc.bcm.edu	37	10	54048544	54048544	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:54048544G>A	ENST00000401604.2	+	15	1917	c.1723G>A	c.(1723-1725)Gac>Aac	p.D575N	PRKG1_ENST00000373985.1_Missense_Mutation_p.D563N|PRKG1-AS1_ENST00000452247.2_RNA|PRKG1-AS1_ENST00000426785.2_RNA|PRKG1_ENST00000373975.2_Missense_Mutation_p.D293N|PRKG1_ENST00000373980.4_Missense_Mutation_p.D590N			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	575	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)	p.D590N(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		GAGGGGGATTGACATGATAGA	0.338																																					p.D590N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1768A	10						.						96.0	98.0	97.0					10																	54048544		2203	4300	6503	53718550	SO:0001583	missense	5592	exon15				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.1723G>A	10.37:g.54048544G>A	ENSP00000384200:p.Asp575Asn		53718550	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation	SNP	ENST00000401604.2	37	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	G	35	5.417616	0.96092	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000332193;ENST00000373975	T;T;T	0.64438	-0.1;-0.1;-0.1	5.26	5.26	0.73747	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65238	0.2672	L	0.31926	0.97	0.80722	D	1	B;D;P	0.54047	0.224;0.964;0.932	B;P;P	0.52758	0.236;0.657;0.708	T	0.68610	-0.5363	10	0.62326	D	0.03	-7.2551	18.4561	0.90721	0.0:0.0:1.0:0.0	.	293;590;575	B3KSF3;Q13976-2;Q13976	.;.;KGP1_HUMAN	N	575;563;590;293;187	ENSP00000384200:D575N;ENSP00000363097:D563N;ENSP00000363092:D590N	ENSP00000327642:D293N	D	+	1	0	PRKG1	53718550	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.444000	0.82710	0.655000	0.94253	GAC		0.338	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ZNF365	22891	hgsc.bcm.edu	37	10	64159424	64159424	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:64159424C>T	ENST00000395254.3	+	5	1380	c.1100C>T	c.(1099-1101)gCt>gTt	p.A367V	ZNF365_ENST00000395255.3_Intron|ZNF365_ENST00000410046.3_Intron|ZNF365_ENST00000466727.1_3'UTR	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0								p.A367V(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					CACGAACAGGCTGAGTCCTCA	0.537																																					p.A367V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1100T	10						.						116.0	113.0	114.0					10																	64159424		2203	4300	6503	63829430	SO:0001583	missense	22891	exon5			AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.1100C>T	10.37:g.64159424C>T	ENSP00000378674:p.Ala367Val		63829430	NM_014951		Missense_Mutation	SNP	ENST00000395254.3	37	CCDS31209.1	.	.	.	.	.	.	.	.	.	.	C	12.25	1.883084	0.33255	.	.	ENSG00000138311	ENST00000395254	T	0.50001	0.76	5.76	4.86	0.63082	.	.	.	.	.	T	0.36193	0.0958	L	0.41236	1.265	0.22468	N	0.999076	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.20840	-1.0263	9	0.22109	T	0.4	.	7.9907	0.30239	0.0:0.7847:0.0:0.2153	.	367;382	Q70YC5;Q70YC5-4	ZN365_HUMAN;.	V	367	ENSP00000378674:A367V	ENSP00000378674:A367V	A	+	2	0	ZNF365	63829430	0.873000	0.30073	0.176000	0.23000	0.744000	0.42396	1.986000	0.40677	1.444000	0.47605	0.650000	0.86243	GCT		0.537	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048238.2	NM_014951	
PBLD	64081	hgsc.bcm.edu	37	10	70043970	70043970	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:70043970A>G	ENST00000358769.2	-	10	1033	c.831T>C	c.(829-831)ggT>ggC	p.G277G	PBLD_ENST00000336578.1_Silent_p.G244G|PBLD_ENST00000309049.4_Silent_p.G277G	NM_022129.3	NP_071412.2	P30039	PBLD_HUMAN	phenazine biosynthesis-like protein domain containing	277					biosynthetic process (GO:0009058)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein import into nucleus (GO:0060392)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	isomerase activity (GO:0016853)	p.G277G(1)		endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	21						CAACAGCTGCACCTCCTCTAA	0.463																																					p.G277G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T831C	10						.						210.0	176.0	187.0					10																	70043970		2203	4300	6503	69713976	SO:0001819	synonymous_variant	64081	exon10			AK027673	CCDS7277.2, CCDS44413.1	10q21.3	2006-11-27			ENSG00000108187	ENSG00000108187			23301	protein-coding gene	gene with protein product	MAWD binding protein	612189				11355021	Standard	XM_005270028		Approved	MAWBP, MAWDBP, FLJ14767	uc001jns.1	P30039	OTTHUMG00000073949	ENST00000358769.2:c.831T>C	10.37:g.70043970A>G			69713976	NM_022129	A8MZJ3|C9JIM0|Q9HCC2	Silent	SNP	ENST00000358769.2	37	CCDS7277.2																																																																																				0.463	PBLD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048314.1	NM_022129	
CDHR1	92211	hgsc.bcm.edu	37	10	85957550	85957550	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:85957550T>C	ENST00000372117.3	+	4	409	c.306T>C	c.(304-306)gaT>gaC	p.D102D	CDHR1_ENST00000332904.3_Silent_p.D102D	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	102	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)	p.D102D(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						AGAGGGAAGATGAGATTGAAG	0.577																																					p.D102D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T306C	10						.						150.0	109.0	122.0					10																	85957550		2203	4300	6503	85947530	SO:0001819	synonymous_variant	92211	exon4			AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.306T>C	10.37:g.85957550T>C			85947530	NM_001171971	Q69YZ8|Q8IXY5	Silent	SNP	ENST00000372117.3	37	CCDS7372.1																																																																																				0.577	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
NOC3L	64318	hgsc.bcm.edu	37	10	96112685	96112685	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:96112685G>A	ENST00000371361.3	-	7	926	c.826C>T	c.(826-828)Cgg>Tgg	p.R276W	NOC3L_ENST00000463649.1_5'UTR|NOC3L_ENST00000371350.1_Missense_Mutation_p.R276W|NOC3L_ENST00000543788.1_Missense_Mutation_p.R14W	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	276					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.R276W(1)		endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				GTGAGGGGCCGGATTTTATAT	0.338																																					p.R276W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C826T	10						.						82.0	87.0	85.0					10																	96112685		2203	4300	6503	96102675	SO:0001583	missense	64318	exon7			AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.826C>T	10.37:g.96112685G>A	ENSP00000360412:p.Arg276Trp		96102675	NM_022451	Q9H5M6|Q9H9D8	Missense_Mutation	SNP	ENST00000371361.3	37	CCDS7433.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341056	0.60963	.	.	ENSG00000173145	ENST00000543788;ENST00000371361;ENST00000371350	T;T;T	0.25579	1.79;2.0;2.0	5.08	3.2	0.36748	Nucleolar complex-associated (1);	0.000000	0.85682	D	0.000000	T	0.56543	0.1992	M	0.93978	3.48	0.51482	D	0.999922	D	0.89917	1.0	D	0.97110	1.0	T	0.59658	-0.7413	10	0.66056	D	0.02	-9.4501	8.25	0.31712	0.0736:0.0:0.6479:0.2785	.	276	Q8WTT2	NOC3L_HUMAN	W	14;276;276	ENSP00000437838:R14W;ENSP00000360412:R276W;ENSP00000360401:R276W	ENSP00000360401:R276W	R	-	1	2	NOC3L	96102675	1.000000	0.71417	0.414000	0.26521	0.838000	0.47535	3.676000	0.54612	0.519000	0.28406	-0.225000	0.12378	CGG		0.338	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451	
NOC3L	64318	hgsc.bcm.edu	37	10	96116944	96116944	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:96116944A>G	ENST00000371361.3	-	4	595	c.495T>C	c.(493-495)acT>acC	p.T165T	NOC3L_ENST00000463649.1_5'UTR|NOC3L_ENST00000371350.1_Silent_p.T165T	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	165					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.T165T(1)		endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				GCTTCTCCCTAGTCTGTGGGA	0.323																																					p.T165T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T495C	10						.						135.0	131.0	132.0					10																	96116944		2203	4300	6503	96106934	SO:0001819	synonymous_variant	64318	exon4			AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.495T>C	10.37:g.96116944A>G			96106934	NM_022451	Q9H5M6|Q9H9D8	Silent	SNP	ENST00000371361.3	37	CCDS7433.1																																																																																				0.323	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049466.1	NM_022451	
HELLS	3070	hgsc.bcm.edu	37	10	96350506	96350506	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:96350506T>C	ENST00000348459.5	+	15	1845	c.1740T>C	c.(1738-1740)ccT>ccC	p.P580P	HELLS_ENST00000371332.4_Silent_p.P626P|HELLS_ENST00000394036.1_3'UTR|HELLS_ENST00000239026.6_3'UTR|HELLS_ENST00000394045.1_Silent_p.P482P|RP11-119K6.6_ENST00000432120.1_RNA	NM_018063.3	NP_060533.2			helicase, lymphoid-specific									p.P580P(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		TTGAATATCCTATAGACCCTG	0.294																																					p.P580P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1740C	10						.						104.0	96.0	99.0					10																	96350506		2203	4298	6501	96340496	SO:0001819	synonymous_variant	3070	exon15			AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.1740T>C	10.37:g.96350506T>C			96340496	NM_018063		Silent	SNP	ENST00000348459.5	37	CCDS7434.1																																																																																				0.294	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049475.1	NM_018063	
MKI67	4288	hgsc.bcm.edu	37	10	129913692	129913692	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr10:129913692T>C	ENST00000368654.3	-	7	1355	c.980A>G	c.(979-981)cAg>cGg	p.Q327R	MKI67_ENST00000484853.1_5'Flank|MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	327					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.Q327R(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GCTGGGAGTCTGAACAGACTC	0.522																																					p.Q327R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A980G	10						.						72.0	78.0	76.0					10																	129913692		2203	4300	6503	129803682	SO:0001583	missense	4288	exon7			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.980A>G	10.37:g.129913692T>C	ENSP00000357643:p.Gln327Arg		129803682	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	11.07	1.531618	0.27387	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.01369	4.97	3.39	0.928	0.19443	.	2.238060	0.01990	N	0.045442	T	0.02767	0.0083	L	0.29908	0.895	0.09310	N	1	D	0.59357	0.985	P	0.50270	0.636	T	0.44937	-0.9295	10	0.87932	D	0	.	7.7668	0.28984	0.0:0.0:0.488:0.512	.	327	P46013	KI67_HUMAN	R	327	ENSP00000357643:Q327R	ENSP00000357643:Q327R	Q	-	2	0	MKI67	129803682	0.005000	0.15991	0.001000	0.08648	0.003000	0.03518	0.538000	0.23160	0.185000	0.20105	-0.331000	0.08364	CAG		0.522	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
APC	324	hgsc.bcm.edu	37	5	112175303	112175303	+	Nonsense_Mutation	SNP	C	C	T	rs121913327		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:112175303C>T	ENST00000457016.1	+	16	4392	c.4012C>T	c.(4012-4014)Cag>Tag	p.Q1338*	APC_ENST00000508376.2_Nonsense_Mutation_p.Q1338*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1338*			P25054	APC_HUMAN	adenomatous polyposis coli	1338	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1338*(30)|p.L1337fs*76(4)|p.?(1)|p.K1192fs*3(1)|p.V1326fs*3(1)|p.S1335fs*70(1)|p.L1337>?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CAGCAGACTGCAGGGTTCTAG	0.458	Q1338*(SW480_LARGE_INTESTINE)|Q1338*(SW620_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1320X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	39	Substitution - Nonsense(30)|Deletion - Frameshift(7)|Unknown(1)|Complex(1)	large_intestine(34)|thyroid(1)|biliary_tract(1)|stomach(1)|soft_tissue(1)|skin(1)	c.C3958T	5	GRCh37	CM930029	APC	M	rs121913327	.						57.0	60.0	59.0					5																	112175303		2202	4300	6502	112203202	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4012C>T	5.37:g.112175303C>T	ENSP00000413133:p.Gln1338*		112203202	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	39	7.909540	0.98557	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.03	6.03	0.97812	.	0.226724	0.46145	D	0.000316	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.6325	20.1672	0.98154	0.0:1.0:0.0:0.0	.	.	.	.	X	1338	.	.	Q	+	1	0	APC	112203202	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	4.607000	0.61133	2.861000	0.98227	0.655000	0.94253	CAG		0.458	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DCP2	167227	hgsc.bcm.edu	37	5	112343733	112343733	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:112343733T>C	ENST00000389063.2	+	9	1239	c.1041T>C	c.(1039-1041)tcT>tcC	p.S347S	DCP2_ENST00000515408.1_Intron|DCP2_ENST00000543319.1_Silent_p.S136S	NM_152624.5	NP_689837	Q8IU60	DCP2_HUMAN	decapping mRNA 2	347					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)|RISC complex (GO:0016442)	exoribonuclease activity, producing 5'-phosphomonoesters (GO:0016896)|m7G(5')pppN diphosphatase activity (GO:0050072)|manganese ion binding (GO:0030145)|RNA binding (GO:0003723)	p.S347S(1)		endometrium(3)|large_intestine(6)|lung(1)	10		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		AGCAGAATTCTTTGATGGTAA	0.398																																					p.S347S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1041C	5						.						91.0	89.0	90.0					5																	112343733		2202	4300	6502	112371632	SO:0001819	synonymous_variant	167227	exon9			AY135173	CCDS34210.1, CCDS56377.1	5q22	2013-05-02	2013-05-02		ENSG00000172795	ENSG00000172795	3.6.1.62	"""Nudix motif containing"""	24452	protein-coding gene	gene with protein product	"""nudix (nucleoside diphosphate linked moiety X)-type motif 20"", ""M(7)GpppN-mRNA hydrolase"""	609844	"""DCP2 decapping enzyme homolog (S. cerevisiae)"""			12218187, 12417715	Standard	NM_152624		Approved	NUDT20	uc003kqh.3	Q8IU60	OTTHUMG00000162853	ENST00000389063.2:c.1041T>C	5.37:g.112343733T>C			112371632	NM_152624	C9J778|Q6P2D4|Q7Z5W5|Q8NBG5	Silent	SNP	ENST00000389063.2	37	CCDS34210.1	.	.	.	.	.	.	.	.	.	.	T	7.801	0.713645	0.15306	.	.	ENSG00000172795	ENST00000513585	.	.	.	5.61	1.45	0.22620	.	.	.	.	.	T	0.25457	0.0619	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23511	-1.0186	4	.	.	.	.	5.1588	0.15050	0.0:0.449:0.2598:0.2912	.	.	.	.	L	329	.	.	F	+	1	0	DCP2	112371632	0.000000	0.05858	0.384000	0.26145	0.957000	0.61999	-0.093000	0.11111	0.262000	0.21774	-0.472000	0.04984	TTT		0.398	DCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370765.3	NM_152624	
HSD17B4	3295	hgsc.bcm.edu	37	5	118861698	118861698	+	Missense_Mutation	SNP	T	T	C	rs199659543		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:118861698T>C	ENST00000256216.6	+	19	1793	c.1660T>C	c.(1660-1662)Tca>Cca	p.S554P	HSD17B4_ENST00000509514.1_Missense_Mutation_p.S292P|HSD17B4_ENST00000504811.1_Missense_Mutation_p.S579P|HSD17B4_ENST00000513628.1_Missense_Mutation_p.S417P|HSD17B4_ENST00000515320.1_Missense_Mutation_p.S536P|HSD17B4_ENST00000510025.1_Missense_Mutation_p.S530P|HSD17B4_ENST00000414835.2_Missense_Mutation_p.S414P|HSD17B4_ENST00000522415.1_3'UTR	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	554	Enoyl-CoA hydratase 2.|MaoC-like.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.S554P(1)		breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		TAATGATGTGTCAAGATTCAA	0.338																																					p.S554P	Colon(35;490 801 34689 41394 43344)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1660C	5						.						168.0	161.0	163.0					5																	118861698		2202	4300	6502	118889597	SO:0001583	missense	3295	exon19				CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.1660T>C	5.37:g.118861698T>C	ENSP00000256216:p.Ser554Pro		118889597	NM_000414	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	ENST00000256216.6	37	CCDS4126.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.263089	0.59431	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628;ENST00000509514	T;T;T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44;-1.44;-1.44	5.39	1.33	0.21861	MaoC-like dehydratase (1);	0.239667	0.43579	D	0.000551	T	0.77532	0.4144	M	0.72353	2.195	0.21762	N	0.999557	D;B;B;P;P	0.59767	0.986;0.008;0.015;0.956;0.779	P;B;B;P;P	0.49047	0.593;0.028;0.028;0.599;0.599	T	0.69409	-0.5153	10	0.59425	D	0.04	-2.911	1.5279	0.02529	0.3979:0.085:0.141:0.3761	.	579;536;530;292;554	F5HE57;E9PB82;E7EWE5;E7EPL9;P51659	.;.;.;.;DHB4_HUMAN	P	554;536;530;579;414;417;292	ENSP00000256216:S554P;ENSP00000424613:S536P;ENSP00000424940:S530P;ENSP00000420914:S579P;ENSP00000411960:S414P;ENSP00000425993:S417P;ENSP00000426272:S292P	ENSP00000256216:S554P	S	+	1	0	HSD17B4	118889597	0.307000	0.24500	0.097000	0.21041	0.976000	0.68499	1.597000	0.36729	0.323000	0.23307	0.482000	0.46254	TCA		0.338	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250863.3	NM_000414	
FNIP1	96459	hgsc.bcm.edu	37	5	130982813	130982813	+	Missense_Mutation	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:130982813A>C	ENST00000510461.1	-	17	3487	c.3392T>G	c.(3391-3393)gTt>gGt	p.V1131G	FNIP1_ENST00000307954.8_Missense_Mutation_p.V1086G|CTC-432M15.3_ENST00000514667.1_Intron|FNIP1_ENST00000307968.7_Missense_Mutation_p.V1103G	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	1131					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.V1131G(1)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		CTTGACATGAACACGCATCTG	0.458																																					p.V1131G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3392G	5						.						204.0	180.0	188.0					5																	130982813		2203	4300	6503	131010712	SO:0001583	missense	96459	exon17			DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.3392T>G	5.37:g.130982813A>C	ENSP00000421985:p.Val1131Gly		131010712	NM_133372	D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.757340	0.89843	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461	T;T;T	0.15834	2.39;2.41;2.39	5.4	5.4	0.78164	.	.	.	.	.	T	0.44456	0.1294	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	0.988;1.0	D;D	0.91635	0.98;0.999	T	0.46762	-0.9168	9	0.87932	D	0	-8.219	15.4258	0.75048	1.0:0.0:0.0:0.0	.	1103;1131	Q8TF40-3;Q8TF40	.;FNIP1_HUMAN	G	1103;1086;883;1131	ENSP00000309266:V1103G;ENSP00000310453:V1086G;ENSP00000421985:V1131G	ENSP00000310453:V1086G	V	-	2	0	FNIP1	131010712	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.057000	0.61298	0.533000	0.62120	GTT		0.458	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
DNAH5	1767	hgsc.bcm.edu	37	5	13766267	13766267	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:13766267C>T	ENST00000265104.4	-	59	10023	c.9919G>A	c.(9919-9921)Gcc>Acc	p.A3307T	DNAH5_ENST00000504001.3_Intron	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3307	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A3307T(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CGAACAGTGGCGATGTCCGAA	0.522									Kartagener syndrome																												p.A3307T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9919A	5						.						95.0	92.0	93.0					5																	13766267		2203	4300	6503	13819267	SO:0001583	missense	1767	exon59	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9919G>A	5.37:g.13766267C>T	ENSP00000265104:p.Ala3307Thr		13819267	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127535	0.77549	.	.	ENSG00000039139	ENST00000265104	T	0.69685	-0.42	5.63	5.63	0.86233	Dynein heavy chain, coiled coil stalk (1);	0.052284	0.85682	N	0.000000	T	0.64886	0.2639	L	0.49778	1.585	0.80722	D	1	B	0.17038	0.02	B	0.25884	0.064	T	0.58261	-0.7667	10	0.24483	T	0.36	.	19.7357	0.96202	0.0:1.0:0.0:0.0	.	3307	Q8TE73	DYH5_HUMAN	T	3307	ENSP00000265104:A3307T	ENSP00000265104:A3307T	A	-	1	0	DNAH5	13819267	1.000000	0.71417	0.284000	0.24805	0.684000	0.39900	7.683000	0.84093	2.660000	0.90430	0.558000	0.71614	GCC		0.522	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
IL3	3562	hgsc.bcm.edu	37	5	131398068	131398068	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:131398068G>A	ENST00000296870.2	+	3	446	c.268G>A	c.(268-270)Gca>Aca	p.A90T		NM_000588.3	NP_000579.2	P08700	IL3_HUMAN	interleukin 3	90					cell-cell signaling (GO:0007267)|embryonic hemopoiesis (GO:0035162)|immune response (GO:0006955)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-3 receptor binding (GO:0005135)	p.A90T(2)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)	10		all_cancers(142;7.42e-12)|Lung NSC(810;4.25e-07)|all_lung(232;1.93e-06)|Prostate(281;0.00741)|Breast(839;0.0544)|Lung SC(612;0.122)|Ovarian(839;0.223)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.0161)|Lung(113;0.105)	Amlexanox(DB01025)	TTTACAGAACGCATCAGCAAT	0.512																																					p.A90T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G268A	5						.						179.0	183.0	182.0					5																	131398068		2203	4300	6503	131425967	SO:0001583	missense	3562	exon3			M14743	CCDS4149.1	5q23-q31	2014-04-04	2014-04-04		ENSG00000164399	ENSG00000164399		"""Interleukins and interleukin receptors"""	6011	protein-coding gene	gene with protein product	"""multilineage-colony-stimulating factor"", ""hematopoietic growth factor"", ""P-cell stimulating factor"", ""mast-cell growth factor"", ""colony-stimulating factor, multiple"""	147740	"""interleukin 3 (colony-stimulating factor, multiple)"""			3489530	Standard	NM_000588		Approved	IL-3, MULTI-CSF, MCGF, MGC79398, MGC79399	uc003kwe.1	P08700	OTTHUMG00000059640	ENST00000296870.2:c.268G>A	5.37:g.131398068G>A	ENSP00000296870:p.Ala90Thr		131425967	NM_000588	Q6GS87	Missense_Mutation	SNP	ENST00000296870.2	37	CCDS4149.1	.	.	.	.	.	.	.	.	.	.	G	9.745	1.166026	0.21538	.	.	ENSG00000164399	ENST00000296870	T	0.34072	1.38	4.33	0.0657	0.14358	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	3.482320	0.00424	N	0.000063	T	0.24160	0.0585	L	0.34521	1.04	0.09310	N	1	B	0.33940	0.433	B	0.22880	0.042	T	0.10613	-1.0622	10	0.17832	T	0.49	8.436	6.8112	0.23805	0.7087:0.0:0.2913:0.0	.	90	P08700	IL3_HUMAN	T	90	ENSP00000296870:A90T	ENSP00000296870:A90T	A	+	1	0	IL3	131425967	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.425000	0.21346	-0.008000	0.14320	-0.140000	0.14226	GCA		0.512	IL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132639.1	NM_000588	
PCDHB5	26167	hgsc.bcm.edu	37	5	140515429	140515429	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:140515429T>C	ENST00000231134.5	+	1	630	c.413T>C	c.(412-414)aTg>aCg	p.M138T		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	138	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.M138T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGAAGGAAATGCTCCTAAAA	0.443																																					p.M138T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T413C	5						.						78.0	86.0	83.0					5																	140515429		2203	4300	6503	140495613	SO:0001583	missense	26167	exon1			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.413T>C	5.37:g.140515429T>C	ENSP00000231134:p.Met138Thr		140495613	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	T	3.695	-0.062659	0.07273	.	.	ENSG00000113209	ENST00000231134	T	0.19669	2.13	5.18	4.02	0.46733	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.15696	0.0378	N	0.25380	0.74	0.09310	N	1	P	0.37233	0.588	B	0.35182	0.197	T	0.09885	-1.0654	9	0.56958	D	0.05	.	10.8812	0.46939	0.0:0.0743:0.0:0.9257	.	138	Q9Y5E4	PCDB5_HUMAN	T	138	ENSP00000231134:M138T	ENSP00000231134:M138T	M	+	2	0	PCDHB5	140495613	0.000000	0.05858	0.994000	0.49952	0.244000	0.25665	-0.467000	0.06664	0.932000	0.37266	0.454000	0.30748	ATG		0.443	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
PCDHB16	57717	hgsc.bcm.edu	37	5	140562870	140562870	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:140562870A>G	ENST00000361016.2	+	1	1891	c.736A>G	c.(736-738)Atc>Gtc	p.I246V		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	246					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I246V(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAGCAGCCCATCTACAAAGT	0.532																																					p.I246V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A736G	5						.						80.0	77.0	78.0					5																	140562870		2203	4300	6503	140543054	SO:0001583	missense	57717	exon1			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.736A>G	5.37:g.140562870A>G	ENSP00000354293:p.Ile246Val		140543054	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.349440	0.00219	.	.	ENSG00000196963	ENST00000361016	T	0.01665	4.7	4.75	-6.32	0.01995	Cadherin (3);Cadherin-like (1);	1.738970	0.04033	N	0.301892	T	0.00845	0.0028	N	0.03177	-0.4	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49224	-0.8962	10	0.15499	T	0.54	.	5.2485	0.15510	0.1954:0.4529:0.2801:0.0715	.	246	Q9NRJ7	PCDBG_HUMAN	V	246	ENSP00000354293:I246V	ENSP00000354293:I246V	I	+	1	0	PCDHB16	140543054	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-3.098000	0.00605	-1.219000	0.02597	-0.438000	0.05819	ATC		0.532	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHGA12	26025	hgsc.bcm.edu	37	5	140811765	140811765	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:140811765A>G	ENST00000252085.3	+	1	1581	c.1439A>G	c.(1438-1440)gAc>gGc	p.D480G	PCDHGA9_ENST00000573521.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	480	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D480G(2)		breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACGACCCCGACTGTGAAGAG	0.567																																					p.D480G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1439G	5						.						71.0	74.0	73.0					5																	140811765		2203	4300	6503	140791949	SO:0001583	missense	26025	exon1			AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.1439A>G	5.37:g.140811765A>G	ENSP00000252085:p.Asp480Gly		140791949	NM_032094	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	37	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	a	13.73	2.323854	0.41096	.	.	ENSG00000253159	ENST00000252085	T	0.74632	-0.86	4.99	4.99	0.66335	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.93232	0.7844	H	0.99942	5.005	0.41399	D	0.98766	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96461	0.9341	9	0.87932	D	0	.	14.6863	0.69052	1.0:0.0:0.0:0.0	.	480;480	O60330-2;O60330	.;PCDGC_HUMAN	G	480	ENSP00000252085:D480G	ENSP00000252085:D480G	D	+	2	0	PCDHGA12	140791949	1.000000	0.71417	0.365000	0.25901	0.025000	0.11179	9.201000	0.95017	1.880000	0.54463	0.459000	0.35465	GAC		0.567	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
TCERG1	10915	hgsc.bcm.edu	37	5	145863158	145863158	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:145863158G>A	ENST00000296702.5	+	14	2116	c.2078G>A	c.(2077-2079)cGg>cAg	p.R693Q	TCERG1_ENST00000394421.2_Missense_Mutation_p.R672Q	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	693	FF 1.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)	p.R693Q(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTTGATCCCCGGTACTTACTT	0.338																																					p.R672Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2015A	5						.						91.0	94.0	93.0					5																	145863158		2203	4300	6503	145843351	SO:0001583	missense	10915	exon13			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.2078G>A	5.37:g.145863158G>A	ENSP00000296702:p.Arg693Gln		145843351	NM_001040006	Q2NKN2|Q59EA1	Missense_Mutation	SNP	ENST00000296702.5	37	CCDS4282.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.510557	0.85389	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.56611	0.45;0.45	5.54	5.54	0.83059	FF domain (4);	0.000000	0.85682	D	0.000000	T	0.78991	0.4371	M	0.91459	3.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.953	T	0.82006	-0.0671	10	0.49607	T	0.09	-12.635	19.4868	0.95032	0.0:0.0:1.0:0.0	.	672;693	O14776-2;O14776	.;TCRG1_HUMAN	Q	693;672	ENSP00000296702:R693Q;ENSP00000377943:R672Q	ENSP00000296702:R693Q	R	+	2	0	TCERG1	145843351	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.832000	0.99423	2.598000	0.87819	0.563000	0.77884	CGG		0.338	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251886.1	NM_001040006	
NMUR2	56923	hgsc.bcm.edu	37	5	151775109	151775109	+	Missense_Mutation	SNP	G	G	A	rs369018357		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:151775109G>A	ENST00000255262.3	-	3	1013	c.848C>T	c.(847-849)cCg>cTg	p.P283L	NMUR2_ENST00000518933.1_5'UTR	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	283					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)	p.P283L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AATGTGGAACGGGGCCCAACA	0.473																																					p.P283L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C848T	5						.	G	LEU/PRO	0,4406		0,0,2203	148.0	128.0	135.0		848	5.8	1.0	5		135	1,8599	1.2+/-3.3	0,1,4299	no	missense	NMUR2	NM_020167.4	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	283/416	151775109	1,13005	2203	4300	6503	151755302	SO:0001583	missense	56923	exon3			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.848C>T	5.37:g.151775109G>A	ENSP00000255262:p.Pro283Leu		151755302	NM_020167	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	37	CCDS4321.1	.	.	.	.	.	.	.	.	.	.	G	34	5.319210	0.95682	0.0	1.16E-4	ENSG00000132911	ENST00000255262	T	0.79845	-1.31	5.8	5.8	0.92144	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.95105	0.8414	H	0.99697	4.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97168	0.9842	10	0.87932	D	0	-13.3859	19.0512	0.93046	0.0:0.0:1.0:0.0	.	283	Q9GZQ4	NMUR2_HUMAN	L	283	ENSP00000255262:P283L	ENSP00000255262:P283L	P	-	2	0	NMUR2	151755302	1.000000	0.71417	0.981000	0.43875	0.947000	0.59692	9.066000	0.93949	2.735000	0.93741	0.655000	0.94253	CCG		0.473	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167	
FAM71B	153745	hgsc.bcm.edu	37	5	156593127	156593127	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:156593127A>G	ENST00000302938.4	-	1	148	c.53T>C	c.(52-54)aTg>aCg	p.M18T		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	18						nucleus (GO:0005634)		p.M18T(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAACGCACTCATTGAAGAGTA	0.438																																					p.M18T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T53C	5						.						111.0	108.0	109.0					5																	156593127		2203	4300	6503	156525705	SO:0001583	missense	153745	exon1				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.53T>C	5.37:g.156593127A>G	ENSP00000305596:p.Met18Thr		156525705	NM_130899	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	A	4.915	0.169965	0.09339	.	.	ENSG00000170613	ENST00000302938	T	0.03717	3.83	4.86	-0.0891	0.13670	.	0.767702	0.12748	N	0.442460	T	0.03011	0.0089	L	0.41027	1.25	0.20926	N	0.999826	B	0.25441	0.126	B	0.21546	0.035	T	0.42515	-0.9447	10	0.39692	T	0.17	-13.4011	2.9785	0.05946	0.5126:0.0:0.3014:0.1859	.	18	Q8TC56	FA71B_HUMAN	T	18	ENSP00000305596:M18T	ENSP00000305596:M18T	M	-	2	0	FAM71B	156525705	0.000000	0.05858	0.200000	0.23457	0.258000	0.26162	-0.815000	0.04481	0.082000	0.17018	0.528000	0.53228	ATG		0.438	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899	
NSD1	64324	hgsc.bcm.edu	37	5	176719032	176719032	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:176719032A>G	ENST00000439151.2	+	22	6381	c.6336A>G	c.(6334-6336)gaA>gaG	p.E2112E	NSD1_ENST00000361032.4_Silent_p.E2009E|NSD1_ENST00000354179.4_Silent_p.E1843E|NSD1_ENST00000347982.4_Silent_p.E1843E	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2112					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.E2112E(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CCCAGGGTGAAATCACAAAGG	0.478			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.E2112E			Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A6336G	5						.						85.0	70.0	76.0					5																	176719032		2203	4300	6503	176651638	SO:0001819	synonymous_variant	64324	exon22	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6336A>G	5.37:g.176719032A>G			176651638	NM_022455	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	37	CCDS4412.1																																																																																				0.478	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
PHYKPL	85007	hgsc.bcm.edu	37	5	177637163	177637163	+	Intron	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:177637163G>A	ENST00000308158.5	-	13	1619				HNRNPAB_ENST00000358344.3_Missense_Mutation_p.G273D|HNRNPAB_ENST00000504898.1_Missense_Mutation_p.G273D|HNRNPAB_ENST00000355836.5_Intron|HNRNPAB_ENST00000506259.1_Intron|HNRNPAB_ENST00000506339.1_Missense_Mutation_p.G268D|HNRNPAB_ENST00000514633.1_Intron|HNRNPAB_ENST00000515193.1_Intron|PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase							mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.G273D(1)								L-Alanine(DB00160)	CAGGGCTACGGCAACTACTGG	0.617																																					p.G273D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G818A	5						.						80.0	79.0	79.0					5																	177637163		2203	4300	6503	177569769	SO:0001627	intron_variant	3182	exon7			BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.1351-1247C>T	5.37:g.177637163G>A			177569769	NM_031266	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	ENST00000308158.5	37	CCDS4434.1	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126198	0.37533	.	.	ENSG00000197451	ENST00000358344;ENST00000506339;ENST00000504898	D;D;D	0.88046	-2.33;-2.33;-2.33	5.87	5.87	0.94306	.	0.189706	0.47852	D	0.000218	D	0.85639	0.5743	M	0.78285	2.405	0.80722	D	1	P	0.42296	0.775	B	0.39660	0.306	T	0.82655	-0.0350	10	0.21014	T	0.42	.	11.0398	0.47825	0.084:0.0:0.916:0.0	.	273	Q99729-2	.	D	273;268;273	ENSP00000351108:G273D;ENSP00000422501:G268D;ENSP00000425031:G273D	ENSP00000351108:G273D	G	+	2	0	HNRNPAB	177569769	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.058000	0.49939	2.781000	0.95711	0.655000	0.94253	GGC		0.617	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
CDH9	1007	hgsc.bcm.edu	37	5	26906834	26906834	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:26906834C>A	ENST00000231021.4	-	4	809	c.637G>T	c.(637-639)Gaa>Taa	p.E213*		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	213	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E213*(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GTACCTGATTCTGGGTCCACT	0.323																																					p.E213X	Melanoma(8;187 585 15745 40864 52829)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G637T	5						.						101.0	92.0	95.0					5																	26906834		2203	4300	6503	26942591	SO:0001587	stop_gained	1007	exon4			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.637G>T	5.37:g.26906834C>A	ENSP00000231021:p.Glu213*		26942591	NM_016279	Q3B7I5	Nonsense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	37	6.348235	0.97494	.	.	ENSG00000113100	ENST00000231021	.	.	.	5.49	5.49	0.81192	.	0.103590	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.943	0.89031	0.0:1.0:0.0:0.0	.	.	.	.	X	213	.	.	E	-	1	0	CDH9	26942591	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.838000	0.55828	2.571000	0.86741	0.655000	0.94253	GAA		0.323	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
AGXT2	64902	hgsc.bcm.edu	37	5	35014156	35014156	+	Silent	SNP	G	G	A			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:35014156G>A	ENST00000231420.6	-	10	1232	c.1032C>T	c.(1030-1032)gaC>gaT	p.D344D		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	344					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)	p.D344D(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	TGGTGACAATGTCAGGCAGGA	0.517																																					p.D344D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1032T	5						.						167.0	135.0	146.0					5																	35014156		2203	4300	6503	35049913	SO:0001819	synonymous_variant	64902	exon10			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.1032C>T	5.37:g.35014156G>A			35049913	NM_031900	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Silent	SNP	ENST00000231420.6	37	CCDS3908.1																																																																																				0.517	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207574.2	NM_031900	
NUP155	9631	hgsc.bcm.edu	37	5	37309298	37309298	+	Silent	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:37309298T>C	ENST00000231498.3	-	24	2903	c.2700A>G	c.(2698-2700)tcA>tcG	p.S900S	NUP155_ENST00000513532.1_Silent_p.S836S|NUP155_ENST00000381843.2_Silent_p.S841S|NUP155_ENST00000502533.1_5'UTR	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	900					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.S900S(1)		endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATTCCTTTAATGATTCCCTTA	0.333																																					p.S900S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2700G	5						.						148.0	141.0	143.0					5																	37309298		2203	4300	6503	37345055	SO:0001819	synonymous_variant	9631	exon24			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.2700A>G	5.37:g.37309298T>C			37345055	NM_153485	Q9UBE9|Q9UFL5	Silent	SNP	ENST00000231498.3	37	CCDS3921.1																																																																																				0.333	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	NM_153485, NM_004298	
HMGCS1	3157	hgsc.bcm.edu	37	5	43294213	43294213	+	Silent	SNP	A	A	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:43294213A>C	ENST00000325110.6	-	8	1334	c.1128T>G	c.(1126-1128)ggT>ggG	p.G376G	HMGCS1_ENST00000433297.2_Silent_p.G376G	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	376					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)	p.G376G(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						CCAAACCAGAACCATAAGAAA	0.418																																					p.G376G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1128G	5						.						141.0	122.0	129.0					5																	43294213		2203	4300	6503	43329970	SO:0001819	synonymous_variant	3157	exon7				CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.1128T>G	5.37:g.43294213A>C			43329970	NM_002130	B2RDL8	Silent	SNP	ENST00000325110.6	37	CCDS34154.1																																																																																				0.418	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368022.1		
PARP8	79668	hgsc.bcm.edu	37	5	50137892	50137892	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:50137892C>T	ENST00000281631.5	+	26	2713	c.2555C>T	c.(2554-2556)gCt>gTt	p.A852V	PARP8_ENST00000505554.1_Missense_Mutation_p.A831V|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000503750.2_Missense_Mutation_p.A810V|PARP8_ENST00000514067.2_Missense_Mutation_p.A810V|PARP8_ENST00000505697.2_Missense_Mutation_p.A852V	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	852						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.A852V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				AATCAAACTGCTACTGGTTAA	0.368																																					p.A852V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2555T	5						.						78.0	73.0	75.0					5																	50137892		2203	4300	6503	50173649	SO:0001583	missense	79668	exon27			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.2555C>T	5.37:g.50137892C>T	ENSP00000281631:p.Ala852Val		50173649	NM_001178055	Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	ENST00000281631.5	37	CCDS3954.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488758	0.84962	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000281631;ENST00000514067;ENST00000505554	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.65048	0.2654	N	0.19112	0.55	0.80722	D	1	D;D;D	0.67145	0.993;0.996;0.993	D;D;D	0.73380	0.956;0.98;0.956	T	0.60454	-0.7260	8	.	.	.	-17.1617	20.8794	0.99867	0.0:1.0:0.0:0.0	.	744;810;852	B4DQ81;Q8N3A8-2;Q8N3A8	.;.;PARP8_HUMAN	V	852;810;852;810;831	.	.	A	+	2	0	PARP8	50173649	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.375000	0.66173	2.941000	0.99782	0.655000	0.94253	GCT		0.368	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214035.3	NM_024615	
CD180	4064	hgsc.bcm.edu	37	5	66479988	66479988	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:66479988T>G	ENST00000256447.4	-	3	840	c.683A>C	c.(682-684)aAc>aCc	p.N228T		NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	228					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N228T(1)		cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		TCCTCCAAAGTTCAAACTTTG	0.418																																					p.N228T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A683C	5						.						66.0	71.0	69.0					5																	66479988		2202	4300	6502	66515744	SO:0001583	missense	4064	exon3			D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.683A>C	5.37:g.66479988T>G	ENSP00000256447:p.Asn228Thr		66515744	NM_005582	B2R7Z7|Q32MM5	Missense_Mutation	SNP	ENST00000256447.4	37	CCDS3992.1	.	.	.	.	.	.	.	.	.	.	T	10.48	1.362761	0.24684	.	.	ENSG00000134061	ENST00000256447	T	0.36340	1.26	5.4	0.15	0.14883	.	0.435749	0.22628	N	0.057616	T	0.25082	0.0609	M	0.71581	2.175	0.28991	N	0.888025	P	0.44139	0.827	B	0.33750	0.169	T	0.34104	-0.9842	10	0.13470	T	0.59	.	6.292	0.21065	0.0:0.1322:0.2501:0.6177	.	228	Q99467	CD180_HUMAN	T	228	ENSP00000256447:N228T	ENSP00000256447:N228T	N	-	2	0	CD180	66515744	0.989000	0.36119	0.860000	0.33809	0.414000	0.31173	1.632000	0.37102	-0.092000	0.12417	0.533000	0.62120	AAC		0.418	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253973.2	NM_005582	
ZCCHC9	84240	hgsc.bcm.edu	37	5	80600714	80600714	+	Silent	SNP	G	G	A	rs529602395		TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:80600714G>A	ENST00000254037.2	+	1	3293	c.138G>A	c.(136-138)agG>agA	p.R46R	ZCCHC9_ENST00000438268.2_Silent_p.R46R|ZCCHC9_ENST00000380199.5_Silent_p.R46R|ZCCHC9_ENST00000407610.3_Silent_p.R46R|ZCCHC9_ENST00000506458.1_Intron			Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9	46					negative regulation of phosphatase activity (GO:0010923)		poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R46R(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)	13		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)		AAGCCAATAGGCTATCCCTCA	0.398																																					p.R46R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G138A	5						.						96.0	92.0	93.0					5																	80600714		2203	4300	6503	80636470	SO:0001819	synonymous_variant	84240	exon2			BC014841	CCDS4054.1	5q14.1	2013-01-09			ENSG00000131732	ENSG00000131732		"""Zinc fingers, CCHC domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25424	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 41"""					12477932	Standard	NM_032280		Approved	DKFZp761J139, PPP1R41	uc003khi.3	Q8N567	OTTHUMG00000119014	ENST00000254037.2:c.138G>A	5.37:g.80600714G>A			80636470	NM_001131036	B2RAE7|Q9H027	Silent	SNP	ENST00000254037.2	37	CCDS4054.1																																																																																				0.398	ZCCHC9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239213.1	NM_032280	
VCAN	1462	hgsc.bcm.edu	37	5	82835863	82835863	+	Silent	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:82835863A>G	ENST00000265077.3	+	8	7606	c.7041A>G	c.(7039-7041)gcA>gcG	p.A2347A	VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Silent_p.A1360A|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2347	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.A2347A(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CCACGGTGGCACCTCTCCCTT	0.458																																					p.A1360A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A4080G	5						.						84.0	79.0	81.0					5																	82835863		2203	4300	6503	82871619	SO:0001819	synonymous_variant	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.7041A>G	5.37:g.82835863A>G			82871619	NM_001164097	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																				0.458	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
LNPEP	4012	hgsc.bcm.edu	37	5	96350679	96350679	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:96350679G>C	ENST00000231368.5	+	13	2948	c.2256G>C	c.(2254-2256)ttG>ttC	p.L752F	LNPEP_ENST00000395770.3_Missense_Mutation_p.L738F	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	752					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L752F(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CCTTTGATTTGATTAATTATC	0.418																																					p.L752F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2256C	5						.						123.0	118.0	120.0					5																	96350679		2203	4300	6503	96376435	SO:0001583	missense	4012	exon13			D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.2256G>C	5.37:g.96350679G>C	ENSP00000231368:p.Leu752Phe		96376435	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	37	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639987	0.67244	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.10860	2.83;2.83	5.72	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.31295	0.0792	M	0.78456	2.415	0.58432	D	0.999999	D	0.61080	0.989	P	0.61722	0.893	T	0.09185	-1.0686	10	0.72032	D	0.01	.	14.4866	0.67622	0.0713:0.0:0.9287:0.0	.	752	Q9UIQ6	LCAP_HUMAN	F	752;738	ENSP00000231368:L752F;ENSP00000379117:L738F	ENSP00000231368:L752F	L	+	3	2	LNPEP	96376435	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	3.682000	0.54656	1.422000	0.47177	0.591000	0.81541	TTG		0.418	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
CHD1	1105	hgsc.bcm.edu	37	5	98212261	98212261	+	Splice_Site	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:98212261A>G	ENST00000284049.3	-	23	3388	c.3239T>C	c.(3238-3240)aTt>aCt	p.I1080T		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1080					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)	p.I1080T(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	ATTGAAACTAATCTGGAATTG	0.373																																					p.I1080T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3239C	5						.						75.0	73.0	74.0					5																	98212261		2203	4300	6503	98240161	SO:0001630	splice_region_variant	1105	exon23			AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.3238-1T>C	5.37:g.98212261A>G			98240161	NM_001270	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	37	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	A	9.294	1.051395	0.19827	.	.	ENSG00000153922	ENST00000284049	D	0.89485	-2.52	5.14	5.14	0.70334	.	0.536010	0.12898	U	0.430037	T	0.81278	0.4789	L	0.27053	0.805	0.43246	D	0.995166	B	0.21821	0.061	B	0.22386	0.039	T	0.73132	-0.4079	10	0.18710	T	0.47	.	9.7585	0.40517	0.922:0.0:0.078:0.0	.	1080	O14646	CHD1_HUMAN	T	1080	ENSP00000284049:I1080T	ENSP00000284049:I1080T	I	-	2	0	CHD1	98240161	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.907000	0.63300	2.058000	0.61347	0.528000	0.53228	ATT		0.373	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	Missense_Mutation
ZNF454	285676	hgsc.bcm.edu	37	5	178392316	178392316	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr5:178392316T>C	ENST00000320129.3	+	5	1214	c.911T>C	c.(910-912)aTt>aCt	p.I304T	ZNF454_ENST00000519564.1_Missense_Mutation_p.I304T	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	304					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I304T(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		AAATGTAACATTTGTGAAAAA	0.378																																					p.I304T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T911C	5						.						48.0	52.0	51.0					5																	178392316		2203	4300	6503	178324922	SO:0001583	missense	285676	exon5			AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.911T>C	5.37:g.178392316T>C	ENSP00000326249:p.Ile304Thr		178324922	NM_182594	Q2M1P2|Q2M323	Missense_Mutation	SNP	ENST00000320129.3	37	CCDS4441.1	.	.	.	.	.	.	.	.	.	.	T	0.952	-0.706069	0.03255	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.11930	2.73;2.73	4.45	1.81	0.25067	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.068200	0.07435	N	0.896360	T	0.11836	0.0288	L	0.31926	0.97	0.09310	N	1	B	0.17268	0.021	B	0.16722	0.016	T	0.32402	-0.9908	10	0.66056	D	0.02	-0.8177	7.3303	0.26577	0.4833:0.0:0.0:0.5166	.	304	Q8N9F8	ZN454_HUMAN	T	304	ENSP00000326249:I304T;ENSP00000430354:I304T	ENSP00000326249:I304T	I	+	2	0	ZNF454	178324922	0.000000	0.05858	0.093000	0.20910	0.014000	0.08584	0.029000	0.13666	0.822000	0.34565	-0.341000	0.08007	ATT		0.378	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253476.2	XM_209718	
VNN3	55350	hgsc.bcm.edu	37	6	133047992	133047992	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AA-A00A-01A-01W-A005-10	TCGA-AA-A00A-10A-01W-A005-10	g.chr6:133047992A>G	ENST00000367927.5	-	4	769	c.697T>C	c.(697-699)Ttc>Ctc	p.F233L	VNN3_ENST00000427187.2_Intron|VNN3_ENST00000414302.2_3'UTR|VNN3_ENST00000275223.3_Intron|VNN3_ENST00000417437.2_Intron|VNN3_ENST00000392393.3_Intron|VNN3_ENST00000580813.1_5'Flank|VNN3_ENST00000519686.2_Intron|VNN3_ENST00000450865.2_Intron|VNN3_ENST00000509351.1_Intron|VNN3_ENST00000207771.3_Missense_Mutation_p.I232T|VNN3_ENST00000423615.2_Intron|VNN3_ENST00000425515.2_3'UTR			Q9NY84	VNN3_HUMAN	vanin 3	233	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)	p.F233L(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		GGGGTAGAGAATGCTGTCAAT	0.493																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	6						.						178.0	128.0	145.0					6																	133047992		2203	4300	6503	133089685	SO:0001583	missense	55350	.			AJ238982		6q23.2	2014-04-09	2010-11-15	2010-11-15	ENSG00000093134	ENSG00000093134	3.5.1.92	"""Vanins"""	16431	other	unknown		606592				10501839, 19932582, 19322213	Standard	NR_028290		Approved	HSA238982	uc010kfs.3	Q9NY84	OTTHUMG00000015589	ENST00000367927.5:c.697T>C	6.37:g.133047992A>G	ENSP00000438024:p.Phe233Leu		133089685	.	B2DFY0|B2DFY1|B2DFY3|B2DFY5|B2DFY6|B2DFY7|B2DFY8|Q3SX90|Q9BQY2	Missense_Mutation	SNP	ENST00000367927.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.76|12.76	2.033233|2.033233	0.35893|0.35893	.|.	.|.	ENSG00000093134|ENSG00000093134	ENST00000367927|ENST00000207771	D|D	0.87256|0.87491	-2.23|-2.26	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	.|0.612220	.|0.15011	.|N	.|0.285556	D|D	0.90456|0.90456	0.7011|0.7011	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	D|D	0.91344|0.91344	0.5099|0.5099	6|7	0.24483|0.87932	T|D	0.36|0	-34.3795|-34.3795	15.6437|15.6437	0.77029|0.77029	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	L|T	233|232	ENSP00000438024:F233L|ENSP00000440594:I232T	ENSP00000438024:F233L|ENSP00000440594:I232T	F|I	-|-	1|2	0|0	VNN3|VNN3	133089685|133089685	0.389000|0.389000	0.25205|0.25205	0.003000|0.003000	0.11579|0.11579	0.226000|0.226000	0.24999|0.24999	6.302000|6.302000	0.72788|0.72788	2.163000|2.163000	0.67991|0.67991	0.443000|0.443000	0.29094|0.29094	TTC|ATT		0.493	VNN3-001	KNOWN	NMD_exception|basic	protein_coding	protein_coding	OTTHUMT00000042265.4	NR_028290	
