#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FGFBP3	143282	broad.mit.edu	37	10	93668130	93668130	+	Silent	SNP	G	G	C			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr10:93668130G>C	ENST00000311575.5	-	2	760	c.597C>G	c.(595-597)ccC>ccG	p.P199P	RP11-402D21.2_ENST00000610263.1_RNA	NM_152429.4	NP_689642.3	Q8TAT2	FGFP3_HUMAN	fibroblast growth factor binding protein 3	199					positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of vascular permeability (GO:0043117)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	fibroblast growth factor binding (GO:0017134)|heparin binding (GO:0008201)	p.P199P(1)		large_intestine(1)|prostate(1)	2		Colorectal(252;0.162)				TCCTCTCTGAGGGGTTTTCTT	0.731																																					p.P199P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C597G	10						.																																			93658110	SO:0001819	synonymous_variant	143282	exon2			AK075410	CCDS7418.1	10q23.33	2006-12-14	2006-12-14	2006-12-14	ENSG00000174721	ENSG00000174721			23428	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 13"""	C10orf13			Standard	NM_152429		Approved	MGC39320	uc001khq.4	Q8TAT2	OTTHUMG00000018751	ENST00000311575.5:c.597C>G	10.37:g.93668130G>C			93658110	NM_152429	B2RD68|Q8NBN0	Silent	SNP	ENST00000311575.5	37	CCDS7418.1																																																																																				0.731	FGFBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049379.1	NM_152429	
SCYL1	57410	broad.mit.edu	37	11	65304471	65304472	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr11:65304471_65304472insC	ENST00000270176.5	+	14	1908_1909	c.1831_1832insC	c.(1831-1833)gccfs	p.A611fs	SCYL1_ENST00000527009.1_Frame_Shift_Ins_p.A468fs|SCYL1_ENST00000525364.1_Frame_Shift_Ins_p.A611fs|SCYL1_ENST00000533862.1_Frame_Shift_Ins_p.A611fs|SCYL1_ENST00000279270.6_Frame_Shift_Ins_p.A611fs|SCYL1_ENST00000524944.1_Frame_Shift_Ins_p.A611fs|SCYL1_ENST00000420247.2_Intron	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	611	Pro-rich.				peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)	p.T613fs*30(1)		ovary(1)|skin(1)	2						TCCTGCCCCAGCCCCCACCCCT	0.649																																					p.A611fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1831_1832insC	11						.																																			65061048	SO:0001589	frameshift_variant	57410	exon14			AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.1836dupC	11.37:g.65304476_65304476dupC	ENSP00000270176:p.Ala611fs		65061047	NM_020680	A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Frame_Shift_Ins	INS	ENST00000270176.5	37	CCDS41672.1																																																																																				0.649	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680	
OR8J1	219477	broad.mit.edu	37	11	56128351	56128351	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr11:56128351C>A	ENST00000303039.3	+	1	661	c.629C>A	c.(628-630)tCc>tAc	p.S210Y		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S210Y(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					GTGGTTGGTTCCTTGATTATA	0.318																																					p.S210Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C629A	11						.						169.0	157.0	161.0					11																	56128351		2201	4296	6497	55884927	SO:0001583	missense	219477	exon1			AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.629C>A	11.37:g.56128351C>A	ENSP00000304060:p.Ser210Tyr		55884927	NM_001005205	B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Missense_Mutation	SNP	ENST00000303039.3	37	CCDS31529.1	.	.	.	.	.	.	.	.	.	.	C	9.110	1.006317	0.19199	.	.	ENSG00000172487	ENST00000303039	T	0.38077	1.16	3.9	3.9	0.45041	GPCR, rhodopsin-like superfamily (1);	0.097073	0.46758	D	0.000277	T	0.66509	0.2796	M	0.92880	3.355	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.62937	-0.6748	10	0.87932	D	0	.	13.0539	0.58969	0.0:0.8369:0.1631:0.0	.	210	Q8NGP2	OR8J1_HUMAN	Y	210	ENSP00000304060:S210Y	ENSP00000304060:S210Y	S	+	2	0	OR8J1	55884927	0.000000	0.05858	0.101000	0.21167	0.113000	0.19764	0.516000	0.22817	2.180000	0.69256	0.542000	0.68232	TCC		0.318	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391606.2	NM_001005205	
CDC42BPG	55561	broad.mit.edu	37	11	64594781	64594781	+	Missense_Mutation	SNP	C	C	T	rs139262308		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr11:64594781C>T	ENST00000342711.5	-	33	4239	c.4240G>A	c.(4240-4242)Gtg>Atg	p.V1414M		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)									p.V1414M(1)		central_nervous_system(1)|lung(3)	4						TCCTCCGACACGCGGAAAAAG	0.667																																					p.V1414M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4240A	11						.						67.0	73.0	71.0					11																	64594781		2201	4297	6498	64351357	SO:0001583	missense	55561	exon33			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.4240G>A	11.37:g.64594781C>T	ENSP00000345133:p.Val1414Met		64351357	NM_017525		Missense_Mutation	SNP	ENST00000342711.5	37	CCDS31601.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440801	0.83993	.	.	ENSG00000171219	ENST00000342711	T	0.69926	-0.44	4.82	3.89	0.44902	.	0.190907	0.25984	N	0.027042	T	0.76343	0.3974	M	0.79926	2.475	0.36077	D	0.842517	D	0.69078	0.997	P	0.54140	0.743	D	0.84068	0.0378	10	0.62326	D	0.03	.	13.0466	0.58931	0.0:0.837:0.163:0.0	.	1414	Q6DT37	MRCKG_HUMAN	M	1414	ENSP00000345133:V1414M	ENSP00000345133:V1414M	V	-	1	0	CDC42BPG	64351357	0.980000	0.34600	0.991000	0.47740	0.991000	0.79684	2.082000	0.41605	1.137000	0.42214	0.561000	0.74099	GTG		0.667	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
PACS1	55690	broad.mit.edu	37	11	65995010	65995010	+	Silent	SNP	T	T	C			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr11:65995010T>C	ENST00000320580.4	+	11	1362	c.1329T>C	c.(1327-1329)acT>acC	p.T443T	PACS1_ENST00000529757.1_5'Flank	NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	443					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.T443T(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						TTAAATCTACTTGGATTAAAA	0.328																																					p.T443T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1329C	11						.						59.0	60.0	60.0					11																	65995010		2200	4295	6495	65751586	SO:0001819	synonymous_variant	55690	exon11			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.1329T>C	11.37:g.65995010T>C			65751586	NM_018026	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Silent	SNP	ENST00000320580.4	37	CCDS8129.1																																																																																				0.328	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026	
OR10G9	219870	broad.mit.edu	37	11	123893917	123893917	+	Missense_Mutation	SNP	C	C	G	rs112152472	byFrequency	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr11:123893917C>G	ENST00000375024.1	+	1	198	c.198C>G	c.(196-198)ttC>ttG	p.F66L		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F66L(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		ACCTGTCCTTCATTGACATGT	0.567																																					p.F66L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C198G	11						.						34.0	34.0	34.0					11																	123893917		2200	4277	6477	123399127	SO:0001583	missense	219870	exon1			AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.198C>G	11.37:g.123893917C>G	ENSP00000364164:p.Phe66Leu		123399127	NM_001001953		Missense_Mutation	SNP	ENST00000375024.1	37	CCDS31703.1	.	.	.	.	.	.	.	.	.	.	C	9.684	1.150095	0.21371	.	.	ENSG00000236981	ENST00000375024	T	0.00966	5.49	3.33	-0.977	0.10282	GPCR, rhodopsin-like superfamily (1);	0.134033	0.34362	N	0.004027	T	0.01029	0.0034	L	0.48642	1.525	0.22745	N	0.998788	B	0.12630	0.006	B	0.21151	0.033	T	0.44483	-0.9325	10	0.39692	T	0.17	.	7.957	0.30049	0.0:0.6186:0.0:0.3814	.	66	Q8NGN4	O10G9_HUMAN	L	66	ENSP00000364164:F66L	ENSP00000364164:F66L	F	+	3	2	OR10G9	123399127	0.000000	0.05858	0.969000	0.41365	0.861000	0.49209	-0.505000	0.06367	-0.331000	0.08501	-0.742000	0.03525	TTC		0.567	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387269.1	NM_001001953	
ISCU	23479	broad.mit.edu	37	12	108958154	108958154	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr12:108958154G>A	ENST00000311893.9	+	2	236	c.214G>A	c.(214-216)Gta>Ata	p.V72I	ISCU_ENST00000539593.1_Missense_Mutation_p.V72I|SART3_ENST00000546611.1_5'Flank|ISCU_ENST00000431221.2_Missense_Mutation_p.V72I|SART3_ENST00000228284.3_5'Flank|ISCU_ENST00000535729.1_Missense_Mutation_p.V72I|ISCU_ENST00000338291.4_Missense_Mutation_p.V47I|ISCU_ENST00000392807.4_Missense_Mutation_p.V47I|ISCU_ENST00000547005.1_Missense_Mutation_p.V72I	NM_213595.2	NP_998760.1	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme	72					iron-sulfur cluster assembly (GO:0016226)|nitrogen fixation (GO:0009399)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|iron-sulfur cluster binding (GO:0051536)|protein complex scaffold (GO:0032947)	p.V47I(1)		kidney(2)|large_intestine(2)|lung(4)|prostate(2)|urinary_tract(1)	11						ATGTGGTGACGTAATGAAATT	0.398																																					p.V47I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G139A	12						.						68.0	73.0	71.0					12																	108958154		2203	4300	6503	107482283	SO:0001583	missense	23479	exon3			U47101	CCDS9118.1, CCDS44966.1, CCDS73518.1	12q24.1	2013-08-05	2013-08-05	2006-10-24	ENSG00000136003	ENSG00000136003			29882	protein-coding gene	gene with protein product		611911	"""NifU-like N-terminal domain containing"", ""IscU iron-sulfur cluster scaffold homolog (E. coli)"", ""iron-sulfur cluster scaffold homolog (E. coli)"""	NIFUN		8875867, 11060020	Standard	XM_005268760		Approved	ISU2, hnifU, IscU	uc010sxc.2	Q9H1K1	OTTHUMG00000168420	ENST00000311893.9:c.214G>A	12.37:g.108958154G>A	ENSP00000310623:p.Val72Ile		107482283	NM_014301	Q6P713|Q99617|Q9H1K2	Missense_Mutation	SNP	ENST00000311893.9	37	CCDS44966.1	.	.	.	.	.	.	.	.	.	.	G	32	5.151675	0.94645	.	.	ENSG00000136003	ENST00000535729;ENST00000431221;ENST00000547005;ENST00000311893;ENST00000392807;ENST00000338291;ENST00000539593	T;T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08;-1.08;-1.08	5.86	5.86	0.93980	NIF system FeS cluster assembly, NifU, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86045	0.5839	L	0.55017	1.72	0.80722	D	1	D;D;D;P;D;D	0.61697	0.99;0.99;0.965;0.939;0.979;0.974	P;P;D;P;P;P	0.77004	0.905;0.905;0.989;0.678;0.836;0.747	D	0.86356	0.1714	10	0.72032	D	0.01	.	17.674	0.88225	0.0:0.0:1.0:0.0	.	72;72;72;72;47;47	B3KQ30;Q9H1K1;B4DNC9;F5H5N2;B1P7G3;Q9H1K1-2	.;ISCU_HUMAN;.;.;.;.	I	72;72;72;72;47;47;72	ENSP00000445598:V72I;ENSP00000411108:V72I;ENSP00000446606:V72I;ENSP00000310623:V72I;ENSP00000376554:V47I;ENSP00000344584:V47I;ENSP00000443272:V72I	ENSP00000310623:V72I	V	+	1	0	ISCU	107482283	1.000000	0.71417	0.982000	0.44146	0.996000	0.88848	8.659000	0.91116	2.777000	0.95525	0.655000	0.94253	GTA		0.398	ISCU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399693.1	NM_014301	
MORN3	283385	broad.mit.edu	37	12	122097186	122097186	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr12:122097186C>T	ENST00000355329.3	-	2	384	c.214G>A	c.(214-216)Gac>Aac	p.D72N		NM_173855.4	NP_776254.3	Q6PF18	MORN3_HUMAN	MORN repeat containing 3	72						nucleus (GO:0005634)		p.D72N(1)		breast(2)|large_intestine(1)|lung(4)|skin(1)|stomach(1)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000409)|Epithelial(86;0.00145)		CCGTAGCCGTCTCGCTTCCCA	0.547																																					p.D72N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G214A	12						.						158.0	126.0	137.0					12																	122097186		2203	4300	6503	120581569	SO:0001583	missense	283385	exon2			BC057760	CCDS31917.1	12q24.31	2006-01-17			ENSG00000139714	ENSG00000139714			29807	protein-coding gene	gene with protein product							Standard	NM_173855		Approved		uc001uax.3	Q6PF18	OTTHUMG00000169075	ENST00000355329.3:c.214G>A	12.37:g.122097186C>T	ENSP00000347486:p.Asp72Asn		120581569	NM_173855	Q86YQ9	Missense_Mutation	SNP	ENST00000355329.3	37	CCDS31917.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081828	0.55861	.	.	ENSG00000139714	ENST00000355329	T	0.53857	0.6	5.23	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.48169	0.1485	N	0.16307	0.4	0.40465	D	0.980287	P	0.51537	0.946	P	0.61533	0.89	T	0.39800	-0.9596	10	0.16420	T	0.52	.	8.8956	0.35463	0.0:0.8274:0.0:0.1726	.	72	Q6PF18	MORN3_HUMAN	N	72	ENSP00000347486:D72N	ENSP00000347486:D72N	D	-	1	0	MORN3	120581569	1.000000	0.71417	1.000000	0.80357	0.227000	0.25037	3.181000	0.50903	1.204000	0.43247	0.563000	0.77884	GAC		0.547	MORN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402154.1	NM_173855	
SCARB1	949	broad.mit.edu	37	12	125267285	125267285	+	Intron	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr12:125267285C>T	ENST00000415380.2	-	11	1777				SCARB1_ENST00000261693.6_Missense_Mutation_p.E492K|SCARB1_ENST00000339570.5_Intron|SCARB1_ENST00000535005.1_5'UTR|SCARB1_ENST00000546215.1_Missense_Mutation_p.E464K|SCARB1_ENST00000376788.1_Missense_Mutation_p.E392K			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1						adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	ATCAGGGATTCAGAATAGGCC	0.478																																					p.E492K												.	.	0			c.G1474A	12						.						108.0	103.0	105.0					12																	125267285		2203	4300	6503	123833238	SO:0001627	intron_variant	949	exon12			Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.1651+3367G>A	12.37:g.125267285C>T			123833238	NM_005505	F8W8N0|Q14016|Q52LZ5|Q6KFX4	Missense_Mutation	SNP	ENST00000415380.2	37		.	.	.	.	.	.	.	.	.	.	C	19.50	3.838926	0.71373	.	.	ENSG00000073060	ENST00000261693;ENST00000376788;ENST00000546215	T;T;T	0.65549	0.1;-0.14;-0.16	5.42	5.42	0.78866	.	11.013500	0.00166	N	0.000000	T	0.78375	0.4273	L	0.50333	1.59	0.80722	D	1	D;D	0.69078	0.996;0.997	P;D	0.64042	0.836;0.921	T	0.60146	-0.7320	10	0.51188	T	0.08	-0.4465	16.1411	0.81522	0.0:1.0:0.0:0.0	.	464;492	B7ZKQ9;Q8WTV0-2	.;.	K	492;392;464	ENSP00000261693:E492K;ENSP00000365984:E392K;ENSP00000442862:E464K	ENSP00000261693:E492K	E	-	1	0	SCARB1	123833238	0.998000	0.40836	0.999000	0.59377	0.998000	0.95712	4.184000	0.58323	2.539000	0.85634	0.561000	0.74099	GAA		0.478	SCARB1-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000400165.1	NM_005505	
SLC6A15	55117	broad.mit.edu	37	12	85279831	85279831	+	Silent	SNP	T	T	G			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr12:85279831T>G	ENST00000266682.5	-	3	847	c.306A>C	c.(304-306)ccA>ccC	p.P102P	SLC6A15_ENST00000551388.1_Intron|SLC6A15_ENST00000552192.1_5'UTR|SLC6A15_ENST00000450363.3_Silent_p.P102P	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	102					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)	p.P102P(1)		kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						GTATTAAATATGGTAAAAGAT	0.313																																					p.P102P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A306C	12						.						48.0	54.0	52.0					12																	85279831		2202	4299	6501	83803962	SO:0001819	synonymous_variant	55117	exon3			AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.306A>C	12.37:g.85279831T>G			83803962	NM_018057	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Silent	SNP	ENST00000266682.5	37	CCDS9026.1																																																																																				0.313	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
GPR133	283383	broad.mit.edu	37	12	131561402	131561402	+	Silent	SNP	C	C	T	rs149379586	byFrequency	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr12:131561402C>T	ENST00000261654.5	+	14	2089	c.1530C>T	c.(1528-1530)tgC>tgT	p.C510C	GPR133_ENST00000543617.1_Silent_p.C29C|GPR133_ENST00000535015.1_Silent_p.C542C|GPR133_ENST00000376682.4_Silent_p.C196C	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	510	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.C510C(2)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TCGTGTACTGCGCCTTCCTGG	0.587													C|||	2	0.000399361	0.0	0.0	5008	,	,		20138	0.0		0.0	False		,,,				2504	0.002				p.C510C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1530T	12						.	C		4,4402	8.1+/-20.4	0,4,2199	188.0	147.0	161.0		1530	-4.8	1.0	12	dbSNP_134	161	0,8600		0,0,4300	no	coding-synonymous	GPR133	NM_198827.3		0,4,6499	TT,TC,CC		0.0,0.0908,0.0308		510/875	131561402	4,13002	2203	4300	6503	130127355	SO:0001819	synonymous_variant	283383	exon14			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1530C>T	12.37:g.131561402C>T			130127355	NM_198827	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	ENST00000261654.5	37	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	C	2.879	-0.232324	0.05983	9.08E-4	0.0	ENSG00000111452	ENST00000335486	.	.	.	3.78	-4.79	0.03200	.	.	.	.	.	T	0.54287	0.1849	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55611	-0.8114	4	.	.	.	.	11.3024	0.49314	0.0:0.2362:0.0:0.7638	.	.	.	.	V	32	.	.	A	+	2	0	GPR133	130127355	0.156000	0.22821	0.969000	0.41365	0.283000	0.27025	-0.961000	0.03845	-0.846000	0.04174	-1.471000	0.01009	GCG		0.587	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
NBEA	26960	broad.mit.edu	37	13	35770435	35770435	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr13:35770435G>A	ENST00000400445.3	+	31	5896	c.5362G>A	c.(5362-5364)Gac>Aac	p.D1788N	NBEA_ENST00000310336.4_Missense_Mutation_p.D1788N|NBEA_ENST00000540320.1_Missense_Mutation_p.D1788N|NBEA_ENST00000379939.2_Missense_Mutation_p.D1785N	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1788					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.D1788N(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TCATTCCTTTGACAGGTAGGT	0.343																																					p.D1788N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5362A	13						.						49.0	46.0	47.0					13																	35770435		1851	4083	5934	34668435	SO:0001583	missense	26960	exon31			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.5362G>A	13.37:g.35770435G>A	ENSP00000383295:p.Asp1788Asn		34668435	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998713	0.93227	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.66995	-0.24;-0.23;-0.23;-0.24	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.81517	0.4839	M	0.67397	2.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	T	0.79085	-0.1948	10	0.41790	T	0.15	.	20.0979	0.97857	0.0:0.0:1.0:0.0	.	1788;1785	Q8NFP9;Q5T321	NBEA_HUMAN;.	N	1788;1788;1785;1788;415	ENSP00000440951:D1788N;ENSP00000383295:D1788N;ENSP00000369271:D1785N;ENSP00000308534:D1788N	ENSP00000308534:D1788N	D	+	1	0	NBEA	34668435	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	9.230000	0.95299	2.767000	0.95098	0.585000	0.79938	GAC		0.343	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
FREM2	341640	broad.mit.edu	37	13	39262809	39262809	+	Missense_Mutation	SNP	G	G	A	rs533045176		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr13:39262809G>A	ENST00000280481.7	+	1	1544	c.1328G>A	c.(1327-1329)cGg>cAg	p.R443Q		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	443					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R443Q(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GTGGTCACCCGGAATACCGGT	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		17008	0.001		0.0	False		,,,				2504	0.0				p.R443Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1328A	13						.						63.0	71.0	68.0					13																	39262809		2203	4300	6503	38160809	SO:0001583	missense	341640	exon1			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1328G>A	13.37:g.39262809G>A	ENSP00000280481:p.Arg443Gln		38160809	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.667568	0.67814	.	.	ENSG00000150893	ENST00000280481	T	0.19532	2.14	5.76	5.76	0.90799	.	0.055642	0.64402	D	0.000002	T	0.22166	0.0534	L	0.39633	1.23	0.58432	D	0.999996	D	0.58620	0.983	P	0.45232	0.474	T	0.00745	-1.1584	10	0.30078	T	0.28	.	15.5538	0.76173	0.0:0.0:0.8615:0.1385	.	443	Q5SZK8	FREM2_HUMAN	Q	443	ENSP00000280481:R443Q	ENSP00000280481:R443Q	R	+	2	0	FREM2	38160809	0.828000	0.29307	0.999000	0.59377	0.971000	0.66376	3.651000	0.54431	2.724000	0.93272	0.561000	0.74099	CGG		0.542	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
BIVM	54841	broad.mit.edu	37	13	103473418	103473418	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr13:103473418T>A	ENST00000257336.1	+	5	1316	c.637T>A	c.(637-639)Tct>Act	p.S213T	BIVM_ENST00000419638.1_Missense_Mutation_p.S213T|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.F184Y|RNY5P8_ENST00000410369.1_RNA|BIVM_ENST00000448849.2_5'UTR	NM_017693.3	NP_060163.2	Q86UB2	BIVM_HUMAN	basic, immunoglobulin-like variable motif containing	213						cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.S213T(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|skin(2)|urinary_tract(1)	25	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GTATAAGACTTCTTGTGGCAT	0.368																																					p.S213T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T637A	13						.						205.0	210.0	208.0					13																	103473418		2203	4300	6503	102271419	SO:0001583	missense	2073	exon5			AF411385	CCDS9505.1, CCDS53879.1	13q33.1	2008-05-14			ENSG00000134897	ENSG00000134897			16034	protein-coding gene	gene with protein product						12036287	Standard	NM_017693		Approved	FLJ20159		Q86UB2	OTTHUMG00000017309	ENST00000257336.1:c.637T>A	13.37:g.103473418T>A	ENSP00000257336:p.Ser213Thr		102271419	NM_017693	Q2M1J2|Q9NXM4	Missense_Mutation	SNP	ENST00000257336.1	37	CCDS9505.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.873007	0.91664	.	.	ENSG00000134897;ENSG00000134897;ENSG00000134899	ENST00000257336;ENST00000419638;ENST00000418659	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.77980	0.4212	M	0.71036	2.16	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.80764	0.994;0.987	T	0.80848	-0.1199	9	0.87932	D	0	.	15.1039	0.72306	0.0:0.0:0.0:1.0	.	184;213	Q59FZ7;Q86UB2	.;BIVM_HUMAN	T	213;213;184	.	ENSP00000257336:S213T	S	+	1	0	ERCC5;BIVM	102271419	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.367000	0.79558	2.053000	0.61076	0.459000	0.35465	TCT		0.368	BIVM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045704.2		
NOVA1	4857	broad.mit.edu	37	14	26949342	26949342	+	Silent	SNP	A	A	C			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr14:26949342A>C	ENST00000344429.5	-	3	291	c.288T>G	c.(286-288)acT>acG	p.T96T	NOVA1_ENST00000465357.2_Silent_p.T96T|NOVA1_ENST00000547619.1_Silent_p.T96T|NOVA1_ENST00000574031.1_Silent_p.T96T|NOVA1_ENST00000267422.7_5'UTR|NOVA1_ENST00000539517.2_Silent_p.T96T	NM_006491.2	NP_006482.1	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	99	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.T96T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		ACACTCGCTCAGTAGTACCTG	0.363																																					p.T96T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T288G	14						.						76.0	66.0	70.0					14																	26949342		2203	4300	6503	26019182	SO:0001819	synonymous_variant	4857	exon3			U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000344429.5:c.288T>G	14.37:g.26949342A>C			26019182	NM_002515	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Silent	SNP	ENST00000344429.5	37	CCDS9635.1																																																																																				0.363	NOVA1-001	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276557.1	NM_006491	
GABRA5	2558	broad.mit.edu	37	15	27128508	27128508	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr15:27128508C>T	ENST00000335625.5	+	6	1189	c.301C>T	c.(301-303)Cga>Tga	p.R101*	GABRA5_ENST00000557449.1_Intron|GABRA5_ENST00000400081.3_Nonsense_Mutation_p.R101*|GABRA5_ENST00000355395.5_Nonsense_Mutation_p.R101*|GABRB3_ENST00000541819.2_Intron	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	101					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.R101*(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CGTGTTTTTCCGACAAAGCTG	0.582																																					p.R101X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C301T	15						.						102.0	109.0	107.0					15																	27128508		2041	4209	6250	24679601	SO:0001587	stop_gained	2558	exon6				CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.301C>T	15.37:g.27128508C>T	ENSP00000335592:p.Arg101*		24679601	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Nonsense_Mutation	SNP	ENST00000335625.5	37	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	C	38	6.898556	0.97920	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000555182;ENST00000400081;ENST00000554596;ENST00000554599;ENST00000554083	.	.	.	5.4	4.46	0.54185	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.5989	0.56487	0.3011:0.6989:0.0:0.0	.	.	.	.	X	101;101;69;101;101;101;69	.	ENSP00000335592:R101X	R	+	1	2	GABRA5	24679601	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.590000	0.53979	1.365000	0.46057	0.561000	0.74099	CGA		0.582	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
WDR72	256764	broad.mit.edu	37	15	53992052	53992052	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr15:53992052G>A	ENST00000396328.1	-	13	1899	c.1660C>T	c.(1660-1662)Cgg>Tgg	p.R554W	WDR72_ENST00000360509.5_Missense_Mutation_p.R554W|WDR72_ENST00000559418.1_Missense_Mutation_p.R564W|WDR72_ENST00000557913.1_Missense_Mutation_p.R551W	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	554								p.R554W(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		AGGTGCTTCCGGGCATGCAGG	0.458																																					p.R554W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1660T	15						.						123.0	130.0	128.0					15																	53992052		2194	4293	6487	51779344	SO:0001583	missense	256764	exon13			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.1660C>T	15.37:g.53992052G>A	ENSP00000379619:p.Arg554Trp		51779344	NM_182758	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	ENST00000396328.1	37	CCDS10151.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.677367	0.68042	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.61627	0.09;0.09	5.72	4.79	0.61399	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.071260	0.56097	D	0.000026	T	0.70622	0.3245	L	0.57536	1.79	0.34392	D	0.694231	D	0.89917	1.0	D	0.69824	0.966	T	0.80677	-0.1276	10	0.87932	D	0	.	12.7214	0.57144	0.0:0.0:0.5877:0.4123	.	554	Q3MJ13	WDR72_HUMAN	W	554	ENSP00000379619:R554W;ENSP00000353699:R554W	ENSP00000353699:R554W	R	-	1	2	WDR72	51779344	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.454000	0.44979	1.510000	0.48803	0.655000	0.94253	CGG		0.458	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758	
BNC1	646	broad.mit.edu	37	15	83936886	83936886	+	Splice_Site	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr15:83936886G>A	ENST00000345382.2	-	2	283	c.198C>T	c.(196-198)caC>caT	p.H66H	BNC1_ENST00000569704.1_Splice_Site_p.H59H|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	66					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H66H(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TAAAGTTACCGTGGGCCACCC	0.418																																					p.H66H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C198T	15						.						104.0	104.0	104.0					15																	83936886		2203	4300	6503	81727890	SO:0001630	splice_region_variant	646	exon2			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.199+1C>T	15.37:g.83936886G>A			81727890	NM_001717	Q15840	Silent	SNP	ENST00000345382.2	37	CCDS10324.1																																																																																				0.418	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304006.1	NM_001717	Silent
SEPT12	124404	broad.mit.edu	37	16	4835843	4835843	+	Silent	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr16:4835843C>T	ENST00000268231.8	-	4	602	c.339G>A	c.(337-339)acG>acA	p.T113T	SEPT12_ENST00000591861.1_5'UTR|SMIM22_ENST00000589721.1_5'Flank|SEPT12_ENST00000396693.5_Silent_p.T113T|SMIM22_ENST00000589327.1_5'Flank	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12	113	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)	p.T113T(1)		NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						CGAAGCCGGGCGTGTCCGTCA	0.542																																					p.T113T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G339A	16						.						86.0	82.0	83.0					16																	4835843		2197	4300	6497	4775844	SO:0001819	synonymous_variant	124404	exon4			AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.339G>A	16.37:g.4835843C>T			4775844	NM_144605	Q0P6B0|Q1PBH0|Q96LL0	Silent	SNP	ENST00000268231.8	37	CCDS10522.1																																																																																				0.542	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251645.2	NM_144605	
UMOD	7369	broad.mit.edu	37	16	20348720	20348720	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr16:20348720G>T	ENST00000570689.1	-	8	1779	c.1633C>A	c.(1633-1635)Cag>Aag	p.Q545K	UMOD_ENST00000424589.1_Missense_Mutation_p.Q578K|UMOD_ENST00000396134.2_Missense_Mutation_p.Q578K|UMOD_ENST00000570331.1_5'UTR|UMOD_ENST00000396142.2_Missense_Mutation_p.Q545K|UMOD_ENST00000396138.4_Missense_Mutation_p.Q594K|UMOD_ENST00000302509.4_Missense_Mutation_p.Q545K			P07911	UROM_HUMAN	uromodulin	545	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)	p.Q545K(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						AATCGGCCCTGGGAGGACTCC	0.463																																					p.Q545K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1633A	16						.						102.0	105.0	104.0					16																	20348720		2203	4300	6503	20256221	SO:0001583	missense	7369	exon8			M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1633C>A	16.37:g.20348720G>T	ENSP00000460548:p.Gln545Lys		20256221	NM_003361	B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Missense_Mutation	SNP	ENST00000570689.1	37	CCDS10583.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.216660	0.39201	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4	5.62	4.65	0.58169	Zona pellucida sperm-binding protein (3);	0.281387	0.25645	N	0.029259	T	0.76716	0.4026	L	0.38175	1.15	0.30610	N	0.759567	P;B	0.51537	0.946;0.118	P;B	0.51487	0.671;0.141	T	0.72978	-0.4127	10	0.25106	T	0.35	-8.9749	9.2958	0.37815	0.0:0.1587:0.6768:0.1645	.	578;545	E9PEA4;P07911	.;UROM_HUMAN	K	545;578;578;545;523;545	ENSP00000379438:Q578K;ENSP00000416346:Q578K;ENSP00000306279:Q545K;ENSP00000379446:Q545K	ENSP00000306279:Q545K	Q	-	1	0	UMOD	20256221	0.839000	0.29477	0.446000	0.26920	0.276000	0.26787	1.149000	0.31626	1.309000	0.44985	0.655000	0.94253	CAG		0.463	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436862.1		
CLEC18B	497190	broad.mit.edu	37	16	74444804	74444804	+	Splice_Site	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr16:74444804G>A	ENST00000339953.5	-	9	1234	c.1113C>T	c.(1111-1113)atC>atT	p.I371I		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	371	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.I371I(1)		endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GGCACTCACCGATCCAGAAGT	0.597																																					p.I371I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1113T	16						.						1.0	1.0	1.0					16																	74444804		543	1201	1744	73002305	SO:0001630	splice_region_variant	497190	exon9			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.1114+1C>T	16.37:g.74444804G>A			73002305	NM_001011880	B4DF90	Silent	SNP	ENST00000339953.5	37	CCDS32484.1																																																																																				0.597	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434697.1	NM_001011880	Silent
C17orf97	400566	broad.mit.edu	37	17	263684	263684	+	Missense_Mutation	SNP	G	G	C	rs199884343	byFrequency	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr17:263684G>C	ENST00000360127.6	+	2	1066	c.1050G>C	c.(1048-1050)gaG>gaC	p.E350D	C17orf97_ENST00000571106.1_Intron|AC108004.3_ENST00000466740.2_RNA	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	380	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCGACCCCGAGGCCCTCAAGG	0.687																																					p.E350D												.	.	0			c.G1050C	17						.						15.0	22.0	19.0					17																	263684		1953	3890	5843	264030	SO:0001583	missense	400566	exon3			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.1050G>C	17.37:g.263684G>C	ENSP00000353245:p.Glu350Asp		264030	NM_001013672	A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	ENST00000360127.6	37	CCDS32519.2	.	.	.	.	.	.	.	.	.	.	g	0.018	-1.470347	0.01044	.	.	ENSG00000187624	ENST00000360127	T	0.33216	1.42	2.04	-4.08	0.03963	.	.	.	.	.	T	0.09686	0.0238	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26360	-1.0105	9	0.17369	T	0.5	.	3.5291	0.07770	0.133:0.1561:0.5526:0.1583	.	350	Q6ZQX7-4	.	D	350	ENSP00000353245:E350D	ENSP00000353245:E350D	E	+	3	2	C17orf97	264030	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.419000	0.00237	-1.607000	0.01589	-1.206000	0.01644	GAG		0.687	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255648.4	NM_001013672	
SPNS2	124976	broad.mit.edu	37	17	4433992	4433992	+	Silent	SNP	C	C	T	rs201502274		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr17:4433992C>T	ENST00000329078.3	+	4	849	c.639C>T	c.(637-639)atC>atT	p.I213I		NM_001124758.1	NP_001118230.1	Q8IVW8	SPNS2_HUMAN	spinster homolog 2 (Drosophila)	213					B cell homeostasis (GO:0001782)|bone development (GO:0060348)|lymph node development (GO:0048535)|lymphocyte migration (GO:0072676)|regulation of eye pigmentation (GO:0048073)|regulation of humoral immune response (GO:0002920)|sphingolipid metabolic process (GO:0006665)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell homeostasis (GO:0043029)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	sphingolipid transporter activity (GO:0046624)	p.I213I(1)		large_intestine(3)|lung(1)|prostate(1)|skin(1)	6						ACTCCACCATCGCCCCCACTA	0.632																																					p.I213I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C639T	17						.	C		0,3136		0,0,1568	58.0	53.0	54.0		639	0.6	1.0	17		54	1,7163		0,1,3581	no	coding-synonymous	SPNS2	NM_001124758.1		0,1,5149	TT,TC,CC		0.014,0.0,0.0097		213/550	4433992	1,10299	1568	3582	5150	4380741	SO:0001819	synonymous_variant	124976	exon4			BC041772	CCDS42237.1	17p13.2	2008-12-15				ENSG00000183018			26992	protein-coding gene	gene with protein product		612584				12815463	Standard	NM_001124758		Approved		uc002fxx.2	Q8IVW8		ENST00000329078.3:c.639C>T	17.37:g.4433992C>T			4380741	NM_001124758	B9A1T3	Silent	SNP	ENST00000329078.3	37	CCDS42237.1																																																																																				0.632	SPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438802.1		
LAMA1	284217	broad.mit.edu	37	18	7049157	7049157	+	Missense_Mutation	SNP	G	G	A	rs200844421	byFrequency	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr18:7049157G>A	ENST00000389658.3	-	5	781	c.688C>T	c.(688-690)Cgc>Tgc	p.R230C		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	230	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.R230C(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GTTCTAATGCGTTGCAAGCGA	0.483													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		16320	0.0		0.0	False		,,,				2504	0.0				p.R230C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C688T	18						.						151.0	124.0	133.0					18																	7049157		2203	4300	6503	7039157	SO:0001583	missense	284217	exon5			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.688C>T	18.37:g.7049157G>A	ENSP00000374309:p.Arg230Cys		7039157	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	18.93	3.728036	0.69074	.	.	ENSG00000101680	ENST00000389658	T	0.80653	-1.4	5.85	4.9	0.64082	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.92609	0.7652	H	0.94385	3.53	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94276	0.7515	10	0.87932	D	0	.	17.7017	0.88296	0.0:0.0:0.869:0.131	.	230	P25391	LAMA1_HUMAN	C	230	ENSP00000374309:R230C	ENSP00000374309:R230C	R	-	1	0	LAMA1	7039157	1.000000	0.71417	0.976000	0.42696	0.505000	0.33919	6.551000	0.73909	2.767000	0.95098	0.557000	0.71058	CGC		0.483	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ZNF526	116115	broad.mit.edu	37	19	42730142	42730142	+	Silent	SNP	A	A	G			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr19:42730142A>G	ENST00000301215.3	+	3	1812	c.1587A>G	c.(1585-1587)caA>caG	p.Q529Q		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	529					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q529Q(1)		autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				GTCCCTACCAATGCCTGGACT	0.642																																					p.Q529Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1587G	19						.						72.0	67.0	69.0					19																	42730142		2203	4300	6503	47421982	SO:0001819	synonymous_variant	116115	exon3			AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1587A>G	19.37:g.42730142A>G			47421982	NM_133444	B3KV29|Q69YI2|Q96E24	Silent	SNP	ENST00000301215.3	37	CCDS12598.1																																																																																				0.642	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463681.2	XM_057401	
LILRA4	23547	broad.mit.edu	37	19	54849426	54849426	+	Missense_Mutation	SNP	G	G	A	rs144792088		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr19:54849426G>A	ENST00000291759.4	-	4	492	c.436C>T	c.(436-438)Cgg>Tgg	p.R146W	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	146	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.R146W(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		AGTCCCAGCCGTGAGGCACAC	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17838	0.0		0.0	False		,,,				2504	0.0				p.R146W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C436T	19						.	G	TRP/ARG	4,4402		0,4,2199	58.0	57.0	58.0		436	-5.3	0.0	19	dbSNP_134	58	1,8599		0,1,4299	yes	missense	LILRA4	NM_012276.3	101	0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384	benign	146/500	54849426	5,13001	2203	4300	6503	59541238	SO:0001583	missense	23547	exon4			AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.436C>T	19.37:g.54849426G>A	ENSP00000291759:p.Arg146Trp		59541238	NM_012276	Q32MC4	Missense_Mutation	SNP	ENST00000291759.4	37	CCDS12890.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	.	3.918	-0.018751	0.07681	9.08E-4	1.16E-4	ENSG00000239961	ENST00000291759	T	0.03094	4.05	2.65	-5.31	0.02730	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.930270	0.00786	N	0.001306	T	0.02727	0.0082	N	0.25890	0.77	0.09310	N	1	B	0.20550	0.046	B	0.19946	0.027	T	0.37197	-0.9716	10	0.33141	T	0.24	.	1.3664	0.02202	0.4151:0.268:0.1818:0.1351	.	146	P59901	LIRA4_HUMAN	W	146	ENSP00000291759:R146W	ENSP00000291759:R146W	R	-	1	2	LILRA4	59541238	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.411000	0.02478	-2.198000	0.00749	-0.253000	0.11424	CGG		0.577	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140229.2	NM_012276	
LILRA1	11024	broad.mit.edu	37	19	55106288	55106288	+	Missense_Mutation	SNP	A	A	C	rs147848714	byFrequency	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr19:55106288A>C	ENST00000251372.3	+	4	411	c.229A>C	c.(229-231)Att>Ctt	p.I77L	LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000453777.1_Missense_Mutation_p.I77L|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	77	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.I77L(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CCCACAGGAGATTGTGAAGAA	0.562																																					p.I77L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A229C	19						.						162.0	152.0	155.0					19																	55106288		2203	4300	6503	59798100	SO:0001583	missense	11024	exon4			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.229A>C	19.37:g.55106288A>C	ENSP00000251372:p.Ile77Leu		59798100	NM_006863	O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	37	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	C	4.547	0.101544	0.08731	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	T;T	0.00695	5.83;5.83	1.62	-1.94	0.07571	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.576540	0.03526	N	0.221733	T	0.00300	0.0009	N	0.00224	-1.81	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.46693	-0.9173	10	0.25106	T	0.35	.	4.3965	0.11365	0.55:0.2547:0.1953:0.0	.	77;77	O75019-2;O75019	.;LIRA1_HUMAN	L	77	ENSP00000251372:I77L;ENSP00000413715:I77L	ENSP00000251372:I77L	I	+	1	0	LILRA1	59798100	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.742000	0.00191	-0.999000	0.03442	-0.982000	0.02568	ATT		0.562	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
COL11A1	1301	broad.mit.edu	37	1	103471859	103471859	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr1:103471859C>T	ENST00000370096.3	-	16	2008	c.1696G>A	c.(1696-1698)Gtc>Atc	p.V566I	COL11A1_ENST00000512756.1_Missense_Mutation_p.V450I|COL11A1_ENST00000353414.4_Missense_Mutation_p.V527I|COL11A1_ENST00000461720.1_5'UTR|COL11A1_ENST00000358392.2_Missense_Mutation_p.V578I	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	566	Collagen-like 2.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.V578I(2)|p.V566I(2)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GGACCCTGGACGCCTCGAGGG	0.388																																					p.V566I												.	.	4	Substitution - Missense(4)	large_intestine(2)|endometrium(2)	c.G1696A	1						.						47.0	54.0	52.0					1																	103471859		2203	4300	6503	103244447	SO:0001583	missense	1301	exon16			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1696G>A	1.37:g.103471859C>T	ENSP00000359114:p.Val566Ile		103244447	NM_001854	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.979736	0.34942	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.21	5.31	2.4	0.29515	.	0.224851	0.38959	N	0.001515	T	0.69637	0.3133	N	0.05050	-0.12	0.38900	D	0.957294	B;B;B;B	0.09022	0.002;0.001;0.001;0.002	B;B;B;B	0.06405	0.002;0.001;0.001;0.002	T	0.63134	-0.6705	10	0.13853	T	0.58	.	8.4845	0.33063	0.0:0.6505:0.0:0.3495	.	450;527;578;566	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	I	566;578;527;450	ENSP00000359114:V566I;ENSP00000351163:V578I;ENSP00000302551:V527I;ENSP00000426533:V450I	ENSP00000302551:V527I	V	-	1	0	COL11A1	103244447	0.718000	0.27976	1.000000	0.80357	0.972000	0.66771	0.399000	0.20916	1.243000	0.43853	0.563000	0.77884	GTC		0.388	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
KIRREL	55243	broad.mit.edu	37	1	158064555	158064555	+	Missense_Mutation	SNP	G	G	A	rs138458053		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr1:158064555G>A	ENST00000359209.6	+	15	1986	c.1919G>A	c.(1918-1920)cGt>cAt	p.R640H	KIRREL_ENST00000368173.3_Missense_Mutation_p.R656H|KIRREL_ENST00000360089.4_Missense_Mutation_p.R476H|KIRREL_ENST00000368172.1_Missense_Mutation_p.R454H|KIRREL_ENST00000416935.2_Missense_Mutation_p.R540H|KIRREL_ENST00000392272.2_Missense_Mutation_p.R537H			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	640					excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)	p.R476H(1)|p.R656H(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CCCTCATCCCGTCTCTCCCAC	0.677																																					p.R640H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1919A	1						.	G	HIS/ARG	0,4406		0,0,2203	42.0	45.0	44.0		1919	4.4	1.0	1	dbSNP_134	44	2,8598	2.2+/-6.3	0,2,4298	no	missense	KIRREL	NM_018240.5	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	640/758	158064555	2,13004	2203	4300	6503	156331179	SO:0001583	missense	55243	exon15			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1919G>A	1.37:g.158064555G>A	ENSP00000352138:p.Arg640His		156331179	NM_018240	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	37	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	G	27.7	4.854839	0.91355	0.0	2.33E-4	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.74421	0.16;-0.84;-0.2;-0.46;-0.38;0.0	4.38	4.38	0.52667	.	0.000000	0.43747	D	0.000522	T	0.73125	0.3547	L	0.46157	1.445	0.80722	D	1	D;D;D;D	0.76494	0.999;0.994;0.999;0.988	P;P;P;P	0.57846	0.828;0.719;0.828;0.557	T	0.75944	-0.3139	10	0.54805	T	0.06	-14.3297	14.4805	0.67579	0.0:0.0:1.0:0.0	.	540;476;454;640	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	H	476;656;537;640;540;454	ENSP00000353202:R476H;ENSP00000357155:R656H;ENSP00000376098:R537H;ENSP00000352138:R640H;ENSP00000389674:R540H;ENSP00000357154:R454H	ENSP00000352138:R640H	R	+	2	0	KIRREL	156331179	1.000000	0.71417	0.968000	0.41197	0.996000	0.88848	7.125000	0.77193	2.255000	0.74692	0.462000	0.41574	CGT		0.677	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
LAMC1	3915	broad.mit.edu	37	1	183094636	183094636	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr1:183094636G>T	ENST00000258341.4	+	15	3009	c.2752G>T	c.(2752-2754)Gct>Tct	p.A918S	LAMC1_ENST00000466964.1_3'UTR	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	918	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.A918S(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GGACTGTGGTGCTTGTGACCC	0.498																																					p.A918S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2752T	1						.						152.0	115.0	127.0					1																	183094636		2203	4300	6503	181361259	SO:0001583	missense	3915	exon15			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2752G>T	1.37:g.183094636G>T	ENSP00000258341:p.Ala918Ser		181361259	NM_002293	Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	37	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	G	2.153	-0.394074	0.04899	.	.	ENSG00000135862	ENST00000258341	T	0.61158	0.13	5.51	0.238	0.15480	EGF-like, laminin (4);	0.250343	0.46442	N	0.000294	T	0.33469	0.0864	N	0.20328	0.56	0.25745	N	0.985112	B	0.13594	0.008	B	0.14578	0.011	T	0.11891	-1.0569	10	0.22109	T	0.4	.	5.4779	0.16706	0.1826:0.0:0.4812:0.3362	.	918	P11047	LAMC1_HUMAN	S	918	ENSP00000258341:A918S	ENSP00000258341:A918S	A	+	1	0	LAMC1	181361259	0.180000	0.23148	0.000000	0.03702	0.051000	0.14879	1.582000	0.36568	-0.209000	0.10156	-0.309000	0.09137	GCT		0.498	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
ARID1A	8289	broad.mit.edu	37	1	27106858	27106858	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr1:27106858G>A	ENST00000324856.7	+	20	6840	c.6469G>A	c.(6469-6471)Gac>Aac	p.D2157N	ARID1A_ENST00000457599.2_Missense_Mutation_p.D1940N|ARID1A_ENST00000540690.1_Missense_Mutation_p.D485N|ARID1A_ENST00000374152.2_Missense_Mutation_p.D1774N	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2157					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.D2157N(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CTTCCTCAGTGACCGAAAGAA	0.592			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.D2157N			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6469A	1						.						72.0	74.0	73.0					1																	27106858		2203	4300	6503	26979445	SO:0001583	missense	8289	exon20			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6469G>A	1.37:g.27106858G>A	ENSP00000320485:p.Asp2157Asn		26979445	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.299061	0.60195	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	T;T;T;T	0.54071	0.85;0.85;0.59;0.85	5.01	5.01	0.66863	Armadillo-like helical (1);	0.095984	0.64402	D	0.000001	T	0.65709	0.2717	L	0.48362	1.52	0.58432	D	0.999997	D;D;D	0.67145	0.986;0.996;0.995	P;D;P	0.63597	0.797;0.916;0.864	T	0.64956	-0.6285	10	0.49607	T	0.09	-13.0791	18.8522	0.92237	0.0:0.0:1.0:0.0	.	1774;2157;1940	O14497-3;O14497;O14497-2	.;ARI1A_HUMAN;.	N	2157;1940;1774;485	ENSP00000320485:D2157N;ENSP00000387636:D1940N;ENSP00000363267:D1774N;ENSP00000442437:D485N	ENSP00000320485:D2157N	D	+	1	0	ARID1A	26979445	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.417000	0.80156	2.771000	0.95319	0.591000	0.81541	GAC		0.592	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
TTC22	55001	broad.mit.edu	37	1	55253429	55253429	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr1:55253429C>T	ENST00000371276.4	-	3	797	c.694G>A	c.(694-696)Gcc>Acc	p.A232T	TTC22_ENST00000371274.4_Missense_Mutation_p.A232T	NM_001114108.1	NP_001107580.1	Q5TAA0	TTC22_HUMAN	tetratricopeptide repeat domain 22	232								p.A232T(2)		kidney(1)|large_intestine(1)|lung(7)|skin(1)	10						CGGAGTAGGGCCAGCGTGCGG	0.662																																					p.A232T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G694A	1						.						59.0	51.0	54.0					1																	55253429		2203	4300	6503	55026017	SO:0001583	missense	55001	exon3			AK000626	CCDS598.1, CCDS44152.1	1p32.3	2013-01-11			ENSG00000006555	ENSG00000006555		"""Tetratricopeptide (TTC) repeat domain containing"""	26067	protein-coding gene	gene with protein product							Standard	NM_017904		Approved	FLJ20619	uc009vzt.1	Q5TAA0	OTTHUMG00000009916	ENST00000371276.4:c.694G>A	1.37:g.55253429C>T	ENSP00000360323:p.Ala232Thr		55026017	NM_001114108	Q9NWT4	Missense_Mutation	SNP	ENST00000371276.4	37	CCDS44152.1	.	.	.	.	.	.	.	.	.	.	C	1.427	-0.571390	0.03882	.	.	ENSG00000006555	ENST00000371276;ENST00000371274;ENST00000448308	T;T	0.42513	0.97;2.24	4.49	1.3	0.21679	Tetratricopeptide-like helical (1);	0.529195	0.18858	N	0.129206	T	0.22126	0.0533	N	0.19112	0.55	0.09310	N	0.999997	B;B	0.09022	0.0;0.002	B;B	0.08055	0.001;0.003	T	0.20571	-1.0271	10	0.13470	T	0.59	-17.3181	7.7103	0.28673	0.0:0.6797:0.0:0.3203	.	232;232	Q5TAA0;Q5TAA0-2	TTC22_HUMAN;.	T	232;232;13	ENSP00000360323:A232T;ENSP00000360321:A232T	ENSP00000360321:A232T	A	-	1	0	TTC22	55026017	0.093000	0.21703	0.980000	0.43619	0.027000	0.11550	0.052000	0.14163	0.504000	0.28082	0.462000	0.41574	GCC		0.662	TTC22-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027438.1	NM_017904	
ATG4C	84938	broad.mit.edu	37	1	63284867	63284867	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr1:63284867T>G	ENST00000317868.4	+	5	793	c.586T>G	c.(586-588)Tat>Gat	p.Y196D	ATG4C_ENST00000371120.3_Missense_Mutation_p.Y196D	NM_032852.3	NP_116241.2	Q96DT6	ATG4C_HUMAN	autophagy related 4C, cysteine peptidase	196					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|protein targeting to membrane (GO:0006612)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)	p.Y196D(2)	ATG4C/FBXO38(2)	NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(3)|ovary(1)|prostate(2)	19						AAATGAAGTTTATCATAGGAA	0.373																																					p.Y196D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T586G	1						.						129.0	135.0	133.0					1																	63284867		2203	4300	6503	63057455	SO:0001583	missense	84938	exon5			AK027773	CCDS623.1	1p31.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000125703	ENSG00000125703			16040	protein-coding gene	gene with protein product		611339	"""AUT (S. cerevisiae)-like 1, cysteine endopeptidase; AUT-like 1, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog C (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog C (S. cerevisiae)"""	AUTL1, APG4C		12446702	Standard	NM_032852		Approved	FLJ14867, AUTL3	uc001dau.3	Q96DT6	OTTHUMG00000009142	ENST00000317868.4:c.586T>G	1.37:g.63284867T>G	ENSP00000322159:p.Tyr196Asp		63057455	NM_178221	A6NLR8|D3DQ58|Q96K04	Missense_Mutation	SNP	ENST00000317868.4	37	CCDS623.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.221948	0.39300	.	.	ENSG00000125703	ENST00000317868;ENST00000371120;ENST00000540025	T;T	0.41065	1.01;1.01	5.92	4.8	0.61643	.	0.354360	0.33813	N	0.004535	T	0.20780	0.0500	L	0.35854	1.095	0.31123	N	0.708651	B	0.31705	0.336	B	0.39027	0.288	T	0.12293	-1.0553	10	0.33141	T	0.24	-5.8139	11.7181	0.51666	0.0:0.0685:0.0:0.9315	.	196	Q96DT6	ATG4C_HUMAN	D	196	ENSP00000322159:Y196D;ENSP00000360161:Y196D	ENSP00000322159:Y196D	Y	+	1	0	ATG4C	63057455	1.000000	0.71417	0.832000	0.32986	0.898000	0.52572	5.892000	0.69790	1.068000	0.40764	0.528000	0.53228	TAT		0.373	ATG4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025332.2	NM_032852	
IL12RB2	3595	broad.mit.edu	37	1	67793984	67793984	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr1:67793984C>G	ENST00000262345.1	+	5	1221	c.581C>G	c.(580-582)tCc>tGc	p.S194C	IL12RB2_ENST00000371000.1_Missense_Mutation_p.S194C|IL12RB2_ENST00000544434.1_Missense_Mutation_p.S194C|IL12RB2_ENST00000541374.1_Missense_Mutation_p.S194C	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	194	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						TCACCTGAATCCAATTTCACA	0.393																																					p.S194C												.	.	0			c.C581G	1						.						216.0	203.0	207.0					1																	67793984		2203	4300	6503	67566572	SO:0001583	missense	3595	exon5			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.581C>G	1.37:g.67793984C>G	ENSP00000262345:p.Ser194Cys		67566572	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.07|14.07	2.424318|2.424318	0.43020|0.43020	.|.	.|.	ENSG00000081985|ENSG00000081985	ENST00000441640|ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	.|D;D;D;D	.|0.85411	.|-1.98;-1.98;-1.98;-1.98	5.35|5.35	4.43|4.43	0.53597|0.53597	.|Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (3);Immunoglobulin-like fold (1);	.|0.550760	.|0.20452	.|N	.|0.092074	D|D	0.89371|0.89371	0.6696|0.6696	M|M	0.77616|0.77616	2.38|2.38	0.40263|0.40263	D|D	0.978197|0.978197	.|D;D;D;D	.|0.89917	.|0.999;1.0;1.0;1.0	.|D;D;D;D	.|0.73380	.|0.922;0.98;0.965;0.979	D|D	0.89541|0.89541	0.3792|0.3792	5|10	.|0.59425	.|D	.|0.04	-10.029|-10.029	10.462|10.462	0.44585|0.44585	0.0:0.907:0.0:0.093|0.0:0.907:0.0:0.093	.|.	.|194;194;194;194	.|B4DGA4;F5H7L6;Q99665-2;Q99665	.|.;.;.;I12R2_HUMAN	M|C	61|194	.|ENSP00000262345:S194C;ENSP00000360039:S194C;ENSP00000445276:S194C;ENSP00000442443:S194C	.|ENSP00000262345:S194C	I|S	+|+	3|2	3|0	IL12RB2|IL12RB2	67566572|67566572	0.940000|0.940000	0.31905|0.31905	0.853000|0.853000	0.33588|0.33588	0.411000|0.411000	0.31082|0.31082	2.897000|2.897000	0.48664|0.48664	2.497000|2.497000	0.84241|0.84241	0.561000|0.561000	0.74099|0.74099	ATC|TCC		0.393	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
IL12RB2	3595	broad.mit.edu	37	1	67794051	67794051	+	Silent	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr1:67794051C>T	ENST00000262345.1	+	5	1288	c.648C>T	c.(646-648)ttC>ttT	p.F216F	IL12RB2_ENST00000371000.1_Silent_p.F216F|IL12RB2_ENST00000544434.1_Silent_p.F216F|IL12RB2_ENST00000541374.1_Silent_p.F216F	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	216	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)	p.F216F(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						CATCCACATTCACATTCTTGG	0.348																																					p.F216F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C648T	1						.						193.0	187.0	189.0					1																	67794051		2203	4300	6503	67566639	SO:0001819	synonymous_variant	3595	exon5			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.648C>T	1.37:g.67794051C>T			67566639	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Silent	SNP	ENST00000262345.1	37	CCDS638.1	.	.	.	.	.	.	.	.	.	.	C	7.282	0.609314	0.14066	.	.	ENSG00000081985	ENST00000441640	.	.	.	5.35	2.4	0.29515	.	.	.	.	.	T	0.40619	0.1124	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24261	-1.0165	4	.	.	.	-25.4247	7.4557	0.27266	0.0:0.7241:0.0:0.2759	.	.	.	.	Y	84	.	.	H	+	1	0	IL12RB2	67566639	1.000000	0.71417	0.645000	0.29479	0.902000	0.53008	1.438000	0.35002	0.216000	0.20781	0.561000	0.74099	CAC		0.348	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
GPR37L1	9283	broad.mit.edu	37	1	202092464	202092464	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr1:202092464G>A	ENST00000367282.5	+	1	479	c.373G>A	c.(373-375)Gag>Aag	p.E125K		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	125					negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.E125K(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						TCCGGTGACCGAGAGCTCCTA	0.607																																					p.E125K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G373A	1						.						175.0	146.0	156.0					1																	202092464		2203	4300	6503	200359087	SO:0001583	missense	9283	exon1			AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.373G>A	1.37:g.202092464G>A	ENSP00000356251:p.Glu125Lys		200359087	NM_004767	B2R7M9|Q5SXP7|Q86VP7	Missense_Mutation	SNP	ENST00000367282.5	37	CCDS1420.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.632010	0.67015	.	.	ENSG00000170075	ENST00000367282	T	0.38240	1.15	5.13	5.13	0.70059	.	0.122062	0.56097	D	0.000034	T	0.37433	0.1003	L	0.59436	1.845	0.53005	D	0.999963	P	0.49185	0.92	B	0.43052	0.406	T	0.21586	-1.0241	10	0.10636	T	0.68	-31.3831	18.1765	0.89764	0.0:0.0:1.0:0.0	.	125	O60883	ETBR2_HUMAN	K	125	ENSP00000356251:E125K	ENSP00000356251:E125K	E	+	1	0	GPR37L1	200359087	1.000000	0.71417	0.995000	0.50966	0.875000	0.50365	6.812000	0.75226	2.370000	0.80446	0.462000	0.41574	GAG		0.607	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087496.2	NM_004767	
U2AF1	7307	broad.mit.edu	37	21	44514604	44514604	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr21:44514604C>G	ENST00000291552.4	-	7	644	c.552G>C	c.(550-552)gaG>gaC	p.E184D	U2AF1_ENST00000380276.2_Missense_Mutation_p.E184D|U2AF1_ENST00000486519.1_5'UTR|U2AF1_ENST00000398137.1_Missense_Mutation_p.E111D|U2AF1_ENST00000459639.1_Missense_Mutation_p.E111D	NM_006758.2	NP_006749.1	Q01081	U2AF1_HUMAN	U2 small nuclear RNA auxiliary factor 1	184	Arg/Gly/Ser-rich (RS domain).				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E184D(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(111)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	126						GGCCATACAGCTCCCGCCGCA	0.522			Mis		"""CLL, MDS"""																																p.E184D			Dom	yes		21	21q22.3	7307	U2 small nuclear RNA auxiliary factor 1		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G552C	21						.						43.0	44.0	43.0					21																	44514604		2203	4300	6503	43387673	SO:0001583	missense	7307	exon7			BC001177	CCDS13694.1, CCDS33574.1, CCDS42948.1	21q22.3	2014-09-17	2006-04-11		ENSG00000160201	ENSG00000160201		"""RNA binding motif (RRM) containing"""	12453	protein-coding gene	gene with protein product		191317	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein"", ""U2(RNU2) small nuclear RNA auxiliary factor 1"""	U2AFBP		8660980, 7956352	Standard	NM_006758		Approved	U2AF35, RNU2AF1, RN	uc002zdb.1	Q01081	OTTHUMG00000086836	ENST00000291552.4:c.552G>C	21.37:g.44514604C>G	ENSP00000291552:p.Glu184Asp		43387673	NM_006758	Q701P4|Q71RF1	Missense_Mutation	SNP	ENST00000291552.4	37	CCDS13694.1	.	.	.	.	.	.	.	.	.	.	C	16.38	3.105861	0.56291	.	.	ENSG00000160201	ENST00000459639;ENST00000380276;ENST00000291552;ENST00000398137	.	.	.	5.01	4.12	0.48240	.	0.000000	0.85682	D	0.000000	T	0.51584	0.1683	N	0.14661	0.345	0.80722	D	1	P;P	0.35745	0.518;0.518	P;P	0.48654	0.585;0.585	T	0.52675	-0.8544	9	0.35671	T	0.21	-26.423	13.426	0.61026	0.0:0.9237:0.0:0.0763	.	184;184	Q01081;Q701P4	U2AF1_HUMAN;.	D	111;184;184;111	.	ENSP00000291552:E184D	E	-	3	2	U2AF1	43387673	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.425000	0.52771	1.234000	0.43709	0.655000	0.94253	GAG		0.522	U2AF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195541.1	NM_006758	
PKDREJ	10343	broad.mit.edu	37	22	46654758	46654758	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr22:46654758C>T	ENST00000253255.5	-	1	4461	c.4462G>A	c.(4462-4464)Gaa>Aaa	p.E1488K		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1488					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)	p.E1488K(1)		NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TTAGCAGTTTCGTAAGCATGC	0.488																																					p.E1488K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4462A	22						.						153.0	148.0	150.0					22																	46654758		2203	4300	6503	45033422	SO:0001583	missense	10343	exon1			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.4462G>A	22.37:g.46654758C>T	ENSP00000253255:p.Glu1488Lys		45033422	NM_006071	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.944416	0.53079	.	.	ENSG00000130943	ENST00000253255	T	0.38887	1.11	5.05	2.95	0.34219	.	0.518101	0.14073	U	0.343251	T	0.39489	0.1080	L	0.54323	1.7	0.09310	N	1	D	0.58970	0.984	P	0.46208	0.507	T	0.17684	-1.0361	10	0.40728	T	0.16	-9.9244	6.6668	0.23044	0.0:0.6891:0.1477:0.1633	.	1488	Q9NTG1	PKDRE_HUMAN	K	1488	ENSP00000253255:E1488K	ENSP00000253255:E1488K	E	-	1	0	PKDREJ	45033422	0.015000	0.18098	0.002000	0.10522	0.001000	0.01503	2.251000	0.43187	0.640000	0.30582	-0.314000	0.08810	GAA		0.488	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
ZBED4	9889	broad.mit.edu	37	22	50280413	50280413	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr22:50280413C>G	ENST00000216268.5	+	2	3580	c.3103C>G	c.(3103-3105)Ctc>Gtc	p.L1035V		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	1035						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		GGAACTCGAACTCATGAATTC	0.562																																					p.L1035V												.	.	0			c.C3103G	22						.						59.0	54.0	56.0					22																	50280413		2203	4300	6503	48666417	SO:0001583	missense	9889	exon2			AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.3103C>G	22.37:g.50280413C>G	ENSP00000216268:p.Leu1035Val		48666417	NM_014838	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	ENST00000216268.5	37	CCDS33677.1	.	.	.	.	.	.	.	.	.	.	C	0.852	-0.738405	0.03111	.	.	ENSG00000100426	ENST00000216268	T	0.24723	1.84	5.18	-2.82	0.05787	Ribonuclease H-like (1);	0.620739	0.16062	N	0.231433	T	0.06416	0.0165	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30031	-0.9992	10	0.13108	T	0.6	-1.6096	2.8014	0.05415	0.3991:0.3576:0.1351:0.1082	.	1035	O75132	ZBED4_HUMAN	V	1035	ENSP00000216268:L1035V	ENSP00000216268:L1035V	L	+	1	0	ZBED4	48666417	0.748000	0.28294	0.002000	0.10522	0.764000	0.43329	0.270000	0.18607	-0.856000	0.04120	-0.262000	0.10625	CTC		0.562	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	NM_014838	
TPO	7173	broad.mit.edu	37	2	1544475	1544475	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr2:1544475G>A	ENST00000345913.4	+	16	2819	c.2728G>A	c.(2728-2730)Gca>Aca	p.A910T	TPO_ENST00000382198.1_Missense_Mutation_p.A737T|TPO_ENST00000349624.3_Missense_Mutation_p.A737T|TPO_ENST00000337415.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.A866T|TPO_ENST00000329066.4_Missense_Mutation_p.A910T|TPO_ENST00000382201.3_Missense_Mutation_p.A853T|TPO_ENST00000497517.2_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	910					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.A910T(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GCAGCGGGCCGCAGCTCAGGA	0.642																																					p.A866T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2596A	2						.						57.0	52.0	54.0					2																	1544475		2203	4300	6503	1523482	SO:0001583	missense	7173	exon14				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2728G>A	2.37:g.1544475G>A	ENSP00000318820:p.Ala910Thr		1523482	NM_175721	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	G	1.032	-0.681483	0.03353	.	.	ENSG00000115705	ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607;ENST00000425083	T;T;T;T;T;T;T;T;T	0.69306	-0.2;-0.16;0.05;-0.2;-0.13;0.05;-0.2;0.61;-0.39	1.36	-2.73	0.05950	.	33.927500	0.00166	U	0.000017	T	0.42877	0.1222	N	0.08118	0	0.09310	N	1	B;B;B;B	0.25743	0.011;0.133;0.013;0.102	B;B;B;B	0.21917	0.003;0.037;0.002;0.012	T	0.18808	-1.0325	10	0.41790	T	0.15	5.4423	3.0841	0.06272	0.0:0.2728:0.4159:0.3112	.	866;737;853;910	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	T	910;866;737;910;853;737;795;340;131	ENSP00000318820:A910T;ENSP00000263886:A866T;ENSP00000332044:A737T;ENSP00000329869:A910T;ENSP00000371636:A853T;ENSP00000371633:A737T;ENSP00000405788:A795T;ENSP00000419461:A340T;ENSP00000389659:A131T	ENSP00000329869:A910T	A	+	1	0	TPO	1523482	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.594000	0.05733	-0.907000	0.03862	0.196000	0.17591	GCA		0.642	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
COL5A2	1290	broad.mit.edu	37	2	189922092	189922092	+	Missense_Mutation	SNP	G	G	A	rs150260969	byFrequency	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr2:189922092G>A	ENST00000374866.3	-	34	2565	c.2291C>T	c.(2290-2292)cCg>cTg	p.P764L		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	764					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.P764L(1)|p.P764R(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TCTTTCTCCCGGCATACCTTG	0.438																																					p.P764L												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C2291T	2						.						69.0	70.0	70.0					2																	189922092		2203	4300	6503	189630337	SO:0001583	missense	1290	exon34			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.2291C>T	2.37:g.189922092G>A	ENSP00000364000:p.Pro764Leu		189630337	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625400	0.87560	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.96885	-4.16	5.92	5.92	0.95590	.	0.000000	0.50627	D	0.000106	D	0.98566	0.9521	M	0.90369	3.11	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.98;0.998	D	0.98745	1.0718	9	.	.	.	.	20.3151	0.98650	0.0:0.0:1.0:0.0	.	404;764	Q5PR22;P05997	.;CO5A2_HUMAN	L	764;404	ENSP00000364000:P764L	.	P	-	2	0	COL5A2	189630337	1.000000	0.71417	0.976000	0.42696	0.971000	0.66376	9.869000	0.99810	2.809000	0.96659	0.467000	0.42956	CCG		0.438	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
STON1	11037	broad.mit.edu	37	2	48809567	48809567	+	Missense_Mutation	SNP	C	C	T	rs147440328		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr2:48809567C>T	ENST00000406226.1	+	3	1990	c.1795C>T	c.(1795-1797)Cgc>Tgc	p.R599C	STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.R599C|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.R599C|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.R599C|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.R599C|STON1_ENST00000404752.1_Missense_Mutation_p.R599C|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.R599C|STON1_ENST00000309835.3_Missense_Mutation_p.R599C	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	599	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)		p.R599C(2)		NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TAAAATGAACCGCCGAGCATG	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		19260	0.001		0.0	False		,,,				2504	0.0				p.R599C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1795T	2						.	C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	70.0	72.0	72.0		1795,1795,1795,1795,1795	5.7	1.0	2	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	STON1,STON1-GTF2A1L	NM_001198593.1,NM_001198594.1,NM_001198595.1,NM_006873.3,NM_172311.2	180,180,180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	599/1159,599/1136,599/736,599/736,599/1183	48809567	1,13005	2203	4300	6503	48663071	SO:0001583	missense	286749	exon1			AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1795C>T	2.37:g.48809567C>T	ENSP00000384615:p.Arg599Cys		48663071	NM_001198594	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Missense_Mutation	SNP	ENST00000406226.1	37	CCDS1841.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	20.2	3.957798	0.73902	0.0	1.16E-4	ENSG00000243244;ENSG00000243244;ENSG00000243244;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781	ENST00000404752;ENST00000406226;ENST00000309835;ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751	T;T;T;T;T;T;T;T	0.14893	2.53;2.53;2.53;2.49;2.47;2.49;2.49;2.68	5.65	5.65	0.86999	Clathrin adaptor, mu subunit, C-terminal (3);	0.088275	0.85682	D	0.000000	T	0.41419	0.1158	M	0.74881	2.28	0.54753	D	0.999988	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.966;0.995	T	0.15723	-1.0427	10	0.87932	D	0	.	12.4592	0.55723	0.2736:0.7264:0.0:0.0	.	599;599;599	A8MXJ1;Q53S48;Q9Y6Q2	.;.;STON1_HUMAN	C	599	ENSP00000385273:R599C;ENSP00000384615:R599C;ENSP00000310969:R599C;ENSP00000385499:R599C;ENSP00000385701:R599C;ENSP00000378236:R599C;ENSP00000311493:R599C;ENSP00000378234:R599C	ENSP00000310969:R599C	R	+	1	0	STON1-GTF2A1L;STON1	48663071	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.572000	0.74005	2.941000	0.99782	0.655000	0.94253	CGC		0.483	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	NM_006873	
SPHKAP	80309	broad.mit.edu	37	2	228882354	228882354	+	Silent	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr2:228882354G>A	ENST00000392056.3	-	7	3262	c.3216C>T	c.(3214-3216)ggC>ggT	p.G1072G	SPHKAP_ENST00000344657.5_Silent_p.G1072G	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1072						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.G1072G(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCCACCTGTCGCCACTCAGTA	0.587																																					p.G1072G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3216T	2						.						44.0	47.0	46.0					2																	228882354		2203	4300	6503	228590598	SO:0001819	synonymous_variant	80309	exon7				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3216C>T	2.37:g.228882354G>A			228590598	NM_001142644	Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	ENST00000392056.3	37	CCDS46537.1																																																																																				0.587	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
CNTN6	27255	broad.mit.edu	37	3	1363375	1363375	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr3:1363375C>T	ENST00000446702.2	+	8	1430	c.803C>T	c.(802-804)cCg>cTg	p.P268L	CNTN6_ENST00000350110.2_Missense_Mutation_p.P268L|CNTN6_ENST00000539053.1_Missense_Mutation_p.P196L			Q9UQ52	CNTN6_HUMAN	contactin 6	268	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.P268L(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GACGGGAGCCCGTTGCCAGGG	0.428																																					p.P268L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C803T	3						.						124.0	129.0	127.0					3																	1363375		2203	4299	6502	1338375	SO:0001583	missense	27255	exon8			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.803C>T	3.37:g.1363375C>T	ENSP00000407822:p.Pro268Leu		1338375	NM_014461	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	37	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.386922	0.42308	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.68025	-0.3;-0.3;-0.3	5.9	3.05	0.35203	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.218694	0.32935	N	0.005472	T	0.52917	0.1764	L	0.49571	1.57	0.51482	D	0.999929	B	0.15473	0.013	B	0.11329	0.006	T	0.36625	-0.9740	10	0.09338	T	0.73	.	7.9609	0.30070	0.0:0.7387:0.0:0.2613	.	268	Q9UQ52	CNTN6_HUMAN	L	268;196;268	ENSP00000407822:P268L;ENSP00000442791:P196L;ENSP00000341882:P268L	ENSP00000341882:P268L	P	+	2	0	CNTN6	1338375	0.068000	0.21057	0.979000	0.43373	0.938000	0.57974	2.822000	0.48073	0.765000	0.33221	0.650000	0.86243	CCG		0.428	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
SLITRK3	22865	broad.mit.edu	37	3	164908339	164908340	+	Frame_Shift_Del	DEL	TA	TA	-	rs147314981		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	TA	TA					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr3:164908339_164908340delTA	ENST00000475390.1	-	2	722_723	c.279_280delTA	c.(277-282)tataccfs	p.T94fs	SLITRK3_ENST00000241274.3_Frame_Shift_Del_p.T94fs			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	94					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.T94fs*8(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						AAACTGTTGGTATATAATTTCC	0.342										HNSCC(40;0.11)																											p.93_94del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.279_280del	3						.																																			166391034	SO:0001589	frameshift_variant	22865	exon2			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.279_280delTA	3.37:g.164908343_164908344delTA	ENSP00000420091:p.Thr94fs		166391033	NM_014926	Q1RMY6	Frame_Shift_Del	DEL	ENST00000475390.1	37	CCDS3197.1																																																																																				0.342	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
EIF4A2	1974	broad.mit.edu	37	3	186503785	186503787	+	In_Frame_Del	DEL	TAT	TAT	-	rs142804104		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	TAT	TAT	TAT	-	TAT	TAT	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr3:186503785_186503787delTAT	ENST00000323963.5	+	5	526_528	c.462_464delTAT	c.(460-465)catatt>cat	p.I155del	SNORA63_ENST00000363548.1_RNA|SNORA4_ENST00000584302.1_RNA|EIF4A2_ENST00000440191.2_In_Frame_Del_p.I156del|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000356531.5_In_Frame_Del_p.I60del|SNORA81_ENST00000408493.2_RNA|RP11-573D15.9_ENST00000577781.1_RNA|SNORA63_ENST00000363450.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	155	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.I155delI(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		AAGCACCACATATTGTTGTTGGT	0.379			T	BCL6	NHL																																p.154_155del			Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	.	1	Deletion - In frame(1)	large_intestine(1)	c.462_464del	3						.																																			187986481	SO:0001651	inframe_deletion	1974	exon5			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.462_464delTAT	3.37:g.186503785_186503787delTAT	ENSP00000326381:p.Ile155del		187986479	NM_001967	D3DNU9|Q53XJ6|Q96B90|Q96EA8	In_Frame_Del	DEL	ENST00000323963.5	37	CCDS3282.1																																																																																				0.379	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
PCDH10	57575	broad.mit.edu	37	4	134073292	134073292	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr4:134073292C>T	ENST00000264360.5	+	1	2823	c.1997C>T	c.(1996-1998)cCg>cTg	p.P666L		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	666	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P666L(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CATGGGCAGCCGCCCCTTTCC	0.731																																					p.P666L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1997T	4						.						17.0	21.0	19.0					4																	134073292		2192	4288	6480	134292742	SO:0001583	missense	57575	exon1			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1997C>T	4.37:g.134073292C>T	ENSP00000264360:p.Pro666Leu		134292742	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416186	0.83449	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.57436	0.4	4.47	4.47	0.54385	Cadherin (4);Cadherin-like (1);	0.000000	0.43260	D	0.000590	T	0.72622	0.3483	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.77349	-0.2621	10	0.87932	D	0	.	16.933	0.86196	0.0:1.0:0.0:0.0	.	666;666	Q9P2E7;Q96SF0	PCD10_HUMAN;.	L	666	ENSP00000264360:P666L	ENSP00000264360:P666L	P	+	2	0	PCDH10	134292742	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.443000	0.80521	2.310000	0.77875	0.655000	0.94253	CCG		0.731	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
NPR3	4883	broad.mit.edu	37	5	32786369	32786369	+	Missense_Mutation	SNP	G	G	A	rs201694177		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr5:32786369G>A	ENST00000265074.8	+	8	1887	c.1544G>A	c.(1543-1545)cGa>cAa	p.R515Q	NPR3_ENST00000415167.2_Missense_Mutation_p.R514Q|AC026703.1_ENST00000326958.1_5'Flank|NPR3_ENST00000415685.2_Missense_Mutation_p.R298Q|NPR3_ENST00000434067.2_Missense_Mutation_p.R299Q	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	515					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)	p.R515Q(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	ATTGAGAGGCGAACCCAGCAA	0.403																																					p.R514Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1541A	5						.						69.0	65.0	66.0					5																	32786369		1835	4085	5920	32822126	SO:0001583	missense	4883	exon8				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.1544G>A	5.37:g.32786369G>A	ENSP00000265074:p.Arg515Gln		32822126	NM_000908	A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	ENST00000265074.8	37	CCDS56357.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138423	0.94560	.	.	ENSG00000113389	ENST00000434067;ENST00000415685;ENST00000265074;ENST00000415167	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.63129	0.2485	L	0.27053	0.805	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.992;0.992	T	0.56426	-0.7981	10	0.30854	T	0.27	-6.1153	20.8794	0.99867	0.0:0.0:1.0:0.0	.	298;515;514	E7EPG9;P17342;Q60I31	.;ANPRC_HUMAN;.	Q	299;298;515;514	ENSP00000388408:R299Q;ENSP00000402490:R298Q;ENSP00000265074:R515Q;ENSP00000398028:R514Q	ENSP00000265074:R515Q	R	+	2	0	NPR3	32822126	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.443000	0.90320	2.941000	0.99782	0.655000	0.94253	CGA		0.403	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908	
ADAMTS12	81792	broad.mit.edu	37	5	33576343	33576343	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr5:33576343G>A	ENST00000504830.1	-	19	4123	c.3788C>T	c.(3787-3789)aCg>aTg	p.T1263M	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.T1178M|ADAMTS12_ENST00000504582.1_5'Flank	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1263	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T1263M(2)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						ACGGTTTGCCGTCTTTCCTGA	0.502										HNSCC(64;0.19)																											p.T1263M												.	.	2	Substitution - Missense(2)	urinary_tract(1)|large_intestine(1)	c.C3788T	5						.						199.0	198.0	198.0					5																	33576343		2203	4300	6503	33612100	SO:0001583	missense	81792	exon19			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3788C>T	5.37:g.33576343G>A	ENSP00000422554:p.Thr1263Met		33612100	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	2.426	-0.331954	0.05314	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.59638	0.26;0.25	5.42	1.0	0.19881	.	2.214480	0.01524	N	0.018491	T	0.36193	0.0958	N	0.14661	0.345	0.09310	N	1	B;B	0.33171	0.4;0.279	B;B	0.27380	0.079;0.022	T	0.28364	-1.0046	10	0.46703	T	0.11	.	1.0625	0.01604	0.4257:0.1432:0.2642:0.1669	.	1178;1263	P58397-3;P58397	.;ATS12_HUMAN	M	1263;1178	ENSP00000422554:T1263M;ENSP00000344847:T1178M	ENSP00000344847:T1178M	T	-	2	0	ADAMTS12	33612100	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.466000	0.22019	0.263000	0.21812	0.655000	0.94253	ACG		0.502	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
APC	324	broad.mit.edu	37	5	112175021	112175021	+	Nonsense_Mutation	SNP	C	C	T	rs79122263		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr5:112175021C>T	ENST00000457016.1	+	16	4110	c.3730C>T	c.(3730-3732)Caa>Taa	p.Q1244*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1244*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1244*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1244	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.A1246fs*10(1)|p.Q1244*(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGGTCAGCCTCAAAAGGCTGC	0.398		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1226X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	4	Substitution - Nonsense(1)|Unknown(1)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	large_intestine(2)|soft_tissue(1)|skin(1)	c.C3676T	5	GRCh37	CM010756	APC	M	rs79122263	.						47.0	47.0	47.0					5																	112175021		2202	4300	6502	112202920	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3730C>T	5.37:g.112175021C>T	ENSP00000413133:p.Gln1244*		112202920	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	6.816074	0.97861	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.03	5.16	0.70880	.	0.519951	0.20111	N	0.099017	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	0.1506	10.2904	0.43592	0.1343:0.7982:0.0:0.0675	.	.	.	.	X	1244	.	.	Q	+	1	0	APC	112202920	0.989000	0.36119	0.217000	0.23759	0.970000	0.65996	3.202000	0.51067	1.558000	0.49541	0.655000	0.94253	CAA		0.398	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
SLC35B2	347734	broad.mit.edu	37	6	44222161	44222162	+	3'UTR	INS	-	-	TG	rs111408583|rs35131506|rs397773171|rs3832441	byFrequency	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr6:44222161_44222162insTG	ENST00000393812.3	-	0	1723_1724				SLC35B2_ENST00000537814.1_3'UTR|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000495706.1_5'UTR|SLC35B2_ENST00000393810.1_3'UTR	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2						3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGAAGAGTAACTGGAACCTACC	0.525														3642	0.727236	0.7421	0.6671	5008	,	,		17383	0.745		0.7306	False		,,,				2504	0.728				.												.	.	0			.	6						.																																			44330140	SO:0001624	3_prime_UTR_variant	347734	.			AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.*282->CA	6.37:g.44222162_44222163dupTG			44330139	.	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Splice_Site	INS	ENST00000393812.3	37	CCDS34462.1																																																																																				0.525	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040724.2		
ATG5	9474	broad.mit.edu	37	6	106649850	106649850	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr6:106649850C>T	ENST00000369076.3	-	7	1011	c.688G>A	c.(688-690)Gaa>Aaa	p.E230K	ATG5_ENST00000475645.1_5'UTR|ATG5_ENST00000343245.3_Missense_Mutation_p.E230K|ATG5_ENST00000369070.1_Missense_Mutation_p.E152K|ATG5_ENST00000360666.4_3'UTR	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	230					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)		p.E230K(1)		endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		GTATTACCTTCAGGATCAATA	0.373																																					p.E230K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G688A	6						.						97.0	93.0	95.0					6																	106649850		2203	4300	6503	106756543	SO:0001583	missense	9474	exon7			Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.688G>A	6.37:g.106649850C>T	ENSP00000358072:p.Glu230Lys		106756543	NM_004849	O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	ENST00000369076.3	37	CCDS5055.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434957	0.62955	.	.	ENSG00000057663	ENST00000369076;ENST00000343245;ENST00000369070	.	.	.	5.09	5.09	0.68999	.	0.050541	0.85682	D	0.000000	T	0.36026	0.0952	L	0.43152	1.355	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.10450	0.004;0.005	T	0.38585	-0.9654	9	0.07175	T	0.84	.	17.2828	0.87133	0.0:1.0:0.0:0.0	.	152;230	Q9H1Y0-2;Q9H1Y0	.;ATG5_HUMAN	K	230;230;152	.	ENSP00000343313:E230K	E	-	1	0	ATG5	106756543	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.038000	0.57318	2.366000	0.80165	0.561000	0.74099	GAA		0.373	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043476.1	NM_004849	
SCML4	256380	broad.mit.edu	37	6	108071008	108071008	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr6:108071008G>A	ENST00000369020.3	-	3	411	c.166C>T	c.(166-168)Cgg>Tgg	p.R56W	SCML4_ENST00000369021.3_Missense_Mutation_p.R27W|SCML4_ENST00000369022.2_5'UTR	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	56					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R27W(1)		endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		ATGAGAACCCGAGACTTGATC	0.557																																					p.R56W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C166T	6						.						64.0	66.0	65.0					6																	108071008		2203	4300	6503	108177701	SO:0001583	missense	256380	exon3				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.166C>T	6.37:g.108071008G>A	ENSP00000358016:p.Arg56Trp		108177701	NM_198081	B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	ENST00000369020.3	37	CCDS5060.2	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630162	0.46944	.	.	ENSG00000146285	ENST00000369020;ENST00000369021;ENST00000440927	T;T;T	0.58652	0.71;0.32;0.49	5.31	4.41	0.53225	.	.	.	.	.	T	0.63920	0.2552	M	0.66939	2.045	0.32947	D	0.51922	D;D;D	0.89917	0.99;0.998;1.0	P;P;D	0.73708	0.53;0.762;0.981	T	0.65981	-0.6036	9	0.38643	T	0.18	.	14.9849	0.71339	0.0:0.0:0.8562:0.1438	.	56;56;27	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	W	56;27;27	ENSP00000358016:R56W;ENSP00000358017:R27W;ENSP00000404688:R27W	ENSP00000358016:R56W	R	-	1	2	SCML4	108177701	1.000000	0.71417	0.971000	0.41717	0.090000	0.18270	5.185000	0.65076	1.152000	0.42452	0.655000	0.94253	CGG		0.557	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000041700.3	XM_171128	
ARG1	383	broad.mit.edu	37	6	131904598	131904598	+	Missense_Mutation	SNP	G	G	A	rs372489226		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr6:131904598G>A	ENST00000368087.3	+	7	908	c.769G>A	c.(769-771)Ggt>Agt	p.G257S	ARG1_ENST00000356962.2_Missense_Mutation_p.G265S|MED23_ENST00000354577.4_Intron			P05089	ARGI1_HUMAN	arginase 1	257					arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|liver development (GO:0001889)|lung development (GO:0030324)|mammary gland involution (GO:0060056)|maternal process involved in female pregnancy (GO:0060135)|positive regulation of endothelial cell proliferation (GO:0001938)|protein homotrimerization (GO:0070207)|regulation of L-arginine import (GO:0010963)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to herbicide (GO:0009635)|response to manganese ion (GO:0010042)|response to methylmercury (GO:0051597)|response to selenium ion (GO:0010269)|response to vitamin A (GO:0033189)|response to vitamin E (GO:0033197)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	arginase activity (GO:0004053)|manganese ion binding (GO:0030145)	p.G257S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|skin(3)	14	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0106)|OV - Ovarian serous cystadenocarcinoma(155;0.0713)	L-Ornithine(DB00129)	ATACAGAGAAGGTCTCTACAT	0.408																																					p.G257S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G769A	6						.	G	SER/GLY,	1,4405	2.1+/-5.4	0,1,2202	97.0	93.0	94.0		769,	5.1	1.0	6		94	0,8600		0,0,4300	no	missense,intron	ARG1,MED23	NM_000045.3,NM_015979.2	56,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,	257/323,	131904598	1,13005	2203	4300	6503	131946291	SO:0001583	missense	383	exon7				CCDS5145.1, CCDS59038.1	6q23	2013-05-01	2013-05-01		ENSG00000118520	ENSG00000118520	3.5.3.1		663	protein-coding gene	gene with protein product		608313	"""arginase, liver"""			22959135	Standard	NM_000045		Approved		uc003qcp.2	P05089	OTTHUMG00000015566	ENST00000368087.3:c.769G>A	6.37:g.131904598G>A	ENSP00000357066:p.Gly257Ser		131946291	NM_000045	A6NEA0|Q5JWT5|Q5JWT6|Q8TE72|Q9BS50	Missense_Mutation	SNP	ENST00000368087.3	37	CCDS5145.1	.	.	.	.	.	.	.	.	.	.	G	34	5.403252	0.96051	2.27E-4	0.0	ENSG00000118520	ENST00000368087;ENST00000356962	D;D	0.84516	-1.86;-1.86	6.01	5.14	0.70334	Ureohydrolase domain (1);	0.000000	0.85682	D	0.000000	D	0.87313	0.6146	L	0.55743	1.74	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72982	0.979;0.978	D	0.87020	0.2128	10	0.38643	T	0.18	-18.4281	15.1337	0.72545	0.0:0.1419:0.8581:0.0	.	265;257	P05089-2;P05089	.;ARGI1_HUMAN	S	257;265	ENSP00000357066:G257S;ENSP00000349446:G265S	ENSP00000349446:G265S	G	+	1	0	ARG1	131946291	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.359000	0.79477	1.542000	0.49330	0.650000	0.86243	GGT		0.408	ARG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042223.1		
SYNCRIP	10492	broad.mit.edu	37	6	86328573	86328573	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr6:86328573C>G	ENST00000369622.3	-	10	1743	c.1243G>C	c.(1243-1245)Gaa>Caa	p.E415Q	SYNCRIP_ENST00000355238.6_Missense_Mutation_p.E415Q	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	415	Interaction with APOBEC1.				cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E415Q(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		GCTTTTCTTTCTTTCCTTTTC	0.294																																					p.E317Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G949C	6						.						35.0	37.0	36.0					6																	86328573		2199	4297	6496	86385292	SO:0001583	missense	10492	exon9			AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.1243G>C	6.37:g.86328573C>G	ENSP00000358635:p.Glu415Gln		86385292	NM_001159673	E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Missense_Mutation	SNP	ENST00000369622.3	37	CCDS5005.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.759186	0.69763	.	.	ENSG00000135316	ENST00000355238;ENST00000369622	T;T	0.74209	-0.82;-0.82	5.27	5.27	0.74061	Nucleotide-binding, alpha-beta plait (1);	0.142256	0.64402	D	0.000006	T	0.81054	0.4743	M	0.67953	2.075	0.80722	D	1	B;D;B;P;P;B;B	0.58970	0.063;0.984;0.404;0.792;0.938;0.336;0.063	B;P;B;B;P;B;B	0.60789	0.073;0.879;0.085;0.176;0.756;0.176;0.073	T	0.80236	-0.1466	10	0.46703	T	0.11	.	19.2355	0.93856	0.0:1.0:0.0:0.0	.	415;380;317;263;380;415;415	O60506;O60506-2;B7Z645;O60506-5;O60506-4;O60506-3;B2R8Z8	HNRPQ_HUMAN;.;.;.;.;.;.	Q	415	ENSP00000347380:E415Q;ENSP00000358635:E415Q	ENSP00000347380:E415Q	E	-	1	0	SYNCRIP	86385292	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.775000	0.85489	2.622000	0.88805	0.591000	0.81541	GAA		0.294	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041396.1	NM_006372	
GPR31	2853	broad.mit.edu	37	6	167570419	167570419	+	Nonsense_Mutation	SNP	G	G	A	rs148093951	byFrequency	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr6:167570419G>A	ENST00000366834.1	-	1	1398	c.901C>T	c.(901-903)Cga>Tga	p.R301*		NM_005299.2	NP_005290.2	O00270	GPR31_HUMAN	G protein-coupled receptor 31	301					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R301*(1)		NS(1)|endometrium(4)|large_intestine(4)|lung(7)|prostate(1)	17		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		CCTTTGCCTCGGAGGGTGTGG	0.592													G|||	4	0.000798722	0.0015	0.0029	5008	,	,		17131	0.0		0.0	False		,,,				2504	0.0				p.R301X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C901T	6						.	G	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	52.0	56.0	55.0		901	-0.8	0.0	6	dbSNP_134	55	2,8598	2.2+/-6.3	0,2,4298	yes	stop-gained	GPR31	NM_005299.2		0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231		301/320	167570419	3,13003	2203	4300	6503	167490409	SO:0001587	stop_gained	2853	exon1			U65402	CCDS5299.1	6q27	2012-08-21				ENSG00000120436		"""GPCR / Class A : Orphans"""	4486	protein-coding gene	gene with protein product	"""hydroxyeicosatetraenoic (HETE) acid receptor 1"", ""12-(S)-HETE acid receptor"""	602043				9205127, 21712392	Standard	NM_005299		Approved	HETER1, 12-HETER	uc011egq.2	O00270		ENST00000366834.1:c.901C>T	6.37:g.167570419G>A	ENSP00000355799:p.Arg301*		167490409	NM_005299	B0M0K2|Q4VBL3|Q9NQ20	Nonsense_Mutation	SNP	ENST00000366834.1	37	CCDS5299.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	38	6.961349	0.97964	2.27E-4	2.33E-4	ENSG00000120436	ENST00000366834	.	.	.	3.54	-0.806	0.10875	.	1.187290	0.06931	U	0.811114	.	.	.	.	.	.	0.45718	D	0.998621	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-8.0189	10.9217	0.47169	0.0:0.0:0.6252:0.3748	.	.	.	.	X	301	.	ENSP00000355799:R301X	R	-	1	2	GPR31	167490409	0.000000	0.05858	0.000000	0.03702	0.266000	0.26442	-1.229000	0.02945	-0.167000	0.10871	0.313000	0.20887	CGA		0.592	GPR31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043111.1	NM_005299	
HECW1	23072	broad.mit.edu	37	7	43548589	43548589	+	Silent	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr7:43548589G>A	ENST00000395891.2	+	24	4493	c.3888G>A	c.(3886-3888)tcG>tcA	p.S1296S	AC011738.4_ENST00000436105.1_RNA|HECW1_ENST00000453890.1_Silent_p.S1262S	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1296	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S1275S(1)		NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GTGGCCCCTCGCGGGAGTTCT	0.537																																					p.S1296S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3888A	7						.						131.0	129.0	130.0					7																	43548589		1867	4105	5972	43515114	SO:0001819	synonymous_variant	23072	exon24			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3888G>A	7.37:g.43548589G>A			43515114	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	37	CCDS5469.2																																																																																				0.537	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
DDX56	54606	broad.mit.edu	37	7	44608737	44608737	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr7:44608737G>A	ENST00000258772.5	-	10	1391	c.1285C>T	c.(1285-1287)Cgc>Tgc	p.R429C	DDX56_ENST00000431640.1_Missense_Mutation_p.R389C|DDX56_ENST00000485367.1_5'UTR	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	429					ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)	p.R429C(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						ACCCTGCAGCGATAGCGGAAG	0.627																																					p.R429C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1285T	7						.						63.0	63.0	63.0					7																	44608737		2203	4300	6503	44575262	SO:0001583	missense	54606	exon10			AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.1285C>T	7.37:g.44608737G>A	ENSP00000258772:p.Arg429Cys		44575262	NM_019082	A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	ENST00000258772.5	37	CCDS5492.1	.	.	.	.	.	.	.	.	.	.	.	19.13	3.768566	0.69878	.	.	ENSG00000136271	ENST00000258772;ENST00000431640;ENST00000448192	T;T	0.07021	3.36;3.23	4.86	3.98	0.46160	.	0.000000	0.85682	D	0.000000	T	0.34716	0.0907	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.989;0.995	T	0.36915	-0.9728	10	0.87932	D	0	-19.5189	10.6773	0.45794	0.0931:0.0:0.9069:0.0	.	389;429	C9JV95;Q9NY93	.;DDX56_HUMAN	C	429;389;34	ENSP00000258772:R429C;ENSP00000393488:R389C	ENSP00000258772:R429C	R	-	1	0	DDX56	44575262	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.252000	0.43196	1.268000	0.44264	0.655000	0.94253	CGC		0.627	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251291.1	NM_019082	
KEL	3792	broad.mit.edu	37	7	142639595	142639595	+	Missense_Mutation	SNP	G	G	A	rs370938244		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr7:142639595G>A	ENST00000355265.2	-	18	2437	c.1963C>T	c.(1963-1965)Cgg>Tgg	p.R655W		NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	655					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.R655W(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CCATGGTGCCGTAACAGCCTC	0.597																																					p.R655W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1963T	7						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	59.0	40.0	46.0		1963	-8.7	0.0	7		46	0,8600		0,0,4300	no	missense	KEL	NM_000420.2	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	655/733	142639595	1,13005	2203	4300	6503	142349717	SO:0001583	missense	3792	exon18			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1963C>T	7.37:g.142639595G>A	ENSP00000347409:p.Arg655Trp		142349717	NM_000420	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	ENST00000355265.2	37	CCDS34766.1	.	.	.	.	.	.	.	.	.	.	G	6.176	0.400625	0.11696	2.27E-4	0.0	ENSG00000197993	ENST00000355265	D	0.90788	-2.73	4.34	-8.67	0.00863	Peptidase M13, neprilysin, C-terminal (1);	3.616020	0.01020	N	0.003977	T	0.82093	0.4962	L	0.33093	0.98	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.68842	-0.5302	10	0.44086	T	0.13	-22.5163	3.9028	0.09169	0.0966:0.2072:0.4197:0.2765	.	655	P23276	KELL_HUMAN	W	655	ENSP00000347409:R655W	ENSP00000347409:R655W	R	-	1	2	KEL	142349717	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.704000	0.00822	-3.552000	0.00142	-1.446000	0.01064	CGG		0.597	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
CSMD3	114788	broad.mit.edu	37	8	113237018	113237018	+	Silent	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr8:113237018C>T	ENST00000297405.5	-	71	11350	c.11106G>A	c.(11104-11106)acG>acA	p.T3702T	CSMD3_ENST00000343508.3_Silent_p.T3662T|CSMD3_ENST00000352409.3_Silent_p.T3632T|CSMD3_ENST00000455883.2_Silent_p.T3533T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3702						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T3702T(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTGTGCAAACCGTGTTCAAGT	0.418										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.T3702T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G11106A	8						.						360.0	302.0	322.0					8																	113237018		2203	4300	6503	113306194	SO:0001819	synonymous_variant	114788	exon71			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.11106G>A	8.37:g.113237018C>T			113306194	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																				0.418	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
OR13F1	138805	broad.mit.edu	37	9	107267421	107267421	+	Missense_Mutation	SNP	G	G	A	rs138205504		TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr9:107267421G>A	ENST00000334726.2	+	1	967	c.878G>A	c.(877-879)cGg>cAg	p.R293Q		NM_001004485.1	NP_001004485.1	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F, member 1	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R293Q(1)		endometrium(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TATAGTCTACGGAACAAAGAG	0.388																																					p.R293Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G878A	9						.	G	GLN/ARG	3,4403	4.2+/-10.8	0,3,2200	48.0	50.0	49.0		878	4.3	1.0	9	dbSNP_134	49	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR13F1	NM_001004485.1	43	0,4,6499	AA,AG,GG		0.0116,0.0681,0.0308	probably-damaging	293/320	107267421	4,13002	2203	4300	6503	106307242	SO:0001583	missense	138805	exon1				CCDS35087.1	9q31.1	2013-09-24			ENSG00000186881	ENSG00000186881		"""GPCR / Class A : Olfactory receptors"""	14723	protein-coding gene	gene with protein product							Standard	NM_001004485		Approved		uc011lvm.2	Q8NGS4	OTTHUMG00000020404	ENST00000334726.2:c.878G>A	9.37:g.107267421G>A	ENSP00000334452:p.Arg293Gln		106307242	NM_001004485	Q6IF50	Missense_Mutation	SNP	ENST00000334726.2	37	CCDS35087.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.965354	0.74131	6.81E-4	1.16E-4	ENSG00000186881	ENST00000334726	T	0.41065	1.01	4.3	4.3	0.51218	.	0.137977	0.31102	N	0.008248	T	0.58032	0.2094	L	0.56199	1.76	0.26233	N	0.978989	D	0.89917	1.0	D	0.68765	0.96	T	0.51803	-0.8659	10	0.87932	D	0	.	15.0807	0.72113	0.0:0.0:1.0:0.0	.	293	Q8NGS4	O13F1_HUMAN	Q	293	ENSP00000334452:R293Q	ENSP00000334452:R293Q	R	+	2	0	OR13F1	106307242	0.213000	0.23551	0.975000	0.42487	0.967000	0.64934	3.026000	0.49689	2.681000	0.91329	0.655000	0.94253	CGG		0.388	OR13F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053475.1		
ZCCHC6	79670	broad.mit.edu	37	9	88967760	88967760	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr9:88967760C>G	ENST00000375963.3	-	2	527	c.355G>C	c.(355-357)Gga>Cga	p.G119R	ZCCHC6_ENST00000375947.1_5'Flank|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.G119R|ZCCHC6_ENST00000277141.6_5'UTR|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.G119R	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	119					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.G119R(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						ATTCTAGGTCCAGGTTTGAAT	0.418																																					p.G119R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G355C	9						.						200.0	201.0	200.0					9																	88967760		2203	4300	6503	88157580	SO:0001583	missense	79670	exon2			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.355G>C	9.37:g.88967760C>G	ENSP00000365130:p.Gly119Arg		88157580	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727418	0.69074	.	.	ENSG00000083223	ENST00000375960;ENST00000375961;ENST00000375963	T;T;T	0.49432	0.81;0.78;0.79	5.03	5.03	0.67393	.	0.186328	0.37809	N	0.001930	T	0.45296	0.1335	L	0.27053	0.805	0.29583	N	0.849026	D;D;D;D;P	0.59767	0.986;0.986;0.986;0.977;0.839	P;P;P;P;B	0.54759	0.76;0.76;0.716;0.66;0.365	T	0.47249	-0.9132	10	0.87932	D	0	-4.2032	8.7079	0.34365	0.0:0.7674:0.1532:0.0794	.	119;119;119;119;119	Q5VYS8-3;Q5VYS8-5;Q5VYS8-2;Q5VYS8-4;Q5VYS8	.;.;.;.;TUT7_HUMAN	R	119	ENSP00000365127:G119R;ENSP00000365128:G119R;ENSP00000365130:G119R	ENSP00000365127:G119R	G	-	1	0	ZCCHC6	88157580	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.681000	0.37618	2.601000	0.87937	0.591000	0.81541	GGA		0.418	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
NUP188	23511	broad.mit.edu	37	9	131768832	131768832	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chr9:131768832T>C	ENST00000372577.2	+	44	5146	c.5125T>C	c.(5125-5127)Tcc>Ccc	p.S1709P	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1709					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						AGCCCCCAGCTCCCCTGCCAC	0.622											OREG0019528	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S1709P												.	.	0			c.T5125C	9						.						66.0	72.0	70.0					9																	131768832		2203	4300	6503	130808653	SO:0001583	missense	23511	exon44			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.5125T>C	9.37:g.131768832T>C	ENSP00000361658:p.Ser1709Pro	1590	130808653	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.712229	0.89112	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.44482	0.92	4.7	4.7	0.59300	.	0.110360	0.64402	D	0.000005	T	0.54367	0.1854	L	0.40543	1.245	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.58053	-0.7704	10	0.87932	D	0	-31.7751	13.4898	0.61388	0.0:0.0:0.0:1.0	.	1709	Q5SRE5	NU188_HUMAN	P	1598;1709	ENSP00000361658:S1709P	ENSP00000349125:S1598P	S	+	1	0	NUP188	130808653	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.294000	0.78760	1.962000	0.57031	0.459000	0.35465	TCC		0.622	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
IL1RAPL2	26280	broad.mit.edu	37	X	105011184	105011184	+	Silent	SNP	C	C	T			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chrX:105011184C>T	ENST00000372582.1	+	11	2347	c.1591C>T	c.(1591-1593)Ctg>Ttg	p.L531L	IL1RAPL2_ENST00000344799.4_Silent_p.L531L	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	531	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.L531L(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CATCAAACTTCTGTCCCTGAT	0.368																																					p.L531L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1591T	X						.						113.0	117.0	115.0					X																	105011184		2203	4300	6503	104897840	SO:0001819	synonymous_variant	26280	exon11			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1591C>T	X.37:g.105011184C>T			104897840	NM_017416	Q2M3U3|Q9NZN0	Silent	SNP	ENST00000372582.1	37	CCDS14517.1																																																																																				0.368	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
AGTR2	186	broad.mit.edu	37	X	115303651	115303651	+	Missense_Mutation	SNP	T	T	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chrX:115303651T>A	ENST00000371906.4	+	3	308	c.118T>A	c.(118-120)Tca>Aca	p.S40T		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	40					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)	p.S40T(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	ACAGAAACCATCAGATAAGCA	0.378																																					p.S40T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T118A	X						.						135.0	119.0	125.0					X																	115303651		2203	4300	6503	115217679	SO:0001583	missense	186	exon3			AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.118T>A	X.37:g.115303651T>A	ENSP00000360973:p.Ser40Thr		115217679	NM_000686	B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	ENST00000371906.4	37	CCDS14569.1	.	.	.	.	.	.	.	.	.	.	T	3.098	-0.185349	0.06340	.	.	ENSG00000180772	ENST00000371906	T	0.38560	1.13	4.29	3.09	0.35607	.	0.150962	0.45867	D	0.000334	T	0.22820	0.0551	N	0.19112	0.55	0.19945	N	0.999946	B	0.11235	0.004	B	0.06405	0.002	T	0.19712	-1.0297	10	0.15499	T	0.54	-4.3669	7.1252	0.25467	0.0:0.0:0.2255:0.7745	.	40	P50052	AGTR2_HUMAN	T	40	ENSP00000360973:S40T	ENSP00000360973:S40T	S	+	1	0	AGTR2	115217679	0.995000	0.38212	0.952000	0.39060	0.988000	0.76386	3.098000	0.50259	0.506000	0.28125	0.412000	0.27726	TCA		0.378	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057984.1	NM_000686	
FGD1	2245	broad.mit.edu	37	X	54491965	54491965	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chrX:54491965G>A	ENST00000375135.3	-	8	2288	c.1555C>T	c.(1555-1557)Cgc>Tgc	p.R519C		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	519	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.R519C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CGGGGGATGCGCTGCACAGGC	0.577																																					p.R519C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1555T	X						.						40.0	36.0	37.0					X																	54491965		2203	4300	6503	54508690	SO:0001583	missense	2245	exon8			U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1555C>T	X.37:g.54491965G>A	ENSP00000364277:p.Arg519Cys		54508690	NM_004463	Q5H999|Q8N4D9	Missense_Mutation	SNP	ENST00000375135.3	37	CCDS14359.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628932	0.67015	.	.	ENSG00000102302	ENST00000375135	D	0.88124	-2.34	5.54	5.54	0.83059	Dbl homology (DH) domain (5);	0.000000	0.53938	D	0.000056	D	0.95974	0.8689	H	0.98786	4.33	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96711	0.9525	10	0.87932	D	0	-19.53	10.9304	0.47215	0.0:0.0:0.6932:0.3068	.	277;519	B4DS99;P98174	.;FGD1_HUMAN	C	519	ENSP00000364277:R519C	ENSP00000364277:R519C	R	-	1	0	FGD1	54508690	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.966000	0.40481	2.329000	0.79093	0.523000	0.50628	CGC		0.577	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056801.1	NM_004463	
FAAH2	158584	broad.mit.edu	37	X	57313371	57313371	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chrX:57313371C>G	ENST00000374900.4	+	1	233	c.113C>G	c.(112-114)tCa>tGa	p.S38*		NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	38						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)	p.S38*(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						AAGTTTGCCTCAAAGACCCCT	0.532										HNSCC(52;0.14)																											p.S38X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C113G	X						.						36.0	34.0	35.0					X																	57313371		2203	4300	6503	57330096	SO:0001587	stop_gained	158584	exon1			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.113C>G	X.37:g.57313371C>G	ENSP00000364035:p.Ser38*		57330096	NM_174912	Q86VT2|Q96N98	Nonsense_Mutation	SNP	ENST00000374900.4	37	CCDS14375.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760867	0.49468	.	.	ENSG00000165591	ENST00000374900	.	.	.	1.7	1.7	0.24286	.	1.254840	0.05765	U	0.605637	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	6.2542	0.20864	0.0:1.0:0.0:0.0	.	.	.	.	X	38	.	ENSP00000364035:S38X	S	+	2	0	FAAH2	57330096	0.004000	0.15560	0.041000	0.18516	0.065000	0.16274	0.463000	0.21972	1.132000	0.42129	0.538000	0.68166	TCA		0.532	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056919.1	NM_174912	
UBE2NL	389898	broad.mit.edu	37	X	142967377	142967377	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A017-01A-01W-A00E-09	TCGA-AA-A017-10A-01W-A00E-09	g.chrX:142967377C>G	ENST00000370494.1	+	1	205	c.175C>G	c.(175-177)Ctt>Gtt	p.L59V		NM_001012989.1	NP_001013007.1	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like (gene/pseudogene)	59						extracellular vesicular exosome (GO:0070062)	acid-amino acid ligase activity (GO:0016881)	p.L59V(1)		breast(1)|endometrium(1)|large_intestine(8)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(192;6.56e-05)					TGAACTATTACTTGCAGAAGA	0.393																																					p.L59V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C175G	X						.						99.0	96.0	97.0					X																	142967377		2203	4300	6503	142795043	SO:0001583	missense	389898	exon1					Xq27.3	2014-06-11	2014-06-11		ENSG00000102069			"""Ubiquitin-conjugating enzymes E2"""	31710	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2N-like"""			20736409	Standard	NM_001012989		Approved		uc004fca.3	Q5JXB2	OTTHUMG00000022586	ENST00000370494.1:c.175C>G	X.37:g.142967377C>G	ENSP00000359525:p.Leu59Val		142795043	NM_001012989	E9KL27	Missense_Mutation	SNP	ENST00000370494.1	37	CCDS35420.1	.	.	.	.	.	.	.	.	.	.	C	8.409	0.843831	0.16963	.	.	ENSG00000102069	ENST00000370494	T	0.73681	-0.77	1.1	1.1	0.20463	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.39909	U	0.001229	T	0.79015	0.4375	M	0.64997	1.995	0.58432	D	0.999994	D	0.53885	0.963	P	0.62435	0.902	T	0.77953	-0.2394	10	0.66056	D	0.02	-0.6451	7.8005	0.29172	0.0:1.0:0.0:0.0	.	59	Q5JXB2	UE2NL_HUMAN	V	59	ENSP00000359525:L59V	ENSP00000359525:L59V	L	+	1	0	UBE2NL	142795043	1.000000	0.71417	0.998000	0.56505	0.151000	0.21798	2.686000	0.46968	0.849000	0.35215	0.190000	0.17370	CTT		0.393	UBE2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058624.1	NM_001012989	
